JP2007070307A - Immunostimulant complex - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide an immunostimulant complex formed by complexing an immunostimulant oligonucleotide with a safe material having a high transfection effect and capable of producing an excellent immunostimulant effect on an antigen-presenting cell. <P>SOLUTION: This immunostimulant complex is formed by complexing the immunostimulant oligonucleotide with β-1,3 glucan having a long-chain β-1,6 glucoside bond side chain (for example, zymosan extracted from a cell wall of a baker's yeast). The complex remarkably increases an amount of production of cytokines, when administered as an immunostimulant. <P>COPYRIGHT: (C)2007,JPO&INPIT

Description

  The present invention belongs to the technical field of immunostimulants (also referred to as immunostimulants or immunostimulants), and in particular, is obtained by complexing an immunostimulatory oligonucleotide with a kind of natural polysaccharide. To provide a safe, highly medicinal immunostimulatory complex.

In 1984, Tokunaga et al. Searched for an anti-tumor component of BCG for oligonucleotides with stimulating activity of immune responses (hereinafter sometimes referred to as immunostimulatory oligonucleotides, immunostimulatory nucleic acids, or immunostimulatory DNA) It was discovered in the process of It has been clarified that the activation action is caused by a specific base sequence including cytosine guanine dinucleotide (5′-CpG-3 ′: so-called CpG sequence).
Tokunaga, T., et al., J. Natl. Cancer Inst., 72, 955 (1984) Tokunaga, T., et al., J. Natl. Cancer Res., 79, 682 (1988)

Similar activity has been observed in genomic DNA with CpG sequences other than vertebrates or plants. Sequences before and after the CpG core are also considered important for immunostimulatory activity, especially 5'-PuPuCpGPyPy, which has an unmethylated CpG and a substituted purine (Pu) and substituted pyrimidine (Py) around it -3 'has gained consensus as a representative unmethylated CpG motif.
Krieg, A., etal., Nature, 374, 576 (1995)

  Here, as is well known, an unmethylated CpG motif is a short nucleotide sequence (generally consisting of 4 to 10 nucleotides) containing at least one cytosine (C) -guanine (G) sequence. Which is not methylated at the 5-position of cytosine in the cytosine-guanine sequence. In the following description, CpG means unmethylated CpG unless otherwise specified.

Examples of useful CpG motifs (hexamers) are listed below (however, A: adenine, G: guanine, C: cytosine, T: thymine, U: uracil).
AACGTT, AGCGTT, GACGTT, GGCGTT, AACGTC, AGCGTC, GACGTC, GGCGTC, AACGCC, AGCGCC, GACGCC, GGCGCC, AACGCT, AGCGCT, GACGCT, and GGCGCT
An oligonucleotide composed of about 8 to 100 containing these sequences has immunostimulatory activity.
Special table 2001-503254

The following sequence is an example of an immunostimulatory oligonucleotide containing a CpG motif that has been reported to be effective for NK cell activation (underlined indicates the CpG motif and capital letters represent thiolated DNA).
Iho Sumiko, Saburo Yamamoto, AnnualReview immune 2001,137-146 (2002) accgataccggtgccggtgacggcaccacg accgatagcgctgccggtgacggcaccacg accgatgacgtcgccggtgacggcaccacg accgattcgcgagccggtgacggcaccacg ggggggggggggcgatcggggggggggggggggggggggggacgatcgtcggggggggggggggggggggggaacgttggggggggggggGAGAACGCTCGACCTTCGATTCCATGACGTTCCTGATGCTTCTCCCAGCGTGCGCCATGGggtcaacgttgaGGGGGg

In addition to the CpG motif, there are several sequences known as immunostimulatory nucleic acids. For example, T-rich nucleic acid rich in thymidine like 5'TTTT3 ', G-rich nucleic acid rich in guanidine like 5'GGGG3', TG-rich nucleic acid rich in both thymidine and guanidine, C-rich nucleic acid rich in cytidine, etc. Has recently attracted attention as a non-CpG immunostimulatory nucleic acid.
Special table 08-800738 Special table 2002-512599 Special table 2003-510282 Special table 2003-510290

A major feature of the effect of these immunostimulatory nucleic acids on immune system cells is to activate antigen-presenting cells. Directly acts on mouse and human monocytes, macrophages, dendritic cells, etc., and has immunity enhancing effects such as IL-6, TNF-α, IL-12, IFNα / β, IL-18, and nitric oxide Produces cytokines.
Patent applications relating to nucleic acid and DNA vaccine compositions for the treatment of immune diseases have recently increased, for example, the University of Iowa Research Foundation application is due to viral, bacterial, fungal or parasitic infections. Many for the treatment of humans and animals with cancer, the treatment of humans and animals with cancer, therapeutic use for subjects who have acute reductions in airflow resulting from exposure to lipopolysaccharides and endotoxins, or for adjuvants The sequence of the CpG motif system is proposed (Patent Documents 6 to 8). In addition, patent applications that use the CpG motif in DNA vaccines are also recognized for fish and shellfish (Patent Document 9). Similarly, there is one for the purpose of preventing infection of animal parvovirus (Patent Document 10). Furthermore, Patent Documents 1, 11 and 12 describe many similar sequences having immunostimulatory activity.
Special table flat 10-506265 Special table 2001-503267 Special table 2001-513776 JP 9-285291 A Special table 2000-509976 Special Table 2002-517156 Special table 2002-526425

As in the case of gene therapy using antisense DNA, the phosphoric acid backbone of immunostimulatory oligonucleotides is often modified with phosphorothioate linkages for nuclease resistance. In addition, there are many examples in which transfection agents such as liposomes, cationic lipids, and cholesterols are used in combination for the purpose of increasing the affinity of immunostimulatory oligonucleotides with cells.
As anti-sense DNA transfection agents for gene therapy, retrovirus or adenovirus initially gave very promising results in vitro, but the inflammatory, immunogenic properties of these naturally occurring viruses, And due to the risk of mutagenesis and integration into the cellular genome, their use in vivo is limited.
Mulligan, Science, 260, 926-932 (1993) Miller, Nature, 357, 455-460 (1992) Crystal, Science, 270, 404-410 (1995)

As an alternative to transfection agents for naturally occurring genes, the use of artificial non-viral carriers that are not only easier to handle than viral systems, but also ensure that DNA can be efficiently and efficiently concentrated in cells. Presented.
Tomlinson and Rollland, J. Contr. Rel., 39, 357-372 (1996)

Currently, polyethyleneimine (PEI) is well studied as a non-viral artificial carrier. In a number of different adherent and floating cell lines, the three-dimensional branched cationic polymer PEI resulted in some cases leading to above-average transfection rates.
Boussif etal., Gene Therapy, 3, 1074-1080 (1996)

Similarly to PEI, various cationic polymers and cationic lipids modified with nitrogen-containing substituents have been recently filed under the names of gene carriers, transfection agents, drug carriers, etc. It has become like this.
However, at present, the safety of cationic polymers such as PEI has hardly been confirmed. In general, the presence of an amino group is indispensable for imparting cationic properties. However, a substance having an amino group has a high physiological activity and is considered to have a risk such as in vivo toxicity. In fact, any cationic polymer studied so far has not yet been put into practical use, and is not described in a pharmaceutical additive dictionary or the like.
Pharmaceutical Additives Dictionary, edited by Japan Pharmaceutical Additives Association, Yakuji Nipposha

On the other hand, β-1,3-glucan is a polysaccharide actually used as a clinical drug for intramuscular injection preparations. It has long been known that this polysaccharide has a triple helical structure in nature (Non-patent Document 11). Furthermore, this polysaccharide has already been confirmed to be safe in vivo, and has been used for more than 20 years as an intramuscular injection for immune enhancement against gynecological cancer (Non-patent Documents 12 and 13).
Theresa M. McIntire and David A. Brant, J. Am. Chem. Soc., 120, 6909 (1998) Shimizu, Chen, Kanmi, Masumi, Biotherapy, 4,1390 (1990) Hasegawa, Oncology and Chemotherapy, 8, 225 (1992)

It is known that such β-1,3-glucan can be conjugated with a biomaterial such as DNA and used as a gene carrier. In this prior art, natural β-1,3-glucan, that is, β-1,3-glucan having a triple helix structure is used as it is, and this is combined with a biochemically active material via a covalent bond. A method for producing a β-1,3-glucan / biomaterial conjugate has been described.
PCT / US95 / 14800 (WO 96/14873)

Recently, the present inventors have been able to form a new type of complex with various nucleic acids by artificially treating a polysaccharide having a β-1,3-glucoside bond as a main chain. It was found.
PCT / JP00 / 07875 (WO 01/34207) PCT / JP02 / 0222 (WO 02/072152) Sakurai, Shinkai, J. Am. Chem. Soc., 122, 4520 (2000) Chem. Lett., 1242 (2000)

It has been conventionally known that β-1,3-glucan has immunostimulatory activity, and examples of addition to vaccines or immunostimulatory nucleic acids as adjuvants have been reported (Patent Documents 16 and 17).
Special table hei 9-504000 Special table 2001-504000

When CpG motif and β-1,3-glucan are used alone, the immunostimulatory effect is not so remarkable. However, the present inventors combined a specific β-1,3-glucan such as schizophyllan with an immunostimulatory oligonucleotide such as a CpG motif, and treated them under specific conditions to form a stable complex. It was found that the amount of cytokines involved in immunity can be increased synergistically by forming and administering it to antigen-presenting cells (Patent Document 18). This complex is useful as an immunostimulant, but it is of course desirable that further improvements are made in the immunostimulatory action and the like.
PCT / JP2004 / 006793

  An object of the present invention is to provide an immunostimulatory agent that exhibits an excellent immunostimulatory effect on antigen-presenting cells by using a safe material and combining with an immunostimulatory oligonucleotide.

The invention disclosed in Patent Document 18 by the present inventors is a new type of immunostimulator comprising a complex of β-1,3-glucan, which is a safe polysaccharide available from nature, and an immunostimulatory oligonucleotide. It is about. Here, β-1,3-glucan actually used in the immunostimulant has a short β-1,6-glucoside-bonded side chain represented by schizophyllan or such side chain. It was β-1,3-glucan having no. It is also known that the complex with nucleic acid is more stable as the side chain substitution rate of β-1,3-glucan is reduced (Patent Document 19). Can β-glucan with 1,6-glucoside-linked branching be complexed with immunostimulatory nucleic acid in the same way as short-chain β-1,3-glucan, and the resulting product has sufficient immunostimulatory effect? This is because there was no knowledge about whether or not it could be demonstrated, and it was thought that it was rather negative.
JP 2004-331758 A

However, as a result of repeated studies by the present inventors, surprisingly, when used in combination with an immunostimulatory nucleotide, β-1,3-glucan having a long β-1,6-glucoside-binding side chain is used. Compared to short β-1,6-linked side chains or β-1,3-glucans that do not have such side chains, it is more likely to form a complex with a significantly improved immune stimulating effect. It was issued.
Thus, the present invention provides an immunostimulatory complex comprising an immunostimulatory oligonucleotide and a β-1,3-glucan having a long β-1,6-glucoside-binding side chain.

  By administering the complex of the present invention to an antigen-presenting cell, it is possible to dramatically increase the amount of cytokine production effective for enhancing immunity.

  As is well known, β-1,3-glucan is a general term for polysaccharides having a β-1,3-glucoside bond as the main chain. β-1,3-glucan has a curdlan without side chain, and the number of side chain glucose residues (length) bonded to the main chain by β-1,6-glucoside bond Schizofiran (Sonifilan: abbreviated as SPG), glyforan, lentinan, etc. are extracted from moss. The β-1,3-glucan used in the immunostimulatory complex disclosed in the above-mentioned Patent Document 18 by the present inventors exclusively has no side chain as described above or a short β-1,3-glucan. It had a 6-glucoside bond side chain.

Meanwhile, baker's yeast (Saccharomyces
cerevisiae) and Candida albicans cell wall extract β-glucan has a relatively long β-1,6-glucoside bond side chain bound to the main chain β-1,3-glucan It is known. This type of β-glucan has a molecular weight of more than about 1 million, aggregates in the form of particles, is hardly soluble in a solvent, and some of the side chains are further branched (Non-Patent Documents 16 to 19). ). Regarding the structure, it has been reported that the fraction extracted from baker's yeast or Candida-derived fractions has about 10-50 glucose residues in the β-1,6-glucoside-bonded side chain (Non-patent Document) 16, 20, 21). The one extracted and purified from the baker's yeast wall is called Zymosan (zymosan or zymosan), and has been widely used as a reagent for immunity research. In addition, there is a β-glucan having a long-chain β-1,6-linkage derived from Agaricus (Agaricus blaziriensis), in which case β-1,6-linkage is the main chain and β-1, 3-bonds are said to be side chains.
Naoto Ono, DOJIN News No. 114, 1-10 (2005) UnderhillDM, Ozinsky A, Hajjar AM, Stevens A, Wilson CB, Bassetti M, Aderem A, Nature, 401,811-815 (1999) Toshiro Yukuzen, YAKUGAKUZASSHI, 120 (5), 413-431 (2000) Naono Ono, Japanese Journal of Bacteriology, 55 (3), 527-537 (2000) Ohno N., Miura T., Miura NN, Adachi Y., Yadomae T., Carbohydrate Polymers, 44, 339-349 (2001) Ohno N., Uchiyama M., Tsuzuki A., Tokunaka K., Miura NN, Adachi Y., Aizawa MW, Tamura H., Tanaka S., Yadomae T., Carbohydrate Res., 316, 161-172 (1999)

  The polysaccharide constituting the immunostimulatory complex of the present invention is a β-1,3-glucan having a long β-1,6-glucoside-bonded side chain as described in the above-mentioned various documents. 1 has the basic structure shown in FIG. 1 (see Non-Patent Document 17). The structural formula in FIG. 1 is a simple case where the side chain includes only a β-1,6-glucoside bond chain, but the structure having a β-1,3-branch in a part of the side chain is also present. It is included in the β-1,3-glucan of the invention. Thus, the present invention has significance as a selective invention with respect to the immunostimulatory complex disclosed in PCT / JP2004 / 006793 (Patent Document 18).

  In the present invention, the long-chain β-1,6-glucoside-bonded side chain is a side chain having a length such that the average number of glucose residues constituting the side chain is 4 or more, preferably , Refers to those having an average number of glucose residues of 10 or more, generally 10 to 50 on average.

  The immunostimulatory oligonucleotide used as the main agent constituting the immunostimulatory complex of the present invention is an oligonucleotide that stimulates an immune response and has an activity to enhance immunity, and is variously described as described in the above document. These oligonucleotides are exemplified, but not limited thereto. As the immunostimulatory oligonucleotide to be used in the present invention, those containing various unmethylated CpG motifs are preferably used. Similarly, non-CpG immunostimulatory oligonucleotides (immunostimulatory oligonucleotides other than unmethylated CpG motifs) exemplified in the same manner can also be used. Non-CpG immunostimulatory oligonucleotides are used alone or in combination with CpG motifs. These administered oligonucleotides act on immune cells such as macrophages and have an effect of enhancing immunity through production of cytokines and the like.

  The oligonucleotide phosphate backbone used in the present invention is usually a phosphorothioate or phosphorodithioate modified portion of the main chain phosphodiester bond in order to increase nuclease resistance. Some or all of them may be retained.

  In order to smoothly prepare the complex of the present invention by combining an oligonucleotide containing a CpG motif with β-glucan, it is desirable to add a tail of poly (dA) to the DNA to be used in advance.

  As a preferred example of β-1,3-glucan, which is another main ingredient, zymosan (hereinafter, abbreviated as Zym), which is an extract from the baker's yeast wall, is available because of its availability. ). This extract is a mixture containing saccharides such as mannan, protein, chitin, glycolipid, ash, etc., in addition to the β-1,3-glucan 55-60% having the long side chains as described above. is there. Proteins and other contaminants removed from the extract as much as possible and purified are available as reagents, and there are also refined products with chemical treatments such as hypochlorite treatment. However, an extraction mixture can be used as long as it contains not only the purified product but also β-1,3-glucan having a long side chain to the above extent. In addition to zymosan, those extracted from the aforementioned Candida cell wall can also be used.

  In order to prepare a complex of an immunostimulatory oligonucleotide and a long side chain β-1,3-glucan, a short side chain such as schizophyllan described in detail in Patent Document 15 by the present inventors was used. This can be carried out according to a method for preparing a complex of β-1,3-glucan and nucleic acid. However, the method of dissociating long side chain β-1,3-glucan, which is poorly soluble in aqueous solvents and highly self-complexed into random coils, is not very effective and is not effective. A method using a polar solvent is preferred. In other words, after the sample β-glucan is dissolved in a polar solvent such as dimethyl sulfoxide (DMSO) and dissolved in a random coil, nucleic acid dissolved in DMSO is added in the same manner, and water is further mixed to stimulate immune stimulation A hybrid complex consisting of a functional oligonucleotide and a long side chain β-1,3-glucan is formed.

  Confirmation of the complex formation between the oligonucleotide and the polysaccharide can be performed by measuring a circular dichroism (CD) spectrum. The behavior of the CD spectrum associated with the complexation is as follows when β-1,3-glucan with a long side chain such as zymosan is used and β-1,3-β with a short side chain such as schizophyllan (SPG). It is different from using glucan. For example, the conformation of the Zym / CpGDNA complex is different from the conformation of the SPG / CpGDNA complex (see Examples and Comparative Examples described later).

  When β-1,3-glucan with a short side chain represented by SPG is used, the complex formed with the oligonucleotide is a triple helical complex consisting of two β-glucans and one nucleic acid. It has been found that On the other hand, the structure of the complex consisting of long side chain β-1,3-glucan and oligonucleotide is not only a complex mixture of raw materials, but also the mixing ratio and aging conditions of both raw materials. It is not a structure determined by the fluctuations of, but can be relatively wide. And when the fluctuation is used for the purpose of enhancing immunity, there is no particular hindrance and it is advantageous in that the immune stimulation function can be changed according to the fluctuation.

The optimum blending ratio of long side chain β-1,3-glucan / immunostimulatory oligonucleotide for obtaining a stable complex according to the present invention is about 2 to 6 times by weight, and the aging temperature and time are 4 Two days or more are preferable at -5 ° C. The prepared composite is soluble in water and easy to handle. Cytokine production when administered to antigen-presenting cells is greatly increased compared to the case where no complex is formed, and significantly increased compared to when complexed with SPG. (Refer to Examples described later). This may be due to the difference in structure of the complex from the case of complexing with SPG.
Hereinafter, the features of the present invention will be described more specifically along with examples in which zymosan is used as the long side chain β-1,3-glucan, but the present invention is not limited to these examples.

Observation of complexation by circular dichroism (CD) of zymosan (Zym) and oligonucleotide (poly (dA)) <Analysis of zymosan>
The zymosan used in this example is Saccharomyces.
It was a granular material obtained from the cell wall of cerevisiae. The molecular weight by GPC was 1 million or more, and the weight ratio of elemental analysis was C / H / N = 42.3 / 7.0 / 2.30 (obtained from InvivoGen). Furthermore, with reference to Non-Patent Documents 20, 21, and 22, a sample solubilized by the dimethyl sulfoxide (DMSO) method was digested with Zymolyase to remove the β-1,3-chain of the main chain, and this was converted to TOF-MS. When analyzed by using Applied Biosystems / Mariner ESI-TOF, the average molecular weight of the side chain was about 3000 (number of glucose in the side chain in terms of polymerization degree: about 15).

  The obtained zymosan was dissolved in DMSO and used for sample preparation. For the DNA, Polydeoxyadenylic Acid (poly (dA)) obtained from Amersham Biosciences was similarly dissolved in DMSO and used. Sample preparation conditions were NaClaq 150 mM, Poly (dA) 12.5 μg / ml, and Tris 30 mM fixed, and samples with Zym changed from 0 to 90 μg / ml (Vw = 0.90) were prepared for 3 days at 5 ° C. After storage, CD measurement was performed. The drug ratio of the measurement sample is shown in Table 1.

  The result of overwriting the CD spectrum obtained by the measurement is shown in FIG. 2A. When the poly (dA) concentration is kept constant (12.5 μg / ml) and the Zym concentration is gradually increased, the spectral intensity around 260 nm increases remarkably. This indicates that the conformation of DNA is changed by complexing Zym with poly (dA). The CD intensity at 260 nm was found to be maximized when the Zym / poly (dA) weight ratio was around 4 to 6 times (60 to 90 μg in Zym amount) (FIG. 2B).

Observation of circular dichroism (CD) over time in complex formation between zymosan (Zym) or schizophyllan (SPG) and oligonucleotide (poly (dA)) (including comparative example 1)
A sample solution containing zymosan and dA40mer (obtained from Hokkaido System Science) dissolved in DMSO and NaClaq and Tris was prepared (see Table 2). For comparison, a sample using schizophyllan (SPG) instead of Zym was also prepared. The sample solution was stored at 5 ° C., but CD measurement was performed at an appropriate time interval immediately after mixing.

When a complex with DNA (poly (dA)) is formed using the SPG of the comparative example, the CD value around 250 nm increases with the aging time as seen in FIGS. 4A and 4B, and around 264 nm. Conversely, the CD value decreases. This change is analyzed by the fact that the DNA conformation changes from the C2′-end Anti type to the syn type by forming a complex with SPG (Non-patent Document 22).
On the other hand, looking at the change in CD when using the Zym of the present invention, as shown in FIG. 3A and FIG. 3B, the CD value near 251 nm once rises, but decreases on the contrary, and A phenomenon different from that of SPG was observed in which the CD value near 262 nm increased. This result is interpreted as a change in the DNA conformation when forming a complex with zymosan from C2'-end Anti type to C3'-end type. From the results shown in FIGS. 3B and 4B, it was also found that the time required for stabilization of the zymosan complex can be as short as about 50 hours compared to 70-80 hours in the case of SPG.
Mizu, M., Koumoto, K., Kimura, T., Sakurai, K., and Shinkai, S., Polymer J., 35 (9), 714-720 (2003)

Observation of complex formation by circular dichroism (CD) of zymosan (Zym) and CpG-dA40 (CpG)
Using a nucleic acid (SEQ ID NO: 1: abbreviated as CpG-dA40) with a 40-mer dA added to the 3 ′ end of phosphorothioated CpG DNA as DNA, complexation with Zym was performed under the same conditions as in Example 2, and CD Measurement was measured. Table 2 shows the drug ratio of the measurement sample.

  FIG. 5A shows the CD measurement result immediately after sample preparation, and FIG. 5B shows the result measured after 3 days. As a result, it is confirmed from the change over time in the CD value around 260 nm that the same conformational change as that observed in the poly (dA) of Example 2 occurs.

Observation of complexation of zymosan (Zym) and CpGDNA by gel electrophoresis (including Comparative Example 2)
Using CpG-dA40 represented by SEQ ID NO: 1 as CpGDNA, a complex with zymosan (Zym / CpGDNA) was examined by gel electrophoresis. As a comparative example, only CpGDNA and a sample (SPG / CpGDNA) complexed with schizophyllan (SPG) instead of zymosan were also used. Table 4 shows the sample preparation conditions. After storing at 5 ° C. for 3 days, gel electrophoresis was performed at 20 V for 3 h. The gel used was 2 wt% agarose gel containing 3% DMSO, and the buffer used was TAE Buffer containing 3% DMSO.

From the results of electrophoresis in FIG. 6, compared to the band in which only the CpG DNA in lane 2 was migrated, the band in which the sample aged with the polysaccharide in lanes 3 and 4 was migrated was shifted to a higher molecular weight side. It can be seen that CpG DNA forms a complex with Zym and SPG. Also, the Zym / CpG DNA complex is more SPG / CpG
It was also observed that the molecular weight was larger than the DNA complex.

Measurement of cytokine production of Zym / CpGDNA complex (1) (including comparative example 3)
Samples having the compositions shown in Table 5 were prepared. The DNA used was the CpG DNA described in SEQ ID NO: 1 containing the CpG motif used in the present invention and the non-CpG DNA described in SEQ ID NO: 2 not containing the CpG motif used as a comparative example. -Oligo type. The zymosan (Zym) of this invention was used for the polysaccharide which is another component of a composite_body | complex. As comparative examples, samples of DNA only (CpG DNA and non-CpG DNA) that are constituents of the complex, Zym alone, and control (saline) were also prepared.

The ELISA method (Enzyme Linked Immuno Sorbent Assay) was used as a method for measuring cytokine production. A sample is added to a plate with antibodies in advance, and cytokines in the sample become antigens, and an antigen-antibody reaction occurs. Next, an enzyme-modified antibody is added to cause an antigen-antibody reaction again. Finally, by adding a substrate corresponding to the enzyme, color develops because the enzyme substrate reaction occurs, and the absorbance is measured with a spectrophotometer. Cell line contains mouse-derived macrophage-like cells: J774A.1 (BALB / c
macrophage, mouse): After measuring the number of cells using DMEM + Penicillin-Streptomycin + 10% FBS, adjust the cells so that the final cell concentration is 1.0 × 10 ⁶ cells / ml, and add 100 µl each to a 96-well microplate (number of cells : 1.0 × 10 ⁵ cells / well). Cultivation was performed at 37 ° C. and 5% CO ₂ for 20 hours, and 10 μl of each sample solution adjusted to each concentration was added and suspended, and 10 μl of physiological saline was added to Control. Incubate for 48 hours at 37 ° C, 5% CO ₂ , Mouse Total IL-12 / IL-6 ELISA Kit (ENDOGEN) and Mouse TNF-α ELISA Kit
The amount of cytokine (IL-12, IL-6 and TNF-α) produced was calculated by measuring the absorbance (450 nm, 570 nm) using (BIOSOURCE) with a microplate reader. The results are shown in FIGS. 7A to 7C.

  From all the results, when zymosan was complexed to CpG DNA and administered, a high amount of cytokines was obtained, and when it was simply mixed and administered without complexing, CpG DNA or zymosan Cytokine production was small when administered alone and in the case of a complex of non-CpG DNA and zymosan.

Measurement of cytokine production of Zym / CpGDNA complex (2) (including Comparative Example 4)
Samples having the compositions shown in Table 6 were prepared. The DNA was the CpG DNA shown in SEQ ID NO: 1 of the present invention, a natural O-oligo type and an S-oligo type. Further, as a comparative example, the non-CpG DNA described in SEQ ID NO: 2 that does not contain a CpG motif was used in the same manner. As another component for forming the complex, zymosan (Zym) of the present invention and schizophyllan (SPG) as a comparative example were used. The method for measuring the amount of cytokines produced is the same as in Example 4.

  The measurement results of the amount of cytokines produced are shown in FIGS. 8A and 8B. The gray column is a complex of SPG and DNA, the black column is a complex of Zym and DNA, the administration of DNA alone is outlined, and the control of physiological saline administration is indicated by a vertical stripe. What is shown as no DNA is the result of polysaccharide only (when Zym or SPG is administered alone).

  In the IL-12 production amount of FIG. 8A, no DNA, CpG DNA alone administration, and non-CpG DNA showed almost no IL-12 production, but S-oligo type CpG DNA and Zym or SPG were complexed. As a result, IL-12 production increased more than 10 times. Moreover, when S-oligo type CpG DNA single administration and Zym complex administration were compared, it was enhanced about 20 times when Zym was used. In the O-oligo type, CpG DNA and Zym or SPG were complexed, resulting in an increase of 10 times or more compared to the case without DNA, and an increase of about 2 to 5 times compared with the administration of CpG DNA alone. The complex with CpG DNA in the case of using Zym was found to be about twice as much as that in the case of using SPG.

  A tendency similar to that of IL-12 was also observed in the IL-6 production amount shown in FIG. 8B, and a result that the complex of Zym and CpGDNA was about twice that of SPG was obtained.

Effect of β-1,6-glucoside bond side chain length on cytokine production (including Comparative Example 5)
The zymosan used in Examples 1 to 6 was solubilized by DMSO, and then mainly composed of β-1,6-glucanase and β-1,3-glucanase activity prepared from the liquid culture supernatant of Streptomyces rochei DB-34. The yeast cell wall lysing complex enzyme preparation (Westase: obtained from Takara Bio Inc.) was used for 5 minutes. The reaction conditions were such that the complex enzyme agent was dissolved at 10 microg / ml in McIlvain Buffer, and the temperature was 37 ° C. and pH 6.0. The sample No. ZY1 obtained by reprecipitation of the reaction product in acetone was obtained. The molecular weight of this sample by GPC was 500,000, and as a result of elemental analysis, C / H / N = 43 / 6.5 / 0.7. Furthermore, when the DM-1, solubilized sample was digested with Zymolyase to remove β-1,3-chain and analyzed by TOF-MS, the average molecular weight was about 2000 (the number of side chain glucose in terms of polymerization degree). : About 10). In sample ZY2, which was treated with the complex enzyme agent for 30 minutes, the molecular weight was 250,000, and as a result of elemental analysis, C / H / N = 43 / 6.5 / 0.4. Furthermore, from the TOF-MS of the sample digested with Zymolyase, the average molecular weight was about 500 (number of side chain glucoses in terms of polymerization degree: about 2.5).
Obtained above. When ZY1 and ZY2 were measured for the amount of cytokine production shown in Example 6, ZY1 was similar to Zym, but ZY2 was similar to SPG, and the length of β-1,6-glucoside bond of the side chain It became clear that the effect decreased as the length decreased.

  The present invention can be used alone by complexing an immunostimulatory oligonucleotide and a β-1,3-glucan having a long β-1,6-glucoside bond, which is a kind of natural polysaccharide. It can be used as an immunostimulant having an immunopotentiating action that is dramatically higher than that of the case.

Basic structure of zymosan (Zym). Example 7: Change in circular dichroism (CD) spectrum of poly (dA) when the amount of zymosan is variable. Relationship between CD intensity of poly (dA) at 262 nm and the amount of Zym (Example 1). Change with time of CD spectrum at the time of complex formation of Zym and poly (dA) (Example 2). Changes in CD intensity at 251 nm and 252 nm during the formation of a complex of Zym and poly (dA) (Example 2). The time-dependent change of CD spectrum at the time of complex formation of Zym and poly (dA) (Comparative Example 1). Changes in CD intensity at 251 nm and 252 nm when Zym and poly (dA) were formed (Comparative Example 1). CD spectrum at the time of complex formation of Zym and CpG (Example 3). CD spectrum after 3 days of complex of Zym and CpG (Example 3). An agarose gel of uncomplexed CpG DNA (2), CpG DNA (3) complexed with zymosan (Zym) according to the present invention, and CpG DNA (4) complexed with schizophyllan (SPG) of a comparative example Electrophoresis pattern (Example 4 and Comparative Example 2). Production amount of cytokine IL-12 (1) when S-oligo type CpG DNA or non-CpG DNA and zymosan (Example) are administered in a complex, immediately after mixing, and when administered alone. (Example 5 and Comparative Example 3). Production amount of cytokine IL-6 when S-oligo type CpG DNA or non-CpG DNA and zymosan (Example) are administered in a complex, immediately after mixing, and when administered alone (1) (Example 5 and Comparative Example 3). Production amount of cytokine TNF-α (1) when S-oligo type CpG DNA or non-CpG DNA and zymosan (Example) are administered in a complex, immediately after mixing, and when administered alone. (Example 5 and Comparative Example 3). Production amount of cytokine IL-12 when using immunostimulant complexed with natural O-, S-oligo type CpG DNA or non-CpG DNA and SPG (comparative example) or zymosan (example) (2) (Example 6 and Comparative Example 4). Production amount of cytokine IL-6 when using immunostimulant complexed with natural O-, S-oligo type CpG DNA or non-CpG DNA and SPG (comparative example) or zymosan (example) (2) (Example 6 and Comparative Example 4).

Claims (9)

  An immunostimulatory complex comprising an immunostimulatory oligonucleotide and β-1,3-glucan having a long β-1,6-glucoside-binding side chain.   The complex according to claim 1, wherein the β-1,6-glucoside bond side chain has an average number of glucose of 10 or more.   The complex according to claim 2, wherein the β-1,6-glucoside bond side chain has an average number of glucose of 10 to 50.   4. The complex of claims 1-3, wherein the immunostimulatory oligonucleotide comprises an unmethylated CpG motif.   5. The complex according to claim 1, wherein the phosphate backbone of the oligonucleotide is phosphorothioate or phosphorodithioate modified.   The complex according to any one of claims 1 to 5, wherein the immunostimulatory oligonucleotide is a CpG motif having poly (dA) bound thereto.   A method for producing the complex of claims 1 to 6, wherein the immunostimulatory oligonucleotide and the β-1,3-glucan of claim 1 are mixed in an aprotic polar solvent, and then water is allowed to act.   8. The process of claim 7, wherein dimethyl sulfoxide is used as the aprotic polar solvent. A method of using the complex of claims 1 to 6 for immunostimulation.