JP2006509493A - Modified CEA nucleic acid and expression vector - Google Patents

Abstract

The present invention relates to a nucleic acid encoding a polypeptide and the use of the nucleic acid or polypeptide for preventing and / or treating cancer. The present invention relates to improved vectors for the insertion and expression of foreign genes encoding tumor antigens for use in cancer immunotherapy. One such foreign DNA sequence is a modified CEA nucleic acid.

Description

  The present invention relates to nucleic acids encoding polypeptides and the use of the nucleic acids or polypeptides in the prevention and / or treatment of cancer. Specifically, the present invention relates to improved vectors for the insertion and expression of foreign genes encoding cancer antigens for use in cancer immunotherapy.

Expression in primary tumors and normal cells with the help of several techniques such as high density microarray, SEREX, immunohistochemical analysis (IHC), RT-PCR, in situ hybridization (ISH), and laser scanning microscopy Due to significant advances in molecular identification based on profiling, the development of cancer vaccines using tumor-associated antigens (TAA) has made significant progress over the past few years (Non-Patent Documents 1 to 4). TAA is an antigen that is expressed or overexpressed by tumor cells and is specific to one or more tumors, for example, CEA antigen is expressed in colorectal cancer, breast cancer and lung cancer. Sgroi (1999) et al. Used a combination of a laser scanning microscope and a cDNA microarray to identify several genes that are differentially expressed in invasive and metastatic cancer cells. Some delivery systems, such as DNA or viruses, can be used for therapeutic vaccine ingestion against human cancer (5) and can also induce an immune response against TAA and break immune tolerance against TAA. it can. For example, tumor cells can be made more immunogenic by inserting a T cell costimulatory molecule such as B7.1 or a transgene encoding a cytokine such as IFNγ, IL2, GM-CSF. Effective therapeutic vaccines can be developed by co-expression of TAA and cytokines or costimulatory molecules (Non-Patent Documents 6 to 8).
Rosenberg, Immunity, 1999 Sgroi et al., 1999 Schena et al, 1995 Offringa et al., 2000 Bonnet et al., 2000 Hodge et al., 1995 Bronte et al., 1995 Chamberlain et al., 1996

  There is a need in the art for reagents and methods useful for stimulating an immune response to prevent or treat cancer. The present invention provides reagents and methods that overcome the difficulties encountered in other ways in an attempt to treat cancer. Specifically, the present invention provides a novel coding sequence for CEA. This nucleotide sequence, CEA (6D) -1,2, contains a sequence modification that, when expressed from an expression vector, eliminates the expression of a truncated form of CEA. Such modified sequences were desired by those skilled in the art to improve CEA expression and immunization protocols.

  The present invention provides an immunogenic target for administration to a patient to prevent and / or treat cancer. Specifically, the immunogenic target is a CEA tumor antigen (“TA”) and / or an angiogenesis associated antigen (“AA”). In one embodiment, the immunogenic target is encoded by a modified CEA nucleotide sequence (CEA (6D) -1,2) that improves CEA expression in transfected cells. In certain embodiments, TA and / or AA is administered to a patient as a nucleic acid contained within a plasmid or other delivery vector, eg, a recombinant virus. TA and / or AA may also be administered with an immunostimulatory agent such as a costimulatory molecule or an adjuvant.

  The present invention provides reagents and methods useful for the treatment and / or prevention of cancer.

  In one embodiment, the present invention relates to inducing or enhancing an immune response against one or more tumor antigens (“TA”) to prevent and / or treat cancer. In some embodiments, one or more TAs may be mixed. In a preferred embodiment, an immune response results from, for example, administration of a nucleic acid vector encoding a tumor antigen followed by expression of TA in a host cell or administration of the tumor antigen itself in the form of a peptide or polypeptide.

  As used herein, the term “antigen” is a molecule (eg, a polypeptide) or portion thereof that induces an immune response in a host to which the antigen has been administered. The immune response includes the production of antibodies that bind to at least one epitope of the antigen and / or the induction of a cellular immune response against cells expressing the epitope of the antigen. The response may be current immunity, for example, by producing increased antibody production, production of antibodies with increased affinity for the antigen, or enhanced cellular immune response (ie, increased T cells). There may be an enhanced response. Alternatively, an antigen that induces an immune response is immunogenic or can be referred to as an immunogen. In the description of the present invention, TA refers to “immunogenic target”.

  TA includes both tumor associated antigen (TAA) and tumor specific antigen (TSA), with cancer cells being the source of the antigen. TAA is an antigen that is expressed on the surface of tumor cells in a greater amount than that observed on normal cells, or an antigen that is expressed on normal cells during fetal development. TSA is an antigen unique to tumor cells and is not expressed on normal cells. TA further includes TAA or TSA, antigenic fragments thereof, and modified forms that retain their immunogenicity.

TA has its expression pattern, function, or origin: cancer-testis (CT) antigen (ie, MAGE, NY-ESO-1); melanocyte differentiation antigen (ie, Melan A / MART-1, tyrosinase, GP100); Mutant antigen (ie MUC-1, p53, CDK-4); overexpressed “self” antigen (ie HER-2 / neu, p53); and viral antigen (ie HPV, EBV), usually 5 Fall into one category. For the purposes of practicing the present invention, a suitable TA is any TA that induces or enhances an anti-tumor immune response in a host that has been administered TA. Suitable TAs include, for example, gp100 (Cox et al., Science, 264: 716-719 (1994)), MART-1 / Melan A (Kawakami et al., J. Exp. Med., 180: 347-352 (1994)), gp75 (TRP-1) (Wang et al., J. Exp. Med., 186: 1131-1140 (1996)), tyrosinase (Wolfel et al., Eur. J. Immunol., 24: 759-764 (1994); International Publication No. 200175017; International Publication No. 200175016; International Publication No. 200175007), NY-ESO-1 (International Publication No. 98/14464; International Publication No. 99/18206), Melanoma Proteoglycans (Hellstrom et al., J. Immunol., 130: 1467-1472 (1983)), MAGE family antigens (ie, MAGE-1, 2, 3, 4, 6, 12, and 51; Van der Bruggen et al ., Science, 254: 1643-1647 (1991); US Pat. No. 6,235,525; CN1319611), BAGE family antigens (Boel et al., Immunity, 2: 167-175 (1995)), GAGE family antigens (ie , GAGE-1, 2; Van den Eynde et al., J. Exp. Med., 182: 689-698 (1995); US Pat. No. 6,013,765), RAGE family of antigens (SUN RAGE-1; Gaugler et al., Immunogenetics, 44: 323-330 (1996); US Pat. No. 5,939,526), N-acetylglucosaminyltransferase-V (Guilloux et al., J. Exp. Med. , 183: 1173-1183 (1996)), p15 (Robbins et al., J. Immunol. 154: 5944-5950 (1995)), β-catenin (Robbins et al., J. Exp. Med., 183: 1185-1192 (1996)), MUM-1 (Coulie et al., Proc. Natl. Acad. Sci. USA, 92: 7976-7980 (1995)), cyclin-dependent kinase-4 (CDK-4) (Wolfel et al., Science, 269: 1281-1284 (1995)), p21 ras (Fossum et al., Int. J. Cancer, 56: 40-45 (1994)), BCR-abl (Bocchia et al., Blood 85: 2680-2684 (1995)), p53 (Theobald et al., Proc. Natl. Acad. Sci. USA, 82: 11993-11997 (1995)), p185 HER2 / neu (ERB-b1; Fisk et al ., J. Exp. Med., 181: 2109-2117 (1995), epidermal growth factor receptor (EGFR) (Harris et al., Breast Cancer Res. Treat, 29: 1-2 (1994)); Sex antigen (CEA) (Kwong et al., J. Natl. Cancer Inst., 85: 982-990 (1995), U.S. Pat.No. 5,756,103 No. 5,274,087; No. 5,571,710; No. 6,071,716; No. 5,698,530; No. 6,045,802; European Patent No. 263933; European Patent No. 346710; and European Patent No. 784483); 1 gene product (Jerome et al., J. Immunol., 151: 1654-1662 (1993)); EBNA EBNA gene product (ie, EBNA-1 gene product; Rick
inson et al., Cancer Surveys, 13: 53-80 (1992)); human papillomavirus E7 and E6 proteins (Ressing et al., J. Immunol. 154: 5934-5943 (1995)); prostate specific antigen ( PSA; Xue et al., The Prostate, 30: 73-78 (1997)); Prostate specific membrane antigen (PSMA; Israel, et al., Cancer Res., 54: 1807-1811 (1994)); Idiotype Epitope or antigen, such as idiotype immunoglobulin, or idiotype T cell receptor (Chen et al., J. Immunol., 153: 4775-4787 (1994)); KSA (US Pat. No. 5,348,887); kinesin 2 (Dietz, et al., Biochem Biophys Res Commun 2000 Sep 7; 275 (3): 731-8); HIP-55, TGFβ-1 anti-apoptotic factor (Toomey, et al., Br. J. Biomed. Sci. 2001; 58 (3): 177-83); tumor protein D52 (Bryne JK, et al., Genomics, 35: 523-532 (1996)); H1FT; NY-BR-1 (WO 01/47959) ); NY-BR-62; NY-BR-75; NY-BR-85; NY-BR-87; NY-BR-96 (Scanlan, M. Serologic and Bioinformatic Approaches to t he Identification of Human Tumor Antigens; Cancer Vaccines 2000, Cancer Research Institute, New York, NY); AAC2-1; or AAC2-2, “wild type (ie, normally encoded by the natural genome), Including modified and mutated forms, and other fragments and derivatives thereof, any of these TAs used alone or in combination with another antigen in a co-immunization protocol Also good.

  In some cases, it may be useful to co-immunize patients with both TA and other antigens such as, for example, angiogenesis associated antigens (“AA”). AA is an immunogenic antigen (ie, peptide, polypeptide) involved in cells involved in vascular induction and / or subsequent development. For example, AA is expressed in epithelial cells (“EC”), which are the major structural components of blood vessels. In the case of cancer, it is preferred that AA is found in or near the blood vessel providing the tumor. Immunizing a patient against AA results in an anti-AA immune response, thereby preventing and / or inhibiting the angiogenic process that occurs near or within the tumor.

  Exemplary AA include, for example, vascular epidermal growth factor (ie, VEGF; Bemardini, et al. J. Urol., 2001, 166 (4); 1275-9; Stames, et al. J. Thorac. Cardiovasc. Surg ., 2001, 122 (3): 518-23), VEGF receptor (ie, VEGF-R, flk-1 / KDR; Stames, et al. J. Thorac. Cardiovasc. Surg., 2001, 122 (3) : 518-23), EPH receptor (ie EPHA2; Gerety, et al., 1999, Cell, 4: 403-414), epidermal growth factor receptor (ie EGFR; Ciardeillo, et al., Clin. Cancer) Res., 2001, 7 (10): 2958-70), basic fibroblast growth factor (ie vFGF; Davidson, et al., Clin. Exp. Metastasis 2000, 18 (6): 501-7; Poon , et al. Am J. Surg., 2001, 182 (3): 298-304), platelet-derived growth factor (ie, PDGF-B), platelet-derived epidermal growth factor (PD-ECGF; Hong, et al. , J. Mol. Med., 2001, 8 (2): 141-8), transforming growth factor (ie, TGF-α; Hong, et al., J. Mol. Med., 2001, 8 (2) : 141-8), Endoglin (Bal za et al., Int. J. Cancer, 2001, 94: 579-585), Id protein (Benezra, R. Trends Cardiovasc. Med., 2001, 11 (6); 237-41), e.g. uPA, uPAR, And proteases such as matrix metalloproteases (MMP-2, MMP-9; Djonov, et al. J. Pathol., 2001, 195 (2): 147-55), nitric oxide synthase (Am. J. Ophthalmol. , 2001, 132 (4): 551-6), aminopeptidase (Rouslhati, E. Nature Cancer, 2: 84-90, 2002), thrombospondin (ie TSP-1, TSP-2; Alvarez, et al ., Gynecol. Oncol., 2001, 82 (2): 273-8; Seki, et al. Int. J. Oncol., 2001, 19 (2): 305-10), K-ras (Zhang, et al Cancer Res., 2001, 61 (16); 6050-4), Wnt (Zhang, et al., Cancer Res., 2001, 61 (16): 6050-4), cyclin-dependent kinases (CDKs; Drug Resist Updat. 2000, 3 (2): 83-88), microtubules (Timar, et al. 2001, Path. Oncol. Res., 7 (2): 85-94), heat shock proteins (ie, HSP90 ( Timar, supra)), heparin binding factor (ie, heparin Gohji, et al. Int. J. Cancer, 2001, 95 (5): 295-301), synthase (ie, ATP synthase, thymidylate synthase), collagen receptor, integrin (ie, αvβ3, αvβ5, α1β1) , Α2β1, α5β1), surface proteoglycan NG2, AAC2-1 (SEQ ID NO: 1), or AAC2-2 (SEQ ID NO: 2), “wild type (ie, normally encoded by the natural genome), Includes modified and mutated forms, as well as other fragments and derivatives thereof. Any of these targets are suitable for practicing the present invention and may be used alone or in combination with another one or other substance.

  In certain embodiments, a nucleic acid molecule encoding an immunogenic target is used. A nucleic acid molecule comprises or consists of a nucleotide sequence encoding one or more immunogenic targets, or fragments or derivatives thereof (eg, contained in a DNA insert deposited with ATCC). The term “nucleic acid sequence” or “nucleic acid molecule” refers to a DNA or RNA sequence. The term includes, but is not limited to, for example, 4-acetylcytosine, 8-hydroxy-N6-methyladenosine, aziridinyl-cytosine, pseudoisocytosine, 5- (carboxyhydroxymethyl) uracil, 5-fluorouracil, 5-bromouracil 5-carboxymethylaminomethyl-2-thiouracil, 5-carboxy-methylaminomethyluracil, dihydrouracil, inosine, N6-iso-pentenyladenine, 1-methyladenine, 1-methyl pseudouracil, 1-methylguanine, 1 -Methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-methyladenine, 7-methylguanine, 5-methylaminomethyluracil, 5- Metoki Amino-methyl-2-thiouracil, β-D-mannosylkyunocin, 5′-methoxycarbonyl-methyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid methyl ester, uracil Includes any known base analogs of DNA and RNA, such as -5-oxyacetic acid, oxybutoxocin, pseudouracil, quinosine, 2-thiocytosine, 2,6-diaminopurine, and the like.

  An isolated nucleic acid molecule is (1) separated from more than about 50% of proteins, lipids, carbohydrates, or other substances found together in nature when total nucleic acid is isolated from the source cell; 2) a nucleic acid molecule that is not bound to all or part of a naturally associated polynucleotide; (3) that is operably linked to a polynucleotide that is not naturally associated; and / or (4) ) Not naturally occurring as part of a larger polynucleotide sequence. Preferably, the isolated nucleic acid molecule of the invention is any other mixed nucleic acid molecule found in its natural environment that interferes with polypeptide production or its use in therapeutic, diagnostic, prophylactic or research applications. Or substantially free of other inclusions. As used herein, the term “naturally occurring”, “naturally occurring” or “found in nature” when used in connection with biological materials such as nucleic acid molecules, polypeptides, host cells, etc. A substance that is found in nature and has not been manipulated by humans. Similarly, the term “non-naturally occurring” or “non-naturally occurring” as used herein refers to a substance not found in nature or synthetically modified or synthesized by humans.

By comparing the sequences, the identity of two or more nucleic acid or polypeptide molecules is identified. As is known in the art, “identity” refers to the degree of sequence relatedness between nucleic acid molecules or polypeptides as determined by the match between the units (ie, nucleotides or amino acid residues) that make up the molecule. means. Identity is the percentage of matching of the smaller sequences of two or more sequences using gap alignments (if any) addressed by a particular mathematical model or computer program (ie, algorithm) (%) Is evaluated. Identity between nucleic acid sequences can also be determined by the ability of related sequences to hybridize to the nucleic acid sequence or isolated nucleic acid molecule. In determining such a sequence, the terms "highly stringent conditions" and "moderately stringent conditions" refer to the nucleic acid strand with which the sequence is complementary. Refers to processing conditions that allow for the hybridization of nucleic acids but eliminate significantly mismatched nucleic acid hybridizations. Examples of “high stringency conditions” for hybridization and washing are 0.015 M sodium chloride, 0.0015 M sodium citrate, 65-68 ° C., or 0.015 M sodium chloride, 0.0015 M sodium citrate, and 50% formamide, 42 (Eg Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual (2nd ed., Cold Spring Harbor Laboratory, 1989); Anderson et al., Nucleic Acid Hybridisation: A Practical Approach Ch. 4 (IRL Press Limited) reference). The term “medium stringent conditions” refers to conditions under which DNA duplexes with a higher percentage of base pair mismatches can be formed than do duplexes under “high stringent conditions”. Called. Exemplary moderate stringent conditions are 0.015 M sodium chloride, 0.0015 M sodium citrate, 50-65 ° C., or 0.015 M sodium chloride, 0.001.
5M sodium citrate, and 20% formamide, 37-50 ° C. By way of example, moderately stringent conditions at 50 ° C. or 0.015 M sodium ion would tolerate about 21% mismatch. During hybridization, other substances may be included in the hybridization and wash buffers in order to reduce non-specific and / or background hybridization. Examples include 0.1% bovine serum albumin, 0.1% polyvinylpyrrolidone, 0.1% sodium pyrophosphate, 0.1% sodium dodecyl sulfate (NaDodSO ₄ , SDS), Ficoll, Denhardt's solution, sonicated salmon sperm DNA (or other non-complementary) DNA), and dextran sulfate, but other suitable materials may be used. The concentration and type of these additives can be varied without substantially affecting the stringency of the hybridization conditions. Hybridization experiments are usually performed at pH 6.8-7.4; however, under standard ionic strength conditions, the rate of hybridization is almost independent of pH.

  In a preferred embodiment of the invention, a vector is used to carry the nucleic acid sequence encoding the polypeptide into the cell. A vector is any molecule used to carry a nucleic acid sequence to a host cell. In some cases, expression vectors are utilized. An expression vector is a nucleic acid molecule that is suitable for transformation of a host cell and contains a nucleic acid sequence that induces and / or controls the expression of the introduced nucleic acid sequence. Without limitation, expression includes processes such as transcription, translation, and splicing if introns are present. An expression vector usually includes one or more flanking sequences operably linked to a heterologous nucleic acid sequence encoding a polypeptide. The flanking sequences can be, for example, homologous (ie, from the same species and / or strain as the host cell), heterologous (ie, from a species different from the host cell species or strain), hybrid (ie, 2 It may be a combination of flanking sequences from more than one source), or synthetic.

  The flanking sequence preferably affects the replication, transcription and / or translation of the coding sequence and is operably linked to the coding sequence. As used herein, the term “functionally linked” refers to the linking of polynucleotides in a functional relationship. For example, a promoter or enhancer is operably linked to its promoter sequence if it affects the transcription of the coding sequence. However, a flanking sequence need not necessarily be adjacent to the coding sequence as long as it functions correctly. Thus, for example, an untranslated transcription intervening sequence may be present between the promoter sequence and the coding sequence, but in that case the promoter sequence is also considered to be operably linked to the coding sequence. Will. Similarly, an enhancer sequence is located upstream or downstream of a coding sequence and affects the transcription of that coding sequence.

  In certain embodiments, it is preferred that the flanking sequence is a transcriptional regulatory region that results in high levels of gene expression in the target cell. Transcriptional regulatory regions include, for example, promoters, enhancers, silencers, repressor elements, or combinations thereof. A transcriptional regulatory region may be constitutive or tissue specific (ie, the region provides a higher level of transcription in one type of tissue or cell than in other tissues, etc.). Or may be tunable (ie, responsive to interaction with a compound such as, for example, tetracycline). The origin of the transcriptional regulatory region is any prokaryotic or eukaryotic organism, any vertebrate or invertebrate organism, provided that the flanking sequence functions in the cell by causing transcription of the nucleic acid in the cell. Or any plant. A wide range of transcriptional regulatory regions can be utilized in the practice of the present invention.

  Suitable transcriptional regulatory regions include: CMV promoter (ie, CMV-early early promoter); eukaryotic gene-derived promoter (ie, estrogen-inducible chicken ovalbumin gene, interferon gene, glucocorticoid-inducible tyrosine aminotransferase gene, and Thymidine kinase gene); and major early and late adenovirus gene promoters; SV40 early promoter region (Bernoist and Chambon, 1981, Nature 290: 304-10); Rous sarcoma virus (RSV) 3 'long terminal repeat (LTR) Promoters contained within (Yamamoto, et al., 1980, Cell 22: 787-97); herpes simplex virus thymidine kinase (HSV-TK) promoter (Wagner et al., 1981, Proc. Natl. Acad. Sci., USA 78: 1444-45); regulatory sequences of the metallothinin gene (Brinster et al., 1982, Nature 296: 39-42); Prokaryotic expression vectors such as the β-lactamase promoter (Villa-Kamaroff et al., 1978, proc. Natl. Acad. Sci. USA, 75: 3727-31); or the tac promoter (DeBoer et al., 1983, Proc Natl. Acad. Sci., USA, 80: 21-25). Examples of tissue and / or cell type-specific transcription control regions include elastase I gene control regions that are active in pancreatic acinar cells (Swift et al., 1984, Cell 38: 639-46; Omitz et al., 1986, Cold Spring Harbor Symp. Quant. Biol. 50: 399-409 (1986); MacDonald, 1987, Hepatology 7: 425-515); Insulin gene regulatory region active in pancreatic β cells (Hanahan, 1985, Nature 315: 115) -22); immunoglobulin gene regulatory region active in lymphoid cells (Grosschedl et al., 1984, Cell 38: 647-58; Adames et al., 1985, Nature 318: 533-38; Alexander et al., 1987, Mol. Cell. Biol., 71436-44); mouse mammary tumor virus regulatory region in testis cells, mammary cells, lymphoid cells and mast cells (Leder et al., 1986, Cell 45: 485-95); Albumin gene regulatory region in liver (Pinkert et al., 1987, Genes and Devel. 1: 268-76); α-fetoprotein gene regulatory region in liver Region (Krumlauf et al., 1985, Mol. Cell. Biol., 5: 1639-48; Hammer et al., 1987, Science 235: 53-58); α1-antitrypsin gene regulatory region in the liver (Kelsey et al. , 1987, Genes and Devel. 1: 161-71); β-globulin gene regulatory region in myeloid cells (Mogram et al., 1985, Nature 315; 338-40; Kollias e tal., 1986, Cell 46: 89-94); myelin basic protein gene regulatory region in oligodendrocytes in the brain (Readhead et al., 1987, Cell 48: 703-12); myosin light chain-2 gene regulatory region in skeletal muscle (Sani, 1985, Nature 314: 283-86); gonadotropin-releasing hormone gene regulatory region in the hypothalamus (Mason et al., 1986, Science 234: 1372-78); and tyrosinase promoter in melanoma cells (Hart, I. Semin Oncol 1996 Feb 23 (1): 154-8; Siders, et al. Cancer Gene Ther 1998 Sep-Oct; 5 (5): 281-91). Other suitable promoters are also known in the art.

  As mentioned above, enhancers are also suitable flanking sequences. Enhancers are cis-acting elements of DNA, usually about 10-300 bp in length, that act on a promoter to enhance transcription. Enhancers are usually orientation and position independent and are found both 5 'and 3' to the controlled coding sequence. Several available enhancer sequences from mammalian genes are known (ie, globin, elastase, albumin, α-fetoprotein, and insulin). Similarly, SV40 enhancers, cytomegalovirus early promoter enhancers, polyoma virus enhancers, and adenovirus enhancers are useful with eukaryotic promoter sequences. The enhancer is inserted into the vector at a position 5 ′ or 3 ′ of the nucleic acid coding sequence, but is usually located at a site 5 ′ of the promoter. Other suitable enhancers are known in the art and are applicable to the present invention.

  During the preparation of the reagents of the present invention, the cells need to be transfected or transformed. Transfection refers to the uptake of foreign or exogenous DNA by the cell, and the cell is transfected when the exogenous DNA is introduced inside the cell membrane. Many transfection techniques are well known in the art (ie Graham et al., 1973, Virology 52: 456; Sambrook et al., Molecular Cloning, A Laboratory Manual (Cold Spring Harbor Laboratories, 1989); Davis et al , Basic Methods in Molecular Biology (Elsevier, 1986); and Chu et al., 1981, Gene 13: 197). Such techniques can be used to introduce one or more exogenous DNA moieties into suitable host cells.

  In certain embodiments, it is preferred that transfection of a cell results in transformation of that cell. A cell is transformed when a change in the properties of the cell occurs, and is transformed when it is modified to contain a novel nucleic acid. After transfection, whether the introduced nucleic acid physically reintegrates with the cell's chromosomes to cause recombination with the cell's genes or is temporarily maintained as an episome without being replicated Alternatively, it may be replicated independently as a plasmid. A cell is stably transformed when the nucleic acid replicates with the division of the cell.

  The invention further provides an isolated immunogenic target in polypeptide form. A polypeptide is considered isolated and (1) separated from about 50% of polynucleotides, lipids, carbohydrates, or other substances found together in nature when isolated from a source cell. (2) the “isolated polypeptide” is not bound to all or part of the polypeptide to which it is naturally bound (covalently or non-covalently); (3) is naturally bound It may be functionally linked (covalently or non-covalently) to a non-polypeptide; or (4) not naturally occurring. Preferably, an isolated polypeptide substantially comprises any other mixed polypeptide or other mixture found in its natural environment that interferes with its therapeutic, diagnostic, prophylactic or research use Absent.

  The immunogenic target polypeptide may be a mature polypeptide as described herein, and may or may not include an amino terminal methionine residue, depending on the method by which it is prepared. In addition, for example, fragments, variants (ie, alleles, splices), orthologs, homologues, and derivatives having at least one property or activity (ie, activity, antigenicity) of an immunogenic target Related polypeptides, such as Also relevant is a series of contiguous amino acid residues having a sequence corresponding to at least a portion of the polypeptide from which the sequence is derived. In preferred embodiments, the peptide comprises about 5-10 amino acids, 10-15 amino acids, 15-20 amino acids, 20-30 amino acids, or 30-50 amino acids. In a more preferred embodiment, the peptide comprises, for example, 9-12 amino acids suitable for presentation on MHC class I molecules.

  Fragments of nucleic acids or polypeptides include sequence truncations (ie, nucleic acids or polypeptides) at the amino terminus (with or without the leader sequence) and / or carboxy terminus. Fragments also include variants (ie, alleles, splices), orthologs, homologs, and other variants that have one or more amino acid additions, substitutions or deletions compared to the parent sequence. In preferred embodiments, the truncations and / or deletions comprise about 10 amino acids, 20 amino acids, 30 amino acids, 40 amino acids, 50 amino acids, or more. What are the polypeptide fragments so produced? Contains about 10 amino acids, 25 amino acids, 30 amino acids, 40 amino acids, 50 amino acids, 60 amino acids, 70 amino acids or more. Such polypeptide fragments optionally include an amino terminal methionine residue. Such a fragment could be used, for example, to elicit an antibody or cellular immune response against an immunogenic target polypeptide.

  A variant is a sequence having one or more sequence substitutions, deletions and / or additions compared to the subject sequence. Variants may be natural or artificially constructed. Such variants can be prepared from the corresponding nucleic acid molecule. In preferred embodiments, the variant is 1 to 3, or 1 to 5, or 1 to 10, or 1 to 15, or 1 to 20, or 1 to 25, or 1 to 30, or 1 to 40, or 1 From 50, or more than 50 amino acid substitutions, insertions, additions and / or deletions.

  Allelic variants are one of several potential natural alternative forms of a gene located at a given locus in the chromosome of an organism or population of organisms. A splice variant is a polypeptide made from one of several RNA transcripts generated by splicing of a primary transcript. An ortholog is a nucleic acid or polypeptide sequence similar to that from another species. For example, mouse and human immunogenic target polypeptides are considered to be orthologs of each other. A derivative of the sequence is a sequence derived from the parent sequence, with substitutions, additions, deletions, or chemically modified variants. Variants also include fusion proteins, which are referred to as amino- or carboxy-terminal fusions of one or more other sequences (eg, heterologous peptides) and one or more first sequences (eg, peptides). The

  “Similarity” is a concept related to identity, except that similarity refers to an assessment of relevance that includes both identical matches and conservative substitution matches. If two polypeptide sequences have, for example, 10/20 identical amino acids and the remaining amino acids are all non-conservative substitutions, the percent identity and similarity will both be 50%. In the same example, if there is a conservative substitution at 5 positions, the percent identity remains 50%, but the percent similarity is 75% (15/20). Let's go. Thus, in the presence of conservative substitutions, the percent similarity between two polypeptides is higher than the percent identity between the same two polypeptides.

The substitutions can be conservative substitutions, non-conservative substitutions, or any combination thereof. Conservative amino acid modifications (and modifications to the corresponding coding nucleotides) to the sequence of the polypeptide will result in a polypeptide having similar functional and chemical properties to the parent polypeptide. For example, a “conservative amino acid substitution” has little or no effect on, for example, the size, polarity, charge, hydrophobicity or hydrophilicity of the amino acid residue at that position, and in particular does not cause a decrease in immunogenicity. Substitution of natural amino acid residues with such unnatural residues. Suitable conservative amino acid substitutions are shown in Table 1.

  One skilled in the art can identify suitable polypeptide variants using well-known techniques. In order to identify appropriate regions of a molecule that can be altered without compromising biological activity (ie, MHC binding, immunogenicity), one skilled in the art will target regions that are not considered important for that activity Can be. For example, if similar polypeptides with similar activity from the same species or other species are known, one skilled in the art can compare the amino acid sequence of the polypeptide with that of such similar polypeptides. By performing such an analysis, one can identify residues or portions of the molecule that are conserved among similar polypeptides. Changes in molecular regions that are not conserved with respect to such similar polypeptides are not believed to adversely affect the biological activity and / or structure of the polypeptide. Similarly, residues necessary for binding to MHC are known and can be modified to improve binding. However, modifications that reduce the binding to MHC are not appropriate in most cases. Those skilled in the art also know that natural residues can be substituted with chemically similar amino acids while retaining their activity even in relatively conserved regions. Thus, conservative amino acid substitutions can be made even in regions important for biological activity or structure without compromising the biological activity or without adversely affecting the polypeptide structure.

  Other preferred polypeptide variants include glycosylation variants in which the number and / or type of glycosylation sites are altered as compared to the subject amino acid sequence. In one embodiment, the polypeptide variant has a greater or lesser number of N-linked glycosylation sites than the subject amino acid sequence. The N-linked glycosylation site is characterized by the sequence Asn-X-Ser or Asn-X-Thr (wherein the amino acid residue represented as X may be any amino acid other than proline). Substitution of amino acid residues to create this sequence provides a potential new site for the addition of N-linked sugar chains. Alternatively, substitutions that remove the sequence will remove existing N-linked sugar chains. Also provided is the rearrangement of N-linked glycans, wherein one or more N-linked glycosylation sites (usually natural) are removed and one or more new N-linked glycosyls. A chemical site is created. In order to affect O-linked glycosylation of the polypeptide, serine and / or threonine residues are modified.

  Another preferred variant includes a cysteine variant in which one or more cysteine residues are deleted or substituted with another amino acid (eg, serine) as compared to the subject amino acid sequence. Cysteine variants are useful when the polypeptide needs to be refolded into a bioactive conformation, such as after isolation of insoluble inclusion bodies. Cysteine variants usually have fewer amino acid residues than the native protein and usually have an even number of cysteines to minimize the interactions caused by unpaired cysteines.

  In other embodiments, an isolated polypeptide of the invention includes a fusion polypeptide moiety that aids in purification of the polypeptide. The fusion may be performed at either the amino acid terminus or the carboxyl terminus of the subject polypeptide variant. The fusion may be performed directly without a linker or adapter molecule or may be performed through a linker or adapter molecule. A linker or adapter molecule is one or more amino acid residues, usually from about 20 to about 50 amino acid residues. The linker or adapter molecule may be designed to have a DNA restriction endonuclease or protease cleavage site to allow separation of the fusion moiety. Once constructed, the fusion polypeptide may be derivatized according to the methods described herein. Suitable fusion moieties include metal binding domains (eg, poly-histidine regions), immunoglobulin binding domains (ie, protein A, protein G, T cells, B cells, FC receptors, or complement protein antibody binding domains), A compound that binds to a sugar binding domain (eg, maltose binding domain) and / or a “tag” domain (ie, at least a portion of α-galactosidase, a strep tag peptide, a T7 tag peptide, a FLAG peptide, or a domain such as a monoclonal antibody) Other domains that can be purified using This tag is usually fused to the polypeptide during polypeptide expression, and can serve as a means for affinity purification of the sequence of the polypeptide of interest from the host cell. Affinity purification can be performed, for example, by column chromatography using an antibody against the tag as an affinity matrix. Subsequently, the tag may be removed from the purified sequence of the polypeptide of interest by various means, for example using a specific peptidase for cleavage, if necessary. As described below, fusions may be performed between TA and costimulatory components such as chemokines CXC10 (IP-10), CCL7 (MCP-3), or CCl5 (RANTES).

  A fusion motif can enhance transport of an immunogenic target to an MHC processing compartment such as the endoplasmic reticulum. These sequences are referred to as transduction or transcytosis sequences and are HIV Tat (see Kim et al., 1997, J. Immunol. 159: 1666), Drosophila antennapedia (Schutze-Redelmeier et al. 1996, J. Immunol 157: 650), or human period-1 protein (hPER1; in particular SRRHHCRSKAKRSRHH).

  Further, a polypeptide or variant thereof may be fused to a homologous polypeptide to form a homodimer, or fused to a heterologous polypeptide to form a heterodimer. Heterologous peptides and polypeptides include, but are not limited to, epitopes that allow detection and / or isolation of fusion polypeptides; for example, transmembrane receptor proteins or the like, such as the extracellular domain or transmembrane and intracellular domains A moiety; a ligand or portion thereof that binds to a transmembrane receptor protein; a catalytic enzyme or portion thereof; a polypeptide or peptide that promotes an oligomerization, such as, for example, a leucine domain; Polypeptides or peptides that enhance stability; and polypeptides that have a therapeutic activity that is different from the polypeptide or variant thereof.

In certain embodiments, a nucleic acid sequence encoding an immunogenic target, polypeptide, or derivative thereof in the composition of the present invention is converted into one or more costimulatory components, such as cell surface proteins, cytokines or chemokines. And may be combined. Co-stimulatory components can be included in the compositions of the invention, for example, as a polypeptide or as a nucleic acid encoding the polypeptide. Suitable costimulatory molecules include, for example, the CD28 binding peptide B7.1 (CD80; Schwartz, 1992; Chen et al., 1992; Ellis et al., J. Immunol., 156 (8): 2700-9) and B7 .2 (CD86; Ellis, et al., J. Immunol., 156 (8): 2700-9), the CD28 family (ie, CD28, ICOS; Hutloff, et al., Nature 1999, 397: 263 -265; polypeptides that bind to members of Peach, et al., J. Exp Med 1994, 180: 2049-2058); integrin families such as members of the ICAM family (ie, ICAM-1, -2 or -3) A polypeptide that binds to a member of (ie, LFA-1 (CD11a / CD18); Sedwick, et al. J Immunol 1999, 162: 1367-1375; Wu (e) lfing, et al. Science 1998, 282: 2266- Lub, et al. Immunol Today 1995, 16: 479-483); for example CD58 (LFA-3; CD2 ligand; Davis et al., Immunol Today 1996, 17: 177-187) or SLAM ligand (Sayos, et al. Nature 1998, 395: 462-469), a member of the CD2 family A polypeptide that binds to CD2, signaling lymphocyte activation molecule (CDw150 or “SLAM”; Aversa, et al., J Immunol 1997, 158: 4036-4044); heat stable antigen (HSA) Or a polypeptide that binds to CD24; Zhou, et al. Eur J Immunol 1997, 27: 2524-2528); for example, 4-1BBL (4-1BB ligand; Vinay, et al. Semin Immunol 1998, 10: 481-489 DeBenedette, et al. J Immunol 1997, 158: 551-559), TNFR associated factor (TRAF-1; 4-1BB ligand; Saoulli, et al. J Exp Med 1998, 187: 1849-1862 , Arch, et al. Mol Cell Biol 1998, 18: 558-565), TRAF-2 (4-1BB and OX40 ligand; Arch, et al. Mol Cell Biol 1998, 18: 558-565; Jang, et al. Biochem Biophys Res Commun 1998, 242: 613-620; Kawamata S, et al. J Biol Chem 1998, 273: 5808-5814), OX40L (OX40 ligand; Gramglia, et al. J Immunol 1998, 161: 6510-6517) TRAF-5 (OX40 ligand; Arch, et al. Mol Cell Biol 1998, 18: Kawamata, et al. J Biol Chem 1998, 273: 5808-5814), and CD70 (CD27 ligand; Couderc, et al. Cancer Gene Ther., 5 (3): 163-75), CD154 (CD40 TNF receptors, such as the ligand or “CD40L”; Gurunathan, et al. J. Immunol., 1998, 161: 4563-4571; Sine, et al. Hum. Gene Ther., 2001, 12: 1091-1102) (TNFR) family (ie 4-1BB (CD137; Vinay et al. Semin Immunol 1998, 10: 481-489), OX40 (CD134;
Weinberg, et al. Semin Immunol 1998, 10: 471-480; Higgins, et al. J Immunol 1999, 162: 486-493), and CD27 (Lens, et al. Semin Immunol 1998, 10: 491-499) Polypeptides that bind to members are also suitable.

  One or more cytokines can also be suitable co-stimulatory components or “adjuvants”, either as polypeptides or encoded by nucleic acids contained within the compositions of the invention (Parmiani, et al. Immunol Lett 2000 Sep 15; 74 (1): 41-4: Berzofsky, et al. Nature Immunol. 1: 209-219). Suitable cytokines include, for example, interleukin-2 (IL-2) (Rosenberg, et al. Nature Med. 4: 321-327 (1998)), IL-4, IL-7, IL-12 (Pardoll, 1992 Harries, et al. J. Gene Med. 2000 Jul-Aug; 2 (4); 243-9; Rao, et al. J. Immunol. 156: 3357-3365 (1996)), IL-15 (Xin, et al. Vaccine, 17: 858-866, 1999), IL-16 (Cruikshank, et al. J, Leuk Biol. 67 (6): 757-66, 2000), IL-18 (J. Cancer Res. Clin Oncol. 2001, 127 (12): 718-726), GM-CSF (CSF (Dissis, et al. Blood, 88: 202-210 (1996)), tumor necrosis factor-α (TNF-α), or Interferon-γ (INF-γ), other cytokines known in the art may be suitable for practicing the present invention.

  Chemokines can also be used. For example, a fusion protein comprising CXCL10 (IP-10) and CCL7 (MCP-3) fused to a tumor autoantigen has been shown to induce anti-tumor immunity (Biragyn, et al. Nature Biotech, 1999, 17 : 253-258). The chemokines CCL3 (MIP-1α) and CCL5 (LANTES) (Boyer, et al. Vaccine, 1999, 17 (Supp. 2); S53-S64) may also be useful in practicing the present invention. Other suitable chemokines are also known in the art.

  It is also known that inhibitory or negative regulatory immune mechanisms are blocked to enhance the immune response. For example, anti-CTLA-4 (Shrikant, et al. Immunity, 1996, 14: 145-155; Sutmuller, et al. J. Exp. Med., 2001, 194: 823-832), anti-CD25 (Sutmuller, supra) Anti-CD4 (Matsui, et al. J. Immunol., 1999, 163: 184-193), fusion protein IL13Ra2-Fc (Terabe, et al. Nature Immunol., 2000, 1: 515-520), and those Treatment with a combination (ie, a combination of anti-CTLA-4 and anti-CD25; Sutmuller, supra) has been found to up-regulate anti-tumor immune responses and is suitable for practicing the present invention.

  Any of these components may be used alone or in combination with other substances. For example, a combination of CD80, ICAM-1 and LFA-3 (“TRICOM” has been shown to be able to enhance anti-cancer immune responses (Hodge, et al. Cancer Res. 59: 5800-5807 (1999)). As an effective combination of, for example, IL-12 + GM-CSF (Ahlers, et al. J. Immunol., 158: 3947-3958 (1997); Iwasaki, et al. J. Immunol. 158: 4591-4601 (1997) ), IL-12 + GM-CSF + TNF-α (Ahlers, et al. Int. Immunol. 13: 897-908 (2001)), CD80 + IL-12 (Fruend, et al. Int. J. Cancer, 85: 508-517 ( Rao, et al. Supra), and CD86 + GM-CSF + IL-12 (Iwasaki, supra) Those skilled in the art will be aware of other combinations useful for practicing the present invention. One would also know additional reagents or methods that can be used to modulate such mechanisms, as well as other reagents and methods known to those skilled in the art to practice the present invention. Available to:

  For example, the use of a self-replicating viral replicon (Caley, et al. 1999, Vaccine, 17: 3124-3135; Dubensky, et al. 2000, Mol. Med. 6: 723-732; Leitner, et al. 2000, Cancer Res 60: 51-55), codon optimization (Liu, et al. 2000, Mol. Ther., 1: 497-500; Dubensky, supra; Huang, et al. 2001, J. Virol. 75: 4947-4951 ), In vivo electroporation (Widera, et al. 2000, J. Immunol. 164: 4635-4640) ;, integration of CpG stimulation motifs (Gurunathan, et al. Ann. Rev. Immunol., 2000, 18: 927) -974; Leitner, supra), endocytosis or ubiquitin-processing pathway (Thomson, et al. 1998, J. Virol. 72: 2246-2252; Velders, et al., 2001, J. Immunol. 166: 5366- 5373), prime-boost method (Gurunathan, supra; Sullivan, et al. 2000, Nature, 408: 605-609; Hanke, et al. 1998, Vaccine, 16: 439-445; Amara, et al. 2001, Science , 292: 69-74), and the use of mucosal transport vectors such as Salmonella (Darji, et al. 1997, Cell, 91: 7 65-775; Woo, et al. 2001 Vaccine, 19: 2945-2954), and other strategies that improve the effectiveness of nucleic acid-based immunity may be used. Other methods are also known in the art and some are described below.

  Chemotherapeutic agents, radiation, anti-angiogenic compounds, or other substances can also be used in the treatment and / or prevention of cancer using immunogenic targets (Sebti, et al. Oncogene 2000 Dec 27; 19 (56); 6566-73). For example, chemotherapeutic agents useful in the treatment of metastatic breast cancer include cyclophosphamide, doxorubicin, paclitaxel, docetaxel, navelbine, capecitabine, and mitomycin C. Combination chemotherapy, such as cyclophosphamide + methotrexate + 5-fluorouracil; cyclophosphamide + doxorubicin + 5-fluorouracil; or cyclophosphamide + doxorubicin has also been found effective. Other compounds such as prednisone, taxane, navelbine, mitomycin C, or vinblastine are also utilized for various reasons. The majority of breast cancer patients have estrogen receptor positive (ER +) tumors, in which endocrine therapy (ie tamoxifen) is preferred over chemotherapy. In such patients, tamoxifen or progestin (medroxyprogesterone acetate or megestrol acetate) is preferred as second line therapy. Aromatase inhibitors (ie aminoglutethimide and its analogues such as letrozole) reduce the efficacy of estrogens necessary to maintain tumor growth, and in some patients secondary or tertiary endocrine therapy Can be used as

  Other cancers may require different chemotherapy. For example, metastatic colorectal cancer is usually treated with camptosar (irinotecan or CPT-11), 5-fluorouracil, or leucovorin alone or in combination with other drugs. For example, proteinase and integrin inhibitors such as MMP inhibitors marimastate (British Biotech), COL-3 (Collagenex), Neovastat (Aetema), AG3340 (Agouron), BMS-275291 (Bristol Myers Squibb ), CGS27023A (Novaritis), or the integrin inhibitor Vitaxin (Medimmune), or MED1522 (Merck KgaA). Immunotargeting of immunogenic targets associated with colorectal cancer can be performed in combination with treatment with these chemotherapeutic agents. Similarly, chemotherapeutic agents used to treat other types of cancer are well known in the art and can be combined with the immunogenic targets described herein.

  Many anti-angiogenic agents are also known in the art and are suitable for administration with immunogenic target vaccines (eg, Timar, et al. 2001, Pathology Oncol. Res., 7 (2): 85- 94). Such substances include, for example, growth factors (ie ANG-2, NK1, 2, 4 (HGF), transforming growth factor β (TGF-β)), cytokines (ie INF-α, -β, -γ Such as interferon, platelet factor 4 (PF-4, PR-39)), protease (ie, truncated AT-III, collagen XVIII fragment (endostatin), HmwKalliKrein-d5 plasmin fragment (angiostatin), prothrombin-F1- 2, TSP-1), protease inhibitors (ie, tissue inhibitors of metalloprostheses such as TIMP-1, -2, or -3; Maspin; Plasminogen activator inhibitors such as PAI-1; Pigment epithelium Derived factor (PEDF)), tumstatin (available for purchase from ILEX, Inc.), antibody products (ie, collagen-binding antibodies HUIV26, HUI77, XL313; anti-VEGF; anti-integrin (ie, vitaxin (Lx sys))), and physiological substances such as glycosidases (ie, heparinase-I, -III). “Chemical” or modified physiological substances known or believed to have anti-angiogenic properties include, for example, vinblastine, taxol, ketoconazole, thalidomide, dolestatin, combrestatin A, Rapamycin (Guba, et al. 2002, Nature Med., 8: 128-135), CEP-7055 (available from Cephalon, Inc.), flavone acetic acid, Bay 12-9566 (Bayer Corp.), AG3340 (Agouron, Inc.), CGS 27023A (Novartis), tetracycline derivatives (ie, COL-3, Collagenix, Inc.), Novastat (Aeterna), BNS-275291 (Bristol-Mayers Squibb), low dose 5-FU, low dose Methotrexate (MTX), irsofladine, radicicol, cyclosporine, captopril, celecoxib, D45152 sulfated polysaccharide, cationic protein (protamine), cationic peptide-VEGF, Min (polysulphonated napthyl urea), a compound that inhibits the function or production of VEGF (ie, SU5416 or SU6668 (Sugen), PTK787 / ZK22584 (Novartis), distamycin A, Angiozyme (ribozyme) ), Isoflavinoids, staurosporine derivatives, genistein, EMD121974 (Merck KcgaA), tyrphostins, isoquinolone, retinoic acid, carboxamidotriazole, TNP-470, octreotide, 2-methoxyestradiol, aminosterol ( Squalamine), glutathione analog (ie, N-acetyl-L-cysteine), combretastatin A-4 (Oxigene), Eph receptor blocking agent (Nature, 414: 933-938, 2001), Rh-angiostatin Rh-endostatin (WO 01/93897), cyclic-RGD pep Tide, actin-disintegrin, benzodiazepen, humanized anti-avb3 antibody, Rh-PAI-2, amiloride, p-amidobenzamidine, anti-uPA antibody, anti-uPAR antibody, L-phenylalanine-N-methylamide (ie, Batimistat ), Marimastat, AG3340, and minocycline. Many other suitable materials are known in the art and are sufficient to practice the invention.

  The present invention can also be used in combination with "non-traditional" cancer treatment methods. For example, it has been recently reported that administration of certain anaerobic bacteria helps slow tumor growth. In one study, Clostridium novyi was modified to remove the toxin gene carried on the phage episome and administered to mice with colorectal cancer (Dang, et al., PNAS USA, 98 (26): 15155-15160, 2001). In combination with chemotherapy, the treatment caused tumor necrosis in the animals. The reagents and methods described in this application may be combined with such treatment methods.

  Nucleic acid encoding an immunogenic target may be administered to a patient by any available technique. Various viral vectors that have been successfully used to introduce nucleic acids into hosts include retroviruses, adenoviruses, adeno-associated viruses (AAV), herpes viruses, poxviruses, and the like. It will be appreciated that many such viral vectors are available in the art. The vectors of the present invention can be constructed using standard recombinant techniques widely used by those skilled in the art. Such techniques are described, for example, in Molecular Cloning: A Laboratory Manual (Sambrook, et al., 1989, Cold Spring Harbor Laboratory Press), Gene Expression Technology (Methods in Enzymology, Vol. 185, by D. Goeddel, 1991, Academic. Press, San Diego, CA), and PCR Protocols: A Guide to Methods and Applications (Innis, et al. 1990, Academic Press, San Diego, CA). Yes.

  Preferred retroviral vectors are lentiviral derivatives, as well as mouse or avian retroviral derivatives. Examples of suitable retroviral vectors include, for example, Moloney murine leukemia virus (MoMuLV), Harvey murine sarcoma virus (HaMuSV), mouse mammary carcinoma virus (MuMTV), SIV, BIV , HIV, and Rous sarcoma virus (RSV). Many retroviral vectors can incorporate a large number of exogenous nucleic acid sequences. Because recombinant retroviruses are incomplete, they need help to form infectious vector particles. For example, help can be provided by helper cell lines encoding retroviral structural genes. Suitable helper cell lines include φ2, PA317 and PA12. Vector virions formed using such cell lines can be used to infect tissue cell lines such as NIH 3T3 cells to produce large quantities of chimeric retroviral virions. Retroviral vectors can be administered by conventional methods (ie injection) or by transplanting a “producer cell line (virus-producing cell line)” in close proximity to the target cell population (Culver, K., et al. 1994, Hum. Gene Ther., 5 (3): 343-79; Culver, K., et al., Cold Spring Harb. Symp. Quant. Biol., 59: 685-90); Oldfield, E., 1993, Hum. Gene Ther., 4 (1): 39-69). Producer cell lines are genetically engineered to produce viral vectors and to release viral particles in the vicinity of target cells. Some of the released viral particles come into contact with the target cells, infect them, and transport the nucleic acid of the invention to the target cells. Following infection of the target cell, vector nucleic acid expression occurs.

  Adenoviral vectors are particularly eukaryotic (Rosenfeld, M., et al., 1991, Science, 252 (5004): 431-4; Crystal, R., et al., 1994, Nat. Genet., 8 (1): 42-51), eukaryotic gene expression studies (Levrero, M., et al., 1991, Gene, 101 (2): 195-201, vaccine development (Graham, F., Prevec, L. , 1992, Biotechnology, 20: 363-90), and animal models (Stratford-Perricaudet, L., 1992, Bone Marrow Transplant., 9 (Suppl. 1): 151-2; Rich, D., et al., 1993, Hum. Gene Ther., 4 (4): 461-76) has been found to be useful for gene transfer Experiments for administering recombinant Ad to various tissues in vivo Routes of administration include intratracheal instillation (Rosenfeld, M., et al., 1992, Cell, 68 (1): 143-55), intramuscular injection (Quantin, B., et al., 1992, Proc Natl. Acad. Sci. USA, 89 (7): 2581-4), peripheral intravenous injection (Herz, J., Gerard, R., 1993, Proc. Natl. Acad. Sci. USA, 90 (7): 2812-6), stereotactic inoculation (Le Gal La Sall e, G., et al., 1993, Science, 259 (5097): 988-90).

  Adeno-associated virus (AAV) has a high level of infectivity, a broad host range, and integration specificity into the host cell genome (Hermonat, P., et al., 1984, Proc. Natl. Acad. Sci. USA). , 81 (20): 6466-70). Type I herpes simplex virus (HSV-I) is a vector system that has yet another appeal, especially for use in the nervous system, due to its neurotropic properties (Geller, A., et al., 1991, Trends Neurosci., 14 (10): 428-32; Glorioso, et al., 1995, Mol. Biotechnol., 4 (1): 87-99; Glorioso, et al., 1995, Annu. Rev. Microbiol., 49: 675-710).

  Poxviruses are another useful expression vector (Smith et al., 1983, Gene, 25 (1): 21-8; Moss, et al., 1992, Biotechnology, 20: 345-62; Moss, et al., 1992, Curr. Top. Microbiol. Immunol., 158: 25-38; Moss, et al., 1991, Science, 252; 1662-1667). Pox viruses include vaccinia willowis, NYVAC, avipox virus, canarypox, ALVAC, ALVAC (2), etc. and have proven useful.

  NYVAC (vP866) is derived from the Copenhagen vaccine strain of vaccinia virus by deleting six non-essential regions encoding known or potential virulence factors (eg, US Pat. Nos. 5,364,773 and (See 5,494,807). The deletion locus was engineered as a recipient locus for insertion of foreign genes. Deletion regions are thymidine kinase gene (TK; J2R); hemorrhagic region (u; B13R + B14R); type A inclusion body region (ATI; A26L); hemagglutinin gene (HA; A56R); host region gene region (C7L-K1L); and the large subunit, ribonucleotide reductase (I4L). NYVAC is a genetically engineered vaccinia virus strain created by specific deletion of 18 open reading frames encoding gene products related to toxicity and host range. NYVAC has been found useful for expressing TA (see, eg, US Pat. No. 6,265,189). NYVAC (vP866), vP994, vCP205, vCP1433, placZH6H4Lreverse, pMPC6H6K3E3, and pC3H6FHVB are VR-2559, VR-2558, VR-2557, VR-2556, ATCC-97913, ATCC-97912, and ATCC-97914, respectively. Deposited with the ATCC in accordance with the provisions of the Budapest Treaty.

  ALVAC-based recombinant viruses (ie, ALVAC-1 and ALVAC-2) are also suitable for use in the practice of the present invention (see, eg, US Pat. No. 5,756,103). ALVAC (2) is identical to ALVAC (1) except that the ALVAC (2) genome contains vaccinia E3L and K3L genes under the control of the vaccinia promoter (US Pat. No. 6,130,066; Beattie et al. , 1995a, 1995b, 1991; Chang et al., 1992; Davies et al., 1993). Both ALVAC (1) and ALVAC (2) have been found useful for expressing foreign DNA sequences such as TA (Tartaglia et al., 1993 a, b; U.S. Pat.No. 5,833,975). ). ALVAC has been deposited with the American Type Culture Collection (ATCC; 10801 University Boulevard, Manassas, Va. 20110-2209, USA) as ATCC registration number VR-2547 in accordance with the provisions of the Budapest Treaty.

  Another useful poxvirus vector is TROVAC. TROVAC refers to attenuated fowlpox virus, a plaque-cloned isolate derived from the FP-1 vaccine strain of fowlpox virus that has been approved for vaccination of 1-day-old chicks. TROVAC was deposited with the ATCC as registration number 2553 under the terms of the Budapest Treaty.

  “Non-viral” plasmid vectors are also suitable for practicing the present invention. Preferred plasmid vectors are compatible with bacterial, insect and / or mammalian host cells. Such vectors include, for example, PCR-II, pCR3, and pcDNA3.1 (Invitrogen, San Diego, Calif.), PBSII (Stratagene, La Jolla, Calif.), PET15 (Novagen, Madison, Wis.), PGEX (Pharmacia Biotech , Piscataway, NJ), pEGFP-N2 (Clontech, Palo Alto, CA), pETL (BlueBacII, Invitrogen), pDSR-α (WO 90/14363) and pFastBacDual (Gibco-BRL, Grand Island, NY), As well as Bluescript® plasmid derivatives (high copy number COLE1-based phagemids, Stratagene Cloning Systems, La Jolla, Calif.), PCR cloning plasmids designed to clone Taq-amplified PCR products (eg, TOMO ™) TA cloning® kit, PCR2.1® plasmid derivative, Invitrogen, Carlsbad, CA). Bacterial vectors can also be used in the present invention. Such vectors include, for example, Shigella, Salmonella, Vibrio cholerae, Lactobacillus, Calmette Guerin (BCG), and Streptococcus (for example, WO 88/6626; 90/0594; 91/13157; 92/1796; and 92/21376). Many other non-viral plasmid expression vectors and systems are known in the art and can be used in the present invention.

Suitable nucleic acid transportation technologies, DNA-ligand complexes, adenovirus - ligand -DNA complexes, direct injection of DNA, CaPO ₄ precipitation, gene gun techniques, electroporation, and colloidal dispersion systems, and the like. Colloidal dispersions include lipid-based systems such as macromolecular complexes, nanocapsules, microspheres, beads, and oil-in-water emulsions, micelles, mixed micelles, and liposomes. A preferred colloidal system in the present invention is a liposome, which is an artificial membrane vesicle useful for transporting transport vehicles (vihicles) in vitro and in vivo. RNA, DNA and intact virions can be encapsulated in the aqueous phase and transported to cells in a bioactive form (Fraley, R., et al., 1981, Trends Biochem. Sci., 6:77). The composition of the liposome is usually a combination of phospholipids, particularly phospholipids having a high phase transition temperature, usually in combination with a steroid such as cholesterol. Other phospholipids or other lipids may be used. The physical properties of the liposomes depend on pH, ionic strength, and the presence of a double cation. Examples of qualities useful in liposome production include phosphatidylglycerol, phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine, sphingolipids, cerebrosides, gangliosides, and the like. Particularly useful is diacyl phosphatidyl glycerol, where the lipid moiety contains 14-18 carbon atoms, especially 16-18 carbon atoms, and is saturated. Exemplary phospholipids include egg phosphatidylcholine, dipalmitoyl phosphatidylcholine, and distearoyl phosphatidylcholine.

To enhance the immune response, an immunogenic target may be administered in combination with one or more adjuvants. Exemplary adjuvants are shown in the following table:

The immunogenic targets of the present invention can be used to generate antibodies for use in screening assays or immunotherapy. Other uses will be apparent to those skilled in the art. The term “antibody” refers to a Fab, Fab ₂ , single chain antibody (eg, Fv), humanized antibody, chimeric antibody, made by methods known in the art, as known in the art, Includes antibody fragments such as human antibodies. Methods for preparing and utilizing various types of antibodies are well known to those of skill in the art and are suitable for practicing the present invention (eg, Harlow, et al., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, 1988 ; Harlow, et al. Using Antibodies: A Laboratory Manual, Portable Protocol No. 1, 1988; Kohler and Milstein, Nature, 256: 495 (1975); Jones et al. Nature, 321: 522-525 (1986); Riechmann et al. Nature, 332: 323-329 (1988); Presta (Curr. Op. Struct. Biol., 2: 593-596 (1992); Verhoeyen et al. Science, 239: 1534-1536 (1988); Hoogenboom et al., J. Mol. Biol., 227: 381 (1991); Marks et al., J. Mol. Biol., 222: 581 (1991); Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R Liss, p. 77 (1985); Boemer et al., J. Immunol., 147 (I): 86-95 (1991); Marks et al., Bio / Technology 10, 779-783 (1992); Lonberg et al., Nature 368 856-859 (1994); Morrison, Nature 368 812-13 (1994); Fishwild et al., Nature Biotechnology 14, 845-51 (1996); Neuberger, Nature Biotechnolog Y 14, 826 (1996); Lonberg and Huszar, Intern. Rev. Immunol. 13 65-93 (1995); and U.S. Pat. Nos. 4,816,567; 5,545,807; 5,545,806; 5,569,825; No. 5,633,425; and 5,661,016). For example, an antibody or its antibody to a therapeutic moiety such as a cytotoxic agent or toxin, or an active fragment thereof such as diphtheria toxin A chain, endotoxin A chain, ricin A chain, curcin, crotine, phenomycin, enomycin, etc. Derivatives may be combined. The cytotoxic substance may contain a radiochemical substance. Antibodies and derivatives thereof may be included in the compositions of the invention for use in vitro or in vivo.

  Nucleic acids, proteins, or derivatives thereof corresponding to immunogenic targets are used in assays to identify the presence of a disease state in a patient, predict prognosis, or identify the effectiveness of chemotherapy or other treatment methods Can do. Expression profiles performed as known in the art can be used to identify the relative expression levels of immunogenic targets. Expression levels can be related to basal levels to determine whether the patient suffers from a particular disease, the patient's prognosis, or whether a particular treatment method is effective. For example, if a patient is treated with specific chemotherapy, a decrease in the expression level of the immunogenic target in the patient's tissue (ie, peripheral blood) suggests that the treatment method has reduced the amount of cancer in the host. To do. Similarly, if expression levels increase, other treatment methods need to be used. In one embodiment, a nucleic acid probe corresponding to a nucleic acid encoding an immunogenic target may be attached to the biochip, as is known in the art, to detect and quantify expression in the host.

  In addition, nucleic acids, proteins, derivatives thereof, or antibodies thereto can be used as reagents in drug screening assays. Reagents may be used to assess the effect of drug candidates on the expression of immunogenic targets in cell lines or patient cells or tissues. Expression profiling techniques can be combined with high-throughput screening techniques to allow rapid identification of useful compounds and to monitor the effects of treatment with drug candidates (eg, Zlokamik, et al., Science 279, 84-8 (1998)). The drug candidate may be a chemical compound, a nucleic acid, a protein, an antibody, or a derivative thereof, and may be natural or synthetic. The drug candidate thus identified can be utilized, for example, as a pharmaceutical composition for administration to a patient or for use in further screening assays.

  Administration of the compositions of the invention to the host can be performed using any of a variety of techniques known to those skilled in the art. The composition can be processed based on conventional methods of pharmacy to create a medicament (ie, a “pharmaceutical composition”) for administration to patients, such as humans and other mammals. The pharmaceutical composition is preferably prepared in the form of a dosage unit containing a predetermined amount of DNA, viral vector, particle, polypeptide or peptide. Appropriate daily doses for humans or other mammals can be identified using routine methods.

  The pharmaceutical composition is administered orally, parenterally, by inhalation spray, rectally, intralymphatically or topically, in dosage unit formulations comprising conventional pharmaceutically acceptable carriers, adjuvants, and vehicles. can do. As used herein, the term “pharmaceutically acceptable carrier” or “physiologically acceptable carrier” is used to achieve or enhance delivery of a nucleic acid, polypeptide, or peptide as a pharmaceutical composition. One or more compounding materials suitable for A “pharmaceutical composition” is a composition comprising a therapeutically effective amount of a nucleic acid or polypeptide. The term “effective amount” or “therapeutically effective amount” refers to the amount of nucleic acid or polypeptide used to induce or enhance an effective immune response. Preferably, the composition of the invention induces or enhances an anti-tumor immune response in the host that protects the host from tumor development and / or eliminates existing tumors from the body.

  For oral administration, the pharmaceutical composition may be in any form, such as a capsule, tablet, suspension, or liquid. The liquid can be administered by injection as a composition comprising a suitable carrier such as saline, dextrose or water. The parenteral terminology used herein includes subcutaneous, intravenous, intramuscular, intrasternal, infusion, or intraperitoneal administration. Suppositories for rectal administration of the drug can be prepared by mixing the drug with a suitable non-irritating excipient such as cocoa butter and polyethylene glycol which are solid at ambient temperature but liquid at the rectal temperature.

The dosage regimen for immunizing the host or treating the disease or condition with the composition of the invention is used for the type of disease, age, weight, sex, patient condition, severity of symptoms, route of administration, and Based on various factors such as specific compounds. For example, the poxvirus vector can be administered as a composition containing 1 × 10 ⁶ infectious particles per dose. Thus, the regimen will vary greatly, but can be identified as usual using standard methods.

  A prime-boost method is also available (WO 01/30382) in which the target immunogen is administered in one form in the priming process, followed by a boosting process in which the target immunogen is administered in another form. The form of the target immunogen in the priming and boosting process is different. For example, if the priming process uses nucleic acids, the boost may be administered as a peptide. Similarly, if the priming process uses one type of recombinant virus (eg ALVAC), the boosting process can use another type of virus (eg NYVAC). This prime-boost regimen has been shown to induce a strong immune response.

  The compositions of the invention may be administered as a single active agent, but used in combination with one or more other compositions or substances (eg, other immunogenic targets, costimulatory molecules, adjuvants, etc.). Also good. When administered in combination, the individual components may be formulated as separate compositions that are administered at the same time or different times, or the components may be formulated as a single composition.

  Injectable preparations, for example, sterile injectable aqueous or oleaginous suspensions, can be prepared according to known methods using suitable dispersing or surfactants and suspending agents. Injectable preparations may be sterile injectable solutions or suspensions in nontoxic parenterally acceptable diluents or solvents. Suitable media and solvents that can be used are water, Ringer's solution, isotonic saline, and the like. For example, a viral vector such as poxvirus may be prepared in 0.4% NaCl. In addition, sterile, fixed oils are conventionally used as a solvent or suspending solvent. For this purpose any bland volatile oil can be employed such as synthetic mono- or diglycerides. Furthermore, it has been found that fatty acids such as oleic acid can be used in the preparation of injectable preparations.

  For topical administration, a suitable topical dosage form composition may be administered 1 to 4 times, more preferably 2 to 3 times per day. In addition, a drug may be administered on a day during which no drug is administered. Suitable compositions include 0.001% to 10% by weight, such as 1% to 2% by weight of the formulation, which may be as much as 10% by weight, but preferably not exceeding 5% by weight, More preferably, it contains 0.1% to 1% by weight of the preparation. Formulations suitable for topical administration include liquid or semi-liquid preparations suitable for penetration through the skin (eg, coatings, lotions, ointments, creams, or pastes), and administration to the eyes, ears, or nose Suitable droplets and the like can be mentioned.

  The pharmaceutical composition may be prepared in a solid dosage form (granule, powder or suppository). The pharmaceutical composition may be subjected to conventional pharmaceutical treatments such as sterilization and / or may include conventional adjuvants such as preservatives, stabilizers, wetting agents, emulsifiers, buffers and the like. Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In such solid dosage forms, the active compound may be admixed with at least one inert diluent such as sucrose, lactose, or starch. Such dosage forms may also contain additional materials other than inert diluents, such as a lubricant such as magnesium stearate, in the usual manner. In the case of capsules, tablets, and pills, the dosage form may also contain a buffer. Tablets and pills may additionally be prepared with enteric coatings. Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, solutions, suspensions, syrups, and elixirs containing inert diluents commonly used in the art, such as water. Can be mentioned. Such compositions may contain adjuvants such as wetting agents, flavoring agents, and flavoring agents.

  The pharmaceutical composition comprising the nucleic acid or polypeptide of the present invention may be in any of several forms and may be administered by any of several routes. In preferred embodiments, the composition is administered via a parenteral route (intradermal, intramuscular or subcutaneous) to induce an immune response in the host. Alternatively, the composition may be administered directly to a lymph node (intralymph node) or a tumor mass (ie, intratumoral administration). For example, doses may be administered subcutaneously on days 0, 7 and 14. Suitable immunization methods using compositions containing TA include p53 (Hollstein et al., 1991), p21-ras (Almoguera et al., 1988), HER-2 (Fendly et al., 1990), melanola-related Antigen (MAGE-1; MAGE-2) (van der Bruggen et al., 1991), p97 (Hu et al., 1988), and carcinoembryonic antigen (CEA) (Kantor et al., 1993; Fishbein et al ., 1992; Kaufman et al., 1991) and the like.

  Preferred embodiments of administrable compositions include nucleic acids or polypeptides in liquid preparations such as, for example, suspensions, syrups, elixirs. Preferred injectable preparations include, for example, nucleic acids or polypeptides suitable for parenteral, subcutaneous, intradermal, intramuscular or intravenous administration, such as sterile suspensions or emulsions. For example, the recombinant poxvirus may be mixed with a suitable carrier, diluent or excipient, such as sterile water, saline, glucose or the like. Also, for example, the composition may be provided in lyophilized form for reconstitution with an isotonic aqueous solution, saline buffer. Furthermore, the composition of the present invention is administered simultaneously with other antineoplastic agents, antitumor agents or anticancer agents and / or agents that reduce or alleviate the side effects of antineoplastic agents, antitumor agents or anticancer agents. Or may be administered continuously. In addition, the kit may include instructions for mixing or formulating and / or administering the components.

  The invention and its many advantages will be better understood with the following examples given by way of illustration.

Example 1
A. Modification of mCEA (6D) repeat 1 After expression of recombinant CEA, the presence of a truncated form of CEA was demonstrated in the cells. This study shows that a CEA-encoding nucleic acid sequence has been created that does not cause expression of truncated CEA after expression in cells. The creation and expression of a new CEA encoding nucleic acid sequence CAP (6D) -1,2 is described below.

  Plasmid p3'H6MCEA was obtained from Virogenetics, Inc. This plasmid contains the MCEA gene with a 6D modification under the control of the partial H6 promoter (FIG. 1A). The 912 bp NruI-BamHI fragment from p3′H6MCEA was cloned into pUC18 to form plasmid pSE1544.9 (pUC18-mCEA repeat 1; FIG. 1B).

  OPC-purified oligo sequences 7524-7526, 7528-7533, 7535-7537, and 7567-7568 were kinased and annealed to create two fragments that were ligated and flanked by AccI and BamHI sites A 464 bp synthetic modified mCEA repeat 1 is generated. This synthetic modified repeat 1 fragment was cloned into pSE1544.9 AccI-BamHI to create pSE1616.44 (pUC18-mCEA-modified repeat 1; FIG. 2). The 904 bp EcoRV-BamHI fragment of pSE1616.44 was cloned back into p3′H6MCEA EcoRV-BamHI to create pSE1658.15 (p3′H6MCEA-modified repeat 1; FIG. 3).

B. Modification of mCEA (6D) repeat 2 (repeat 2) A synthetic modified repeat 2 fragment was created using a method called gene splicing with overlap extension, cloned into pBluescript-SK +, and pBSmCEA (Fig. 4) was created. The oligo sequences used for repeat 2 modification are shown below (sections IV and B). Two different clones (pBS-mCEA-3 and pBS-mCEA-8) contained various point mutations.

  The 697 bp BamHI-EcoRI fragment of pBS-mCEA-3 was cloned into pUC18 BamHI-EcoRI to generate pSE1671.8. The 591 bp SpeI-Bsu36I fragment of pBSmCEA-8 was cloned into pSE1671.8 SpeI-Bsu36I to create a plasmid called pSE1681.1. Two site PCR mutagenesis was performed using the Quikchange site-directed mutagenesis kit (Stratagene) with oligo sequences 7751 (GGACGGTAGTAGGTGTATGATGGAGATATAGTTGGGTCGTCTGGGCC) and 7760 (CAGAATGAATTATCCGTTGATCACTCC) to produce the two remaining point mutations. Fixed. The corrected clone is designated pSE1686.1 (pUC18mCEA modified repeat 2; FIG. 5).

  It has recently been found that the alanine codon is not present at the 5 'end of repeat 2 in plasmid p3'H6MCEA contained in CEA. In order to maintain the integrity of the CEA amino acid sequence, the alanine codon present in plasmid pSE1686.1 containing the modified repeat 2 of CEA was knocked out. This was done using oligo sequences 7802 (CGTGACGACGATTACCGTGTATGAGCCACCAAAACCATTCATAAC) and 7803 (GTTATGAATGGTTTTGGTGGCTCATACACGGTAATCGTCGTCACG), and Quikchange site-directed mutagenesis kit (Stratagene). The obtained plasmid pSE1696.1 (pUC18mCEA modified repeat 2; FIG. 6) was confirmed by sequencing.

  The 694 bp Bsu36I-BamHI fragment from the pSE1696.1 fragment was cloned into the Bsu36I-BamHI site of pSE1658.15 to bind the modified repeats 1 and 2. The prepared plasmid is called p3′H6modMCEA-1st & 2nd repeat (FIG. 7).

C. Construction of ALVAC donor plasmid pNVQH6MCEA (6D1st & 2nd)
The 2.2 kb NruI / XhoI fragment from p3'H6mdoMCEA-1st & 2nd repeat was cloned into the NruI / XhoI site of pNVQH6LSP-18 to create pNVQH6MCEA (6D1st &2nd; FIG. 8). FIG. 9 shows the modified CEA sequence (“CAP (6D) -1,2”) contained in pNVQH6MCEA.

D. Expression of modified CEA To test the stability of CAP (6D) -1,2 sequences during expression in cells, pNVQH6MCRA (6D1st & 2nd) as template and two oligo sequences (8034LZ: CTGGCGCGCCTTCTTTATTCTATACTTAAAAAGTG; and 8035LZ: CTGGTACCAGAAAAACTATATCAGAGACC Was used to PCR amplify the gene with the adjacent H6 promoter. The PCT product was then cloned into the NYVAC TK donor plasmid designated pLZTK1 containing the LacZ and KIL marker genes. This vector was specially made to create recombinant virus in NYVAC by using a blue / white screening method. After in vitro recombination between the donor plasmid pLZTK1mCEA (6D1st & 2nd) and NYVAC, the foreign CAP (6D) -1,2 sequence and marker gene are integrated into the NYVAC genome. Plaques containing the intermediate recombinant NYVAC containing both LacZ and mCEA appeared blue. Several plaque purifications were performed. The second recombination event removes the marker gene, resulting in a final white plaque containing a recombinant containing only the CAP (6D) -1,2 sequence and no marker gene (FIG. 10).

  White and blue recombinant plaques were collected for confirmation of CAP (6D) -1,2 sequence expression. Infection was performed with the virus from each plaque and cells were harvested 3 days after infection to prepare either cellular DNA or cell lysate. For isolation of recombinant NYVAC DNA, DNAzol® reagent (GibcoBRL) was used. PCR (PCR conditions: 95 ° C (5 minutes) → [95 ° C (30 seconds) → 49 ° C (30 seconds) → 72 ° C (1 minute)] 30 cycles → 72 ° C (7 minutes) → 4 ° C) Thus, the presence of the CAP (6D) -1,2 sequence in the recombinant NYVAC genome was confirmed. The primers used were 7569LZ (5'ttggatccatggagtctccctcggcc3'forward primer) and 7570LZ (5'ttggatccctatatcagagcaacccc3'reverse primer), which can amplify full length 2106bp CAP (6D) -1,2.

  The final white recombinant plaque PRBC-III-2,3,6,8,9,10 all showed a band of 2.1 kb CAP (6D) -1,2 sequence in PCR. PRBC-III-N1 is a blue plaque with both the marker gene and the CAP (6D) -1,2 sequence still present in the viral genome, and the CAP (6D) -1,2 sequence band was also detected by PCR. Amplified. A prominent PCR band amplified from vCP 307 DNA (including native CEA integrated into the ALVAC genome) was a truncated CEA at 1.2 kb, including a very weak full-length CEA band. A cell-only sample (no viral infection) was used as a negative control and plasmid pLZTKIMCEA (6D1st & 2nd) was used as a positive control in the PCR reaction. The PCR results clearly showed full-length CAP (6D) -1,2 in the recombinant viral genome, without any visible other truncated forms of CEA. This result suggests that CAP (6D) -1,2 has higher stability compared to native CEA in the ALVAC genome.

  Protein expression was also assessed by immunoblot to confirm the absence of cleaved CEA in cells expressing CAP (6D) -1,2 (FIG. 11). For isolation of cell lysate, cells were first washed with PBS, then lysis buffer (reporter gene assay; Boehringer Mannheim) was added and stirred for 15 minutes. Cell lysates were centrifuged at 13,000 rpm and supernatants were collected for Western blot analysis. Samples were loaded on a 10% polyacrylamide gel and run at 125 volts. The protein was then transferred to a PVDF filter membrane (Immobilon-P, Millipore). Expression of mCEA was detected using amplification with a chemiluminescent reagent (DNA Thunder ™; NEN ™ Life Science Products) using HRP-conjugated mouse CEA monoclonal antibody (1: 1000; Fitzgerald).

  All six final white CAP (6D) -1,2 recombinant plaques (PRBC-III-2,3,6,8,9,10) and one intermediate blue plaque (pRBC-III-N1) ) Showed a single CEA band without other cleavage forms (FIG. 11). On the other hand, vCP307 plaques (recombinant ALVAC expressing native CEA) showed a clear cleaved CEA product per ~ 60 kDa in addition to full-length CEA. Long-term film exposure proved that none of the cleaved CEA polypeptide was present in the CPA (6D) -1,2 recombinant. CEF was used as a negative control.

  In conclusion, in order to prevent the expression of various types of CEA, CAP (6D) -1,2 recombinants were made using mCEA rather than native CEA. CAP (6D) -1,2 expressed from recombinant NYVAC proved to be effective in eliminating truncated forms of CEA by both PCR and Western blot methods.

  Although the present invention has been described with reference to preferred embodiments, variations and modifications thereof will be apparent to those skilled in the art. Accordingly, the appended claims include all such equivalent variations and are intended to be included within the scope of this invention.

Explanatory drawing of plasmid p3'H6MCEA containing the CEA coding sequence having 6D modification under the control of the partial H6 promoter (Fig. A) and explanatory drawing of plasmid pSE1544.9 (pUC18-mCEA). Explanatory drawing of plasmid pSE1616.44 (pUC18 mCA-modified repeat 1) Explanatory drawing of plasmid pSE1658.15 (p3'H6MCEA-modified repeat 1) Illustration of plasmid pBSmCEA Illustration of plasmid pSE1686.1 (pUC18 mCA-modified repeat 2) Illustration of plasmid pSE1696.1 (pUC18 mCA-modified repeat 2) Illustration of plasmid p3’H6modMCEA 1st & 2nd repeat Explanatory drawing of plasmid pNVQH6MCEA (6D1st & 2nd) Comparison of nucleotide sequences of CAP (6D) and CAP (6D) -1.2. Differences between sequences are underlined (AD). PCR analysis to confirm the presence of CAP (6D) -1.2 in NYVAC DNA. Immunoblot showing deletion of cleaved CEA in cells expressing CAP (6D) -1.2.

[Sequence Listing]

Claims (37)

  An expression vector comprising the nucleic acid sequence CEA (6D) -1,2 or a fragment thereof shown in SEQ ID NO: 24 and FIG.   The expression vector according to claim 1, which is a plasmid or a viral vector.   The expression vector according to claim 2, which is a viral vector selected from the group consisting of poxvirus, adenovirus, retrovirus, herpes virus, and adeno-associated virus.   The expression vector according to claim 3, which is a poxvirus selected from the group consisting of vaccinia virus, NYVAC, avipox virus, canarypox virus, ALVAC, ALVAC (2), fowlpox virus, and TROVAC.   The expression vector according to claim 4, which is a poxvirus selected from the group consisting of NYVAC, ALVAC, and ALVAC (2).   2. The expression vector of claim 1 further comprising at least one nucleic acid sequence encoding an additional tumor associated antigen.   The expression vector according to claim 6, which is a plasmid or a viral vector.   8. The expression vector according to claim 7, which is a viral vector selected from the group consisting of poxvirus, adenovirus, retrovirus, herpes virus, and adeno-associated virus.   The expression vector according to claim 8, which is a poxvirus selected from the group consisting of vaccinia virus, NYVAC, avipox virus, canarypox virus, ALVAC, ALVAC (2), fowlpox virus, and TROVAC.   The expression vector according to claim 9, which is a poxvirus selected from the group consisting of NYVAC, ALVAC, and ALVAC (2).   The expression vector according to claim 1, further comprising at least one nucleic acid sequence encoding an angiogenesis-related antigen.   The expression vector according to claim 11, which is a plasmid or a viral vector.   13. The expression vector according to claim 12, which is a viral vector selected from the group consisting of poxvirus, adenovirus, retrovirus, herpes virus, and adeno-associated virus.   The expression vector according to claim 13, which is a poxvirus selected from the group consisting of vaccinia virus, NYVAC, avipox virus, canarypox virus, ALVAC, ALVAC (2), fowlpox virus, and TROVAC.   The expression vector according to claim 14, which is a poxvirus selected from the group consisting of NYVAC, ALVAC, and ALVAC (2).   The expression vector according to claim 6, further comprising at least one nucleic acid sequence encoding an angiogenesis-related antigen.   The expression vector according to claim 16, which is a plasmid or a viral vector.   18. The expression vector according to claim 17, which is a viral vector selected from the group consisting of poxvirus, adenovirus, retrovirus, herpes virus, and adeno-associated virus.   19. The expression vector according to claim 18, which is a poxvirus selected from the group consisting of vaccinia virus, NYVAC, avipox virus, canarypox virus, ALVAC, ALVAC (2), fowlpox virus, and TROVAC.   The expression vector according to claim 19, which is a poxvirus selected from the group consisting of NYVAC, ALVAC, and ALVAC (2).   The expression vector according to claim 1, 6, 11 or 16, further comprising at least one nucleic acid sequence encoding a co-stimulatory component.   The expression vector according to claim 21, which is a plasmid or a viral vector.   The expression vector according to claim 22, wherein the expression vector is a viral vector selected from the group consisting of poxvirus, adenovirus, retrovirus, herpes virus, and adeno-associated virus.   The expression vector according to claim 23, which is a poxvirus selected from the group consisting of vaccinia virus, NYVAC, avipox virus, canarypox virus, ALVAC, ALVAC (2), fowlpox virus, and TROVAC.   The expression vector according to claim 24, which is a poxvirus selected from the group consisting of NYVAC, ALVAC, and ALVAC (2).   A composition comprising an expression vector comprising the nucleic acid sequence CEA (6D) -1,2 or a fragment thereof shown in SEQ ID NO: 24 and FIG. 9 in a pharmaceutically acceptable carrier.   27. The composition of claim 26, wherein the vector is a plasmid or a viral vector.   28. The composition of claim 27, wherein the vector is a viral vector selected from the group consisting of poxvirus, adenovirus, retrovirus, herpes virus, and adeno-associated virus.   29. The poxvirus selected from the group consisting of vaccinia virus, NYVAC, avipox virus, canarypox virus, ALVAC, ALVAC (2), fowlpox virus, and TROVAC. Composition.   30. The composition of claim 29, wherein the vector is a poxvirus selected from the group consisting of NYVAC, ALVAC, and ALVAC (2).   A method for preventing or treating cancer, comprising administering an expression vector comprising the nucleic acid sequence CEA (6D) -1,2 or a fragment thereof shown in SEQ ID NO: 24 and FIG. 9 to a host.   32. The method of claim 31, wherein the vector is a plasmid or a viral vector.   33. The method of claim 32, wherein the vector is a viral vector selected from the group consisting of poxvirus, adenovirus, retrovirus, herpes virus, and adeno-associated virus.   34. The vector is a poxvirus selected from the group consisting of vaccinia virus, NYVAC, avipox virus, canarypox virus, ALVAC, ALVAC (2), fowlpox virus, and TROVAC. the method of.   35. The method of claim 34, wherein the vector is a poxvirus selected from the group consisting of NYVAC, ALVAC, and ALVAC (2).   An isolated DNA molecule comprising the nucleic acid sequence CEA (6D) -1,2 shown in SEQ ID NO: 24 and FIG.   An isolated DNA molecule comprising a fragment of the nucleic acid sequence CEA (6D) -1,2 shown in SEQ ID NO: 24 and FIG.

Images