JP2006304709A - Method for searching genome-wide restriction enzyme reaction site or variation or modification site which is carried out with trace amount of cell and kit therefor - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for detecting a restriction enzyme reaction site or a variation site in a DNA, which is carried out with a trace amount of a DNA and does not require a specific apparatus and tool. <P>SOLUTION: The method for detecting a restriction enzyme reaction site or a variation or modification site in a genome DNA comprises (i) obtaining a genome DNA from cells to be examined, treating the genome DNA with a restriction enzyme or a site-specific enzyme and performing a long PCR using the genome DNA treated with the enzyme as a template, (ii) carrying out a short PCR using an amplification product as a template and then (iii) comparing the results of the short PCR of samples treated with and without the enzyme. (iv) When a variation is detected, the result of normal cells obtained by performing the processes (i)-(iii) is compared with the result of cells to be examined. <P>COPYRIGHT: (C)2007,JPO&INPIT

Description

  The present invention relates to the field of gene analysis. Specifically, the present invention relates to a genome-wide restriction enzyme reaction site or mutation or modification site search method that can be performed from a very small amount of cells, and a kit therefor.

  There is a Restriction Landmark Genomic Scanning (RLGS) method (see Non-Patent Document 1) as a method for detecting a genome-wide restriction enzyme reaction site or mutation or modification site. In this method, the presence or absence of a restriction enzyme site is visualized by performing electrophoresis on an agarose gel, cleaving with another enzyme in the gel, and performing two-dimensional electrophoresis on an acrylamide gel. However, the RLGS method requires a large amount of genomic DNA (several tens of μg), and also requires a two-dimensional electrophoretic layer and a radioisotope.

Furthermore, a conventional footprinting method (methylation sensitive AP-PCR method etc.) (see Non-Patent Document 2) for searching for a methylation variation region via PCR requires a large amount of denom DNA. In stage PCR, only mutations (for example, polymorphisms) and modifications (for example, methylation) within a relatively narrow range could be detected.
Hayashizaki Y, et al .: Electrophoresis, 14: 251-258, 1993 Liang G, et al .: Methods, 27: 150-155, 2002

  The problem to be solved by the present invention was to develop a method for detecting a restriction enzyme reaction site or mutation site in DNA that can be carried out with a very small amount of DNA and that does not require any special apparatus or instrument.

  As a result of intensive studies in view of the above problems, the present inventors have performed a restriction enzyme treatment on a huge genomic DNA prepared from a very small amount of cells, and further obtained a repetitive sequence or a plurality of arbitrary primers. By combining the two-stage genomic DNA amplification method consisting of long PCR and short PCR, the presence or absence of restriction enzyme reaction sites or mutation sites can be confirmed without using special equipment. Visualization was successful and the present invention was completed.

That is, the present invention provides the following (1) to (8):
(1) A method for detecting a restriction enzyme reaction site or mutation or modification site in genomic DNA,
(I) Obtaining genomic DNA from the cell to be tested, treating it with a restriction enzyme or site-specific enzyme, and performing long PCR using the genomic DNA treated with the enzyme as a template,
(Ii) performing short PCR using the amplification product as a template, and then (iii) comparing the results of short PCR of the sample treated with the enzyme and the sample not treated with the enzyme, (Iv) In the case of detecting a mutation, a method obtained by comparing the results obtained by performing the above steps (i) to (iii) on normal cells with the results obtained on the cells to be tested ;
(2) The method according to (1), wherein repetitive sequences or arbitrary primers are used as primers for long PCR;
(3) The method according to (1), wherein the long PCR amplifies DNA of about 2 kb or more, and the short PCR amplifies DNA of less than about 2 kb;
(4) The method according to (1), wherein the modification is DNA methylation;
(5) The following steps:
(I) collect the cells in an appropriate buffer;
(Ii) mixing the cells with a low melting point agarose solution in mineral oil and coagulating;
(Iii) The method according to (1), wherein genomic DNA is obtained from cells by a method characterized by treating the coagulated low melting point agarose mixture with proteinase and then (iv) washing with an appropriate buffer;
(6) A kit for detecting a restriction enzyme reaction site or mutation site using the method according to (1), comprising a long PCR instrument and reagent, and a short PCR instrument and reagent as essential components;
(7) The kit according to (6), further comprising an instrument and a reagent for preparing genomic DNA using the method according to (5);
(8) The method according to any one of (1) to (5) or the kit according to (6) or (7) for searching for methylation of genomic DNA.

  According to the present invention, a genome-wide restriction enzyme site or mutation or modification site can be searched from a very small amount of sample (for example, about 10 cells, several tens of pg as DNA). In addition, in the conventional genome footprint, restriction enzyme sites could be searched only in a narrow range that can be separated by acrylamide gel. However, according to the present invention, the search can be performed in a wider range, and the restriction enzyme sites can be searched. Alternatively, a restriction enzyme site having a wide range of mutation or modification sites and a lower frequency of appearance is also a target of the search.

  In the following, the present invention will be described in more detail. Terms used in this specification shall have their ordinary meanings used in the art unless otherwise specified.

  In the first aspect, the present invention provides a method for detecting a restriction enzyme reaction site or a mutation or modification site. The method comprises (i) obtaining genomic DNA from a cell to be tested, treating it with a restriction enzyme or a site-specific enzyme, and performing long PCR using the genomic DNA treated with the enzyme as a template. (Ii) short PCR using the amplification product as a template, and (iii) comparing the results of short PCR of the sample treated with the enzyme and the sample not treated with the enzyme, Furthermore, in the case of (iv) mutation detection, the results obtained by performing the above steps (i) to (iii) on normal cells are compared with the results obtained on the cells to be tested. .

  In carrying out the method of the present invention, first, genomic DNA is obtained from a cell. The cell may be a cell of any organism, but is preferably a vertebrate cell whose repeat sequence is well known, more preferably a mammalian cell, most preferably a primate cell. The genomic DNA used in the method of the present invention is preferably as large as possible since it contains as many restriction enzyme sites or mutation or modification sites as possible. The size is preferably 100 kb or more, and more preferably 1000 kb or more. There are several known methods for preparing such giant genomic DNA. For example, the giant genomic DNA is obtained by scaling down the genomic DNA preparation method in low melting point agarose, which is performed by pulse field gel electrophoresis. May be. This method consists of (i) collecting the cells in a suitable buffer, (ii) mixing the cells with a low melting point agarose solution in mineral oil, coagulating, and (iii) treating the coagulated low melting point agarose mixture with proteinase. And (iv) washing with a suitable buffer. A preferred specific example of this method is described in Example 3 and FIG.

  There are various restriction enzyme reaction sites or mutation or modification sites that can be detected by the present invention. A large genomic DNA can be cleaved with an enzyme that recognizes a target restriction enzyme site or mutation or modification site, and an amplification reaction can be performed according to the method of the present invention to detect the mutation or modification site. Restriction enzyme reaction site or mutation or modification site sequence, mutation type (eg, nucleotide addition, deletion, substitution, etc., or number of mutant nucleotides), modification type (eg, nucleotide methylation), and use The enzyme to be used is not particularly limited, and any enzyme may be used. For example, the enzyme may be one that cleaves the DNA strand at or near the target restriction enzyme site or mutation or modification site, or DNA when the target mutation or modification exists. May not be cut. When the purpose is to detect a restriction enzyme site, the giant genomic DNA can be cleaved with the corresponding restriction enzyme. When the purpose is to detect a mutation or modification site, the giant genome can be cleaved with an enzyme that specifically recognizes the mutation or modification site (site-specific enzyme). For example, using the method of the present invention, a methylation variation region on a genome can be searched using an enzyme that recognizes DNA methylation as a site-specific enzyme. Such a method would be useful for the diagnosis of cancer and other diseases. A system without enzyme treatment is prepared as a control when enzyme treatment is performed on a large genomic DNA, and the operations described below are performed in the same manner to compare products in short PCR. When detecting mutations in DNA, it is preferable to compare the results obtained for the normal cells with the results obtained for the cells to be tested.

  Next, the enzyme-treated giant genomic DNA is amplified. The purpose of amplification at this stage is to amplify a small amount of genomic DNA. DNA amplification means at this stage include PCR (polymerase chain reaction) method, MDA (Multiple Displacement Amplification) method, etc., but amplification by PCR is preferable, and for amplification of enzyme fragments of a large genome as in the present invention. Long PCR is optimal. Hereinafter, long PCR will be described as an amplification method at this stage. The long PCR used in the present invention preferably amplifies DNA of about 2 kb or more. Any primer can be used for long PCR, but when searching for restriction enzyme reaction sites or mutation or modification sites in vertebrate genomic DNA, a large number of repeats exist in the vertebrate genome. Use of a sequence is preferable from the viewpoint of improving detection sensitivity. Arbitrary primers may be used, and are effective when it is unknown or not included in the template genomic DNA. There are various arbitrari primers, and degenerate oligonucleotide primers are also included in the arbitrary primers. When the template DNA obtained from cells is extremely small, it may be preferable to lower the primer concentration from the viewpoint of suppressing the self-amplification of the primer.

  The reaction conditions for long PCR are known to those skilled in the art, and can be appropriately changed or changed by those skilled in the art depending on the origin of genomic DNA as a template, the target restriction enzyme site or mutation or modification site, the primers used, the required detection sensitivity, etc. You can choose. Generally, long PCR is performed using a thermal cycler set according to the set reaction conditions.

  The product obtained from the previous amplification is further amplified. Amplification at this stage aims to obtain sufficient DNA to detect a band for comparison. PCR is preferable as a method for amplifying DNA at this stage, and short PCR is particularly optimal. The short PCR will be described below as an amplification method at this stage. Short PCR preferably amplifies DNA of less than about 2 kb.

  Short PCR may be performed after confirming the purified product obtained by the previous amplification by agarose gel electrophoresis. The long PCR product may be purified by, for example, a column and then subjected to short PCR. Depending on the concentration of the long PCR product, it may be desirable to perform a short PCR after dilution. Reaction conditions for short PCR may be general. As a primer used for short PCR, a repetitive sequence or an arbitrary primer may be used as described above, or another primer may be used. Those skilled in the art can appropriately change or select short PCR conditions according to the target detection site, the type of long PCR product, and the like. Generally, short PCR is performed using a thermal cycler set according to the set reaction conditions.

  The result of short PCR is compared between the enzyme treated with a large genome and the control without enzyme treatment. In general, short PCR products can be checked by acrylamide gel electrophoresis. If the migration pattern of the enzyme treated with a large genome is compared with the control pattern without enzyme treatment, and there is a difference between the two patterns, the target restriction enzyme reaction site or mutation or site is present in the genomic DNA. It is determined that If there is no difference between the two patterns, it is determined that the target restriction enzyme reaction site or mutation site did not exist in the genomic DNA. Further, as described above, when detecting a mutation in DNA, it is preferable to compare the result obtained by performing the same operation for normal cells with the result obtained for the cells to be tested.

  The detection and comparison of electrophoresis patterns is generally performed by staining with dyes such as ethidium bromide or SYBR Green1, but if the template DNA is extremely low and the amplification efficiency is not so high, electrophoresis may be performed. A label suitable for high-sensitivity detection may be attached to the DNA to be provided. As the DNA label, a radioactive label, a fluorescent label or the like can be used.

  In a further aspect, the present invention provides a kit for detecting restriction enzyme reaction sites or mutation or modification sites using the methods of the present invention. The kit preferably includes, as essential, long PCR instruments and reagents, and short PCR instruments and reagents. More preferably, the kit of the present invention comprises an instrument and reagents for preparing genomic DNA using the above-described method for preparing a large genome (see also Example 3). Generally, an instruction manual is attached to the kit. An example of such a kit of the present invention is a kit for searching for the presence or absence of methylation of genomic DNA.

  The present invention will be described in more detail and specifically below with reference to examples, but the examples are not intended to limit the present invention.

Example 1. Search for MspI site in HelaS3 cell genomic DNA 1 ng genomic DNA obtained from HeLa cells by a conventional method was treated with restriction enzyme MspI and non-treated with MspI (control). Using these as templates, Alu-c-1 primer (CCTGGGCGACAGAGCGAGAC) (SEQ ID NO: 1) and Alu-c-2 primer (TAGTAGAGACGGGGTTTCAC) based on the consensus sequence of Alu element, which is said to be present in 1 million copies in the human genome According to (SEQ ID NO: 2), about 10 kb or more genomic DNA sandwiched between Alu was subjected to long PCR under the condition that the restriction enzyme MspI region can be amplified. Since one Alu element exists in the human genome on average of about 3 kb, a long region of the human genome can be covered by long PCR under the following conditions.

1X PCR buffer, dNTP 0.2 mM each, MgCl ₂ 1.5 mM, Alu-c-1 primer 2 mM, Alu-c-2 primer 2 mM, LA Taq (TaKaRa) 5 U, 1 ng genomic DNA, 5% DMSO

Total volume 100μl

94 ° C 3 minutes 37 ° C 5 minutes 72 ° C 12 minutes 94 ° C 1 minute ^a
50 ° C 1 minute 72 ° C 12 minutes ^b
72 ° C 15 minutes

19 cycles were performed between a and b.

  Further, the above long PCR product was diluted 100-fold, and short PCR was performed using 1 μl of the template as a template using the Alu-c-1 primer and the arbory primer. Arbitrary primers used for the short PCR were AP-1 (AAGCTTATTGGTC) (SEQ ID NO: 3) and AP-2 (AAGCTTAACGAGG) (SEQ ID NO: 4). The reaction conditions for short PCR are as follows.

1X PCR buffer, dNTP 0.2 mM each, MgCl ₂ 1.5 mM, Alu-c-1 primer 0.2 mM, Arbitrary primer 0.2 mM each, TaqGold 1 U, 1 μl 100-fold diluted long PCR product, 5% DMSO

Total volume 20μl

95 ° C 9 minutes 40 ° C 5 minutes 72 ° C 5 minutes 94 ° C 15 seconds ^c
40 ° C 2 minutes 72 ° C 1 minute ^d
72 ° C 5 minutes

24 cycles were performed between cd.

  An agarose gel electrophoresis image of the long PCR product and a native acrylamide electrophoresis image of the short PCR product (SYBR Green1 staining) are shown in FIG. In the electrophoresis image of the short PCR, a clear difference in the electrophoresis pattern was observed between the MspI-treated sample and the control. For example, the band indicated by the arrow was clearly observed in the control sample, but not clearly observed in the MspI-treated sample. Thus, the method of the present invention can finally produce 10,000 genome footprints from 1 ng of genomic DNA.

  The band indicated by the arrow of the short PCR in FIG. 1 was cut out and cloned by a conventional method, the sequence was determined, the adjacent sequence was obtained from the database, and the corresponding primer was prepared. The map 2 is shown in the upper panel of FIG. PCR was performed using these primers (lower panel in FIG. 2). This confirmed that the difference in the band between the control sample in the short PCR of this example and the MspI-treated sample was dependent on the presence or absence of digestion of the MspI site in the vicinity of the band.

Example 2 Retrieval of restriction enzyme sites in the absence of repetitive sequences In the same manner as in Example 1, 1 ng of genomic DNA obtained from HeLa cells by a conventional method was treated with restriction enzyme MspI, and one not treated with MspI (control). Each was prepared. In order to search for the absence of repetitive sequences, long PCR was performed using 4 types of arbitrari primers, and after column purification (using QIA quick (registered trademark) PCR purification kit), 1 μl was used as a template. Short PCR was performed with two other arbitrari primers, and the difference in electrophoresis band was observed. Electrophoresis image and primers used (AP-1, AP-2, AP-5, AP-6, AP-7, AP-8, AP-9 and AP-10, SEQ ID NOs: 5, 6, 7, 8 respectively. , 9, 10, 11 and 12) are shown in FIG. In any reaction system, a clear difference in electrophoresis pattern was observed between the MspI-treated sample and the control. The reaction conditions for long PCR and short PCR are as follows.

Long PCR

1X PCR buffer, dNTP 0.2 mM each, MgCl ₂ 1.5 mM, arbitrari primer (4 types) 2 mM each, ExTaq (TaKaRa) 5 U, 1 ng genomic DNA, 5% DMSO

Total volume 100μl

95 ° C 3 minutes 37 ° C 5 minutes 72 ° C 2 minutes 94 ° C 1 minute ^e
37 ° C 2 minutes 72 ° C 2 minutes ^f
72 ° C 5 minutes

24 cycles were performed between ef.

Short PCR

1X PCR buffer, dNTP 0.2 mM each, MgCl ₂ 1.5 mM, Arbitrary primer (2 types) 0.2 mM each, AmpliTaq Gold 1U, 1 μl long PCR product, 5% DMSO

Total volume 20μl

95 ° C 9 minutes 40 ° C 5 minutes 72 ° C 5 minutes 94 ° C 15 seconds ^g
40 ° C 2 minutes 72 ° C 1 minute ^h
72 ° C 5 minutes

24 cycles were performed between gh.

Example 3 Retrieval of restriction enzyme sites in genomic DNA from a very small amount of cells Actually, a restriction enzyme reaction site was searched from a very small amount of cells. In order to obtain as much macromolecules as possible without losing genomic DNA, we applied a method of scaling down genomic DNA preparation in low melting point agarose, which is performed by pulsed field gel electrophoresis (the operation shown in FIG. 4). Show method). First, 10 Hela S3 cells were collected in 1 μl PBS with a capillary, and 3 μl of 0.75% GTG agarose was added and coagulated at 4 ° C. At this time, in order to prevent the gel from drying, the low melting point agarose was coagulated in mineral oil. This lump of agarose was treated with proteinase K for 1 hour under the following conditions (proteinase K 1 mg / ml, 150 mM EDTA (pH 8.0), 10 mM Tris-HCl (pH 8.0), 1% SDS), and then 8% with TE. Washed for hours.

  In this manner, a 4 μl volume of 0.5% low melting point agarose (sample block) containing macromolecular DNA obtained from 10 cells was prepared, subjected to restriction enzyme treatment, and the Alu primer was used as it was. The long PCR used was performed. The sample block is easily dissolved at 94 ° C. for 3 minutes at the beginning of PCR, and the internal genomic DNA is melted into the PCR reaction solution. The long PCR product was subjected to short PCR. The long PCR agarose gel electrophoresis image and the short PCR acrylamide gel electrophoresis image are shown in FIG.

The reaction conditions for long PCR and short PCR are as follows.
Long PCR

1X PCR buffer, dNTP 0.2 mM each, MgCl ₂ 1.5 mM, Alu-c-1 primer 0.2 mM, Alu-c-2 primer 0.2 mM, LA Taq (TaKaRa) 5 U, 1 ng genomic DNA, 5% DMSO

Total volume 100μl

94 ° C 3 minutes 37 ° C 5 minutes 72 ° C 12 minutes 94 ° C 1 minute ⁱ
50 ° C 1 minute 72 ° C 12 minutes ^j
72 ° C 15 minutes

24 cycles were performed between ij.

Short PCR

1X PCR buffer, dNTP 0.2 mM each, MgCl ₂ 1.5 mM, Arbitrary primer 4 types (each 0.2 mM), AmpliTaq Gold 1U, 100-fold diluted long PCR product 1 μl, 5% DMSO

Total volume 20μl

95 ° C. 9 minutes 40 ° C. 5 min 72 ° C. 5 min 94 ° C. 15 seconds ^k
40 ° C. 2 min 72 ° C. 1 min ^l
72 ° C 5 minutes

39 cycles were performed between kl.

  In this short PCR, only an arbitrage primer is used, and its sequence is AP-1 (-2N) (AAGCTTATGGNN) (SEQ ID NO: 5), AP-2 (-2N) (AAGCTTAACGANN) (SEQ ID NO: 6), AP-17 (-2N) (GGCCGGGGTCNN) (SEQ ID NO: 13) and AP-18 (-2N) (GGCCGGGAGGNN) (SEQ ID NO: 14). This time, not only MspI (methylation insensitivity) but also its isoschizomer, methylation sensitive enzyme HpaI is used. In each lane, the difference in the band was confirmed by the difference in the reactivity of the restriction enzyme (FIG. 5). In the case of this example, 10,000 footprints are possible from the genomic DNA of 10 cells.

  When band 1 and band 2 indicated by arrows in FIG. 5 were cloned and sequenced, MspI sites were present in the sequences of the respective bands. A primer was created so as to sandwich the MspI site, and PCR was performed using 10 ng of genomic DNA of Hela S3 cells digested with HpaII and MspI as a template. It was confirmed that this was due to a difference in the state of the site, that is, in this case, a difference in methylation of the original genomic DNA sequence (FIG. 6).

  The present invention can be used in the fields of biology, genetics, biochemistry, genetic engineering, and medicine. In particular, it can be used for the manufacture of research reagents used in these areas.

FIG. 1 is an electrophoresis image of long PCR (upper panel) and short PCR (lower panel) according to the method of the present invention when 1 ng of Hela S3 genomic DNA is used. FIG. 2 is a diagram showing the results of checking different portions of the electrophoresis band pattern according to the method of the present invention when 1 ng of Hela S3 genomic DNA is used. FIG. 3 is an electrophoretic image of long PCR (upper panel) and short PCR (two lower panels) according to the method of the present invention concerning a region not containing a repetitive sequence when 1 ng of Hela S3 genomic DNA is used. . FIG. 4 is a large genomic DNA preparation scheme from 10 Hela S3 cells (see Example 3). FIG. 5 is an electrophoresis image of long PCR (upper panel) and short PCR (lower panel) according to the method of the present invention when genomic DNA derived from 10 Hela S3 cells is used. FIG. 6 is an electrophoretic image showing the results of confirming the difference in methylation of the genomic DNA sequences used in Example 3.

Claims (8)

A method for detecting a restriction enzyme reaction site or a mutation or modification site in genomic DNA, comprising:
(I) Obtaining genomic DNA from the cell to be tested, treating it with a restriction enzyme or site-specific enzyme, and performing long PCR using the genomic DNA treated with the enzyme as a template,
(Ii) performing short PCR using the amplification product as a template, and then (iii) comparing the results of short PCR of the sample treated with the enzyme and the sample not treated with the enzyme, (Iv) In the case of detecting a mutation, a method obtained by comparing the results obtained by performing the above steps (i) to (iii) on normal cells with the results obtained on the cells to be tested .   The method according to claim 1, wherein a repetitive sequence or an arbitrary primer is used as a primer for long PCR.   The method according to claim 1, wherein the long PCR amplifies DNA of about 2 kb or more, and the short PCR amplifies DNA of less than about 2 kb.   The method of claim 1, wherein the modification is DNA methylation. The following process:
(I) collect the cells in an appropriate buffer;
(Ii) mixing the cells with a low melting point agarose solution in mineral oil and coagulating;
The method according to claim 1, wherein the genomic DNA is obtained from the cell by a method characterized in that (iii) the coagulated low melting point agarose mixture is treated with proteinase and then (iv) washed with an appropriate buffer.   A kit for detecting a restriction enzyme reaction site or mutation site using the method according to claim 1, comprising a long PCR instrument and a reagent, and a short PCR instrument and a reagent as essential.   Furthermore, the kit of Claim 6 containing the instrument and reagent for preparing genomic DNA using the method of Claim 5. The method according to any one of claims 1 to 5, or the kit according to claim 6 or 7, for searching for methylation of genomic DNA.