JP2006180705A - Chimeric receptor and method for screening ligand or inhibitor for the receptor - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a chimeric receptor comprising an extracellular region derived from a membrane type guanylate cyclase and an intracellular region derived from a receptor other than the membrane type guanylate cyclase and to provide a method for screening a ligand and inhibitor of the membrane type guanylate cyclase by utilizing the receptor and to provide a substance obtained by the method. <P>SOLUTION: By constructing a human NPR-A/mouse G-CSFR chimeric receptor expression vector and transferring the vector into mouse Ba/F3 cells, a chimeric ANP receptor-expressing cell line highly sensitive to human ANP is successfully obtained. Use of the cell makes it possible to screen the ligand or the inhibitor for the chimeric receptor. <P>COPYRIGHT: (C)2006,JPO&NCIPI

Description

【図面の簡単な説明】
【図１】 ヒトNPR-A/マウスG-CSFRキメラ受容体の塩基配列（上段）及びアミノ酸配列（下段）を示したものである。ヒトNPR-Aアミノ酸配列は四角で囲み、マウスG-CSF受容体アミノ酸配列は何も付さずに示した。マウスG-CSF受容体の膜貫通領域を下線で示した。
【図２】 図２は、図１の続きの図である。
【図３】 図３は、NPRAGの、アゴニスト活性を示すグラフである。吸光度を縦軸に、ヒトANP濃度を横軸に示す。
【図４】 図４は、ヒトNPR-A／マウスG-CSFRキメラ受容体発現ベクターのベクターマップである。[0001]
BACKGROUND OF THE INVENTION
The present invention relates to a chimeric receptor and a screening method for a ligand or inhibitor of the receptor.
[0002]
[Prior art]
The natriuretic peptide family is composed of three types of natriuretic peptides, atrial natriuretic peptide (ANP), B-type natriuretic peptide (BNP), and C-type natriuretic peptide (CNP). It has a cyclic structure of residues.
[0003]
On the other hand, the natriuretic peptide receptor is composed of NPR-A, NPR-B, and NPR-C. NPR-A and NPR-B are membrane-type guanylate cyclases of type I membrane proteins, and the produced cGMP induces physiological actions of natriuretic peptides. NPR-A and NPR-B are widely distributed throughout the body, including the kidneys, blood vessels, adrenal glands, brain, lungs, intestinal tract, and heart. ANP / BNP mainly exhibits antihypertensive action by peripheral vasodilatory action and natriuretic action, renin-aldosterone secretion inhibition, and direct cardiac fibrosis inhibition through NPR-A. In NPR-A KO mice, significant cardiac hypertrophy and fibrosis with hypertension are observed, and sudden death frequently occurs (see Non-Patent Document 1). Therefore, the importance of the physiological function of signals through NPR-A is important. Phased up.
[0004]
The ligand of NPR-B is CNP, which mainly mediates its action as a vascular local hormone (suppression of vascular cell proliferation). Recently, a group of Kyoto University reported that NPR-B is important for cartilage formation (see Non-Patent Document 2).
[0005]
NPR-C has only 37 amino acid residues in the intracellular domain and does not show guanyl cyclase activity, but its binding affinity with ANP, BNP, and CNP is equivalent to that of NPR-A and NPR-B, so-called It is considered to exist as a clearance type receptor (more than 95% of natriuretic peptide receptors are NPR-C).
[0006]
NPR-A exists as a dimer (dimer) on the cell membrane, and conformational changes occur due to the binding of ANP / BNP to the extracellular domain. This change causes a change in the intracellular kinase homology domain (KHD) through the transmembrane domain and promotes the binding of ATP. This binding of ATP releases NPR-A by releasing suppression of guanyl cyclase activity (see Non-Patent Document 3). NPR-A is similar to the cytokine receptor in that the signal is transduced by oligomerization and conformational change of the receptor chain.
[0007]
As described above, ANP / BNP mainly exhibits NPR-A, which shows antihypertensive effect by peripheral vasodilatory effect and natriuretic effect, renin-aldosterone secretion inhibition, and direct cardiac fibrosis inhibition. These ligands are believed to be effective in treating heart failure. In addition, pulmonary hypertension is suppressed in ANP transgenic mice (see Non-Patent Document 4), and pulmonary hypertension is promoted in ANP knockout mice (see Non-Patent Document 5). Therefore, NPR-A ligand can be a therapeutic agent for pulmonary hypertension. I think that there is also a nature.
[0008]
Therefore, since the ligand of NPR-A can be a therapeutic agent for various diseases, a screening method for efficiently obtaining such a substance has been desired. However, a method for efficiently screening for a ligand of NPR-A has not been established.
[0009]
[Non-Patent Document 1]
Paula M. Oliver, Jennifer E. Fox, Ron Kim, Howard A. Rockman, Hyung-Suk Kim, Robert L. Reddick, Kailash N. Pandey, Sharon L. Milgram, Oliver Smithies, and Nobuyo Maeda., `` Hypertension, cardiac hypertrophy, and sudden death in mice lacking natriuretic peptide receptor A. '', PNAS, 1997, Vol. 94, p. 14730-14735.
[0010]
[Non-Patent Document 2]
Michio Suda, Yoshihiro Ogawa, Kiyoshi Tanaka, Naohisa Tamura, Akihiro Yasoda, Toshiya Takigawa, Masahiro Uehira, Hirofumi Nishimoto, Hiroshi Itoh, Yoshihiko Saito, Kohei Shiota, and Kazuwa Nakao. ``, PNAS, 1998, Vol. 95, p.2337-2342.
[0011]
[Non-Patent Document 3]
Lincoln R. Potter and Tony Hunter, `` Guanylyl Cyclase-linked Natriuretic Peptide Receptors: Structure and Regulation. '', J. Biol. Chem., 2001, Vol. 276, p. 6057-6060.
[0012]
[Non-Patent Document 4]
JR Klinger, RD Petit, LA Curtin, RR Warburton, DS Wrenn, ME Steinhelper, LJ Field, and NS Hill, `` Cardiopulmonary responses to chronic hypoxia in transgenic mice that overexpress ANP. '', J Appl Physiol, 1993, Vol. 75, p.198-205.
[0013]
[Non-Patent Document 5]
JR Klinger, RR Warburton, LA Pietras, R. Swift, S. John, and NS Hill, `` Exaggerated pulmonary hypertensive responses during chronic hypoxia in mice with gene-targeted reductions in atrial natriuretic peptide. '', Chest, 1998, Vol. .114, 79S-80S
[0014]
[Problems to be solved by the invention]
The present invention has been made in view of such a situation, and an object thereof includes an extracellular region derived from a membrane-type guanyl cyclase and an intracellular region derived from a receptor other than the membrane-type guanyl cyclase. It is to provide a chimeric receptor. It is another object of the present invention to provide a method for screening for ligands and inhibitors of membrane-type guanyl cyclase using the receptor, and a substance obtained by the method.
[0015]
[Means for Solving the Problems]
In order to solve the above-mentioned problems, the present inventors have conducted intensive research. The present inventors first produced a chimeric receptor comprising an extracellular region of natriuretic peptide, which is a membrane-type guanyl cyclase, and an intracellular region of mouse G-CSF. More specifically, after cloning of the human NPR-A (hNPR-A) gene by PCR, PCR is performed using the gene fragment as a template, and the extracellular region of hNPR-A and a part of the mouse G-CSF receptor are detected. The encoding gene fragment was obtained. Subsequently, the gene fragment was inserted into an expression vector having a gene sequence downstream from the transmembrane region of the mouse G-CSF receptor. The nucleotide sequence of the insert part of the plasmid was confirmed, and a human NPR-A / mouse G-CSFR chimeric receptor expression vector (pCV / hNPR-A-mGCSFR) was constructed.
[0016]
Next, the expression vector was linearized and introduced into mouse Ba / F3 cells by electroporation to attempt to establish a chimeric receptor-expressing cell line. A cell line that is sensitive to human ANP based on cell growth activity using cell viability as an index, after culturing electroporated cells in a medium supplemented with human ANP (atrial natriuretic peptide) as a ligand And succeeded in obtaining a chimeric ANP receptor-expressing cell line exhibiting ligand-dependent growth.
[0017]
The chimeric receptor provided by the present invention, and cells expressing the receptor are considered useful for screening for ligands or inhibitors of membrane-type guanyl cyclase, particularly natriuretic peptide receptor. The screening method using the natriuretic peptide receptor of the present invention was first developed by the present inventors.
[0018]
That is, the present invention relates to a chimeric receptor comprising a membrane type guanyl cyclase, for example, an extracellular region of a natriuretic peptide receptor and another receptor, for example, an intracellular region of G-CSF. In terms of
[1] A chimeric receptor comprising an extracellular region derived from membrane-type guanyl cyclase and an intracellular region derived from a receptor other than membrane-type guanyl cyclase,
[2] The chimeric receptor according to [1], wherein the membrane type guanyl cyclase is a natriuretic peptide receptor,
[3] The chimeric receptor according to [2], wherein the natriuretic peptide receptor is NPR-A,
[4] The chimeric receptor according to any one of [1] to [3], further comprising a transmembrane region,
[5] The chimeric receptor according to any one of [1] to [4], wherein the receptor other than membrane-type guanyl cyclase is a cytokine receptor,
[6] The chimeric receptor according to [5], wherein the cytokine receptor is a granulocyte colony-stimulating factor receptor,
[7] DNA encoding the chimeric receptor according to any one of [1] to [6],
[8] A vector containing the DNA according to [7],
[9] A cell containing the vector according to [8],
[10] A cell expressing the chimeric receptor according to any one of [1] to [6],
[11] A cell expressing the chimeric receptor according to [2] or [3], which exhibits natriuretic peptide-dependent growth,
[12] Receptor ligand screening method comprising the following steps:
(a) contacting the test substance with the chimeric receptor according to any one of [1] to [6],
(b) measuring physiological activity;
(c) a step of selecting a test substance that changes physiological activity compared to a case where the test substance is not contacted
[13] Receptor ligand screening method comprising the following steps:
(a) a step of bringing a test substance into contact with the cell according to any one of [9] to [11],
(b) measuring physiological activity;
(c) a step of selecting a test substance that changes physiological activity compared to a case where the test substance is not contacted
[14] A screening method for a receptor inhibitor comprising the following steps;
(a) contacting the test substance and a ligand of the chimeric receptor with the chimeric receptor according to any one of [1] to [6],
(b) measuring physiological activity;
(c) a step of selecting a test substance that changes physiological activity compared to a case where the test substance is not contacted
[15] A screening method for a receptor inhibitor comprising the following steps;
(a) contacting the test substance and a ligand of the chimeric receptor with the cell according to any one of [9] to [11],
(b) measuring physiological activity;
(c) a step of selecting a test substance that changes physiological activity compared to a case where the test substance is not contacted
[16] A substance isolated by the screening method according to any one of [12] to [15] is provided.
[0019]
DETAILED DESCRIPTION OF THE INVENTION
The present invention provides a chimeric receptor comprising an extracellular region derived from membrane-type guanyl cyclase and an intracellular region derived from a receptor other than membrane-type guanyl cyclase.
[0020]
The membrane-type guanyl cyclase used in the present invention is not particularly limited, and any membrane-type guanyl cyclase may be used, but is preferably a natriuretic peptide receptor. The natriuretic peptide receptor may be any of NPR-A, NPR-B, and NPR-C, but NPR-A is preferably used. The GenBank accession number of the hNPR-A sequence is NM_000906, hNPR-B is NM_000907, and hNPR-C is NM_000908. The hNPR-A sequence is described in Jill R Schoenfeld et al., Molecular Pharmacology, 47: 172-180 (1995). The natriuretic peptide may be any of atrial natriuretic peptide (ANP), B-type natriuretic peptide (BNP), and C-type natriuretic peptide (CNP). It may be a modified body that has been lost, inserted, added or the like.
[0021]
As the extracellular region of the receptor used in the chimeric receptor of the present invention, membrane-type guanyl cyclase, preferably the extracellular region of the natriuretic peptide receptor can be used. The extracellular region of the receptor may be the entire extracellular region or a part thereof, but it is preferable to use the entire extracellular region in that the physiological activity can be appropriately reflected. When a part of the extracellular region of the receptor is used, it may be a ligand binding site, or a partial sequence of 20 amino acids or more, preferably 50 amino acids or more, more preferably 100 amino acids or more in the region near the cell membrane may be used. it can. The extracellular region used for the chimeric receptor may be any partial structure / subsequence as long as it can induce a change in physiological activity when a ligand is bound to the chimeric receptor. There may be substitutions, deletions, insertions and additions of the constituent amino acids. As a method well known to those skilled in the art for preparing a protein functionally equivalent to a certain protein, a method of introducing a mutation into the protein is known. For example, those skilled in the art will recognize site-directed mutagenesis (Hashimoto-Gotoh, T. et al. (1995) Gene 152, 271-275, Zoller, MJ, and Smith, M. (1983) Methods Enzymol. 100 , 468-500, Kramer, W. et al. (1984) Nucleic Acids Res. 12, 9441-9456, Kramer W, and Fritz HJ (1987) Methods. Enzymol. 154, 350-367, Kunkel, TA (1985) Proc Natl Acad Sci US A. 82, 488-492, Kunkel (1988) Methods Enzymol. 85, 2763-2766) and the like.
[0022]
In such mutants, the number of amino acids to be mutated is usually within 50 amino acids, preferably within 30 amino acids, more preferably within 20 amino acids, still more preferably within 10 amino acids, still more preferably. Is considered to be within 5 amino acids, more preferably within 3 amino acids.
[0023]
The amino acid residue to be mutated is preferably mutated to another amino acid in which the properties of the amino acid side chain are conserved. For example, amino acid side chain properties include hydrophobic amino acids (A, I, L, M, F, P, W, Y, V), hydrophilic amino acids (R, D, N, C, E, Q, G, H, K, S, T), amino acids having aliphatic side chains (G, A, V, L, I, P), amino acids having hydroxyl group-containing side chains (S, T, Y), sulfur atom-containing side chains Amino acids with amino acids (C, M), amino acids with carboxylic acid and amide-containing side chains (D, N, E, Q), amino groups with base-containing side chains (R, K, H), aromatic-containing side chains (H, F, Y, W) can be mentioned (all parentheses indicate single letter amino acids).
[0024]
It is already known that a protein having an amino acid sequence modified by deletion, addition and / or substitution by another amino acid residue to one amino acid sequence maintains its biological activity. (Mark, DF et al., Proc. Natl. Acad. Sci. USA (1984) 81, 5662-5666, Zoller, MJ & Smith, M. Nucleic Acids Research (1982) 10, 6487-6500, Wang, A. et al., Science 224, 1431-1433, Dalbadie-McFarland, G. et al., Proc. Natl. Acad. Sci. USA (1982) 79, 6409-6413).
[0025]
The intracellular region of the chimeric receptor of the present invention is not particularly limited as long as it can induce a change in physiological activity when a ligand is bound to the chimeric receptor, and may be derived from any receptor. Specific examples of the receptor include a cell membrane receptor, a nuclear receptor, an intracellular receptor, and the like. Since the natriuretic peptide used as the extracellular region is a cell membrane receptor, it is preferable to use the intracellular region of the cell membrane receptor as the intracellular region. A cell membrane receptor is a receptor that is expressed on the surface of a cell membrane, and when a ligand binds to an extracellular region, a signal is transmitted into the cell to induce some physiological change. Further, when the intracellular region of the cell membrane receptor is used, it may be the entire intracellular region or a part thereof. When using a part of the intracellular region of the receptor, it is preferable to include a signal transduction region.
[0026]
Specific examples of receptors include hematopoietic factor receptor family, cytokine receptor family, tyrosine kinase type receptor family, serine / threonine kinase type receptor family, TNF receptor family, G protein coupled receptor family, Examples include receptors belonging to the receptor family such as GPI anchor type receptor family, tyrosine phosphatase type receptor family, adhesion factor family, hormone receptor family and the like.
[0027]
Numerous references exist regarding receptors belonging to these receptor families and their characteristics. For example, Cooke BA., King RJB., Van der Molen HJ. Ed. New Comprehesive Biochemistry Vol. 18B "Hormones and their Actions Part II "pp.1-46 (1988) Elsevier Science Publishers BV., New York, USA, Patthy L. (1990) Cell, 61: 13-14., Ullrich A., et al. (1990) Cell, 61: 203 -212., Massagul J. (1992) Cell, 69: 1067-1070., Miyajima A., et al. (1992) Annu. Rev. Immunol., 10: 295-331., Taga T. and Kishimoto T. (1992) FASEB J., 7: 3387-3396., Fantl WI., Et al. (1993) Annu. Rev. Biochem., 62: 453-481., Smith CA., et al. (1994) Cell, 76: 959-962., Flower DR. (1999) Biochim. Biophys. Acta, 1422: 207-234., Supervised by Masayuki Miyasaka, Cellular Engineering Handbook Series "Adhesion Factor Handbook" (1994) Shujunsha, Tokyo, Japan , Etc. Specific receptors belonging to the above receptor family include, for example, human or mouse erythropoietin (EPO) receptor, human or mouse granulocyte colony stimulating factor (G-CSF) receptor, human or mouse thrombopoietin (TPO). ) Receptor, human or mouse insulin receptor, human or mouse Flt-3 ligand receptor, human or mouse platelet derived growth factor (PDGF) receptor, human or mouse interferon (IFN) -α, β receptor, human or Mouse leptin receptor, human or mouse growth hormone (GH) receptor, human or mouse interleukin (IL) -10 receptor, human or mouse insulin-like growth factor (IGF) -I receptor, human or mouse leukemia inhibitory factor (LIF) receptor, human or mouse ciliary neurotrophic factor (CNTF) receptor, etc. can be exemplified, and these receptors are preferably used in the present invention. Rukoto can. The sequences of these receptors are known (hEPOR: Simon, S. et al. (1990) Blood 76, 31-35 .; mEPOR: D'Andrea, AD. Et al. (1989) Cell 57, 277- 285 .; hG-CSFR: Fukunaga, R. et al. (1990) Proc. Natl. Acad. Sci. USA. 87, 8702-8706 .; mG-CSFR: Fukunaga, R. et al. (1990) Cell 61 , 341-350 .; hTPOR: Vigon, I. et al. (1992) 89, 5640-5644 .; mTPOR: Skoda, RC. Et al. (1993) 12, 2645-2653 .; hInsR: Ullrich, A. et al. (1985) Nature 313, 756-761 .; hFlt-3: Small, D. et al. (1994) Proc. Natl. Acad. Sci. USA. 91, 459-463 .; hPDGFR: Gronwald, RGK Et al. (1988) Proc. Natl. Acad. Sci. USA. 85, 3435-3439 .; hIFNα / βR: Uze, G. et al. (1990) Cell 60, 225-234. And Novick, D. at al. (1994) Cell 77, 391-400.).
[0028]
A nuclear receptor is a receptor that binds to a specific DNA sequence by binding to a ligand and induces an increase or decrease in the transcriptional activity of mRNA. The steroid receptor family, retinoid X receptor family, etc. are used. be able to. The steroid receptor family includes glucocorticoid receptors, mineralocorticoid receptors, progesterone receptors, androgen receptors, estrogen receptors. The retinoid X receptor family includes retinoic acid receptors, thyroid hormone receptors, and vitamin D3 receptors. An intracellular receptor means a receptor that is present in a cell and binds to various ligands to induce physiological activity.
[0029]
As the intracellular region of the chimeric receptor of the present invention, it is preferable to use the intracellular region of the G-CSF receptor from the viewpoint that the structure and function are examined in detail, and in particular, the cell of the mouse G-CSF receptor. It is preferable to use the inner region. The mouse G-CSF receptor consists of 813 amino acids and is divided into an extracellular region and an intracellular region by a single transmembrane region (Fukunaga, R. Cell (1990) 61, 341-350). In addition, when the G-CSF receptor gene is expressed in myeloid progenitor cell line FDC-P1 and pro-B cell line Ba / F3 cell, the expressed G-CSF receptor transmits cell proliferation signal. It has also been shown that G-CSF-dependent growth activity is observed. Furthermore, it has been clarified that a region consisting of 76 amino acids in the intracellular region is essential for the transmission of proliferation signals (Fukunaga, R. EMBO J. (1991) 10, 2855-2865). Therefore, a chimeric receptor containing the 76 amino acids as a signal transduction region is prepared and expressed in Ba / F3 cells, whereby the detection index can be cell proliferation activity.
[0030]
In the human G-CSF receptor, deletion of the 716th and subsequent amino acids suppresses internalization of the receptor and increases the number of G-CSF receptors expressed on the cell surface. It has been shown that signaling efficiency upon stimulation is significantly enhanced (Melissa G., Blood (1999) 93, 440-446). The deletion region includes a region called Box3 containing a sequence assumed to be a motif necessary for internalization, while box1 and box2 necessary for signal transduction are conserved. Therefore, it is easy to increase the signal transduction efficiency when stimulating the G-CSF receptor by deleting the region that does not contain box2, but also contains box3 in the mouse G-CSF receptor. is expected.
[0031]
Further, the intracellular region of the chimeric receptor of the present invention has substitutions, deletions, insertions and additions of constituent amino acids as long as a change in physiological activity can be induced when a ligand is bound to the chimeric receptor. Also good. Amino acid substitutions, deletions, insertions and additions can be performed by the methods described above.
[0032]
The chimeric receptor of the present invention preferably contains a transmembrane region. The transmembrane region used for the chimeric receptor is not particularly limited, and may be derived from the receptor used for the extracellular region of the chimeric receptor or may be derived from the receptor used for the intracellular region. Further, it may be derived from a completely different cell membrane receptor. It is preferable to use the transmembrane region derived from the receptor used for the intracellular region as the transmembrane region of the chimeric receptor in that a plurality of chimeric receptors can be easily produced.
[0033]
DNA encoding the chimeric receptor of the present invention and a transcript RNA of the DNA are also included in the present invention. DNA encoding the chimeric receptor of the present invention can be prepared by methods known to those skilled in the art. For example, a cDNA library is prepared from a cell expressing a receptor used as an extracellular region, an intracellular region, or a transmembrane region in the present invention, and a part of a DNA sequence known in the target literature is used as a probe. By performing hybridization, DNA encoding an extracellular region, an intracellular region, or a transmembrane region can be prepared. It is possible to prepare the target chimeric receptor by binding each prepared DNA. The cDNA library may be prepared by the method described in, for example, Sambrook, J. et al., Molecular Cloning, Cold Spring Harbor Laboratory Press (1989), or a commercially available DNA library may be used. In addition, RNA is prepared from cells expressing the receptor, cDNA is synthesized by reverse transcriptase, oligo DNA is synthesized based on the target DNA sequence, and PCR reaction is performed using this as a primer. It is also possible to prepare by amplifying the cDNA encoding the receptor.
[0034]
The prepared DNA fragment of interest is ligated with vector DNA. Further, a recombinant vector is prepared from this, introduced into Escherichia coli, etc., and colonies are selected to prepare a desired recombinant vector. As the vector DNA for retaining the DNA fragment, known ones (eg, pUC19, pBluescript, etc.) can be used. Known Escherichia coli (eg, DH5α, JM109, etc.) can be used. The base sequence of the target DNA can be confirmed by a known method, for example, the dideoxynucleotide chain termination method (Sambrook, J. et al., Molecular Cloning, Cold Spring Harbor Laboratory Press (1989)). In the present invention, an automatic base sequence determination device (DNA Sequencer PRISM 377 or DNA Sequencer PRISM 310, Perkin-Elmer) or the like can be used.
[0035]
In addition, in the DNA of the present invention, a base sequence with higher expression efficiency can be designed in consideration of the codon usage of the host used for expression (Grantham, R. et al., Nucelic Acids Research (1981). ) 9, r43-74). Moreover, the DNA of the present invention can be modified by a commercially available kit or a known method. Examples of modifications include digestion with restriction enzymes, insertion of synthetic oligonucleotides and appropriate DNA fragments, addition of linkers, insertion of start codon (ATG) and / or stop codon (TAA, TGA, or TAG). .
[0036]
For the expression of a chimeric receptor, an expression vector containing DNA encoding the chimeric receptor is prepared under an expression control region such as an enhancer / promoter. A host cell is co-transformed with this expression vector to allow the cell to express the chimeric receptor.
[0037]
Conventional promoters useful for expression in mammalian cells can be used. For example, it is preferable to use human polypeptide chain elongation factor 1α (HEF-1α). Examples of expression vectors containing the HEF-1α promoter include pEF-BOS (Mizushima, S. et al. (1990) Nuc. Acid Res. 18, 5322). Other gene promoters that can be used for the present invention include viral promoters such as cytomegalovirus, retrovirus, polyoma virus, adenovirus, simian virus 40 (SV40), and promoters derived from mammalian cells. is there. For example, when the SV40 promoter is used, it can be easily carried out according to the method of Mulligan et al. (Nature (1990) 277, 108).
[0038]
For gene transfer into the host cell system, the expression vector is a selectable marker gene (eg, phosphotransferase APH (3 ') II or I (neo) gene, thymidine kinase gene, E. coli xanthine-guanine phosphoribosyltransferase (Ecogpt) gene) , Dihydrofolate reductase (DHFR) gene, etc.).
[0039]
For gene transfer, known methods such as calcium phosphate method (Chen, C. et al. (1987) Mol. Cell. Biol. 7, 2745-272), lipofection method (Felgner, PL. Et al. (1987) Proc. Natl. Acad. Sci. USA 84, 7413-), electroporation method (Potter, H. (1988) Anal. Biochem. 174, 361-373) and the like can be used. In the present invention, a gene introduction device (Gene Pulser, Bio-Rad) by electroporation can be used.
[0040]
The present invention also relates to a vector containing the DNA of the present invention and a cell containing the vector. The vector used in the present invention can be appropriately selected by those skilled in the art, and is not particularly limited.For example, pCOS1 (WO98 / 13388), pME18S (Med.immunol. 20: 27-32 (1990)), pEF-BOS ( Nucleic Acids Res. 18: 5322 (1990)), pCDM8 (Nature 329: 840-842 (1987), pRSVneo, pSV2-neo, pcDNAI / Amp (Invitrogen), pcDNAI, pAMoERC3Sc, pCDM8 (Nature 329: 840 (1987) ), PAGE107 (Cytotechnology 3: 133 (1990)), pREP4 (Invitrogen), pAGE103 (J. Biochem. 101: 1307 (1987)), pAMoA, pAS3-3, pCAGGS (Gene 108: 193-200 (1991)) PBK-CMV, pcDNA3.1 (Invirtogen), pZeoSV (Stratagene), etc. can be used.
[0041]
The present invention also relates to cells that express the chimeric receptor of the present invention. In a preferred embodiment of the cell, the cell contains the vector of the present invention and expresses the chimeric receptor of the present invention. The cell used in the present invention can be appropriately selected by those skilled in the art and is not particularly limited to animal cells, Escherichia coli, yeast and the like, but animal cells are preferred, and mammalian cells are particularly preferred. Specific examples of cells include BaF3, NFS60, FDCP-1, FDCP-2, CTLL-2, DA-1, KT-3, 32D and the like. If an example of the cell of this invention is shown, the cell which shows a natriuretic peptide dependence proliferation can be mentioned.
[0042]
Furthermore, the present invention provides a screening method for receptor ligands and receptor inhibitors.
[0043]
The screening method for a ligand or inhibitor of membrane-type guanyl cyclase, particularly a natriuretic peptide receptor, using the chimeric receptor of the present invention comprises contacting a test substance with the chimeric receptor of the present invention or the cell of the present invention. (Step (a)), the physiological activity is measured (Step (b)), and the test substance that changes the physiological activity is selected compared to the case where the test substance is not contacted (Step (c)). The “change” in the above step (c) usually means an increase (enhancement) or a decrease in physiological activity. Generally, a substance that increases (enhances) physiological activity is considered to be a ligand as compared with a case where a test substance is not contacted. On the other hand, a substance that decreases physiological activity is considered to be an inhibitory substance. By using the above method of the present invention, those skilled in the art can appropriately determine whether a test compound that changes physiological activity is a ligand or an inhibitor in consideration of the type of physiological activity used as an index. Is possible. In the step (a), although not particularly limited, usually, the chimeric receptor of the present invention is contacted with a test substance in a state expressed on the cell membrane.
[0044]
In the present invention, the physiological activity is an activity capable of causing a quantitative and / or qualitative change or influence on a living body, tissue, cell, protein, DNA, RNA or the like. Any physiological activity may be used in the screening method of the present invention. As the physiological activity, cytokine activity, enzyme activity, transcription activity, membrane transport activity, binding activity and the like can be used. Examples of the enzyme activity include proteolytic activity, phosphorylation / dephosphorylation activity, redox activity, transfer activity, nucleic acid degradation activity, and dehydration activity. The binding activity includes, for example, a reaction between an antigen and an antibody, binding and / or activation of cell adhesion factors.
[0045]
In the present invention, a detection index used for measuring a change in physiological activity can be used as long as a quantitative and / or qualitative change can be measured. For example, a cell-free (cell free assay) index, a cell-based (cell-based assay) index, a tissue-based index, or a biological index can be used. As an index of a cell-free system, enzymatic reaction and quantitative and / or qualitative changes of protein, DNA, and RNA can be used. As the enzyme reaction, for example, amino acid transfer reaction, sugar transfer reaction, dehydration reaction, dehydrogenation reaction, substrate cleavage reaction and the like can be used. Furthermore, protein phosphorylation, dephosphorylation, dimerization, multimerization, degradation, dissociation, and the like, DNA, RNA amplification, cleavage, and extension can be used. For example, phosphorylation of a protein existing downstream in the signal transduction pathway can be used as a detection index. As an indicator of the cell system, changes in cell phenotype, such as quantitative and / or qualitative changes of the produced substance, changes in proliferative activity, changes in morphology, changes in characteristics, etc. can be used. As production substances, secreted proteins, surface antigens, intracellular proteins, mRNA, and the like can be used. Changes in morphology include protrusion formation and / or change in number of protrusions, change in flatness, change in elongation / aspect ratio, change in cell size, change in internal structure, and deformity / uniformity as a cell population Changes in sex and cell density can be used. These morphological changes can be confirmed by observation under a microscope. As changes in properties, anchorage dependence, cytokine dependence responsiveness, hormone dependence, drug resistance, cell motility, cell migration activity, pulsatility, changes in intracellular substances, and the like can be used. Cell motility includes cell invasion activity and cell migration activity. Examples of changes in intracellular substances include enzyme activity, mRNA level, Ca ²⁺ The amount of intracellular signaling substances such as cAMP and the amount of intracellular proteins can be used. When a ligand for a cell membrane receptor is desired to be selected, a change in cell proliferation activity induced by receptor stimulation can be used as an index. As an index of the tissue system, a change in function according to the tissue used can be used as a detection index. Biological indicators include tissue weight changes, blood system changes such as blood cell number changes, protein content, enzyme activity, electrolysis mass changes, and circulatory system changes such as blood pressure and heart rate changes. Etc. can be used.
[0046]
There are no particular limitations on the method for measuring these detection indices, and light emission, color development, fluorescence, radioactivity, fluorescence polarization, surface plasmon resonance signal, time-resolved fluorescence, mass, absorption spectrum, light scattering, fluorescence resonance energy Movement or the like can be used. These measurement methods are well known to those skilled in the art, and can be appropriately selected according to the purpose. For example, the absorption spectrum can be measured with a commonly used photometer, plate reader, etc., emission can be measured with a luminometer, and fluorescence can be measured with a fluorometer. Mass can be measured using a mass spectrometer. Radioactivity is measured using a gamma counter or other measuring device according to the type of radiation, fluorescence polarization is measured by BEACON (Takara Shuzo), surface plasmon resonance signal is measured by BIACORE, time-resolved fluorescence, fluorescence resonance energy transfer is measured by ARVO, etc. it can. Furthermore, a flow cytometer or the like can also be used for measurement. These measurement methods may measure two or more types of detection indices with a single measurement method, and if simple, more detections can be made by measuring two or more types simultaneously and / or successively. It is also possible to measure an indicator. For example, fluorescence and fluorescence resonance energy transfer can be measured simultaneously with a fluorometer.
[0047]
In the present invention, a preferable detection index is a change in cell proliferation activity. Changes in cell proliferation activity can be measured using the MTT method or the tritium-labeled thymidine method. For example, using intracellular regions of G-CSF receptor, EPO receptor, EGF receptor, and TPO receptor, cell proliferation activity induced by stimulation of these receptors can be used as a detection index. For example, a chimeric receptor having an extracellular region of growth hormone receptor and an intracellular region of G-CSF receptor has been shown to induce growth hormone-dependent cell proliferation (Fuh, G. Science (1992) 256, 1677-1680).
[0048]
In addition, when measuring cell proliferation activity as a detection index, cell lines that die in the absence of a ligand are preferred for the purpose of increasing detection sensitivity, and in particular, cytokine-dependent cell lines in terms of easy passage. Is preferred. For example, CTLL-2 cells that are IL-2 dependent cell lines, 32D cells, FDC-P1 cells, and Ba / F3 cells that are IL-3 dependent cell lines can be used. These cell lines have a feature that cells are killed on the 2nd or 3rd day of the culture by removing cytokines necessary for growth such as IL-2 or IL-3 from the culture medium. It is preferable to use FDC-P1 cells or Ba / F3 cells in which a chimeric receptor having a mouse G-CSF receptor intracellular region is expressed.
[0049]
The cells can be processed and used for the purpose of improving the sensitivity of screening. Cell sensitivity can be enhanced by, for example, expressing the chimeric receptor gene using an appropriate expression control region and poly A addition signal so that the chimeric receptor is highly expressed, or removing the mRNA destabilization signal. For example, it is replaced with a stable one. Alternatively, a chimeric receptor gene in which the periphery of the start codon is modified with a Kozak consensus sequence (CCACC) can be used. Further, by combining with an appropriate selection marker, it is possible to easily obtain a high-expression cell line. For example, in dihydrofolate reductase (DHFR) deficient cell lines, by using DHFR as a selection marker, a method for obtaining a cell line that inhibits DHFR with methotrexate and highly expresses the target gene, or a thymidine lacking a promoter A method for efficiently selecting a cell line that highly expresses a target gene by using a kinase gene as a selection marker is known. In addition, it is possible to select a high-expressing cell line with a cell sorter using co-expression of a fluorescent antibody-labeled anti-receptor antibody or GFP (green fluorescence protein). Furthermore, a highly sensitive detection system can be obtained by improving the metabolic mechanism of the receptor. For example, in the mouse G-CSF receptor, it is known that a receptor lacking the C-terminus has a reduced uptake into cells and an increased expression level. In general, proteins having a high content of proline, glutamic acid, serine, and threonine are said to be rapidly decomposed, and it is possible to add mutations to amino acids so as to reduce such amino acid bias.
[0050]
When screening for an inhibitor of natriuretic peptide receptor, it is preferable to add a natriuretic peptide receptor ligand in addition to the test substance. That is, in this case, in the step (a), the test substance and the ligand of the chimeric receptor are brought into contact with the chimeric receptor of the present invention or the cell of the present invention. A known ligand can be used as the ligand to be added, and for example, ANP, BNP, CNP and the like can be used.
[0051]
In the present invention, the “ligand” means a substance having an activity of binding to a receptor and capable of inducing a physiological activity via the receptor. Among the ligands, a substance produced by the living body itself and having physiological activity in the living body is called a natural ligand.
[0052]
In the present invention, the “inhibitory substance” means a substance that inhibits a ligand from binding to a receptor and inducing physiological activity.
[0053]
As a test substance used in the method of the present invention, a desired substance whose physiological activity is to be detected can be used. Examples include cell extracts, cell culture supernatants, fermented microbial products, marine organism extracts, plant extracts, purified or crude proteins, peptides, non-peptidic compounds, synthetic low molecular compounds, natural compounds. However, it is not limited to these.
[0054]
The chimeric receptor of the present invention can also be applied to various known screening methods (for example, International Publication WO02 / 06838, Japanese Patent Application No. 2002-127260, etc.).
[0055]
The ligand or inhibitor isolated by the screening method of the present invention can be used as a medicament for the treatment or prevention of various diseases according to its physiological activity. For example, if it is a ligand, it will be useful for the treatment and prevention of chronic heart failure, pulmonary hypertension, hypertension, renal failure, chondrogenic failure and the like. Substances isolated by the screening method of the present invention are also included in the present invention.
[0056]
When these ligands and inhibitors are used as pharmaceuticals for humans and mammals such as mice, rats, guinea pigs, rabbits, chickens, cats, dogs, sheep, pigs, cows, monkeys, baboons, chimpanzees, they themselves In addition to administration to patients, it is also possible to formulate and administer by a known pharmaceutical method. For example, tablets, capsules, elixirs, microcapsules as required, or aseptic solutions or suspensions with water or other pharmaceutically acceptable liquids It can be used parenterally in the form of injections. For example, a pharmacologically acceptable carrier or medium, specifically, sterile water or physiological saline, vegetable oil, emulsifier, suspension, surfactant, stabilizer, flavoring agent, excipient, vehicle, preservative It is conceivable to prepare a pharmaceutical preparation by combining with a binder or the like as appropriate and mixing in a unit dosage form generally required for pharmaceutical practice. The amount of active ingredient in these preparations is such that an appropriate volume within the indicated range can be obtained.
[0057]
Additives that can be mixed into tablets and capsules include, for example, binders such as gelatin, corn starch, gum tragacanth and gum arabic, excipients such as crystalline cellulose, swelling agents such as corn starch, gelatin and alginic acid Lubricants such as magnesium stearate, sweeteners such as sucrose, lactose or saccharin, flavoring agents such as peppermint, red mono oil or cherry are used. When the dispensing unit form is a capsule, the above material can further contain a liquid carrier such as fats and oils. Sterile compositions for injection can be formulated according to normal pharmaceutical practice using a vehicle such as distilled water for injection.
[0058]
Aqueous solutions for injection include, for example, isotonic solutions containing physiological saline, glucose and other adjuvants such as D-sorbitol, D-mannose, D-mannitol and sodium chloride, and suitable solubilizers such as You may use together with alcohol, specifically ethanol, polyalcohol, for example, propylene glycol, polyethylene glycol, nonionic surfactant, for example, polysorbate 80 (TM), HCO-50.
[0059]
Examples of the oily liquid include sesame oil and soybean oil, which may be used in combination with benzyl benzoate or benzyl alcohol as a solubilizing agent. Moreover, you may mix | blend with buffer, for example, phosphate buffer, sodium acetate buffer, a soothing agent, for example, procaine hydrochloride, stabilizer, for example, benzyl alcohol, phenol, antioxidant. The prepared injection solution is usually filled into a suitable ampoule.
[0060]
For example, intraarterial injection, intravenous injection, subcutaneous injection, etc., as well as intranasal, transbronchial, intramuscular, transdermal, or oral administration to a patient are performed by methods known to those skilled in the art. sell. The dose varies depending on the weight and age of the patient, the administration method, etc., but those skilled in the art can appropriately select an appropriate dose.
[0061]
The dose varies depending on symptoms, but in the case of oral administration, generally for adults (with a body weight of 60 kg), about 0.1 to 500 mg per day, preferably about 1.0 to 100 mg, more preferably about 1.0 to It is considered to be 20mg.
[0062]
When administered parenterally, the single dose varies depending on the administration subject, target organ, symptom, administration method, etc. For example, in the form of an injection, it is usually 1 for an adult (with a body weight of 60 kg). It may be convenient to administer about 0.01 to 30 mg per day, preferably about 0.1 to 20 mg, more preferably about 0.1 to 10 mg by intravenous injection. In the case of other animals, an amount converted per 60 kg body weight or an amount converted per body surface area can be administered.
[0063]
【Example】
EXAMPLES The present invention will be specifically described below with reference to examples, but the present invention is not limited to these examples.
[0064]
[Reference Example] Preparation of pCV vector
The expression plasmid vector pCV was constructed by replacing the poly (A) addition signal of pCOS1 (see International Patent Publication No. WO98 / 13388 “Antibody against human parathormone related peptides”) with that derived from human G-CSF. pEF-BOS (Mizushima S. et al. (1990) Nuc. Acid. Res., 18, 5322) was cleaved with Eco RI and Xba I to obtain a poly (A) added signal fragment derived from human G-CSF. . This fragment was inserted into pBacPAK8 (CLONTECH) at the Eco RI / Xba I site. After cutting with Eco RI, both ends were smoothed and digested with Bam HI. As a result, a fragment containing a poly (A) addition signal derived from human G-CSF in which a Bam HI site was added to the 5 ′ end and the 3 ′ end was blunted was obtained. This fragment and the poly (A) addition signal part of pCOS1 were replaced with the Bam HI / Eco RV site, which was designated as pCV.
[0065]
[Example 1] Preparation of human NPR-A / mouse G-CSFR chimeric receptor expression vector
The following primers using human kidney cDNA (Marathon ready cDNA, CLONTECH) as a template
hNPR-5 ': ATGCGCCCCGCTGGCTCCCGCC (SEQ ID NO: 3)
hNPR-3 ': CAGGGAGCCGTAATTGGAGCCTC (SEQ ID NO: 4)
PCR was performed using hNPR-A gene (amino acids 1 to 539).
Next, using this gene fragment as a template, the following primers:
hNPR-5'-NotI: TTGCGGCCGCCACCATGCGCCCCGCTGGCTCCCG (SEQ ID NO: 5)
hNPR-3'-BglII: GCAACCAAGATCACCTTTCCACCGATCCATCTGACTTAAACATTTTCCTGGAGATCTGGT (SEQ ID NO: 6)
PCR was performed, and the extracellular region of hNPR-A (amino acids 1-467) and the downstream region immediately before the transmembrane region of mouse G-CSF receptor (amino acids 598-812 (Fukunaga, R. et al., (1990) Cell, 61, 341-350)) were ligated to prepare human NPR-A / mouse G-CSFR chimeric receptor cDNA. This was inserted downstream of the HEF1a promoter of the expression plasmid vector pCV to construct a human NPR-A / mouse G-CSFR chimeric receptor expression vector.
The protein expressed by this expression vector, that is, the base sequence and amino acid sequence of human NPR-A / mouse G-CSFR chimeric receptor are shown in FIG. 1, and the vector map of human NPR-A / mouse G-CSFR chimeric receptor expression vector Is shown in FIG. 4 (vector map). Further, the base sequence of human NPR-A / mouse G-CSFR chimeric receptor is shown in SEQ ID NO: 1, and the amino acid sequence thereof is shown in SEQ ID NO: 2, respectively.
[0066]
[Example 2] Establishment of a chimeric receptor-expressing cell line
The linearized expression gene vector was introduced into mouse Ba / F3 cells (purchased from RIKEN: Cell No. RCB0805) using an electroporation apparatus (Gene Pulser: Bio Rad). After washing Ba / F3 cells twice with Dulbecco's PBS (hereinafter referred to as PBS), approximately 1 × 10 × in PBS ⁷ Suspended to a cell density of cells / mL. 10 μg of linearized expression vector DNA was added to 0.8 mL of this suspension, and transferred to a gene pulser cuvette (Bio Rad, 0.4 cm, Cat No. 165-2088). Pulses were applied using a Gene Pulser (Bio Rad) with a capacitance of 0.33 kV and 960 μF.
[0067]
After standing at room temperature for about 10 minutes, electroporation-treated cells are suspended in medium A containing 0.2 ng / mL mouse IL-3, resulting in 100 μL / well in a 96-well microwell flat bottom plate (Falcon) Sowing. CO ₂ Incubator (CO ₂ Concentrate: 5%) for about 24 hours and add 3x10 ^-9 Add 100 μL / well of medium A containing mol / L human ANP (1000 for hump injection, Zeria Shinyaku Kogyo), CO ₂ Incubator (CO ₂ Concentration: 5%). As the medium A, RPMI1640 medium (GIBCO) containing 10% fetal bovine serum (HyClone, Cat No. SH30071.03, Lot No. AKE11829) and penicillin 100 units / mL and streptomycin 0.1 mg / mL (GIBCO) was used. Microscopically after about 1 week from the start of culture, collect cells from single colony holes, 3x10 ^-8 mol / L or 3x10 ^-9 Subcultured in medium A containing mol / L human ANP. Subculture is performed twice or three times a week with a cell density of 1x10 ⁶ Do not exceed cells / mL. After washing the cells twice with medium B, 5 × 10 ^Four Suspended in medium B to a cell density of cells / mL. Medium B uses RPMI1640 medium containing CHO-S-SFMII medium (GIBCO), RPMI1640 medium containing 10% fetal bovine serum, or 10% fetal bovine dialysis serum (HyClone, Cat No. SH30079, Lot No. ALA13106) It was. Dilute human ANP appropriately with medium B, dispense 25 μL / well of cell suspension and 25 μL / well of diluted human ANP into a 96-well microwell flat bottom half area plate (Costar) ₂ Incubator (CO ₂ The cells were cultured for 3 days at a concentration of 5%. After incubation, add 10 μL / well of WST-8 reagent (Cell Counting Kit-8: Dojindo Laboratories) ₂ Incubator (CO ₂ (Concentration: 5%) was incubated for 2 hours, and absorbance at a measurement wavelength of 450 nm and a control wavelength of 655 nm was measured using an absorption microplate reader (Sunrise classic: Wako). Select a cell line that is sensitive to human ANP based on cell growth activity with the absorbance after 2 hours on the vertical axis and the human ANP concentration on the horizontal axis and the number of living cells as an index. The somatic cell line NPRAG was used (FIG. 3).
[0068]
【The invention's effect】
According to the present invention, a chimeric receptor comprising an extracellular region derived from membrane-type guanyl cyclase and an intracellular region derived from a receptor other than membrane-type guanyl cyclase is provided. By utilizing the receptor, it becomes possible to screen for a ligand or an inhibitor of membrane-type guanyl cyclase, particularly a natriuretic peptide receptor, and the substance is expected to be a therapeutic agent for various diseases. .
[0069]
[Sequence Listing]

[Brief description of the drawings]
FIG. 1 shows the nucleotide sequence (upper) and amino acid sequence (lower) of human NPR-A / mouse G-CSFR chimeric receptor. The human NPR-A amino acid sequence is boxed and the mouse G-CSF receptor amino acid sequence is shown without any label. The transmembrane region of mouse G-CSF receptor is underlined.
FIG. 2 is a continuation of FIG.
FIG. 3 is a graph showing the agonist activity of NPRAG. Absorbance is plotted on the vertical axis and human ANP concentration is plotted on the horizontal axis.
FIG. 4 is a vector map of human NPR-A / mouse G-CSFR chimeric receptor expression vector.

Claims (16)

  A chimeric receptor comprising an extracellular region derived from membrane-type guanyl cyclase and an intracellular region derived from a receptor other than membrane-type guanyl cyclase.   The chimeric receptor according to claim 1, wherein the membrane-type guanyl cyclase is a natriuretic peptide receptor.   The chimeric receptor according to claim 2, wherein the natriuretic peptide receptor is NPR-A.   The chimeric receptor according to claim 1, further comprising a transmembrane region.   The chimeric receptor according to any one of claims 1 to 4, wherein the receptor other than membrane-type guanyl cyclase is a cytokine receptor.   The chimeric receptor according to claim 5, wherein the cytokine receptor is a granulocyte colony stimulating factor receptor.   DNA encoding the chimeric receptor according to any one of claims 1 to 6.   A vector containing the DNA according to claim 7.   A cell containing the vector according to claim 8.   A cell expressing the chimeric receptor according to any one of claims 1 to 6.   A cell expressing the chimeric receptor according to claim 2 or 3, which exhibits natriuretic peptide-dependent growth. A receptor screening method comprising the following steps.
(a) contacting the test substance with the chimeric receptor according to any one of claims 1 to 6;
(b) measuring physiological activity;
(c) a step of selecting a test substance that changes physiological activity compared to a case where the test substance is not contacted A receptor screening method comprising the following steps.
(a) contacting the test substance with the cell according to any one of claims 9 to 11,
(b) measuring physiological activity;
(c) a step of selecting a test substance that changes physiological activity compared to a case where the test substance is not contacted A method for screening a receptor inhibitor comprising the following steps.
(a) contacting the test substance and a ligand of the chimeric receptor with the chimeric receptor according to any one of claims 1 to 6;
(b) measuring physiological activity;
(c) a step of selecting a test substance that changes physiological activity compared to a case where the test substance is not contacted A method for screening a receptor inhibitor comprising the following steps.
(a) contacting the cell according to any one of claims 9 to 11 with a test substance and a ligand of the chimeric receptor;
(b) measuring physiological activity;
(c) a step of selecting a test substance that changes physiological activity compared to a case where the test substance is not contacted   A substance isolated by the screening method according to claim 12.

Images