JP2006518999A - Oligomeric compounds for modification of thioredoxin expression - Google Patents

Abstract

The present invention provides oligonucleotides to the TRX gene for altering TRX expression. The composition of the invention comprises an oligonucleotide, particularly an antisense oligonucleotide, that targets a nucleic acid encoding TRX. Methods of using these compounds are provided for the modification of TRX expression and for the treatment of diseases associated with either or both of TRX overexpression or mutant TRX expression. Examples of the disease include lung cancer, breast cancer, colon cancer, prostate cancer, pancreatic cancer, lung cancer, liver cancer, thyroid cancer, kidney cancer, brain cancer, testicular cancer, gastric cancer, intestinal cancer, intestinal cancer, spinal cancer, sinus cancer, Bladder cancer, urinary tract cancer, or ovarian cancer. The oligonucleotide can be composed of deoxyribonucleosides or nucleic acid analogs (eg, locked nucleic acids) or combinations thereof.

Description

Detailed Description of the Invention

(Technical field)
The present invention provides compositions and methods for altering TRX expression. In particular, the present invention relates to an oligomeric compound capable of specifically hybridizing with a nucleic acid encoding TRX (the oligomeric compound is preferably an oligonucleotide). The oligonucleotide compounds have been found to modify TRX expression and disclose their pharmaceutical formulations and their use as a treatment for cancer diseases.

(Background technology)
The present invention relates to oligonucleotides (eg, containing LNA) that are complementary to a human thioredoxin (TRX) putative oncogene, which is responsible for tumor cell proliferation and apoptosis in various human cancers. It was found to modify the inhibition. TRX is also closely related to drug resistance in the treatment of cancer (Yokomizo et al., 1995. Cancer Res. 55: 4293-4296; Kahlos et al., 2001. Int. J. Cancer 20; 95: 198-204 ). TC Laurent first described E. coli-derived TRX in 1964. It is an approximately 12 kDa oxidoreductase that is widely distributed and well conserved, present in both prokaryotes and eukaryotes (Holmgren, 1989, J. Biol. Chem., 264; 13963-13966 ). TRX contains a dithiol disulfide active site that participates in the redox reaction by reversible disulfide bond formation and undergoes reversible thiol reduction by the NADPH-dependent enzyme thioredoxin reductase. The active site is highly conserved and contains the Cys-Gly-Pro-Cys sequence (Holmgren, 1985, Annu. Rev. Biochem. 54: 237-71; 237-271). The mammalian thioredoxin family includes TRX-1 and TRX-2. The former is the cytosolic and nuclear form and the latter is the mitochondrial form. TRX-1 is the most extensively described and is a 104 amino acid protein predicted to be expressed in several mutated forms in cells (Powis et al., 2001. Annu. Rev. Biophys Biochem. Struct. 30: 421-55: 421-455). Human TRX / TRX-1 (11.5 kDa) (also known as adult T-cell leukemia derived factor (ADF)) (by Gasdaska et al., 1994. Biochim. Biophys. Acta. 1218: 292-296) Or Eosinophil cytotoxicity stimulating factor (Silberstein et al., 1993, J. Biol. Chem. 268: 9138-9142) contains 5 cysteine residues (3 or more in bacteria) (Silberstein et al., 1993, J. Biol. Chem. 268: 9138-9142). These extra cysteines are involved in the specific properties of human TRX (Gasdaska et al., 1994. Biochim. Biophys. Acta. 1218: 292-296). TRX has been shown to modify the binding of transcription factors to DNA by redox control and consequently control gene transcription. Transcription factors described as being under TRX control are NF-κB (Matthews et al., 1992, Nucleic Acids Res. 20: 3821-3830), TFIIIC (Cromlish et al., J. Biol. Chem. 264: 18100- 18109), BZLF1 (Bannister et al., 1991, Oncogene 6: 1243-1250), p53 (Ueno et al., 1999, J. Biol. Chem. 274: 35809-35815), glucocorticoid receptor (Grippo et al., 1983 , J. Bio. Chem. 258: 13658-13664) and indirect AP-1 (Fos / Jun heterodimer) (Abate et al., 1990, Science, 249: 1157-1161). TRX also increases the binding of AP-2, estrogen receptor and PEBP2 / CBF to DNA (Powis et al., 2001, Annu. Rev. Biophys. Biochem. Struct. 30: 421-55: 421-455 ). Hypoxia-inducible factor 1 alpha (HIF-1α) has been shown to increase with elevated TRX (Welsh et al., 2002, Cancer Res. 62: 5089-5095), which makes it an anti-tumor angiogenic target TRX can be enhanced. Moreover, it participates in the first step in DNA synthesis that catalyzes the conversion of nucleotides to deoxynucleotides, ie essential for growth. TRX can function as a signal for cancer cell growth, possibly by increasing the autocrine activity of growth factors (Gasdaska et al., 1995, Cell Growth Differ. 6: 1643-1650). TRX has been suggested to upregulate the alpha subunit of the high affinity IL-2 receptor in HTLV-1 transformed T-cells (Schenk et al., 1996, J. Immunol. 156: 765-771 ), Where IL-2 can increase up to 100-fold (Powis et al., 2001, Annu. Rev. Biophys. Biochem. Struct. 30: 421-455; 421-455). TRX also increases cytokines similar to IL-1, IL-6, IL-8, and TNF-α (Schenk et al., 1996, J. Immunol. 156: 765-771), resulting in immune Affects disease (eg, human rheumatoid arthritis). Stress (eg, hypoxia, lipopolysaccharide, O ₂ , hydrogen peroxide, phosbol esters, viral infections, and infectious agents, X-ray radiation and UV radiation, hormones and chemicals) induces TRX (Powis et al., 2001, Annu. Rev. Biophys. Biochem. Struct. 30: 421-455; 421-455). The promoter region of the gene encoding TRX contains a group of stress responsive elements (Taniguchi et al., 1996, Nucleic Acids Res. 24: 2746-2752). TRX-1 is overexpressed in many human primary tumors, and cancer cells are known to be able to secrete TRX-1 via a leaderless secretion pathway in an ER-Golgi-independent manner (Rubartelli et al. 1992, J. Biol. Chem. 267: 24161-24164). Human TRX has been proposed to be a possible target for anti-apoptotic and anti-proliferative treatments in various cancers, and may itself play an important role in various human diseases (Powis et al., 2001). , Annu. Rev. Biophys. Biochem. Struct. 30: 421-455; 421-455). Apoptosis is suppressed by overexpression of TRX both in vitro and in vivo (Barker et al., 1997, Cancer Res. 57: 5162-5167). Recombinant human TRX stimulates the growth of normal cells and cultured cancer cells from various solid tumors (Gasdaska et al., 1995, Cell Growth Differ. 6: 1643-1650; Oblong et al., J. Biol. Chem. 269: 11714-11720), and TRX mRNA has been found to be overexpressed in human tumor cells. On the other hand, redox-inactive TRX does not stimulate cell proliferation (Oblong et al., J. Biol. Chem. 269: 11714-11720). Surprisingly, it has been found that the malignancy of human primary tumor cells is either expressing or overexpressing TRX compared to normal tissue. For example, gastric cancer (Grogan et al., 2000, Hum. Pathol. 31: 475-481), malignant pleural mesothelioma (Kahlos et al., 2001, Int. J. Cancer 20; 95: 198-204), non-small cells Lung cancer (Soini et al., Clin. Cancer Res., 7: 1750-1757), liver cancer (Nakamura et al., Cancer 69: 2091-2097), cervical cancer (by Fujii et al., Cancer 68: 1583-1591), Pancreatic cancer (Nakamura et al., Cancer Detect. Rrev. 24: 53-60), colon cancer, non-Hodgkin lymphoma, acute lymphocytic leukemia and myeloma (Powis et al., 2001, Annu. Rev Biophys. Biochem. Struct. 30 : 421-55; 421-455).

  In addition to the discovery that TRX is overexpressed and involved in a number of primary tumors, the growth-stimulating and anti-apoptotic effects of TRX-1 induced by a number of anticancer drugs (reviewed by Powis et al., 2001, Annu. Rev. Biophys. Biochem. Struct. 30: 421-455; 421-455) makes TRX modifications using TRX specific drugs an attractive target for drug development. Phosphorothioate antisense oligonucleotides are known to specifically modify TRX mRNA and protein (Saitoh et al., EMBO J. 17: 2596-2603) (WO 9938963). All of these phosphorothioates were 20 or 23 bp in length (with one exception being the 17-mer).

  Most of the oligonucleotides in current clinical trials are based on phosphorothioate chemistry since 1988, which was the first useful antisense chemistry developed. However, as has become apparent recently, this chemistry has significant drawbacks that limit clinical use. These include, for example, low affinity for their target mRNA, which negatively impacts potency, and as a result, how complex products are small active oligonucleotides and increase treatment costs Give restrictions in terms of Their low affinity is also translated into poor access to the target mRNA, thus complicating the identification of active compounds. Finally, phosphorothioate oligonucleotides suffer from a wide range of side effects that narrow their therapeutic window.

To address these and other issues, greater efforts are spent creating new analogs with improved properties. As shown in Scheme 1 below, which are completely artificial analogs (e.g., PMA and morpholino), and more convenient DNA analogue (e.g., boranophosphate, N3 ^'-P5' phosphoramidate and some 2 ^'modified analogs ^{(e.g., 2' -F, 2 '-O} -Me, 2' -O- methoxyethyl (MOE) and 2 ^'-O- (3- aminopropyl)) than. including (AP) recently, the hexitol nucleic acid (HMA), 2 ^'-F- arabino nucleic acid ^(2' -F-ANA) and D- cyclohexenyl nucleoside (CeNA) have been introduced.

Many of these analogs show improved binding to complementary nucleic acids, biological stability, or they are cellular enzymes, RNAse H (this is in the mode of action of many antisense compounds). Retain the ability to replenish). However, none of them combine these benefits, and in many cases one improvement of the property impairs one or more other properties. Also, new complications are often described that greatly limit the commercial value of some analogs. These include, for example, low solubility, complex oligomerization chemistry, very low cellular uptake, incompatibility with other chemicals, and the like. The MOE chemistry has several limitations. This becomes apparent only when some MOEs insert blocks into the oligo. MOE 2 ^'- belong to the modification of the family, and this group of compounds the antisense activity is directly correlated with RNA binding affinity in vitro are well known. MOE 20 bp gapmer targeting c-raf (5MOE / PO-10PS-5MOE / PO) has been reported to have an IC ₅₀ of about 20 nm in T24 cells and MOE targeting PKC-a Gapmers have been reported to have an IC ₅₀ of 25 nm in A549 cells. For comparison, phosphothioate compounds used in antisense experiments typically exhibit IC ₅₀ in the 150 nm range (Stein, Kreig, Applied Antisense Oligonucleotide Technology, Wiley-Liss, 1988, pages 87-90).

A practical object of the present invention is to provide novel oligomeric compounds for survivin mRNA. It has been found that the compounds of the present invention show a decrease in IC ₅₀ (thus increased activity) and consequently promote effective treatment of various cancer diseases in which the expression of survivin is involved as a cause or related substance. As explained below, this objective is best achieved by the use of a very high affinity called LNA (locked nucleic acid).

The present invention relates to oligomeric compounds, in particular LNA antisense oligonucleotides, which target nucleic acid encoding survivin and modify the expression of survivin. This modification is a particularly powerful down-modification of survivin mRNA as well as the induction of an apoptotic response. The LNA-containing oligomeric compound is as low as 8-mer and certainly very active as 16-mer, which is significantly more than the reported antisense compounds targeting survivin short. These 16-mer oligomeric compounds have an IC _{50 in the} nanomolar range or less. The present invention allows for considerable shortening of the normal length of antisense oligomers (from 20-25 mer to, for example, 8-16 mer) without compromising the affinity required for pharmacological activity. Since the intrinsic specificity of an oligo is inversely related to its length, the shortening will significantly increase the specificity of the antisense compound for its RNA target. Furthermore, it is estimated that shorter oligomeric compounds have higher biological stability and cell permeability than longer oligomeric compounds. For at least these reasons, the present invention is a significant contribution to the field.

(Summary of Invention)
The present invention relates to oligomeric compounds, in particular LNA antisense oligonucleotides, which target a nucleic acid encoding TRX and modify the expression of said TRX. Pharmaceutical compositions and other compositions containing the oligomeric compounds of the invention are also provided.

  A central aspect of the invention is to provide a compound comprising a total of 8-50 nucleotides and / or nucleotide analogs, wherein the compound comprises a subsequence of at least 8 nucleotides or nucleotide analogs. The subsequences are SEQ ID NOs: 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25. , 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 , 51, 52, 53, 54, 55, 56 and 57.

  Further provided is a method for altering the expression of TRX in a cell or tissue, the method comprising contacting the cell or tissue with one or more oligomeric compounds or compositions of the invention. An animal or human suffering from or susceptible to a disease or condition associated with the expression of TRX by administering a therapeutically or prophylactically effective amount of one or more oligomeric compounds or compositions of the invention A method of treating is also disclosed. Further provided are methods of using the oligomeric compounds for inhibiting TRX expression and for treating diseases associated with TRX activity. Examples of the disease include different types of cancer such as lung, breast, large intestine, prostate, pancreas, lung, liver, thyroid, kidney, brain, testis, stomach, intestinal fistula, intestine, spinal cord, sinus, bladder, urinary tract, Or ovarian cancer.

(Description of invention)
In the present specification, the term “target nucleic acid” refers to thioredoxin or thioredoxin reductase (preferably human thioredoxin 1 (TRX1) (hereinafter referred to as TRX)) and RNA transcribed from the DNA (eg, pre-mRNA and mRNA). As well as cDNA derived from the RNA.

As used herein, the term “gene” refers to exons, introns, non-coding 5 ^′ and 3 ^′ regions, regulatory elements, and all currently known variants thereof and any further variants (which are Gene that can be elucidated).

  As used herein, the term “nucleoside” is used in its ordinary meaning, that is, it contains 2-deoxyribose or ribose units, which are nitrogenous bases: adenine (A), cytosine (C ), Thymine (T), uracil (U) or guanine (G) by the number 1 carbon atom.

  Similarly, the term “nucleotide” means a 2-deoxyribose unit or RNA unit, which is a nitrogenous base: adenine (A), cytosine (C), thymine (T) or guanine (U), uracil ( It is linked to U) by its number 1 carbon atom and from its internucleoside phosphate group or terminal group by its number 5 carbon atom.

  As used herein, the term “nucleotide analog” means a non-natural nucleotide where the ribose unit is different from 2-deoxyribose or RNA and / or the nitrogenous base is A, C, Either different from T and G and / or the internucleoside phosphate linking group is different. Specific examples of nucleoside analogs are described, for example, by Freier & Altmann, Nucl. Acid Res., 1997, 25, 4429-4443 and by Uhlmann, Curr. Opinion in Drug Development, 2000, 3 (2), 293-213. ing.

  The terms “corresponding nucleoside analog” and “corresponding nucleoside” are intended to indicate that the nucleobase and nucleoside in the nucleoside analog are identical. For example, when a 2-deoxyribose unit of nucleotide is linked to adenine, the “corresponding nucleoside analog” includes a pentose unit linked to adenine (different from 2-deoxyribose).

  The term “nucleic acid” is defined as a molecule formed by the covalent attachment of two or more nucleotides. The terms “nucleic acid” and “polynucleotide” are used interchangeably herein.

  The term “nucleic acid analog” refers to a compound that binds to a non-natural nucleic acid.

  Nucleotide and nucleic acid analogs are described, for example, by Freier & Altmann et al., Nucl. Acid Res., 1997, 25, 4429-4443, and Uhlmann et al., Curr. Opinion in Drug & Development 2000, 3 (2): 293-21 ). Scheme 1 illustrates an example of selecting a nucleotide analog suitable for producing a nucleic acid.

  The term “LNA” means a nucleotide containing one bicyclic nucleoside analog, which also means an LNA monomer or an oligonucleotide containing one or more bicyclic nucleoside analogs. To do. LNA monomers are described in WO 9914226 and subsequent applications, WO 0056746, WO 0056748, WO 0066604, WO 00125248, WO 0228875, WO 2002094250 and PCT / DK02 / 00488. One specific example of a thymidine LNA monomer is (1S, 3R, 4R, 7S) -7-hydroxy-1-hydroxymethyl-5-methyl-3- (thymin-1-yl) -2,5-dioxa-bicyclo [ 2: 2: 1] heptane.

As used herein, the term “oligonucleotide” refers to an oligomer (also referred to as an oligo), a nucleic acid polymer (eg, ribonucleic acid (RNA) or deoxyribonucleic acid (DNA)) or a nucleic acid analog known in the art ( The term refers to locked nucleic acids (LNA), or mixtures thereof, the term includes oligonucleotides containing natural nucleobases, sugars, and internucleoside (backbone) linkages, as well as non-natural moieties (which function similarly) Or having certain improved functions). Fully or partially modified or substituted oligonucleotides may have some desirable properties of the oligonucleotides (eg, ability to permeate cell membranes, good resistance to extracellular and intercellular nucleases, high affinity for the nucleic acid target And specificity) are often preferred over the natural form. The LNA analog exhibiting the above properties is particularly preferred.

  The term “unit” is understood to be a monomer.

  The term “at least one” includes an integer greater than or equal to 1, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 Etc.

The term “thio-LNA” includes locked nucleotides in which at least one of X and Y in Scheme 2 is selected from S or —CH ₂ —S. Thio-LNA can be in both beta-D and alpha-L-configuration.

The term “amino-LNA” means that at least one of X or Y in Reaction Scheme 2 is —N (H) —, N (R) —, CH ₂ —N (H) —, —CH ₂ —N (R). - a, wherein R is hydrogen or C _{1 to 4} - is selected from alkyl, it comprises a locked nucleotide. Amino-LNA can be in both beta-D and alpha-L-configuration.

The term “oxy-LNA” includes locked nucleotides wherein at least one of X or Y in Scheme 2 is —O— or —CH ₂ —O—. Oxy-LNA can be in both beta-D and alpha-L-configuration.

The term “ena-LNA” includes locked nucleotides where Y in Scheme 2 is —CH ₂ —O—.

  The term “alpha-L-LNA” includes locked nucleotides as shown in Reaction Scheme 3 (right structural formula).

  The term “LNA derivative” refers to all locked nucleotides in Scheme 2 except beta-D-methylene LNA (eg, thio-LNA, amino-LNA, alpha-L-oxy-LNA, and ena-LNA). including.

  The term “linking group” is intended to mean a group that can be covalently coupled to two nucleosides, two nucleoside analogs, nucleoside and nucleoside analogs, and the like. Specific and preferred examples include phosphate groups and phosphorothioate groups.

  As used herein, the term “conjugate” refers to the sharing of a compound described herein (ie, a compound containing a sequence of a nucleoside or nucleoside analog) with one or more non-nucleotide or non-polynucleotide molecules. It is intended to mean a foreign molecule that is produced by binding. Non-nucleotide or non-polynucleotide molecules include, for example, macromolecular drugs (eg, proteins, fatty acid chains, saccharide residues, glycoproteins, polymers, or combinations thereof). A typical protein may be an antibody against the target protein. A typical polymer may be polyethelene glycol.

  The term “carcinoma” is intended to indicate a malignant tumor of epithelial origin. Epithelial tissue covers or follows the body surface on the inner and outer body surfaces of the body. Epithelial tissues are, for example, the skin, mucous membranes, and serosa along body cavities and internal organs (gut fistula, bladder, uterus, etc.). Epithelial tissue can also extend from glands (eg, mucus-secreting glands) to deeper tissue layers.

  The term “sarcoma” is intended to mean a malignant tumor growing from connective tissue (eg, cartilage, fat, muscle, tendon and bone).

  The term “glioma” as used herein is intended to encompass malignant tumors of glial cell origin.

  The term “a” as used for a nucleoside, nucleoside analog, SEQ ID NO, etc. is intended to mean one or more. In particular, “a component selected from the group consisting of (eg, nucleoside, nucleoside analog, SEQ ID NO, etc.)” is intended to mean that one or more of the cited components can be selected. Accordingly, the expression “a component selected from the group consisting of A, B, and C” includes all combinations of A, B, and C (ie, A, B, C, A + B, A + C, B + C, and A + B + C). Intended.

As used herein, the term “C _1-4 alkyl” is intended to mean a straight or branched saturated hydrocarbon chain having 1 to 4 carbon atoms in the chain, eg, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, and tert-butyl.

  As used herein, the term “target nucleic acid” includes DNA encoding survivin, RNA transcribed from the DNA (including pre-mRNA and mRNA), and also cDNA derived from the RNA. .

  As used herein, the term “oligomeric compound” refers to, for example, target genes “chimeric plasts” and “TFO”; target genes “antisense inhibitors”, “siRNA”, “ribozymes” and “oligozymes”. RNA transcripts; or the desired therapeutic effect in humans by binding by hydrogen bonding to either of the proteins encoded by the target genes “aptamers”, “spiegelmers” or “decoys” It means an oligonucleotide that can be induced.

  As used herein, the term “mRNA” refers to the currently known mRNA transcript of a target gene, and any further transcripts, which can be elucidated.

  The term “modification” as used herein means either an increase (stimulation) or a decrease (suppression) of gene expression. In the present invention, suppression is a preferred form of gene expression modification and mRNA is a preferred target.

  As used herein, the term “targeting” an antisense compound to a target nucleic acid refers to binding of the antisense oligonucleotide to its intended target and functioning. Means subject to cell, animal or human in a manner that can be modified.

  As used herein, “hybridization” means a hydrogen bond between complementary nucleosides or nucleotide bases, which can be Watson-Crick, Holstein, reverse Holstein hydrogen bonds, etc. . Watson and Crick are composed of duplexes held together in a helical configuration approximately 50 years ago by hydrogen bonds that deoxyribonucleic acid (DNA) forms between opposite complementary nucleobases in the duplex. Showed that. The four nucleobases normally found in DNA are guanine (G), adenine (A), thymine (T) and cytosine (C), of which G nucleobase pairs with C and A The nucleobase pairs with T. In the case of RNA, the nucleobase thymine is replaced by the nucleobase uracil (U), which pairs with A as well as the T nucleobase. The chemical groups in the nucleobase involved in standard duplex formation constitute the Watson-Crick face. Hoogsteen, several years later, in addition to the Watson-Crick face, purine nucleobases (G and A) recognize the Hoogsten face from the outside of the double strand and bind to the pyrimidine oligonucleotide by hydrogen bonding As a result, it was shown that a triple helix structure can be formed.

  As used herein, “complementary” refers to the ability to accurately pair each other between two nucleotide or nucleoside sequences. For example, if a nucleotide at a position of an oligonucleotide can hydrogen bond with a nucleotide at the corresponding position of a DNA or RNA molecule, the oligonucleotide and the DNA or RNA are complementary to each other at that position it is conceivable that. If a sufficient number of nucleotides in the oligonucleotide can form hydrogen bonds with the corresponding nucleotides in the target DNA or RNA to form a stable complex, the DNA or RNA and the Oligonucleotides are considered to be complementary to each other. In order to be stable in vitro or in vivo, the sequence of the antisense compound need not be 100% complementary to its target nucleic acid molecule. Thus, the terms “complementary” and “specifically hybridizable” mean that an antisense compound binds sufficiently strongly and specifically to the target molecule to produce the desired interference with the normal function of the target. Mean that it does not affect the function of the non-target mRNA.

  The present invention uses oligomeric compounds (especially antisense oligonucleotides) for use in altering the function of a nucleic acid molecule encoding TRX. The modification is ultimately a change in the amount of TRX produced. In one embodiment, this is accomplished by providing an antisense compound that specifically hybridizes with a nucleic acid encoding TRX. The modification is preferably suppression of TRX expression, resulting in a decrease in the number of functional proteins produced.

  The antisense compounds and other oligomeric compounds of the present invention, which modify the expression of the target, design a rational design based on experiment or sequence information at the target, and an oligomeric compound for the desired target Identified by know-how on the best method. The sequence of these compounds is a preferred embodiment of the present invention. Similarly, sequence motifs in the target to which these preferred oligomeric compounds are complementary (referred to as “hot spots”) are preferred sites for targeting.

  Preferred oligomeric compounds comprise at least 8 nucleobase moieties and the subsequence is SEQ ID NO: 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43 , 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56 or 57, and their sequences are presented in Table 2. The oligomeric compounds described in the present invention are powerful target modifiers. For example, target in vitro suppression is shown in Table 2 as measured by real-time PCR. Table 3 shows the low IC50 of the oligomeric compound. Figures 2 and 3 show the in vitro potency of the oligomeric compounds of the invention as measured by Northern blotting. Figures 6 and 7 show the in vitro potency of the oligomeric compounds of the invention as measured by Western blotting. FIG. 8 shows specific inhibition of LNA oligomeric compounds when tracked with another target. The compounds of the invention also induce apoptosis (FIG. 9). FIG. 10 shows the in vivo efficacy of the oligomeric compounds of the invention. All the above experimental observations show that the compounds of the invention can constitute active compounds in pharmaceutical compositions.

  In one embodiment, the nucleobase moiety is selected from at least 9, at least 10, at least 11, at least 12, at least 13, at least 14 or at least 15.

  Preferred oligomeric compounds of the present invention are SEQ ID NOs: 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24. 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 , 50, 51, 52, 53, 54, 55, 56 and 57, and their sequences are presented in Table 2.

In another embodiment of the invention, the nucleosides are linked to each other by a phosphorothioate group. An interesting embodiment of the present invention is SEQ ID NO: 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, For compounds 49, 50, 51, 52, 53, 54, 55, 56 and 57, where each linking group within each compound is a phosphorothioate group. The modification is indicated by the subscript S. In other words, one aspect of the present invention, SEQ ID _{NO: 5 A, 6 A, 7} A, 8 A, 9 A, 10 A, 11 A, 12 A, 13 A, 14 A, 15 A, 16 A, 17 _{A, 18 A, 19 A,} 20 A, 21 A, 22 A, 23 A, 24 A, 25 A, 26 A, 27 A, 28 A, 29 A, 30 A, 31 A, 32 A, 33 A, _{34 A, 35 A, 36 A} , 37 A, 38 A, 39 A, 40 A, 41 A, 42 A, 43 A, 44 A, 45 A, 46 A, 47 A, 48 A, 49 A, 50 A a compound of _{51 a, 52 a, 53 a} , 54 a, 55 a, 56 a and 57 _a.

A further aspect of the present invention, SEQ ID _{NO: 5 B, 6 B, 7} B, 8 B, 9 B, 10 B, 11 B, 12 B, 13 B, 14 B, 15 B, 16 B, 17 B, _{18 B, 19 B, 20 B} , 21 B, 22 B, 23 B, 24 B, 25 B, 26 B, 27 B, 28 B, 29 B, 30 B, 31 B, 32 B, 33 B, 34 B _{, 35 B, 36 B, 37} B, 38 B, 39 B, 40 B, 41 B, 42 B, 43 B, 44 B, 45 B, 46 B, 47 B, 48 B, 49 B, 50 B, 51 _{B, 52 B, 53 B,} 54 B, 55 B, 56 _B compound and 57 _B relates.

A further aspect of the present invention, SEQ ID _{NO: 5 C, 6 C, 7} C, 8 C, 9 C, 10 C, 11 C, 12 C, 13 C, 14 C, 15 C, 16 C, 17 C, _{18 C, 19 C, 20 C} , 21 C, 22 C, 23 C, 24 C, 25 C, 26 C, 27 C, 28 C, 29 C, 30 C, 31 C, 32 C, 33 C, 34 C , 35 _C , 36 _C , 37 _C , 38 _C , 39 _C , 40 _C , 41 _C , 42 _C , 43 _C , 44 _C , 45 _C , 46 _C , 47 _C , 48 _C , 49 _C , 50 _C , 51 _C , 52 _C , 53 _C , 54 _C , 55 _C , 56 _C and 57 _C.

  In one embodiment of the invention, the oligomeric compound contains at least one chemical meaning LNA (locked nucleic acid).

上記式中、ＸおよびＹは独立して、−Ｏ−、−Ｓ−、−Ｎ(Ｈ)−、Ｎ(Ｒ)−、−ＣＨ₂−、または−ＣＨ−（二重結合の部分の場合）、−ＣＨ₂−Ｏ−、−ＣＨ₂−Ｓ−、−ＣＨ₂−Ｎ(Ｈ)−、−ＣＨ₂−Ｎ(Ｒ)−、−ＣＨ₂−ＣＨ₂−、または−ＣＨ₂−ＣＨ−（二重結合の部分の場合）、−ＣＨ＝ＣＨ−の群から選ばれて、ここで、Ｒは水素またはＣ_1〜4−アルキルから選ばれる。不斉の基は、いずれかの配向で存在することができる。 LNA monomers are typically international patent application WO 99/14226 and subsequent applications WO 0056746, WO 0056748, WO 0066604, WO 00125248, WO 0228875, WO 2002094250 and PCT / DK02 / 00488, all of which are herein. Means a bicyclic nucleoside analog described in the above). A preferred LNA monomer structure is illustrated in Scheme 2.

In the above formula, X and Y are independently —O—, —S—, —N (H) —, N (R) —, —CH ₂ —, or —CH— (in the case of a double bond moiety). _{), - CH 2 -O -,} - CH 2 -S -, - CH 2 -N (H) -, - CH 2 -N (R) -, - CH 2 -CH 2 -, or -CH ₂ -CH - (if part of a double bond), - CH = CH- is selected from the group consisting of wherein, R represents hydrogen or C _{1 to 4} - selected from alkyl. Asymmetric groups can exist in any orientation.

  In Scheme 2, the four chiral centers are shown in an immobilized configuration. However, the configuration in Reaction Scheme 2 is not necessarily fixed. In this invention, the compound of general Reaction formula 2 is also included. Here, the chiral center exists in a different configuration (eg, as shown in Scheme 3 or 4). Accordingly, the illustrative intent of Scheme 2 is not intended to limit the configuration of the chiral center. Each chiral center in Scheme 2 can exist in either R or S configuration. The definitions of R (left-handed) and S (right-handed) are defined in IUPAC 1974 Recommendations, Section E, Fundamental Stereochemistry: The rules can be found in Pure Appl. Chem. 45, 13-30, (1976) and “Nomenclature of Organic Chemistry "pergamon, New York, 1979.

Z and Z ^* are not independently present or are selected from internucleoside linkages, terminal groups or protecting groups.

The internucleoside linkage is -OP (O) ₂ -O-, -OP (O, S) -O-, -OP (S) ₂ -O-, -SP (O). ₂ -O-, -S-P (O, S) -O-, -S-P (S) ₂ -O-, -O-P (O) ₂ -S-, -O-P (O, S ) -S-, -S-P (O) ₂ -S-, -O-PO (R ^H ) -O-, O-PO (OCH ₃ ) -O-, -O-PO (NR ^H ) -O -, - O-PO (OCH 2 CH 2 S-R) -O -, - O-PO (BH 3) -O -, - O-PO (NHR H) -O -, - O-P (O) ₂ -NR ^H- , -NR ^H -P (O) ₂ -O-, -NR ^H -CO-O-, -O-CO-O-, -O-CO-NR ^H- , -NR ^H -CO _{-CH 2 -, - O-CH} 2 -CO-NR H -, - O-CH 2 -CH 2 -NR H -, - CO-NR H -CH 2 -, - CH 2 -NR H -CO-, _{-O-CH 2 -CH 2 -S -} , - _{-CH 2 -CH 2 -O -, -} S-CH 2 -CH 2 -S -, - CH 2 -SO 2 -CH 2 -, - CH 2 -CO-NR H -, - O-CH 2 -CH ₂ -NR ^H -CO -, - and obtained selected from the group consisting of wherein, R ^H is hydrogen or _{C 1~4 - - CH 2 -NCH 3} -O-CH 2 selected from alkyl.

The terminal groups are independently hydrogen, azide, halogen, cyano, nitro, hydroxy, Prot-O-, Act-O-, mercapto, Prot-S-, Act-S-, _C1-6 -alkylthio, amino Prot-N (R ^H )-, Act-N (R ^H )-, mono- or di- (C _1-6 -alkyl) amino, optionally substituted C _1-6 alkoxy, optionally substituted C _1-6 alkyl, optionally substituted C _2-6 alkenyl, optionally substituted C _2-6 alkenyloxy, optionally substituted C _2-6 alkynyl, optionally substituted C _2-6 alkynyl Oxy, monophosphate, monothiophosphate, diphosphate, dithiophosphate, triphosphate, trithiophosphate, DNA intercalators, photochemically active , Thermochemically active groups, chelating groups, acceptor groups, ligands, carboxy, sulphono, _{hydroxymethyl, Prot-O-CH 2 -} , Act-O-CH 2 -, aminomethyl, Prot-N (R ^H ) —CH ₂ —, Act—N (R ^H ) —CH ₂ —, carboxymethyl, sulfonomethyl (where Prot is a protecting group for —OH, SH, and —NH (R ^H ), respectively, and Act is Each is an activating group for —OH, —SH, and —NH (R ^H ), and R ^H is selected from hydrogen or C _1-6 alkyl.

Protecting group of the hydroxy substituent is substituted trityl, such as 4,4 ^'- dimethoxytrityl oxy (DMT), 4-monomethoxytrityl oxy (MMT), and trityloxy, optionally substituted 9- (9-phenyl) Xanthenyloxy (pixyl), optionally substituted methoxytetrahydropyra to ruoxy (mthp), silyloxy (eg, trimethylsilyloxy (TMS), triisopropylsilyloxy (TIPS), tert-butyldimethylsilyloxy (TBDMS) ), Triethylsilyloxy, and phenyldimethylsilyloxy, tert-butyl ether, acetal (containing two hydroxy groups), acyloxy (eg acetyl) or halogen-substituted acetyl (eg chloroacetyloxy, Or fluoroacetyloxy), isobutyryloxy, pivaloyloxy, benzoyloxy, and substituted benzoyl, methoxymethyloxy (MOM), benzyl ether or substituted benzyl ether (eg, 2,6-dichlorobenzyloxy (2,6-Cl ₂₎ Or if Z or Z ^* are hydroxyl, they may optionally be protected by binding to a solid support via a linking group.

When Z or Z ^* is an amino group, illustrative examples of the amino protecting group include fluorenylmethoxycarbonylamino (Fmoc), tert-butyloxycarbonylamino (BOC), trifluoroacetylamino, Allyloxycarbonylamino (alloc, AOC), Z-benzyloxycarbonylamino (Cbz), substituted benzyloxycarbonylamino (eg 2-chlorobenzyloxycarbonylamino (2-ClZ)), monomethoxytritylamino (MMT), Examples include dimethyloxytritylamino (DMT), phthaloylamino, and 9- (9-phenyl) xanthenylamino (pixyl).

In the above embodiments, Act represents the active group for —OH, —SH, and —NH (R ^H ), respectively. The active group may be, for example, optionally substituted O-phosphoramidite, optionally substituted O-phosphotriester, optionally substituted O-phosphodiester, optionally substituted H-phosphonate, and optionally substituted. Selected from O-phosphonates.

As used herein, the term “phosphoramidite” refers to the formula —P (OR ^x ) —N (R ^y ) ₂ where R ^x is an optionally substituted alkyl group (eg, methyl, 2-cyanoethyl, Or benzyl) and each R ^y is an optionally substituted alkyl group (eg, ethyl or isopropyl) or a group —N (R ^y ) ₂ (morpholino group (—N (CH ₂ CH ₂ ) .R ^x which means forming) the ₂ O is preferably 2-cyanoethyl, and said the two R ^y are the same and are preferably isopropyl. Thus, particularly relevant phosphoramidite Is N, N-diisopropyl-O- (2-cyanoethyl) phosphoramidite.

  B is a natural or non-natural nucleobase and is adenine, cytosine, 5-methylcytosine, isocytosine, pseudoisocytosine, guanine, thymine, uracil, 5-bromouracil, 5-propynyluracil, 5-propynyl-6-fluorouracil, 5-methylthiazole uracil, 6-aminopurine, 2-aminopurine, inosine, diaminopurine, 7-propyne-7-deazaadenine, 7-propyne-7-deazaguanine, and 2-chloro- Selected from 6-aminopurine.

に示す。式中、Ｙは、−Ｏ−、−Ｓ−、−ＮＨ−またはＮ(Ｒ^H)であり；そして、
ＺおよびＺ^*は独立してヌクレオシド間連結、末端基もしくは保護基から選ばれる。 A particularly preferred bicyclic structure is shown below in Reaction Scheme 3:

Shown in Where Y is —O—, —S—, —NH— or N (R ^H );
Z and Z ^* are independently selected from internucleoside linkages, terminal groups or protecting groups.

The internucleoside linkage is -OP (O) ₂ -O-, -OP (O, S) -O-, -OP (S) ₂ -O-, -SP (O). ₂ -O-, -S-P (O, S) -O-, -S-P (S) ₂ -O-, -O-P (O) ₂ -S-, -O-P (O, S ) -S-, -S-P (O) ₂ -S-, -O-PO (R ^H ) -O-, O-PO (OCH ₃ ) -O-, -O-PO (NR ^H ) -O -, - O-PO (OCH 2 CH 2 S-R) -O -, - O-PO (BH 3) -O -, - O-PO (NHR H) -O -, - O-P (O) ₂ -NR ^H- , -NR ^H -P (O) ₂ -O-, -NR ^H -CO-O-, wherein R ^H is selected from hydrogen or C _1-4 alkyl.

The terminal groups are independently hydrogen, azide, halogen, cyano, nitro, hydroxy, Prot-O-, Act-O-, mercapto, Pro-S-, Act-S-, _C1-6 alkylthio, amino, Prot-N (R ^H )-, Act-N (R ^H )-, mono- or di- (C _1-6 -alkyl) amino, optionally substituted C _1-6 alkoxy, optionally substituted C _{1 6} alkyl, optionally monophosphate substituted, mono-thiophosphate, diphosphate, dithiophosphate, triphosphate, selected from trithiophosphate, where, Prot each -OH, -SH, and -NH (R ^H ) And R ^H is selected from hydrogen or C _1-6 -alkyl.

Protecting group of the hydroxy substituent is substituted trityl (e.g., 4,4 ^'- dimethoxytrityl oxy (DMT), 4-monomethoxytrityl oxy (MMT), optionally substituted 9- (9-phenyl) key Sante oxy (Pixyl), optionally substituted methoxytetrahydropyranyloxy (mtp), silyloxy (eg, trimethylsilyloxy (TMS), triisopropylsilyloxy (TIPS), tert-butyldimethylsilyloxy (TBDMS), triethylsilyloxy, And phenyldimethylsilyloxy, tert-butyl ether, acetal (containing two hydroxy groups), acyloxy (eg acetyl), or, if Z or Z ^* is hydroxy, they are optionally linking groups By It may be protected by binding with a solid carrier Te.

When Z or Z ^* is an amino group, illustrative examples of the amino protecting group include fluorenyl-methoxy-carbonylamino (Fmoc), tert-butyloxycarbonylamino (BOC), trifluoroacetylamino, Examples include allyloxycarbonylamino (alloc, AOC), monomethoxytritylamino (MMT), dimethoxytritylamino (DMT), and phthaloylamino.

In the above embodiments, Act represents an activating group for —OH, —SH, and —NH (R ^H ), respectively. These activating groups include, for example, optionally substituted O-phosphoramidites, optionally substituted O-phosphotriesters, optionally substituted O-phosphodiesters, optionally substituted H-phosphonates, or optionally Selected from substituted O-phosphonates.

As used herein, the term “phosphoramidite” means a group of the formula: —P (OR ^x ) —N (R ^y ) ₂ , where R ^x is an optionally substituted alkyl group. And each R ^y is an optionally substituted alkyl group, R ^x is preferably 2-cyanoethyl, and the two R ^y are the same. And is preferably isopropyl. A particularly relevant phosphoramidite is therefore N, N-diisopropyl-O- (2-cyanoethyl) phosphoramidite.

  B constitutes a natural or non-natural nucleobase and is adenine, cytosine, 5-methylcytosine, isocytosine, pseudoisocytosine, guanine, thymine, uracil, 5-bromouracil, 5-propynyluracil, 6-aminopurine , 2-aminopurine, inosine, diaminopurine, 2-chloro-6-aminopurine.

A particularly preferred LNA unit is shown in Reaction Scheme 4.

(Therapeutic principle)
Those skilled in the art will appreciate that LNA-containing oligomeric compounds can be used to combat TRX-related diseases by a number of different principles, and therefore this will be within the spirit of the present invention. .

  For example, LNA oligomeric compounds can be designed as antisense inhibitors, which are single-stranded nucleic acids that prevent the production of proteins that cause disease by intervention at the mRNA level. They can also be designed as antisense oligonucleotides ribozymes or oligozymes, which contain, in addition to the target binding domain, catalytic activity that degrades the target mRNA (ribozyme) or endogenous enzyme (RNase P). This includes an external guide sequence (EGS) that supplements (which degrades the target mRNA (oligozyme)).

Similarly, the LNA oligomeric compounds may be designed as siRNA ^'s, using this compound, by a cell to silence specific endogenous or exogenous genes by yet poorly understood "antisense-like" mechanism Is a small double-stranded RNA molecule.

  LAN oligomeric compounds can also be designed as aptamers (and their modifications, called Spiegelmers), which are nucleic acids that adopt a three-dimensional structure by intramolecular hydrogen bonding. This allows them to bind and block biological targets with high affinity and specificity. LNA oligomer compounds can also be designed as Decoys. This is a small double-stranded nucleic acid that prevents cellular transcription factors from transactivating their target genes by selectively blocking DNA binding sites.

  Moreover, LNA oligomeric compounds can be designed as chimeric plasts, which are small single stranded nucleic acids that can specifically pair and modify target gene sequences. Thus, LNA-containing oligomeric compounds that utilize this principle may be particularly useful for treating TRX-related diseases caused by mutations in the TRX gene.

Finally, LNA oligomeric compounds may be designed as a TFO ^'s (triplex forming oligonucleotides). This is a nucleic acid that binds to double-stranded DNA and prevents the production of disease-causing proteins by intervention at the RNA transcription level.

  When indicated in part to the therapeutic principle intended to manipulate the oligonucleotide, the LNA oligomeric compounds described in the present invention have from about 8 to about 60 nucleobases, ie, from about 8 to about 60. It is preferred to include 1 linked nucleoside. Particularly preferred compounds are antisense oligonucleotides containing about 12 to about 30 nucleobases (antisense compounds containing about 12 to 20 nucleobases are most preferred).

  When referring to the above principles that allow an LNA oligomeric compound to manifest its therapeutic effect, the target of the present invention may be a TRX gene, mRNA or protein. In a most preferred embodiment, the LNA oligomeric compound is designed as an antisense inhibitor to TRX pre-mRNA or TRX mRNA.

The oligonucleotides, any of the sites along the pre -mRNA or mRNA TRX (e.g., 5 ^'- untranslated leader, exons, introns, and ^3' non-site-translated end) capable of hybridizing with .

  In a preferred embodiment, the oligonucleotide hybridizes to a human TRX pre-mRNA or portion of mRNA comprising a translation-start site. More preferably, the TRX oligonucleotide comprises a CAT sequence, which is complementary to the AUG start sequence of TRX pre-mRNA or RNA. In another embodiment, the TRX oligonucleotide hybridizes to a portion of the splice donor site of human TRX pre-mRNA. In yet another embodiment, the TRX oligonucleotide hybridizes to a portion of the splice receptor site of the human TRX pre-mRNA. In another embodiment, the TRX oligonucleotide hybridizes to a human TRX pre-mRNA or portion of mRNA involved in polyadenylation, transport or degradation.

  Those skilled in the art will recognize that preferred oligonucleotides will hybridize to TRX pre-mRNA or portions of mRNA that do not generally occur in transcripts from unrelated genes to increase treatment specificity. You will admit that it is something to keep.

  The oligomeric compounds of the present invention are designed to be sufficiently complementary to the target to obtain the desired clinical response, eg the oligomeric compound has sufficient strength and specificity with the target They must be combined to give the desired effect. In one embodiment, compounds that modify TRX are also designed to modify other specific nucleic acids that do not encode TRX.

  The oligomeric compounds of the present invention are preferably designed to avoid intramolecular and intermolecular oligonucleotide hybridization.

  In many cases, the identification of LNA oligomeric compounds that are effective in modifying TRX activity in vivo or clinically is based on sequence information about the target gene. However, one skilled in the art will appreciate that the oligomeric compounds can also be identified by empirical testing. For example, compared to that of the preferred embodiment, the sequence homology is inferior, or has a larger or smaller modified nucleotide, or a longer or shorter length but nevertheless clinical treatment TRX oligomeric compounds that exhibit a response in are also within the scope of the present invention.

(Antisense drug)
In one embodiment of the invention, the oligomeric compound is a suitable antisense drug. A powerful and safe antisense drug has a good number of parameters (eg, affinity / specificity, stability in biological fluids, cellular uptake, mode of action, pharmacokinetic properties, and toxicity) Requires adjustment.

(Affinity and specificity)
Oxymethylene 2 ^{'-O, 4'} LNA having -C linking group (beta-D-oxy-LNA) shows unprecedented binding properties for DNA and RNA target sequences. Similarly, LNA derivatives (eg, amino-, thio-, and α-L-oxy-LNA) exhibit unprecedented affinity for complementary RNA and DNA, and in the case of thio-LNA, for RNA. Affinity is better than with β-D-oxy-LNA.

In addition to these remarkable hybridization properties, LNA monomers DNA and RNA monomers, and other nucleic acid molecule analogue (e.g., 2 ^'-O- alkyl modified RNA monomers) that were mixed, and acts cooperatively it can. For example, the oligonucleotides of the invention can be composed entirely of β-D-oxy-LNA monomers, or they can be β-D-oxy-LNA and DNA, RNA or complementary nucleic acid molecule analogs (which are For example, LNA derivatives such as amino-, thio-, and α-L-oxy-LNA). LNA's unprecedented binding affinity for DNA or RNA target sequences, and its ability to mix freely with DNA, RNA, and a wide range of current nucleic acid analogs are widely used for the development of effective and safe antisense compounds. With significant results of the present invention.

  First, in one embodiment of the invention, the normal length of the antisense oligo is significantly shortened (from 20-25 mer, e.g. 12-12, without compromising the affinity required for pharmacokinetic activity. To 15 mer). Such shortening will significantly increase the specificity of the antisense compound for its RNA target since the intrinsic specificity of the oligo is inversely related to its length. One embodiment of the present invention is to identify the shortest possible specific sequence in the target mRNA by available human genome sequences and fast-advancing gene annotations.

  In another embodiment, the use of LNA to reduce the size of the oligo significantly facilitates the method of manufacture and prize and thus represents a commercially competitive treatment for a variety of diseases. Provides a basis for antisense therapy.

  In another embodiment, the unprecedented affinity of LNA is used to substantially increase the ability of an antisense oligo to be able to hybridize in vivo with its target mRNA, resulting in other chemicals The time and effort required to identify the active compound compared to the situation used can be significantly reduced.

  In another embodiment, LNA's unprecedented affinity is used to increase the efficacy of antisense oligonucleotides, resulting in a compound with a therapeutic window superior to current ones in clinical trials. Development becomes possible.

  When designed as an antisense inhibitor, the oligonucleotide of the invention binds to the target nucleic acid and alters the expression of its cognate protein. The modification preferably results in at least 10% or 20% suppression of expression compared to normal expression levels, and at least 30%, 40%, 50%, 60%, 70 compared to normal expression levels. %, 80% or 90% inhibition is more preferred.

Typically, LNA oligonucleotides of the invention, other residues other than beta-D-oxy-LNA (e.g., native DNA monomers, RNA monomers, N3 ^'-P5' Hosuramideto, 2 ^{'-F, 2'} -O-Me-, 2 ^'-O- methoxyethyl ^{(MOE), 2' -O- (} 3- aminopropyl) (AP), hexitol (hexitol) nucleic acid (HNA), 2 ^'-F- arabino nucleic acid (2 ^' -F-ANA) and D-cyclohexenyl nucleoside (CeNA) and β-D-oxy-LNA-modified oligonucleotides may also contain other LNA units in addition to or in place of the oxy-LNA group. In particular, another preferred LNA unit is a thio-LNA or amino-LNA monomer in either configuration of D-β or L-α or combinations thereof, Or LNA-modified oligonucleotides typically comprise at least about 5, 10, 15 or 20% LNA units, more typically the total bases of the oligonucleotide, based on the total nucleotides of the oligonucleotide. Containing at least about 20, 25, 30, 40, 50, 60, 70, 80, or 90% of LNA units.

(Stability in biological fluids)
One embodiment of the present invention provides a standard (eg, by increased resistance to nucleases (endonucleases and exonucleases)) to increase the stability of the resulting oligomeric compounds in biological fluids. Introducing LNA monomers into DNA or RNA oligonucleotides. The magnitude of stability depends on the number of LNA monomers used, their position in the oligonucleotide, and the type of LNA monomer used. Compared to DNA and phosphorothioate, the following order of ability to stabilize oligonucleotides against nucleolytic degradation can be established. DNA << phosphorothioate to oxy-LNA << [alpha] -L-LNA <amino-LNA <thio-LNA.

  Given the fact that LNA can be compatible with standard DNA synthesis and it is free to mix with many current nucleic acid analogs, the nuclease resistance of LNA-oligomer compounds shows increased nuclease stability. Further increase according to the present invention by introducing other analogs or by utilizing nuclease-resistant internucleoside linkages such as phosphoromonothioate, phosphorodithioate, and methylphosphonate linkages Can do.

(Mode of action)
The antisense compounds described in the present invention can exert their therapeutic effects by various mechanisms, and this can be combined with some of these in the same compound. In one scenario, the binding of the oligonucleotide to its target (pre-mRNA or mRNA) prevents binding to other factors (proteins, other nucleic acid molecules, etc.) necessary for the proper functioning of the target. Act (ie, function by a steric barrier). For example, antisense oligonucleotides can contain sequence motifs of either pre-mRNA or mRNA (which can be recognized, bound to transacting factors involved in splicing, poly-adenylation, cell trafficking, RNA Post-transcriptional modification of nucleosides, which is important for ^5' -end capping, translation, etc.). In the case of pre-mRNA splicing, the result of the interaction between the oligonucleotide and its target is either suppression of expression of the unwanted protein or generation of another spliced mRNA encoding the desired protein, or both It can be.

  In another embodiment, binding of an oligonucleotide to its target disables the translation process by creating a physical block to the ribosomal machinery (ie, translation termination).

  In another embodiment, the binding of the oligonucleotide to its target is compatible with secondary and higher order structures, which are important for its proper function, ie, structural interference. Interferes with the ability of the RNA. For example, the oligonucleotides play a key role in different functions, such as providing additional stability to the RNA or adapting essential recognition motifs for different proteins. ) May interfere with the formation of the structure.

  In yet another embodiment, the binding of the oligonucleotide deactivates the target for further cellular metabolic processes by recruiting cellular enzymes that degrade mRNA. For example, the oligonucleotide may comprise a segment of a nucleoside that has the ability to recruit ribonuclease H (RNase H), which degrades the RNA portion of a DNA / RNA duplex. Similarly, the oligonucleotide can include a segment that supplements a double-stranded RNAase (eg, RNAse III), or is itself an external guide sequence (EGS) that supplements an endogenous enzyme (RNase P) that degrades the target mRNA. ). Alternatively, the oligonucleotide may contain a sequence motif that exhibits RNAse catalytic activity, or the molecule binds to the oligonucleotide that renders the target incapable of further metabolic activity when in close proximity to the target by a hybridization event. Can do.

β-D-oxy-LNA was found not to support RNase H activity. However, this can be altered according to the present invention by making chimeric oligonucleotides that make up β-D-oxy-LNA and DNA, which are called gapmers. Gapmers are 4-12 nt central stretches of DNA, modified monomers that are recognizable and cleavable by RNAase H (gap), typically 1-6 of β-D-oxy-LNA. Based on (flanked) (flanked by residues). The flank can also be configured with an LNA derivative. There are other chimeric constructs of the invention that can act by an RNAase-mediated mechanism. The headmer is a modified monomer that can be cleaved by βase-D-oxy-LNA or a proximal stretch of an LNA derivative at the ^5′ -end, followed by a proximal stretch of DNA or recognizable and cleavable by RNAase H at the ^3′- end. Defined by A tailmer is then defined by a proximal stretch of DNA or a modified monomer that is recognizable and cleavable by RNAase H at the 5 ^′ end, followed by a proximal stretch of β-D-oxy-LNA or LNA derivative to the 3 ^′ end. Is done. Other chimeras of the invention (which may be another component of DNA or a mixmer composed of a recognizable and cleavable monomer, β-D-oxy-LNA and / or LNA derivative). ) Can also mediate RNAaseH binding and cleavage. Since α-L-LNA replenishes RNAaseH activity to some extent, a smaller gap in DNA, or a modified monomer that is recognizable and cleavable by RNAaseH for the gapmer construct, may be necessary and the mixmer Greater flexibility in the composition can be introduced. FIG. 1 outlines the different designs of the present invention.

(Pharmacokinetic properties)
The clinical utility of antisense oligonucleotides depends to a significant extent on their pharmacokinetics (eg, absorption, distribution, cellular uptake, metabolism and secretion). These parameters are significantly derived by the underlying chemistry and size and three-dimensional structure of the oligonucleotide.

  Because the above LNAs of the present invention are several related chemistries rather than one (although molecularly different), all exhibit stunning affinity for complementary DNA or RNA. Thus, the LNA family of chemistry uses tailored pharmacokinetic properties (utilizing the greater affinity of LNA to alter the size of the active compound or altering the exact molecular composition of the active compound) Uniquely adapt to the development of oligos of the present invention with different LNA chemistries (for example). In the latter case, for example, the use of amino-LNA rather than oxy-LNA will alter the total charge of the oligo and affect the uptake and distribution behavior. Similarly, the use of thio-LNA instead of oxy-LNA increases the lipophilicity of the oligonucleotide and thus affects its ability to cross lipophilic barriers (eg, cell membranes).

  Altering the pharmacokinetic properties of the LNA oligonucleotides of the invention can be further achieved by linking various different molecules. For example, the ability of an oligonucleotide to cross a cell membrane can be increased, for example, by linking with a lipid molecule (eg, a cholesterol molecule, a thioether, an aliphatic chain, a phospholipid or a polyamine for an oligonucleotide). Similarly, uptake of LNA oligonucleotides into cells can be increased by joining molecules with oligonucleotides that interact with molecules in the membrane, thereby mediating transport into the cytoplasm.

(Pharmacodynamic properties)
In accordance with the present invention, improved oligomer uptake, increased biological stability (eg, increased oligomer resistance to degradation) and / or specificity of the hybridizing properties of the oligonucleotide with the target sequence (eg, mRNA sequence) With groups that increase sex and affinity, the pharmacodynamic properties can be increased.

(Toxicology)
There are basically two types of toxicity associated with antisense oligos; sequence-dependent toxicity (which is related to the base sequence) and sequence-independent class-related toxicity. Except for problems associated with immune stimulation with natural CpG sequence motifs, the most significant toxicity in the development of antisense oligonucleotides is sequence independent, eg, oligonucleotide chemistry, as well as dosage, mode of administration , Related to times and duration. The phosphorothioate class of oligonucleotides is particularly well identified, and it has numerous side effects (eg, complement activation, long-term PTT (partial thromboplastin time), thrombocytopenia, hepatotoxicity (of liver enzymes) Increased), cardiotoxicity, reticuloendothelial cell splenomegaly and thickening).

  As mentioned above, the LNA family of chemistry provides unprecedented affinity, very high biological stability, and the ability to modify the exact molecular composition of the oligonucleotide. In one embodiment of the invention, the compound containing LNA has a high potency combined with little if any phosphorothioate linking group, and thus better efficacy than the complementary antisense compound. And allows the development of oligonucleotides that will exhibit stability.

(Manufacturing)
The oligos and polynucleotides of the present invention can be obtained using nucleic acid chemistry polymerization methods well known to those skilled in the art of organic chemistry. Generally speaking, the standard oligomerization cycle of the phosphoramidite method (by SL Beaucage and RP Iyer, Tetrahedron, 1993, 49, 6123; by SL Beaucage and RP Iyer, Tetrahedron, 1992, 48, 2223) is used. However, for example, H-phosphonate chemistry, phosphortriester chemistry can also be used.

In the case of some monomers of the present invention, longer coupling times and / or repeated coupling with new reagents and / or the use of more concentrated coupling reagents were used. The phosphoramidites used are coupled with sufficient> 95% sequential coupling yield. Thiolation of the phosphate is usually done by extending the oxidation used to synthesize phosphodiester oligomers by oxidation with, for example, iodine / pyridine / H ₂ O, Beaucage reagent (commercially available), etc. Of satisfactory reagents. The phosphorothioate LNA oligomer was efficiently synthesized using a sequential coupling method to yield> 98%.

  β-D-amino-LNA, β-D-thio-LNA oligonucleotides, α-L-LNA and β-D-methylamino-LNA oligonucleotides are also efficiently used with sequential coupling methods using phosphoramidite methods. Synthesis yielded over 98% yield.

Purification of LNA oligomeric compounds was performed using disposable reverse phase purification cartridges and / or reverse phase HPLC and / or precipitation from ethanol or butanol. The purity of the synthesized oligonucleotide was confirmed using capillary gel electrophoresis, reverse phase HPLC, MALDI-MS, and ESI-MS. In addition, a solid support material on which optionally protected nucleobases and optionally ^5′- OH protected LNA is immobilized is used as a material for the synthesis of LNA-containing oligomeric compounds containing LNA monomers at the 3 ^′ end. Especially interesting. In this case, the solid support material is preferably CPG, for example CPG material or polystyrene which is readily (commercially) available. Here, ^3′ -functionalized polystyrene, optionally protected nucleobase, and optionally ^5′- OH protected LNA are added to this using the conditions stated by the supplier for a substance. Connect to

(index)
TRX is involved in a number of basic biological mechanisms including, for example, red blood cell growth, cell growth, iron metabolism, glucose and energy metabolism, pH modification, matrix metabolism. The method of the present invention is used to treat or prevent diseases caused by cancer, particularly tissues (eg, lung cancer, breast cancer, colon cancer, prostate cancer, pancreatic cancer, liver cancer, brain cancer, testicular cancer, gastric cancer, intestinal cancer, intestinal fistula. Cancer, intestinal cancer, spinal cord cancer, sinus cancer, urinary tract cancer or ovarian cancer).

  The invention described herein includes a method for preventing or treating cancer, the method comprising a therapeutically effective amount of an oligomeric compound that modifies TRX (eg, high dose oligomers). Administration) to a human in need of such treatment. The invention further encompasses the use of short-term administration of TRX-modified oligomeric compounds. Normal non-cancerous cells divide at a frequency characteristic for the cell type. When cells are transformed to a cancerous state, uncontrolled cell growth and reduced cell death occur, and thus promiscuous cell division or cell proliferation is characteristic of cancerous cell types. Non-Hodgkin lymphoma, Hodgkin lymphoma, leukemia (eg, acute leukemia (eg, acute lymphocytic leukemia, acute myelocytic leukemia, chronic myelocytic leukemia, chronic lymphocytic leukemia, multiple myeloma) Colorectal cancer, rectal cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, renal cell cancer, liver cancer, gallbladder cancer, choriocarcinoma, cervical cancer, testicular cancer, lung cancer, bladder cancer, melanoma, head and neck cancer, brain Cancer, cancer of unknown primary site, cancer of peripheral nervous system, cancer of central nervous system, tumor (eg fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, angiosarcoma, endothelial sarcoma, lymphatic vessel Sarcoma, lymphangioendotheliosarcoma, synovial sarcoma, mesothelioma, Ewing tumor, leiomyosarcoma, rhabdomyosarcoma, squamous cell carcinoma, basal cell tumor, adenocarcinoma, sweat gland carcinoma, sebaceous carcinoma, papillary carcinoma, Papillary adenocarcinomas, Cystadenocarcinoma, medullary cancer, bronchogenic lung cancer, seminoma, fetal cancer, Wilms tumor, small cell lung cancer, epithelial sarcoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, Ependymoma, pineal tumor, hemangioblastoma, acoustic neuroma, oligodendroma, meningioma, neuroblastoma, and retinoblastoma), heavy chain disease, metastasis, or non This includes, but is not limited to, any disease or disorder characterized by controlled or abnormal cell growth.

(Pharmaceutical composition)
The invention also relates to a pharmaceutical composition, which comprises at least one antisense oligonucleotide composition of the invention as an active ingredient. The pharmaceutical composition of the present invention optionally comprises a pharmaceutical carrier, and the pharmaceutical composition optionally further comprises an antisense compound, a chemotherapeutic compound, an anti-inflammatory compound, an antiviral compound and / or an immunomodulatory compound. Should be understood.

(salt)
The oligomeric compounds encompassed by the present invention can be used in various pharmaceutically acceptable salts. As used herein, the term refers to salts that retain the desired biological activity of the compounds identified herein and that exhibit minimal undesirable toxicological effects. Non-limiting examples of such salts can be formed with organic amino acids, and base addition salts can be metal cations (eg, zinc, calcium, bismuth, barium, magnesium, aluminum, copper, cobalt, nickel, cadmium, sodium Or a salt formed with a cation or the like formed from ammonia, N, N-secondary benzylethylene-diamine, D-glucosamine, tetraethylammonium or ethylenediamine; or (c) of (a) and (b) Combination; for example, zinc tannate salt and the like.

(Prodrug)
One embodiment of the present invention may be an oligomeric compound in prodrug form. Oligonucleotides are also negatively charged ions. Due to the lipophilic nature of the cell membrane, the cellular uptake of the oligonucleotide is reduced compared to the natural or lipophilic equivalent. This polarity “disturbance” is achieved by using prodrug methods (see, for example, Crooke, RM (1998) in Crooke, ST Antisense research and Application. Springer-Verlag, Berlin, Germany, 131, 103-140). It can be avoided. In this method, the oligonucleotide is produced in a protective manner such that the oligo is neutral when administered. These protecting groups are designed so that they can be removed and then the oligo taken up by the cell. Examples of the protein group include S-acetylthioethyl (SATE) or S-pivaloylthioethyl (t-butyl-SATE). These protecting groups are nuclease resistant and are selectively removed intracellularly.

(Joint)
In one embodiment of the invention, the oligomeric compound is linked to a ligand / conjugate. As such, it is a way to increase cellular uptake of antisense oligonucleotides. This conjugation can occur at the terminal position 5 ^′ / ^3′- OH, but the ligand can also occur at sugars and / or bases. In particular, the growth factor to which the antisense oligonucleotide can be conjugated can include transferrin or folic acid. Transferrin-polylysine-oligonucleotide complexes or folate-polylysine-oligonucleoside complexes can be prepared for uptake by cells expressing high levels of transferrin or folate receptors. Other examples of conjugates / ligands include cholesterol molecules, dual intercalators (eg, acridine, poly-L-lysine, one or more nuclease resistant linking groups (eg, phosphoromonothioate, etc.) “ends”. -"Capping".

(Formulation)
The present invention also includes the formulation of one or more oligonucleotide compounds disclosed herein. Pharmaceutically acceptable binding agents and adjuvants can include the portion of the drug that is formulated. Capsules, tablets and pills may contain, for example, the following compounds: microcrystalline cellulose, gum or gelatin as binder; starch or lactose as excipient; stearic acid as lubricant; various Sweetener or fragrance. In the case of capsules, the dosage unit may comprise a liquid carrier-like fatty oil. Similar coatings of sugar or enteric drugs can be part of the dosage unit. The oligonucleotide formulations can also be active pharmaceutical ingredient emulsions and liquid-forming micelle emulsions.

  The oligonucleotides of the invention can be mixed with any substance that does not impair the desired action, or supplements that supplement the desired action. These may include other drugs that contain other nucleoside compounds.

  For parenteral, subcutaneous, intradermal or topical administration, the formulation may include a sterilizing diluent, a buffering agent, a toxic and antimicrobial modifier. The active compounds can be prepared with carriers that will prevent degradation or elimination of the immediate effect from the body, including implants or microcapsules with sustained release characteristics. For intravenous administration, preferred carriers are saline or phosphate buffered saline.

  The oligomeric compound is sufficient to deliver a therapeutically effective amount to the patient in a unit formulation (eg, a pharmaceutically acceptable carrier or diluent) without causing significant side effects in the patient being treated. It is preferable to include it in an appropriate amount.

(Administration)
The pharmaceutical compositions of the present invention can be administered in a number of ways depending on whether local or systemic treatment is desired and on the area to be treated. Administration includes (a) oral (b) lung (eg, by inhalation or gas infusion of powder or aerosol (including by nebulizer) or intratracheal, intranasal; (c) epithelial, transdermal, topical, including eye And mucosa (eg, including, for example, vaginal and rectal delivery); or (d) parenteral (eg, intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial (eg, (Intrathecal or intraventricular administration) In one embodiment, the active oligo is administered by intravenous, intraperitoneal, oral, topical or bolus injection, or administered directly to the target organ Is done.

  Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, sprays, suppositories, solutions and powders. Conventional pharmaceutical carriers, solutions, powders or oily bases, thickeners and the like may be necessary or desirable. Coated condoms, gloves and the like may also be useful. Preferred topical formulations mix the oligonucleotides of the invention with topical carriers (eg, lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents, and surfactants). Compositions and formulations for oral administration include, for example, powders or granules, microparticulates, nanoparticles, suspensions or solutions in aqueous or non-aqueous media, capsules, gel capsules, sachets , But not limited to, tablets or minitablets. Compositions and formulations for parenteral, intrathecal or intraventricular administration include sterile aqueous solutions which also contain buffering agents, diluents and other suitable additives (eg, osmotic agents). Including, but not limited to, enhancers, carrier compounds, and other pharmaceutically acceptable carriers or excipients.

(Transport)
Examples of the pharmaceutical composition of the present invention include, but are not limited to, liquids, emulsions, and liposome-containing preparations. These compositions can be obtained from a variety of components such as, but not limited to, preformed liquids, semi-emulsifying solids, and semi-emulsifying semi-solids. Drug delivery to tumor tissue is by carrier-mediated delivery (including but not limited to cationic liposomes, cyclodextrins, porphyrin derivatives, branched dendrimers, polyethyleneimine polymers, nanoparticles and microspheres). Can be increased (by Dass CR., J Pharm Pharmacol 2002; 54 (1): 3-27).

  The pharmaceutical formulations of the present invention can usually be provided in a single dosage form and can be manufactured according to conventional techniques well known in the pharmaceutical industry. The technique involves combining the active ingredient with a pharmaceutical carrier or excipient. Typically, the formulations are prepared by uniformly and intimately combining the active ingredient with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.

  The compositions of the present invention are formulated into any of a number of possible dosage forms, including but not limited to tablets, capsules, gel capsules, liquid syrups, soft gels and suppositories. can do. The compositions of the invention can also be formulated as suspensions in aqueous or non-aqueous or mixed media. Aqueous suspensions can further contain certain substances that increase the viscosity of the suspension, including, for example, sodium carboxymethylcellulose, sorbitol and / or dextran. The suspension may also contain stabilizers.

(Combination drug)
The oligonucleotides of the invention can also be conjugated to active drug substances (eg, aspirin, ibuprofen, sulfa drugs, antidiabetic drugs, antibacterial drugs or antibiotics).

  LNA-containing oligomeric compounds are useful for a number of therapeutic applications as indicated above. In general, the therapeutic methods of the invention comprise administering a therapeutically effective amount of an LNA-modified oligonucleotide to a mammal, particularly a human.

  In certain embodiments, the invention contains (a) one or more antisense compounds, and (b) one or more other chemotherapeutic agents that function by a non-antisense mechanism. A pharmaceutical composition is provided. When used in conjunction with a compound of the invention, the chemotherapeutic agent may be separately (eg, mitramycin and oligonucleotide), sequentially (eg, mitramycin and oligonucleotide for a period of time, followed by another drug and Oligonucleotide), or in combination with one or more other such chemotherapeutic agents or in combination with radiation therapy. All chemotherapeutic agents known to those skilled in the art are included as combination treatments with the compounds of the present invention.

  Anti-inflammatory drugs (eg, including but not limited to non-steroidal anti-inflammatory drugs), corticosteroids, antiviral drugs, and immunomodulators can also be combined with the compositions of the invention. Two or more combined compounds can be used together or sequentially.

  In another embodiment, the composition of the present invention comprises one or more antisense compounds, in particular an oligonucleotide targeting a first nucleic acid, and one or more other targeting a second nucleic acid molecule target. Antisense compounds can be included. Two or more combined compounds can be used together or sequentially.

(dose)
The dose depends on the severity and responsiveness of the disease state being treated and the duration of treatment (several days to months, or until healing is effective or reduction of the disease state is achieved). The optimal dosing schedule can be calculated from measurements of drug accumulation in the patient's body.

  The optimal dose may vary depending on the relative potency of the individual oligonucleotides. Usually, it can be estimated on the basis of the EC50 (which proves to be effective in in vitro and in vivo animal models). Usually the dose is 0.01 μg to 1 g per kg body weight and this is at least once daily, weekly, monthly or yearly, once every 2 to 10 years, or from several hours to several months by continuous infusion, Can be given. The rate of repeated administration can be estimated based on the residence time measured and the drug concentration in bodily fluids or tissues. After sufficient treatment, it may be desirable for the patient to receive maintenance therapy to prevent recurrence of the disease state.

(use)
The LNA-containing oligomeric compounds of the present invention can be used as research reagents for diagnosis, treatment and prevention. In research, the antisense oligonucleotide is used to specifically suppress the synthesis of the TRX gene in cells and laboratory animals, so that it serves as a target for target functional analysis or therapeutic intervention. The effectiveness can be easily evaluated. In diagnostics, antisense oligonucleotides can be used to detect and quantify TRX expression in cells and tissues by Northern blot, in situ hybridization or similar methods. For therapy, an animal or human that is expected to have a disease or disorder, which can be treated by altering the expression of TRX, is treated by administering an antisense compound according to the present invention. To do. In addition, mice, rats and humans who have or are expected to have a disease or illness related to TRX expression are treated therapeutically or prophylactically with one or more antisense compounds or compositions of the invention. Methods of treatment are provided by administering a pharmaceutically effective amount.

(Example)
(Example 1: Monomer synthesis)
The LNA monomer building blocks and derivatives thereof were prepared according to the methods known below and the publications cited therein. See below.
WO 03/095467 A1;
By DS Pedersen, C. Rosenbohm, T. Koch, (2002) Preparation of LNA Phosphoramidites, Synthesis 6, 802-808;
MD Sorensen, L. Kvaerno, T. Bryld, AE Hakansson, B. Verbeure, G. Gaubert, P. Herdewijn, J. Wengel, (2002) α-L-ribo-configured Locked Nucleic Acid (α-l-LNA ): Synthesis and Properties, J. Am. Chem. Soc., 124, 2164-2176;
SK Singh, R. Kumar, J. Wengel, (1998) Synthesis of Novel Bicyclo [2.2.1] Ribonucleosides: 2 ^' -Amino- and 2 ^' -Thio-LNA Monomeric Nucleosides, J. Org. Chem. 1998, 63 , 6078-6079;
C. Rosenbohm, SM Christensen, MD Sorensen, DS Pedersen, LE Larsen, J. Wengel, T. Koch, (2003) Synthesis of 2 ^' -amino-LNA: a new strategy, Org. Biomol. Chem. 1, 655 -663.

2 ^'- thio LNA ribonucleic thymidine phosphoramidite. Reagents and conditions: i) Pd / C, H ₂ , acetone, MeOH; ii) BzCl, pyridine, DMF; iii) 0.25 MH ₂ SO ₄ (aq), DMF, 80 ° C. ( 4 to 79%; 3 steps) Iv) Tf ₂ O, DMAP, CH ₂ Cl ₂ , 0 ° C .; v) Na ₂ S, DMF ( 7 to 72%, 2 steps); vi) NaOBz, DMF, 100 ° C. (81%); vii) _{NH 3, MeOH (76%)} ; viii) DMT-Cl, pyridine (88%); ix) P (OCH 2 CH 2 CN) (N (iPr) 2) 2, 4,5- dicyano imidazole, CH ₂ Cl ₂ (99%). DMT = 4,4 ^'- dimethoxytrityl, PN ₂ = 2-cyanoethoxy (diisopropylamino) phosphinoyl (Phosphinoyl).

1- (3-O-benzoyl-5-O-methanesulfonyl-4-C-methanesulfonyloxymethyl-β-D-threo-pentofuranosyl) thymine ( 7 , FIG. 4)
Anhydrous nucleoside 4 (C. Rosenbohm, SM Christensen, MD Sorensen, DS Pedersen, LE Larsen, J. Wengel, according to T. Koch, (2003) Synthesis of 2 '-amino-LNA:.. A new strategy, Org Biomol Chem 1, 655-663) (30.0 g, 58.1 mmol) was heated to 70 ° C. in a mixture of methanol (1000 cm ³ ) and acetone (1000 cm ³ ) to give a clear solution and the solution Was allowed to reach room temperature. The reaction flask was flushed with argon and Pd / C (10 wt%, Pd / C, 6.2 g, 5.8 mmol) was added. The mixture was stirred vigorously under an atmosphere of hydrogen gas (balloon). After 23 hours, the slurry was filtered through a pad of celite. The catalyst was recovered from celite and refluxed in DMF (1000 cm ³ ) for 1 hour. The hot DMF slurry was filtered through a pad of celite and the organic phases were combined and evaporated under vacuum to give nucleoside 5 as a yellow powder. Residual solvent was removed overnight using a high vacuum pump.

Crude nucleoside 5 (23 g) was heated to 70 ° C. in DMF (300 cm ³ ) to give a clear yellow solution that was cooled to room temperature. Benzoyl chloride (81.7g, 581mmol, 67.4cm ³⁾ was added followed by pyridine (70cm ^3). After 18 hours, the reaction was quenched with methanol (200 cm ³ ) and excess methanol was removed under vacuum. To a dark brown solution of nucleoside 6 was added H ₂ SO ₄ aqueous solution (0.25 M, 400 cm ³ ). The solution was heated to 80 ° C. on an oil bath (precipitation occurs at about 50 ° C. The solution becomes clear again at 80 ° C.). After 22 hours at 80 ° C., the solution was cooled to room temperature. The reaction mixture was transferred to a separatory funnel with ethyl acetate (1000 cm ³ ). The organic phase was washed with saturated aqueous NaHCO ₃ solution (2 × 1000 cm ³ ). The aqueous phases were combined and extracted with ethyl acetate (1000 + 500 cm ³ ). The organic phases were combined, washed with saturated aqueous NaHCO ₃ (1000 cm ³ ), dried (using Na ₂ SO ₄ ), filtered and evaporated under vacuum to give a yellow liquid. Residual solvent was removed overnight using a high vacuum pump to give a yellow syrup. The product was dried column vacuum chromatography (id 10 cm; 100 cm ³ fraction; 50-100% by volume EtOAc / n-heptane-10% increments; 2-24% by volume MeOH / EtOAc— Purified by 2% increments). Fractions containing the product were combined and evaporated under vacuum to give white foam nucleoside 7 (25.1 g, 79%).
R _f = 0.54 (5% by volume MeOH / EtOAc);
ESI-MS m / z measured 549.0 ([MH] ⁺ , calculated 549.1);
¹ H NMR (DMSO-d ₆ ) δ 11.39 (br s, 1H, NH), 8.10-8.08 (m, 2H, Ph), 7.74-7.70 (m, 1H, Ph), 7.60-7.56 (m, 2H, Ph), 7.51 (d, J = 1.1 Hz, 1H, H6), 6.35 (d, J = 4.9 Hz, 1H, H1 ^' ), 6.32 (d, J = 5.3 Hz, 1H, 2 ^' -OH), 5.61 (d, J = 4.0 Hz, 1H, H3 ^' ), 4.69 (d, J = 10.8 Hz, 1H), 4.59 (m, 1H, H2 ^' ), 4.55 (d, J = 10.8 Hz, 1H), 4.52 ( d, J = 10.8 Hz, 1H), 4.46 (d, J = 10.6 Hz, 1H) (H5 ^' and H1 ^'' ), 3.28 (s, 3H, Ms), 3.23 (s, 3H, Ms), 1.81 ( s, 3H, CH3);
¹³ C NMR (DMSO-d ₆ ) δ 164.5, 163.6 (C4, Ph C (O)), 150.3 (C2), 137.7 (C6), 133.8, 129.6, 128.7, 128.6 (Ph), 108.1 (C5), 84.8 (C1 ^' ), 81.1 (C4 ^' ), 78.0 (C3 ^' ), 73.2 (C2 ^' ), 68.0, 67.1 (C5 ^' , C1 ^'' ), 36.7, 36.6 (2 × Ms), 11.9 (CH ₃ );
Elemental analysis (C ₂₀ H calculated as _{24 N 2 O 12 S 2 ·} 0.33 H 2 O) (%); Calculated: C, 44.34; H, 4.65 ; N, 4.85. Found: C, 44.32; H, 4.58; N, 4.77.

(1R, 3R, 4R, 7R) -7-Benzyloxy-1-methanesulfonyloxymethyl-3- (thymin-1-yl) -2-oxa-5-thiabicyclo [2: 2: 1] heptane ( 9 )
1- (3-O-benzoyl-5-O-methanesulfonyl-4-C-methanesulfonyloxymethyl-β-D-threo-pentofuranosyl) thymine ( 7 ) (10.00 g, 18.23 mmol) was added to dichloromethane. Dissolved in (500 cm ³ ) and cooled to 0 ° C. Pyridine (15 cm ³ ) and DMAP (8.91 g, 72.9 mmol) were added followed by dropwise addition of trifluoromethanesulfonic anhydride (10.30 g, 36.5 mmol, 6.0 cm ³ ). After 1 hour, the reaction was quenched with saturated aqueous NaHCO ₃ (500 cm ³ ) and transferred to a separatory funnel. The organic phase was washed with 1.0 M hydrochloric acid (500 cm ³ ), saturated aqueous NaHCO ₃ (500 cm ³ ) and brine (500 cm ³ ). The organic phase was evaporated under vacuum with toluene (100 cm ³ ) to give 1- (3-O-benzoyl-5-O-methanesulfonyl-4-C-methanesulfonyloxymethyl-2-O as a yellow powder. -Trifluoromethanesulfonyl-β-threo-pentofuranosyl) thymine ( 8 ) was obtained.

The crude nucleoside 8 was dissolved in DMF (250 cm ³ ) and Na ₂ S (1.57 g, 20.1 mmol) was added to give a dark green slurry. After 3 hours, the reaction was quenched with aqueous NaHCO ₃ half-saturated (500 cm ^3), and extracted with dichloromethane ^{(500 + 2 × 250cm 3)} . The combined organic phases were washed with brine (500 cm ³ ), dried (using Na ₂ SO ₄ ), filtered and concentrated in vacuo to give a yellow liquid. Residual solvent was removed overnight using a high vacuum pump to give a yellow gum which was dried column vacuum chromatography (id 6 cm; 50 cm ³ fraction; 50-100 vol% EtOAc / n-heptane-10 Purification by%; increasing by 2-20% by volume of MeOH / EtOAc -2%) to give nucleoside 9 (6.15 g, 72%) as a yellow foam.
R _f = 0.27 (20% by volume n-heptane / EtOAc);
ESI-MS m / z measured value: 469.0 ([MH] ⁺ , calculated value: 469.1);
¹ H NMR (CDCl ₃ ) δ 8.70 (br s, 1H, NH), 8.01-7.99 (m, 2H, Ph), 7.67 (d, J = 1.1 Hz, 1H, H6), 7.65-7.61 (m, 1H , Ph), 7.50-7.46 (m, 2H, Ph), 5.98 (s, 1H, H1 ^' ), 5.34 (d, J = 2.4 Hz, 1H, H3 ^' ), 4.66 (d, J = 11.7 Hz, 1H , H5 ^' a), 4.53 (d, J = 11.5 Hz, 1H, H5 ^' b), 4.12 (m (overlapping with residual EtOAc), 1H, H2 ^' ), 3.15-3.13 (m, 4H, H1 ^'' a And Ms), 3.06 (d, J = 10.6 Hz, 1H, H1 ^'' b), 1.98 (d, J = 1.1 Hz, 3H, CH ₃ );
¹³ C NMR (CDCl ₃ ) δ 165.2, 163.5 (C4, Ph C (O)), 149.9 (C2), 134.1, 133.9, 129.8, 128.7, 128.3 (C6, Ph), 110.7 (C5), 91.1 (C1 ^' ), 86.8 (C4 ^' ), 72.6 (C3 ^' ), 65.8 (C5 ^' ), 50.5 (C2 ^' ), 37.9 (Ms), 35.1 (C1 ^'' ), 12.5 (CH ₃ );
Elemental analysis (C ₁₉ calculated as _{H 20 N 2 O 8 S 2} 0.3 · 3 EtOAc) (%); Calculated: C, 49.21; H, 4.72 ; N, 5.47. Found: C, 49.25; H, 4.64; N, 5.48.

(1R, 3R, 4R, 7R) -7-Benzoyloxy-1-benzoyloxymethyl-3- (thymin-1-yl) -2-oxa-5-thiabicyclo [2: 2: 1] heptane ( 10 )
Nucleoside 9 (1.92 g, 4.1 mmol) was dissolved in DMF (110 cm ³ ). Sodium benzoate (1.2 g, 8.2 mmol) was added and the mixture was heated to 100 ° C. for 24 hours. The reaction mixture was transferred to a separatory funnel with half-saturated brine (200 cm ³ ) and this was extracted with ethyl acetate (3 × 100 cm ³ ). The organic phases were combined, dried (using Na ₂ SO ₄ ), filtered and evaporated under vacuum to give a brown liquid. The product was placed under a high vacuum pump to remove residual solvent. The resulting brown gum was subjected to dry column vacuum chromatography (id 4 cm; 50 cm ³ fraction; 0-100 volume% EtOAc / n-heptane-10% increments; 2-10 volume% MeOH / EtOAc-2% To give a slightly yellow foam nucleoside 10 (1.64 g, 81%).
R _f = 0.57 (20% by volume n-heptane / EtOAc);
ESI-MS m / z measured value 495.1 ([MH] ⁺ , calculated value 495.1);
¹ H NMR (CDCl ₃ ) δ 9.02 (br s, 1H, NH), 8.07-7.99 (m, 4H, Ph), 7.62-7.58 (m, 2H, Ph), 7.47-7.42 (m, 5H, Ph and H6), 5.95 (s, 1H, H1 ^' ), 5.46 (d, J = 2.2 Hz, 1H, H3 ^' ), 4.93 (d, J = 12.8 Hz, 1H, H5 ^' a), 4.60 (d, J = 12.8 Hz, 1H, H5 ^' b), 4.17 (d, J = 2.2 Hz, 1H, H2 ^' ), 3.27 (d, J = 10.6 Hz, 1H, H1 ^'' a), 3.16 (d, J = 10.6 Hz , 1H, H1 ^'' b), 1.55 (d, J = 1.1 Hz, 3H, CH ₃ );
¹³ C NMR (CDCl ₃ ) δ 165.8, 165.1, 163.7 (C4, 2 × PhC (O)), 150.0 (C2), 133.9, 133.7, 133.6, 129.8, 129.6, 129.0, 128.8, 128.6, 128.5 (C6, 2 × Ph), 110.3 (C5) , 91.3 (C1 '), 87.5 (C4'), 72.9 (C3 '), 61.3 (C5'), 50.6 (C2 '), 35.6 (C1''), 12.3 (CH 3 );
Elemental analysis (C calculated as _{25 H 22 N 2 O 7 S} ) (%); Calculated: C, 60.72; H, 4.48 ; N, 5.66. Found: C, 60.34; H, 4.49; N, 5.35.

(1R, 3R, 4R, 7R) -7-hydroxy-1-hydroxymethyl-3- (thymin-1-yl) -2-oxa-5-thiabicyclo [2: 2: 1] heptane ( 11 )
Nucleoside 10 (1.50 g, 3.0 mmol) was dissolved in methanol (50 cm ³ ) saturated with ammonia. The reaction flask was sealed and it was stirred at ambient temperature for 20 hours. The reaction mixture was concentrated under vacuum to give a yellow gum which was purified by dry column vacuum chromatography (id 4 cm, 50 cm ³ fraction; increasing from 0 to 16 vol% MeOH / EtOAc by 1%). Transparent needle-like nucleoside 11 (0.65 g, 76%) was obtained.
R _f = 0.31 (10% by volume MeOH / EtOAc);
ESI-MS m / z measured value 287.1 ([MH] ⁺ , calculated value 287.1);
¹ H NMR (DMSO-d ₆ ) δ 11.32 (br s, 1H, NH), 7.96 (d, J = 1.1 Hz, 1H, H6), 5.95 (s, 1H, H6), 5.70 (d, J = 4.2 Hz, 1H, 3 ^' -OH), 5.62 (s, 1H, H1 ^' ), 4.49 (t, J = 5.3 Hz, 1H, 5 ^' -OH), 4.20 (dd, J = 4.1 and 2.1 Hz, 1H, H3 ^' ), 3.77-3.67 (m, 2H, H5 ^' ), 3.42 (d, J = 2.0 Hz, 1H, H2 ^' ), 2.83 (d, J = 10.1 Hz, 1H, H1 ^'' a), 2.64 ( d, J = 10.1 Hz, 1H, H1 ^'' b), 1.75 (d, J = 1.1 Hz, 3H, CH ₃ );
¹³ C NMR (DMSO-d ₆ ) δ 163.8 (C4), 150.0 (C2), 135.3 (C6), 107.5 (C5), 90.2, 89.6 (C1 ^' and C4 ^' ), 69.4 (C3 ^' ), 58.0 (C5 ^' ), 52.1 (C2 ^' ), 34.6 (C1 ^'' ), 12.4 (CH ₃ );
Elemental analysis (calculated as _{C 11 H 14 N 2 O 5} S) (%); Calculated: C, 46.15; H, 4.93 ; N, 9.78. Found: C, 46.35; H, 4.91; N, 9.54.

(1R, 3R, 4R, 7R) -1- (4,4′-dimethoxytrityloxymethyl) -7-hydroxy-5-methyl-3- (thymin-1-yl) -2-oxa-5-thiabicyclo [ 2: 2: 1] heptane ( 12 )
Nucleoside 11 (0.60 g, 2.1 mmol) was dissolved in pyridine (10 cm ³ ). 4,4 ^'- dimethoxytrityl chloride (0.88 g, 2.6 mmol) was added and stirred for 3 hours the reaction mixture at ambient temperature. The reaction mixture was transferred to a separatory funnel with water (100 cm ³ ) and this was extracted with ethyl acetate (100 + 2 × 50 cm ³ ). The organic phases were combined, washed with saturated aqueous NaHCO ₃ (100 cm ³ ), brine (100 cm ³ ) and evaporated to dryness in vacuo to give a viscous yellow liquid. The product was redissolved in toluene (50 cm ³ ) and concentrated under vacuum to give a yellow foam. The foam is dried overnight using a high vacuum pump and purified by dry column vacuum chromatography (id 4 cm; 50 cm ³ fraction; 10-100% by volume EtOAc / n-heptane-10% increments). As a result, white foam nucleoside 12 (1.08 g, 88%) was obtained.
R _f = 0.24 (20% by volume n-heptane / EtOAc);
ESI-MS m / z measured value 587.1 ([MH] ⁺ , calculated value 587.2);
¹ H NMR (CDCl ₃ ) δ 8.96 (br s, 1H, NH), 7.74 (d, J = 1.1 Hz, 1H, H6), 7.46-7.44 (m, 2H, Ph), 7.35-7.22 (m, 9H , Ph), 7.19-7.15 (m, 2H, Ph), 6.86-6.80 (m, 2H, Ph), 5.82 (s, 1H, H1 ^' ), 4.55 (dd, J = 9.3 and 2.1 Hz, 1H, H3 ^' ), 3.79 (s, 6H, OCH ₃ ), 3.71 (d, J = 2.0 Hz, 1H, H2 ^' ), 3.50 (s, 2H, H5 ^' ), 2.81 (d, J = 10.8 Hz, 1H, H1 ^'' a), 2.77 (d, J = 10.8 Hz, 1H, H1 ^'' b), 2.69 (d, J = 9.2 Hz, 1H, 3 ^' -OH), 1.42 (s, 3H, CH ₃ );
¹³ C NMR (CDCl ₃ ) δ 158.7 (C4), 150.1 (C2), 144.1, 135.2, 135.1, 130.1, 129.1, 128.1, 128.0, 127.1, 127.0, 113.3 (C6, 3 × Ph), 110.0 (C5), 90.2 ( C (Ph) ₃ ), 89.6 (C1 ^' ), 87.0 (C4 ^' ), 71.7 (C3 ^' ), 60.9 (C5 ^' ), 55.2 (C2 ^' ), 34.7 (C1 ^'' ), 12.2 (CH ₃ );
Elemental analysis (calculated as C ₃₂ H ₃₂ N ₂ O ₇ S · 0.5H ₂ O) (%); calculated value: C, 64.31; H, 5.57; N, 4.69. Found: C, 64.22; H, 5.67; N, 4.47.

(1R, 3R, 4R, 7R ) -7- (2- cyanoethoxy (diisopropylamino) Hosufinokishi) -1- (4,4 ^'- dimethoxytrityl oxy) -3- (thymine-1-yl) -2- Oxa-5-thiabicyclo [2.2.1] heptane ( 13 )
According to known methods (DS Pedersen, C. Rosenbohm, T. Koch, (2002) Preparation of LNA Phosphoramidites, Synthesis, 6, 802-808), nucleoside 12 (0.78 g, 1.33 mmol) was dissolved in dichloromethane (5 cm ³ ) And a 1.0 M solution of 4,5-dicyanoimidazole (0.93 cm ³ , 0.93 mmol) in acetonitrile is added followed by 2-cyanoethyl-N, N, N ^′ , N ^′ −. Tetraisopropyl phosphorodiamidite (0.44 cm ³ , 1.33 mmol) was added dropwise. After 2 hours, transferred to a separatory funnel with dichloromethane (40 cm ³⁾ The reaction solution and washed with aqueous NaHCO ₃ this one (2 × 25 cm ³⁾ and brine (25 cm ^3). The organic phase was dried (using Na ₂ SO ₄ ), filtered and evaporated under vacuum to give nucleoside 13 (1.04 g, 99%) as a white foam. R _f = 0.29 and 0.37-2 diastereomers (using 20% by volume n-heptane / EtOAc); ESI-MS m / z found 789.3 ([MH] ⁺ , calculated 789.3) ³¹ P NMR (DMSO-d ₆ ) δ 150.39, 150.26.

Example 2 Oligonucleotide Synthesis Oligonucleotides were synthesized at 1 or 15 μmol using the phosphoramidite method using Expedite 8900 / MOSS synthesizer (multiple oligonucleotide synthesis system). At the end of the synthesis (DMT-one), the oligonucleotide was cleaved from the solid support with aqueous ammonia for 1 hour at room temperature and further deprotected at 65 ° C. for 3 hours. The oligonucleotide was purified by reverse phase HPLC (RP-HPLC). After removal of the DMT-group, the oligonucleotide was confirmed by IE-HPLC or RP-HPLC. The identity of the oligonucleotide is confirmed by ESI-MS. See below for more details.

(Production of LNA succinyl hemiester)
^5′- O-Dmt- ^3′ -hydroxy-LNA monomer (500 mg), succinic anhydride (1.2 eq) and DMAP (1.2 eq) were dissolved in DCM (35 mL). The reaction was stirred at room temperature overnight. After extraction with NaH ₂ PO ₄ 0.1M pH 5.5 (2 ×) and brine (1 ×), the organic phase was further dried with anhydrous Na ₂ SO ₄ , filtered and evaporated. The hemiester derivative was obtained in 95% yield and was used without any further purification.

(Manufacture of LNA-carrier)
The hemiester derivative prepared above (90 μmol) was dissolved in a minimum amount of DMF, DIEA, and pyBOP (90 μmol) was added and mixed together for 1 minute. This pre-activated mixture was mixed with LCAA-CPG (500 Å, 80-120 mesh size, 300 mg) in a manual synthesizer and stirred. After 1.5 hours at room temperature, the support was filtered off and washed with DMF, DCM and MeOH. After drying, the load was measured to be 57 μmol / g (“Tom Brown, Dorcas JS Brown,“ Modern machine-aided methods of oligodeoxyribonucleotide synthesis ”, edited by F. Eckstein, Oligonucletide and Analogues A Practical Approach. Oxford : IRL Press, 1991: 13-14).

(Extension of oligonucleotide)
Phosphoramidite (A (bz), G ( ibu), 5- methyl -C (bz) or T-beta-cyanoethyl - phosphoramidite) coupling reaction is, 0 of 5 ^'-O-DMT- protected amidite in acetonitrile. Performed with 1M solution and DCI (4,5-dicyanoimidazole) solution in acetonitrile (0.25M) as activator. The thiolation is performed by using xanthan chloride (0.01M acetonitrile: pyridine 10%). The remainder of the reagent is what is typically used for oligonucleotide synthesis.
Purification by RP-HPLC:
Column: XTerra, RP18, 5 μm, 7.8 × 50 mm column.
Eluent: Eluent A: 0.1M NH ₄ OAc, pH: 10.
Eluent B: acetonitrile.
Flow rate: 5 mL / min.

(Analysis by IE-HPLC)
Column: Dionex, DNAPac PA-100, 2 × 250 mm column.
Eluent: Eluent A: 20 mM Tris-HCl, pH 7.6; 1 mM EDTA: 10 mM NaClO ₄ .
Eluent B: 20 mM Tris-HCl, pH 7.6; 1 mM EDTA; 1 M NaClO ₄ .
Flow rate: 0.25 mL / min.

Abbreviations DMT: Dimethoxytrityl;
DCI: 4,5-dicyanoimidazole;
DMAP: 4-dimethylaminopyridine;
DCM: dichloromethane;
DMF: dimethylformamide;
THF: tetrahydrofuran;
DIEA: N, N-diisopropylethylamine;
PyBOP: benzotriazol-1-yl-oxy-tris-pyrrolidino-phosphonium hexafluorophosphate;
Bz: benzoyl;
Ibu: isobutyryl.

(Example 3: Design test of oligomer compound)
Our interest was to evaluate the antisense activity of oligonucleotides with different designs to prove the importance of choosing the best design for oligonucleotides targeting TRX. To this end, we can screen a number of different oligonucleotide designs by measuring the activity of firefly (Photinus pyralis) luciferase after downward modification with antisense oligonucleotides. An assay was set up. FIG. 1 includes illustrations of the designs described herein.

In the first screen, a design containing β-D-oxy-LNA, which targets all the same motifs in the mRNA, was evaluated. Designs composed of gapmers with different gap sizes, different loads of phosphorodioate internucleoside linkages, and different loads of LNA were tested. Headmers and tailmers with different loads of β-D-oxy-LNA, different loads of phosphorothioate internucleoside linkages, and different loads of DNA were produced. Mixmers of various compositions (which means having β-D-oxy-LNA, α-L-LNA and another number of units of DNA) were also analyzed in in vitro assays. . In addition, different designs of LNA derivatives were also included and their antisense activity was evaluated. The importance of good design is influenced by the data that can be obtained in the luciferase assay. The luciferase expression level was measured in% and this gives an indication of the different designs of antisense activity containing β-D-oxy-LNA and LNA derivatives. We can easily see that some designs are powerful antisense oligonucleotides, while others show moderate to low down-modification levels. Thus, the close correlation between good antisense activity and optimally designed oligonucleotides is very obvious. We have observed a good level of downward modification using various designs. Gapmers with 7-10 nt DNA and thiolation across the backbone or with a gap in the flank and an exclusive thiolation at PO showed good results. These designs include β-D-oxy-LNA or LNA derivatives. The 6nt and 8nt β-D-oxy-LNA headmers also showed good levels of down-modification when phosphorothioate internucleoside linkages were present throughout the entire backbone or only in the DNA-segment. Different mixmers showed good antisense activity in the luciferase assay. Each α-L-oxy-LNA, β-D-oxy-LNA or another number of units of DNA composition defines a mixmer (see FIG. 1). Mixmer 3-9-3-1, which has a deoxynucleoside residue at the 3 ^′ end, showed a significant level of down-modification. In the case of mixmer 4-1-1-1-5-1-3, we have two α-L-oxy-LNA residues (which are frank β-D-oxy-LNA) that interrupt the gap. Placed. Moreover, we interrupted the gap with two α-L-oxy-LNA residues and replaced both flanks with α-L-oxy-LNA. Both designs showed a significant level of downward modification. The presence of α-L-oxy-LNA creates a flexible transition between north-lock flank (oxy-LNA) and α-L-oxy-LNA residues by spiking into deoxynucleotide residues. Can be introduced. It is also of interest to study the design 4-3-1-3-5 where α-L-oxy-LNA residues interrupt the DNA stretch. In addition to α-L-oxy-LNA in the gap, we also replaced two oxy-LNA residues at the end of the flank with two α-L-oxy-LNA residues. The presence of only one β-D-oxy-LNA residue that interrupts the stretch of DNA in the gap (design 4-3-1-3-5) results in a dramatic reduction in downward modification. By simply using α-L-oxy-LNA instead, the design shows a significant downward modification at an oligonucleotide concentration of 50 nM. Installation of α-L-oxy-LNA in the junction and one α-L-oxy-LNA in the middle of the gap also showed downward modification.

α-L-oxy-LNA has been shown to be a powerful tool allowing the construction of different mixmers, which can exhibit a high level of antisense activity. Other mixmers (eg, 4-1-5-1-5 and 3-3-3-3-3-1) can also be shown. We can readily see that some designs are powerful antisense oligonucleotides, while others show moderate to low down-modification levels. Thus, again, the close correlation between good antisense activity and optimal design of oligonucleotides is very obvious. Another preferred design is (1-3-8-3-1), where the DNA residues are located in flank with 3-β-D-oxy-LNA monomer on each side of the gap. A more preferred design is (4-9-3-1), having 9 gaps with D-oxy-LNA flank and DNA at the 3 ^' end.

(Example 4: In vitro model: cell culture)
The effect of an antisense compound on a target nucleic acid can be tested in any of a variety of cell types, provided that the target nucleic acid is present at a measurable level. The target can be expressed endogenously or by transient or stable transfection of a nucleic acid encoding the nucleic acid. The expression level of the target nucleic acid can be routinely measured using, for example, Northern blot analysis, real-time PCR, ribonuclease protection assay. The following cell types are presented for illustrative purposes, but other cell types can be routinely used provided that the target is expressed in the chosen cell type.

Cells were cultured in appropriate media as described below and maintained at 37 ° C. with 95-98% humidity and 5% CO ₂ . Cells were routinely passaged 2-3 times a week.

15PC3: Human prostate cancer cell line 15PC3 was kindly donated by Dr. F. Baas, Neurozintuigen Laboratory, AMC, The Netherlands, and this was DMEM (Sigma) + 10% fetal bovine serum (FBS) + glutamax ( Glutamax) I + gentamicin.
A549: Human non-small cell lung cancer cell line A549 was purchased from ATCC, Manassas and was cultured in DMEM (Sigma) + 10% FBS + glutamax I + gentamicin.
MDF7: Human breast cancer cell line MCF7 was purchased from ATCC and was cultured in Eagle MEM (Sigma) + 10% FBS + Glutamax I + Gentamicin.
SW480: Human colorectal cancer cell line SW480 was purchased from ATCC and cultured in L-15 Leibovitz (Sigma) + 10% FBS + Glutamax I + gentamicin.
SW620: Human colon cancer cell line SW620 was purchased from ATCC and cultured in L-15 Leibovitz (Sigma) + 10% FBS + Glutamax I + gentamicin.
HT29: Human prostate cancer cell line HT29 was purchased from ATCC and was cultured in McCoy's 5a MM (Sigma) + 10% FBS + Glutamax I + gentamicin.
NCI H23: Human non-cell lung cancer cell line was purchased from ATCC and cultured in RPMI 1640 with glutamax I (Gibco) + 10% FBS + HEPES + gentamicin.
HCT-116: Human colorectal cancer cell line HCT-116 was purchased from ATCC and was cultured in McCoy's 5a MM + 10% FBS + glutamax I + gentamicin.
MDA-MB-231: The human breast cancer cell line MDA-MB-231 was purchased from ATCC and was cultured in L-15 Leibovitz + 10% FBS + glutamax I + gentamicin.
MDA-MB-435s: The human breast cancer cell line MDA-MB-435s was purchased from ATCC and was cultured in L-15 Leibovitz + 10% FBS + Glutamax I + gentamicin.
DMS273: Human small cell lung cancer cell line DMS273 was purchased from ATCC and was cultured in Waymouth with glutamine (Gibco) + 10% FBS + gentamicin.
PC3: Human prostate cancer cell line PC3 was purchased from ATCC and cultured in F12 Coon's with glutamine (Gibco) + 10% FBS + gentamicin.
U373: Human glioblastoma astrocytoma cell line U373 was purchased from ECACC and was cultured in EMEM + 10% FBS + glutamax + NEAA + sodium pyrovate + gentamicin.

HUVEC: Human umbilical vein endothelial cells were purchased from ATCC.
HUVEC-C human umbilical vein endothelial cells were purchased from ATCC and were grown according to the manufacturer's instructions.
HMVEC-d (DMVEC dermal human microvascular endothelial cells) was purchased from Clonetics and cultured as described by the manufacturer.
HMVEC human microvascular endothelial cells were purchased from Clonetics and cultured as described by the manufacturer.
Human fetal lung fibroblasts were purchased from ATCC and cultured as described by the manufacturer.
HMEC-1 human mammary epithelial cells were purchased from Clonetics and kept as recommended by the commercial owner.

(Example 5: In vitro model: treatment with antisense oligonucleotide)
The cells were treated with oligonucleotides using the cationic liposome formulation LipofectAMINE 2000 (Gibco) as the transfection vehicle. Cells were seeded in 12-well cell culture plates (NUNC) and treated at 80-90% confluence. The oligo concentration used should be in the final concentration range of 125 nM to 0.2 nM. The formulation of the oligo-lipid complex is essentially as described in Dean et al. (Journal of Biological Chemistry 1994, 269, 16416-16424). This was carried out using 10 μg / mL LipofectAMINE 2000 in a total volume of 500 μL. Cells were incubated for 4 hours at 37 ° C. and treatment was terminated by removal of oligo-containing medium. Cells were washed and serum-containing medium was added. After oligo treatment, cells were harvested for 18 hours (except where noted in the figure legend), after which they were collected for RNA or protein analysis.

Example 6: In vitro model: Extraction of RNA and cDNA synthesis
(Total RNA isolation)
Total RNA was isolated using either the RNeasy mini kit (Qiagen catalog number 74104) or the Trizol reagent (Life technologies catalog number 15596). For RNA isolation from cell lines, RNeasy is the preferred method, and for tissue samples, trizole is the preferred method. Total RNA was isolated from the cell line using a Qiagen RNA OPF Robot-BIO Robot 3000 according to the protocol presented by the manufacturer. Tissue samples were homogenized using an Ultra Turrax T8 homogenizer (IKA Analysen technik) and total RNA was isolated using the Trizol reagent protocol presented by the manufacturer.

(Single strand production)
Single strand synthesis was performed using an OmniScript reverse transcriptase kit (Catalog No. 205113, Qiagen) according to the manufacturer's instructions. For 0.5 μg of each sample, total RNA was modified to 12 μL each using RNase-free H ₂ O and 2 μL poly (dT) _12-18 (2.5 μg / mL) (Life Technologies, GibcoBRL , Roskilde, DK), 2 μL dNTP mix (5 mM each dNTP), 2 μL 10 × buffer RT, 1 μL RNAguard® Rnase INHIBITOR (33.3 U / mL) (Catalog No. 27-0816-01, Amersham Pharmacia Biotech, Horsholm, DK) and 1 μL OmniScript reverse transcriptase (4 U / μL), followed by incubation at 37 ° C. for 60 minutes, and thermal inactivation of the enzyme at 93 ° C. for 5 minutes. It was.

(Example 7: In vitro model: Analysis of oligonucleotide suppression of TRX expression by real-time PCR)
Antisense modification of TRX expression can be assayed in various ways known in the art. For example, TRX mRNA levels can be quantified by, for example, Northern blot analysis, competitive polymerase chain reaction (PCR) or real-time PCR. Real-time quantitative PCR is currently preferred. RNA analysis can be performed using total cellular RNA or mRNA.

  Methods of RNA isolation and RNA analysis (eg, Northern blot analysis) are routine in the art and are taught, for example, in Current Protocols in Molecular Biology, John Wiley and Sons.

  Real-time quantification (PCR) can be easily accomplished using a commercial iQ Multi-Color real-time PCR detection system (available from BioRAD).

(Real-time quantitative PCR analysis of TRX mRNA levels)
Quantification of mRNA levels was measured by real-time quantitative PCR using an iQ multi-color real-time PCR detection system (BioRAD) according to the manufacturer's instructions. Real-time quantitative PCR is a well-known method in the art and is taught, for example, by Heid et al., Real time quantitative PCR, Genome Research (1996), 6: 986-994. .

  Platinum quantitative PCR SuperMix UDG 2 × PCR master mix was obtained from Invitrogen catalog number 11730. Primers and TaqMan® probes were obtained from MWG-Biotech AG, Ebersberg (Germany).

  Probes and primers for human TRX are designed to hybridize to human TRX sequences using known sequence information (Jane Bank deposit number NM 003329, which forms part of this specification as SEQ ID NO: 1). did.

In the case of human TRX, PCR primers are as follows. forward primer: 5 ^′ aagcctttctttcattccctctc 3 ^′ (final concentration in assay: 0.3 μM reverse primer: 5 ^′ cttcttaaaaaactggaatgttggc 3 ^′ (final concentration in assay: 0.3 μM) (SEQ ID NO: 81) and PCR probe is 5 ^′ FAM -gatgtggatgactgtcaggatgttgcttc-TAMRA 3 ^' (final concentration in the assay: 0.1 μM).

  Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA quantification was used as an endogenous control to normalize any variance in sample preparation.

  The sample content of human GAPDH mRNA was quantified using human GAPDH ABI Prism Pre-Developed TaqMan assay reagent (Applied Biosystems catalog number 4310884E) according to the manufacturer's instructions.

For quantification of mouse GAPDH mRNA, the following primers and probes were designed. Sense primer 5 ^' aaggctgtgggcaaggtcatc 3 ^' (final concentration: 0.3 μM), antisense primer 5 ^' gtcagatccacgacggacacatt (final concentration: 0.6 μM), TaqMan probe 5 ^' FAM-gaagctcactggcatggcatggccttccgtgtt c-TAMRA 3 ^' (final concentration: 0.2 μM).

(Real-time PCR)
CDNA from single-stranded synthesis performed as described in Example 8 was diluted 2-20 fold and analyzed by real-time quantitative PCR. The primers and probe were mixed with 2 × Platinum Quantitative SuperMix UDG (Cat. No. 11730, Invitrogen) and added to 3.3 μL cDNA to a final volume of 25 μL. . Each sample was analyzed in triplicate. Two-fold dilutions of cDNA (prepared for material purified from a cell line expressing the RNA of interest) gave a standard curve for the assay. Sterile H ₂ O was used instead of cDNA for non-template control. PCR program: 50 ° C. for 2 minutes, 95 ° C. for 10 minutes; followed by 40 cycles of 95 ° C. for 15 seconds and 60 ° C. for 1 minute. The relative amount of target mRNA sequence was measured from the calculated threshold cycle using iCycler iQ real-time detection system software.

(Example 8: In vitro analysis: Northern blot analysis of TRX mRNA level)
Northern blot analysis was performed by methods well known in the art, essentially as described in Current Protocols in Molecular Biology, John Wiley & Sons. The hybridizing probe was obtained by PCR amplification of a TRX bp fragment derived from TRX cDNA obtained by reverse transcriptase PCR as described in Example 8. The reaction was carried out with primers 5 ^' ggatccatttccatcggtcc 3 ^' (forward) and 5 ^' gcagatggcaactggttatgtct 3 ^' (reverse), 200 nM each dNTP, 1,5 mM MgCl ₂ and Platinum Taq DNA polymerase (in vitro) at a final concentration of 0.5 μM each. Gen catalog number 10966-018). The DNA was amplified on a Perkin Elmer 9700 thermocycler for 40 cycles using the following program. 94 ° C. for 2 minutes; then 94 cycles at 40 ° C. for 30 seconds and 72 ° C. for 30 seconds (0.5 ° C. drop per cycle), followed by 72 ° C. for 7 minutes.

  Amplified PCR products were purified using S-400 MicroSpin columns (Amersham Pharmacia Biotech catalog number 27-5140-01) according to the manufacturer's instructions and quantified spectrophotometrically.

The hybridized probe was prepared using Redivue® [α- ³² P] dCTP 3000 Ci / mmol (Amersham Pharmacia Biotech catalog number AA 0005) and Prime-It RmT labeling kit (Stratagene catalog number 300392). And labeled according to the manufacturer's instructions, and the radiolabeled probe was purified using an S-300 MicroSpin column (Amersham Pharmacia Biotech catalog number 27-5130-01). Prior to use, the probe was denatured at 96 ° C. and immediately placed on ice.

  Samples of total RNA (1-5 μg) purified as described in Example 7 were denatured and size separated using a 2.2 M formaldehyde / MOPS agarose gel. The RNA is transferred to a positively charged nylon membrane by a downward capillary transfer using a TurboBlotter (Schleicher & Schuell), and the RNA is transferred to the membrane by UV crosslinking using a Stratagene crosslinker. Immobilized. The membrane was prehybridized in ExpressHyb hybridization solution (Clontech catalog number 8015-1) at 60 ° C. and the probe was subsequently added for hybridization. Hybridization is performed at 60 ° C., and the blot is run at room temperature with low stringency wash buffer (2 × SSC, 0.1% SDS) and high stringency wash buffer (0.1%). X SSC, 0.1% SDS). The blot was exposed to a Kodak storage phosphor screen, which was scanned in a BioRAD FX molecular imager. TRX mRNA levels were quantified with Quality One software (BioRAD).

Equal amounts of RNA sample load were stripped of the blot in 0.5% SDS / H ₂ O at 85 ° C. and labeled GAPDH (glyceraldehyde-3-phosphate dehydrogenase) probe essentially as described above. And 5 ^′ aac gga ttt ggt cgt att 3 ^′ (foroward) and 5 ^′ taa gca gtt ggt ggt gca 3 ^′ (reverse).

Figures 2 and 3 show TRX suppression normalized to GAPDH. Intensity was followed using a phosphoimager Biorad, FX-scanner (see Table 1). The test oligomeric compound is provided in Example 10.

Example 9: In vitro assay: Western blot analysis of TRX protein levels
TRX protein levels can be determined by various methods well known in the art (eg, immunoprecipitation, Western blot analysis (immunoblot), ELISA, RIA (radioimmunoassay), or fluorescence activated cell sorter (FACS). ) Can be quantified. Antibodies against TRX can be identified and obtained from various sources (eg, Upstate Biotechnologies (Lake Placid, USA), Novus Biologicals (Littleton, Colorado), Santa Cruz Biotechnology (Santa Cruz, California)). Alternatively, it can be produced by an ordinary antibody production method.

(Western blot)
To measure the effect of treatment with antisense oligonucleotides on TRX, TRX protein levels in treated and untreated cells were measured using Western blots. After treatment with the oligonucleotides described in Example 5, the cells were washed with ice-cold lysis buffer (50 mM Tris, pH 6.8, 10 mM NaF, 10% glycerol, 2.5% SDS, 0.1 mM orthovanadate (orthovanadate ) Sodium, 10 mM β-glycerol phosphate, 10 mM dithiothreitol (DTT), Complete protein inhibitor cocktail (Boehringer Mannheim)). The solution was stored at −80 ° C. until further use.

  The protein concentration of the protein lysate was measured using a BCA protein assay kit (Pierce) as described by the manufacturer.

(SDS gel electrophoresis)
Protein samples prepared as above were thawed on ice and denatured at 96 ° C. for 3 minutes. The sample was loaded onto a 1.0 mm 4-20% NuPage Tris-Glycine gel (Introgen) and the gel was loaded into TGS running buffer (BioRAD) in an Xcell II minicell electrophoresis module (Invitrogen). Operation).

(Semi-drive lotting)
After electrophoresis, the separated proteins were transferred to polyvinylidi difluoride (PVDF) by semi-driving. The blot method was performed in a semi-dry transfer cell (CBS Scientific Co.) according to the manufacturer's instructions. Membranes were stained with amidoblack to visualize migrated proteins and stored at 4 ° C. until further use.

(Immune detection)
To detect the desired protein, the membrane was incubated with either polyclonal or monoclonal antibodies against the protein.
The membrane was blocked in blocking buffer (5% non-fat milk powder dissolved in PBST-buffer (PBS + 150 mM NaCl, 10 mM Tris base, pH 7.4, 0.1% Tween-20)) Washed briefly in buffer and incubated with primary antibody in block buffer at room temperature. The following primary and secondary antibodies and concentrations / dilutions were used.
Monoclonal mouse anti-human thioredoxin antibody clone 2G11 (Cat. No. 559969, Pharmingen) 1: 500;
Monoclonal mouse anti-human tubulin Ab-4 (Cat. No. MS-719-P1, NeoMarkers);
Peroxidase-conjugated goat anti-mouse immunoglobulin (code number P0447, DAKO) 1: 1000.

After incubation with primary antibody, the membrane was briefly washed in PBS and incubated with peroxidase-conjugated secondary antibody at room temperature. The membrane was then washed in PBS followed by three additional 10 minute washes in PBST with stirring at room temperature. After the last wash, the membrane was incubated with ECL ⁺ plus reagent (Amersham) and chemiluminescence was analyzed using VersaDoc chemiluminescence detection system (BioRAD) or X-omat film (Kodak) Detected. The membrane was stripped in ddH ₂ O by incubating at 96 ° C. for 1 minute. After stripping, the membrane was placed in PBS and stored at 4 ° C. (see FIGS. 6 and 7; see Example 10 for compound).

(Example 10: In vitro analysis: antisense suppression of human TRX expression by oligomeric compounds)
In accordance with the present invention, a group of oligonucleotides is linked to a known sequence (Jane Bank Deposit No. BD132005, which forms part of SEQ ID NO: 1); NM 003329 (SEQ ID NO: 2 herein). D28376 (which constitutes part of this specification as SEQ ID NO: 3); AF 548001 (which constitutes part of this specification as SEQ ID NO: 4)) Were designed to target different regions (see FIG. 5). Oligonucleotides that are 16 nucleotides in length are shown in Table 2 with CUR numbers and SEQ ID NOs. “Target site” indicates the number of first nucleotides on a particular target sequence to which the oligonucleotide is bound. Table 3 shows the IC ₅₀ for the four compounds.

Table 2: Oligomeric compounds of the invention Oligomeric compounds were evaluated for their ability to knock down TRX mRNA in 15PC3 cells. The data is presented as a percentage of down regulation relative to mock transfected cells. Transcript steady state was followed by real-time PCR and normalized to GAPDH transcription steady state. Note that total LNA C is ^5' -methyl-cytosine.

Table 3: IC ₅₀ (nM) in two cell lines of different origin
Oligomeric compounds were evaluated for their ability to knock down TRX mRNA in 15PC3 cells. Transcription steady state was followed by real-time PCR and normalized to GAPDH transcription steady state. Note that total LNA C is ^5' -methyl-cytosine.

  As shown in Tables 2 and 3, SEQ ID NOs: 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17 and 18 show at least 30% suppression of survivin expression at 25 nM, These are therefore preferred.

Compounds of particular interest are 8A, 9A, 10A and 14A which showed low IC ₅₀ .

  The specificity of LNA oligomeric compounds targeting TRX was also tested. 15PC3 cells were transfected with LNA oligos targeting either human survivin (4LNA / PS + 8PS + 4LNA / PS) (referred to as LNA survivin) or human thioredoxin (CUR2766) at 5 nM and 25 nM (see FIG. 8) .

(Example 11: Induction of apoptosis by LNA antisense oligomer compound targeting TRX)
BD measurement cell apoptosis using ^(R) cytometric bead array (cytometric bead array) (CBA) (Cat. No. 557816), (see Example 5) as described above, it was transfected with Ripofetamin 2000. Twenty-four hours after transfection, cells from the supernatant were spun down and adherent cells were trypsinized and spun down. The cell pellet was resuspended / washed in PBS and counted to give a cell concentration of 2 × 10 ⁶ cells / mL of lysis buffer containing protease inhibitors. The method proceeded with the following modifications as described by the manufacturer. After lysing the cells, they were lysed for 40 minutes and swirled at 10 minute intervals. 1 × 10 ⁵ cells were incubated with caspase 3 beads, mixed briefly, and incubated for 1 hour at room temperature, after which they were analyzed by flow cytometry. The data were analyzed using the BD ^(TM) CBA software, Excel (where all data (set to one) for false) were transferred to (see Figure 9).

Example 12: Antisense oligonucleotide inhibition of TRX in proliferating cancer cells
Cells were seeded to a density of 12000 cells per well in white 96-well plates (Nunc 136101) in DMEM the day before transfection. The next day, the cells were washed once in pre-warmed OptiMEM, followed by the addition of 72 μL OptiMEM containing 5 μg / mL Lipofectamine 2000 (Invitrogen). The cells were incubated for 7 minutes, after which 18 μL of oligonucleotide diluted in OptiMEM was added. Final oligonucleotide concentrations ranged from 5 nM to 100 nM. Four hours after treatment, cells were washed in OptiMEM and 100 μL of serum containing DMEM was added. Following oligo treatment, cells were harvested for a suggested period and viable cells were collected in 20 μL of tetrazolium compound [3- (4,5-dimethyl-2-yl) -5- (3-carboxymethoxyphenyl) -2- (4-sulfophenyl) -2H- tetrazolium, inner salt; MTS] and an electron coupling reagent (phenazine ethosulfate; PES) (CellTiter 96 _{^{(TM) AQ ueous One Solution Cell Proliferation Assay}} , Promega Corporation) adding Measured by. Viable cells were measured at 490 nm in Powerwave (Biotek Instruments). Growth rate (ΔOD / hour) was plotted against oligo concentration.

Example 13: Measurement of cell ploidy (cell cycle) and DNA degradation (apoptosis) after treatment with an oligomeric compound targeting TRX
The late stage in the apoptotic cascade yields a large number of small DNA fragments that can be analyzed by propidium iodide staining of the cells and further evaluated for fold relationships in treated cells using propidium iodide staining. can do. To evaluate the fold relationship / apoptosis of cells treated with oligomeric compounds against TRX, cells were washed in PBA and fixed in 70% EtOH at 4 ° C. for 1 hour. After treatment with 50 μg / mL RNAse (Sigma) at room temperature for 20 minutes, the cells were washed with PBS and 30 minutes with 40 μg / mL propidium iodide (Sigma or BD). Incubated. All samples were analyzed using a fluorescence activated cell sorter (FACSCalibur, Becton Dickinson) and Cell Quest software. In the DNA histogram, hypodiploid or sub-G1 peaks are shown for apoptotic cells.

Example 14: Measurement of changes in cellular mitochondrial membrane potential after treatment with oligomeric compounds targeting TRX
To measure changes in the mitochondrial membrane potential was used Mito sensor (MitoSensor) ^{(registered trademark)} reagent method (Becton Dickinson Co., Cat. No. K2017-1). It melted by Mito sensor ^(TM) reagent healthy cells, this compound forms aggregates that emit red fluorescence. After apoptosis, the mitochondrial membrane potential changes and this causes the reagent to aggregate within the mitochondria and thus remain in monomeric form in the cytoplasm and emit green fluorescence. Cells treated with oligomeric compounds for TRX were washed and incubated in mitosensor reagent diluted in incubation buffer as described by the manufacturer. Changes in membrane potential after oligo treatment were detected by use of a fluorescence activated cell sorter (FACSCalibur, Becton Dickinson) and CellQuest software.

(Example 15: Inhibition of capillary formation of endothelial cells after antisense oligo treatment)
Endothelial monolayer cells (eg HUVEC) were incubated with an antisense oligo against survivin. Tube formation was analyzed by either of the following two methods. The first method is the BD Biocoat angiogeneis tube formation system. Cells were transfected with oligos as described above (Example 5). Transfected cells were seeded at 2 × 10 ⁴ cells / 96 wells on Matrigel polymerized BD biocoated angiogenic plates. The plates were incubated for the indicated times / days with or without PMA (5-50 nM), VEGF (20-200 ng / mL), suramin or vehicle. The plates were stained with Cacein AM and imaged as described by the manufacturer. The length of all tubes was measured using MetaMorph.

Alternatively, cells are seeded in rat tail type I collagen (3 mg / mL, Becton Dickinson) in 0.1 volume of 10 × DMEM, neutralized with sterile 1M NaOH, and this Was kept on ice or Matrigel. Cells were added to the collagen suspension at a final concentration of 1 × 10 ⁶ cells / mL of collagen. The cell-collagen mixture was added to a 6-well or 35 mm plate and placed in a humidified incubator at 37 ° C. Gelling medium (3 mL) + extra 10% FBS was added and the cells were allowed to form capillar-like blood vessels during the suggested period with or without PMA (16 nM), VEGF (50 ng / ml). Tube formation was quantified after cryostat sectioning of the gel, and sections were examined by phase contrast microscopy.

Example 16: Measurement of in vitro cytotoxicity after treatment with an oligomeric compound targeting TrX
Cells were seeded (0.3-1.2 × 10 ⁴ ) and treated with antisense oligos as described above (eg, the MTS assay of Example 12). At the suggested times, media from antisense-treated cells (20-50 μL) was transferred to a 96-well plate and LDH release into the media was measured. An equal amount of LDH substrate was added as described by the manufacturer. Released LDH is measured using a 30 minute coupled enzymatic assay, which results in the conversion of tetrazolium salt (INT) to a red formazan product. The amount of color produced is proportional to the number of lysed cells. Visible wavelength absorption data (measured at 490 nm) were collected using a standard 96 well plate reader (Powerwave, Bio-Tek Instruments). Similarly, positive control cells were treated with 0.9% Triton X-100 (= 100% lysis) for about 45 minutes. Cytotoxicity was plotted against mock and Triton-x100 treated cells (100% lysis = 100% cytotoxicity).

Example 17: In vivo model; Inhibition of tumor growth of human tumor cells grown in vivo by systemic treatment with antisense oligonucleotides
Six week old female NMRI athymic nude mice were purchased from M & B (Denmark) and acclimated for at least one week prior to entering experiments. Typically 10 ⁶ human cancer cells suspended in 300 μL Matrigel (BD Bioscience) were injected subcutaneously into the flank of 7-8 week old NMRI athymic female nude mice. After tumor growth is established, typically 7-12 days after tumor cell injection, different antisense oligonucleotides are injected at 5 mg / kg / day for up to 28 days using a subcutaneously implanted ALZET osmotic pump. Administered. Prior to dorsal implants, the pump was incubated in sterile PBS overnight at room temperature to start the pump. Control animals received saline alone for the same period. Each experimental group contains at least 5 mice. Anti-tumor activity was estimated by suppression of tumor size. Tumor growth was followed periodically by measuring 2 vertical diameters. Tumor size (where, L is the largest diameter, and D is a tumor a diameter perpendicular to the L) formula ^{(π × L × D 2/} 6) were calculated according to. At the end of the treatment, the animals were anesthetized and the tumor weight was measured. The average tumor size and weight of the groups were compared using the Mann-Whitney test. All analyzes were performed by Windows with SPSS version 11.0.

  Optimally, Western blot analysis can also be performed to determine whether antisense oligonucleotides have an inhibitory effect on protein levels. Therefore, at the end of the treatment period, the mice were anesthetized and the tumor was excised and immediately frozen in liquid nitrogen. The tumor was homogenized in lysis buffer (ie 20 mM Tris-Cl [pH 7.5]; 2% Triton X-100; 1/100 volume). Protease inhibitor cocktail set III (Calbiochem); 1/100 volume. Protease inhibitor cocktail set II (manufactured by Calbiochem), 4 ° C., motor driven homogenizer is used. 500 μL of lysis buffer was applied per 100 mg of tumor tissue. Tumor lysates from each group of mice were stored and centrifuged (13,000 g) for 5 minutes at 4 ° C. to remove tissue debris. The protein concentration of the tumor extract was measured using a BCA protein assay reagent kit (Pierce, Rockford).

  The protein extract (50-100 μg) was fractionated using gradient SDS-PAGE gel spanning (4-20%), transferred to a PVDF membrane, and visualized by amino black staining. TRX expression was detected by anti-human TRX antibody followed by horseradish peroxidase-conjugated anti-goat IgG (DAKO). Immunoreactivity was detected by ECL plus (Amersham biotech) and quantified with the Versadoc 5000 lite system (Bio-Rad).

Example 17a: In vivo model; tumor growth inhibition in HT29 human colon cancer xenograft model in nude mice treated with LNA oligomeric compounds
Six week old female NMRI athymic nude mice were purchased from M & B (Denmark) and acclimated for at least one week prior to entering experiments. 3 × 10 ⁶ human cancer cells suspended in 300 μL Matrigel (BD Bioscience) were injected subcutaneously into the flank of 7-8 week old NMRI athymic female nude mice (Day 0). . Each experimental group contained at least 5 mice. This study was conducted to test the single effect of the thioredoxin target Cur2681 in the HT29 human colon cancer xenograft model in nude mice. The antisense oligonucleotide is administered at 10 and 20 mg / kg by osmotic minipump for 7-20 days, s. c. Administered. Efficacy was assessed by measuring tumor size during a 21 day treatment period. HT29 human colon cancer xenograft, BALB / c female nude mouse. Average / SEM. The average tumor size and average tumor weight observed in the different treatment groups were statistically compared by using the Mann-Whitney test (see FIG. 10).

Example 18: In vivo model: Tumor growth inhibition of human tumor fragments transplanted into nude mice after intraperitoneal treatment with LNA oligomeric compounds
Tumor growth inhibitory activity of LNA antisense oligonucleotides, Oncotest ^'s (Freiburg, Inc., Germany) breeding colony derived from xenotransplantation athymic nude mice were tested in NMRI nu / nu. Human tumor fragments from breast cancer (MDA MB 231), prostate cancer (PC3) or lung cancer (LXFE 397, Oncotest) were obtained from xenografts in serial passages in nude mice. After removing the tumor from the donor mice, they were cut into pieces (1-2 mm in diameter) and placed in RPMI 1640 medium until the subcutaneous implant. Recipient mice were anesthetized by inhalation of isoflurane. A small incision was made in the back skin. The tumor fragments (2 fragments per mouse) were transplanted using tweezers. MDA MB 231 and LXFE 397 tumors were transplanted into female mice and PC3 tumors were transplanted into male mice. After the average tumor diameter reached 4-6 mm, the animals were randomized and treated intraperitoneally once a day for 3 weeks excluding weekends with oligonucleotides at 20 mg / kg. Vehicle (saline) and positive control group (taxol, 20 mg / kg / day) were included in all experiments. All groups consisted of 6 mice. The tumor size was measured by two-way measurement using calipers on the day of randomization (day 0) and then twice a week. Tumor size was calculated according to the formula (a × b ² ) × 0.5, where a is the maximum tumor diameter and b is the vertical tumor diameter. Mice were observed daily for 28 days after randomization until tumor size doubled. Mice were sacrificed after the tumor diameter exceeded 1.6 cm. A U-test by Mann-Whitney-Wilcoxon was performed to assess the statistical significance of tumor suppression. By convention, a p-value <0.05 indicates the significance of tumor suppression.

(Example 19: Biodistribution of oligonucleotides in mice)
Six week old female NMRI athymic nude mice were purchased from M & B (Denmark) and acclimated for at least one week prior to the participation experiment. Typical 10 ⁶ human cancer cells suspended in 300 μL Matrigel (BD Bioscience) were injected subcutaneously into the flank of 7-8 week old NMRI athymic female nude mice. After tumor growth was established, tritium labeled oligonucleotides were administered at 5 mg / kg / day for 14 days using a subcutaneously implanted ALZET osmotic pump. The oligonucleotide was tritium labeled as described by Graham MJ et al. (J Pharmacol Exp Ther 1998; 286 (1): 447-458). Oligonucleotide-derived tissue extracts from all major organs (liver, kidney, spleen, heart, stomach, lung, small intestine, large intestine, lymph node, skin, muscle, fat, bone, bone marrow) and human tumor tissue transplanted subcutaneously Quantified by scintillation counting.

  The invention is specifically described by preferred embodiments. Accordingly, the examples serve only to illustrate the invention and are not intended to limit the invention.

FIG. 1 is a drawing showing illustrations of different designs of the present invention: gapmers, headmers, and tailmers, and mixmers of different compositions. For mixmers, the numbers indicate another close stretch of DNA, β-D-oxy-LNA or α-L-DNA. In the figure, the lines are DNA, the gray shades correspond to α-L-LNA residues, and the squares are β-D-oxy-LNA. TRX Northern lot for total RNA from 15PC3. FIG. 2 shows a TRX Northern blot of total RNA from 15PC3 cells treated with 0.2, 1, 5, 25 nM CUR2675, CUR2676, CUR2677, and CUR2681, respectively. Indupro RNA samples from each of the three transfections were stored and 2 μg of total RNA was loaded onto the gel. All compounds are shown to be effective inhibitors. It should also be noted that the inhibition occurs at very low compound concentrations. FIG. 3 shows a TRX Southern blot of total RNA from MCF7 cells treated with four oligomeric compounds of the present invention. Indupro RNA samples from each of the three transfections were stored and 2 μg of total RNA was loaded onto the gel. All compounds are shown to be effective inhibitors. It should also be noted that the inhibition occurs at very low compound concentrations. FIG. 5 shows a general reaction formula for the synthesis of thio-LNA. FIG. 5 shows the target sequence of the present invention: Jane Bank accession number BD132005 (which constitutes part of this specification as SEQ ID NO: 1); D28376 (which constitutes part of this specification as SEQ ID NO: 3); AF548001 (which constitutes part of this specification as SEQ ID NO: 4). FIG. 6 shows that the time course of thioredoxin protein reduction (Western blot) in 15 PC3 cells transfected with CUR2675 shows a constant low level of protein, while mock-transfected cells show a large increase in thioredoxin. (Upper panel). Following transfection, cells were incubated in serum-containing medium for 24, 48 and 72 hours. The lower panel shows the relative quantification of thioredoxin from the Western blot signal. Thioredoxin data was normalized using the corresponding tubulin data. FIG. 7 shows that the time course of reduction of thioredoxin protein in CUR2676 transfected 15PC3 cells (Western blot) shows a constant low level of protein, while mock-transfected cells show a large increase in thioredoxin. (Upper panel). Western blot of protein extracts from transfected 15PC3 cells. Following transfection, cells were incubated in serum-containing medium for 24, 48 and 72 hours. The lower panel shows the relative quantification of thioredoxin from the Western blot signal. Thioredoxin data was normalized using the corresponding tubulin data. FIG. 8 shows the specificity of LNA oligomeric compounds targeting TRX. 15PC3 cells were transfected with LNA oligos targeting either human survivin (4LNA / PS + 8PS + 4LNA / PS) (referred to as LNA survivin) or human thioredoxin (CUR2766) at 5 nM and 25 nM. Transcript steady state for TRX and survivin. Transcript steady state was followed by real-time-PCR and normalized to GAPDH transcript steady state. This indicates that antisense oligos targeting survivin have no effect on TRX expression, and vice versa. FIG. 9 is a graph showing suppression of apoptosis by CUR2675, CUR2768, CUR2766 and CUR2766 targeting TRX, which are LNA antisense oligomeric compounds. FIG. 10 shows 10 and 20 mg / kg s. c. FIG. 6 shows in vivo suppression of tumor growth by CUR2681 administered. HT29, human colon cancer xenograft, BALB / c female nude mouse. Average / SEM.

Claims (94)

A compound comprising a total of 8-50 nucleotides and / or nucleotide analogues,
A subsequence of at least 8 nucleotides or nucleotide analogues, wherein the subsequence is SEQ ID NO: 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 , 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56 and 57.   2. A compound according to claim 1 which modifies the expression of thioredoxin. A compound comprising a total of 8-50 nucleotides and / or nucleotide analogs targeting a nucleic acid molecule encoding TRX, comprising:
Specifically hybridizes with a nucleic acid encoding TRX, suppresses expression of TRX, and comprises a subsequence of at least 8 nucleotides or nucleotide analogs, wherein the subsequence is SEQ ID NO: 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56 and 57. The compound in a sequence selected from the group consisting of 57.   The compound according to any one of claims 1 to 3, which is an antisense oligonucleotide.   5. A compound according to any one of claims 1 to 4, comprising at least one nucleotide analogue.   6. A compound according to any one of claims 1 to 5 comprising at least one locked nucleic acid (LNA) unit. Locked nucleic acids (LNA) have the general formula:

[Where:
X and Y are independently —O—, —S—, —N (H) —, N (R) —, —CH ₂ —, or —CH— (in the case of a double bond), —CH _{2 -O -, - CH 2 -S} -, - CH 2 -N (H) -, - CH 2 -N (R) -, - CH 2 -CH 2 -, or -CH ₂ -CH- (double In the case of a moiety), selected from the group of —CH═CH—, wherein R is selected from hydrogen or C _1-4 -alkyl;
Z and Z ^* are independently present or are selected from internucleoside linkages, end groups or protecting groups;
B constitutes a natural or non-natural nucleobase; and
Asymmetric groups can exist in any orientation]
The compound of Claim 6 which has structural formula shown by these. At least one nucleotide has the formula:

[Where:
Y is —O—, —S—, —NH— or N (R ^H );
Z and Z ^* are independently absent or selected from internucleoside linkages, terminal groups or protecting groups; and
B constitutes a natural or non-natural nucleobase]
A compound according to any of claims 6 or 7, comprising a locked nucleic acid (LNA) according to any of Nucleotide analogs are -OP (O) ₂ -O-, -OP (O, S) -O-, -OP (S) ₂ -O-, -SP (O) _2- O-, -SP (O, S) -O-, -SP (S) ₂ -O-, -OP (O) ₂ -S-, -OP (O, S)- S-, -S-P (O) ₂ -S-, -O-PO (R ^H ) -O-, O-PO (OCH ₃ ) -O-, -O-PO (NR ^H ) -O-, —O—PO (OCH ₂ CH ₂ S—R) —O—, —O—PO (BH ₃ ) —O—, —O—PO (NHR ^H ) —O—, —O—P (O) ₂ — Comprising a nucleotide linkage selected from the group consisting of NR ^H —, —NR ^H —P (O) ₂ —O—, —NRH—CO—O—, wherein R ^H is from hydrogen or C _1-4 -alkyl. 9. The compound according to any one of claims 1 to 8, which is selected.   The nucleotide analog consists of 5-methylcytosine, isocytosine, pseudoisocytosine, 5-bromouracil, 5-propynyluracil, 6-aminopurine, 2-aminopurine, inosine, diaminopurine, 2-chloro-6-aminopurine. 10. A compound according to any one of claims 1 to 9, comprising a modified nucleobase selected from the group.   The compound according to any one of claims 5 to 10, wherein LNA is oxy-LNA, thio-LNA, amino-LNA, which is a configuration of either D-β or L-α or a combination thereof. .   A compound comprising a total of 8-50 nucleotides and / or nucleotide analogs that target a nucleic acid molecule encoding TRX, said compound specifically hybridizing with a nucleic acid encoding TRX and expressing TRX Wherein the compound is a sub-sequence of at least 8 nucleotides or nucleotide analogs of SEQ ID NO: 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 or 18. The compound comprising a sequence.   5. The compound of claim 4, wherein the antisense oligonucleotide is a design described in any of the designs presented in FIG.   14. A compound according to claim 13, wherein the antisense oligonucleotide is a gapmer.   The compound according to any one of claims 1 to 14, wherein the antisense oligonucleotide is 13, 14, 15, 16, 17, 18, 19, 20 or 21 mer in length.   2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 LNA units, such as at least two LNA units 16. A compound according to any one of claims 1 to 15, comprising a unit.   The compound according to any one of claims 1 to 16, wherein the subsequence is SEQ ID NO: 2a.   The compound according to any one of claims 1 to 16, wherein the subsequence is SEQ ID NO: 3a.   The compound according to any one of claims 1 to 16, wherein the subsequence is SEQ ID NO: 4a.   The compound according to any one of claims 1 to 16, wherein the subsequence is SEQ ID NO: 5a.   The compound according to any one of claims 1 to 16, wherein the subsequence is SEQ ID NO: 6a.   The compound according to any one of claims 1 to 16, wherein the subsequence is SEQ ID NO: 7a.   The compound according to any one of claims 1 to 16, wherein the subsequence is SEQ ID NO: 8a.   The compound according to any one of claims 1 to 16, wherein the subsequence is SEQ ID NO: 9a.   The compound according to any one of claims 1 to 16, wherein the subsequence is SEQ ID NO: 10a.   The compound according to any one of claims 1 to 16, wherein the subsequence is SEQ ID NO: 11a.   The compound according to any one of claims 1 to 16, wherein the subsequence is SEQ ID NO: 12a.   The compound according to any one of claims 1 to 16, wherein the subsequence is SEQ ID NO: 13a.   The compound according to any one of claims 1 to 16, wherein the subsequence is SEQ ID NO: 14a.   The compound according to any one of claims 1 to 16, wherein the subsequence is SEQ ID NO: 15a. 73. A compound according to any one of claims 57 to 72, wherein the 3 ^' terminal LNA is replaced by the corresponding natural nucleoside.   A compound comprising SEQ ID NO: 2a.   A compound comprising SEQ ID NO: 3a.   A compound comprising SEQ ID NO: 4a.   A compound comprising SEQ ID NO: 5a.   A compound comprising SEQ ID NO: 6a.   A compound comprising SEQ ID NO: 7a.   A compound comprising SEQ ID NO: 8a.   A compound comprising SEQ ID NO: 9a.   A compound comprising SEQ ID NO: 10a.   A compound comprising SEQ ID NO: 11a.   A compound comprising SEQ ID NO: 12a.   A compound comprising SEQ ID NO: 13a.   A compound comprising SEQ ID NO: 14a.   A compound comprising SEQ ID NO: 15a.   No original text.   No original text.   No original text.   No original text. 46. A compound according to any one of claims 34 to 45, wherein the 3 ^' terminal LNA is replaced by the corresponding nucleotide.   51. A conjugate comprising a compound according to any one of claims 1-50 and wherein at least one non-nucleotide or non-polynucleotide molecule is covalently bound to said compound.   60. A pharmaceutical composition comprising a compound according to any one of claims 1 to 51 or a conjugate according to claim 59, and a pharmaceutically acceptable diluent, carrier or adjuvant.   52. The pharmaceutical composition according to claim 51, further comprising at least one chemotherapeutic agent.   Chemotherapeutic compounds include corticosteroids (eg, prednisone, dexamethasone or decadron); altretamine (hexalene, hexamethylmelamine (HMM)); amifostine (ethylol); aminoglutethimide (citadrene); ); Anastrozole (Arimidex); Androgen (eg, Testosterone): Asparaginase (Oelspar); Bacillus Calmette-Grin; Bicalutamide (Casodex); Bleomycin (Bleoxan); Busulfan (Mirelan); Carboplatin (Paraplatin); , BiCNU); chlorambucil (Luclan); chlorodeoxyadenosine (2-CDA, cladribine, leustatin); cisplatin (platino) Cytosine arabinoside (cytarabine); dacarbazine (DTIC); dactinomycin (actinomycin-D, cosmegen); daunorubicin (servidin); docetaxel (taxotere); doxorubicin (adriamycin); epirubicin; estramustine (emcyt) Estrogen (eg, diethylstilbestrol (DES)); etoposide (VP-16, bepsid, ethofos); fludarabine (fludara); flutamide (eurexin); 5-FUDR (furoxyuridine); 5-fluorouracil (5-FU) ); Gemcitabine (Gemzar); Goserelin (Zodalex); Herceptin (Trastuzumab); Hydroxyurea (Hydrea); Idarubicin (idamycin); Ifosfamide; IL Interferon alpha (Intron A, Roferon A); Irinotecan (camptostar); Leuprolide (Luplon); Lebamisol (Ergamisole); Lomustine (CCNU); Mechlorlatamine (Mustalgen, Nitrogen Mustard); Mel Farran (alkeran); mercaptopurine (purinesol, 6-MP); methotrexate (mexate); mitomycin-C (mutamsin); mitoxantrone (novantrone); octreotide (sandstatin); pentostatin (2-deoxycoformycin, nipent) ); Prikamycin (mitromycin, mitaracin); prolocarbazine (Matsuran); streptozocin; tamoxifen (Norbadex); Teniposide (bumon, VM-26); thiotepa; topotecan (Hycamtin); tretinoin (vesanoid, all-trans retinoic acid); vinblastine (barban); vincristine (oncobin); and vinorelbine (navelbine) 53. A pharmaceutical composition according to claim 52, selected from:   51. A pharmaceutical composition comprising a compound according to any one of claims 1 to 50, further comprising a pharmaceutically acceptable carrier.   51. A pharmaceutical composition comprising a compound according to any one of claims 1-50 for use in a pharmaceutically acceptable salt.   51. A pharmaceutical composition comprising a compound according to any one of claims 1 to 50 that constitutes a prodrug.   Furthermore, the pharmaceutical composition containing the compound as described in any one of Claims 1-50 containing an anti-inflammatory compound and / or an antiviral compound.   52. Use of a compound according to any one of claims 1 to 50 or a conjugate according to claim 51 in the manufacture of a medicament for the treatment of cancer.   60. Use according to claim 59, wherein the cancer is in the form of a solid cancer.   61. Use according to any of claims 59 or 60, wherein the cancer is a carcinoma.   Cancers include malignant melanoma, basal cell tumor, ovarian cancer, breast cancer, non-small cell lung cancer, renal cell cancer, bladder cancer, recurrent superficial bladder cancer, gastric cancer, prostate cancer, pancreatic cancer, lung cancer, cervical cancer, 62. Use according to claim 61, selected from the group consisting of cervical dysplasia, laryngeal papillomatosis, colon cancer, colon colon cancer, and carcinoid tumor.   64. Use according to claim 62, wherein the carcinoma is selected from the group consisting of malignant melanoma, non-small cell lung cancer, breast cancer, colon cancer, and renal cell carcinoma.   64. Use according to claim 63, wherein the malignant melanoma is selected from the group consisting of superficial enlarged melanoma, nodular melanoma, malignant melanoma, terminal melanoma, melanin-deficient melanoma, and fibrogenic melanoma.   62. Use according to any of claims 60 or 61, wherein the cancer is sarcoma.   66. Use according to claim 65, wherein the sarcoma is selected from the group consisting of osteosarcoma, Ewing sarcoma, chondrosarcoma, malignant fibrous histiocytoma, fibrosarcoma, and Kaposi sarcoma.   62. Use according to any of claims 60 or 61, wherein the cancer is glioma.   59. A method of treating cancer comprising treating a compound according to any one of claims 1 to 50, a conjugate according to claim 51, or a pharmaceutical composition according to any one of claims 52 to 58. Administering to a patient in need thereof.   69. The method of claim 68, wherein the cancer is in the form of a solid tumor.   70. The method according to any of claims 68 or 69, wherein the cancer is a carcinoma.   Cancer is malignant melanoma, basal cell tumor, ovarian cancer, breast cancer, non-cell lung cancer, renal cell cancer, bladder cancer, recurrent superficial bladder cancer, gastric cancer, prostate cancer, pancreatic cancer, lung cancer, cervical cancer, uterus 71. The method of claim 70, selected from the group consisting of cervical dysplasia, laryngeal papillomatosis, colon cancer, colon colon cancer, and carcinoid tumor.   72. The method of claim 71, wherein the carcinoma is selected from the group consisting of malignant melanoma, non-small cell lung cancer, breast cancer, colon cancer, and renal cell carcinoma.   125. The method of claim 124, wherein the malignant melanoma is selected from the group consisting of superficial enlarged melanoma, nodular melanoma, malignant melanoma, terminal melanoma, melanin-deficient melanoma, and fibrogenic melanoma.   69. The method of claim 68, wherein the cancer is sarcoma.   Sarcoma consists of osteosarcoma, Ewing sarcoma, chondrosarcoma, malignant fibrous histiocytoma, fibrosarcoma, atherosclerosis, psoriasis, diabetic retinopathy, rheumatoid arthritis, asthma, warts, allergic dermatitis, and Kaposi sarcoma 75. The method of claim 74, selected from the group.   69. The method of claim 68, wherein the cancer is glioma.   A method for suppressing the expression of TRX in a cell or tissue, comprising contacting the cell or tissue with the compound according to any one of claims 1 to 50 to suppress the expression of TRX. Including the method.   A method for altering the expression of a gene involved in cancer disease by altering gene expression, comprising contacting the gene or RNA derived from the gene with an oligomeric compound, wherein the compound comprises SEQ ID NO: 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53 , 54, 55, 56 or 57 having a sequence containing at least 8 nucleobase moieties.   78. The method of claim 77, wherein the compound comprises one or more LNA units.   79. The method of any of claims 77 or 78, wherein the compound is hybridized with messenger RNA of the gene to suppress its expression.   A method for treating a mammal suffering from or susceptible to a cancer disease, comprising administering to the mammal a therapeutically effective amount of an oligonucleotide targeting TRX comprising one or more LNA units Comprising the steps of:   The cancerous disease is lung, breast, large intestine, prostate, pancreas, lung, liver, thyroid, kidney, brain, testis, stomach, intestinal fistula, intestine, spinal cord, sinus, bladder, urinary tract, or ovarian cancer, claim Item 81. The method according to any one of Items 77 to 80.   51. A method for modifying erythrocyte proliferation, cell proliferation, iron metabolism, glucose and energy metabolism, pH modification, or matrix metabolism, wherein the cell is an antisense compound according to any one of claims 1-50. The method comprising contacting and modifying the cell.   A method for inhibiting cell proliferation, wherein the cells are contacted with an effective amount of an antisense compound according to any one of claims 1 to 50 in vitro to inhibit the proliferation of said cells. Including the method.   84. The method of claim 83, wherein the cell is a cancer cell.   A method for inhibiting the expression of TRX in a human cell or tissue, wherein the human cell or tissue is contacted with a compound according to any one of claims 1 to 50 to reduce the expression of TRX. The method comprising inhibiting.   A method for treating an animal having a disease or condition associated with TRX, wherein the anti-therapeutically or prophylactically effective amount of the animal having the disease or condition associated with TRX. Administering the sense compound, thereby inhibiting the expression of TRX.   90. The method of claim 86, wherein the disease or condition is a hyperproliferative disease.   90. The method of claim 87, wherein the hyperproliferative disease is cancer.   A method for treating a human having a disease or condition characterized by a decrease in apoptosis, the amount being prophylactically or therapeutically effective in a human having a disease or condition characterized by a decrease in apoptosis 51. A method comprising administering an antisense compound according to any one of claims 1-50.   51. A method for modifying apoptosis in a cell comprising contacting the cell with an antisense compound according to any one of claims 1 to 50 to modify apoptosis.   51. A method for altering cytokinesis in a cell comprising contacting the cell with an antisense compound according to any one of claims 1-50 to alter cytokinesis.   51. A method for altering the cell cycle in a cell comprising contacting the cell with an antisense compound according to any one of claims 1-50 to alter the cell cycle.   A method for inhibiting cell proliferation comprising contacting a cell with an effective amount of an antisense compound according to any one of claims 1 to 50 to inhibit cell proliferation, The method.

Images