JP2006311824A - Swine mycoplasma pneumonia vaccine - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide an effective, economical and highly safe vaccine against swine mycoplasma pneumonia. <P>SOLUTION: An adhesin protein(P97) of mycoplasma hyopneumoniae and a polypeptide containing a reiterated sequence in the paralogs of the protein are provided, respectively. A gene encoding the polypeptide is also provided. The vaccine, namely, a swine mycoplasma pneumonia vaccine containing the polypeptide, is also provided. <P>COPYRIGHT: (C)2007,JPO&INPIT

Description

  The present invention relates to a mycoplasma hyopneumoniae adhesin protein (P97) and a polypeptide comprising a repetitive sequence in the paralog, a gene encoding the polypeptide, and their use as a porcine mycoplasma pneumonia vaccine.

  Mycoplasma pneumonia in pigs is chronic pneumonia caused by Mycoplasma hyopneumoniae (Mhp), which is low in lethality but has a rapid transmission and high morbidity. Mhp-infected pigs have characteristic lung lesions that cause reduced lung function, so Mhp infection adversely affects body weight gain and feed efficiency, resulting in significant economic losses.

  As a report on the surface antigen protein of Mhp and its use, there are a method for diagnosing porcine mycoplasma pneumonia by ELISA using a monoclonal antibody against the 46 kd membrane protein of Mhp (Patent Document 1), a 46 kd membrane protein of Mhp or one of them. Method for diagnosing porcine mycoplasma pneumonia using DNA encoding DNA (Patent Documents 2 and 3), and a method for diagnosing porcine mycoplasma pneumonia using compositions containing several kinds of membrane proteins having different molecular weights of Mhp (Patent Documents) Although there is 4), there is no description of using these antigenic proteins in vaccines.

  Currently, several types of vaccines against swine mycoplasma pneumonia are on the market, and their inoculation does not prevent infection with Mhp, but it is effective to reduce lung lesions. These vaccines are basically those in which cultured Mhp cells are inactivated and mixed with an adjuvant. For example, surface suspension of culture (Patent Document 5), supernatant of Mhp culture solution and adjuvant (Patent Document) 6) and other vaccines are reported.

  In recent years, the componentization of various animal vaccines has progressed, and the reason why Mhp vaccines have not progressed is that analysis of pathogenic factors and protective factors has not progressed. For example, conventionally, the Mhp vaccine effect was considered to be linked to the antibody titer in serum, that is, humoral immunity. Thus, many researchers have tried to relate the antibody response to the constitutive protein on the cell surface to the suppression of pulmonary lesion formation or prevention of infection, but no clear results have been obtained. On the other hand, Tacker et al. Reported that systemic cellular immunity rather than humoral immunity significantly affected the suppression of Mhp pulmonary lesion formation, and in particular, there was a high correlation between IFN-γ and the vaccine effect (Non-Patent Literature). 1). Since then, the results supporting this report have been reported one after another, and the general view is that systemic cellular immunity is largely involved in the vaccine effect of Mhp. However, it is not clear which component is involved in the induction of systemic cellular immunity among many types of bacterial cell components. In addition, it cannot be said that studies on local immunity are sufficient.

  On the other hand, problems when using an inactivated antigen as a vaccine antigen include safety and cost problems. As for side effects of vaccines currently on the market, allergy-like reactions such as shock and fever loss due to fever have been reported. However, as long as cells containing various components are used, it is difficult to identify the causative substance. In addition, culture media used for culturing Mhp cells often contain high-priced horse serum, pig serum, and high protein components, which increases production costs and increases the protein content. Frequent vaccination will increase the incidence of side effects such as allergies. Therefore, it is desired to specify only a component involved in lung lesion formation among Mhp bacterial cell constituents and provide a vaccine (component vaccine) comprising only the component.

  As a result of immunization of pigs using the detoxified Porphylococcus pneumoniae strain YS-19 that expresses a partial protein of Mycoplasma hyopneumoniae (Mhp) adhesin protein (P97) previously, Succeeded in inducing antibodies against swine erysipelas and antibodies against P97 in the serum and nasal cavity of administered samples, and the possibility that the YS-19 strain could be used as an effective vaccine against two diseases (See Patent Document 7). In addition, by nasally administering the YS-19 strain to pigs, it is possible to impart a pulmonary disease-suppressing effect to virulent Mhp, and the effects include systemic cellular immunity conferred by the strain and local lungs. It has been reported that the IgA antibody produced, that is, humoral immunity plays an important role (see Non-Patent Documents 2 and 3). However, the effectiveness of the P97 partial protein as a vaccine against porcine mycoplasma pneumonia has not been confirmed.

Japanese Patent Publication No. 7-95069 Japanese Patent No. 2772531 Japanese Patent No. 312868 Japanese National Patent Publication No. 11-501809 JP-A-6-172213 Japanese Patent Laid-Open No. 7-118167 JP 2002-119285 A Thacher et al. Am.J.Vet.Res 61,1384,2000 Shimoji et al. Infect.Immun. 70,226,2002 Shimoji et al. Vaccine 21,532,2003

  Accordingly, an object of the present invention is to identify only components involved in lung lesion formation among Mhp bacterial cell components, and provide this as an effective, economical, and highly safe vaccine against swine mycoplasma pneumonia. It is in.

  As a result of the administration of the attenuated swine genus YS-19 strain into which the repetitive sequence region (R1 + 2) of Mycoplasma hyopneumoniae (Mhp) adhesin protein (P97) was introduced into the nasal cavity of the pig, Inflammatory lesions were observed in the lungs, and then attacked with virulent Mhp, it was found that the lung lesions were suppressed. Therefore, focusing on this repetitive sequence region (R1 + 2) and examining the effectiveness of the polypeptide alone containing this region, the vaccine effect similar to that of the YS-19 strain was obtained, and IL-8 production Confirmed to induce. The present invention has been completed based on such findings.

That is, the present invention includes the following inventions.
(1) The polypeptide shown in the following (a) to (e).
(A) a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing (b) consisting of an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing And a polypeptide having protective immunity-inducing activity against porcine mycoplasma pneumonia (c) an amino acid functionally equivalent to the polypeptide comprising the amino acid sequence shown in SEQ ID NO: 2 and having homology with the amino acid sequence shown in SEQ ID NO: 2 Polypeptide containing sequence (d) Polypeptide consisting of amino acid sequence shown in SEQ ID NO: 4 in Sequence Listing (e) One or several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 4 in Sequence Listing A polypep having a protective amino acid-inducing activity against porcine mycoplasma pneumonia De
(2) A gene encoding the polypeptide according to (1).
(3) A gene containing DNA shown in the following (f) to (i).
(F) DNA comprising the base sequence shown in SEQ ID NO: 1 in the sequence listing
(G) a polypeptide that hybridizes under stringent conditions with a DNA comprising a base sequence complementary to the DNA comprising the base sequence shown in SEQ ID NO: 1 in the sequence listing and has protective immunity-inducing activity against porcine mycoplasma pneumonia DNA encoding
(H) DNA consisting of the base sequence shown in SEQ ID NO: 3 in the sequence listing
(I) a polypeptide that hybridizes under stringent conditions with a DNA comprising a base sequence complementary to the DNA comprising the base sequence shown in SEQ ID NO: 3 in the sequence listing and has protective immunity-inducing activity against porcine mycoplasma pneumonia DNA encoding
(4) A recombinant vector comprising the gene according to (2) or (3).
(5) A transformant transformed with the gene according to (2) or (3).
(6) A method for producing the polypeptide according to (1), comprising culturing the transformant according to (5) in a medium and collecting the polypeptide from the obtained culture.
(7) A polypeptide produced by the method according to (6).
(8) A porcine mycoplasma pneumonia vaccine comprising the polypeptide according to (1) or (7).
(9) A porcine mycoplasma pneumonia vaccine comprising the gene according to (2) or (3).
(10) The vaccine according to (8) or (9), comprising adjuvant.
(11) The vaccine according to any one of (8) to (10), which is a systemic or mucosal immunity-inducing vaccine.
(12) Prevention of swine mycoplasma pneumonia, comprising administering the vaccine according to any of (8) to (11) to an animal other than a human who is infected with or may be infected with swine mycoplasma pneumonia / Or how to treat.
(13) The method according to (12), wherein the animal is a pig.
(14) The method according to (12), wherein the administration route is intranasal, intradermal, subcutaneous, intramuscular, intraperitoneal, intravenous, or oral.
(15) An antibody against the polypeptide according to (1).
(16) The antibody according to (15), wherein the antibody is a monoclonal antibody or a polyclonal antibody.

  According to the present invention, a polypeptide that can be used as a porcine mycoplasma pneumonia vaccine is provided. The polypeptide can be produced in large quantities by non-pathogenic recombinant bacteria using genetic recombination technology, and a vaccine comprising this as a component is highly safe because unnecessary components can be reduced, It is cheaper than a vaccine using whole mycoplasma cells.

1. Polypeptide and gene for porcine mycoplasma pneumonia vaccine According to the present invention, as a polypeptide that can be used as a porcine mycoplasma pneumonia vaccine, a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing, or SEQ ID NO: 2 in the sequence listing A polypeptide having a protective immunity-inducing activity against porcine mycoplasma pneumonia, comprising an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence shown in FIG.

  According to the present invention, the polypeptide that can be used as a porcine mycoplasma pneumonia vaccine is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 4 in the sequence listing, or 1 or a number in the amino acid sequence shown in SEQ ID NO: 4 in the sequence listing. A polypeptide comprising an amino acid sequence in which one amino acid is deleted, substituted or added, and having protective immunity-inducing activity against porcine mycoplasma pneumonia is provided. The amino acid sequence shown in SEQ ID NO: 4 in the sequence listing is a partial sequence of adhesin protein (P97) derived from Mycoplasma hyopneumoniae (Mhp) E-1 strain, which is a repeat sequence region 1 (R1) and a repeat sequence region 2 ( R2) is included. R1 corresponds to positions 76 to 225 of the base sequence of the gene encoding a part of the adhesin protein (P97) shown in Sequence Table 3, and R2 corresponds to positions 562 to 633.

  The range of “1 to several” in the above “amino acid sequence in which 1 to several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 2 (or SEQ ID NO: 4)” is not particularly limited. For example, 1 to 10, more preferably 1 to 7, further preferably 1 to 5, particularly preferably about 1 to 3.

  The amino acid deletion, substitution, or addition can be performed by modifying the gene encoding the polypeptide by a technique known in the art. Mutation can be introduced into a gene by a known method such as the Kunkel method or the Gapped duplex method or a method equivalent thereto, for example, a mutation introduction kit (for example, Mutant-K using site-directed mutagenesis). (TAKARA) or Mutant-G (TAKARA)) or the like, or the TAKARA LA PCR in vitro Mutagenesis series kit is used to introduce mutations.

  The above-mentioned “having protective immunity-inducing activity against porcine mycoplasma pneumonia” means that IL-8, a neutrophil migration factor, is produced in response to infection with Mycoplasma hyopneumoniae (Mhp) A polypeptide having an activity of inducing cellular immunity based on a mechanism of migrating neutrophils and phagocytosing the fungus, wherein the activity has an amino acid sequence described in SEQ ID NO: 2 (or SEQ ID NO: 4) Is substantially equivalent to the activity possessed by.

  The above polypeptide also includes a polypeptide comprising an amino acid sequence that is functionally equivalent to the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 and has homology with the amino acid sequence shown in SEQ ID NO: 2. Such a polypeptide is an amino acid having about 70% or more, preferably about 80% or more, more preferably about 90% or more, most preferably about 95% or more homology with the amino acid sequence shown in SEQ ID NO: 2. A polypeptide comprising a sequence is meant. To determine the homology of a polypeptide, an algorithm described in the literature (Wilbur, W.J. and Lipman, D.J., Proc. Natl. Acad., Sci. USA (1983) 80, 726-730) may be used.

  Therefore, MhpP97 protein paralogues, specifically, Mhp271, Mhp385, Mhp493, and Mhp684 consisting of the amino acid sequences shown in SEQ ID NOs: 18, 20, 22, and 24, respectively, are also within the scope of the polypeptide of the present invention. Mhp271, Mhp385, Mhp493, and Mhp684 are registered in NCBI (http://www.ncbi.nlm.nih.gov/) as Gene IDs: 3105322, 3105685, 3105785, and 3105747, respectively. Is possible.

  The polypeptide of the present invention can also be produced by culturing a transformant containing DNA encoding the polypeptide as described later, or depending on the number of amino acids, a known peptide synthesis method or Can be manufactured by. As a peptide synthesis method, for example, either a solid phase synthesis method or a liquid phase synthesis method may be used.

  According to the present invention, a gene that can be used as a porcine mycoplasma pneumonia vaccine is provided. Such gene may be any gene as long as it encodes the above-described polypeptide. Specifically, it comprises DNA consisting of the base sequence shown in SEQ ID NO: 1 in the sequence listing; the base sequence shown in SEQ ID NO: 1 in the sequence listing DNA encoding a polypeptide having a protective immunity-inducing activity against porcine mycoplasma pneumonia that hybridizes with a DNA comprising a base sequence complementary to DNA comprising a base sequence shown in SEQ ID NO: 3 in the sequence listing A DNA comprising a sequence; a polyhybrid that hybridizes under stringent conditions with a DNA comprising a base sequence complementary to the DNA comprising the base sequence shown in SEQ ID NO: 3 in the sequence listing and has protective immunity-inducing activity against porcine mycoplasma pneumonia Examples include DNA encoding a peptide.

  The above-mentioned “DNA capable of hybridizing under stringent conditions with a DNA consisting of a base sequence complementary to the DNA consisting of the base sequence shown in SEQ ID NO: 1 (or SEQ ID NO: 3)” includes SEQ ID NO: 1 (or 3). And a DNA having a homology of about 70% or more, preferably about 80% or more, more preferably about 90% or more, and most preferably about 95% or more. Here, the stringent condition refers to a condition in which a so-called specific hybrid is formed and a non-specific hybrid is not formed. For example, the sodium concentration is 10 mM to 300 mM, preferably 20 to 100 mM, and the temperature Refers to conditions at 25 ° C to 70 ° C, preferably 42 ° C to 55 ° C.

2. Recombinant vector and transformant
(1) Production of recombinant vector The recombinant vector of the present invention can be obtained by inserting the gene of the present invention into an appropriate vector. The vector for inserting the gene of the present invention is not particularly limited as long as it can express the gene in a host and can replicate in the host. For example, plasmid DNA, phage DNA, etc. Either may be sufficient. Examples of plasmid DNA include plasmids derived from E. coli (eg, pBR322, pUC118, etc.), plasmids derived from Bacillus subtilis (eg, pUB110, pTP5, etc.), plasmids derived from yeast (eg, YEp13, YEp24, YCp50, etc.), and phage DNA Examples include λ phage. Furthermore, animal viruses such as retrovirus or vaccinia virus, and insect virus vectors such as baculovirus can also be used.

  The vector contains a replication origin, a selection marker, and a promoter, and may contain an enhancer, terminator, ribosome binding site, polyadenylation signal, and the like as necessary.

  As replication origins, vectors derived from E. coli such as Col1E1, R factor, and F factor are derived from E. coli, yeast vectors are derived from, for example, 2 μm DNA, ARS1, and animal cell vectors are SV40, Those derived from adenovirus are used.

  As promoters, vectors for E. coli include trp promoter, lac promoter, PL promoter, PR promoter, etc., and vectors for yeast include gal1 promoter, PHO5 promoter, PGK promoter, GAP promoter, ADH promoter, AOX1 promoter, etc. SRα promoter, SV40 promoter, LTR promoter, CMV promoter, and the like are used as the animal cell vector.

  Selection markers include kanamycin resistance gene, ampicillin resistance gene, tetracycline resistance gene, etc. for vectors for E. coli, Leu2, Trp1, Ura3 genes, etc. for yeast vectors, and neomycin resistance gene for vectors for animal cells. , Thymidine kinase gene, dihydrofolate reductase gene and the like are used.

  Commercially available vectors can be used. For such vectors, when the host cell is E. coli, for example, pET vector (Novagen), pTrxFUS vector (Invitrogen), When the host cell is yeast such as pCYB vector (NEW ENGLAMD Bio Labs), etc., for example, pESP-1 expression vector (STRATAGENE), pAUR123 vector (Takara Shuzo), pPIC vector (Invitrogen), etc. However, when the host cell is an animal cell, for example, pMAM-neo expression vector (CLONTECH), pCDNA3.1 vector (Invitrogen), pBK-CMV vector (STRATAGENE), etc. Examples of insect cells include pBacPAK vector (manufactured by CLONTECH), pAcUW31 vector (manufactured by CLONTECH), pAcP (+) IE1 vector (manufactured by Novagen), and the like.

  In addition, a tag may be incorporated into the vector to facilitate detection and purification of the expressed polypeptide. Examples of tags include glutathione-S-transferase, maltose binding protein, histidine (His6) and the like. Affinity purification becomes possible by using a carrier having affinity for these tags (a carrier chelated with nickel in the case of histidine).

(2) Production of transformant The transformant of the present invention can be obtained by introducing the above recombinant vector. Here, the host is not particularly limited as long as it can express the target gene. For example, bacteria belonging to the genus Escherichia such as Escherichia coli, Bacillus genus such as Bacillus subtilis, Pseudomonas putida such as Pseudomonas putida; Saccharomyces cerevisiae, -Yeast such as Pombe (Schizosaccharomyces pombe); Animal cells such as monkey cells COS-7, Vero, Chinese hamster ovary cells (CHO cells), mouse L cells, human GH3, human FL cells; or insect cells such as Sf9, Sf21 Is mentioned.

  Introduction of a vector into a host cell can be performed by a known method according to the type of host, and examples thereof include a calcium phosphate method, an electroporation method, a spheroplast method, a lithium acetate method, a lipofection method and the like. Moreover, gene transfer into each of the above host cells can be performed by a method not using a recombinant vector, such as a particle gun method.

3. Production of Polypeptide of the Present Invention The polypeptide of the present invention can be obtained by culturing the transformant and collecting it from the culture. “Culture” means any of cultured cells, cultured cells, or disrupted cells or cells in addition to the culture supernatant.

  The method of culturing the transformant of the present invention in a medium can be carried out according to a usual method used for culturing the host cell.

  As a medium for culturing transformants obtained using microorganisms such as Escherichia coli and yeast as a host, the medium contains a carbon source, nitrogen source, inorganic salts, etc. that can be assimilated by the microorganisms. As long as the medium can be used, either a natural medium or a synthetic medium may be used. Any carbon source may be used as long as the organism can assimilate, and carbohydrates such as glucose, fructose, sucrose, and starch, organic acids such as acetic acid and propionic acid, and alcohols such as ethanol and propanol are used. As the nitrogen source, ammonium salts of inorganic acids or organic acids such as ammonia, ammonium chloride, ammonium sulfate, ammonium acetate and ammonium phosphate, or other nitrogen-containing compounds, peptone, meat extract, corn steep liquor and the like are used. As the inorganic salts, monopotassium phosphate, dipotassium phosphate, magnesium phosphate, magnesium sulfate, sodium chloride, ferrous sulfate, manganese sulfate, copper sulfate, calcium carbonate and the like are used.

  The culture is usually performed at 30 to 37 ° C. for about 6 to 62 hours under aerobic conditions such as shaking culture or aeration and agitation culture. During the culture period, the pH is maintained at 7.0 to 7.5. The pH is adjusted using an inorganic or organic acid, an alkaline solution, or the like. During culture, an antibiotic such as ampicillin or tetracycline may be added to the medium as necessary.

  When culturing a microorganism transformed with an expression vector using an inducible promoter as a promoter, an inducer may be added to the medium as necessary. For example, when cultivating a microorganism transformed with an expression vector using the Lac promoter, culture a microorganism transformed with isopropyl-β-D-thiogalactopyranoside (IPTG) or the like with an expression vector using the trp promoter. Sometimes indoleacetic acid (IAA) or the like may be added to the medium.

As a medium for culturing a transformant obtained using animal cells as a host, generally used RPMI1640 medium, DMEM medium, a medium obtained by adding fetal calf serum or the like to these mediums, or the like is used. The culture is usually performed at 37 ° C. for 1 to 30 days in the presence of 5% CO ₂ . During culture, antibiotics such as kanamycin and penicillin may be added to the medium as necessary.

  When the polypeptide is produced in cells or cells after culturing, the polypeptide is extracted by disrupting the cells or cells. When the polypeptide is produced outside the cells or cells, the culture solution is used as it is, or the cells or cells are removed by centrifugation or the like. Thereafter, by using a general biochemical method used for protein isolation and purification, for example, ammonium sulfate precipitation, gel filtration, ion exchange chromatography, affinity chromatography, etc. alone or in appropriate combination, from the culture. The polypeptide can be isolated and purified.

  A preferred purification method in the present invention is, for example, a method in which a polypeptide is bound to a carrier with the tag (histidine or the like) and recovered, and then released from the carrier.

4). Vaccine containing the polypeptide and gene of the present invention The polypeptide of the present invention has an effect of suppressing inflammatory lesions in the lung by intranasal administration to pigs, and then suppressing the lesion by attack with virulent Mhp. Have. Therefore, the polypeptide of the present invention can be used as a porcine mycoplasma pneumonia vaccine.

  In addition, recombinant DNA in which the gene of the present invention is incorporated into an appropriate plasmid DNA can also be used as a porcine mycoplasma pneumonia vaccine (DNA vaccine). The recombinant DNA used as a DNA vaccine is constructed by linking the gene of the present invention to a regulatory region that enables transcription thereof, for example, various promoters and enhancers for gene expression in animal cells. Compared to the case where the antigen protein itself is used as an immunogen, the DNA vaccine is advantageous in that the immune response is sustained by several inoculations and that the purification of the plasmid DNA is simple and stable.

  In the present specification, the term “vaccine” means a substance capable of producing an immune response, and is used in a broad sense including a vaccine for preventing the development of porcine mycoplasma pneumonia caused by Mycoplasma hyopneumoniae infection, and a vaccine for treating porcine mycoplasma pneumonia.

  The vaccine of the present invention can be provided in the form of a pharmaceutical composition by combining with an adjuvant for enhancing immune response and a pharmaceutically acceptable carrier (such as a transfection reagent). Examples of adjuvants include Freund's complete or incomplete adjuvant, aluminum compounds such as aluminum hydroxide and aluminum phosphate, muramyl peptide, potassium alum, saponin or derivatives thereof, mineral oil or vegetable oil. The pharmaceutically acceptable carrier is suitable for transfection of a DNA vaccine into living cells, and examples thereof include known transfection reagents such as liposomes, gold particles, and cationic polymers.

  The vaccine preparation further includes pH adjusters such as sodium phosphate, potassium phosphate, sodium hydroxide and hydrochloric acid, antibiotics such as kanamycin sulfate and erythromycin, lactose, potassium glutamate, D-sorbitol, aminoacetic acid and the like. It is also possible to add a stabilizer, an isotonic agent such as sodium chloride, and the like.

  The vaccine of the present invention can be administered by a normal active immunization method, and can be used in any form of a systemic vaccine administered by injection, or a mucosal-derived vaccine administered by nasal administration or the like without injection.

  The vaccine of the present invention can be administered by single or repeated administration in an amount effective for protection against porcine mycoplasma pneumonia, ie, an amount that induces immunity in animals, preferably pigs, against the infection. The administration route of the vaccine may be intranasal, intradermal, subcutaneous, intramuscular, intraperitoneal, intravenous, or oral. Moreover, you may use the vaccine of this invention mixed with another antigen component.

  Vaccine dose and number of doses vary depending on the type of subject animal, symptoms, etc., but for example, the above polypeptide amount is about 10 μg to 50 μg per kg body weight, administered once a week to several weeks, several times This can induce protective immunity in the animal.

5. Antibody to the polypeptide of the present invention The antibody of the present invention can be obtained by the following general antibody preparation method.
(1) Production of polyclonal antibody Animals are immunized with the polypeptide prepared as described above. Immunization is performed by administering to a mammal (eg, rat, mouse, rabbit, etc.). In the case of rabbits, the dose of antigen per animal is, for example, 100 to 500 μg using an adjuvant. Examples of adjuvants include Freund's complete adjuvant (FCA), Freund's incomplete adjuvant (FIA), and aluminum hydroxide adjuvant. The administration site is intravenous, subcutaneous or intraperitoneal. Immunization intervals are not particularly limited, and immunization is performed 1 to 10 times, preferably 2 to 3 times at intervals of several days to several weeks, preferably 2 to 3 weeks. Then, the antibody titer is measured 6 to 60 days after the final immunization day, and blood is collected on the day when the maximum antibody titer is shown to obtain antiserum. The antibody titer can be measured by enzyme immunoassay (ELISA), radioimmunoassay (RIA), or the like.

  When purification of antibody from antiserum is required, it should be purified by selecting a known method such as ammonium sulfate salting-out method, ion exchange chromatography, gel filtration, affinity chromatography, or a combination thereof. Can do.

(2) Production of monoclonal antibody An animal is immunized with the polypeptide prepared as described above. If necessary, in order to effectively immunize, an adjuvant (commercially available Freund's complete adjuvant, Freund's incomplete adjuvant, etc.) may be mixed as described above.

  Immunization is performed by administering to a mammal (eg, rat, mouse, rabbit, etc.). One dose of antigen is 50 μg per mouse in the case of mice. The administration site is mainly intravenous, subcutaneous and intraperitoneal. The interval between immunizations is not particularly limited, and is performed at least 2-3 times at intervals of several days to several weeks, preferably at intervals of 2-3 weeks. Then, antibody-producing cells are collected after the final immunization. Examples of antibody-producing cells include spleen cells, lymph node cells, and peripheral blood cells, with spleen cells being preferred.

  Next, in order to obtain a hybridoma, cell fusion between antibody-producing cells and myeloma cells is performed. As myeloma cells to be fused with antibody-producing cells, cell lines derived from animals such as mice and generally available can be used. As a cell line to be used, it has drug selectivity and cannot survive in a HAT selection medium (including hypoxanthine, aminopterin and thymidine) in an unfused state, but can survive only in a state fused with antibody-producing cells. What has is preferable. For example, specific examples of myeloma cells include mouse myeloma cell lines such as P3X63-Ag.8.U1 (P3U1), P3 / NSI / 1-Ag4-1, Sp2 / 0-Ag14.

  Cell fusion of myeloma cells and antibody-producing cells is performed by mixing antibody-producing cells and myeloma cells in a ratio of 15: 1 to 25: 1 in animal cell culture media such as serum-free DMEM and RPMI-1640 media. After mixing, a fusion reaction is carried out in the presence of a cell fusion promoter such as polyethylene glycol or by electric pulse treatment (for example, electroporation). The target hybridoma is selected from the cells after cell fusion treatment. For example, cells can be cultured using a medium containing hypoxanthine, aminopterin and thymidine, and the growing cells can be obtained as hybridomas.

Next, it is screened whether the target antibody exists in the culture supernatant of the grown hybridoma. Hybridoma screening is not particularly limited, and may be performed according to ordinary methods. For example, a part of the culture supernatant contained in a well grown as a hybridoma can be collected and screened by enzyme-linked immunosorbent assay (ELISA), RIA (radioimmuno assay), or the like. Cloning of the fused cells is performed by a limiting dilution method or the like, and finally a hybridoma that is a monoclonal antibody-producing cell is established. As a method for collecting a monoclonal antibody from the established hybridoma, a normal cell culture method or the like can be employed. In the cell culture method, the hybridoma is cultured in an animal cell culture medium such as RPMI-1640 medium or MEM medium containing 10% fetal bovine serum under normal culture conditions (eg, 37 ° C., 5% CO ₂ concentration) for 3 to 10 days. Then, an antibody is obtained from the culture supernatant.

  In the above antibody collection method, when purification of the antibody is required, a known method such as ammonium sulfate fractionation, ion exchange chromatography, affinity chromatography, gel chromatography or the like is appropriately selected, or these It can be purified by a combination of methods.

6). Medicament for immunoregulation of the present invention The polypeptide of the present invention induces the production of IL-8 which is a neutrophil migration factor and regulates the expression of proteins related to the inflammatory reaction, as shown in Examples below. Induces the factor NF-κB. Therefore, the polypeptide of the present invention has an action of inducing an immune response and controlling the immune response in the direction of activation, and thus can be used as an immunostimulator. The present immunostimulant is effective for treating diseases and pathologies caused by decreased immune function, such as malignant tumors such as cancer, lifestyle-related diseases (hypertension, diabetes, etc.) and the like.

  On the other hand, the antibody against the polypeptide of the present invention can be used as an immunosuppressive agent that controls the immune response in a suppressive direction, and is a disease or condition that progresses by an inflammatory reaction due to a neutrophil stimulation response, such as a wound Malignant tumors (cancers such as stomach cancer, colon cancer, breast cancer, lung cancer), autoimmune diseases (such as rheumatoid arthritis, multiple sclerosis), allergic diseases (bronchial asthma attack, atopic dermatitis, allergic rhinitis, hay fever) , Urticaria, etc.), inflammatory diseases (inflammatory bowel disease (IBD), ulcerative colitis, etc.) and the like.

  These immunoregulatory drugs are prepared by mixing a polypeptide or the like alone or with a pharmacologically and pharmaceutically acceptable additive, and using a technique known in the art, tablets, powders, granules, Fine granules, capsules, internal liquids (suspensions, syrups, emulsions, etc.), external liquids (injections, mouthwashes, mouthwashes, sprays / aerosols, inhalants, coatings, etc.), ointments, It can be formulated into various preparations such as injections, drops, suppositories and the like.

  Hereinafter, the present invention will be described more specifically with reference to examples. However, the present invention is not limited to these.

Example 1 Cloning of MhpR1 + 2 Gene and Expression of Recombinant MhpR1 + 2 First, a gene containing two repetitive sequences R1 + 2 (referred to as MhpR1 + 2 gene) from the chromosomal gene of virulent MhpE-1 strain For the purpose of cloning, the following PCR primers were designed based on the sequences registered in Genebank.
Forward Primer: AAGGTAAAAGAGAAGAAGTAG (SEQ ID NO: 5)
Reverse Primer: TTTTTACCTAAGTCAGGAAGG (SEQ ID NO: 6)

  PCR was performed using the above primers and DNA of MhpE-1 strain as a template. PCR was repeated 35 times with one cycle of heat denaturation: 94 ° C., 30 seconds, annealing: 55 ° C., 30 seconds, extension: 72 ° C., 90 seconds. The obtained amplification product, ie, MhpR1 + 2 gene was ligated to TA cloning vector pCR2.1 and transformed into E. coli TOP10 (Invitrogen). A plasmid was prepared from the obtained transformant, and the sequence of the cloned MhpR1 + 2 gene was determined by the cycle sequence method using the M13 primer sequence and T7 promoter sequence on the plasmid. The base sequence of the cloned MhpR1 + 2 gene is shown in SEQ ID NO: 1, and the amino acid sequence encoded by the gene is shown in SEQ ID NO: 2.

In order to clone this gene into the expression vector pBADgIII, the following primers with EcoRI sites added from the sequenced gene were designed.
Forward Primer: GGGAATTCGGTAAAAGAGAAGAAGTAGATAAA (SEQ ID NO: 7)
Reverse Primer: GGGAATTCTTCGGTAGTTGTGTTTTGTTG (SEQ ID NO: 8)

  PCR was performed using the above primers under the same PCR conditions as described above, and the obtained amplification product was treated with EcoRI. The MhpR1 + 2 gene was inserted into the site of pBADgIII previously treated with EcoRI to construct pBADgIII R1 + 2. The pBADgIII vector is a plasmid for protein expression that is designed such that a promoter PBAD that starts expression upon addition of arabinose is introduced and HisTag is added to the C-terminus. pBADgIII R1 + 2 was transformed into E. coli Top10 (Invitrogen) to obtain a transformant pBADgIII R1 + 2-23 strain. After culturing this strain with LENNOX L Broth (LB) at 37 ° C for 4 hours, arabinose was added to a final concentration of 0.05%, and further cultured at 37 ° C for 3 hours to induce protein expression. . After collecting the cells, the cells were suspended in guanidine buffer, subjected to ultrasonic treatment, and centrifuged again to collect the supernatant. Recombinant MhpR1 + 2 protein (rMhpR1 + 2) contained in the supernatant was detected by monoclonal antibody against Mhp97 and Western blotting. Since a histidine tag was added to the C-terminus of rMhpR1 + 2, rMhpR1 + 2 was purified with a nickel affinity column to obtain purified rMhpR1 + 2.

(Example 2) rMhpR1 + 2 administration test to pigs The following test was conducted using the purified rMhpR1 + 2 obtained in Example 1 as a vaccine antigen.
Approximately 28-day-old SPF pigs were administered intranasally with rMhpR1 + 2 diluted with phosphate buffered saline by spraying. On the next day, autopsy was performed and lung lesions were observed. As a result, lung lesions similar to those observed 24 hours after administration of the porcine erysentery strain YS-19 were observed. This lesion was not observed in pigs inoculated with another recombinant protein derived from Mhp (C-terminal partial protein of liponucleic acid reductase: NrC). In addition, in the lung lavage fluid of swine in the rMhpR1 + 2 administration group, more neutrophils were observed than in the control group (non-vaccination group, antigen (NrC) administration group) (Fig. 1), and inflammatory lesions were observed. It was judged. This lesion was not observed in autopsy pigs 5 days after administration.

  In addition, pigs 2 weeks after administration of rMhpR1 + 2 were attacked intranasally for 3 consecutive days with the virulent MhpE-1 strain. Necropsy was performed 6 weeks after the final challenge, and the lung lesion was compared with the control group to determine the vaccine effect. The rMhpR1 + 2 administration group showed a significant lung lesion suppression effect compared to the control group. From these results, it became clear that the R1 + 2 region of P97 protein is involved in lung lesion formation in Mhp-infected pigs (Table 1). It was also thought that this action stimulates the immune system and has the effect of suppressing lung lesions.

(Example 3) Cytokine-inducing ability of rMhpR1 + 2 After separating and culturing porcine peripheral blood mononuclear cells, rMhpR1 + 2 was added, and cytokines produced from mononuclear cells were identified. It was revealed that the production of interleukin 8 (IL-8) was induced (FIG. 2).

(Example 4) Identification of cytokine-inducible epitope After isolation and culture of porcine peripheral blood mononuclear cells, the induction test of IL-8 production was carried out in the same manner as in Example 3 using the following synthetic peptides NO.1 to No.8. And attempted to identify the epitope. FIG. 3 shows the relationship between the amino acid sequence of each synthetic peptide and the amino acid sequence of the MhpP97R1 + 2 protein.

Peptide No. 1: ILPQPPA (SEQ ID NO: 9)
Peptide No. 2: PAAKPEAAKPEAAKPETAKP (SEQ ID NO: 10 / SEQ ID NO: 2)
Peptide No.3: PVAAKPEAAKPVAAKPETTKPVATNTNTN (SEQ ID NO: 11)
Peptide No. 4: INVFLELVHQSEYE (SEQ ID NO: 12)
Peptide No. 5: EYEEQKILKELDKT (SEQ ID NO: 13)
Peptide No. 6: QFQEVKVASDQYQK (SEQ ID NO: 14)
Peptide No. 7: PEAAKPEAAKPEAAKP (SEQ ID NO: 15)
Peptide No. 8: PEAAKPEAAKP (SEQ ID NO: 16)

  As a result, peptide No. 2: PAAKPEAAKPEAAKPETAKP showed the highest IL-8 production inducing ability (FIG. 4).

(Example 5) Cytokine inducing ability of MhpP97 protein paralog
According to the report of Minion et al. (J. Bacteriol., 186, 7123-7133, 2004), Mhp271 (base sequence; SEQ ID NO: 17, amino acid sequence; SEQ ID NO: 18), Mhp385 (base sequence; sequence) on the Mhp chromosome gene No. 19, amino acid sequence; SEQ ID NO: 20), Mhp493 (base sequence; SEQ ID NO: 21, amino acid sequence; SEQ ID NO: 22), Mhp684 (base sequence; SEQ ID NO: 23, amino acid sequence; SEQ ID NO: 24), four MhpP97 protein paralogs Exists. Among them, Mhp271 protein having high homology to the peptide No.2: PAAKPEAAKPEAAKPETAKP sequence was expressed in E. coli and allowed to act on porcine peripheral blood mononuclear cells. 5).

(Example 6) Immunostimulatory activity of rMhpR1 + 2
After stimulating J774.1 cells (mouse macrophage-like cell line) with LPS or antigen (rMhpR1 + 2), the nuclear fraction was purified, electrophoresed, and transferred to a membrane. A probe having a nucleotide sequence that specifically binds to the transcription factor NF-κB was bound to this membrane. Similar to LPS stimulation, rMhpR1 + 2 also detected NF-κB that had migrated into the nucleus, and NF-κB bound to anti-P65l antibody (a P65 molecule-specific antibody that constitutes NF-κB), resulting in an increased molecular weight band. It was confirmed (FIG. 6).

  NF-κB is the central presence of transcription factors that control the expression of proteins related to inflammatory responses. NF-κB exists in the cytoplasm in a state of being bound to IκB. However, when cells are stimulated from the outside (cytokines, antigens, inflammation), IκB in the cytoplasm is immediately degraded, and NF-κB enters the nucleus of NF-κB. Inflow occurs. These genes are said to be expressed by binding to promoter regions upstream of various genes (TMF-α, IL-1, IL-8, etc.) involved in the initial immune response. Thus, since NF-κB is a switch of the initial immune response, rMhpR1 + 2 showing the inducing activity of NF-κB can also be used as an immunostimulator.

The pathological observation of the lung lavage fluid collected from pigs in the rMhpR1 + 2 administration group and the control group is shown. The production amount of cytokines (IFN-γ, IL-1, IL-8) of porcine peripheral blood mononuclear cells by rMhpR1 + 2 stimulation is shown. The relationship between the amino acid sequence of each synthetic peptide (No.1-No.8) and the amino acid sequence of MhpP97R1 + 2 protein is shown. IL-8 production amount of porcine peripheral blood mononuclear cells by stimulation with each synthetic peptide (No. 1 to No. 8) is shown. The IL-8 production amount of a porcine peripheral blood mononuclear cell by Mhp97 protein paralog (Mhp271) stimulation is shown. The electrophoresis photograph which confirmed NF-κB induction by rMhpR1 + 2 protein is shown.

Claims (16)

Polypeptides shown in the following (a) to (e).
(A) a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing (b) consisting of an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing And a polypeptide having protective immunity-inducing activity against porcine mycoplasma pneumonia (c) an amino acid functionally equivalent to the polypeptide comprising the amino acid sequence shown in SEQ ID NO: 2 and having homology with the amino acid sequence shown in SEQ ID NO: 2 Polypeptide containing sequence (d) Polypeptide consisting of amino acid sequence shown in SEQ ID NO: 4 in Sequence Listing (e) One or several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 4 in Sequence Listing A polypep having a protective amino acid-inducing activity against porcine mycoplasma pneumonia De   A gene encoding the polypeptide of claim 1. The gene containing DNA shown to the following (f)-(i).
(F) DNA comprising the base sequence shown in SEQ ID NO: 1 in the sequence listing
(G) a polypeptide that hybridizes under stringent conditions with a DNA comprising a base sequence complementary to the DNA comprising the base sequence shown in SEQ ID NO: 1 in the sequence listing and has protective immunity-inducing activity against porcine mycoplasma pneumonia DNA encoding
(H) DNA consisting of the base sequence shown in SEQ ID NO: 3 in the sequence listing
(I) a polypeptide that hybridizes under stringent conditions with a DNA comprising a base sequence complementary to the DNA comprising the base sequence shown in SEQ ID NO: 3 in the sequence listing and has protective immunity-inducing activity against porcine mycoplasma pneumonia DNA encoding   A recombinant vector comprising the gene according to claim 2 or 3.   A transformant transformed with the gene according to claim 2 or 3.   A method for producing the polypeptide according to claim 1, which comprises culturing the transformant according to claim 5 in a medium and collecting the polypeptide from the resulting culture.   A polypeptide produced by the method of claim 6.   A swine mycoplasma pneumonia vaccine comprising the polypeptide according to claim 1 or 7.   A swine mycoplasma pneumonia vaccine comprising the gene according to claim 2 or 3.   The vaccine according to claim 8 or 9, comprising adjuvant.   The vaccine according to any one of claims 8 to 10, which is a systemic or mucosal immunity inducing vaccine.   A method for preventing and / or treating porcine mycoplasma pneumonia, comprising administering the vaccine according to any one of claims 8 to 11 to an animal other than a human who is infected with or may be infected with porcine mycoplasma pneumonia. .   13. A method according to claim 12, wherein the animal is a pig.   13. The method of claim 12, wherein the route of administration is intranasal, intradermal, subcutaneous, intramuscular, intraperitoneal, intravenous, or oral.   An antibody against the polypeptide of claim 1.   The antibody according to claim 15, wherein the antibody is a monoclonal antibody or a polyclonal antibody.

Images