JP2006516184A - Human CD3-specific antibody with immunosuppressive properties - Google Patents

Abstract

Monovalent and multivalent scFv-antibodies containing binding sites specific for human T cell CD3 are described. These antibodies are highly immunosuppressive and do not cause significant release of cytokines. Furthermore, a polynucleotide encoding the antibody and a vector containing the polynucleotide, a host cell transformed thereby and their use in the production of the antibody are described. Pharmaceutical compositions containing any of the above polynucleotides, antibodies or vectors are useful for immunotherapy, preferably acute graft rejection.

Description

Detailed Description of the Invention

  The present invention relates to monovalent and multivalent scFv-antibodies containing binding sites specific for the human T cell marker CD3. The antibodies of the present invention are highly immunosuppressive and do not cause significant release of cytokines. The invention also relates to polynucleotides encoding the antibodies and vectors containing the polynucleotides, host cells transformed thereby and their use in the production of the antibodies. Finally, the invention relates to a composition, preferably a pharmaceutical composition, containing any of the above polynucleotides, antibodies or vectors. The pharmaceutical composition is useful for immunotherapy (preferably against acute graft rejection).

OKT3, a mouse IgG2a mAb directed to the ε-chain of the CD3 complex on human T lymphocytes (Salmeron et al., J. Immunol. 147 (1991), 3047-3052) and produced by a hybridoma having ATCC accession number CRL8001 Is used to prevent tissue rejection after kidney and liver transplantation and provides an alternative treatment for graft rejection that is refractory to corticosteroids. In vivo, administration of OKT3 induces a dramatic decrease in the number of circulating CD3 ⁺ cells as it downmodulates the T cell receptor (TCR). However, side effects can occur on the first day of treatment. Chills and fever often follow OKT3 administration, and patients sometimes suffer from nausea, vomiting, diarrhea, dyspnea, wheezing, and aseptic meningitis. Many of these side effects are due to cytokine release (especially from T cells). After longer use, many patients develop a human anti-mouse antibody (HAMA) response.

The binding of OKT3 alone is insufficient to trigger T cells. T cell proliferation that induces the release of cytokines such as IL-2, IL-6, TNF-α and IFN-γ results from the cross-linking of T cells and FcR-bearing cells. Human IgG Fc receptors (FcγRI, FcγRII, FcγRIII) are distributed on human monocytes / macrophages, B lymphocytes, NK cells and granulocytes. They all bind to the C _H 2 regions of both mouse and human IgG with different affinities. The immunogenicity of such anti-CD3 Ab is reduced by using chimeric antibodies made from the variable domains of murine mAb and the constant region of human Ab. In order to reduce binding to Fc receptors, Fc domains derived from specific classes of human IgG are used, or mutations are introduced into the Fc domains that bind to Fc receptors. However, Fc domain interaction could not be completely eliminated and the efficiency of immunosuppressive activity did not increase.

  Thus, the technical problem underlying the present invention is to provide a more appropriate means to prevent allograft responses that overcome the disadvantages of the prior art means.

The solution to the above technical problem is achieved by providing the embodiments characterized in the claims. Although more efficient antibodies in suppressing T cell activation and proliferation by down-regulating the CD3 molecule have been constructed, they do not cause massive release of cytokines and thus many of the unpleasant side effects It can be avoided. These antibodies contain only variable immunoglobulin domains, so-called Fv modules, by means by which unwanted immune responses can be avoided. The Fv module is formed by the association of immunoglobulin heavy and light chain variable domains, _VH and _VL , respectively. Preferred embodiments of these antibodies are based solely on the variable domain of the OKT3 antibody, but contain serine instead of cysteine at position H100A (according to Kabat numbering system) of the heavy chain. This mutation was previously shown to improve the stability of single chain Fv molecules (Kipriyanov et al., Protein Engineering 10 (1997), 445-453). Surprisingly, such antibodies, and in particular the so-called diabody mode of bivalent antibodies, have greater immunity than the original parent OKT3 as measured by CD3 down-regulation and inhibition of T cell proliferation in a mixed lymphocyte reaction (MLR). Has an inhibitory effect and did not cause significant release of cytokines IFN-α and IL-2 in contrast to parental OKT3.

Accordingly, the present invention provides the following features:
(a) can suppress the immune response;
(b) lacks a constant antibody region; and
(c) binds to an epitope on the CD3 complex of the T cell receptor,
Relates to an antibody characterized by

  The antibodies of the invention are specific for the human TCR / CD3 complex on all T cells regardless of their MHC specificity. Such antibodies can suppress activated T lymphocytes without any significant release of inflammatory cytokines, thus avoiding many of the unpleasant side effects. The release of cytokines such as IL-2, IFN-γ and TNF-α is more than 100 times less than that of OKT3. This is in sharp contrast to any known immunosuppressive antibody. Immunosuppression can be achieved by administering such conventional antibodies to humans, but their efficacy depends on two factors: early dosing syndrome resulting from T cell activation, and multiple rounds of foreign proteins of non-human origin. Impaired by antiglobulin response (eg, HAMA response) resulting from administration. Symptoms of antibody toxicity include fever, chills, diarrhea and vomiting, leading to death in severe cases. The syndrome is caused by the release of inflammatory cytokines as a result of transient T cell activation. Such activation relies on the interaction of the Fc portion of the antibody on the accessory cell with the Fc receptor (FcR) to crosslink the CD3 complex on the T cell. The Fc portion of the mAb of mouse origin is also the main reason for the antiglobulin response. The antibodies of the present invention lack immunoglobulin constant domains and are therefore unable to interact with FcR and are much less immunogenic.

The antibodies of the present invention can be prepared by methods known to those skilled in the art, for example, by the following methods:
(a) combining the genes encoding at least two immunoglobulin variable _VH and _VL domains, either separated by a peptide linker or without a linker, into a single genetic construct and combining it with bacteria or other Of single chain Fv-antibodies by expression in an appropriate expression system.
(b) Prevent their intramolecular pairing of single chain Fv antibodies containing at least two _VH and _VL specific for human CD3, either separated by a peptide linker or without a linker Non-covalent dimerization or multimerization in the direction.

  The term “can suppress the immune response” means that the antibody can, on the one hand, prevent the activation of T lymphocytes by foreign alloantigens and, on the other hand, selectively deplete already activated T cells. Means that you can.

  The antibodies of the present invention can be monovalent, divalent or multivalent antibodies.

In a preferred embodiment, an antibody of the invention is a non-covalent dimer of a single chain Fv antibody (scFv) containing sc3-specific V _H and _VL domains, either separated by a peptide linker or without a linker (“ Diabody ”(see FIG. 1).

In a further preferred embodiment, the antibody of the invention comprises two single chain Fv antibodies (scFv) (see FIG. 1) containing CD3-specific V _H and V _L domains.

In a further preferred embodiment, the antibody of the invention is a single chain diabody (see FIG. 1) containing CD3-specific V _H and V _L domains.

The term “Fv antibody” as used herein relates to an antibody comprising a variable domain but no constant domain. The term “peptide linker” as used herein relates to any peptide capable of linking two variable domains having a length depending on the type of variable domain to be linked. The peptide linker may contain any amino acid residue, but the amino acid combination SAKTTP or SAKTTPKLGG is preferred. Peptide linkers linking (scFv) ₂ and a single scFv of a single chain diabody (scDb) can contain any amino acid residue, but 1-3 amino acid combinations of GGGGS are preferred for (scFv) ₂ and GGGGS 3 to 4 repeats are preferred for scDb.

  In a more preferred embodiment, the antibody of the invention substantially corresponds to the variable domain of the antibody produced by the hybridoma of ATTC accession number CRL8001.

  In an even more preferred embodiment, the antibody of the invention is characterized in that the cysteine at position H100A (Kabat numbering system) is replaced with another amino acid, preferably serine.

  The present invention also relates to a polynucleotide encoding the antibody of the present invention and a vector, preferably an expression vector, containing the polynucleotide. Recombinant vectors can be constructed according to methods well known to those skilled in the art; see, for example, Sambrook, Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory (1989) N.Y.

  Various expression vector / host systems contain and express sequences encoding the antibodies of the invention. These include: bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors; microorganisms such as yeast transformed with yeast expression vectors; insect cell lines infected with viral expression vectors (eg, baculovirus) Plant cell lines transformed with viral expression vectors (eg, cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or bacterial expression vectors (eg, Ti or pBR322 plasmid); or animal cell lines including but not limited to: Not.

  “Control elements” or “regulatory sequences” are untranslated regions of the vector—enhancers, promoters, 5′- and 3′-untranslated regions that interact with host cell proteins for transcription and translation. Such elements can vary in their strength and specificity. Depending on the vector system and host used, any number of suitable transcription and translation elements, including constitutive and inducible promoters, can be used. For example, when cloning in a bacterial system, an inducible promoter such as a hybrid lacZ promoter such as Bluescript.RTM. Phagemid (Stratagene, LaJolla, Calif.) Or pSport1.TM plasmid (Gibco BRL) may be used. The baculovirus polyhedrin promoter can be used in insect cells. Promoters or enhancers from plant cell genomes (eg, heat shock, RUBISCO; and storage protein genes) or plant viruses (eg, viral promoters or leader sequences) can be cloned into vectors. In mammalian cell systems, promoters derived from mammalian genes or mammalian viruses are preferred. If it is necessary to generate a cell line that contains multiple copies of a sequence that encodes a multicopy multivalent multimer, vectors based on SV40 or EBV can be used with an appropriate selectable marker.

  In bacterial systems, a number of expression vectors may be selected depending upon the use intended for the antibody of the invention. Suitable vectors for use in the present invention include, but are not limited to, pSKK expression vectors for expression in bacteria.

  In the yeast, Saccharomyces cerevisiae, a number of vectors containing constitutive or inducible promoters such as alpha factor, alcohol oxidase, and PGH can be used; for a review, Grant et al. (1987) Methods Enzymol. 153: 516-544 reference.

  Where plant expression vectors are used, the expression of sequences encoding the antibodies of the invention can be driven by any number of promoters. For example, viral promoters such as the CaMV 35S and 19S promoters can be used alone or in combination with TMV-derived omega leader sequences (Takamatsu, N. (1987) EMBO J. 6: 307-311). Alternatively, plant promoters such as RUBISCO or the small subunit of the heat shock promoter can be used (Coruzzi, G. et al. (1984) EMBO J. 3: 1671-1680; Broglie, R et al. (1984) Science 224: 838 -843; and Winter, J. et al. (1991) Results Probl. Cell Differ. 17: 85-105). These constructs can be introduced into plant cells by direct DNA transformation or pathogen-mediated transfection. Such techniques are described in numerous publicly available reviews (eg, Hobbs, S. and Murry, L.E., McGraw Hill, Yearbook of Science and Technology (1992) New York, N.Y .; pp.191-196).

  Insect systems can also be used to express the antibodies of the invention. For example, in one such system, Autographa Californica nuclear polynuclear virus (AcNPV) is used as a vector to express foreign genes in Spodoptera frugiperda cells or Trichoplusia larvae. The sequence encoding the antibody can be cloned into a non-essential region of a virus such as the polyhedrin gene and placed under the control of the polyhedrin promoter. Successful insertion of the gene encoding the antibody inactivates the polyhedrin gene and produces a recombinant virus that lacks the coat protein. The recombinant virus can then be used to infect S. frugiperda cells or Trichoplusia larvae in which APOP can be expressed (Engelhard, EK et al. (1994) Proc. Nat. Acad. Sci. 91: 3224-3227) .

  A number of viral-based expression systems can be used in mammalian host cells. When an adenovirus is used as an expression vector, the sequence encoding the antibody of the present invention may be ligated to an adenovirus transcription / translation complex consisting of the late promoter and tripartite leader sequence. Insertions in the nonessential E1 or E3 region of the viral genome can be used to obtain viable viruses capable of expressing antibodies in infected host cells (Logan, J. and Shenk, T. (1984) Proc. Natl. Acad. Sci. 81: 3655-3659). In addition, transcription enhancers such as the Rous sarcoma virus (RSV) enhancer can be used to increase expression in mammalian host cells.

  Human artificial chromosomes (HACs) can also be used to deliver larger pieces of DNA than are contained in plasmids and can be expressed. 6-10 M HAC is constructed and delivered by conventional delivery methods (liposomes, polycationic aminopolymers, or vesicles) for therapeutic purposes.

  Specific initiation signals can also be used to achieve more efficient translation of sequences encoding the antibodies of the invention. Such signals include the ATG start codon and adjacent sequences. In cases where the antibody coding sequence, its initiation codon, and upstream sequences are inserted into the appropriate expression vector, no additional transcriptional or translational control signals may be required. However, when the coding sequence is inserted, an exogenous translational control signal containing the ATG start codon should be provided. Furthermore, the start codon should be in the correct reading frame to ensure translation of the entire insert. Exogenous translation elements and initiation codons can be of various origins, both natural and synthetic. The efficiency of expression can be enhanced by including appropriate enhancers in the particular cell line used, such as those described in the literature (Scharf, D et al. (1994) Results Probl. Cell Differ. 20: 125- 162).

  In addition, a host cell strain can be chosen for its ability to modulate the expression of the inserted sequences or to process the expressed antibody chains in the desired fashion. Post-translational processing that cleaves the “prepro” form of the protein can also be used to facilitate correct insertion, folding, and / or function. Various host cells with specific cell machinery are available from the American Type Culture Collection (ATCC; Bethesda, Md.) And can be selected to ensure correct modification and processing of the foreign antibody chains.

  Stable expression is preferred for long-term, high-yield production of recombinant antibodies. For example, a cell line that stably expresses an antibody may contain viral origins of replication and / or endogenous expression elements and a selectable marker gene on the same or another vector. Following the introduction of the vector, the cells are grown for 1-2 days in enriched media before being transferred to selective media. The purpose of the selectable marker is to confer resistance to selection, and its presence allows the growth and recovery of cells that successfully express the introduced sequence. Resistant clones of stably transformed cells can be propagated using tissue culture techniques appropriate to the cell type.

  Any number of selection systems may be used to recover transformed cell lines. These include the herpes simplex virus thymidine kinase (Wigler, M. et al. (1977) Cell 11: 223-32) gene and adenine phosphoribosyltransferase (Lowy), which can be used in tk.sup. And aprt.sup. Cells, respectively. , I. et al. (1980) Cell 22: 817-23), but not limited to. Antimetabolite, antibiotic or herbicide resistance can also be used as a basis for selection; for example, ghfr conferring resistance to methotrexate (Wigler, M. et al. (1980) Proc. Natl. Acad. Sci. 77: 3567-70); npt conferring resistance to aminoglycosides, neomycin and G-418 (Colbere-Garapin, F. et al. (1981) J. Mol. Biol. 150: 1-14) and chlorsulfuron and phosphino, respectively. Als and pat conferring resistance to tricine (Murry, supra). Additional selectable genes have been described, for example trpB, which allows cells to utilize indole instead of tryptophan, or hisD, which allows cells to utilize histinol instead of histidine (Hartman, SC And RC Mulligan (1988) Proc. Natl. Acad. Sci. 8: 8047-51). Recently, anthocyanins, β-glucuronidases and their substrates are widely used not only to identify transformants, but also to quantify the amount of transient or stable protein expression resulting from a particular vector system The use of GUS and visible markers such as luciferase and its substrate luciferin has gained popularity (Rhodes, CA et al. (1995) Methods Mol. Biol. 55: 121-131).

  A particularly preferred expression vector is pSKK3-scFv6_anti-CD3 deposited on August 16, 2002 at DSM 15137 and deposited with DSMZ (Deutsche Sammlung fuer Mikroorganismen und Zellen) according to the Budapest Treaty.

  The present invention also relates to a composition containing the antibody, polynucleotide or expression vector of the present invention. Preferably, the composition is a pharmaceutical composition, preferably in combination with a suitable pharmaceutical carrier. Examples of suitable pharmaceutical carriers are well known in the art and include phosphate buffered saline, water, emulsions such as oil / water emulsions, various types of wetting agents, sterile solutions, and the like. Such carriers can be formulated according to conventional methods and administered to a subject at an appropriate dosage. Administration of suitable compositions can be accomplished by a variety of methods, for example, intravenous, intraperitoneal, subcutaneous, intramuscular, topical or intradermal administration. Of course, the route of administration will depend on the type of treatment and the type of compound contained within the pharmaceutical composition. The dosage regimen will be determined by the attending physician and other clinical factors. As is well known in the medical field, the dose for any one patient is determined by the patient's physique, body surface area, age, gender, specific compound to be administered, time and route of administration, type of treatment, general health condition and administration It depends on many factors, including other drugs you are doing.

  A preferred medical use of the compounds of the present invention described above is immunotherapy, preferably acute graft rejection, or treatment of autoimmune diseases such as type I diabetes, multiple sclerosis and rheumatoid arthritis.

  The following examples illustrate the invention in more detail.

Example 1: Construction of plasmids pHOG-scFv10 / anti-CD3, pHOG-scFv6 / anti-CD3, pSKK-scFv10 / anti-CD3 and pSKK-scFv6 / anti-CD3 for expression of anti-CD3 scFv ₁₀ and scFv ₆ antibodies in bacteria To construct the genes encoding CD3 scFv ₁₀ and scFv ₆ (FIG. 2), the plasmid pHOG21-dmOKT3 (Kipriyanov et al., 1997, Protein Engineering 10, 445-453) containing the gene for anti-human CD3 scFv ₁₈ was used. . To facilitate the cloning procedure, a NotI restriction site was introduced into the plasmid pHOG21-dmOKT3 by PCR amplification of the scFv ₁₈ gene using primers Bi3sk, 5'-CAGCCGGCCATGGCGCAGGTGCAACTGCAGCAG and Bi9sk, 5'-GAAGATGGATCCAGCGGCCGCAGTATCAGCCCGGTT. The resulting 776 bp PCR fragment was digested with NcoI and NotI and cloned into the NcoI / NotI linearization vector pHOG21-CD19 (Kipriyanov et al., 1996, J. Immunol. Methods 196, 51-62) and thus Thus, plasmid pHOG21-dmOKT3 + Not was prepared. The gene encoding the OKT V _H domain with a Cys-Ser substitution at position 100A according to the Kabat numbering scheme (Kipriyanov et al., 1997, Protein Engineering 10, 445-453) is expressed as primers DP1, 5'-TCACACAGAATTCTTAGATCTATTAAAGAGGAGAAATTAACC and DP2, 5 ' Amplification was performed by PCR using either -AGCACACGATATCACCGCCAAGCTTGGGTGTTGTTTTGGC or OKT_5,5'-TATTAAGATATCGGGTGTTGTTTTGGCTGAGGAG, and V _H genes followed by 10 and 6 amino acid linkers, respectively, were prepared (FIG. 2). The resulting 507 bp and 494 bp PCR fragments were digested with NcoI and EcoRV and cloned into the NcoI / EcoRV linearized plasmid pHOG21-dmOKT3 + Not, thus plasmids pHOG21-scFv10 / anti-CD3 and pHOG21-scFv6 / Anti-CD3 was prepared respectively.

In order to increase the yield of functional scFv antibody within the bacterial periplasm, an optimized expression vector pSKK3 was constructed (FIG. 3). This vector is a plasmid pHKK (Horn et al., 1996, Appl. Microbiol. Biotechnol. 46, 524-532) containing the hok / sok plasmid-free cell suicide system (Thisted et al., 1994, EMBO J. 13, 1960-1968). Built on the basis of. First, a gene encoding hybrid scFv V _H 3-V _L 19 was obtained from plasmid pHOG3-19 (Kipriyanov et al., 1998, Int. J. Cancer 77, 763-772) from primers 5-NDE, 5′-GATATACATATGAAATACCTATTGCCTACGGC and Amplification was performed by PCR using 3-AFL, 5'-CGAATTCTTAAGTTAGCACAGGCCTCTAGAGACACACAGATCTTTAG. The resulting 921 bp PCR fragment was digested with NdeI and AflII and cloned into the NdeI / AflII linearized plasmid pHKK to produce the vector pHKK3-19. To delete the extra XbaI site (encoding the lac repressor) that is a fragment of the pHKK plasmid that contains the 3'-end of the lacI gene, a strong transcription terminator tHP and a wild-type lac promoter / operator are used as primers Amplification was performed by PCR using 5-NAR, 5'-CACCCTGGCGCCCAATACGCAAACCGCC and 3-NDE, 5'-GGTATTTCATATGTATATCTCCTTCTTCAGAAATTCGTAATCATGG. The resulting 329 bp DNA fragment was digested with NarI and NdeI and cloned into the NarI / NdeI linearized plasmid pHKK3-19 to produce the vector pHKK Xba. In order to introduce a gene encoding the Skp / OmpH periplasmic factor for higher recombinant antibody production (Bothmann and Plueckthun, 1998, Nat. Biotechnol. 16, 376-380), the skp gene was added to the primer Skp-3, 5'-CGAATTCTTAAGAAGGAGATATACATATGAAAAAGTGGTTATTAGCTGCAGG and Skp-4, 5'-CGAATTCTCGAGCATTATTTAACCTGTTTCAGTACGTCGG were amplified by PCR using plasmid pGAH317 as a template (Holck and Kleppe, 1988, Gene 67, 117-124). The resulting 528 bp PCR fragment was digested with AflII and Xhol and cloned into the AflII / Xhol digested plasmid pHKK Xba, resulting in the expression plasmid pSKK2. To remove the sequence encoding the potential immunogenic c-myc epitope, the NcoI / XbaI linearized plasmid pSKK2 was used to clone the NcoI / XbaI digested 902 bp PCR fragment encoding scFv phOx31E (Marks et al., 1997, BioTechnology 10, 779-783), which was amplified using primer DP1 and His-Xba, 5'-CAGGCCTCTAGATTAGTGATGGTGATGGTGATGGG. The resulting plasmid pSKK3 was digested with NcoI and NotI and plasmids pHOG21-scFv6 / anti-CD3 and pHOG21-scFv10 / anti-CD3 were digested with NcoI and NotI, respectively, and then isolated as 715 bp and 727 bp DNA fragments And used as a vector for cloning the genes encoding the anti-CD3 scFv ₆ and scFv ₁₀ .

  The prepared plasmids pSKK3-scFv6 / anti-CD3 (Figure 3) and pSKK3-scFv10 / anti-CD3 improve plasmid performance and function in the E. coli periplasm under high shake flask culture and high cell density fermentation conditions. Including several features that lead to the accumulation of targeted bivalent products. These are hok / sok post-isolation killing systems that suppress plasmid loss, are strong tandem ribosome binding sites, and genes that encode the periplasmic factor Skp / OmpH that increases the functional yield of antibody fragments in bacteria . This expression cassette is under the transcriptional control of the wt lac promoter / operator system and is a short sequence encoding the N-terminal peptide (lacZ ′) of β-galactosidase (the first rbs from the E. coli lacZ gene, followed by the phage T7 10 genes (with a gene encoding scFv antibody and Skp / OmpH periplasmic factor under the transcriptional control of strong rbs from T7g10). In addition, after both the immunodetection and purification of the recombinant product by immobilized metal affinity chromatography (IMAC), there is a nucleotide sequence encoding 6 histidine residues after the gene of the scFv-antibody.

Example 2: Production and purification of scFv antibody in bacteria E. coli K12 strain RV308 (Δlacχ74 galISII :: OP308strA) (Maurer et al., 1980, J. Mol. Biol. 139, 147-161) (ATCC 31608) Used for functional expression. Bacteria transformed with the expression plasmids pSKK3-scFv6 / anti-CD3 and pSKK3-scFv10 / anti-CD3, respectively, at 26 ° C. in 2 × YT medium (2 × YT _GA ) containing 100 μg / ml ampicillin and 100 mM glucose. Grow overnight. The overnight culture is diluted in fresh 2 × YT _GA medium to an optical density at 600 nm (OD ₆₀₀ ) of 0.1, and as a flask culture, OD at 26 ° C. with vigorous stirring (180-220 rpm) Growth continued until ₆₀₀ reached 0.6-0.8. Bacteria were collected by centrifugation at 5000 g for 10 minutes at 20 ° C. and resuspended in the same volume of fresh YTBS medium (2 × YT containing 1M sorbitol, 2.5 mM glycine betaine and 50 μg / ml ampicillin) did. Isopropyl-β-D-thiogalactopyranoside (IPTG) was added to a final concentration of 0.2 mM and growth was continued at 21 ° C. for 14-16 hours. Cells were harvested by centrifugation at 9000 g for 20 minutes at 4 ° C. To isolate soluble periplasmic proteins, the pelleted bacteria were resuspended in an initial volume of 5% ice-cold 200 mM Tris-HCl, 20% sucrose, 1 mM EDTA, pH 8.0. After 1 hour incubation on ice with occasional agitation, spheroplasts are centrifuged at 30000 g for 30 minutes at 4 ° C. to dissolve soluble periplasmic extracts as supernatant and spheroplasts and insoluble periplasmic substances as pellets. The remaining. The periplasmic extract was dialyzed extensively against 50 mM Tris-HCl, 1M NaCl, pH 7.0 and used as starting material to isolate scFv antibodies. The recombinant product was concentrated by ammonium sulfate precipitation (final concentration 70% saturation). The protein precipitate is recovered by centrifugation (10000 g, 4 ° C, 40 minutes), dissolved in 10% of the initial volume of 50 mM Tris-HCl, 1M NaCl, pH 7.0, and then dialyzed thoroughly against the same buffer. did. Immobilized metal affinity chromatography (using a 5 ml column of Chelating Sepharose (Amersham Pharmacia, Freiburg, Germany) packed with Cu ²⁺ and equilibrated with 50 mM Tris-HCl, 1M NaCl, pH 7.0 (starting buffer). IMAC) was performed at 4 ° C. The sample was loaded by passing through the column by gravity flow. The column was then washed with 20 column volumes of start buffer followed by start buffer containing 50 mM imidazole until the eluate had a minimum absorbance (280 nm) (approximately 30 column volumes). The adsorbed substance was eluted as a 1 ml fraction with 50 mM Tris-HCl, 1M NaCl, 300 mM imidazole, pH 7.0. The eluted fractions containing the recombinant protein were identified by reduction with 12% SDS-PAGE followed by Coomassie staining. Positive fractions were pooled and subjected to solvent exchange with 50 mM imidazole-HCl, 50 mM NaCl (pH 7.0) using a pre-packed PD-10 column (Pharmacia Biotech, Freiburg, Germany). The turbidity of the protein solution was removed by centrifugation (30000 g, 1 hour, 4 ° C.).

Final purification was performed by ion exchange chromatography on a Mono S HR 5/5 column (Amersham Pharmacia, Freiburg, Germany) in 50 mM imidazole-HCl, 50 mM NaCl, pH 7.0 with a 0.05-1 M NaCl gradient. I went to. Fractions containing scFv antibody were concentrated simultaneously with buffer exchange with PBS containing 50 mM imidazole, pH 7.0 (PBSI buffer) using an Ultrafree-15 centrifugal filter device (Millipore, Eschborn, Germany). The protein concentration was measured by the Bradford dye binding assay (Bradford, 1976, Anal. Biochem., 72, 248-254) using the Bio-Rad (Munich, Germany) protein assay kit. SDS-PAGE analysis showed that anti-CD3 scFv ₁₀ and scFv ₆ migrate as a single band with a molecular weight (M _r ) of about 30 kDa (FIG. 4). By size exclusion chromatography on a calibrated Superdex 200 HR 10/30 column (Amersham Pharmacia) that, scFv ₆ is a dimeric form of predominantly M _r about 60 kDa, scFv ₁₀ is a pure monomer Was shown (FIG. 5).

Example 3: Cell binding measurements The human CD3 ⁺ T cell leukemia Jurkat cell line was used for flow cytometry experiments. Cells at 37 ° C. in a humidified atmosphere containing 5% CO ₂ , 10% heat-inactivated fetal calf serum (FCS), 2 mM L-glutamine, 100 U / mL penicillin G sodium, 100 μg / ml streptomycin sulfate (all Invitrogen, Groningen, The Netherlands) was added in RPMI 1640. 1 × 10 ⁶ cells were diluted with 2% heat-inactivated fetal calf serum (FCS, Invitrogen, Groningen, The Netherlands) and 0.1% azimuth containing diluted scFv antibody or mAb OKT3 (Orthoclone, OKT3, Cilag, Sulzbach, Gemany). Incubated for 45 minutes on ice with 0.1 ml phosphate buffered saline (PBS, Invitrogen, Groningen, The Netherlands) supplemented with sodium hydride (Roth, Karlsruhe, Germany). After washing with FACS buffer, cells were incubated with 0.01 mg / ml anti- (His) ₆ mouse mAb 13/45 / 31-2 (Dianova, Hamburg, Germany) in 0.1 ml of the same buffer for 45 minutes on ice. After the second wash cycle, the cells were incubated with 0.115 mg / ml FITC-conjugated goat anti-mouse IgG (Dianova. Hamburg, Germany) under the same conditions as before. Cells were then washed again and resuspended in 0.5 ml FACS buffer containing 2 μg / ml propidium iodide (Sigma-Aldrich, Taufkirchen, Germany) to eliminate dead cells. The fluorescence of 1 × 10 ⁴ stained cells was measured using a Beckman-Coulter Epics XL flow cytometer (Beckman-Coulter, Krefeld, Germany). Mean fluorescence (F) was calculated using System-II and Expo32 software (Beckman-Coulter, Krefeld, Germany) and subtracted background fluorescence. Equilibrium dissociation constants (K _d ), experimental values using the software program PRISM (GraphPad Software, San Diego, Calif.), Lineweaver-Burk equation: 1 / F = 1 / F _max + (K _d / F _max ) It was determined by fitting to (1 / [Ab]).

Flow cytometry experiments showed specific interaction of scFv antibodies against Jurkat cells expressing CD3 on the surface. The fluorescence intensity obtained for scFv ₆ is significantly higher than that of scFv ₁₀ , reflecting a 10-fold difference in affinity values for these two antibodies (FIG. 6, Table 1). Affinity value estimated for scFv ₆ is very close to that of mAb OKT3, therefore, bivalent binding of scFv ₆ to the cell surface is confirmed.

Example 4: In vitro cell surface retention direct binding experiments To investigate the biological relevance of the differences between scFv _6, scFv ₁₀ and OKT3, in vitro retention of the scFv antibodies on the surface of CD3 ⁺ Jurkat cells, flow cytometry (Fig. 7). The cell surface retention assay detected the retained scFv antibody using mouse anti- (His) ₆ mAb 13/45 / 31-2 (0.01 mg / ml, Dianova. Hamburg, Germany) followed by FITC-conjugated goat anti-mouse IgG ( Inhibits cell surface antigen internalization as described (Adams et al., 1998, Cancer Res. 58, 485-490) except with 0.015 mg / ml, Dianova. Hamburg, Germany) Performed at 37 ° C under conditions. Using the software program PRISM (GraphPad Software, San Diego, Calif.), The kinetic dissociation constant (K _off ) and half-life of dissociation (t _1/2 ) of the antibody were determined using a one-phase exponential decay fit ( One-phase exponential decay fit). Monovalent scFv ₁₀ had a relatively short retention half-life (1.02 min), while scFv ₆ and OKT3 had 1.5 and 2.5 fold longer t _1/2 respectively and were therefore estimated from direct binding experiments Correlate well with the high binding affinity (Figure 7, Table 1).

The dissociation constant (K _d ) was estimated from the line weaver-bark plot shown in FIG. The K _off value was estimated from the Jurkat cell surface retention experiment shown in FIG. The half-life value (t _1/2 ) of dissociation of the antibody-antigen complex was estimated from the ln2 / K _off ratio.

Example 5: Isolation of peripheral blood mononuclear cells (PBMC) Human PBMC were isolated from heparinized peripheral blood of healthy volunteers by density gradient centrifugation. Blood samples were diluted twice with PBS (Invitrogen, Groningen, The Netherlands), overlaid on a cushion of Histopaque-1077 (Sigma-Aldrich, Taufkirchen, Germany) and centrifuged at 800 g for 25 minutes. PBMC located on the interface was collected and washed 3 times with PBS before use.

Example 6: Cell Proliferation Assay Isolated PBMCs were treated with 10% heat inactivated FCS, 2 mM L-glutamine, 100 U / mL penicillin G sodium salt and 0.1 mg / ml streptomycin sulfate (all, Invitrogen, Groningen, The Netherlands And re-suspended in 96-well flat bottom tissue culture dishes (Greiner, Frickenhausen, Germany) at a cell density of 2 × 10 ⁵ per well. Triplicate cultures were pulsed with 0.01 mM 5-bromo-2′-deoxyuridine (BrdU) for 18 hours at 37 ° C. in a humidified atmosphere containing 5% CO _2. While incubating with serial dilutions of soluble antibody. BrdU incorporation was examined by cell proliferation ELISA (Roche, Mannheim, Germany) according to the manufacturer's instructions.

During the 24-36 hour incubation, neither scFv ₆ nor scFv ₁₀ induced the proliferation of both autologous (donor A alone and donor B alone) and mixed (donor A + B) lymphocyte cultures. In contrast, mAb OKT3 clearly showed high mitotic activity due to CD3 cross-linking through cells with FcγR for all 24-hour cultures tested (FIG. 8).

OKT3-induced T cell proliferation was significantly higher in autologous PBMC cultures incubated for 72-90 hours, whereas scFv ₆ and scFv ₁₀ showed only a slight effect compared to 24 hours incubation. (FIG. 9). Mixed PBMC cultures (donor A + B) incubated for 72 hours without antibody treatment showed a mixed lymphocyte reaction (MLR). Treatment of mixed PBMC cultures with OKT3 had no effect on MLR, but both scFv antibodies were able to suppress MLR in a concentration-dependent manner, and thus background at a concentration of 10 μg / ml Reached the level.

Example 7: Analysis of cytokine release For measurement of cytokine secretion by activated lymphocytes, 2 x 10 ⁶ PBMCs were treated with 10% heat-inactivated FCS in individual wells of a 24-well plate (Greiner, Frickenhausen, Germany). Plated with the indicated antibodies in RPMI 1640 supplemented with 2 mM L-glutamine, 100 U / mL penicillin G sodium salt and 0.1 mg / ml streptomycin sulfate (all from Invitrogen, Groningen, The Netherlands). For measurement of IL-2, TNF-α and IFN-γ secretion, aliquots of culture supernatants were collected after 24, 36 and 72 hours, respectively. Cytokine levels were measured in duplicate for IL-2 (Pharmingen, San Diego, Calif.) TNF-α and IFN-γ (Endogen, Cambridge, Mass.) Using a commercially available ELISA kit.

In both autologous and mixed PBMC cultures, OKT3 induced strong release of IL-2 (FIG. 10), IFN-γ (FIG. 11) and TNF-α (FIG. 12). In contrast, autologous PBMC cultures treated with scFv ₆ and scFv ₁₀ , respectively, did not produce IL-2 (FIG. 10), IFN-γ (FIG. 11) and TNF-α (FIG. 12). Mixed lymphocyte cultures incubated without antibody showed a significant amount of cytokine release as a result of allogeneic stimulation. This secretion of IL-2 and IFN-γ could be suppressed in a dose-dependent manner by scFv antibodies (FIGS. 10 and 11). Bivalent scFv ₆ was almost 10 times more effective than scFv ₁₀ . In contrast, mAb OKT3 had induction rather than suppression of cytokine release in mixed PBMC cultures.

Example 8: Modification of surface antigen on PBMC treated with anti-CD3 antibody To measure the cell surface expression of IL-2 receptor α subunit (CD25) as an initial activation marker, 2 x 10 ⁶ PBMC In individual wells of well plates (Greiner, Frickenhausen, Germany), 10% heat-inactivated FCS, 2 mM L-glutamine, 100 U / mL penicillin G sodium salt and 0.1 mg / ml streptomycin sulfate (all, Invitrogen, Groningen , The Netherlands) with RPMI 1640 supplemented with the indicated antibodies. After 90 hours of incubation, cells were collected and for flow cytometric analysis, as described in Example 3, PE-conjugated anti-CD25 mAb B1.49.9 and the corresponding isotype control (all Beckman-Coulter, Krefeld, Germany Dyeing). 10 ⁴ lymphocytes were analyzed by Beckman-Coulter Epics XL flow cytometer (Beckman-Coulter, Krefeld, Germany ). Mean fluorescence (F) was calculated using System-II software (Beckman-Coulter, Krefeld, Germany) and background fluorescence was subtracted.

PBMC cultured in the presence of OKT3 showed strong upregulation of the early activation marker IL-2R (CD25) on its surface as measured by flow cytometry (FIG. 12). In contrast, none of the PBMC cultures treated with either scFv ₆ or scFv ₁₀ showed increased levels of CD25 expression (FIG. 13). Therefore, these results clearly show that scFv ₆ and scFv ₁₀ do not have T cell activation properties, unlike mAb OKT3.

Example 9: Modulation and coating of TCR / CD3 on lymphocytes treated with anti-CD3 antibody To measure the modulation and coating of cell surface TCR / CD3 on lymphocytes, 2 x 10 ⁶ PBMCs were prepared in 24-well plates ( In individual wells of Greiner, Frickenhausen, Germany) 10% heat-inactivated FCS, 2 mM L-glutamine, 100 U / mL penicillin G sodium salt and 0.1 mg / ml streptomycin sulfate (all, Invitrogen, Groningen, The Netherlands Were plated with the indicated antibodies in RPMI 1640 supplemented with After 24 hours of incubation, cells were harvested and analyzed by flow cytometry for FITC-conjugated anti-OKT3 (Dr. Moldenhauer, German Cancer Research Center, Heidelberg) or PC-5-conjugated anti-TCRα / β (Beckman-Coulter, Krefeld, Germany) and corresponding isotype controls (Beckman-Coulter, Krefeld, Germany). Cells were counterstained for T lymphocytes with anti-CD5 antibody (Beckman-Coulter, Krefeld, Germany) and analyzed with a Beckman-Coulter Epics XL flow cytometer (Beckman-Coulter, Krefeld, Germany). Mean fluorescence (F) of OKT3-FITC and TCR-PC5 derived from CD5 positive cells was calculated using System-II software (Beckman-Coulter, Krefeld, Germany). CD3 modulation calculations and coatings were performed as previously described (Cole, MS et al., 1997, J. Immunol. 159, 3613-3621).

A coating defined by the number of CD3 molecules on the surface of T lymphocytes, which is a bound antibody and therefore cannot be detected by FITC-conjugated anti-OKT3, is one experiment with the lowest concentrations of OKT3 and anti-CD3 scFv _6. Was observed only in FIG. 14 (FIG. 14). CD3 modulation, which indicates the percentage of TCR / CD3 complex on the surface of T cells lost after antibody treatment, is efficiently achieved by OKT3 and anti-CD3 scFv ₆ at concentrations ranging between 0.1 μg / ml and 10 μg / ml. (> 90%) is induced (FIG. 14). In contrast, the regulatory activity of anti-CD3 scFv ₁₀ was much lower and could only be observed at concentrations above 10 μg / ml (FIG. 14).

FIG. 1: Schematic representation of monovalent and multivalent single chain Fv-antibody constructs. Diabodies: noncovalently bound scFv dimers; scDb: single chain diabodies; scFv: single chain Fv fragments; (scFv) ₂ : scFv-scFv dimers. Antibody _VH and _VL domains are shown as black and gray ellipses, respectively. Figure 2: Expression cassette for anti-CD3 scFv construct. His ₆ : 6 C-terminal histidine residues; L: short peptide linker to connect the V _H and V _L domains (amino acid sequences are shown in bold); leader, secretion of the recombinant product into the cytoplasm Bacterial leader sequences (eg, PelB leader); rbs, ribosome binding site; stop: stop codon (TAA); V _H and V _L : variable regions of heavy and light chains specific for human CD3. The four C-terminal amino acids of the V _H domain and the four N-terminal amino acids of the _VL domain are underlined. Figure 3: Diagram of expression plasmid pSKK3-scFv6_OKT3. bla: gene of β-lactamase responsible for ampicillin resistance; bp: base pair; CDR-H1, CDR-H2, and CDR-H3: sequence encoding heavy chain complementarity determining region (CDR) 1-3; CDR-L1 , CDR-L1, CDR-L2 and CDR-L3: sequence encoding light chain complementarity determining region (CDR) 1-3; CH1-L6 linker: 6 amino acid peptide Ser- linking V _H and V _L domains Sequence encoding Ala-Lys-Thr-Thr-Pro; His6 tag: sequence encoding 6 C-terminal histidine residues; hok-sok: plasmid stabilizing the DNA locus; lacI: lac-repressor Lac P / O: wild type lac-operon promoter / operator; M13ori: intergenic region of bacteriophage M13; pBR322ori: origin of DNA replication; PelB leader: bacterial pectate lyase; rbs1: E. coli lacZ gene (lacZ Ribosome binding sites derived from); rbs2 and rbs3: robust expression of bacteriophage T7 Ribosome binding site (T7 g10) derived from the gene 10; skp gene: gene encoding bacterial periplasmic factor Skp / OmpH; tHP: strong transcriptional terminator; TLPP: transcription of the lipoprotein terminator; V _H and V _L: each immunization A sequence encoding the variable regions of globulin heavy and light chains. Unique restriction sites are indicated. FIG. 4: Analysis of purified anti-CD3 scFv antibody by 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) under reducing conditions. Lane 1: _Mr marker (kDa, _Mr unit: 4); Lane 2: anti-CD3 scFv ₁₀ ; Lane 3: anti-CD3 scFv ₆ . The gel was stained with Coomassie blue. FIG. 5: Analysis of purified anti-CD3 scFv antibody by size exclusion chromatography on a calibrated Superdex200 column. The elution position of the molecular weight standard is indicated. Figure 6: Fluorescence-dependent Linewaver-Burk analysis for antibody concentration as measured by flow cytometry. Binding of mAb OKT3 (circle), scFv ₆ (triangle) and scFv ₁₀ (square) to CD3 ⁺ Jurkat cells was measured. FIG. 7: Retention of anti-CD3 antibody on the surface of CD3 ⁺ Jurkat cells at 37 ° C. Cell surface retention of mAb OKT3 (circles), scFv ₆ (triangles) and scFv ₁₀ (squares) on CD3 ⁺ Jurkat was measured. Values are expressed as a percentage of the initial average fluorescence intensity. FIG. 8: Proliferation of peripheral blood mononuclear cells (PBMC) after 24 hours incubation in the presence of mAb OKT3 and anti-CD3 scFv-antibody at a concentration of 0.01-10 μg / ml. Mixed lymphocyte cultures of PBMC derived from donor A + B, either in the absence of antibodies or in the presence of serial dilutions of mAb OKT3, anti-CD3 scFv ₆ and anti-CD3 scFv ₁₀ , 2 × 10 ⁵ cells / well Of microtiter plates at a density of After 24 hours, the cells were pulsed with 10 μM BrdU for 18 hours. BrdU incorporation was measured by BrdU-ELISA. Triplicate means and SD are shown. FIG. 9: Proliferation of PBMC after 72 hours incubation in the presence of mAb OKT3 and anti-CD3 scFv-antibody at a concentration of 0.01-10 μg / ml. Mixed lymphocyte cultures of PBMC from healthy donor A or donor B alone and PBMC from donor A + B without antibody or in the presence of serial dilutions of mAb OKT3, anti-CD3 scFv ₆ and anti-CD scFv ₁₀ Were seeded in microtiter plates at a density of 2 × 10 ⁵ cells / well. After 72 hours incubation, cells were pulsed with 10 μM BrdU for 18 hours. BrdU incorporation was measured by BrdU-ELISA. Triplicate means and SD are shown. FIG. 10: Release of IL-2 by PBMC after 24 hours incubation in the presence of mAb OKT3 and anti-CD3 scFv-antibody at a concentration of 0.01-10 μg / ml. Mixed lymphocyte cultures of PBMC from healthy donor A or donor B alone and PBMC from donor A + B, either without antibody or in the presence of serial dilutions of mAb OKT3, anti-CD3 scFv ₆ and anti-CD3 scFv ₁₀ Seeded in 24-well plates at a density of 2 × 10 ⁶ cells / well. After 24 hours incubation, a sample was collected from the culture supernatant and the IL-2 concentration was measured by ElISA. Average values of duplicates are shown. FIG. 11: Release of IFN-α by PBMC after 72 hours incubation in the presence of mAb OKT3 and anti-CD-3 scFv-antibody at a concentration of 0.01-10 μg / ml. Mixed lymphocyte cultures of PBMC from healthy donor A or donor B alone and PBMC from donor A + B in the absence of antibody or in the presence of serial dilutions of mAb OKT3, anti-CD3 scFv ₆ and anti-CD3 scFv ₁₀ Were seeded in 24-well plates at a density of 2 × 10 ⁶ cells / well. After 72 hours of incubation, a sample of the culture supernatant was collected and the concentration of IFN-α was measured by ELISA. Average values of duplicates are shown. FIG. 12: Release of TNF-α by PBMC after 36 hours incubation in the presence of mAb OKT3 and anti-CD3 scFv-antibody at a concentration of 0.01-0.1 μg / ml. Mixed lymphocyte cultures of PBMC from healthy donor A or donor B alone and PBMC from donor A + B were used without antibodies or 0.1 μg / ml and 0.01 μg / ml mAb OKT3, anti-CD3 scFv ₆ and anti-CD3 scFv either in the presence of ₁₀ at a density of 2 x 10 ⁶ cells / well were seeded in 24-well plates. After 36 hours of incubation, a sample of the culture supernatant was collected and the concentration of TNF-α was measured by ELISA. Average values of duplicates are shown. FIG. 13: Induction of IL-2Rα (CD25) expression in T cells after 90 hours incubation of PBMC cultures in the presence of mAb OKT3 and anti-CD3 scFv-antibody at concentrations of 0.01-10 μg / ml. Mixed lymphocyte cultures of PBMC from healthy donor A or donor B alone and PBMC from donor A + B in the absence of antibody or in the presence of serial dilutions of mAb OKT3, anti-CD3 scFv ₆ and anti-CD3 scFv ₁₀ A 24-well plate was seeded at a density of 2 × 10 ⁶ cells / well. After 90 hours incubation, CD25 expression was detected by flow cytometry using anti-CD25 mAb B1.49.9. The average fluorescence intensity value after subtracting the background fluorescence is shown. FIG. 14: mAb OKT3 and coating with mAb OKT3 and anti-CD3 scFv-antibody. 24-well plates were seeded at a density of 2 × 10 ⁶ cells / well, either without antibody or in the presence of serial dilutions of mAb OKT3, anti-CD3 scFv ₆ and anti-CD3 scFv ₁₀ . After 24 hours of incubation, cells were harvested and stained with FITC-conjugated anti-CD3 mAb OKT3, PC5-conjugated anti-TCRα / β mAb BMA031. T cells were enriched with anti-CD5 mAb and analyzed by flow cytometry. Data regarding CD3 modulation represent the percentage of TCR / CD3 complex on the surface of treated CD5-positive T cells as a fraction of TCR / CD3 complex on the surface of untreated CD5-positive T cells. CD3 coating is shown as the fraction of TCR / CD3 complex that cannot be detected by FITC-conjugated OKT3. Figure 15: (a) DNA sequence of plasmid pSKK3-scFv6_anti-CD3; (b) V _H and V _L bound by peptide linker SAKTTP encoded by the DNA sequence contained in pSKK3-scFv6_anti-CD3 Amino acid sequence.

Claims (17)

The following characteristics:
(a) can suppress the immune response;
(b) lacks a constant antibody region; and
(c) binds to an epitope on the CD3 complex of the T cell receptor,
An antibody characterized by:   The antibody according to claim 1, which is monovalent, divalent or multivalent.   The antibody according to claim 2, which is a diabody.   The antibody according to claim 2, comprising two scFv antibodies linked by a peptide linker.   The antibody according to claim 2, which is a single-chain diabody. The antibody according to any one of claims 1 to 5, wherein the variable _VH and _VL domains are linked via a peptide linker SAKTTP or SAKTTPKLGG.   The antibody according to any one of claims 1 to 6, wherein the variable domain corresponds to a variable domain of an antibody produced by a hybridoma having ATCC deposit number CRL8001.   The antibody according to claim 7, wherein the cysteine at position H100A (Kabat numbering system) is substituted with another amino acid.   The antibody according to claim 8, wherein cysteine is substituted with serine.   A polynucleotide encoding the antibody according to claim 1.   An expression vector comprising the polynucleotide according to claim 10.   The expression vector according to claim 11, which is pSKK3-scFv_6-anti-CD3 (DSM 15137).   A host cell comprising the expression vector according to claim 11 or 12.   A pharmaceutical composition comprising the antibody according to any one of claims 1 to 9, the polynucleotide according to claim 10, or the expression vector according to claim 11 or 12.   Use of the antibody of any one of claims 1 to 9, the polynucleotide of claim 10 or the expression vector of claim 11 or 12 for the preparation of a pharmaceutical composition for immunotherapy.   17. Use according to claim 16, wherein the immunotherapy is treatment for acute graft rejection.   Use of the polynucleotide of claim 10 or the expression vector of claim 11 or 12 for the preparation of a pharmaceutical composition for gene therapy.

Images