JP2006265173A - Crystal comprising complex of glucocorticoid receptor ligand connecting domain with ligand - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a crystal comprising complex of glucocorticoid receptor ligand connecting domain with a ligand containing non-steroid skeleton. <P>SOLUTION: The invention relates to the rhombic crystal comprising complex of glucocorticoid receptor ligand connecting domain with the ligand, belonging to 12<SB>1</SB>2<SB>1</SB>2<SB>1</SB>space group, having unit cells a=48.0±4.0 Å, b=116.5±4.0 Å, c=164.0±4.0 Å and α=β=γ=90°. <P>COPYRIGHT: (C)2007,JPO&INPIT

Description

  The present invention relates to a crystal or the like containing a complex of a glucocorticoid receptor ligand binding domain and a ligand.

Nuclear receptors are defined as a family of ligand-dependent transcription factors that are localized in the cytoplasm or nucleus and activated in response to ligand binding (see, for example, Non-Patent Document 1). A group of steroid receptors in this family include glucocorticoid receptor (GR), mineralocorticoid receptor (MR), androgen receptor (AR), progesterone receptor (PR) and estrogen (ER) receptor. Etc. are included. As ligands for steroid receptors, estradiol, progesterone, cortisol and the like are known. When these ligands are present in the fluid surrounding the cell, they pass through the outer cell membrane by passive diffusion and bind to specific nuclear receptors to form receptor / ligand complexes. This complex then moves to the nucleus of the cell where it binds to specific genes in the cellular DNA. When bound to DNA, the complex regulates the production of the protein encoded by the gene. From this point of view, compounds that bind to nuclear receptors and mimic the action of natural ligands are called “agonists”, while compounds that suppress the action of natural ligands are called “antagonists”.
When not stimulated by a ligand, the glucocorticoid receptor forms a complex with heat shock proteins (Hsp90, Hsp70, Hsp56) and exists in the cytoplasm. Glucocorticoid receptors dissociate from heat shock proteins upon ligand binding, translocate into the nucleus, and then interact specifically with DNA and / or proteins and regulate gene expression.
When an agonist binds to the glucocorticoid receptor, Iκ-B is expressed. And it is thought that Iκ-B and NFκ-B that are expressed interact to exhibit an anti-inflammatory effect. The glucocorticoid receptor is considered to exhibit an anti-inflammatory effect by interacting with transcription factors such as AP-1 and NFκ-B.
Examples of glucocorticoid receptor agonists include cortisol, corticosterone, and the like. Many synthetic glucocorticoid receptor agonists already exist, such as dexamethasone, prednisone, prednisilone and the like. Steroids that act on glucocorticoid receptors have been shown to be effective anti-inflammatory agents, but mineralocorticoid receptors (MR), androgen receptors (AR), which have similar ligand binding domains, As a result of cross-reaction with steroid receptors such as progesterone receptor (PR) and estrogen receptor (ER), there are known side effects in selectivity and long-term administration. Existing.

In the study of agonists of the glucocorticoid receptor, it has specificity for one or more steroid receptors but has reduced cross-reactivity to other steroid receptors or intracellular receptors or The identification, search, evaluation or design of non-existing non-steroidal compounds is of great value in the art.
Certain atomic coordinates of the glucocorticoid receptor ligand binding domain have already been clarified (see, for example, Non-Patent Document 2 and Non-Patent Document 3).
In addition, in the atomic coordinates of a crystal containing a complex of a glucocorticoid receptor ligand-binding domain and a ligand that are already known, the ligand is any one of dexamethasone having a steroid skeleton, RU38486, or fluticasone propionate (Fluticasone propionate). It is a ligand having such a steroid skeleton, and only information on a limited three-dimensional structure exists.

Evans RM, Science, 240, 889 (1988) Bledsoe RK et al., Cell, 110, 93 (2002): Protein Data Bank Registration Number: 1M2Z Kauppi B et al., J Biol Chem, 278, 22748 (2003): Protein Data Bank Registration Number: 1P93, 1NHZ International Publication No. 2003/015692 Pamphlet European Patent Application Publication No. 1375517 International Publication No. 2003/090666 Pamphlet

  However, the atomic coordinates of a crystal containing a complex of a glucocorticoid receptor ligand binding domain and a ligand having a non-steroidal skeleton are not yet known, and information on the three-dimensional structure derived based on the atomic coordinates is not available. What happened did not happen. Therefore, finding a new crystal for providing information on chemical interaction between a glucocorticoid receptor ligand-binding domain and a ligand having a non-steroidal skeleton, and utilizing the crystal and information obtained from it It is very useful and eager to identify, search, evaluate or design mutants, agonists or antagonists of glucocorticoid receptors.

Under such circumstances, the present inventors have conducted intensive studies, and as a result, 6-[[3- [1- (2-Chloro-5-fluorophenyl) cyclobutyl] -2-hydroxy-2-trifluoromethylpropionyl] amino was used as a non-steroidal skeleton ligand. ] -4-methyl-2,3-benzoxazin-1-one was used to newly find a crystal containing a complex of a glucocorticoid receptor ligand-binding domain and a ligand having a non-steroid skeleton, and the present invention was achieved. .
That is, the present invention
1. An orthorhombic crystal containing a complex of a glucocorticoid receptor ligand-binding domain and a ligand, the space group belongs to I2 ₁ 2 ₁ 2 ₁ , and the unit cell is a = 48.0 plus or minus 4.0 angstroms B = 116.5 plus / minus 4.0 angstroms, c = 164.0 plus / minus 4.0 angstroms, α = β = γ = 90 °;
2. 2. The crystal according to claim 1, wherein the unit cell has a = 48.04 angstrom, b = 116.54 angstrom, c = 164.03 angstrom, and α = β = γ = 90 °.
3. The crystal according to claim 1 or 2, wherein the ligand is a ligand having a non-steroid skeleton;
4). The crystal according to claim 1 or 2, wherein the ligand is a ligand having a nonsteroidal skeleton and having agonist activity;
5. The ligand is 6-[[3- [1- (2-Chloro-5-fluorophenyl) cyclobutyl] -2-hydroxy-2-trifluoromethylpropionyl] amino] -4-methyl-2,3-benzoxazin-1-one The crystal according to claim 1, wherein
6). The crystal according to any one of claims 1 to 5, wherein the glucocorticoid receptor ligand binding domain is a glucocorticoid receptor ligand binding domain having the amino acid sequence represented by SEQ ID NO: 2.
7). The crystal as described in any one of 1 to 5 above, wherein the resolution determined by X-ray crystal structure analysis is at least 2.8 angstroms;
8). The glucocorticoid receptor ligand binding domain is Met560, Leu563, Asn564, Leu566, Gly567, Gln570, Trp600, Met601, Met604, Ala605, Ala607, Leu608, Arg611, Phe623, Met639, Gln642, Met646, Leu732, Typ735, Cys736, The crystal according to any one of claims 1 to 5, comprising a ligand binding pocket composed of amino acid residues including Thr739, Phe749, Leu753;
9. A protein having a glucocorticoid receptor ligand-binding domain, wherein the polypeptide three-dimensional structure state is a polypeptide three-dimensional structure state capable of binding a ligand and is in the polypeptide three-dimensional structure state The crystal space group belongs to I2 ₁ 2 ₁ 2 ₁ and the unit cell is a = 48.04 angstrom, b = 116.54 angstrom, c = 164.03 angstrom, α = β = γ = 90 °. A protein characterized by:
10. The protein according to claim 9, wherein the glucocorticoid receptor ligand binding domain is a glucocorticoid receptor ligand binding domain having the amino acid sequence represented by SEQ ID NO: 2.
11. Use of the crystal according to any one of claims 1 to 5 for obtaining information relating to atomic coordinates of a crystal comprising a complex of a glucocorticoid receptor ligand binding domain and a ligand;
12 The crystal of any one of claims 1-5 for deriving the three-dimensional structure of the complex based on the atomic coordinates of the crystal comprising the complex of a glucocorticoid receptor ligand binding domain and a ligand. use;
13. The chemical interaction between the glucocorticoid receptor ligand-binding domain and the test substance is expressed by the atomic coordinates of the crystal according to any one of claims 1 to 5, or a three-dimensional structure derived based on the atomic coordinates. Use of a crystal according to any one of claims 1 to 4 for evaluation as a reference;
14 Use of the crystal according to claim 11, 12 or 13, wherein the glucocorticoid receptor ligand binding domain is a glucocorticoid receptor ligand binding domain having the amino acid sequence represented by SEQ ID NO: 2.
15. A test substance is applied to the pocket for ligand binding having the atomic coordinates of the crystal according to any one of claims 1 to 5 or a three-dimensional structure derived based on the atomic coordinates, and conforms to the pocket A method for searching for a substance that can be an active ingredient of an agonist of a glucocorticoid receptor, comprising a step of selecting a test substance;
16. A method of searching for a substance that can be an active ingredient of an agonist of a glucocorticoid receptor,
(1) The step of inputting the atomic coordinates of the crystal according to any one of claims 1 to 5 to the first storage means,
(2) a step in which atomic coordinates of the test substance are input to the second storage means;
(3) Binding to the ligand binding pocket by stably optimizing the spatial arrangement specified by the combination of the characteristics of the atomic group of the test substance and the distance of each atomic group based on the input atomic coordinates of both A method comprising the step of selecting a test substance to be performed by computer processing means;
17. A agonist of a glucocorticoid receptor comprising a substance selected by the search method according to claim 15 or 16 or a pharmaceutically acceptable salt thereof as an active ingredient;
18. Means for inputting / accumulating / managing data information relating to the presence / absence or degree of chemical interaction of the substance selected by claim 15 or 16 or a pharmaceutically acceptable salt thereof; A system comprising: means for querying / retrieving data information based on a condition for obtaining a desired result; and means for displaying / outputting the queryed / retrieved result;
Etc. are provided.

  According to the present invention, a crystal containing a complex of a glucocorticoid receptor ligand binding domain and a ligand having a non-steroid skeleton can be provided. Furthermore, a method for identifying, searching, evaluating, or designing a glucocorticoid receptor mutant, agonist, antagonist, or the like can be provided by using the crystal and information obtained from the crystal.

  In the present specification, amino acids, peptides, and proteins are represented using abbreviations adopted by the IUPAC-IUB Biochemical Nomenclature Committee (CBN) shown below. Unless otherwise specified, the amino acid sequences of peptides and proteins are expressed from the N-terminal to the C-terminal from the left end to the right end, and so that the N-terminal is number 1.

A or Ala: alanine residue, D or Asp: aspartic acid residue,
E or Glu: glutamic acid residue, F or Phe: phenylalanine residue,
G or Gly: glycine residue, H or His: histidine residue,
I or Ile: isoleucine residue, K or Lys: lysine residue,
L or Leu: leucine residue, M or Met: methionine residue,
N or Asn: asparagine residue, P or Pro: proline residue,
Q or Gln: glutamine residue, R or Arg: arginine residue,
S or Ser: serine residue, T or Thr: threonine residue,
V or Val: valine residue, W or Trp: tryptophan residue,
Y or Tyr: tyrosine residue, C or Cys: cysteine residue.
In addition, when there are optical isomers with respect to amino acids, L-form is shown unless otherwise specified.

  The glucocorticoid receptor in the present invention is, for example, a glucocorticoid receptor having any of the following amino acid sequences, and is derived from mammals, preferably mice, humans, particularly preferably humans.

<Amino acid sequence>
(A) an amino acid sequence represented by SEQ ID NO: 1, 2, or 3; (b) an amino acid sequence represented by SEQ ID NO: 1, 2, or 3, wherein one or more amino acids are deleted, added or substituted; And an amino acid sequence of a protein having a function as a glucocorticoid receptor,
(C) an amino acid sequence having 80% or more sequence identity with the amino acid sequence represented by SEQ ID NO: 1, 2, or 3, and a protein having a function as a glucocorticoid receptor,
(D) an amino acid sequence encoded by a DNA having a base sequence having 80% or more sequence identity with a DNA having a base sequence encoding the amino acid sequence represented by SEQ ID NO: 1, 2 or 3, and a glucocorticoid An amino acid sequence of a protein having a function as a receptor,
(E) an amino acid sequence encoded by DNA having a base sequence encoding the amino acid sequence represented by SEQ ID NO: 1, 2 or 3 and DNA hybridized under stringent conditions, and as a glucocorticoid receptor Amino acid sequence of a protein having the functions of

  Here, “amino acid deletion, addition or substitution” in (b) above, “80% or more sequence identity” in (c) and “80% or more sequence identity” in (d). Is naturally produced by, for example, the processing that the protein having the amino acid sequence represented by SEQ ID NO: 1, 2, or 3 receives in the cell, the species difference of the organism from which the protein is derived, individual differences, differences between organs, tissues, etc. Mutations or artificial amino acid mutations (for example, in the amino acid sequence of proteins produced by introducing and expressing mutations in DNA encoding natural proteins by site-directed mutagenesis or mutagenesis) Amino acid mutations) and the like.

  As a technique for artificially performing “deletion, addition or substitution of amino acids” in the above (b) (hereinafter sometimes collectively referred to as amino acid modification), for example, SEQ ID NO: 1, 2 or 3 A conventional site-directed mutagenesis is applied to DNA encoding the amino acid sequence represented by the following, and then this DNA is expressed by a conventional method. Here, as a site-specific mutagenesis method, for example, a method using amber mutation (gapped duplex method, Nucleic Acids Res., 12, 9441-9456 (1984)), a PCR method using a mutagenesis primer Etc.

  The number of amino acids modified as described above is at least 1 residue, specifically 1 or several (here, “several” is about 2 to about 10) or more. . The number of such modifications may be within a range where the ability to promote fat accumulation can be found.

  Of the deletions, additions or substitutions, the modification relating to amino acid substitution is particularly preferable. The substitution is more preferably substitution with an amino acid having similar properties such as hydrophobicity, charge, pK, and structural features. Examples of such substitution include (1) glycine, alanine; (2) valine, isoleucine, leucine; (3) aspartic acid, glutamic acid, asparagine, glutamine, (4) serine, threonine; (5) lysine, arginine. And (6) substitution within the group of phenylalanine and tyrosine.

  In the present invention, “sequence identity” refers to sequence identity and homology between two DNAs or two proteins. The “sequence identity” is determined by comparing two sequences that are optimally aligned over the entire region of the sequence to be compared. Here, the DNA or protein to be compared may have an addition or a deletion (for example, a gap) in the optimal alignment of the two sequences. Such sequence identity can be calculated, for example, by creating an alignment using the ClustalW algorithm (Nucleic Acid Res., 22 (22): 4673-4680 (1994)) using Vector NTI. The sequence identity is measured using sequence analysis software, specifically, an analysis tool provided by Vector NTI, GENETYX-MAC, or a public database, for example, the homepage address http It is generally available at: //www.ddbj.nig.ac.jp.

  In the present invention, for example, the sequence identity is preferably 80% or more in the case of amino acid sequence standard, and preferably 80% or more in the case of base sequence standard. Of course, as long as the above conditions are satisfied, for example, among the amino acid sequence represented by SEQ ID NO: 1, the sequence identity in the first to 160th amino acid sequence is 50% or more, and the amino acid represented by SEQ ID NO: 1 Of the amino acid sequences represented by positions 161 to 418 and SEQ ID NO: 2 or 3, among the sequences, sequence identity may be such that the sequence identity at positions 1 to 258 is 90% or more. .

  Regarding “hybridize under stringent conditions” in (e) above, the hybridization used here is, for example, by Sambrook J., Frisch EF, Maniatis T., Molecular Cloning Second Edition (Molecular Cloning 2nd edition), Cold Spring Harbor Laboratory issuance (Cold Spring Harbor Laboratory press), etc. In addition, “stringent conditions” means, for example, that a hybrid is prepared at 45 ° C. in a solution containing 6 × SSC (a solution containing 1.5M NaCl and 0.15M trisodium citrate is 10 × SSC). Examples of the conditions include a condition of washing with 2 × SSC at 50 ° C. (Molecular Biology, John Wiley & Sons, NY (1989), 6.3.1-6.3.6). The salt concentration in the washing step can be selected, for example, from 2 × SSC at 50 ° C. (low stringency conditions) to 0.2 × SSC at 50 ° C. (high stringency conditions). The temperature in the washing step can be selected, for example, from room temperature (low stringency conditions) to 65 ° C. (high stringency conditions). It is also possible to change both the salt concentration and the temperature.

Specifically, for example, the human-derived glucocorticoid receptor in the present invention is described in, for example, access number P04150 (SwissProt) (Hollenberg, SM et al., Nature, 318: 635-41 (1985)). And has the amino acid sequence shown by SEQ ID NO: 2.
The “ligand binding domain” in the present invention means, for example, a C-terminal ligand binding site of a steroid receptor that causes ligand binding.
The glucocorticoid receptor ligand-binding domain in the present invention is described in, for example, a human-derived glucocorticoid receptor (SwissProt) (Hollenberg, SM et al., Nature, 318: 635-41 (1985)). Means the ligand binding site on the C-terminal side.
In the present invention, the human glucocorticoid receptor ligand-binding domain includes, for example, from the 500th to the 533rd in the amino acid sequence on the N-terminal side. Preferably, they are 510th to 531st. More preferably, from 522nd.
In the present invention, the ligand binding domain of the human glucocorticoid receptor has, for example, up to the 777th position in the amino acid sequence on the C-terminal side.
More specifically, the human glucocorticoid receptor ligand binding domain in the present invention means, for example, the glucocorticoid receptor ligand binding domain from the 522nd to the 777th.
In the case of a glucocorticoid receptor ligand-binding domain derived from another mammal, it means a region corresponding to the human-derived glucocorticoid receptor ligand-binding domain.
However, the start site and the end site of the glucocorticoid receptor ligand binding domain in the present invention are not necessarily exact, and any number of residues may be present at the N-terminal and / or C-terminal, provided that the function is maintained. These are also misaligned, or those in which an amino acid is added to the N-terminus and / or C-terminus are also included.
Such a slight difference in primary structure does not significantly affect the overall three-dimensional structure of the glucocorticoid receptor ligand-binding domain, and its function is generally considered to be maintained.
The glucocorticoid receptor ligand binding domain contains a ligand binding pocket. For the crystals of the present invention, residues in the glucocorticoid receptor ligand binding domain are defined by their spatial proximity to the ligand in the crystal structure. The term “ligand binding domain” also includes homologues of a ligand binding domain or portions thereof.
The ligand binding pocket in the present invention is Met560, Leu563, Asn564, Leu566, Gly567, Gln570, Trp600, Met601, Met604, Ala605, Ala607, Leu608, Arg611, Phe623, Met639, Gln642, Met646, Leu732, Typ735, Cys736, Thr739, It is composed of amino acid residues including Phe749 and Leu753 or a homologue thereof.
In the present invention, the ligand binding pocket relates to the space in the structure that binds the ligand and is located in the ligand binding domain.
The mutant used in the glucocorticoid receptor ligand binding domain in the present invention is, for example, a wild type (see SEQ ID NO: 3), a single mutant of F602S, a single mutant of C638D, or two of F602S and C638D. Heavy mutants (see SEQ ID NO: 2) and the like. Preferable examples include F602S and C638D double mutants.

（Ｂ）ＲＵ３８４８６

（Ｃ）フルチカゾンプロピオネイト

等を挙げることができ、またリガンドとして非ステロイド骨格を有するリガンドである6-[[3-[1-(2-Chloro-5-fluorophenyl)cyclobutyl]-2-hydroxy-2-trifluoromethylpropionyl]amino]-4-methyl-2,3-benzoxazin-1-one

等が挙げられる。尚、当該化合物は、国際公開第02／10143号に記載される方法により製造することができる。 In the present specification, the “ligand” may be any compound as long as it activates the receptor, but usually indicates a compound that interacts with the ligand binding domain of the receptor. However, ligands also include compounds that activate the receptor without binding.
The ligand in the present invention is not particularly limited as long as it has a binding activity with a glucocorticoid receptor. For example, U.S. Pat. No. 3,683,091, JP-B 45-014056, JP-B 6-263688, WO 95/10266 pamphlet, JP-B 45-36500, European Patent Application Publication No. 0 188 396, CF Bigge et al., J Med. Chem., 36, 1977-1995 (1993), PRKanjilal et al., J. Org. Chem., 50, 857-863 (1985), G. Sinha, J. Chem. Soc., Perkin Trans. I, (10), 2519-2528 (1983), U. r. Ghatak, M. Sarkar and SK Patra, Tetrahedron Letters No. 32, pp. 2929-2931 (1978), p. N. Chakrabortty et al., Indian J. Chem ., 12 (9), 948-55 (1974), E. Fujita et al., J. Chem. Soc., Perkin Trans. I, (1), 165-77 (1974), H. Sdassi et al., Synthetic Communications, 25 (17), 2569-2573 (1995), T. Ibuka et al., Yakugaku Zasshi 87 (8), 1014-17 (1967), Japanese Patent No. 09052899, US Patent No. 5,696,127, US Patent No. 5,767,113, Europe Patent Application Publication No. 0 683 172, D. Bonnet-Delpon et al., Tetrahedron, 52 (1), 59-70 (1996), International Publication No. 98/26783, International Publication No. 98/2 7986 pamphlet, WO 98/31702 pamphlet, European Patent Application Publication No. 0 903 146, JA Findlay et al., Tetrahedron Letters, No. 19, pp.869-872 (1962), German Patent Application Publication No. 19856475 International Publication No. 99/41256, International Publication No. 99/41257, International Publication No. 00/06137, International Publication No. 99/33786, International Publication No. 99/41257, International Publication No. 99/63976, International Publication No. 00/006137, International Publication No. 00/032584, International Publication No. 00/07972, International Application No. PCT / IB00 / 00366 or International Publication No. 02 / The compound described in the pamphlet of No. 24702 etc. can be mentioned.
More specifically, for example, (A) dexamethasone which is a ligand having a steroid skeleton as a ligand

(B) RU38486

(C) Fluticasone propionate

6-[[3- [1- (2-Chloro-5-fluorophenyl) cyclobutyl] -2-hydroxy-2-trifluoromethylpropionyl] amino]-, which is a ligand having a non-steroidal skeleton as a ligand 4-methyl-2,3-benzoxazin-1-one

Etc. In addition, the said compound can be manufactured by the method described in international publication 02/10143.

A complex of a glucocorticoid receptor ligand binding domain and a ligand can be obtained by the following acquisition method (hereinafter sometimes referred to as the present complex acquisition method).
This complex acquisition method is a method for acquiring a complex of a glucocorticoid receptor ligand binding domain and a ligand,
(1) a step of culturing a genetically modified microorganism or cell expressing a fusion protein of (a) a purified domain and (b) a glucocorticoid receptor ligand binding domain in the absence of a ligand (first step);
(2) A step of recovering the microorganism or cell obtained by the step and crushing the recovered microorganism or cell (second step),
(3) a step (third step) of recovering the fusion protein from the disrupted cells obtained by the step based on the binding property between the purification domain and the purification carrier (third step);
(4) A step of separating a complex of a glucocorticoid receptor ligand-binding domain and a ligand from the fusion protein obtained by the step by cleaving a protease-cleavable linker present in the purified domain of the protein with a protease. (Fourth step), and (5) A step of collecting the complex obtained by the above step (fifth step).
And having
(6) In the step before cleaving the protease-cleavable linker present in the purified domain of the fusion protein in the crushing step, the fusion protein recovery step, or the separation step, with the protease, The step of bringing the fusion protein into contact with the ligand (ligand contact step)
including.

  In the first step of the complex obtaining method, the purification domain is preferably a polypeptide comprising thioredoxin to which a metal chelate peptide is added and a protease-cleavable linker. Moreover, it is preferable that the said glucocorticoid receptor ligand binding domain is a glucocorticoid receptor ligand binding domain which has an amino acid sequence shown by sequence number 2.

The purification domain is (a1) a site that can be recovered based on the binding property between the purification domain and the purification carrier in order to purify the fusion protein in the third step of the complex obtaining method, (A2) A site that allows the complex of the glucocorticoid receptor ligand-binding domain and the ligand to be separated by cleaving the fusion protein with a protease in the fourth step of the complex acquisition method ( That is, it comprises a protease-cleavable linker present in the purification domain of the protein, and (a3) a polypeptide for stabilizing the complex, if necessary. The (a3) site may be the (a1) site itself.
Examples of the (a1) site include a metal chelate peptide such as histidine-tryptophan module or a metal chelate peptide such as histidine-tryptophan module that enables purification on a fixed metal. Thioredoxin, etc. added, hemagglutinin (HA) tag (corresponding to epitopes derived from influenza hemagglutinin protein; Wilson, I. et al. (1984) Cell 37: 767), maltose binding poly Peptides, FLAG epitopes (Immunex Corp, Seattle, WA) and E-epitop tags (E-tags) used in the FLAGS expression / affinity-purification system. Preferred examples include thioredoxin obtained by adding a metal chelate peptide such as histidine-tryptophan module, and maltose-binding polypeptide, and more preferably a metal chelate such as histidine-tryptophan module. A thioredoxin to which a peptide is added is mentioned. Here, the residue in “histidine” refers to immobilized metal ion affinity chromatography (IMIAC) as described, for example, in Porath et al., Protein Expression and Purification, 3: 263-281 (1992). It facilitates purification.
Examples of the (a2) site include those having functions such as FactorXa Protease (blood coagulation factor Xa) cleavage site, PreScission Protease cleavage site, and thrombin cleavage site.
Examples of the (a3) site include, for example, a polypeptide for enhancing the water solubility of the complex, and the three-dimensional structure of the complex of the glucocorticoid receptor ligand-binding domain and the ligand following the site with good reproducibility. A polypeptide that can be used. Preferable examples include thioredoxin.

  A genetically modified microorganism or cell that expresses a fusion protein of (a) a purified domain and (b) a glucocorticoid receptor ligand-binding domain can be expressed by an ordinary genetic engineering technique using an expression vector capable of expressing the fusion protein in a host microorganism. And then introducing the constructed expression vector into the microorganism or cell using a conventional genetic engineering technique. The produced genetically modified microorganisms or cells are cultured under suitable culture conditions in the presence of a non-ligand while promoting the transcriptional activity of the promoter of the expression vector by appropriate means such as temperature change or chemical induction. Incubate with Reference literature for culturing and producing a large number of microorganisms or cells (including cells of bacteria, plants, animals (especially mammals) and archaebacteria) includes Sambrook, Ausubel and Berger (all Supra), and Freshney, Culture of Animal Cells, a Manual of Basic Technique, 3rd edition (1994), Wiely-Liss, New York and references cited therein; Doyle and Griffiths, MAMMALIAN CELL CULTURE: ESSENTIAL TECHNIQUES (1997), John Wiley and Sons, NY; Humason, Animal Tissue Techniques, 4th edition (1979), WHFreeman and company; and Ricciardelli et al., In vitro Cell Dev. Biol. 25: 1016-1024 (1989); Payne et al., Plant Cell and Tissue Culture in Liquid Systems (1992), John Wiley & Sons, Inc., New York; Gamborg and Phillips (ed.), Plant Cell, Tissue and Organ Culture; Fundamental Methods Springer Lab Manual (1995), Springer-Verlag (Berlin Heidelberg New York) and Plant Molecular Biology, edited by RRDCroy, Bios Scientific Publishers (1993), Oxford, UKISBN0 12 198470 6; Atlas and Parks (ed.), The Handbook of Microbiological Media (1993), CRC Press, Boca Raton, FL .; Sigma-Aldrich, Inc (St. Louis, MO) Life Sience Research Cell Culture Catalog (1998) (`` Sigma-LSRCCC ''); The Plant Culture Catalog and supplement (1997) (`` Sigma-PCCS '') from Sigma-Aldrich, Inc. (St. Louis, MO); Tymms In vitro Transcription and Translation Protocols: Methods in Molecular Biology, Vol. 37 (1995), Garland Publishing, NY.

  In the second step of the complex obtaining method, the method for recovering the microorganisms or cells includes centrifugation. Examples of the method for disrupting the genetically modified microorganism or cells include normal physical or chemical destruction treatment such as freeze-thaw cycle treatment, ultrasonic treatment, mechanical destruction treatment, cell lysing agent treatment, etc. And microbial engineering techniques based on the above.

  In the third step of the present complex acquisition method, the purification domain is recovered by using affinity chromatography such as a tagging system that is a commercially available product in order to recover the fusion protein from the disrupted bacterial cell. It may be recovered on the basis of the binding property between the carrier and the purification carrier. Further ammonium sulfate or ethanol precipitation, acidic extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography or lectin chromatography as required It may be purified and recovered in combination with various protein purification methods such as-. In addition, as a reference for many purification and recovery, for example, Sandana, Bioseparation of Preteins (1997), Academic Press, Inc .; Bollag et al., Protein Methods 2nd edition (1996), Wiley-Liss, NY; Walker, The Pretein Protocols Handbook (1996), Humana Press, NJ; Harris and Angal, Protein Purification Applications: A Practical Approach (1990), IRL Press at Oxford, Oxford, England; Harris and Angal, Protein Purification Methods: A Practical Approach, IRL Press at Oxford, Oxford, England; Scopes, Protein Purification: Principles and Practice 3rd edition (1993), Springer Verlag, NY; Janson and Ryden, Protein: Principles, High Resolution Methods and Applycations, 2nd edition Purification (1998), Wiley-VCH, NY; or Walker, Protein Protocols on CD-ROM (1998), Humana Press, NJ.

  In the fourth step of the complex obtaining method, the fusion protein is separated into (a) a purified domain and (b) a glucocorticoid receptor ligand binding domain. In the fourth step of the complex obtaining method, examples of the protease include proteases such as Factor Xa Protease (blood coagulation factor Xa), PreScission Protease, and thrombin. The protease cleavage conditions may be those that can separate the complex from the purified domain, and depend on the type of protease. For example, the temperature is 4 ° C to 20 ° C, preferably 4 ° C. The time required for the cleavage of the protease is, for example, 6 hours to 48 hours, preferably 10 hours to 20 hours. However, since the efficiency of cleavage of the fusion protein changes depending on the amount of protease added, if the fusion protein can be separated into a purified domain and a glucocorticoid receptor ligand binding domain, the time required for cleavage is not exact. . The concentration of the fusion protein in the solution to which the protease is added is not a problem as long as the complex does not cause precipitation, but is, for example, 0.001 mg / ml to 10 mg / ml, preferably 0.1 mg. / ml to 2.0 mg / ml. More preferably, it is 0.5 mg / ~ 1.0 mg / ml.

In the fifth step of the complex obtaining method, the complex can be recovered by, for example, ammonium sulfate or ethanol precipitation, acidic extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction. Purification and recovery may be performed in combination with various protein purification methods such as action chromatography, affinity chromatography, hydroxylapatite chromatography, or lectin chromatography. Reference documents for many purifications and recovery include, for example, Sandana, Bioseparation of Preteins (1997), Academic Press, Inc .; Bollag et al., Protein Methods 2nd edition (1996), Wiley-Liss, NY; Walker, The Pretein Protocols Handbook (1996), Humana Press, NJ; Harris and Angal, Protein Purification Applications: A Practical Approach (1990), IRL Press at Oxford, Oxford, England; Harris and Angal, Protein Purification Methods: A Practical Approach, IRL Press at Oxford, Oxford, England; Scopes, Protein Purification: Principles and Practice 3rd edition (1993), Springer Verlag, NY; Janson and Ryden, Protein: Principles, High Resolution Methods and Applycations, 2nd edition Purification (1998), Wiley-VCH, NY; or Walker, Protein Protocols on CD-ROM (1998), Humana Press, NJ. For example, the complex may be concentrated and purified using gel filtration chromatography, or after passing through anion exchange chromatography, or adsorbed and further purified.
In the fifth step of this complex acquisition method, for example, a PD10 column (Amersham Bioscience) or dialysis may be used as a method for replacing the solution obtained by cleaving the fusion protein in the above step. After substituting the solution, the complex separated in the above step can be recovered by obtaining a passing product such as affinity chromatography, which is a commercially available tagging system. For example, the complex may be further purified by an anion exchange column, gel filtration chromatography, or the like. After the complex is purified, the complex may be concentrated using an apparatus for concentration such as centriprep centricon, amicon or microcon.
In order to collect the complex obtained in the fifth step, the solution containing the complex may be collected in a storage container using a pipetman or the like, or may be stored at −80 ° C. In each stage of the fifth step, the purified sample may be collected and subjected to crystallization treatment.

It is important that this complex acquisition method includes a ligand contact step in relation to a specific step among the above steps. Specifically, the crushing step, the fusion protein recovery step (second step) Alternatively, the step of contacting the microorganism or cell or the fusion protein with a ligand in the step before the protease cleavable linker existing in the purification domain of the fusion protein is cleaved by a protease in the separation step is included. The presence of this step leads to more stable retention of the three-dimensional structure of the complex of the glucocorticoid receptor ligand binding domain and the ligand.
In the complex obtaining method of the present invention, in the above step, for example, a solution in which a ligand is dissolved is added to a solution obtained by holding a microorganism or a cell or the fusion protein in the previous period, thereby bringing them into contact by natural diffusion. Can do. In this case, the final concentration of the ligand is, for example, 0.001 pM to 500 mM, preferably 1 nM to 200 mM, and more preferably 1 nM to 100 mM. In Examples, in the second to fifth steps in the above step, the fusion protein and the ligand may be contacted at a concentration of 10 mM, for example. The ligand may be stored by dissolving in a solvent such as dimethyl sulfoxide, methanol or ethanol, for example.
In addition, as long as the said ligand contact process is implemented, you may implement the following process after said specific process in the presence of a ligand.

Next, the crystal of the present invention can be obtained by the following crystal acquisition method (hereinafter sometimes referred to as the present crystal acquisition method).
This crystal acquisition method is a method for acquiring a crystal containing a complex of a glucocorticoid receptor ligand-binding domain and a ligand, and is obtained by subjecting the complex obtained by this complex acquisition method to crystallization treatment. Recovering the crystals.

  In this crystal acquisition method, the glucocorticoid receptor ligand binding domain is preferably a glucocorticoid receptor ligand binding domain having the amino acid sequence represented by SEQ ID NO: 2.

The crystallization treatment in this crystal acquisition method is performed when, for example, the protein is brought into an insoluble state from a solution state by an operation of adding a precipitant to the target protein solution or an operation of reducing the amount of solvent by evaporation or the like. The property of precipitating as crystals is used. Moreover, physical and chemical factors such as the type, state or concentration of the protein, salt concentration, hydrogen ion concentration (pH), type of precipitant to be added, temperature, and the like are involved as conditions for crystallization. Further, as a method for adjusting the amount of the precipitant and the solvent, for example, as described in Blundell, TL and Johnson, LN, PROTEIN CRYSTALLOGRAPHY, pages 59-82, (1976) Academic Press, New York, etc. Methods for processing such as batch method, dialysis method, vapor diffusion method and the like can be mentioned.
Examples of the vapor diffusion method include a hanging drop method, a sitting drop method, and an oil batch method, and an oil batch method is preferable. Examples of the oil used in the oil batch method include silicon oil, paraffin oil, and oil obtained by mixing silicon oil and paraffin oil at a certain mixing ratio (preferably, 1: 1 mixture of silicon oil and paraffin oil). Oil mixed in a ratio) and the like. In general, the vapor diffusion speed of the crystallization drop may be adjusted according to the type and amount of oil dispensed to the well of the crystallization screening plate. Specifically, for example, the amount of oil dispensed can be about 10 μl to 200 μl, preferably about 30 μl to 60 μl, and more preferably about 40 μl.
As a crystallization plate used in the crystallization treatment, a plate such as 72 Well, 96 Well, 384 Well, and 1536 Well may be used, but any plate that can be used for crystallization screening is used. There is no limit to the number of wells.

In the present crystal acquisition method, when the complex obtained by the present complex acquisition method is subjected to crystallization treatment, the glucocorticoid receptor coactivator peptide is subjected to crystallization treatment in the presence of the glucocorticoid receptor as necessary. Also good.
Examples of coactivator peptides to be coexisted include TIF2 coactivator peptides.
The TIF2 coactivator peptide is NRBOX3, specifically, for example, KENALLRYLLDK, KKKENALLRYLDKDD, PVSPKKKENALLRYLLDKDD, or L having an amino acid sequence L consisting of an amino acid sequence L consisting of an amino acid sequence L having an amino acid sequence L. Preferable examples include those consisting of an amino sequence having an LXXLL motif consisting of the amino acid sequence of PVSPKKKENALLRYLLKDKDDT (SEQ ID NO: 8).

The “target protein solution” prepared in the crystallization process of the present crystal acquisition method is a complex of a glucocorticoid receptor ligand-binding domain and a ligand, and, if necessary, a coactivator peptide of the glucocorticoid receptor. The concentration of the complex of the glucocorticoid receptor ligand binding domain and the ligand in the solution may be, for example, about 1 mg / ml or more, and more preferably about 2 mg / ml or more. is there.
As a water-soluble substance used for precipitating crystals in the above crystallization treatment, by adding the substance to the solution, the solubility of the protein in the solution is reduced, and aggregation is performed without denaturing the protein. And salts that can be precipitated as crystals, organic solvents, polymer compounds, and the like.
Specific examples of the salts include inorganic salts such as sodium chloride, ammonium sulfate, sodium citrate, sodium phosphate, sodium sulfate, calcium chloride, ammonium chloride, ammonium citrate, ammonium tartrate, potassium phosphate, magnesium sulfate, and the like. Mention may be made of salts. Preferred examples include sodium chloride, ammonium acetate, imidazole, and ammonium tartrate. More preferably, imidazole or ammonium acetate can be mentioned.
Specific examples of the polymer compound include polyethylene glycol. A polyethylene glycol having an average molecular weight of about 1000 to 15,000 is preferable, and a polyethylene glycol having an average molecular weight of about 6000 to 8000 is more preferable.
For example, when the water-soluble substance is a salt, the concentration of the water-soluble substance added to the solution is about 5 to 70% (W / W), preferably about 10 to 60% (W / W). When the water-soluble substance is a polymer compound, the final concentration is about 0.5 to 50% (W / W), preferably about 1.3% to 4.0% (W / W). .
Further, the pH of the “target protein solution” is usually preferably maintained at about 2 to 10. Preferably, it is good to keep about 7-9. The temperature of the solution is usually preferably maintained at about 1 to 40 ° C. Preferably it is good to keep at about 4-25 degreeC, More preferably, it is good to keep at about 4-20 degreeC. The time required for the crystallization treatment may be about 1 minute to 2 months.
The crystals obtained by recovering the crystals obtained by performing the crystallization treatment in this way are used as seed crystals in the sheeting and / or macrosheeting, if necessary, to obtain X-ray crystals. It can be further grown into a crystal of a size suitable for structural analysis.

In the present invention, “X-ray crystal structure analysis” used as a method for determining atomic coordinates of a crystal containing a complex of a glucocorticoid receptor ligand-binding domain and a ligand is, for example, a three-dimensional structure of a protein. It is the most commonly used analytical technique for inducing and clarifying. Specifically, for example, a technique as described in Blundell, TL and Johnson, LN, PROTEIN CRYSTALLOGRAPHY, pp. 1-565, (1976) Academic Press, New York, etc. This is an analysis method for inducing and clarifying the three-dimensional structure of the protein on the basis of the X-ray diffraction image obtained by irradiating with monochromatic X-rays.
Other conditions and techniques suitable for the X-ray structural analysis are described in, for example, Glusker, J., Crystal Structure Analysis for Chemists and Biologists, Wiley-VCH Press (1994), International Tables for X-Ray Crystallography, Volume F, Those described in MGRosssman and E. Arnold, Kluwer Academic Publishers (2001), etc. may be applied. Specifically, for example, data can be measured isomorphically using the SCALEPACK module of HKL2000 [Otwinowski et al., Methods Enzymol. 276: 307-326 (1997)], or d * Trek (Rigaku MSC) or SCALA (COLLABORATIVE COMPUTATIONAL PROJECT) No.4 "The CCP4 Suite: Programs for Protein Crystallography" [Acta Cryst. D50, 760-763 (1994)] All subsequent calculations can be done using the CNX package (Accelrys, Inc.), or a combination of CCP4 program package software or software packages well known to those skilled in the art. It is also possible to identify atomic coordinates.
Using such an analysis technique, the atomic coordinates of a crystal including a complex of a glucocorticoid receptor ligand-binding domain and a ligand may be determined, and the three-dimensional structure of the protein may be derived from the determined atomic coordinates.

The crystal of the present invention is an orthorhombic crystal containing a complex of a glucocorticoid receptor ligand-binding domain and a ligand, the space group belongs to I2 ₁ 2 ₁ 2 ₁ , and the unit cell is a = 48.04 angstroms. B = 116.54 angstroms, c = 164.03 angstroms, and α = β = γ = 90 °. In addition, as a component of the “orthogonal crystal including a complex of a glucocorticoid receptor ligand-binding domain and a ligand” in the present invention, in addition to both components of the glucocorticoid receptor ligand-binding domain and the ligand, The coagulator peptide of a glucocorticoid receptor may be contained as a constituent component.
The crystal of the present invention can be analyzed with a resolution of 2.8 angstroms by a general X-ray crystal structure analysis technique.

  A typical ligand used in the present complex obtaining method for obtaining such a two-component crystal or a three-component crystal is a ligand having a non-steroid skeleton, and more typically, It is a ligand having a non-steroid skeleton and having agonist activity. Specific compounds include 6-[[3- [1- (2-Chloro-5-fluorophenyl) cyclobutyl] -2-hydroxy-2-trifluoromethylpropionyl] amino] -4-methyl-2,3-benzoxazin-1 -one. Similarly, a typical glucocorticoid receptor ligand-binding domain used in the present complex obtaining method is a glucocorticoid receptor ligand-binding domain having the amino acid sequence represented by SEQ ID NO: 2. A typical coactivator peptide coexisting as necessary consists of an amino sequence having an LXXLL motif consisting of the amino acid sequence of TIF2 coactivator peptide (more specifically, PVSPKKKENALLRYLLKDDD (SEQ ID NO: 8)). Stuff).

  The atomic coordinates of the crystals of the present invention are used to identify, search, evaluate or design glucocorticoid receptor mutants, agonists or antagonists. In addition, the overall structure of the complex can be clarified by inducing a three-dimensional structure based on the atomic coordinates of the crystal of the present invention.

  The present invention includes (1) a computer storage medium storing all or part of the atomic coordinates of the present invention, (2) identifying, searching for a glucocorticoid receptor mutant, agonist or antagonist. All or part of the atomic coordinates of the present invention for evaluation or design, or the use of the storage medium for the previous computer, (3) All of the atomic coordinates of the present invention in the crystal structure analysis using the molecular replacement technique Or the use of a part or a storage medium for a previous computer is included.

In the present invention, the chemical interaction between the glucocorticoid receptor ligand binding domain and the test substance is evaluated using the atomic coordinates of the crystal of the present invention or a three-dimensional structure derived based on the atomic coordinates as a reference. The use of the crystals of the present invention to accomplish this is also included. The glucocorticoid receptor ligand binding domain is preferably a glucocorticoid receptor ligand binding domain having the amino acid sequence represented by SEQ ID NO: 2.
The glucocorticoid receptor is obtained by inputting the atomic coordinates obtained from the crystal of the present invention into a computer on which a computer program that expresses the three-dimensional structure of a protein operates or a storage medium for the computer. It is possible to express in detail the state related to the three-dimensional spatial chemical interaction of the ligand binding domain. Here, “chemical interaction” means, for example, the interaction energy between the glucocorticoid receptor ligand binding domain and the test compound molecule. Here, the “interaction energy” means, for example, hydrogen bond, electrostatic interaction, van der Waals force, and the like.
The computer storage medium is not particularly limited as long as it can lead to a computer program capable of deriving a three-dimensional structure based on atomic coordinates obtained from the crystal of the present invention. is not. For example, it may be an electrical temporary storage medium called a memory or a semi-permanent storage medium such as a flexible disk, a hard disk, an optical disk, a magneto-optical disk, or a magnetic tape.

Computer programs that express the three-dimensional structure of proteins include, for example, means for inputting atomic coordinates of proteins, etc., visual representation of the atomic coordinates on a computer screen, and within the expressed proteins. The program is not particularly limited as long as it is a program created so as to provide means for measuring the distance between each atom, bond angle, etc., and means for performing additional correction of the atomic coordinates. Preferably, a program created so as to provide means for calculating the structural energy of the molecule based on atomic coordinates and means for calculating free energy in consideration of solvent molecules such as water molecules may be mentioned. it can. Specific examples include InsightII (Accelrys, Inc.) and QUANTA (Accelrys, Inc.), which are computer programs.
Such computer programs are usually introduced and used in computers called workstations supplied by Silicon Graphics, Sun Microsystems, etc. It is not limited to.

  The agonist of the present invention contains a substance selected by the following searching method or a pharmaceutically acceptable salt thereof as an active ingredient. Such agonists are particularly useful for the treatment of subsequent diseases such as obesity, diabetes, inflammation, inflammatory diseases, immune and autoimmune diseases.

The present invention relates to a method for searching for a substance that can be an active ingredient of an agonist of a glucocorticoid receptor, the atomic coordinate of the crystal of the present invention or a pocket for ligand binding having a three-dimensional structure derived based on the atomic coordinate. Applying a test substance to the pocket and selecting a test substance that fits into the pocket, or (1) the step of inputting the atomic coordinates of the crystal of the present invention into the first storage means,
(2) a step in which atomic coordinates of the test substance are input to the second storage means;
(3) Binding to the ligand binding pocket by stably optimizing the spatial arrangement specified by the combination of the characteristics of the atomic group of the test substance and the distance of each atomic group based on the input atomic coordinates of both The method includes the step of selecting the test substance to be performed by a computer processing means.
A person skilled in the art introduces the atomic coordinates of the crystal of the present invention into the computer or its storage medium by using a computer that is adjusted so that a program suitable for the purpose operates. For the first time, we can understand the state expressed up to the arrangement of each atom in three-dimensional space. This makes it possible to select a test substance that binds to the pocket for ligand binding. As a result, the lead compound can be optimized based on the atomic coordinates of the crystal of the present invention.

  Experimental methods for finding lead compounds include, for example, a series of compounds known as combinatorial libraries, commercially available compound libraries, and high-throughput screens from cultures such as microorganisms or cells. You may select by technique such as ning. In evaluating the chemical interaction between the obtained lead compound and the glucocorticoid receptor ligand-binding domain, find a site with non-optimal chemical interaction and design a more optimized compound. That's fine. In the initial stage, as a method for clarifying the details of the chemical interaction between the lead compound and the glucocorticoid receptor ligand binding domain accurately, this crystal acquisition method is used. To obtain a crystal containing a complex of a complex compound and a glucocorticoid receptor ligand-binding domain, and to know details of chemical interaction information using the X-ray crystal structure analysis technique as described above It becomes possible. In a group of compounds of the same family, chemical interaction between the lead compound and the glucocorticoid receptor ligand binding domain is achieved by visual comparison and / or energy calculation by a computer and comparison. You can also understand the information related to

Examples of general methods used by this computer program and similar programs include the following three application examples. More detailed information on some of these techniques can be found in the Molecular Simulation User Guide (1995) and the like.
A typical computer program used for this purpose includes the following steps.
(A) The existing compound is removed from the protein.
(B) Using a computer program (such as DOCK), dock the three-dimensional structure of the test substance to the active site, or move the substance to the active site so that chemical interaction is enhanced To make it dock.
(C) Characterize the space between the compound and the active site atom.
(D) (i) Search the library for molecular fragments that fit in the empty space between the compound and the active site, and (ii) can bind to the test substance.
(E) The fragment found above is bound to the test substance and the newly modified compound is evaluated.
In step (c), it is important to characterize the geometric and complementary interactions formed between the active site atoms and the test substance. A suitable geometric fit is achieved when a significant surface area is shared between the test substance and the active site atom without forming an inappropriate steric interaction. It is also possible to screen the database of many compounds by skipping the above steps (d) and (e).

Computer programs for screening many compounds include, for example, (1) GRID (PJ Goodford, “A Computational Procedure for Determining Energetically Favorite Binding Sites on Biologically Important Macromoecules”, J. Med. Chem., 28, 849-857 ( 1985)), (available from Oxford University, Oxford, UK);
(2) MCSS (A.Miranker et al., “Functionality Maps of Binding Sites: A Multiple Copy Simultaneous Search Method”, Proteins: Structure, Function and Genetics, 11, 29-34 (1991)), (Accelrys, Inc. available),;
(3) AUTODOCK (DSGoodsell et al., "Automated Docking of Substrates to Proteins by Simulated Annealing", Proteins: Structure, Function, and Genetics, 8, 195-202 (1990)), (available from Scripps Research Institute, La Jolla, CA) );
(4) DOCK (IDKuntz et al., “A Geometric Approach to Macromolecule-Ligand Interactions”, J. Mol. Biol., 161, 269-288 (1982)) (available from University of California, San Francisco, Calif.);
(5) GOLD (Jones ET al., J. Mol. Biol 267: 727-748 (1997)) (available from Cambridge Crystallographic Data Center (UK));
(6) GLIDE (Eldridge ET al., J. Comput. Aided Mol. Des. 11: 425-445 (1997)) (available from Schrodinger (Portland OR));
(7) FlexX (Tripos, Inc.), (available from Tripos, Inc.);
(8) Flexidock (Tripos, Inc.), (available from Tripos, Inc.);
(9) GRAMM (Ilya A. Vakser, RockefellerUniv.), (Available from RockefellerUniv.);
Can be mentioned.

The database of test substances used is
(A) Elsevier MDL
(B) Cambridge Crystallographic Data Center
(C) Chemical Abstracts Service
(C) The Thomson Corporation
(D) Maybridge
(E) Sigma-Aldrich
Etc. are available.

For example, (1) CONCORD (Tripos, Inc),
(2) Sketcher and Converter (Accelrys, Inc.)
Computer programs such as

  Structural-based design and identification of active ingredients of agonists of glucocorticoid receptors can be used in conjunction with assay screening. Since large computer data bases (about 10,000 compounds) for compounds can be searched with time issues, the computer based method is based on the glucocorticoid receptor ligand binding domain. Possible modulators can narrow the compounds to be tested by cellular assays.

Another way to identify the active ingredients of agonists of glucocorticoid receptors is to modify the existing modulators of the compound. For example, a modulator computer image can be modified within a computer image of a glucocorticoid receptor ligand binding domain.
These methods are, for example,
(1) LUDI (available from H.-J. Bohm, J. Comp. Aid. Molec. Design 6: 61-78 (1992), Accelrys, Inc .;
(2) LEGEND (available from Y. Nishibata ET al., Tetrahedron 47: 8985 (1991), Accelrys, Inc .;
(3) Available from LeapFrog, Tripos, Inc.
(4) SPROUT V. Gillet ET al, J. Comput. Aided Mol. Design 7: 127-153 (1993), University of Leeds (UK) can be mentioned.
The computer image of the modulator is modified by deleting one or more substituents or adding one or more substituents. Each modification to the compound shifts the modified compound and active site atoms within the conformation, and the distance between the modular and active site atoms is evaluated with complementary interactivity formed between the two molecules. Is done. The evaluation is complete when a suitable geometric fit and a suitable interaction are obtained. Compounds with suitable evaluation are potential modulators of the glucocorticoid receptor.

Another way of designing a structure-based modulator is to screen for compounds designed by the modulator construction or the modulator search computer program. This type of computer program includes, for example, Catalyst (Accelrys, Inc.), ISIS / HOST (Elsevier MDL), ISIS / BASE (Elsevier MDL), ISIS / DRAW (Elsevier MDL), UNITY (Tripos, Inc). These computer programs operate based on the structure of the compound removed from the active site of the three-dimensional structure of the complex of the compound and the glucocorticoid receptor ligand binding domain. Manipulating the program for such compounds is preferred because it is in a biologically active conformation. The modulator construction computer program replaces the computer image of the substituent with the substituent from the computer database in a complex with the glucocorticoid receptor ligand binding domain. It is a computer program that can be used to The Modulator Search Computer Program is used to identify compounds from computer databases that have similar three-dimensional structure and similar substituents to compounds bound to the glucocorticoid receptor ligand binding domain. A computer program that can be used to retrieve computer images.
Such a computer program can be operated using the following general steps.
(A) Map compounds by chemical feature, such as by hydrogen bond donor or acceptor, hydrophobic / lipophilic, positively ionizable site, or negatively ionizable site.
(B) Add geometric constraints to the mapped feature points.
(C) The database is searched with the model generated in (b).

  The versatility of computer-based modulator design and identification lies in the variety of structures screened by the computer program. The computer program is able to search a database containing 200,000 molecules, and to create a modulator that has already formed a complex with an enzyme having various chemical functional groups. Can be modified. The importance of this chemical diversity is that potential modulators of glucocorticoid receptor ligand binding domain function may adopt a three-dimensional structural state that cannot be predicted. A broad set of organic synthesis techniques are in the technology to meet the challenge of constructing potential modulators of the function of the glucocorticoid receptor ligand binding domain. Many of these organic synthesis methods are described in detail in standard literature used by those skilled in the art. An example of such a document is Advanced Organic Chemistry: Reactions, Mechanisms and Structures, March 1994, New York, McGraw Hill. Thus, the techniques required to synthesize potential modulators of glucocorticoid receptor ligand binding domains identified by computer-based methods are readily available to those skilled in organic chemical synthesis. Is possible.

  In the present invention, data on the presence / absence or the degree of the chemical interaction of the test substance selected by the search method 1 or the search method 2 of the present invention is input and stored for the test substance. Means for managing (hereinafter also referred to as means a), means for inquiring / searching the data information based on conditions for obtaining a desired result (hereinafter also referred to as means b) And a system for displaying / outputting the result of inquiry / search (hereinafter also referred to as means c).

  First, the means a will be described. As described above, the means a, after inputting the data information relating to the presence or degree of the chemical interaction of the test substance selected by the search method 1 or the search method 2 of the present invention, It is a means for accumulating and managing the input information. Such information is input by the input unit 1 and stored in the normal storage unit 2. As an input means, what can input the said information, such as a keyboard and a mouse | mouth, is mentioned, for example. When the input, storage, and management of the information are completed, the process proceeds to the next means b. In addition, for storing and managing the information, information having a data structure is input using hardware such as a computer and software such as an OS and database management. By storing in a storage device such as a flexible disk, magneto-optical disk, CD-ROM, DVD-ROM, hard disk or other computer-readable recording medium, a large amount of data can be stored efficiently. Just manage.

  The means b will be described. The means b is a means for inquiring and searching the data information stored and managed by the means a based on conditions for obtaining a desired result as described above. For such information, if the condition for inquiry / search is input by the input means 1 and the information that matches the condition is selected from the information stored in the normal storage means 2, the process proceeds to the next means c. The selected result is normally stored in the storage unit 2 and can be displayed by the display / output unit 3.

  The means c will be described. The means c is a means for displaying and outputting the result of inquiry / search as described above. Examples of the display / output means 3 include a display and a printer. The display / output means 3 may display the result on a display device of a computer or output the result on paper by printing or the like.

  EXAMPLES Hereinafter, although an Example is given and this invention is demonstrated in detail, this invention is not limited to these.

Example 1 (Construction of expression vector)
A glucocorticoid receptor ligand-binding domain was cloned, and a primer consisting of the nucleotide sequence represented by SEQ ID NOs: 4 and 5 (SEQ ID NO: 4: GGTATTGAGGGTCGCCTGGTGCCACGCGGTTCTCCTGCAACGTTACCACAACT, SEQ ID NO: 5) : AGAGGAGAGTTAGAGCCTCACTTTTGATGAAACAGAA). The resulting amplified DNA was then cloned into pET32 / XaLIC vector (Novagen). Using a cloned human-derived glucocorticoid receptor ligand-binding domain with a primer comprising the nucleotide sequence shown in SEQ ID NOs: 6 and 7 (SEQ ID NO: 6: ATCATCATCATTCTTCTGGTGGTATGAAAGAAACCGCTGC, SEQ ID NO: 7: GCAGCGGTTTCTTTCATACCACCAGAAGAATGATGATGAT) The thrombin cleavage site on the pET32 / XaLIC vector (Novagen) was deleted by specific mutagenesis (QuickChange Site directed mutagenesis). An expression vector was constructed so as to include a thioredoxin tag, a polyhistidine tag, and a thrombin cleavage site in order from the N-terminus. Substitution of F602 with S and substitution of C638 with D was performed with the expression vector using a QuickChange Site-Direct Mutagenesis kit (STRATAGENE). The expression vector thus obtained was transformed into E. coli strain BL21 (DE3).

Example 2 (Protein expression and purification)
The glucocorticoid receptor ligand binding domain was driven by the T7 promoter of the pET32 / XaLIC vector (Novagen) and expressed as a fusion protein. Escherichia coli BL21 (DE3) was prepared using 2xYT medium (composition: 16 g, tryptone, 10 g yeast extract, 5 g NaCl / L culture) supplemented with 0.5 mM isopropyl-β-D-thiogalactopyranoside. After culturing at 15 ° C. for 16 to 20 hours in the absence of ligand, E. coli was recovered by centrifugation (7330 g, 12 min, 4 ° C.) to obtain a cell pellet. The obtained cell pellet was stored at -80 ° C.
Approximately 80 g of the cell pellet was suspended in 300 ml of 50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 10% Glycerol, 10 mM β-mercaptoethanol, 2M UREA, and then 6-[[3- [1- ( 2-Chloro-5-fluorophenyl) cyclobutyl] -2-hydroxy-2-trifluoromethylpropionyl] amino] -4-methyl-2,3-benzoxazin-1-one was added to a concentration of 10 μM. The obtained bacterial mixture was subjected to ultrasonic treatment (level 5 intensity, on ice, 20 minutes) using Digital Sonifer S-450D (BRANSON) to obtain a microbial cell disruption product. The cell disruption solution was centrifuged by centrifugation (38900 g, 30 min, 4 ° C.), and the supernatant was collected.
Next, the obtained supernatant was subjected to chromatography on a nickel chelating resin, and then the fusion protein (about 90% purity) was obtained by gradient elution with 0.04-0.5 M imidazole. A total of 10-30 mg was recovered. The amino acid sequence of the obtained fusion protein (that is, a human-derived glucocorticoid receptor ligand-binding domain fused with thioredoxin and polyhistidine) is shown in SEQ ID NO: 1. The amino acid region from the 157th to the 162nd in SEQ ID NO: 1 is a thrombin cleavage site.

The solvent of the solution obtained after subjecting the obtained fusion protein to a PD-10 column (Amersham Bioscience) was 50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 10% Glycerol, 10 mM β-mercaptoethanol, 10 μM 6− [[3- [1- (2-Chloro-5-fluorophenyl) cyclobutyl] -2-hydroxy-2-trifluoromethylpropionyl] amino] -4-methyl-2,3-benzoxazin-1-one, 10 mM imidazole-containing buffer Replaced with liquid. After adding 500 U of thrombin (Amersham Biosciences) to the solution after replacement, the thrombin cleavage site in the fusion protein was cleaved by placing it at 4 ° C. overnight. 5 ml of Ni-NTA Superflow (Amersham Bioscience) previously equilibrated with 25 ml of 50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 10% Glycerol, 10 mM DTT, 10 mM imidazole, By applying to a packed 16/20 column (Amersham Bioscience), the glucocorticoid receptor ligand-binding domain and ligand complex shown in FIG. 2 was recovered.
The collected complex was passed through a column of Hitrap Q HP 5 ml (Amersham Biosciences) equilibrated with 25 ml of 50 mM Tris-HCl, pH 8.0, 10% Glycerol, 10 mM DTT, and then Centricon YM10 (Amicon). To 14 mg / ml.
The concentrated glucocorticoid receptor ligand-binding domain is 50 mM Tris-HCl, pH 8.0, 10% Glycerol, 10 mM DTT, 10 μM 6-[[3- [1- [2-Chloro-5-fluorophenyl) cyclobutyl] -2 -hydroxy-2-trifluoromethylpropionyl] amino] -4-methyl-2,3-benzoxazin-1-one, 500 mM ammonium acetate, 100 μM TIF2 coactivator peptide (SEQ ID NO: 8) After dilution to volume, the dilution is concentrated and recovered using Microcon YM10 (Amicon) to obtain a complex consisting of a glucocorticoid receptor ligand-binding domain and a ligand, wherein TIF2 coactivator peptide is A purified product of the contained complex was obtained.

Example 3 (crystallization)
The purified product of the complex obtained in Example 2 was crystallized by the following operation based on the microbatch method.
The plate used was a 96-well plate (corning), and 40 μl of oil was added. The oil used was a mixture of silicone oil (HAMPTON RESERCH) and paraffin oil (HAMPTON RESERCH) at a ratio of 1: 1.
Under oil, 0.4 μl of various precipitants and 2.0 μl of the purified product of the complex obtained in Example 2 were mixed and used as a crystallization sample.
After about one month at 4 ° C., the glucocorticoid receptor ligand-binding domain and the ligand (6-[[3- [1- (2- Chloro-5-fluorophenyl) cyclobutyl] -2-hydroxy-2-trifluoromethylpropionyl] amino] -4-methyl-2,3-benzoxazin-1-one), which comprises a TIF2 coactivator peptide A plurality of crystals (that is, crystals of the present invention) containing the complex contained were obtained.

<Composition of precipitant>
Composition 1.8% (W / V) PEG 4000, 0.1 M ammonium acetate, 0.1 M HEPES (pH 7.5)
Composition 2.1M imidazole (pH 7.0)

A crystallization drop prepared by mixing 1: 1 the thus-prepared crystal of the present invention and a precipitant having the same composition as described above is prepared in 40 μl of oil having the same composition as described above. This produced a new crystallization drop at 20 ° C.
A plurality of the crystals of the present invention already prepared above were added as seed crystals to the produced crystallization drop. The crystals grew over time and grew to a measurable size after 7-10 days.
An example of the grown crystal of the present invention is shown in FIG. 2 (when the composition of the precipitant is composition 1) and FIG. 3 (when the composition of the precipitant is composition 2).

Example 4 (Data measurement)
The crystal of the present invention prepared in Example 3 was seeded with a HAMPTON RESERCH and allowed to penetrate into a reservoir solution to which 20% glycerol was added as a cryoprotectant for 1 to 3 seconds. And then quickly frozen with liquid nitrogen. The crystals of the present invention after quick freezing were stored in liquid nitrogen. The crystal of the present invention after storage was collected by the vibration method under XK nitrogen flow under X-ray diffraction intensity. Data measurement was performed using X-rays having a wavelength of 1.5418 angstroms. The detector was R-AXIS IV ++ (Rigaku), and an imaging plate having a diameter of 300 × 300 mm was used for the reading unit. The camera length was 200 mm and the exposure time was 15 minutes. The vibration angle was 1 degree. Crystal Clear 1.3 (Rigaku) was used for data processing and analysis. An X-ray diffraction photograph obtained from the crystal of the present invention is shown in FIG.
As a result of analyzing the measured data, the crystal of the present invention belongs to the space group I2 ₁ 2 ₁ 2 ₁ , the unit cell is a = 48.04 angstrom, b = 116.54 angstrom, c = 164.03. The crystal was found to be angstrom, α = β = γ = 90 °.

Example 5 (Three-dimensional structure refinement)
A molecular model is constructed using a progesterone receptor ligand binding domain, etc., and a molecular replacement program (AMORE et al. ((CCP4 (Collaborative Computational Project, Number4. Acta Crystallogr. D50, 670-673 (1994))) The initial structure is determined, and the three-dimensional structure is refined by QUANTA2000 version 00.1110 (Accelrys, Inc.) and CNX (Brunger, att. Et al., 1998).
At the ligand binding site of the glucocorticoid receptor ligand binding domain, 6-[[3- [1- (2-Chloro-5-fluorophenyl) cyclobutyl] -2-hydroxy-2-trifluoromethylpropionyl] amino] -4-methyl-2 , 3-benzoxazin-1-one can confirm the electron density map. 6-[[3- [1- (2-Chloro-5-fluorophenyl) cyclobutyl] -2-hydroxy-2-trifluoromethylpropionyl] amino] -4-methyl-2,3-benzoxazin-1-one on the electron density map Adapt.

The three-dimensional structure is further refined using QUANTA2000 version 00.1110 (Accelrys, Inc.) and CNX (Brunger, att. Et al., 1998), etc., and the atomic coordinates of the crystal of the present invention are determined.

  According to the present invention, a crystal containing a complex of a glucocorticoid receptor ligand binding domain and a ligand having a non-steroid skeleton can be provided. Furthermore, a method for identifying, searching, evaluating, or designing a glucocorticoid receptor mutant, agonist, antagonist, or the like can be provided by using the crystal and information obtained from the crystal.

FIG. 1 is an X-ray diffraction photograph obtained from the crystal of the present invention. FIG. 2 shows the glucocorticoid receptor ligand prepared when the composition of the precipitating agent is composition 1 (8% (W / V) PEG 4000, 0.1 M ammonium acetate, 0.1 M HEPES (pH 7.5)). Binding domain and ligand (6-[[3- [1- (2-Chloro-5-fluorophenyl) cyclobutyl] -2-hydroxy-2-trifluoromethylpropionyl] amino] -4-methyl-2,3-benzoxazin-1-one FIG. 2 is a diagram (photograph) showing a crystal (a crystal of the present invention) including a complex containing TIF2 coactivator peptide. FIG. 3 shows that the glucocorticoid receptor ligand-binding domain and the ligand (6-[[3- [1- (1- (1- (1-M-imidazole, pH7.0)) prepared in the case where the composition of the precipitant is composition 2 2-Chloro-5-fluorophenyl) cyclobutyl] -2-hydroxy-2-trifluoromethylpropionyl] amino] -4-methyl-2,3-benzoxazin-1-one), which is a TIF2 core activator It is a figure (photograph) which shows the crystal | crystallization (invention crystal | crystallization) containing the composite_body | complex containing a peptide.

SEQ ID NO: 4
Oligonucleotide primers designed for PCR
SEQ ID NO: 5
Oligonucleotide primers designed for PCR
SEQ ID NO: 6
Oligonucleotide primers designed for PCR
SEQ ID NO: 7
Oligonucleotide primers designed for PCR

Claims (18)

An orthorhombic crystal containing a complex of a glucocorticoid receptor ligand-binding domain and a ligand, the space group belongs to I2 ₁ 2 ₁ 2 ₁ , and the unit cell is a = 48.0 plus or minus 4.0 angstroms B = 116.5 plus / minus 4.0 angstroms, c = 164.0 plus / minus 4.0 angstroms, α = β = γ = 90 °. 2. The crystal according to claim 1, wherein the unit cell has a = 48.04 angstroms, b = 116.54 angstroms, c = 164.03 angstroms, and α = β = γ = 90 °. The crystal according to claim 1 or 2, wherein the ligand is a ligand having a non-steroid skeleton. The crystal according to claim 1 or 2, wherein the ligand is a ligand having a nonsteroidal skeleton and having agonist activity. The ligand is 6-[[3- [1- (2-Chloro-5-fluorophenyl) cyclobutyl] -2-hydroxy-2-trifluoromethylpropionyl] amino] -4-methyl-2,3-benzoxazin-1-one The crystal according to claim 1, wherein the crystal is present. 6. The crystal according to any one of claims 1 to 5, wherein the glucocorticoid receptor ligand binding domain is a glucocorticoid receptor ligand binding domain having the amino acid sequence represented by SEQ ID NO: 2. The crystal as described in any one of 1 to 5 above, wherein the resolution determined by X-ray crystal structure analysis is at least 2.8 angstroms. The glucocorticoid receptor ligand binding domain is Met560, Leu563, Asn564, Leu566, Gly567, Gln570, Trp600, Met601, Met604, Ala605, Ala607, Leu608, Arg611, Phe623, Met639, Gln642, Met646, Leu732, Typ735, Cys736, The crystal according to any one of claims 1 to 5, comprising a ligand binding pocket composed of amino acid residues including Thr739, Phe749, and Leu753. A protein having a glucocorticoid receptor ligand-binding domain, wherein the polypeptide three-dimensional structure state is a polypeptide three-dimensional structure state capable of binding a ligand and is in the polypeptide three-dimensional structure state The crystal space group belongs to I2 ₁ 2 ₁ 2 ₁ and the unit cell is a = 48.04 angstrom, b = 116.54 angstrom, c = 164.03 angstrom, α = β = γ = 90 °. A protein characterized by The protein according to claim 9, wherein the glucocorticoid receptor ligand binding domain is a glucocorticoid receptor ligand binding domain having the amino acid sequence represented by SEQ ID NO: 2. Use of the crystal according to any one of claims 1 to 5 for obtaining information relating to atomic coordinates of a crystal containing a complex of a glucocorticoid receptor ligand-binding domain and a ligand. The crystal of any one of claims 1-5 for deriving the three-dimensional structure of the complex based on the atomic coordinates of the crystal comprising the complex of a glucocorticoid receptor ligand binding domain and a ligand. use. The chemical interaction between the glucocorticoid receptor ligand-binding domain and the test substance is expressed by the atomic coordinates of the crystal according to any one of claims 1 to 5, or a three-dimensional structure derived based on the atomic coordinates. Use of a crystal according to any of claims 1 to 4 for evaluation as a reference. The use of the crystal according to claim 11, 12 or 13, wherein the glucocorticoid receptor ligand binding domain is a glucocorticoid receptor ligand binding domain having the amino acid sequence represented by SEQ ID NO: 2. A test substance is applied to the pocket for ligand binding having the atomic coordinates of the crystal according to any one of claims 1 to 5 or a three-dimensional structure derived based on the atomic coordinates, and conforms to the pocket A method for searching for a substance that can be an active ingredient of an agonist of a glucocorticoid receptor, comprising a step of selecting a test substance. A method of searching for a substance that can be an active ingredient of an agonist of a glucocorticoid receptor,
(1) The step of inputting the atomic coordinates of the crystal according to any one of claims 1 to 5 to the first storage means,
(2) a step in which atomic coordinates of the test substance are input to the second storage means;
(3) Binding to the ligand binding pocket by stably optimizing the spatial arrangement specified by the combination of the characteristics of the atomic group of the test substance and the distance of each atomic group based on the input atomic coordinates of both A method comprising the step of selecting a test substance to be performed by computer processing means. 17. A glucocorticoid receptor agonist comprising a substance selected by the search method according to claim 15 or 16 or a pharmaceutically acceptable salt thereof as an active ingredient. Means for inputting / accumulating / managing data information relating to the presence / absence or degree of chemical interaction of the substance selected by claim 15 or 16 or a pharmaceutically acceptable salt thereof; A system comprising: means for querying / retrieving data information based on conditions for obtaining a desired result; and means for displaying / outputting the queryed / retrieved result.

Images