JP2006517799A - A non-immunogenic selectable marker resistant to cardiac glycosides - Google Patents

Abstract

Disclosed is a recombinant Na ⁺ , K ⁺ ATPase α1-subunit protein resistant to cardiac glycosides (eg ouabain), as well as methods for its production and use. Resistance to cardiac glycosides is obtained by altering the region located between and within amino acids 65-133. Such recombinant proteins and nucleic acid constructs that express them are useful as selectable markers in gene therapy and research applications.

Description

The present invention relates to the field of biotechnology, in particular, recombinant human proteins resistant to cardiac glycosides, in particular the α1-subunit of ouabain resistant Na ⁺ , K ⁺ ATPase, and the corresponding nucleic acid constructs, as well And relates to their use in therapy and research.

  Gene therapy is an approach to treating a disease either by altering the expression of one or more genes in an individual or by correcting an abnormal gene. Currently, many different diseases are being investigated as candidates for gene therapy by administering DNA rather than drugs. Such diseases include genetic disorders such as cystic fibrosis, cardiovascular disease, various forms of cancer, as well as infectious diseases such as AIDS. When transferring genes to cells ex vivo or in vivo, selection may be necessary if the genetically modified cells do not have a selective advantage over the unmodified cells. It is also desirable to ensure sufficient growth of cells that have taken up the new gene before transferring them to the patient.

  The practical use of gene therapy is still limited for a variety of reasons, one of which is to obtain a low concentration of gene transfer and a high concentration or pure population of genetically modified cells. In addition, it is necessary to select cell cultures that have been modified in vitro. Conventionally, various marker genes for selecting genetically modified cells have been used. These fall into two categories: cell surface markers and metabolic selectable markers.

  Cells modified by cell surface marker genes can be selected by fluorescence activated cell sorting (FACS) or immunomagnetic techniques. Cell surface markers usually provide a rapid selection procedure, but the marker protein in the retroviral envelope is transferred to the plasma membrane of the target cell so that selection is made too early after introduction. Doing so creates the risk of false positive selection. Furthermore, since FACS is an open system, it is difficult to maintain a sterilized state. In addition, sorting a large amount of cells takes a considerable amount of time. A common drawback of immunomagnetic sorting is the low recovery rate of genetically modified cells. Only cells in which the transgene is highly expressed are sorted efficiently. Low recovery requires a large amount of starting material and is economically undesirable.

  Metabolic selectable markers allow efficient and background-free genetically modified cell selection, but usually the selection period is long, typically lasting about 1 week to 10 days. Further, the selective substance may directly damage DNA.

  Furthermore, there is a great risk that non-human genes or gene fragments cause an immune response against genetically modified cells. Therefore, human cells modified with such genes may be removed by the immune system, but in the case of cell surface markers, these are generally human and immunogenicity is usually a problem. Must not. In contrast, metabolic selectable markers are sometimes derived from non-mammals, and immunogenicity problems have been pointed out.

  Another problem with current selectable markers is their putative impact on normal cell function. This raises the danger of causing cellular alterations that may affect cell transformation.

Na ⁺ , K ⁺ ATPase is a housekeeping enzyme that is present in all mammalian cells. Na ⁺ , K ⁺ ATPase establishes an electrochemical gradient through the cytoplasmic membrane by transporting sodium ions out of the cell and potassium ions into the cell (at a ratio of 3: 2). It is an integral membrane protein that utilizes ATP hydrolysis as an energy source. Changes in the activity of Na ⁺ , K ⁺ ATPase have an effect on a number of important cellular functions. The minimally functional enzyme active in the membrane is a dimer consisting of an α-subunit and a β-subunit. In humans and rats, four isoforms (α ₁ , α ₂ , α ₃ and α ₄ ) of the Na ⁺ , K ⁺ ATPase α-subunit gene family have been cloned, and α ₁ is a cardiac glycoside. Is the most resistant isoform.

  Cardiac glycosides are naturally occurring compounds that have been shown to have an effect on the contractility and rhythm of the mammalian heart. For example, digoxin and digitoxin from Digitalis lanata, and the common digitalis purpurea; uricia (Scilla) maritime, prosilaridin A from Strophanthus gross Strafanthin); Mayflower (Lily-of-the-valley, Combalana majalis) convalatoxin; and moth Paritoa toxica Derived paritoxin. Any cardiac glycoside is believed to contain a steroid moiety bound to one or more glucose-like molecules.

  Ouabain is one member of the above drug group and has been shown to bind to the α-subunit and inhibit the enzyme's ATPase and ion transport activities. In this description, ouabain is used as an example of cardiac glycoside.

  As described above, current selection methods have a number of disadvantages that adversely affect cell selection. Accordingly, there is a need for rapid selectable markers for use in in vitro applications as well as human gene therapy with high efficiency and minimal immunogenicity. Such markers are also expected to have widespread use in methods for drug toxicology, toxicity mechanism studies, in vitro screening for new drugs, and the like.

  One object of the present invention is to make available such markers as well as their method of manufacture and use. Further objects, solutions provided by the present invention, as well as their advantages, are expected to be apparent to those skilled in the art upon studying the following description and examples.

The ouabain sensitivity naturally varies greatly between various mammalian species. Rat and mouse Na ⁺ , K ⁺ ATPase proteins are highly resistant to cardiac glycosides, whereas human, sheep, monkey and pig proteins are highly sensitive (Kuntzweiler et al., J. Biol. Chem. 271: 29682-29687, 1996). As early as 1988, Price and Lingllell (Biochemistry, 1, 27: 8400-8408) found that the determinant involved in the ouabain sensitivity of sheep proteins is located in the amino-terminal half of the Na ⁺ , K ⁺ ATPα subunit. It suggests. Numerous attempts have been made to increase the resistance of various non-human Na ⁺ , K ⁺ ATPases, but the success rate varies, and the highly resistant phenotype of rat Na ⁺ , K ⁺ ATPase is Not achieved.

US 6,309,874 (Belusa) contains a point mutation at amino acid positions 799 and / or 801 and is a selection system based on the rat Na ⁺ , K ⁺ ATPase α ₁ gene transfected into a non-human mammalian cell line Has been advocated.

Coppi et al. (Biochemistry, 38: 2494-2505, 1999) studied the effect of a combination of residues with charge in the M1-M2 loop adjacent to the ouabain affinity portion of the α ₁ and α ₂ rat isoforms. They report that the ouabain sensitivity of rat Na ⁺ , K ⁺ ATPase depends not only on the identity of the residues adjacent to the M1-M2 loop, but also on the environment in which they are introduced. They also note that these residues affect ouabain sensitivity by destabilizing or altering the E2 conformation of Na ⁺ , K ⁺ ATPase to which ouabain preferentially binds. It suggests that there is a possibility.

De Fusco et al. (Nature Genetics, 33: 192-196, published 2003-January 21, 2003), mutations in the gene encoding the α ₂ subunit of human Na ⁺ , K ⁺ ATPase, and And the association between familial hemiplegic migraine type 2. To investigate the ion transport function of the mutant α ₂ and β ₂ subunits, they used Na ⁺ , K ⁺ ATPase activity. The α ₂ and β ₂ subunits were made ouabain resistant by introducing two amino acid mutations (Q116R and N127D) into the first extracellular loop. However, at the amino acid level, the homology between the α ₁ and α ₂ isoforms in human Na ⁺ , K ⁺ ATPase is low (ie, only about 87%) and therefore the same mutation in the α ₁ gene. It cannot be assumed that the same desired effect will occur by waking up.

Aints et al. (Human Gene Therapy, 13: 969-977, 2002) achieved increased ouabain resistance in human cells with the α1-subunit of rat Na ⁺ , K ⁺ ATPase, Through targeted mutagenesis, leucine at position 799 has been replaced with cysteine.

Emanuel et al. (Mol. Cell Biol., 9: 3744-3749, 1989) studied the determinants within the α subunit of Na ⁺ , K ⁺ ATPase that contribute to differential ouabain sensitivity. They constructed a chimeric cDNA molecule of ouabain resistant α subunit cDNA and ouabain sensitive α subunit cDNA. By replacing the 5 ′ end of the human α1 subunit with the 5 ′ end of the rat α1 cDNA, Emanuel et al. Recombined containing 172 amino acid residues of the rat α1 subunit at the amino terminus. Protein was obtained. When this construct was transfected into African green monkey CV-1 cells, recombinant Na ⁺ , K ⁺ ATPase was shown to be resistant to 10 ⁻⁴ M ouabain. However, this construct has not been transfected into human cells and the functionality and immunogenicity of the construct in human cells cannot be deduced from this study. Constructs containing large-scale substitutions derived from such rat genes are likely to confer high immunogenicity to human cells and are therefore not suitable as selectable markers for use in human gene therapy.

That is, these prior art, Na ^+, in biology related K ⁺ ATP-ase, to obtain evidence that human Na ^+, an amino acid that confers increased ouabain resistance in α1- subunit K ⁺ ATP-ase are identical And therefore has not been successful in providing evidence or suggestions that the human Na ⁺ , K ⁺ ATPase α1 gene can be developed into an efficient selectable marker for human gene therapy Is explained. Thus, there is a need for non-immunogenic, rapid and reliable selectable markers for use in human gene therapy and research.

The present invention relates to recombinant human Na ⁺ , K ⁺ ATPase protein having high cardiac glycoside resistance, and in particular, α1 of recombinant human Na ⁺ , K ⁺ ATPase that imparts such high cardiac glycoside resistance. -Relates to subunit polypeptides. Said recombinant protein is at least 98% homologous to the α1-subunit of the corresponding human Na ⁺ , K ⁺ ATPase at the amino acid level. A recombinant α1- subunit pcs, corresponding human Na ^+, K ⁺ differences in the amino acid sequence of α1- subunit of ATP-ase, the human Na + of SEQ ID NO: 1, number 65 of α1- subunit K + ATP-ase Located between and within amino acids corresponding to ~ 133 or homologues equivalent to their function.

In the attached sequence listing (made using PatentIn 3.1 software), the amino acid sequence for the α1-subunit of human wild-type Na ⁺ , K ⁺ ATPase (SEQ ID NO: 1), the present invention 1 discloses an amino acid sequence (SEQ ID NO: 2) of a recombinant Na ⁺ , K ⁺ ATPase and a sequence (SEQ ID NO: 3) encoding a recombinant nucleic acid corresponding to the protein. The primers used in the examples are disclosed as SEQ ID NOs: 4-21. The amino acid sequence showing a minimum of two amino acid substitutions is disclosed as SEQ ID NO: 23, and the corresponding coding sequence is disclosed as SEQ ID NO: 24, both of which constitute a preferred embodiment of the present invention.

  Further aspects of the present invention and their advantages will be apparent from the following description, examples, drawings and appended claims, which are hereby incorporated by reference.

The invention is explained in more detail in the following description, examples and accompanying figures:
FIG. 1 shows a schematic of the constructs tested for resistance to ouabain-induced cell death. HeLa and COS-7 cells transfected with plasmids containing these constructs were incubated in 10 μM ouabain for 24 hours and 4 days, respectively, followed by analysis. The six constructs from the top conferred resistance to ouabain-induced cell death, but the eight constructs below did not.
FIG. 2 illustrates the results of selecting HeLa cells with ouabain after transient transfection. Ouabain was added to the cells 24 hours after transfection. After 48 hours, transfected cells were trypsinized and transferred to ouabain-free medium. The next day, the cells were washed with PBS and analyzed using WST-1 cell proliferation reagent. Cells are either untransfected (control) or in frame C1 plasmid encoding EGFP, rat OuaR (pEGFPPR), or human Na ⁺ , K ⁺ ATPase α1 with amino acid substitution Q118R, N129D. It was transfected with cDNA (pEGFP-Q118R; N129D).

DETAILED DESCRIPTION OF THE INVENTION In the description and claims of the present invention, the terms “functionally homologous” or “functionally equivalent” have low structural homology with the disclosed sequences, It may mean sequence characteristics that exhibit homologous functions in vivo and / or in vitro, either in healthy or diseased organisms, for example identical or highly similar cells with the same or highly similar cell functions Refers to a sequence property encoding a protein. The most relevant cellular functions are in this case increased resistance to cardiac glycosides and low or no immunogenicity.

The present invention relates to novel efficient selectable markers for use in cell culture experiments and molecular biology, eg, selection of human cells. The present invention is based on a gene that is naturally expressed in all cells, ie, the α1-subunit gene of Na ⁺ , K ⁺ ATPase. Establishing efficient selectable markers for use in human gene therapy by minimizing changes in normal protein activity, thereby rapidly removing human cells that have not been modified with ouabain, genetically modified cells Can be efficiently recovered. By minimizing naturally occurring genetic alterations, the selectable marker can be made less immunogenic or can be made very immunogenic.

In particular, the present invention provides a nucleotide sequence encoding the first about 130, preferably the first 133 amino acids at the amino terminus of the cDNA of the α1-subunit of human Na ⁺ , K ⁺ ATPase, and the corresponding rat Na Based on the results of experiments in which the cDNA portion of the α1-subunit of ⁺ , K ⁺ ATPase was substituted. The rat homologue of the α1-subunit of human Na ⁺ , K ⁺ ATPase confers significantly higher resistance to ouabain toxicity. Surprisingly, the inventor has shown that the chimeric α1-subunit encoded by this chimeric cDNA is significantly more resistant to cardiac glycoside ouabain compared to human Na ⁺ , K ⁺ ATPase α1. showed that. The chimeric α1-subunit encodes an amino acid that differs from the human α1-subunit at the 10 position. Thus, the difference between the chimeric α1-subunit and the wild type human α1-subunit at the protein level is a 10 amino acid substitution.

  Considering the form of the invention relating to the selection of genetically modified cells, it is emphasized that the selection process is based on the specific rapid removal of human cells with ouabain by inhibiting ion transport across the cytoplasmic membrane. . Therefore, this selection process is not genotoxic, i.e., in the best knowledge of the inventor, this indicates that, for the first time, high ouabain resistance was substantially obtained for human genes. The resulting unprecedented level of resistance allows this mutant gene to be used as a selectable marker for the very rapid removal of unmodified human cells. This marker may have use in gene therapy applications for a wide array of human illnesses and disabilities, as well as genetic modification of cells in culture.

  Moreover, this selectable marker can be advantageously used with so-called suicide genes, ie genes that induce cell death.

The present invention is based on genes expressed in all cell types and provides an advantageous selection system for current selection / sorting markers. Immunogenicity occurs because the amino acid sequence encoded by the nucleic acid construct of the present invention has at least 98%, preferably more than 99% homology with the α1-subunit of human wild-type Na ⁺ , K ⁺ ATPase The possibility is very low.

A further advantage is that ouabain is a well known, relatively inexpensive drug and is widely used as a cardiotonic drug in hospitals. Uavine is not known for toxic effects other than its action as an inhibitor of Na ⁺ , K ⁺ ATPase, can be quickly removed from cell culture by simple washing and does not result in false positive selection . Their rapid course of action in the cell culture environment allows for the rapid selection of transiently transfected or stably introduced cells, in short, the selection is rapid, i.e. almost No cell type is 24-48 hours and does not produce false positive results. These properties make this human mutation construct a preferred selectable marker for use in preclinical and clinical molecular medicine.

Uabain binds extracellularly to Na ⁺ , K ⁺ ATPase, and the junction between the first and second transmembrane regions (H1-H2 junction) strongly affects the ouabain resistance level of the α1-subunit. Is thought to give. The extracellularly exposed H1-H2 junction comprises amino acid numbers 118-129 (numbering established according to SEQ ID NO: 1 or functionally equivalent homologues thereof) and the first approximately 130 amino acids 4 of the residue differences between the 5 matched species in are in the H1-H2 junction, ie amino acids in the α1-subunit sequence of human Na ⁺ , K ⁺ ATPase as set forth in SEQ ID NO: 1 Corresponding amino acids in numbers Q118, A119, Q126 and N129, or functionally equivalent homologues of the subunit sequences. Residues bound to the membrane at the end of the H1-H2 junction are also thought to be important for ouabain affinity.

One form of the invention is the α1-subunit of recombinant Na ⁺ , K ⁺ ATPase, wherein the recombinant protein is at the amino acid level at the α1-subunit of the corresponding human Na ⁺ , K ⁺ ATPase. Wherein the amino acid sequence of the human protein is the sequence set forth in SEQ ID NO: 1, or any functionally equivalent homologue thereof, and the recombinant Na ⁺ , K ⁺ ATP The ouabain resistance of the α1-subunit of ase is higher than the corresponding human protein.

The inventor has shown that the position of substitution is extremely important. Consequently, a preferred form of the invention is the α1-subunit of recombinant Na ⁺ , K ⁺ ATPase, wherein said protein and the corresponding human Na ⁺ , K ⁺ ATPase α1-subunit. Is within the first approximately 130 amino acids, wherein the amino acid sequence of the human protein is the sequence set forth in SEQ ID NO: 1, or any functionally equivalent homologue thereof. is there.

Studies conducted by the inventors have demonstrated that: The difference in amino acid sequence between the α1-subunit of the protein and the α1-subunit of the corresponding human Na ⁺ , K ⁺ ATPase is Preferably it is located between and within amino acid numbers 65-133, most preferably amino acid numbers 117-130 (including residues bound to the first membrane at the end of the H1-H2 junction). Limited to at least one of the amino acids located between and within, wherein the amino acid sequence of the human protein is the sequence set forth in SEQ ID NO: 1, or any functionally equivalent homologue thereof . In one embodiment of the invention, the protein and the corresponding human Na ⁺ , K ⁺ ATPase α1-subunit are between amino acid numbers 117-130 and a maximum of 10 amino acids located therein. Preferably differing between amino acid numbers 117-130 and up to 4 amino acids located therein, most preferably with respect to amino acid numbers 117-130 and up to 2 amino acids located therein, wherein The amino acid sequence of the human protein is the sequence shown in SEQ ID NO: 1, or any functionally equivalent homologue thereof.

In one embodiment, the recombinant α1-subunit and the corresponding human Na ⁺ , K ⁺ ATPase α1-subunit are identical in amino acid numbers 118 and 129, most preferably in mutations Q118R and N129D. Wherein the amino acid sequence of the human protein is the sequence set forth in SEQ ID NO: 1, or any functionally equivalent homologue thereof.

The recombinant protein according to the invention exhibits high ouabain resistance, preferably the protein is ouabain resistant with a ouabain concentration of at least 10 ⁻⁷ M. More preferably, the protein is ouabain resistant with a ouabain concentration of at least 10 ⁻⁵ M, most preferably at least 10 ⁻³ M.

The present invention makes available the α1-subunit of the recombinant Na ⁺ , K ⁺ ATPase defined above, and the present invention further provides that the protein comprises the amino acid sequence of SEQ ID NO: 2, Α1 of recombinant Na ⁺ , K ⁺ ATPase, characterized in that it comprises any functionally equivalent homologues of, preferably the sequence set forth in SEQ ID NO: 23, or any functionally equivalent homologues thereof -Make subunits available.

Another aspect of the invention is the α1-subunit of recombinant Na ⁺ , K ⁺ ATPase protein having at least 98% homology with the α1-subunit of human Na ⁺ , K ⁺ ATPase, as defined above. A nucleic acid construct encoding a subunit, in particular the encoded amino acid sequence is SEQ ID NO: 1 or any functionally equivalent homology thereof to the corresponding human Na ⁺ , K ⁺ ATPase α1-subunit Nucleic acid constructs that differ between and within amino acids corresponding to body numbers 65-133. The constructs, when expressed in cells, are cardiac glycosides and other Na ⁺ , K ⁺ ATPase inhibitors, particularly but not limited to ouabain, digoxin and digitoxin, prosilaridin A, palytoxin and construct. High resistance to any one of baratoxins.

  According to one embodiment of the invention, the nucleic acid construct comprises the sequence set forth in SEQ ID NO: 3, or a functionally equivalent homologue thereof.

The present invention also makes available a novel method for producing the α1-subunit of recombinant ouabain resistant Na ⁺ , K ⁺ ATPase as defined above. In this method, human Na ^+, K ⁺ 5 'end of the cDNA of α1- subunit of ATP-ase, the human Na ⁺ corresponding amino acid level, at least 98% homologous set to α1- subunit K ⁺ ATP-ase Modified to produce a replacement protein, said modification being an amino acid substitution located between and within amino acid numbers 65-133 of SEQ ID NO: 1 or any functionally equivalent homologue thereof.

According to one embodiment of the method of the present invention, the 5 ′ end of the cDNA of the α1-subunit of human Na ⁺ , K ⁺ ATPase is such that at least one site-specific mutation is introduced into the coding sequence. Wherein at least one amino acid is substituted between amino acids 117-130 and with respect to the amino acids contained therein, the amino acid sequence of said human protein is the sequence of SEQ ID NO: 1 or their functionally Any equivalent homologue.

According to another embodiment of the method according to the invention, the 5 ′ end of the cDNA of the α1-subunit of human Na ⁺ , K ⁺ ATPase is modified so that a specific change is introduced into the amino acid sequence of the protein. Said change consists of up to 10 site-specific mutations in the coding sequence whereby amino acids located between and within amino acid numbers 117-130 are substituted, more preferably amino acid number 117 A maximum of 4 amino acids located between and within 130 are substituted, most preferably a maximum of 2 amino acids located between and within amino acid numbers 117 to 130 are substituted, the amino acid sequence of said human protein is The sequence set forth in SEQ ID NO: 1 or any functionally equivalent homologue thereof.

In one embodiment of the method of the invention, the recombinant α1-subunit comprises the corresponding α1-subunit of human Na ⁺ , K ⁺ ATPase protein and amino acid numbers 118 and 129 (sequence numbering is According to the corresponding amino acids of SEQ ID NO: 1 or their functionally equivalent homologues), most preferably modified differently in substitutions Q118R and N129D. The corresponding sequences are attached as SEQ ID NO 23 (protein) and SEQ ID NO 24 (coding sequence).

According to another embodiment of the method of the present invention, the α1-subunit of the recombinant Na ⁺ , K ⁺ ATPase is resistant to at least 10 ⁻⁷ M ouabain when expressed in cells. Give. Preferably, the nucleic acid construct confers resistance to at least 10 ⁻⁵ , more preferably at least 10 ⁻³ M ouabain.

The present invention also provides that the α1-subunit of the recombinant Na ⁺ , K ⁺ ATPase of the present invention is limited to other cardiac glycosides and other Na ⁺ , K ⁺ ATPase inhibitors such as, but not limited to, Although not, it relates to a method of conferring resistance to digoxin and digitoxin, prosilaridin A, paritoxin and combaratoxin.

Furthermore, in the present invention, a recombinant cardiac glycoside resistance marker (for example, ouabain-resistant Na ⁺ , α 1 -subunit of K ⁺ ATPase as defined above) is used in a method for selecting genetically modified cells in vitro. Make available the steps in gene therapy.

  Methods for selecting genetically modified cells in vitro are well known to those skilled in the art. Typically, such a method may comprise the following steps: first, growing a stable cultured cell line or initial human cells from a donor or patient in cell culture medium. . Second, the transfer of genes, ie the transfer of genetic information, in the form of natural or synthetic nucleic acids or modified nucleic acids, or analogs thereof, can be carried out by electrical, chemical or biological means such as electroporation. By transfection or viral gene transfer (introduction). However, this only occurs in gene transfer in the cell fraction.

  Therefore, as a third step, the resulting genetically modified cell population must be isolated from unmodified cells by separation (eg, chemical selection): Also, the transferred genetic material is therapeutically In addition to containing active genes, it also includes selectable genes that confer resistance to toxic substances or drugs at toxic concentrations. The selection is performed by contacting a mixture of modified and unmodified cells with a toxic substance or mixture of substances. Such substances induce cell death in unmodified cells, but not in genetically modified cells. Thus, a pure genetically modified cell population is obtained after selection.

According to the present invention, a cardiac glycoside such as ouabain is used as a toxic substance, and the genetic material to be transferred includes recombinant Na ⁺ , K ⁺ imparting ouabain resistance disclosed in the present invention. Examples include a nucleic acid sequence encoding the α1-subunit of ATPase.

Furthermore, the present invention makes available steps in the methods used for the study of toxicity mechanisms, where a method for in vitro or in vivo studies includes a recombinant cardiac glycoside resistance marker (eg as defined above). Ouabain resistant recombinant Na ⁺ , α 1 -subunit of K ⁺ ATPase).

In vitro toxicity studies are well known to those skilled in the art. In general, such methods induce cell death, for example, by using substances that affect the ionostatic homeostasis and the electrochemical gradient across the cytoplasmic membrane by acting on ion channels in the cell membrane. May include research on In such studies, test cells were grown in cell culture and the responses of the cells to various test substances were recorded. According to the present invention, the test cells are modified to express the α1-subunit construct of ouabain resistant recombinant Na ⁺ , K ⁺ ATPase, and the changes in cell viability and cell chemical signaling response pattern Is recorded.

Furthermore, the present invention provides a ouabain resistant recombinant Na ⁺ , K ⁺ ATPase as defined above for use in pharmacological studies of substances that directly or indirectly affect human Na ⁺ , K ⁺ ATPase. Of the α1-subunit.

A person skilled in the art knows methods for various pharmacological studies and can modify such methods based on the literature and the information disclosed in the description and examples of the present invention. In general, such studies involve induction of changes in cellular metabolism by chemical stimulation or gene transfer. An example of such a method includes the following steps: first, growing the test cell in cell culture, and recording the response of the cell to the test substance or genetic manipulation. According to the present invention, the cells are modified to express the α1-subunit construct of ouabain-resistant recombinant Na ⁺ , K ⁺ ATPase, and changes in the pattern of cell function are recorded. Pharmacological studies can also be performed in vivo.

  The invention also encompasses the nucleic acid constructs defined above, or any functionally equivalent homologue thereof, wherein the construct forms a functional part of a gene transfer vector. Such transfer vectors are preferably plasmids, viral vectors, or any hybrid constructs thereof.

  Furthermore, certain embodiments of the invention include genetically modified, natural, partially or fully synthetic, including such nucleic acid constructs as defined above, or any functionally equivalent homologue thereof. It is a cell. Preferably the cell is a eukaryotic cell or a human chimeric cell, most preferably a human cell.

Furthermore, certain embodiments of the present invention express the α1-subunit of ouabain resistant recombinant Na ⁺ , K ⁺ ATPase transferred by carriers (eg, exosomes and liposomes), or functional equivalents thereof. Cell.

  The invention is further illustrated by the following non-limiting examples.

1. Materials and methods
1.1 Constructs and Plasmids Plasmid (pCMVOuab ′) encoding wild type rat Na ⁺ , K ⁺ ATPase α1 was purchased from Pharmingen (Pharmingen, San Diego, Calif.). The cDNA of human Na ⁺ , K ⁺ ATPase α1 was used as a plasmid (phNKAa1) in J. B. Provided to Lingrel (Dept Mol Gene, Biochem and Microbiol, Univ Cincinnati College of Medicine, Cincinnati, Ohio). L-799 in pCMVOuabr was mutated to cysteine by site-directed mutagenesis and named OuaR (Aints et al., Human Gene Therapy, 13: 969-977, 2002). pEGFP-OuaR (pEGGFPR) was created by inserting the ApaI-XbaI fragment from pCMV-OuaR between the ApaI and XbaI sites of pEGFP-C3 (Clontech, Palo Alto, CA). . The pEGFP-hNKAα1 plasmid (pEGFPH) was generated by inserting the NcoI (packed) -XbaI fragment from phNKAα1 between SmaI and XbaI in pEGFP-C1 (Clontech, Palo Alto, Calif.). In both cases, there was an in-frame fusion between the inserted protein and EGFP. The pEGFP-hNKAα1-PX (H3R) chimeric fusion gene was generated by replacing the nucleotide sequence PfuMI-XbaI with a homologous fragment of pEGFP-OuaR. pEGFP-hNKAa1-PV (H3R4H) and pEGFP-hNKAa1-VX (H4R) chimeric fusion genes were generated by replacing the nucleotide sequences PfuMI-PpuMI and PpuMI-XbaI with homologous fragments of pEGFP-OuaR, respectively. To create a chimera at the 5 ′ end of Na ⁺ , K ⁺ ATPase α1, the segment of OuaR was amplified with the following primers:
GGAACCTCAAAAACGATATCTGTACCTCGGGGGTCGC (forward) (SEQ ID NO: 4),
TCATCACGGGTGTGGCTGGTTCCCTGGGGGGTTCTT (forward) (SEQ ID NO: 5),
AAGACACACCCAGGAACACAGCCACACCCGTGATGGAGG (reverse) (SEQ ID NO: 6),
AGCACCACACCCAGGTACACATCATCATTTTGGTGGTTCC (reverse) (SEQ ID NO: 7), and
GGCAAGCTTTTATCTAGA (reverse) (SEQ ID NO: 8).

The pEGGFPH segment was amplified with the following primers:
GGAACCACCAAATGATGATCTGTACCTGGGTGGTGTGCT (forward) (SEQ ID NO: 9),
CCTCATCACGGGTGTGGCTGTGTCTCTGGGTGGTTCTT (forward) (SEQ ID NO: 10),
GCACGACCCCGAGGTACAGATTATCGTTTTGAGGTTCC (forward) (SEQ ID NO: 11),
AAGACACCCCCCAGGAACACAGCCACACCCGTGATGA (reverse) (SEQ ID NO: 12), and
GCGAAGCTTGACGGGGGGCTATAATATAGTAG (reverse) (SEQ ID NO: 13).

The following primers:
CGGGATCACTCTCGGGCATGGAC (forward) (SEQ ID NO: 14)
Was used for both constructs. The intersections were 390 bp and 900 bp from the 5 ′ end of the gene. The chimeric constructs cloned by PCR are as follows: H1R, R1H, R1H4R, R1H3R, R1H3R4H, H1R2H3R, H1R2H3R4H, H1R2H4R, R1H2R.

  H = human, R = rat, 1 = to first intersection, 2 = to second intersection, 3 = after PfuMI restriction site, 4 = after PpuMI restriction site. The PCR product was purified on a gel, cloned into a TOPO vector (Invitrogen), and One-Shot E. coli. Amplified by transformation of E. coli (Invitrogen) according to the protocol provided by the manufacturer. From these bacteria, plasmids were purified using Qiaprep miniprep (Qiagen) according to the protocol supplied by the manufacturer. The PCR construct was excised from the HindIII site of the plasmid and purified on a gel. This fragment was inserted into the HindIII site in the EGFP-C1 or EGFP-C3 plasmid (Clontech, Palo Alto, Calif.) And fused in-frame with EGFP. All constructs having the 5 'end of the rat gene sequence were inserted into the EGFP-C3 plasmid, and constructs having the 5' end of the human sequence were inserted into the EGFP-C1 plasmid. These plasmids were transformed into one shot E. coli. Amplified with E. coli (Invitrogen) and purified using Qiaprep Miniprep (Qiagen). The construct was confirmed by restriction enzyme mapping and partial sequence analysis.

1.2 Transfection and ouabain toxicity analysis HeLa cells (ATCC, Manassas, VA) were cultured in DMEM glutamax (Glutamax) containing fetal bovine serum (FBS) inactivated with 10% heat. For transfection, Fugene 6 reagent (Roche Boehringer Mannheim, Germany) was used according to the manufacturer's instructions. Briefly, plasmid DNA (2 μg per 10 ⁵ cells) and reagent (5 μl) were mixed in cell culture medium (100 μl), incubated for 15 minutes and then added to the cells. After 24 hours, ouabain was added to each well to a final concentration of 10 μM. After 24 hours of incubation, cell viability was recorded.

  COS-7 cells (ATCC, Manassas, VA) were cultured and transfected as described above. After 48 hours incubation in 10 μM ouabain, the cells were washed twice in PBS (Gibco) and incubated with saline solution (Sigma) containing 0.025% porcine trypsin for 15 minutes. Trypsin was inactivated by addition of FBS. Cells were reincubated in 10 μM ouabain. After 48 hours of incubation, cell viability was recorded.

2. result
2.1 Intracellular localization To monitor the transfection process and the localization of the mutant protein in the cell, an EGFP-chimeric human / rat Na ⁺ , K ⁺ ATPase α1 fusion gene was constructed. Transfection of COS-7 and HeLa cells with the pEGFP-chimeric fusion gene resulted in localization of the fusion protein to the cell membrane. PEGFPR was used as a positive control in transfection experiments. pEGGFPH expression did not confer ouabain resistance to COS-7 cells. Moreover, overexpression of the human Na ⁺ , K ⁺ ATPase α1 gene naturally expressed in HeLa by transfection with pEGGFPH did not affect ouabain sensitivity. Similarly to the control, pEGFPPR, pEGFPH, the chimeric EGFP fusion protein was localized in the cell membrane and could be detected by GFP fluorescence. Post-translational regulation of Na ⁺ , K ⁺ ATPase α1 expression is controlled by the level of its cognate β subunit. In transfected cells, the protein encoded by the plasmid competes with the endogenous α subunit for the β subunit, and the unassembled α-subunit degrades rapidly (Shanbaky and Pressley, Biochem. Cell Biol , 1995, 73: 261-268).

2.2 Sensitivity to ouabain The sensitivity of the transfected chimeric cDNA to ouabain toxicity was measured in vitro. 10 μM ouabain induces cell death of wild-type HeLa and COS-7, whereas rat OuaR constructs confer ouabain resistance and survive HeLa and COS-7 expressing this α1-subunit. The viability of the transfected HeLa cells was recorded after 24 hours incubation with ouabain. After 48 hours of incubation, the viability of the transfected COS-7 cells was recorded, then trypsinized and contacted with 10 μM ouabain for an additional 48 hours. Cells transfected with the chimeric cDNA having the 5 ′ end of the rat sequence chimeric cDNA were resistant to 10 μM ouabain, whereas cells transfected with the construct having the 5 ′ end of the human sequence were It was killed by ouabain-induced cell death, regardless of the rest of the composition (Fig. 1). The positive control (pEGGFPR) conferred resistance to the transfected cells, while the negative control (pEGGFPH) and unintroduced cells were removed by ingestion with ouabain. Therefore, the amino acids important for the 10 μM ouabain resistant phenotype are located within the amino terminus of the chimeric α1-subunit, more precisely within the first 129 amino acids. The ouabain binding site is presumed to be close to the membrane on the extracellular surface. Thus, the inventor believes that the amino acids within and at the end of the H1-H2 junction are of particular importance with respect to the 10 μM ouabain resistant phenotype of the rat-human chimeric α1-subunit protein.

Experimental part added in the year that claimed priority
3. Materials and methods
3.1 Site-directed mutagenesis pEGGFPH was used as a template to make H-Q118R, H-Q118R; A119S, H-Q126P; N129D, H-N129D. The following primers were used to create overlapping segments that were ligated and amplified by PCR;
TTGTTTCTTGGCTTATAGTATCGAGCTGTCTACAGAAGAGGAACCT (Q118R forward) (SEQ ID NO: 15),
AGGTTCCCTCTTCTGTAGCAGCTCCGATACTATAAGCCAAGAAACAA (Q118R reverse) (SEQ ID NO: 16),
TTGTTTCTTGGCTTATAGATCCGATCAGCTACCAGAGAAGGAACCT (Q118R; A119S forward) (SEQ ID NO: 17),
AGGTTCCCTCTTCTGTAGCTGATCGGATACTATAAGCCAAGAAAAAA (Q118R; A119S reverse) (SEQ ID NO: 18),
AGAAGAGGAACCTCCAAACGATGATCTGTACCTGGGG (Q126P; N129D forward) (SEQ ID NO: 19),
CCCAGGTACAGATCATCGTTTGGAGGTTCCCTCTCT (Q126P; N129D reverse) (SEQ ID NO: 20),
AGAAGAGGAACCTCAAAACGATGATCTGTACCTGGGG (N129D forward) (SEQ ID NO: 21),
CCCAGGTACAGATCATCGTTTTGAGGTTCCCTCTCT (N129D reverse) (SEQ ID NO: 22).

  Using the cDNA encoding one or two amino acid substitutions described above as a template, H (Q118R; A119S; Q126P; N129D), H (Q118R; Q126P; N129D), H (Q118R; N129D) and H (Q118R) A119S; N129D) and the above primers were used again. These constructs were cloned into a TOPO vector (Invitrogen) as described for the chimeric cDNA. AccI excised fragments (including the mutated region) of these clones were inserted into and replaced by pEGFPH cut with AccI. The final cDNA is as follows; pEGGFPH-Q118R; A119S; Q126P; N129D, pEGGFPH-Q118R; Q126P; N129D, pEGGFPH-Q118R; N129D, pEGGFP-Q118R; A119S; Q126P; N129D pEGGFPH-N129D. These constructs were produced by amplification as described for the chimeric cDNA. Mutated cDNA was confirmed by restriction enzyme mapping and partial sequence analysis.

3.2 Cell line human epithelial cancer HeLa (ATCC, Manassas, VA, USA), Phoenix GP (lymphoblast C1R-sB7) are available from Dept. of Molecular Pharmacology, Stanford University Medical Center (Stanford, California, USA). The mouse retrovirus-producing cell line PG13 with GaLV envelope, obtained from ATCC with permission of Dr. Nolan, was inactivated with Dulbecco's modified minimal essential medium (DMEM) glutamax-1 and 10% heat. Cultured in fetal bovine serum (Gibco). To grow, cells were washed twice with PBS (Gibco) and incubated for about 5 minutes in saline (Sigma) containing 0.025% porcine trypsin. Trypsin was inactivated by addition of FBS.

3.3 DNA transfection and ouabain toxicity analysis For transfection, Fugene 6 reagent (Roche Boehringer Mannheim, Germany) was used according to the manufacturer's instructions. Briefly, plasmid DNA (2 μg per 10 ⁵ cells) and reagent (5 μl) were mixed in a 100 μl volume of cell culture medium DMEM glutamax, incubated for 15 minutes and then added to the cells. Uabain (Sigma, St. Louis, MO, USA) was dissolved in DMEM as a 10 mM stock solution. For selection experiments, 10-500 μM was used. Ouabain was added to the cells 24 hours after transfection. Forty-eight hours after transfection, cells were trypsinized and transferred to ouabain-free medium. Cell viability was quantified spectrophotometrically using WST-1 cell proliferation reagent (Roche) according to the manufacturer's instructions.

NheI of 700bp from pMP71-EGFP containing 3.4 retroviral vector construct multiple cloning site; the XhoI3'-LTR fragment, by insertion into XbaI site in SF91 _MCS, to prepare a pMP91 _MCS. Retrovirus vector pMP91-H (Q118R; N129D) cut with HindIII and SalI, vector pMP91 _MCS , pGC1-H (Q118R; N129D) HindIII; BglII fragment, and BglII from pGC3-R1 ^st H; SalI fragment It was prepared as a three-point DNA ligation (including a HindIII site introduced downstream of the stop codon by PCR).

3.5 Production of virus supernatant Recombinant retroviral vectors were produced by transient transfection of Phoenix GP. Cells were plated at a concentration of 100,000 in a 6-well plate. The next day, Fugene 6 reagent was used according to the protocol described above, and the cells were transformed into vector plasmid (3.75 μg) and pMDG (0.75 μg) (D. Trono, Dept of Genetics and microbiology, University of Geneva, Geneva, Switzerland). Provided, encoding vesicular stomatitis virus glycoprotein (VSV-G)). Forty-eight hours after transfection, the supernatant was collected, filtered, aliquoted and frozen at -70 ° C. A PG13GALV-pseudoproduction cell pool was produced using VSV-G pseudoretroviral vector. PG13 cells were plated at approximately 23000 cells in 6-well plates and introduced using VSV-G (1 ml). Polybrene was used at a concentration of 4-8 μg / ml. Introducing 6 times for 6 consecutive days. The production cell pool was expanded and used to produce the supernatant. The supernatant was collected, filtered through a 0.45 μm filter and frozen.

3.6 HeLa Introduction and Selection HeLa was seeded in 6-well plates at a density of 10 ⁵ / well. The supernatant (200 μl) of frozen pMP91-H (Q118R; N129D) recovered from the PG13 producing cell pool (about 5000 TU / ml) was warmed to 37 ° C. and added to the cells. 8 μg / ml polybrene was added. 24 hours after introduction, ouabain was added to the culture at a concentration of 10 μM. After 48 hours of ouabain selection, cells were washed twice with PBS. The introduced and selected cells were then grown in ouabain-free medium.

4). result
4.1 Engineered ouabain resistance of human proteins We planned to determine the key amino acids involved in increasing the ouabain resistance of the cDNA of chimeric rat-human Na ⁺ , K ⁺ ATPase α1. The ouabain binding site is presumed to be close to the membrane on the extracellular surface. The inventor therefore hypothesized that amino acids in and adjacent to the H1-H2 junction may have particular importance for the 10 μM ouabain resistant phenotype. Since the four positions in the H1-H2 junction (positions 118-129, human amino acid sequence) differ between the human α1-subunit sequence and the rat α1-subunit sequence, the present inventors Q118, A119, Q126, and N129) were speculated to be important for the ouabain resistance of the chimeric rat-human Na ⁺ , K ⁺ ATPase α1 cDNA. In human cDNA, by substituting the amino acids at these positions from human to rat, such as Q118R, A119S, Q126P, N129D, which of these are α1- of recombinant human Na ⁺ , K ⁺ ATPase It can be assessed whether it is necessary and sufficient to increase the resistance of a subunit to 10 μM ouabain. Amino acid substitutions were made by site-directed mutagenesis using PCR technology. The mutated genes are as follows: H-Q118R; A119S; Q126P; N129D, H-Q118R; A119S; Q126P, H-Q118R; A119S, H-Q126P; N129D, H-Q118R; N129D, H-Q118R, and , H-N129D. Mutant human cDNA was fused in frame with EGFP in the GC1 plasmid using the method described for the chimeric cDNA.

4.2 Transfection and selection of human cell lines HeLa cells were transfected with a plasmid carrying the EGFP mutant human cDNA, followed by 24 hours incubation in 10 μM ouabain 24 hours after transfection. Mutant genes H-Q118R; A119S; Q126P; N129D, H-Q118R; A119S; Q126P, and H-Q118R; N129D conferred ouabain resistance, but H-Q118R; A119S, H-Q126P; N129D, H -Q118R and H-N129D were not imparted with resistance. In conclusion, substitution at two positions; Q118R and N129D is necessary and sufficient to confer 10 μM ouabain resistance of human Na ⁺ , K ⁺ ATPase α1. To determine how much ouabain resistance was conferred by minimally mutated human Na ⁺ , K ⁺ ATPase α1, a dose response analysis was performed. HeLa cells were transiently transfected with plasmids pEGGFPH-Q118R; N129D or pEGGFPR. At 24 hours, cells expressed sufficient amounts of the fusion gene for selection with ouabain. The transfected cells were selected with various concentrations of ouabain (10-500 μM) for 24 hours followed by transfer to ouabain-free medium and quantified using WST-1 proliferative material. The results are shown in FIG. After 24 hours of ouabain, control and untransfected cells were removed, but cells transfected with either rat OuaR or human Q118R; N129D-substituted Na ⁺ , K ⁺ ATPase α1 cDNA were 10 and Survived at 10 μM ouabain concentration. 500 μM ouabain was toxic to cells transfected with the mutant human construct and was also shown to be generally somewhat toxic to cells transfected with rat OuaR. Dead cell debris and cells dissociated during ouabain selection were washed and transferred to ouabain-free medium. No viable cells were observed from dissociated cells and dead cell debris (data not shown).

4.3 Production of Retroviral Vectors and Gene Transfer We were able to introduce H-Q118R; N129D cDNA into target HeLa cells using the PG13 MP91H-Q118R; N129D retroviral producer cell pool. The degree of superinfection (MOI) was <0.05. Therefore, it is very unlikely that the introduced cells will integrate more than one retroviral copy per cell. To obtain a purely transfected cell population, 10 μM ouabain was added for 48 hours 24 hours after introduction. Selected cell populations were further expanded and grown in growth media without ouabain. Transient transfection with plasmid DNA transfers thousands of gene copies per cell, resulting in high expression of the transgene. In this experiment, it was found that even a single gene copy expressed H-Q118R; N129D cDNA in an amount sufficient to confer 10 μM ouabain resistance.

  While the present invention has been described with reference to preferred embodiments that constitute the best mode recognized by the inventors, various changes and modifications will become apparent to those skilled in the art without departing from the scope of the invention. And can be made in accordance with the description of the claims appended hereto.

Figure 2 shows a schematic of the constructs tested for resistance to ouabain-induced cell death. Figure 8 illustrates the results of selecting HeLa cells with ouabain after transient transfection.

Claims (27)

Recombinant Na ⁺ , K ⁺ ATPase protein comprising:
The α1-subunit of the recombinant protein is at least 98% homologous to the α1-subunit of the corresponding human Na ⁺ , K ⁺ ATPase protein at the amino acid level, wherein the α1-subunit of the human protein The amino acid sequence of is the sequence set forth in SEQ ID NO: 1, or any functionally equivalent homologue thereof;
The difference in amino acid sequence between the α1-subunit of the protein and the α1-subunit of the corresponding human Na ⁺ , K ⁺ ATPase is located between amino acid numbers 65-133; and
The recombinant Na ⁺ , K ⁺ ATPase protein is resistant to a cardiac glycoside selected from ouabain, digoxin, digitoxin, prosilaridin A, palytoxin and combaratoxin;
A protein as described above. The set of claim 1, wherein the α1-subunit of the protein differs from the α1-subunit of the corresponding human Na ⁺ , K ⁺ ATPase protein with respect to at least one amino acid located between amino acid numbers 117-133. Modified Na ⁺ , K ⁺ ATPase protein. 2. The protein α1-subunit differs from the corresponding human Na ⁺ , K ⁺ ATPase protein α1-subunit with respect to a maximum of 10 amino acids located between amino acid numbers 117-130. Recombinant Na ⁺ , K ⁺ ATPase protein. 2. The α1-subunit of a protein differs from the α1-subunit of the corresponding human Na ⁺ , K ⁺ ATPase protein with respect to a maximum of 4 amino acids located between amino acid numbers 117-130. Recombinant Na ⁺ , K ⁺ ATPase protein. 2. The α1-subunit of the protein differs from the corresponding α1-subunit of the human Na ⁺ , K ⁺ ATPase protein with respect to a maximum of two amino acids located between amino acid numbers 117-130. Recombinant Na ⁺ , K ⁺ ATPase protein. The recombinant Na ⁺ , K ⁺ ATPase according to claim 5, wherein the α1-subunit of the protein differs from the corresponding α1-subunit of the human Na ⁺ , K ⁺ ATPase protein at amino acid numbers 118 and 129. protein. The recombinant Na ⁺ , K ⁺ ATPase protein according to any one of claims 1 to 6, wherein the protein is resistant to at least 10 ^-7 M ouabain. The recombinant Na ⁺ , K ⁺ ATPase protein according to claim 1 or 2, wherein the α1-subunit of the protein comprises the sequence set forth in SEQ ID NO: 2. The recombinant Na ⁺ , K ⁺ ATPase protein according to claim 1 or 2, wherein the α1-subunit of the protein comprises the sequence set forth in SEQ ID NO: 23. A nucleic acid construct or a functional homologue thereof encoding the α1-subunit of the recombinant Na ⁺ , K ⁺ ATPase protein according to any one of claims 1-9.   11. The nucleic acid construct of claim 10, which is the sequence set forth in SEQ ID NO: 3, or any functionally equivalent homologue thereof.   11. The nucleic acid construct of claim 10, which is the sequence set forth in SEQ ID NO: 24, or any functionally equivalent homologue thereof. The method for producing a recombinant Na ⁺ , K ⁺ ATPase protein according to any one of claims 1 to 9. Recombinant ouabain resistant Na ^+, a process for the preparation of K ⁺ ATP-ase protein, human Na ^+, alpha 1-subunit gene K ⁺ ATP-ase, the corresponding human Na ^+, K ⁺ ATP-ase of alpha 1-subunit In order to produce a recombinant α1-subunit protein or any functionally equivalent homologue thereof that is at least 98% homologous at the amino acid level, said modification comprising amino acid numbers 65-133 of SEQ ID NO: 1. The method as described above, which is an amino acid substitution located between. 15. The cDNA or gene of the α1-subunit of human Na ⁺ , K ⁺ ATPase is modified so that at least one amino acid substitution is introduced for an amino acid contained between amino acid numbers 117-130. The method described. The α1-subunit gene of human Na ⁺ , K ⁺ ATPase has been modified to introduce specific amino acid substitutions, which change is a substitution of up to 10 amino acids contained between amino acid numbers 117-130. The method of claim 14, comprising: The cDNA or gene of the α1-subunit of human Na ⁺ , K ⁺ ATPase has been modified to introduce specific substitutions into the amino acids of the protein, and the change is an amino acid contained between amino acid numbers 117-130. 15. The method of claim 14, comprising a maximum of 4 substitutions. The 5 ′ end of the cDNA or gene of the α1-subunit of human Na ⁺ , K ⁺ ATPase has been modified to introduce specific substitutions into the amino acids of the protein, the changes being amino acid numbers 117-130. 15. A method according to claim 14 consisting of up to two substitutions of amino acids contained between. The cDNA or gene of the α1-subunit of human Na ⁺ , K ⁺ ATPase has been modified to introduce specific substitutions into the amino acids of the protein, the changes being substitutions at amino acid numbers 118 and 129. Item 19. The method according to Item 18.   A step in a gene therapy method, wherein the recombinant protein according to any one of claims 1 to 9 is used for selection of genetically modified cells in vitro.   A step in a method used for the study of toxicity mechanisms, characterized in that the recombinant protein according to any one of claims 1 to 9 is used in an in vitro study. The recombinant protein according to any one of claims 1 to 9, for use in a pharmacological study of a substance that directly or indirectly affects a mammalian Na ⁺ , K ⁺ ATPase.   The nucleic acid construct according to any one of claims 10 to 12, or any equivalent homologue thereof, which forms a functional part of a gene transfer vector.   A genetically modified initial normal human or human tumor cell, human, comprising a donor, patient or source of a third element or any combination thereof comprising a nucleic acid construct according to any one of claims 10-12. Chimeric cells, or non-human cells, partially or fully natural or synthetic cells.   25. The genetically modified cell of claim 24, wherein the cell is a eukaryotic cell.   25. The genetically modified cell of claim 24, wherein the cell is a human cell.   Of a donor, patient or third element that expresses a recombinant protein according to any one of claims 1 to 9 transferred by a mechanism (eg exosomes and liposomes, or functional equivalents thereof). Initial normal human or human tumor cells, human chimeric cells, or non-human cells, partially or fully natural or synthetic cells of source or any combination thereof.

Images