JP2006520195A - Antisense oligonucleotide that suppresses HIF-1 expression - Google Patents

Abstract

Novel antisense oligonucleotide compounds, RX-0047 and RX-0149, suppress the expression of HIF-1 and induce cytotoxicity in several cancer cell lines.

Description

Field of Invention

  The present invention relates to novel antisense oligonucleotide compounds, RX-0047 and RX-0149, that suppress the expression of human protein HIF-1 and induce cytotoxicity in several cancer cell lines.

Background of the Invention

  Tumors cannot grow without blood vessels that supply cancer cells with oxygen and nutrients (Blagosklonny, International J. Oncol., 2001 19: 257-262). Controlling the hypoxic response in mammalian cells by the transcription factor HIF-1 is one of the major regulators of cancer cell growth. HIF is a cell that survives hypoxia and stimulates endothelial growth and is upregulated in a wide range of cancers (Zhong et al., Cancer Res. 1999 59: 5830-5835). One of the most prominent examples of the role of HIF in angiogenesis and tumor progression is to abolish the protein function of the tumor suppressor gene VHL, which is mutated in most sporadic clear cell kidney cancers and VHL diseases. ing. Therefore, disruption of the HIF-1 pathway suppresses tumor growth, suggesting that HIF-1 is a potential anticancer target. Since HIF-mediated effects control tumor angiogenesis, inhibition of HIF-1 is an anti-angiogenic method based on the mechanism of action. US Pat. No. 6,222,018 (Semenza), effective April 24, 2001, relates to a nucleotide sequence encoding HIF-1. The specific oligonucleotides disclosed and claimed in the present invention are not disclosed in said patent.

[Summary of Invention]
The present invention is directed to antisense oligonucleotides that target nucleic acid encoding HIF-1 and regulate the expression of HIF-1 (hypoxia-inducible factor 1). Also provided is a method of inhibiting HIF-1 expression in a cell comprising contacting the cell with the oligonucleotide compounds and compositions of the invention. The advantage of said oligonucleotide is that it has cytotoxic effects against several different cancer cell lines in addition to suppressing the expression of HIF-1. The effect of the present invention is that an antisense compound capable of specifically hybridizing to a site having the following sequence at position 2,772 of the HIF-1 gene (Genebank number NM001530): 5 ′ ttggacactggtggctcatt 3 ′ (SEQ ID NO: 1), It is obtained by contacting with cells of various cancer cell lines. Particularly preferred is RX-0047 comprising 5 ′ aatgagccaccagtgtccaa 3 ′ (SEQ ID NO: 2). A similar effect can be obtained with a compound that is antisense to the sequence 5 ′ gacttggagatgttagctcc 3 ′ (SEQ ID NO: 3) at position 1,936 of the HIF-1 gene (Genebank number NM001530). Particularly preferred is RX-0149 containing 5 ′ ggagctaacatctccaagtc 3 ′ (SEQ ID NO: 4). This contact occurs under circumstances where the oligonucleotide can hybridize with the gene encoding HIF-1. After hybridization, the ability of cells to produce HIF-1 is suppressed, and the viability of cancer cells decreases.

HIF (hypoxia-inducible factor) is a heterodimeric major transcription factor and is activated under hypoxia. HIF not only mediates homeostatic responses such as erythropoiesis, angiogenesis and glycolysis to hypoxia in mammals, but also promotes tumor neovascularization and growth. HIF is composed of two subunits, HIF-1α and HIF-1β, also known as ARNT (Aryl Receptor Nuclear Translocator). These two subunits belong to the bHLH (basic helix-loop-helix) and PAS (Per, ARNT, Sim) families. The two helices of the bHLH domain of these factors are involved in dimer formation and the basic region is involved in DNA binding. These two domains within HIF-1α and HIF-2α respond to the hypoxic signaling pathway. The former is an oxygen-dependent degradation (ODD) domain that undergoes post-translational modification by oxygen-dependent prolyl hydroxylase under normoxia (Jaakkola et al., Science, 2001, 292: 468-472). Hydroxylated proline promotes the interaction between HIF and the VHL (von Hippel-Lindau) ubiquitin ligase complex. After rapid ubiquitination, the proteasome destroys the HIF protein. HIF COOH-terminal transactivation domain (CAD) asparagine hydroxylation also plays an important role in proteasome-mediated HIF disruption, which inhibits interaction with p300 / CBP coactivator, Recent studies have shown that HIF-1 transcriptional activity is reduced under normoxia (Lando et al., Science, 2002, 295: 858-861). Thus, asparagine hydroxylase, together with prolyl hydroxylase, acts as a hypoxic switch that is regulated by intracellular O ₂ levels. In hypoxia, p42 / p44 MAPK activity induces post-translational phosphorylation of HIF-1 and promotes transcriptional activity of HIF-1. Recent studies have shown that ubiquitination, phosphorylation, and acetylation, as well as hydroxylation, have an important role in regulating HIF-1 stability (Jeong et al., Cell, 2002). , 111: 709-720).

  Under hypoxic conditions, hydroxylase that requires oxygen molecules for activation becomes inactive, and HIF-1α is not hydroxylated. Therefore, HIF-1α is not recognized by pVHL but accumulates in cells. Thereafter, HIF-1α moves to the nucleus and forms a dimer with the constitutively present HIF-1β subunit (Semenza, Genes & Development, 1985, 14: 1983-1991). The dimer then binds to a hypoxia responsive element (HRE) in the target gene, erythropoietin, VEGF (Forsythe et al., Mol. Cell. Biol., 1996, 16: 4604-4613) , Genes such as platelet-derived growth factor β (PDGF-β), glucose transporter (GLUT1) and nitrous oxide synthase (Neckers, J. Natl. Cancer Ins., 1999, 91: 106-107) are transactive Turn into. Certain hormones and growth factors also increase HIF-1α levels and also increase the mutation frequency of certain oncogenes and tumor suppressor genes, such as VHL, resulting in increased levels of HIF-1α (Ivan and Kaelin, Current Opinion in Genetics & Development, 2001, 11: 27-34). It is an interesting question whether hydroxylation or an alternative mechanism is involved in this hypoxia-independent HIF activation.

  Some of the latest cancer therapies using hypoxic microenvironment and hypoxic response are as follows: 1) Hypoxia-dependent drugs or gene therapy vectors, 2) Suppression of HIF stability 3) Inhibition of transactivation by HIF, 4) VEGF inhibitor.

  Given the central role of HIF transcription factors in cancer progression, it may be desirable to suppress their action during tumor formation. However, it may also be desirable to avoid interfering as much as possible with other aspects of the family's cellular metabolism. It is considered to be one method to identify a gene encoding a promising transcription factor that is highly expressed in a hypoxic state and to invent an antisense oligonucleotide that can be used for suppression of the gene activity in the correct sense. The present inventors have found that both of the two antisense oligonucleotides have a high ability to suppress the protein production of the HIF-1 gene, and induce cytotoxicity in various cancer cell lines.

  Antisense compounds can be used to modify nucleic acids present in living cells. The term “antisense” refers to the concept that a nucleic acid “encodes” a protein. That is, the nucleotide sequence of the nucleic acid, above all, determines which protein is produced. The “sense” sequence of the full-length gene produces a normal amount of normal protein in response to a given stimulus. “Sense” oligonucleotides hybridize to normal gene sequences and do not affect the quantity or properties of the protein. A “nonsense” sequence may not produce a product or may produce a non-functional product. For example, if a “nonsense” codon or oligomer is inserted into a gene, the produced protein may be cleaved and non-functional. “Antisense” oligonucleotides hybridize to normal genes, but the protein produced is altered in structure or quantity. Antisense oligomers, ie, relatively short antisense compounds, have been found to be easily inserted into cells and to alter gene function.

  Since antisense compounds can modify gene expression with excellent specificity, they are commonly used as research reagents for investigating gene functions, and can be used to elucidate the functions of specific genes. Antisense compounds can be used, for example, to differentiate functions of various members of a biological pathway.

  Antisense oligonucleotides can be used to selectively block disease-causing genes, thereby inhibiting the production of disease-related proteins. Several antisense oligonucleotides have been safely and effectively administered to humans and numerous clinical trials are currently underway. Thus, it is possible to use oligonucleotides for the treatment of cells, tissues and animals, especially humans. In describing the present invention, the term “oligonucleotide” refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics thereof. The term includes not only oligonucleotides composed of naturally occurring nucleobases, sugars and covalent internucleoside (basic backbone) linkages, but also oligonucleotides that function similarly and have non-naturally occurring moieties. It is. Such modified or substituted oligonucleotides often have desirable properties such as, for example, cellular uptake, higher affinity for the target nucleic acid and greater stability in the presence of nucleobases, and are therefore often more than native. Liked. The present invention uses oligomeric nucleotide compounds, particularly antisense oligonucleotides, that target a portion of the nucleic acid encoding HIF-1 and alter HIF-1 expression. Oligonucleotide compounds are designed to specifically hybridize to one or more nucleic acids encoding HIF-1. Oligonucleotide RX-0047 targets a site having the following sequence at position 2,772 of the HIF-1 gene (Genebank number NM001530): 5 ′ ttggacactggtggctcatt 3 ′ (SEQ ID NO: 1). The sequence of the basic skeleton of RX-0047 is complementary to this site. Oligonucleotide RX-0149 targets a site having the following sequence: 5 ′ gacttggagatgttagctcc 3 ′ (SEQ ID NO: 3) in the coding region at position 1,936 of the HIF-1 gene (Genebank No. NM001530). The basic skeleton sequence of RX-0149 is complementary to this site. The inventors have discovered that oligomers containing 5 or 10 nucleotides upstream and downstream of the sequence from which 20mer RX-0047 and RX-0149 are derived suppress measurable suppression of HIF-1 mRNA expression. However, we have found that this oligonucleotide is more sensitive to mutations and that 18mer RX-0149 somewhat suppresses HIF-1 mRNA expression, but if either end is further cleaved, It was found that suppression of HIF-1 mRNA expression was significantly lost. Oligomers containing 5 or 10 nucleotides upstream and downstream of the sequence from which the 20mer RX-0047 and RX-0149 were derived showed suppression of cancer cell growth. Truncated forms of RX-0047 and RX-0149, which somewhat suppress HIF-1 mRNA expression, also showed suppression of cancer cell growth.

  Targeting an antisense compound to a particular gene means identifying the nucleic acid sequence of interest and selecting one or more sites within the nucleic acid sequence for modification. Once the target site is identified, an oligonucleotide that is sufficiently complementary to the target site that hybridizes specifically to that site, that is, is sufficiently strong and has sufficient specificity to obtain the desired effect. You can choose.

  As used herein, the phrase “nucleic acid encoding HIF-1” is derived from DNA encoding HIF-1, RNA transcribed from such DNA (including pre-mRNA) and such RNA. Also includes cDNA. When an antisense oligomeric compound specifically hybridizes to its target nucleic acid, the normal function of the nucleic acid is disturbed. Interfering DNA functions include replication and transcription. Interfering RNA functions include, for example, translocation of RNA to the protein translation site, translation of RNA into protein, splicing of RNA to produce one or more mRNA species, and RNA or RNA All biological functions are included, such as enzyme activity promoted by. The overall effect obtained by so interfering with the function of the target nucleic acid is that the expression or production of the protein is regulated. In the context of the present invention, “modulation” means an increase (stimulation) or a decrease (suppression) of gene expression. For the purposes of the present invention, the gene encoding HIF-1 is regulated such that HIF-1 expression is suppressed.

  In the context of the present invention, “hybridize” means hydrogen bonding, which may be Watson-Crick, complementary nucleoside or nucleotide base, Hoogsteen or reverse Hoogsteen hydrogen bonding. Good. For example, adenine and thymine are complementary nucleobases that pair in hydrogen bond formation. “Complementary” as used herein means the ability to form an exact pair between two nucleotides. For example, if a nucleotide at a position in an oligonucleotide can hydrogen bond with a nucleotide at the same position in a DNA or RNA molecule, the oligonucleotide and DNA or RNA are considered to be complementary to each other at that position. The oligonucleotide and the DNA or RNA are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides capable of hydrogen bonding to each other. Thus, “specifically hybridizable” and “complementary” refer to a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between the oligonucleotide and the DNA or RNA target. It is a term indicating formation. There is a common recognition in the art that the sequence of an antisense compound need not be 100% complementary in order to specifically hybridize to the sequence of its target nucleic acid. Binding of the antisense compound to the target DNA or RNA molecule impairs the normal function of the target DNA or RNA and loses its usefulness, and conditions under which specific binding is desired, i.e. in vivo analysis or There is a sufficient degree of complementarity under the physiological conditions for therapeutic treatment and the conditions under which the analysis is performed for in vitro analysis, and the non-specificity between the antisense compound and the non-target sequence If binding is avoided, the antisense compound can specifically hybridize.

  Although antisense oligonucleotides are a preferred form of antisense compound, the present invention also encompasses other oligomeric antisense compounds, including but not limited to oligonucleotide mimetics as described below. The antisense compounds according to the present invention preferably contain from about 10 to about 30 nucleobases. Particularly preferred are antisense oligonucleotides comprising about 20 nucleobases (ie about 20 linked nucleosides). As is well known in the art, a nucleoside is a base-sugar conjugate. The base portion of a nucleoside is usually a heterocyclic base. The two most common types of such heterocyclic bases are purines and pyrimidines. Nucleotides are nucleosides in which a phosphate group is further covalently linked to the sugar moiety of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to either the 2 ′, 3 ′ or 5 ′ hydroxyl moiety of the sugar. In forming the oligonucleotide, the phosphate group is covalently bonded to adjacent nucleosides to form a linear polymer compound. Each end of this linear polymer structure can be further linked one after another to form a cyclic structure, but an open linear structure is generally preferred. Within the oligonucleotide structure, the phosphate groups are generally referred to as forming the internucleoside basic backbone of the oligonucleotide. The normal linkage or basic backbone of RNA and DNA is a 3 ′ to 5 ′ phosphodiester linkage.

  Specific examples of preferred antisense compounds useful in the present invention include oligonucleotides containing modified basic backbones or unnatural internucleoside linkages. As defined herein, oligonucleotides having a modified basic backbone include those that maintain a phosphorus atom in the basic backbone and those that do not have a phosphorus atom in the basic backbone. For the purposes of this specification, and as sometimes mentioned in the art, modified oligonucleotides that do not have a phosphorus atom in the basic backbone between the nucleosides can also be considered to be oligonucleosides.

  Preferred modified oligonucleotide backbones include, for example, methyl and other such as phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl phosphotriesters, 3'-alkylene phosphonic acids and chiral phosphonic acids. Phosphoramidates such as alkylphosphonic acids, phosphinic acids, 3'-aminophosphoramidates and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonic acids, thionoalkylphosphotriesters, and normal 3 '-5' linkages, adjacent pairs of these 2'-5 'linked analogs and nucleoside units bound from 3'-5' to 5'-3 'or from 2'-5' to 5'-2 ' Boranophosphates having reverse binding are included. Various salts, mixed salts and free acid forms are also included.

The basic backbone of a preferred modified oligonucleotide that does not contain a phosphorus atom is a short alkyl or cycloalkyl internucleoside bond, mixed heteroatom and alkyl or cycloalkyl internucleoside bond, or one or more short heteroatoms or heterocycles. It has a basic skeleton formed by an internucleoside bond. These are basic skeletons with morpholino linkages (partially formed from the sugar moiety of the nucleoside), siloxane basic skeleton, sulfide, sulfoxide and sulfone basic skeleton, formacetyl and thioformacetyl basic skeleton, methylene Formacetyl and thioformacetyl backbones, alkene containing backbones, sulfamic acid backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and N, O , Other basic skeletons with S and CH ₂ mixed constituents.

  In other preferred oligonucleotide mimetics, both the sugar and internucleoside linkages or basic backbone of the nucleotide unit are replaced with novel groups. Base units are maintained for hybridization with the appropriate nucleic acid target compound. One such oligomeric compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is called peptide nucleic acid (PNA). In PNA compounds, the sugar-basic backbone of the oligonucleotide is replaced by an amide containing a basic backbone, in particular an aminoethylglycine basic backbone. The nucleobase is maintained and is bound directly or indirectly to the nitrogen atom instead of the carbon of the amide moiety of the basic backbone.

Most preferred embodiments of the present invention include oligonucleotides having a phosphorothioate backbone and heteroatom backbones, particularly —CH ₂ —NH—O—CH ₂ —, —CH ₂ —N (CH ₃ ) —O—CH ₂ — (methylene (known as methylimino) or MMI _{backbone), - CH 2 -ON (CH} 3) -CH 2 -, - CH 2 -N (CH 3) -N (CH 3) -CH 2 - and It is an oligonucleoside having —ON (CH ₃ ) —CH ₂ —CH ₂ — (where the natural phosphodiester basic skeleton is represented as —OPO—CH ₂ —). Oligonucleotides having a morpholino basic backbone structure are also preferred.

The modified oligonucleotide may also have one or more sugar moieties substituted. Preferred oligonucleotides contain one of the following at the 2 ′ position: OH, F, O-alkyl, S-alkyl or N-alkyl, O-alkenyl, S-alkenyl or N-alkenyl, O-alkynyl, S— Alkynyl or N-alkynyl, or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted C ₁ -C ₁₀ alkyl or C ₂ -C ₁₀ alkenyl and alkynyl. Particularly preferred are O [(CH ₂ ) _n O] _m CH ₃ , O (CH ₂ ) _n OCH ₃ , O (CH ₂ ) _n NH ₂ , O (CH ₂ ) _n CH ₃ , O (CH ₂ ) _n ONH ₂ and O (CH ₂ ) _n ON [(CH ₂ ) _n CH ₃ )] ₂ (where n and m are from 1 to about 10). Other preferred oligonucleotides contain one of the following at the 2 ′ position: C ₁ -C ₁₀ lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH ₃ , OCN, Cl , Br, CN, CF ₃ , OCF ₃ , SOCH ₃ , SO ₂ CH ₃ , ONO ₂ , NO ₂ , N ₃ , NH ₂ , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl , RNA cleaving groups, reporter groups, intercalators, groups for improving the pharmacokinetic properties of oligonucleotides or groups for improving the pharmacodynamic properties of oligonucleotides, and other substituents with similar properties . Preferred modification includes 2'-methoxyethoxy _{(2'-OCH 2 CH 2 OCH} 3, also known as 2'-O- (2- methoxyethyl) or 2'-MOE) (Martin et al . , Helv. Chim. Acta, 1995, 78, 486-504), that is, alkoxyalkoxy groups are included. Further preferred modifications include 2′-dimethylaminooxyethoxy, an O (CH ₂ ) ₂ ON (CH ₃ ) ₂ group, also known as 2′-DMAOE, as described in the examples below. Other preferred modifications include 2'-methoxy (2'-O-CH ₃ ), 2'-aminopropoxy (2'-OCH ₂ CH ₂ CH ₂ NH ₂ ) and 2'-fluoro (2'-F) Is included. Similar modifications may also be made at other positions on the oligonucleotide, particularly the 3 ′ position of the sugar on the 3 ′ terminal nucleotide or in the 2′-5 ′ linked oligonucleotide and the 5 ′ position of the 5 ′ terminal nucleotide. Good. Oligonucleotides may also contain sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Oligonucleotides may also contain modifications or substitutions of nucleobases (often referred to in the art simply as “bases”). As used herein, `` unmodified '' or `` natural '' nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil ( U) is included. Modified nucleobases include 5-methylcytosine (5-Me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, adenine and 2-Propyl and other alkyl derivatives of guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil) ), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo especially 5-bromo, 5-trifluoromethyl and others 5-substituted uracil and cytosine, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, Other synthetic and natural nucleobases are included, such as 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Certain nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6 and O-6 substituted purines, such as 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitution has been shown to increase the stability of nucleic acid duplexes at 0.6-1.2 ° C, and is even more preferred when combined with 2'-O-methoxyethyl sugar modifications. Is a substitution.

  Another oligonucleotide modification of the invention includes a chemical linkage of one or more moieties to the oligonucleotide, or a conjugate that promotes its activity, cell differentiation or oligonucleotide acquisition by the cell. Such moieties include cholesterol moieties, cholic acids such as hexyl-S-tritylthiol, thioethers such as thiocholesterol, aliphatic chains such as dodecanediol or undecyl residues, such as di-hexadecyl-rac-glycerol or triethyl -Ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonic acid such as phosphonic acid, polyamine or polyethylene glycol chain, or adamantaneacetic acid, palmityl moiety, or octadecylamine or hexylamino-carbonyl-oxy Includes, but is not limited to, lipid moieties, such as cholesterol moieties.

  It is not necessary for all positions in a compound to be uniformly modified, and in fact, more than one of the above modifications is included in one compound or, in the extreme, one nucleoside in an oligonucleotide. It only has to be. The present invention also includes antisense compounds that are chimeric compounds. In the context of the present invention, a “chimeric” antisense compound or “chimeras” refers to two or more, each consisting of at least one monomer unit, ie a nucleotide in the case of an oligonucleotide compound. Antisense compounds containing chemically different regions, in particular oligonucleotides. These oligonucleotides typically have at least one region that increases the resistance of the oligonucleotide to degradation by nucleolytic enzymes, increases acquisition by cells, and / or improves binding affinity for the target nucleic acid. It is qualified. Additional regions of the oligonucleotide can be substrates for enzymes that cleave RNA: DNA or RNA: RNA hybrids. As an example, RNase H is a cellular endonuclease that cleaves RNA strands of RNA: DNA duplexes. Therefore, when RNase H is active, the target RNA is cleaved, thereby greatly promoting the gene expression suppressing effect of the oligonucleotide. As a result, similar effects are often obtained with shorter oligonucleotides when compared to phosphorothioated deoxyoligonucleotides that hybridize to the same target region. Whether the target RNA is cleaved can be routinely confirmed by gel electrophoresis and, if necessary, related nucleic acid hybridization techniques known in the art.

  As described above, the chimeric antisense compound of the present invention may be formed to take a composite structure of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and / or oligonucleotide mimetics. Such compounds are also referred to in the art as hybrids or gapmers.

  Antisense compounds used in the present invention can be conveniently and routinely produced by well-known solid phase synthesis techniques. Equipment for such synthesis is sold by several vendors such as Applied Biosystems (Foster City, CA). Any other method known in the art for making such synthesis may additionally or alternatively be used. It is well known that oligonucleotides such as phosphorothioated and alkylated derivatives can be prepared using similar techniques.

  The antisense compounds of the present invention are synthesized in vitro and do not include antisense compositions of biological origin or genetic vector constructs designed to direct in vivo synthesis of antisense molecules. The compounds of the invention may be mixed, encapsulated, conjugated, or otherwise aided by, for example, liposomes, receptors targeting molecules, oral, rectal, topical formulations, or ingestion, distribution and / or absorption Formulated with other molecules, molecular structures, or mixtures of compounds, such as other pharmaceutical forms.

  The antisense compounds of the present invention can be any pharmaceutically acceptable salt, ester, or salt of such an ester, or a biologically active metabolite or residue thereof when administered to an animal, including a human. It includes any other compound that can provide a product (directly or indirectly). Thus, for example, the invention extends to prodrugs and pharmaceutically acceptable salts of the compounds of the invention, pharmaceutically acceptable salts of the prodrugs, and other biological equivalents.

  The term “prodrug” refers to a therapeutic agent that is prepared in an inactive form and is converted into the active form (ie, drug) by the action of endogenous enzymes or other chemicals and / or conditions in the body or in its cells. Indicates. In particular, prodrug forms of the oligonucleotides of the invention are prepared as SATE [(S-acetyl-2-thioethyl) phosphate] derivatives.

  The term “pharmaceutically acceptable salt” refers to a physiologically and pharmaceutically acceptable salt of a compound of the invention, ie, retains the desired biological activity of the parent compound and is not preferred for the parent compound. Means a salt that does not have toxicological effects.

  Preferred examples of pharmaceutically acceptable salts of oligonucleotides include, but are not limited to, the following salts: (a) polyamines such as sodium, potassium, ammonium, magnesium, calcium, spermine and spermidine, etc. A salt formed with a cation, (b) an acid addition salt formed with a non-organic acid such as hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid or nitric acid, (c) for example acetic acid, oxalic acid, tartaric acid, succinic acid Acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid Acids, salts formed with organic acids such as polygalacturonic acid, and (d) chlorine, bromine and iodine Salts formed from the basic anion.

  The compounds of the present invention can be used as pharmaceutical compositions by adding an effective amount of an antisense compound to a suitable pharmaceutically acceptable diluent or carrier. The use and methods of the antisense compounds of the invention can also be useful prophylactically for the prevention or delay of, for example, infection, inflammation or tumor formation.

  Since the antisense compound of the present invention hybridizes to a nucleic acid encoding HIF-1, this can be used to easily construct a sandwich or other analysis, which is useful for research and diagnosis. . Hybridization between the antisense oligonucleotide of the present invention and a nucleic acid encoding HIF-1 can be detected by methods known in the art. Such methods can include binding of the enzyme to the oligonucleotide, labeling of the oligonucleotide with a radioisotope, or any other suitable detection method. Kits that detect the concentration of HIF-1 in a sample using such a detection method are also available.

  The present invention also includes pharmaceutical compositions and formulations comprising the antisense compounds of the present invention. The pharmaceutical compositions of the present invention can be administered in a number of ways depending on whether local or systemic treatment is desired, and on the area to be treated. Administration is topical (intraocular administration and administration to mucous membranes such as vaginal and rectal delivery, to the lungs including the trachea, nasal cavity, epidermis and transcutaneous by inhalation or gas infusion of powders or aerosols such as using a nebulizer Or oral or parenteral. Parenteral administration includes intravenous, arterial, subcutaneous, intraperitoneal or intramuscular injection or infusion, or intracranial, eg, intrathecal or intraventricular administration. Oligonucleotides with at least one 2′-O-methoxyethyl modification are considered particularly useful for oral administration.

  Pharmaceutical compositions and formulations for topical administration can include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders, and the like. Conventional pharmaceutical carriers, water-soluble, powdered or oily bases, thickeners and the like may be necessary or desirable.

  Compositions and formulations for oral administration include powders or granules, suspensions or solutions in water or non-aqueous solvents, capsules, sachets or tablets. Thickeners, flavorings, diluents, emulsifiers, dispersion aids or binders may be desirable.

  Compositions and formulations for parenteral, intrathecal or intracerebroventricular administration include buffers, diluents, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients, etc. There may be included sterile aqueous solutions that may contain other suitable additives including but not limited to.

  The pharmaceutical composition of the present invention includes, but is not limited to, solutions, emulsions and liposome-containing preparations. These compositions can be prepared from a variety of components such as, but not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semisolids.

[Example]
The following examples are illustrative of the implementation of various aspects of the present invention. They are not intended to limit the invention or the appended claims.

Cancer Cell Line Cultures Cancer cells used to measure the effects of oligonucleotide compounds were obtained from the following strains: Human Type OVCAR-3 (ovary), MCF-7 (chest of American Type Culture Collection (ATCC) (Manassas, VA)) , Hormone dependent), HeLa (cervical), PC3 (prostate), HepG2 (liver), A549 (lung), HT-29 (large intestine), PANC-1 (pancreas) and Caki-1 (kidney), Riken Cell Bank (Japan) U251 (brain), German Collection of Microorganisms and Cell Cultures (DSMZ) (Germany) MKN-45 (stomach), United States National Cancer Institute (Bethesda, MD) UMRC2 (liver) and Lox IMVI (black) Tumor). All cell lines except UMRC2, Caki-1 and PANC-1 are 10% fetal bovine serum (“FBS”), 1 mM sodium pyruvate, 10 mM HEPES and 100 U / ml penicillin and 100 μg / ml streptomycin (“P / S ]) Supplemented with RPMI 1640 medium (Invitrogen, Carlsbad, Calif.). UMRC2, Caki-1 and PANC-1 cells were maintained in Dulbecco's Modified Eagle Medium (“DMEM”, Invitrogen) supplemented with 10% FBS, P / S, 10 mM HEPES and 2 mM L-glutamine. All cells were cultured at 37 ° C. in humidified 5% CO ₂ .

Oligonucleotide synthesis Targets the various nucleotide sequences found in the coding region known as the open reading frame (`` ORF '') and the 3 ′ untranslated region (`` 3 ′ UTR '') of the human HIF-1 gene, Corresponding complementary oligonucleotides were synthesized. In order to produce antisense oligonucleotides, the basic backbone of each oligonucleotide was modified during the synthesis process to introduce a phosphorothioate bond between the nucleotides except the 3 ′ and 5 ′ ends.

  Oligonucleotides located in the HIF-1 coding region were synthesized using an 8909 Expedite DNA synthesizer from Applied Biosystems, Foster City, CA (“ABI”). The synthesis of phosphorothioate involves the standard oxidation bottle, 0.2M 3H-1,2-benzodithiol-3-one 1,1-dioxide, in order to gradually thiolate the phosphite bond. The synthesis was performed in the same manner as the synthesis of the corresponding phosphodiester oligonucleotide, except that the phosphodiester oligonucleotide was substituted with an acetonitrile solution. Oligonucleotide compounds were cleaved from a controlled pore glass column, deblocked in concentrated ammonium hydroxide, and then heated at 55 ° C. in the presence of ammonium hydroxide overnight. The supernatant was transferred to a new tube and the ammonium hydroxide was evaporated with Speedvac plus and UVS400 Universal Vacuum System (Thermo Savant, Holbrook, NY). The oligonucleotide was precipitated with 75 mM NaOAc at pH 7.2 and 2.5 volumes of ethyl alcohol and washed once with ethyl alcohol. The oligonucleotide was dissolved in water and the oligonucleotide concentration was measured with a UV spectrophotometer.

Transfer The day before transfer, cells were trypsinized, counted and plated. On the day of transfer, 2.5 × 10 ⁵ UMRC2 cells were seeded in each well of the 6-well plate so that the confluency reached 50-90%. All reagents and cultures used for transfer experiments were obtained from Invitrogen (Carlsbad, CA). The following solutions were prepared in sterile tubes. Solution A: At each transfer, a mixture of 2 μl (0.5 μg) DNA, 100 μl serum-free medium (“Opti-MEM”) and 3 μl PLUS reagent was incubated at room temperature for 15 minutes. Solution B: At each transfer, a mixture of 2.5 μl Lipofectamine reagent and 100 μl serum free medium (Opti-MEM). Solutions A and B were mixed and incubated for 15 minutes at room temperature. At the time of transfer, the cells were washed once with 2 ml of serum-free medium or PBS, and 800 μl of serum-free medium (Opti-MEM) was added to each well. Mixed solutions A and B were added to each well and mixed gently. Subsequently, the cells were incubated at 37 ° C. for 3 hours, the medium was replaced with a standard medium and incubated for the indicated time. Standard lipofectamine 2000 was used for RT-PCR and cytotoxicity experiments, and cells were plated in 100 μl growth medium in 96-well plates the day before transfer. For each well, the oligonucleotide sample was diluted to 25 μl of OPTI-MEM reduced serum medium. Separately, Lipofectamine 2000 reagent was diluted 1:50 in 25 μl OPTI-MEM and placed at room temperature for 5 minutes. The oligonucleotide and reagent were mixed and incubated at room temperature for 20 minutes to form a complex, which was then added directly to the cells in growth medium and mixed gently. Cells were then incubated for 4 hours at 37 ° C., after which the growth medium was replaced with standard medium and incubated for the indicated time.

Suppression of HIF-1α mRNA expression by antisense oligonucleotide The ability of the obtained antisense oligonucleotide to down-regulate or suppress the expression of mRNA encoding HIF-1α was tested. The expression level of HIF-1α mRNA in the cells transfected with the antisense oligonucleotide was measured by RT-PCR analysis. Samples were taken 2 hours after transfer (medium replacement), RNA was isolated and subjected to RT-PCR analysis.

The test oligonucleotide was transferred to UMRC2 cells (2.5 × 10 ⁵ cells per well) on a 6-well plate, and total RNA was isolated from the resulting transferred cells. Total RNA was isolated using the RNA-STAT kit (TEL-TEST, Inc., Friendswood, TX) according to the instructions (Chomczynski, P. and Sacchi, N in Anal. Biochem. 162: 156-159 (See also (1987)). Briefly, media was removed from two 6-well plates, a total volume of 0.5 ml RNA-STAT solution was added, mixed by pipetting several times, and transferred to an Eppendorf tube. 0.1 ml of chloroform was added to the tube and the tube was shaken vigorously for 15 seconds, then incubated at room temperature for 3 minutes and then centrifuged at 14,000 rpm at 4 ° C. for 15 minutes. The top layer was transferred to a new tube and 0.3 ml isopropanol was added and incubated for 10 minutes at room temperature. The RNA precipitate was then centrifuged at 14,000 rpm for 10 minutes. The resulting pellet was washed with 70% ethanol, dried briefly and returned to 20 μl water. RNA concentration was measured with a spectrophotometer. RT reaction was performed using M-MLV enzyme kit (Invitrogen). CDNA was synthesized in 20 μl of RT reaction using 5 μg of total RNA. A mixture of total RNA, oligo dT (0.5 mg) and dNTP (0.5 mM) was incubated at 65 ° C. for 5 minutes and rapidly cooled on ice to synthesize first strand cDNA. First strand buffer, 7.4 mM DTT and 1 μL M-MLV reverse transcriptase (200 units) are added to the above reaction mixture, incubated at 37 ° C. for 50 minutes, then incubated at 70 ° C. for 15 minutes to inactivate the enzyme I let you. HIF-1 cDNA synthesized by RT reaction was subjected to PCR measurement using Sapphire RCR mix (SuperBio Inc., Seoul, Korea) and appropriate primers. Primers for measuring HIF-1α mRNA were 5 ′ GCACAGGCCACATTCACG 3 ′ (SEQ ID NO: 5) and 5 ′ TGAAGATTCAACCGGTTTAAGGA 3 ′ (SEQ ID NO: 6). Beta actin was used as a PCR internal standard. Primers for beta actin were 5 ′ CCCATGCCATCCTGCGTCTG 3 ′ (SEQ ID NO: 7) and 5 ′ ACGGAGTACTTGCGCTCAG 3 ′ (SEQ ID NO: 8). PCR products were analyzed by 1.5% agarose gel electrophoresis.

Of the total 124 oligonucleotides initially screened, the results of 4 preferred oligonucleotides are shown in Table 1 below. Each oligonucleotide was reanalyzed to confirm the down-regulated level of mRNA expression. Each reaction was performed twice.

  RX-0047, RX-0073, RX-0149 and RX-0158 are novel arrangements designed by the present inventors. These were selected as representatives from the two regions in the literature, the 3'UTR and ORF regions of the HIF-1α gene, and according to the tests used in the reference, these two regions had the highest inhibition rates. (%). All other oligonucleotides have a novel sequence designed by the inventors. All new sequences showed higher percent inhibition than the reference sequences in the tests described herein. However, as described in Example 6, it was found that the inhibition rate (%) did not correlate with cytotoxicity. Subsequently, two oligonucleotides that showed high inhibition of HIF-1 mRNA expression (%) and cytotoxicity in UMRC2 cells were selected for testing in the other 12 cancer cell lines. A list of nucleotides tested is shown in Table 2 below.

  Figure 1 shows 13 cancer cell lines (UMRC2, OVCAR-3, MKN-45, A549, PC3, U251, Lox IMVI, HeLa, HepG2, HT-29 after transfer of 0.3 μM RX-0047 and RX-0149. , Caki-1, PANC-1 and MCF-7) show downregulation of HIF-1 mRNA levels. High levels of HIF-1 downregulation are observed in UMRC2, PANC-1, OVCAR-3, MCF-7, Lox IMVI, A549 and PC3 cell lines, while moderate downregulation is observed in HT-29 and Caki-1 cells. Observed, low levels of down-regulation were observed with HeLa, HepG2, MKN-45 and U251. As shown in Figure 1, the down-regulation levels of RX-0047 and RX-0149 HIF-1 mRNA expression are slightly higher in RX-0047-treated cells than RX-0149-treated cells in some cell lines Other than showing the level, it was the same level.

Western Blot Analysis of HIF-1 Protein Concentration Preferred RX-0047 and RX-0149 oligonucleotides at a concentration of 0.3 μM were transferred into various cancer cell lines as described in Example 3 above. Cells were treated with iron chelator, final concentration of 100 μM deferroxiamine for 6 hours before 24 hours after transfer. The following method was used for the preparation of the nuclear extract. On a 10 cm dish, gently wash the cells with ice-cold PBS containing 0.1 mM NaVO ₄ (2 x 6 ml), resuspend in 1 ml ice-cold PBS containing 0.1 mM NaVO ₄ and centrifuge at 2000 rpm for 5 min. separated. 0.3-0.5 ml of pH 7.6 CE buffer (10 mM HEPES, 60 mM KCl, 1 mM EDTA, 1 mM DTT, 1 mM PMSF, 1 × protease inhibitor cocktail and 0.1 mM NaVO ₄ ) containing 0.5% NP40 The pellet was resuspended and the cells were allowed to swell on ice for 5 minutes. The preparation was centrifuged at 2000 rpm for 5 minutes. The cytoplasmic extract was removed from the pellet and transferred to a new tube. Nuclei were gently washed with 0.5 ml CE buffer without NP40. Nuclei were centrifuged at 2,000 rpm for 5 minutes as described above. Add 50 μl of pH 8.0 NE buffer (20 mM Tris-HCl, 420 mM NaCl, 1.5 mM MgCl ₂ , 0.2 mM EDTA, 1 mM PMSF, 25% glycerol, 0.1 mM NaVO ₄ and 1 × protease inhibitor cocktail) to the nuclear pellet Vortex and resuspend. The extract was incubated on ice for 40 minutes with intermittent vortexing, and the CE and NE fractions were centrifuged at maximum speed for 15 minutes to pellet all nuclei. The supernatant was transferred to a new tube (soluble nucleus fraction) and stored at -70 ° C. Protein concentration was measured using BCA protein quantification reagent (Pierce Biotechnology, Rockford, IL). HIF-1 protein expression in the crude cell extract was measured by Western analysis using SDS-PAGE followed by anti-HIF1 antibody (Transduction Labs, Lexington, KY). Anti-beta actin antibody (Santa Cruz Biotechnology) was used as an internal standard. The result is shown in figure 2. Both RX-0047 and RX-0149 showed suppression of HIF-1 protein expression in all cell lines to varying degrees.

Cytotoxic activity test The cytotoxic activity of the test oligonucleotide was tested using a human cancer cell line. Cell viability after RX-oligonucleotide transfer was assessed using the sulforhodamine B (“SRB”) method (Skehan et al., J. National Cancer Institute, 82: 1107-1112 (1990)).

  Cells were seeded on 96-well plates and oligonucleotides transferred the next day. After 72 hours of incubation, viable cells were stained with sulforhodamine B and counted with a microplate reader. Briefly, 1,000 to 10,000 cells were seeded in each well of a 96-well plate and the test oligomer was transferred using Lipofectamine 2000 reagent (Invitrogen). After 4 hours of incubation, the transfer reagent was removed and freshly prepared culture was added to each well. After 72 hours of incubation, the culture medium was removed. Cells were fixed with 10% trichloroacetic acid (“TCA”), incubated for 1 hour at 4 ° C. and washed 4 times with tap water. Cells were then stained with 0.4% sulforhodamine B / 1% acetic acid for 30 minutes, washed 4 times with 1% acetic acid, and air dried. After stirring in a 10 mM Tris solution for 5 minutes, the optical density of the sample was measured at 530 nm using a Benchmark Plus microplate reader (Bio-Rad Laboratories, Hercules, CA).

  Test compounds that showed down-regulation of HIF-1 mRNA were tested for the effect on UMRC2 cell viability. The following oligo compounds, RX-0047, RX-0073, RX-0149 and RX-0158, were used for cytotoxicity experiments. RX-0047 and RX-0149 showed the most potent cytotoxic activity compared to the other oligonucleotides tested. Interestingly, the novel oligonucleotides, RX-0118 and RX-0121, had mRNA repression rates (%) of 74 and 45, respectively, but not as cytotoxic as RX-0047 and RX-0149. Therefore, the mRNA suppression test did not correlate with cytotoxicity.

  Two leading candidates for mRNA suppression studies, RX-0047 and RX-0149, were screened for cytotoxicity against various cancer cell lines. RX-0047 decreased cell viability of the following human cancer cell lines: PC3 (prostate), U251 (brain), HeLa (cervix), OVCAR-3 (ovary), Lox IMVI (melanoma), HepG2 (liver) ), MCF-7 (chest), UMRC2 (kidney), MKN-45 (stomach), PANC-1 (pancreas), HT-29 (colon), Caki-1 (kidney) and A549 (lung). In each cell line tested, the cytotoxic activity of RX-0047 increased with RX-0047 concentration. With 0.1 μM RX-0047, cell death occurred in more than 50% of cells in all 13 cell lines tested. Similar results were obtained with RX-0149. Again, RX-0149 also showed cytotoxicity in all cell lines, which increased to varying degrees with concentration in each cell line. With 0.1 μM RX-0149, more than 50% of cells died in PC3, U251, HeLa, OVCAR-3, Lox IMVI, MCF-7, MKN-45, A549, Caki-1 and UMRC2. However, in PANC-1, HT-29 and HepG2, at 0.1 μM, more than 50% of the cells survived.

Measurement of IC ₅₀ representing cytotoxic activity of RX-0047 and RX-0149 oligonucleotides Test oligonucleotides were screened in relative effective amounts. Thirteen different cancer cell lines were transfected with RX-0047 or RX-0149 in a concentration range of 0.01 μM to 1 μM, and 72 hours after transfer, the cells were stained with sulforhodamine B and bio-Rad microplate reader (Bio -Rad Laboratories) to count the number of viable cells. The IC ₅₀ value or drug concentration required to kill half of the cells was calculated with the KaleidaGraph software (Synergy Software, Reading, PA) program. The results are shown in Table 3 below.

For comparison, it should be noted that the IC ₅₀ of UMRC2 is 8 nM for RX-0047 and 17 nM for RX-0149. A similar cytotoxic effect was also observed in cell lines U251, OVCAR-3 and A549.

Array variability
To determine whether RX-0047 and RX-0149 need to be a complete 20mer basic scaffold to down-regulate HIF-1 mRNA expression, 18-, 16-, 14- and 10mer oligos were used. Nucleotides were synthesized and analyzed for their effects on mRNA expression and cytotoxicity. In RT-PCR analysis data, 18mer type RX-0047 showed some suppression of HIF-1 mRNA expression. On the other hand, 16, 14 and 10mer types showed weaker inhibition of HIF-1 mRNA expression. This suggests that even if the sequence of RX-0047 is cleaved into 16, 14 and 10 mer, it has a certain degree of inhibitory effect on HIF-1 mRNA expression. Regarding RX-0149, 18-01 and 16mer RX-0149 showed the same suppression of HIF-1 mRNA expression as 20mer RX-0149. However, when the sequence was cleaved to 14 and 10mer RX-0149, the suppression was minimal. This indicates that for RX-0047, the 18 and 16mer types also acted with the same efficiency as the 20mer type. For RX-0149, a 20mer full-length sequence is required to achieve maximum suppression of HIF-1 mRNA expression.

  Combined with the above data, it was confirmed that oligomers containing 5 or 10 nucleotides both upstream and downstream of the sequence from which the 20mer RX-0047 was derived show measurable suppression of HIF-1 mRNA expression.

  Cytotoxicity in the UMRC2 cell line was tested using the same oligomers containing 5 or 10 nucleotides upstream and downstream of the sequence from which the 20mer RX-0047 was derived. Consistent with RT-PCR data, all four modified oligomers showed cytotoxic effects comparable to 20mer RX-0047. The truncated forms of RX-0047 and RX-0149 also showed a similar suppression pattern in cancer cell proliferation as observed by RT-PCR analysis.

Ex vivo xenograft study In order to observe the suppression of tumor growth by one of the compounds of the present invention, RX-0047, in an animal model, an ex vivo xenograft study of nude mice was conducted. Human lung cancer cell line A549 was cultured in a medium supplemented with 10% cosmic calf serum (HyClone, Logan, UT) in a 4: 1 mixture of Dulbecco's modified Eagle's medium and 199 medium (medium 199). Cells were maintained at 37 ° C. with 5% CO ₂ .

  A marker gene, luciferase, was introduced into tumor cells. The following method was used. Cells were infected with luciferase using a lentiviral vector containing the luciferase gene and the G418 / neo selectable marker. Cells were incubated for 24 hours in the presence of viral supernatant. The medium was changed after infection and G418 selection was started 3-4 days after infection. Luciferase positive cells were confirmed with a luminometer.

  Immunodeficient mice (Nu / Nu, Harlan Sprague Dawley, Inc., Indianapolis, IN) are aseptic in the Animal Resources Center (ARC) of the University of Texas Southwestern Medical Center. And treated according to ARC and IACUC guidelines.

As an A549 lung cancer xenograft model, A549 cells (4 × 10 ⁶ cells) were subcutaneously injected into the flank of each mouse. The test substance was administered over 14 days with an Alzet pump system. Alzet micro-osmotic pumps (Alza, Palo Alto, Calif.) Were implanted subcutaneously (sc) in 10 g mice and intraperitoneally (IP) in 20 g mice. The pump rate was maintained at 0.25 μl / hr (± 0.05 μl / hr) and infusion continued for 14 days. Aseptic techniques were used during filling and handling of the pump and during surgical implantation.

As an A549 lung cancer metastasis model, mice were irradiated with γ-rays and 1 × 10 ⁶ cells were intravenously administered into the tail vein. Animals were imaged and observed weekly by luciferase-based bioluminescence imaging. If the result is negative (after 3 to 4 months), the treatment of the mouse is terminated; otherwise, according to the ARC / IACUC guidelines, the cancer weight is 10% of the standard body weight of the host mouse (1 to 2 cm in diameter for adult mice). ), And observed images every week.

Table 4 shows the measurement results of bioluminescence by luciferase in RX-0047-treated athymic nude mice sc-transplanted with control and A549 human lung cancer xenografts as an index of tumor growth. One week after RX-0047 treatment, tumor size was reduced to 1/3 compared to control animals. Two weeks after RX-0047 treatment, tumor size was reduced by half. This suggests that RX-0047 is a potent anti-tumor agent in tumor xenograft models.

In the A549 metastasis model, animals received IP RX-0047 daily (60 mg / kg / day for 9 days, then 30 mg / kg / day for another 5 days). Metastatic tumors were imaged 2 and 3 weeks after IP administration of RX-0047 for 14 days. As shown in Table 5, no lung metastases were detected at 2 weeks after RX-0047 treatment, but lung metastases were observed in the control group. Three weeks after RX-0047 treatment, lung metastases were reduced to 1/60 compared to the control group. This suggests that RX-0047 is a potentially potent lung metastasis suppressor.

RX-0047 and RX-0149 suppress HIF-1 mRNA expression in various cancer cells. Western blot analysis of inhibition of HIF-1 protein expression by RX-0047 and RX-0149.

[Sequence Listing]

Claims (10)

Targeting a nucleic acid molecule encoding human HIF-1, SEQ ID NO: 2, 5 '
RX-0047, an oligonucleotide compound having a sequence containing aatgagccaccagtgtccaa 3 ′ and suppressing the expression of human HIF-1.   The compound of claim 1 which is an antisense oligonucleotide.   The antisense oligonucleotide according to claim 2, which has a phosphorothioate bond which is at least one modified internucleoside bond.   A method for inhibiting HIF-1 expression in a human cell or tissue, comprising contacting the cell or tissue with the compound of claim 1.   A method for inducing cytotoxicity in a cancer cell, the step of introducing into a cell an oligonucleotide comprising SEQ ID NO: 2, 5 ′ aatgagccaccagtgtccaa 3 ′ which is RX-0047, which hybridizes to a human HIF-1 sequence Including methods.   RX-0149, an oligonucleotide compound that targets a nucleic acid molecule encoding human HIF-1 and has a sequence comprising SEQ ID NO: 4, 5 ′ ggagctaacatctccaagtc 3 ′ and suppresses expression of human HIF-1.   7. A compound according to claim 6 which is an antisense oligonucleotide.   The antisense oligonucleotide according to claim 7, which has a phosphorothioate bond which is at least one modified internucleoside bond.   A method for suppressing HIF-1 expression in a human cell or tissue comprising contacting the cell or tissue with the compound of claim 6. A method for inducing cytotoxicity in a cancer cell, the step of introducing into a cell an oligonucleotide comprising SEQ ID NO: 4, 5 ′ ggagctaacatctccaagtc 3 ′ which is RX-0149, which hybridizes to a human HIF-1 sequence Including methods.

Images