JP2006141347A - METHOD FOR DETERMINING NUCLEIC ACID BASE SEQUENCE USING RecA PROTEIN DERIVED FROM HIGHLY THERMOPHILIC BACTERIUM AND KIT FOR DETERMINING THE NUCLEIC ACID BASE SEQUENCE - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for accurately and efficiently determining a nucleic acid base sequence, capable of improving elongation properties of DNA polymerase reaction, even in cycle sequence reaction in which an elongation temperature is high and a heat denaturation process is repeated, and further capable of increasing base sequence specificity of a primer to a target nucleic acid. <P>SOLUTION: This method for determining the nucleic acid base sequence comprises determining the base sequence of the target nucleic acid by conducting the cycle sequence reaction in the presence of a RecA protein derived from a highly thermophilic bacterium. <P>COPYRIGHT: (C)2006,JPO&NCIPI

Description

  The present invention relates to a nucleobase sequencing method and a nucleobase sequencing kit, and in particular, a nucleobase that determines a nucleic acid base sequence by performing a cycle sequence reaction in the presence of a RecA protein derived from an extreme thermophile. The present invention relates to a sequencing method and a nucleobase sequencing kit.

Nucleic acid base sequencing is a very important technique in genome analysis and genetic diagnosis represented by today's human genome project.
A dideoxy method developed by Sanger et al. Is a method for determining the base sequence of nucleic acids. Such a method is representative of the current base sequencing method because of the ease of operation and high reproducibility. The dideoxy method is used by stopping the complementary strand synthesis reaction by DNA polymerase by incorporation of dideoxynucleotide triphosphate (hereinafter sometimes abbreviated as “ddNTP”). Specifically, complementary strand synthesis by DNA polymerase using a target nucleic acid (hereinafter sometimes abbreviated as “target nucleic acid”) as a template, and a primer complementary to the target nucleic acid. I do. At this time, if a small amount of ddNTP is added as a substrate analog, synthesis of the complementary strand stops at the position where ddNTP is incorporated. The reaction is carried out using ddNTP corresponding to each of the four types of bases, and the sequence is read by separating the products according to their chain lengths.

  In the sequencing reaction based on the dideoxy method, it has been reported that a certain kind of nucleic acid binding protein is effective in inhibiting the reaction caused by the problem of the target nucleic acid serving as a template (for example, Non-Patent Documents 1 and 2, See 3, 4 and 5.) Examples of such proteins include single-stranded DNA-binding proteins (hereinafter sometimes abbreviated as “SSB”), T4 gene 32 protein, E. coli-derived RecA protein (hereinafter sometimes abbreviated as “RecA”), and the like. There is. This report is further explained below. During the sequence reaction, when the template nucleic acid is double-stranded DNA, it must be denatured into single-stranded DNA. At this time, the protein binds to denatured single-stranded DNA, so that recombination between single-stranded DNAs is suppressed, and secondary structures that occur frequently in single-stranded DNA are eliminated. As a result, the extensibility of the DNA polymerase reaction in the sequence reaction is improved. In addition, a methodology for DNA analysis using RecA derived from Escherichia coli has been reported (see, for example, Patent Documents 4 and 5).

  In recent years, as an application of the dideoxy method, a cycle sequencing method using a polymerase chain reaction (hereinafter sometimes abbreviated as “PCR”) has been developed. This method has made it possible to sequence even a small amount of target nucleic acid. Furthermore, direct sequencing of the PCR product, which is not suitable by the dideoxy method such as Sanger, is possible, so-called direct sequencing. At present, it is established as a large-scale, quick and safe sequencing method in combination with an automatic sequencer. The cycle sequence method is based on the principle that the dideoxy method reaction is repeatedly performed by a thermal cycler. Specifically, heat denaturation of template nucleic acid, primer annealing, extension reaction with heat-resistant polymerase and reaction stop with ddNTP are defined as one cycle, and this is repeated for about 30 cycles. As a result, various sequence reaction products are synthesized, and their base sequences are determined by analyzing them.

Kowalozykowski S.C. et al., The Enzymes, 3rd edition, Academic press, 1981, New York, 14, 373 Quin Chou et al., Minimizing deletion mutagenesis artifact during Taq DNA polymerase PCR by E.coli SSB. Nucleic Acids Research, 1992 , Volume 20, Number 16, Page 4371 K. Schwarz et al., An improved double stranded DNA sequencing method using gene 32 protein., Nucleic Acids Res. Nucleic Acids Res., 1990 February, Vol. 18, No. 4, pp. 1079 Rigas B, Welcher AA, Ward DC, Weissman SM. Rapid plasmid library screening using RecA-coated biotinylated probes. (Proc Natl Acad Sci, USA, 1986) December, volume 83, number 24, pages 9951-9595 Honigberg SM, Rao BJ, Radding CM, Ability of RecA protein to promote a search for rare sequences in duplex DNA., Proc Natl Acad Sci US A. December 1986, 83, 24, 9586-9590

  However, since the cycle sequence reaction uses the principle of PCR, the extension reaction temperature is high, and the heat denaturation step is repeated, so that the above-described protein cannot be applied to the cycle sequence reaction. This is because during PCR, these proteins lose their biological functions due to thermal denaturation. Such denaturation occurs while bound to the template DNA. As a result, there is a problem that a strong higher-order structure is formed in the template DNA and the reaction of the DNA polymerase in the sequence reaction is inhibited. Furthermore, none of the above proteins is effective in improving the base sequence specificity to the target nucleic acid that serves as a primer template, and the effect is not recognized for direct sequencing using any primer. There was also a point.

  Therefore, the present invention can improve the elongation of the DNA polymerase reaction even in a cycle sequence reaction in which the elongation reaction temperature is high and repeats the heat denaturation step, and further improves the base sequence specificity of the primer to the target nucleic acid. An object of the present invention is to provide an accurate and efficient nucleic acid sequencing method that can be used.

  As a result of diligent research to solve the above problems, the present inventors have found that when the cycle sequence reaction is performed in the presence of RecA derived from an extreme thermophile, the extendibility of the DNA polymerase reaction can be improved. It was. Furthermore, the knowledge that the base reading mistake by DNA polymerase can also be improved was acquired, and it came to complete this invention based on these knowledge.

That is, in order to achieve the above object, the present invention provides a nucleobase sequencing method for determining the base sequence of a target nucleic acid by carrying out a cycle sequence reaction in the presence of a RecA protein derived from an extreme thermophile.
The target nucleic acid is an amplification product, and it is preferable to perform a sequence reaction directly after amplification.
In addition, it is preferably carried out when the target nucleic acid has a zone of inhibitory or inhibitory secondary structure.
Further preferably, the RecA protein is derived from Thermus thermophilus .

In order to achieve the above object, the present invention provides a nucleobase sequencing kit for cycle sequencing. The nucleobase sequencing kit of the present invention comprises four types of deoxynucleotide triphosphates corresponding to each of thermostable DNA polymerase, adenine, thymine, guanine and cytosine, four types corresponding to each of adenine, thymine, guanine and cytosine And a RecA protein from a hyperthermophilic bacterium.
Preferably, the RecA protein is derived from Thermus thermophilus .

  By performing a cycle sequence reaction in the presence of RecA derived from an extreme thermophile, it became possible to improve the overall efficiency of the reaction. That is, since RecA derived from highly thermophilic bacteria is heat resistant, its activity can be stably maintained without being denatured even during a cycle sequence reaction in which high temperature conditions are repeated. Thereby, the base sequence specificity of the binding of the primer to the target nucleic acid is improved, and it can be suitably used for a direct sequence using an arbitrary primer. Moreover, it was possible to suppress the generation of a higher-order structure of the primer and the target nucleic acid in a single-stranded state, and as a result, it became possible to improve the extensibility of the DNA polymerase. In addition, errors in reading bases by DNA polymerase are reduced, and accurate sequencing of the base sequence becomes possible by improving the efficiency of the cycle sequence reaction.

  Hereinafter, specific embodiments of the present invention will be described. However, these are merely examples of the present invention, and do not limit the present invention.

  In the present invention, the base sequence of a nucleic acid is determined by carrying out a cycle sequence reaction in the presence of RecA derived from an extreme thermophile.

  Here, the cycle sequence method will be described. The circle sequence method is a nucleic acid base sequencing technique that combines the dideoxy method and PCR. Typically, a target nucleic acid to be sequenced as a template, one kind of primer, deoxynucleotide triphosphate (hereinafter sometimes abbreviated as “dNTP”) and a termination nucleotide ddNTP are added to the reaction system, Then heat resistant polymerase is added. The reaction is carried out by repeating the reaction with one cycle consisting of heat denaturation of template nucleic acid, primer annealing, and extension reaction as appropriate. At this time, ddNTP is an analog of dNTP in which the —OH group at the 3 ′ position of deoxyribose is an —H group. Therefore, when ddNTP is incorporated during PCR, extension of the complementary strand is stopped. As a result, a nucleic acid having the same base at the 3 ′ end is synthesized. Since ddNTP incorporation occurs randomly, nucleic acids with various chain lengths are synthesized. By separating these sequence products, the base sequence of the target nucleic acid is determined.

  The reaction solution used for the base sequence determination method of the present invention contains a target nucleic acid, a thermostable DNA polymerase, one kind of primer DNA, dNTP, a terminating nucleotide, and an appropriate buffer in the presence of RecA derived from an extreme thermophile. It is prepared with.

Here, RecA is a protein that binds cooperatively to a single-stranded nucleic acid, searches for a homologous region between the single-stranded nucleic acid and double-stranded diffusion, and performs homologous recombination of the nucleic acid. RecA used in the present invention is a highly thermophilic bacterium-derived protein. The RecA suitable for use in the present invention, Thermus (Thermus) genus Thermococcus (Thermococcus) genus Pyrococcus (Pyrococcus) genus Thermotoga (Thermotoga) RecA derived from the genus, and the like. Specifically, RecA derived from Thermus thermophilus and Thermusaquaticus is preferably exemplified. Particularly preferred is RecA derived from Thermus thermophilus (hereinafter sometimes abbreviated as T.th.RecA).

  These RecAs include RecA synthesized chemically or genetically engineered, as well as RecA derived from nature. Specifically, those extracted from highly thermophilic bacteria can be used according to a conventional method. Furthermore, it can be easily purified using a known host / expression vector system such as Escherichia coli. For example, Escherichia coli as a host is transformed with an expression vector into which a gene encoding the RecA is introduced by a known method and cultured to express the RecA. Then, E. coli-derived proteins other than the RecA are thermally denatured and thermally aggregated by crushing the host E. coli and heat treatment, and thus can be separated and removed by centrifugation or the like. Thus, the RecA that is not heat-denatured can be separated from the E. coli-derived protein as a soluble fraction and purified using affinity chromatography or the like.

  At this time, since RecA is derived from a highly thermophilic bacterium, its structure is stable at room temperature, and it has high stability against organic solvents. Therefore, the purification step can be performed at room temperature.

The host cell is not limited to E. coli, and eukaryotic cells such as yeast ( Saccharomyces cerevisiae ) and insects ( Sf9 cells) can be used. Moreover, the expression vector includes a sequence such as a promoter sequence and a multicloning site having at least one restriction enzyme site into which a gene encoding RecA of hyperthermophilic bacteria can be inserted, and can be expressed in the host cell. Any expression vector can be used. As a suitable promoter, for example, the T7lac promoter is preferably used.

  Furthermore, this expression vector may contain other known base sequences. Other known base sequences are not particularly limited. For example, a stability leader sequence that confers stability of the expression product, a signal sequence that confers secretion of the expression product, and a neomycin resistance gene, kanamycin resistance gene, chloramphenicol resistance gene, ampicillin resistance gene, hygromycin resistance gene Marking sequences that can confer phenotypic selection in transformed hosts such as As such an expression vector, a commercially available expression vector for Escherichia coli (for example, pET protein expression system: manufactured by Novagen) can be used. Furthermore, an expression vector incorporating a desired sequence can be prepared and used as appropriate.

  Further, it includes a protein having a structure similar to RecA as described above and functionally equivalent. Therefore, it is intended to include RecA-like proteins existing in nature, as well as proteins modified by artificial mutagenesis or genetic recombination. For example, in the amino acid sequence of the above-mentioned naturally-occurring RecA, a variant having an amino acid sequence in which one or several amino acids are substituted, deleted, or added, and having the biological function equivalent to that of the above-mentioned RecA Can be included. The number of mutations in the amino acid sequence is not limited as long as the biological function of the original protein is maintained.

  Here, the modification to the amino acid sequence may be artificially performed on the amino acid sequence to be modified using a known mutation manipulation means such as a site-specific mutagenesis method (Nucleic Acid Res. 10, pp6487, 1982). it can. Furthermore, the modified substance produced by the variation | mutation of the amino acid in nature is also included.

  The target nucleic acid to be sequenced in the present invention is not limited in its origin, length, base sequence and the like. Moreover, any nucleic acid may be used regardless of single-stranded, double-stranded, circular or linear. Specifically, it may be a genomic DNA of an organism, or a fragment obtained by cleaving the genomic DNA by physical means or restriction enzyme digestion. Furthermore, it can be suitably used for DNA fragments inserted into plasmids, phages and the like. Furthermore, it may be prepared or isolated from a sample that may contain a nucleic acid. In addition, artificial DNA fragments such as DNA fragments synthesized using an automatic DNA synthesizer or the like commonly used in the technical field, cDNA fragments synthesized using mRNA as a template, DNA fragments amplified by amplification techniques such as PCR, etc. Any product or the like can be a target nucleic acid. In particular, the method of the present invention can be suitably applied to a direct sequencing method for directly determining the base sequence of an amplification product. Further, the amplification product may be purified by an appropriate purification method and then subjected to a sequencing reaction, and such purification can be performed by a known means. For example, such purification can be performed using a commercially available kit such as QIAquick PCR Purification Kit (manufactured by QIAGEN).

  Here, the direct sequencing method means that a nucleic acid fragment amplified by PCR or the like is used as a template without cloning into a vector and a nucleic acid base sequence is determined.

Furthermore, the method of the present invention can be suitably used for amplification of a nucleic acid having an area that forms a secondary structure in which amplification of the nucleic acid is prevented or suppressed when general PCR is performed.
For example, a template nucleic acid having a high GC content or a template nucleic acid having a short repetitive sequence can be used. These became higher-order structures when they became single-stranded by heat denaturation, and became an inhibitory factor during nucleic acid amplification. According to the method of the present invention, RecA binds to a template nucleic acid, so that such a higher-order structure can be solved and the base sequence of the template nucleic acid can be determined efficiently.

  The primer preferably has an arbitrary base sequence complementary to the sequence of the specific portion of the target nucleic acid. Those having appropriate complementarity with the sequence immediately 5 'to the target position where the nucleic acid sequence is to be determined can be suitably used. For example, when the target nucleic acid is in a state of being subcloned into a vector, known primers such as M13 Universal, Reverse primer, T7, and T3 primer can be used. Further, when the target nucleic acid is a PCR product, a primer on one side used in PCR can be used.

  As the primer, a chemical synthesis method based on the phosphoramidite method or the like, or a restriction enzyme fragment or the like when a target nucleic acid has already been obtained can be used. When preparing a primer based on a chemical synthesis method, it is designed based on the sequence information of the target nucleic acid prior to synthesis. After synthesis, the primer is purified by means such as HPLC. Moreover, when performing chemical synthesis, it is also possible to use a commercially available automatic synthesizer. Here, the term “complementary” means that the primer and the target nucleic acid can specifically bind according to the base pairing rule to form a stable duplex structure. Thus, not only perfect complementarity, but also a portion where only a few nucleobases fit along the base-pairing rule as long as the primer and target nucleic acid are sufficient to form a stable duplex structure with each other. Even the perfect complementarity is acceptable. The number of bases must be long enough to specifically recognize the target nucleic acid, but if it is too long, a non-specific reaction is induced, which is not preferable. Accordingly, an appropriate length is determined depending on many factors such as target nucleic acid sequence information such as GC content, and hybridization reaction conditions such as reaction temperature and salt concentration in the reaction solution. 15-30 bases.

Here, the DNA polymerase used is not particularly limited as long as it is a heat-resistant DNA polymerase that can be used in a cycle sequence reaction. For example, Taq polymerase derived from Thermus aquaticus and T. aeruginosa derived from Thermus thermophilus . th. Polymerase, DNA polymerase derived from thermophilic bacteria such as Bst polymerase derived from Bacillus Stearothermophilus , Vent DNA polymerase derived from Thermococcus litoralis, Pfu derived from Pyrococcus furiosus ( Pyrococcusfuriosus ) Examples include DNA polymerases derived from thermophilic archaea such as polymerase.

  As dNTP, four types of dNTP corresponding to each base of adenine, thymine, guanine and cytosine are used. In particular, a mixture of dGTP, dATP, dTTP, and dCTP is preferably used. Furthermore, dNTPs as used herein may also include derivatives of deoxynucleotides, so long as they can be incorporated by a thermostable DNA polymerase into a DNA molecule synthesized and extended by a cycle sequencing reaction. Examples of such derivatives include 7-deaza-dGTP, 7-deaza-dATP, and the like. For example, they can be used instead of dGTP and dATP, or both can be used together. Therefore, the use of any derivative is not excluded as long as four types corresponding to each base of adenine, thymine, guanine and cytosine necessary for nucleic acid synthesis are included.

  As the termination nucleotides, four types of termination nucleotides corresponding to the bases of adenine, thymine, guanine and cytosine are used. And it is typically ddNTP. As ddNTP, ddGTP, ddATP, ddTTP, and ddCTP are particularly preferably used, but are not limited thereto. It is therefore possible to use other terminating nucleotides that can be incorporated by thermostable DNA polymerase into DNA molecules synthesized and extended in a cycle sequence reaction, while stopping the subsequent polymerization reaction. Examples of such nucleotides include 3 ′ amino nucleotides. Therefore, the use of any derivative is not excluded as long as there are four types corresponding to each base of adenine, thymine, guanine and cytosine necessary for nucleic acid synthesis.

The buffer solution is generally prepared containing an appropriate buffer component and a magnesium salt. As the buffer component, phosphates such as trisacetic acid, trishydrochloric acid, sodium phosphate, and calcium phosphate can be suitably used, and the use of trisacetic acid is particularly preferable. The final concentration of the buffer component is in the range of 5 mM to 100 mM and is prepared in the range of pH 6.0 to 9.5. Further, the magnesium salt is not particularly limited, but magnesium chloride, magnesium acetate and the like can be appropriately used, and magnesium acetate is particularly preferable. Furthermore, potassium salts such as KCl, DMSO, glycerol, betaine, gelatin, Triton and the like can be added as necessary. Further, a buffer solution attached to a commercially available thermostable DNA polymerase for cycle sequence can be used. The composition of the buffer can be appropriately changed according to the type of DNA polymerase used. In particular, it can be set appropriately in consideration of the effects of ionic strength such as MgCl ₂ and KCl, various additives that affect the melting temperature of DNA such as DMSO and glycerol, and their concentrations.

  The reaction solution is preferably prepared in a volume of 100 μl or less, particularly in the range of 10 to 50 μl. As the concentration of each component, RecA is preferably used so as to be contained in the reaction solution at a concentration of 0.004 to 0.02 μg / μl. The concentration of each component other than RecA can be appropriately set by those skilled in the art since the cycle sequence reaction is known. For example, the target nucleic acid is preferably prepared at a concentration of 10 pg to 1 μg per 100 μl, and the primer DNA is preferably prepared at a final concentration of 0.01 to 10 μM, particularly 0.1 to 1 μM. Furthermore, the DNA polymerase is preferably used at a concentration ranging from 0.1 to 50 Units, in particular from 1 to 5 Units per 100 μl. Then, dNTP is preferably prepared at a final concentration of 0.1 mM to 1 M, and ddNTP is preferably prepared at a concentration of 1 to 5 μM. And it is preferable to use ddNTP in the ratio of 100: 1 to 1000: 1 with respect to dNTP. The magnesium salt is preferably prepared in a final concentration of 0.1 to 50 mM, particularly 1 to 5 mM.

  The primer, dNTP, or ddNTP is preferably labeled with a labeling substance for detection. The cycle sequencing method is roughly classified into a primer labeling method using a labeled primer, an internal labeling method using a labeled dNTP, and a terminator labeling method using a labeled ddNTP depending on the labeling target. The method of the present invention can be applied to any of the above.

Here, as the labeling substance used for labeling, any known substance can be used as long as the primer, dNTP, and ddNTP can maintain the stability and functionality required in the cycle sequence reaction. Specifically, a radioisotope element, a fluorescent dye, or an organic compound such as digoxigenin or biotin can be used. Of these, the use of fluorescent dyes is particularly preferred, but is not limited thereto. Examples of suitable radioisotopes include, but are not limited to, ³² P, ³⁵ S, ¹³¹ I, ⁴⁵ Ca, ³ H, and the like. Suitable fluorescent dyes include fluorescein isothiocyanate (FITC), tetramethylrhodamine (TAMRA), tetramethylrhodamine isothiocyanate (TRICA), Texas Red, 4 ′, 5′-dichloro-2 ′, 7′-dimethoxy. Examples include cyanine dyes such as fluorescein (JOE), 4-fluoro-7-nitrobenzofurazone (NBD-F), cyanine 3 (Cy3) and cyanine 5 (Cy5), but are not limited thereto. Absent. Further, the position at which the label is introduced is not particularly limited as long as it does not inhibit the primer extension reaction by dNTP incorporation and the termination of extension by ddNTP in the cycle sequence reaction.

In the case of labeling a primer, those labeled with a 5 ′ end and / or a base in the chain are preferably used. The labeled primer can be prepared according to a conventional method. Examples thereof include a method of incorporating a labeled nucleotide to which the labeling substance has been added during a nucleotide extension reaction. Furthermore, a method of introducing a labeling substance enzymatically or chemically after the nucleotide extension reaction may be used. Specifically, when a radioisotope element is used as a labeling substance, for example, the phosphate group at the 5 ′ end is removed with alkaline phosphatase, and γ-phosphate of [γ- ³² P] ATP is removed with polynucleotide kinase. This can be done by transferring the group to the 5 'end of the oligonucleotide chain. In addition, when a fluorescent substance is used as the labeling substance, it can be performed by coupling the fluorescent substance directly to the 5 ′ end of the oligonucleotide on a DNA synthesizer using a fluorescent amidite. Furthermore, commercially available nucleic acid labeling kits such as 5'oligolabelling kit for the FluorImager (manufactured by Amersham) can also be used.

  In the case of labeling dNTP or ddNTP, the OH group of the 5 ′ phosphate part, the OH group of the base, and the amino group are preferable. The labeled primer can be prepared according to a conventional method. For example, the labeling substance can be more covalently bound to the nucleotide via a spacer. As an example, a spacer such as a thioester group can be introduced into nucleotides, and a fluorescent label molecule having reactivity can be bound to the spacer (in this case, -SH group). For labeled dNTP, ddNTP, etc., commercially available labeled nucleotides can be used. Furthermore, a sequencing kit such as BigDye Terminator Cycle Sequencing Kit V3.1 (Applied Biosystems Japan) can be used.

  When the terminator labeling method is performed, it is preferable to use fluorescent dyes having different emission wavelengths for each of the four types of bases. By using ddNTPs labeled with fluorescent dyes having different emission wavelengths for each base in this way, sequence products that emit four types of different fluorescence depending on the type of base at the 3 ′ end can be obtained. When this is separated by electrophoresis, one DNA sequence can be analyzed by one lane electrophoresis, and as a result, a large amount of sequence analysis can be performed at once. DdNTP can also be labeled with the same dye for all bases. In this case, a sample obtained by separately performing a synthesis reaction for each different base from the same template can be migrated in four different lanes, and the base sequence can be determined based on the relative position.

The nucleic acid base sequence determination method of the present invention is carried out according to the following steps.
(1) Thermal denaturation of template nucleic acid (2) Primer annealing (3) Extension reaction with thermostable polymerase, and
Termination of extension reaction by ddNTP (4) Determination of base sequence

  By repeating the above-mentioned reactions (1) to (3) as one cycle and repeating appropriate cycles, sequence reaction products of various chain lengths are synthesized. The number of thermocycles is determined according to the type, amount and purity of the template nucleic acid, and is preferably about 20 to 40 cycles.

Each step will be described in detail below.
(1) Thermal denaturation of template nucleic acid Double-stranded nucleic acid is denatured by heating and dissociated into single strands. Preferably, it is carried out at 92 to 98 ° C. for 10 to 60 seconds. When a long DNA such as genomic DNA is used as a template nucleic acid, only the first heat denaturation can be set longer (about 10 minutes) in order to completely denature the template nucleic acid.

(2) Primer annealing By reducing the temperature, the template nucleic acid that has been heat denatured and becomes a single strand in (1) above and a primer are formed. Annealing is preferably performed for 30 to 60 seconds. The annealing temperature is preferably estimated from the Tm of the oligonucleotide used for the primer, and this Tm is set as the annealing temperature. Usually, it is carried out at 50 to 70 ° C.

(3) Termination of extension reaction by thermostable polymerase and extension reaction by ddNTP The extension reaction of the nucleic acid chain from the primer is performed at the 3 ′ end by the thermostable polymerase. This nucleic acid elongation reaction stops at that base when ddNTPs are randomly incorporated. Thereby, sequence reaction products of various lengths are obtained. The temperature is appropriately set according to the type of heat-resistant polymerase, but is preferably 65 to 75 ° C. Further, when the target sequence is 1 kb or less, about 1 minute is sufficient for the extension time, and when it is longer, the extension time is preferably increased at a rate of 1 minute per 1 kb.

(4) Determination of base sequence The sequence reaction product after the thermocycle reaction in the above steps (1) to (3) is separated, and the nucleic acid sequence is read. Separation of sequence reaction products can be appropriately performed by a method that can be separated according to the molecular weights of a plurality of reaction products having different molecular weights. At this time, it is preferable to have the separation ability divided by the difference of one base. Examples of such separation means include electrophoresis. In addition, HPLC or the like can also be used. In the case of separation by electrophoresis, the conditions for electrophoresis are not particularly limited, and can be performed according to a conventional method such as acrylamide electrophoresis. The nucleic acid sequence can be read from a band (nucleic acid ladder) obtained by subjecting the reaction product to electrophoresis.

  Reading of the nucleic acid ladder can be performed by detecting the label of the sequence reaction product. The detection can be performed by a known method according to the type of the labeling substance. For example, in the case of labeling with a radioactive substance, it can be performed by detecting radioactivity. After electrophoresis, the X-ray film is exposed to autoradiography and analyzed by an image analyzer. . In addition, in the case of labeling with a fluorescent dye, it can be read by detecting luminescence, and a method of detecting and analyzing a fluorescent signal emitted from a dye molecule excited by irradiating a laser beam with a fluorescence detector is exemplified. . Furthermore, it can carry out using the apparatus etc. which are used for a commercially available DNA sequence suitably. As such a device, ABI PRISM 377 (manufactured by Applied Biosystems Japan) or the like can be suitably used.

  By configuring the nucleic acid base sequence determination method of the present invention as described above, it is possible to determine the nucleic acid base sequence efficiently and accurately. That is, since RecA derived from highly thermophilic bacteria is heat resistant, it is stable even during a cycle sequence reaction in which a denaturation reaction under high temperature conditions is repeated, and can retain its biological function. And, by performing cycle sequencing reaction in the presence of RecA derived from highly thermophilic bacteria, it is possible to suppress the generation of higher order structures of the primer and target nucleic acid in a single-stranded state, thereby improving the elongation of DNA polymerase To do. Furthermore, the base sequence specificity of the binding of the primer to the target nucleic acid is improved by the action of RecA derived from hyperthermophilic bacteria. Therefore, the efficiency of the sequence reaction can be improved. In particular, when an arbitrary primer such as a direct sequence is used, the effect is remarkably recognized. In addition, base reading errors by DNA polymerase are reduced, and more accurate base sequence decoding is possible. That is, generally, the ladder signal intensity at the 5 ′ end, which is the end side in the reading direction, is low, and it is often difficult to decode the base sequence. However, according to the method of the present invention, a clear ladder signal and a decoded base sequence can be obtained over the entire sequence region, so that efficient and accurate determination of the base sequence can be achieved.

  The present invention also provides a nucleobase sequencing kit for cycle sequencing. The nucleobase sequencing kit of the present invention comprises DNA polymerase, dNTP, highly thermophilic bacterium-derived RecA, and termination nucleotide. Furthermore, it may be configured by appropriately containing components necessary for the activity of DNA polymerase, such as an appropriate buffer and magnesium salt. Moreover, you may include the arbitrary primer for the cycle sequence reaction of a target nucleic acid, etc. At this time, the primer, dNTP or terminating nucleotide is preferably labeled with an appropriate labeling substance for detection. In this way, a simple and rapid cycle sequence reaction can be performed by configuring the components necessary for determining the base sequence as a kit.

  EXAMPLES The present invention will be specifically described below with reference to examples, but the present invention is not limited to these examples.

Example 1: By cycle sequence reaction in the presence of RecA derived from extreme thermophile
Improvement of ladder signal of nucleic acid base sequence-1
An experiment was performed to compare the conventional method with the ability to improve the ladder signal of the nucleotide sequence of a nucleic acid by carrying out a cycle sequence reaction in the presence of RecA derived from an extreme thermophile.

(Method)
Step 1: PCR amplification of template DNA PCR amplification reaction was carried out using primer 1 and primer 2 using human genomic DNA (Promega, Human genomic DNA catalog number G3041) as a template. The composition of the PCR reaction solution is 1 × so that each primer has a final concentration of 0.6 μM, 20 ng of template DNA, 0.63 Unit of Ex-Taq DNA polymerase (Takara-Bio), and a final concentration of 200 μM of dNTP mixture. A total of 25 μl of PCR reaction solution was prepared by mixing with DNA Polymerase buffer. The above reaction solution was subjected to an amplification reaction of 35 cycles with 98 ° C., 10 seconds, 55 ° C., 30 seconds, 72 ° C., and 60 seconds as one cycle, followed by a final extension reaction at 72 ° C. for 3 minutes in one cycle. The amplification reaction was terminated. The amplified reaction solution was purified using QIAquick PCR Purification Kit (manufactured by QIAGEN), and the purified amplification product was dissolved in 20 μl Mili-Q water.

Step 2: Cycle sequence reaction Using 1 μl of the DNA solution obtained in Step 1 as template DNA and Primer 1, 0.2 μg of T.P. th. A cycle sequence reaction was performed in the presence of RecA. T. T. et al. th. RecA is written by Masui R, Mikawa T, Kato R, Kuramitsu S., Characterization of the oligomeric states of RecA protein: monomeric RecA protein can form a nucleoprotein filament., Biochemistry. October 20, 1998, Vol. 37, Vol. No. 42, pages 14788 to 14797, and those prepared by the inventors of the present invention were used. The cycle sequencing reaction was performed using BigDye Terminator Cycle Sequencing Kit V3.1 (Applied Biosystems Japan) according to the manufacturer's instructions. Half of the reaction solution after the reaction was subjected to base sequence determination. The nucleotide sequence was determined using a DNA fluorescence sequencer (ABI PRISM 377: manufactured by Applied Biosystems Japan). The result is shown in FIG.

  Further, in accordance with the same procedure, the results of using primers 3 and 4 in place of primer 1 and 2 in step 1 and using primer 3 in place of primer 1 in step 2 are shown in lane 4.

  As a control, in step 2, T.M. th. A cycle sequence reaction was performed without adding RecA. At this time, the results of using primers 1 and 2 in step 1 and using primer 2 in step 2 are shown in lane 1 of FIG. In addition, the results of using primers 3 and 4 in step 1 and using primer 3 in step 2 are shown in lane 2 of FIG.

Here, the base sequences of the primers used are as follows.
Primer 1:
5'- GACTACTCTAGCGACTGTCCATCTC -3 '(sequence recognition number 1)
Human S100 protein beta-subUnit gene
GenBank ACCESSION No. M59486 J05600
Primer 2:
5'- GACAGCCACCAGATCCAATC -3 '(sequence recognition number 2)
Human S100 protein beta-subUnit gene
GenBank ACCESSION No. M59486 J05600
Primer 3:
5'-TTTTCGAGGCCCTGTAATTGG -3 '(sequence recognition number 3)
Human 18S rRNA gene
GenBank ACCESSION No. M10098
Primer 4:
5'- AACAAAATAGAACCGCGGTC -3 '(sequence recognition number 4)
Human 18S rRNA gene
GenBank ACCESSION No. M10098

(result)
The fluorescent ladder signal obtained by the above experiment is shown in FIG. Each lane is as follows: Lane 1... th. The result of using primers 1 and 2 in step 1 and adding primer 2 in step 2 without adding RecA is shown. (Control)
Lane 2... th. The result of using primers 3 and 4 in step 1 and adding primer 3 in step 2 without adding RecA is shown.
Lane 3... th. The results of using RecA and using primer 1 and 2 in step 1 and primer 2 in step 2 are shown.
Lane 4... th. The results of using RecA and using primers 3 and 4 in step 1 and primer 3 in step 2 are shown.
The above experiment was repeated 6 times, and similar results were obtained in all cases.

T. T. et al. th. When the reaction was carried out with RecA added, T.P. th. Compared with the case where the reaction was carried out without adding RecA (control), clear ladder signals were confirmed (lane 3 and lane 1, lane 4 and lane 2). That is, T.W. th. Ladder signal intensity was improved by adding RecA to the cycle sequencing reaction. In particular, a remarkable difference was observed in the definition of the ladder signal at the end in the reading direction.
From the above results, T.W. th. It has been found that the addition of Rec protein improves the overall efficiency of the cycle sequencing reaction. This is because T.W. th. Since the Rec protein is heat resistant, it means that its activity is stably maintained without being denatured even during a cycle sequence reaction in which high temperature conditions are repeated. As a result, T.W. th. It is understood that the base sequence specificity of the binding of the primer to the target nucleic acid is improved by the function of RecA. In addition, it is understood that the generation of higher order structures of the primer and the target nucleic acid at the same time in a single-stranded state can be suppressed, and the extensibility of DNA polymerase is improved. Further, it is understood that the base reading error by the DNA polymerase is reduced and more accurate base sequence decoding is possible. In general, the ladder signal intensity at the 5 ′ end, which is the end side in the reading direction, is low, and it is often difficult to decode the base sequence. Therefore, in the control, a decrease in the ladder signal intensity was observed on the terminal side, but the strength suitable for the analysis was maintained on the terminal side by addition of RecA. From this, it was found that the method of the present invention can achieve efficient and accurate determination of the base sequence.

Example 2: By cycle sequence reaction in the presence of RecA derived from extreme thermophile
Improvement of nucleic acid base sequence analysis (method)
The effect on the signal resolution was confirmed by decoding the nucleotide sequence from the fluorescent ladder signals of the nucleotide sequences of FIG. 1 lane 1 and lane 3 obtained in Example 1.

(result)
The decoding image of the base sequence of the ladder signal obtained by the above experiment is shown in FIG.
FIG. 2A shows a decoded image when the base sequence is decoded from the fluorescent ladder signal of the base sequence in lane 1 of FIG. That is, T.W. th. The results when cycle sequencing was performed without adding RecA are shown (control).
FIG. 2B shows a decoded image when the base sequence is decoded from the fluorescent ladder signal of the base sequence in lane 3 of FIG. That is, T.W. th. The result at the time of performing a cycle sequence reaction by adding RecA is shown.

T. T. et al. th. When the reaction was carried out with RecA added, T.P. th. Compared with the case where the reaction was carried out without adding RecA (control), an improvement in the degree of decoding was confirmed (comparison between FIG. 2 (B) and FIG. 2 (A)). In particular, the difference was remarkably observed at the 5 ′ end, which is the end side in the reading direction. That is, T.M. th. By adding RecA to the cycle sequence reaction, the degree of decoding of the base sequence is improved.
From the above results, T.W. th. It has been found that the addition of the Rec protein improves the efficiency of the entire sequencing reaction, which in turn improves the accuracy of base sequence decoding.

Example 3: Effect of various DNA binding proteins on cycle sequencing reaction
Examination of the effect of various DNA-binding proteins on the cycle sequence reaction. Here, the examined proteins are as follows.
-RecA derived from E. coli
・ T. th. RecA
・ SSB derived from E. coli
・ T4 gene 32 protein

(Method)
The following experiment was performed by comparing the decoded images of the fluorescence ladder signal of the base sequence in the presence of the protein according to the procedures of Examples 1 and 2. Specifically, template DNA was amplified using primers 1 and 2 in Step 1 of Example 1. After amplification, a cycle sequence reaction was performed using primer 1 in Step 2 of Example 1 in the presence of 0.2 μg of each protein. The base sequence of the fluorescent ladder obtained according to the procedure of Step 2 of Example 1 was decoded according to the procedure of Example 2.

(result)
The decoded image of the ladder signal obtained by the above experiment is shown in FIG.
FIG. 3A shows a decoded image when the base sequence is determined without adding a protein in Step 2 (control). This figure is the same as FIG.
FIG. th. The decoding image in the case where the base sequence is determined by adding RecA is shown. This figure is the same as FIG.
FIG. 3C shows a decoded image when the base sequence is determined by adding RecA derived from E. coli in Step 2.
Here, although not shown, when the reaction was performed by adding SSB derived from E. coli or T4gene 32 protein, a DNA ladder could not be obtained and the base sequence could not be decoded.
The above experiment was repeated 6 times, and similar results were obtained in all cases.

T. T. et al. th. When RecA was added and the reaction was performed, a clear decoded image was confirmed as compared to the case where the reaction was performed without adding any protein (control) (FIG. 3B and FIG. 3). Comparison with A)). This result confirms the result obtained in Examples 1 and 2. In addition, it was confirmed that when the reaction was performed with E. coli-derived RecA added, the degree of decoding was lower than when the reaction was performed without adding any protein (control) (FIG. 3). Comparison between (C) and FIG. 3 (A)). As described above, when the reaction was carried out by adding E. coli-derived SSB or T4gene 32 protein, a DNA ladder could not be obtained and the base sequence could not be decoded. That is, T.W. th. By adding RecA to the cycle sequence reaction, the degree of decoding of the base sequence is improved. However, the addition of other proteins does not show such an improvement in the degree of decoding, but also inhibits the progression of the sequence reaction.
From the above results, T.W. th. The addition of the Rec protein improves the efficiency of the entire sequencing reaction, and thus the accuracy of base sequence decoding, but it has been found that such an effect cannot be found in other proteins. This is because T.W. th. It is considered that proteins other than RecA are caused by denaturing and inhibiting the DNA polymerase reaction during a cycle sequence reaction that repeats high-temperature conditions.

Example 4: By cycle sequence reaction in the presence of RecA derived from extreme thermophile
Improvement of Nucleotide Nucleotide Sequence Decoding Image An experiment was carried out in comparison with the conventional method that the decoding sequence of a nucleic acid base sequence can be improved by performing a cycle sequence reaction in the presence of RecA derived from an extreme thermophile. Here, the effect was confirmed using a nucleic acid having a chain length different from that of the target nucleic acid examined in Examples 1 to 3.

(Method)
Step 1: PCR amplification of template DNA PCR amplification reaction was performed using primer 5 and primer 6 using PhiX174 RF I DNA (Takara-Bio, phiX174 RF I DNA catalog number 3040) as a template. The composition of the PCR reaction solution was as follows: each primer at a final concentration of 0.6 μM, 5 ng of template DNA, 0.63 Unit of Ex-Taq DNA polymerase (manufactured by Takara-Bio), a final concentration of 200 μM of dNTP mixture, 0.4 μg of T . th. A total of 25 μl of a PCR reaction solution was prepared by mixing with 1 × DNA Polymerase BUFFER so as to contain RecA. After performing 35 cycles of amplification reaction with the above reaction solution at 94 ° C., 10 seconds, 55 ° C., 30 seconds, 70 ° C., 5 minutes as one cycle, the final extension reaction at 70 ° C. for 3 minutes in one cycle The amplification reaction was terminated. The amplified reaction solution was purified using QIAquick PCR Purification Kit (manufactured by QIAGEN), and the purified amplification product was dissolved in 20 μl Mili-Q water.

Step 2: Cycle sequence reaction Using 2 μl of the DNA solution obtained in Step 1 as a template DNA, a primer 5 was used to perform a cycle sequence reaction in the presence of 0.2 μg of RecA. The cycle sequencing reaction was performed using BigDye Terminator Cycle Sequencing Kit V3.1 (Applied Biosystems Japan) according to the manufacturer's instructions. Half of the reaction solution after the reaction was subjected to base sequence determination. The nucleotide sequence was determined using a DNA fluorescence sequencer (ABI PRISM 377: manufactured by Applied Biosystems Japan).

  As a control, in step 2, T.M. th. A cycle sequence reaction was performed without adding RecA.

Here, the base sequences of the primers used are as follows.
Primer 5:
5'- CCTTGCTATTGACTCTACTGTAGAC -3 '(sequence recognition number 5)
Coliphage phi-X174, complete genome
GenBank ACCESSION No. J02482
M10348 M10379 M10714 M10749 M10750 M10866 M10867 M24859 V0112
Primer 6:
5'- CCTAACGACGTTTGGTCAGTTCCAT -3 '(sequence recognition number 6)
Coliphage phi-X174, complete genome
GenBank ACCESSION No. J02482
M10348 M10379 M10714 M10749 M10750 M10866 M10867 M24859 V0112

(result)
The decoded image of the ladder signal obtained by the above experiment is shown in FIGS.
FIG. th. A decoded image in the case where the base sequence was determined without adding RecA is shown (control).
FIG. th. The decoding image in the case where the base sequence is determined by adding RecA is shown.
The above experiment was repeated 6 times, and similar results were obtained in all cases.

T. T. et al. th. When the reaction was carried out with RecA added, T.P. th. Compared with the case where the reaction was carried out without adding RecA (control), an improvement in the degree of decoding was confirmed (comparison between FIG. 5 and FIG. 4). In particular, the difference was remarkably observed at the 5 ′ end, which is the end side in the reading direction. Since the target nucleic acid used here was longer than that used in Examples 1 and 2, the analytical degree of the target nucleic acid was significantly reduced particularly in the terminal side (FIG. 4). On the other hand, T.W. th. In the presence of RecA, good resolution was maintained over the entire sequence (FIG. 5). That is, T.W. th. By adding RecA to the cycle sequence reaction, the degree of decoding of the base sequence is improved.
From the above results, T.W. th. It was found that the addition of RecA protein improves the overall efficiency of the cycle sequencing reaction. T. T. et al. th. The function of RecA improves the base sequence specificity of the binding of the primer to the target nucleic acid, and also suppresses the formation of higher order structures of the primer and the target nucleic acid, thereby improving the stretchability of the DNA polymerase. Is understood. Further, it is understood that the base reading error by the DNA polymerase is reduced and more accurate base sequence decoding is possible. And it turned out that this effect is not influenced by the chain length, origin, etc. of the target nucleic acid to be sequenced, and can be suitably used for sequencing of any nucleic acid.

  The present invention relates to a nucleic acid base sequencing method and base sequencing kit useful in molecular biology, medical field, food field and the like.

A nucleic acid ladder showing the results of Example 1 in which it was confirmed that the ladder signal of the nucleotide sequence of the nucleic acid can be improved by performing a cycle sequence reaction in the presence of RecA derived from an extreme thermophile The base sequence decoding image showing the result of Example 2 in which the base sequence of the nucleic acid ladder of FIG. 1 was decoded Nucleotide sequence decoding image showing the result of Example 3 in which the influence of various DNA binding proteins on the cycle sequence reaction was examined. T.A. th. Nucleotide sequence decoding image (control) showing the result of Example 4 in which comparison of the conventional method was confirmed that the decipherment of the nucleotide sequence of the nucleic acid can be improved by performing a cycle sequence reaction in the presence of RecA. T.A. th. Nucleotide sequence decoding image (+ T.th.RecA) showing the result of Example 4 which was confirmed by comparison with the conventional method that the deciphering degree of the nucleotide sequence of the nucleic acid can be improved by performing a cycle sequence reaction in the presence of RecA

Claims (6)

  A nucleic acid base sequence determination method for determining a base sequence of a target nucleic acid by performing a cycle sequence reaction in the presence of a RecA protein derived from an extreme thermophile.   The nucleobase sequencing method according to claim 1, wherein the target nucleic acid is an amplification product and is directly subjected to a sequencing reaction after amplification.   The nucleobase sequencing method according to claim 1 or 2, wherein the target nucleic acid has a zone of secondary structure that is inhibitory or suppressive. The nucleobase sequencing method according to any one of claims 1 to 3, wherein the RecA protein is derived from Thermus thermophilus . Thermostable DNA polymerase,
4 types of deoxynucleotide triphosphates corresponding to adenine, thymine, guanine and cytosine,
4 termination nucleotides corresponding to each of adenine, thymine, guanine and cytosine, and
A nucleobase sequencing kit for cycle sequencing of a target nucleic acid containing RecA derived from an extreme thermophile. The nucleobase sequencing kit according to claim 5, wherein the RecA protein is derived from Thermus thermophilus .