JP2006129861A - Method, kit and apparatus for easily producing circular dna - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for quickly separating a high-quality plasmid having low nick content with decreased steps at a low cost. <P>SOLUTION: The method for producing a circular DNA from a cell contains a step to add a flocculant to a liquid containing the cell. <P>COPYRIGHT: (C)2006,JPO&NCIPI

Description

  The present invention relates to a method, kit and apparatus for easily preparing closed circular DNA from cells.

Circular double-stranded DNAs such as phages and plasmids usually have a negative superhelical closed circular structure, and the circular DNA having such a structure is called cccDNA (covalently closed circular DNA).
Conventionally, there has been no isolation method that satisfies all the conditions that the time required for separation of cccDNA is low, the cost is low, the quality of the isolated cccDNA is good, and the yield is high. Furthermore, although there is a phenol / chloroform method as a method for preparing cccDNA, a harmful organic solvent has to be used.

  Qiagen Spin Miniprep Kit from Qiagen is well known as a kit for separating cccDNA from a small sample mainly using the alkaline SDS method, which is a known method. In the alkaline SDS method, there is an operation to temporarily make the solution strong alkali. However, DNA is vulnerable to alkali and is more likely to nick, and the final preparation will have a higher proportion of linear DNA rather than circular DNA. In addition, there are disadvantages that the time spent for work is long and the price is high. As of 2004, the kit for 50 samples is 11,000 yen (220 yen per sample).

  Separation method using anion exchange resin is Funakoshi's Midiprep Kit, PhoenIX. As of 2004, 25 samples are very expensive at 34000 yen (1360 yen per sample), and the working time is also long. There is a drawback.

  The kit for multi-samples mainly using the alkaline SDS method is R.I. E. A. L. There is a Prep 96 Plasmid Kit, but there is a high possibility that a nick will be entered in the cccDNA and the price will be high.

  Further, when isolating multiple samples of cccDNA at a time, centrifugation of the plate is an essential process, which has been an obstacle to full automation. That is, an attempt to fully automate the plate by centrifuging is found in, for example, Japanese Patent Application Laid-Open No. 2001-333763 (Patent Document 1). However, (1) The plate centrifuge is weak in centrifugal force and cannot sufficiently separate the pelleted plasmid. (2) When setting the plate in the centrifuge, or when removing the plate from the centrifuge after centrifugation, There was a problem that the rotation of the robot arm and the centrifuge had to be highly controlled, and it was substantially difficult to manufacture.

Furthermore, an attempt to fully automate can also be found in Japanese Patent Laid-Open No. 10-155481 (Patent Document 2). This method is a method of isolating DNA by adsorbing DNA to a carrier on a filter using a chaotropic ion method. Although it is said that 4 to 6 μg of plasmid DNA can be obtained at maximum from 0.6 ml of E. coli culture solution, only about 0.5 μg of plasmid DNA can be actually obtained, and further genomic DNA is contaminated.
JP 2001-333763 A JP 10-155481 A

An object of the present invention is to provide a method for isolating a high-quality plasmid with low nicks and few nicks from cells using harmless substances with less man-hours in a short time.
It is a further object of the present invention to provide a fully automated plasmid preparation machine that isolates multiple samples at once.

The present inventors succeeded in separating closed circular DNA (for example, plasmid) from other cell components, particularly genomic DNA and protein by using a flocculant due to the difference in aggregating action. It came to complete.
The gist of the present invention is as follows.
(1) A method for preparing closed circular DNA from cells, comprising a step of adding an aggregating agent to a liquid containing cells.
(2) The following steps:
(A) adding at least one alcohol and / or ketone to the liquid containing the cells;
(B) adding a flocculation aid and a flocculating agent to the liquid containing the cells, and separating the supernatant into a precipitate;
(C) removing the supernatant from the supernatant and precipitate produced in step (b);
(D) adding a cell lysate to the precipitate after removing the supernatant in step (c);
(E) A step of applying vibration to the liquid mixture produced in step (d);
(F) a step of adding an alcoholic solution to the mixed solution that has been vibrated in step (e); and (g) passing the supernatant of the mixed solution to which the alcoholic solution has been added in step (f) through an ultrafiltration filter. The method according to (1), further comprising a step of recovering the closed circular DNA.
(3) The method according to (2), which does not include a step of performing centrifugation.
(4) The method according to (2) or (3), wherein the hypertonic solution is brought into contact with cells as a pre-step of the step (a).
(5) The following steps:
(A ′) the step of precipitating the cultured cells by centrifugation and removing the supernatant;
(B ′) suspending the precipitated cells with a buffer or a medium to prepare a cell suspension;
(C ′) adding at least one alcohol and / or ketone to the cell suspension;
(D ′) a step of adding a coagulant aid and a coagulant to the cell suspension;
(E ′) adding a cell lysate to the cell suspension;
(F ′) applying vibration to the mixed solution produced in step (e ′);
(G ′) adding the alcoholic solution to the mixed solution subjected to vibration in step (f ′); and (h ′) limiting the supernatant of the mixed solution to which the alcoholic solution is added in step (g ′). The method according to (1), comprising a step of recovering closed circular DNA through a filtration filter.
(6) The method according to (5), wherein the buffer or medium in the step (b ′) is a hypertonic solution.
(7) The method according to any one of (1) to (6), wherein the cell is a unicellular organism.
(8) The method according to (7), wherein the unicellular organism is a bacterium.
(9) The method according to (8), wherein the bacterium is Escherichia coli.
(10) The method according to any one of (1) to (9), wherein the cell is a transformant.
(11) The method according to any one of (1) to (10), wherein the closed circular DNA is selected from the group consisting of plasmid DNA, cosmid DNA, P1 DNA, BAC DNA, PAC DNA, and YAC DNA.
(12) A kit for use in the method according to any one of (1) to (11), wherein the following components:
(a) a solution comprising at least one alcohol and / or ketone;
(b) an aggregation aid;
(c) a flocculant;
(d) a cell lysate;
(e) an alcoholic solution;
(f) a cleaning solution; and
(g) A kit containing the eluate.
(13) In addition, the following elements:
(h) chip;
(i) a tipping device; and
(j) The kit according to (12), including a culture plate.
(14) An apparatus for preparing closed circular DNA, the following apparatus:
(A) lateral movement device;
(B) Dispensing device;
(C) Supernatant suction device;
(D) Vibration device;
(E) a plate suction device; and
(F) A device including a robot arm.
(15) A method for separating closed circular DNA from other cell components using an aggregating agent.

In the present specification, the term “single cell organism” refers to an organism consisting of a single cell in the majority of life history, and most prokaryotes (bacteria, cyanobacteria, archaea) and some eukaryotes ( Protists, flagellate algae, diatoms, green algae, some red algae, and some fungi) fall under this category.
As used herein, “closed circular DNA” refers to circular DNA having a superhelical structure in which the 3 ′ end and 5 ′ end of DNA are self-ligated by covalent bonds. When a part of the DNA strand is unwound, Watson-Crick rotation is reduced, and twisting occurs correspondingly to form a super helix. Most closed circular DNA has a negative superhelical structure.
In this specification, “flocculant” is a chemical used to remove the turbidity and color of water. Fine particles suspended in water are put together to form a floc (agglomeration), which is separated and removed by sedimentation and filtration. Something that makes it easy to do. Many fine particles are negatively charged. By adding a positively charged flocculant, the fine particles are cross-linked, and the flocs are increased to increase the sedimentation speed.
In the present specification, the “aggregation aid” is a substance having a function of enhancing the aggregating action of the aggregating agent, and has an effect of facilitating the formation of fine flocs by suspending in water.
In the present specification, the “cell lysate” refers to a liquid containing a substance having an action of lysing cells.
As used herein, “alcoholic solution” refers to a liquid containing alcohol.
As used herein, “hypertonic solution” refers to a solution that is hypertonic than the cells of interest.
As used herein, “chip” refers to a replaceable instrument (usually made of plastic) such as a pipetman. Used when aspirating and discharging solutions.
In the present specification, unless otherwise specified, the percentage (%) indicates% by weight.

According to the present invention, it is possible to isolate high-quality closed circular DNA from cells at low cost and in a short time using harmless substances with less man-hours. In particular, it is a great advantage that the cost is about one-tenth or less of the conventional cost.
For example, as of 2004, Qiagen's Qiagen Spin Miniprep Kit has 50 samples at 11,000 yen (1 sample at 220 yen). E. A. L. In the case of the Prep 96 Plasmid kit (96 specimens simultaneous preparation), 4 plates cost 75,000 yen (1 specimen 195 yen), while in the present invention, 1 specimen is 18 yen.
Furthermore, it has become possible to isolate closed circular DNA from a large number of samples fully automatically.

Hereinafter, the present invention will be described in detail.
The present invention provides a method for preparing closed circular DNA from cells, comprising the step of adding an aggregating agent to a liquid containing cells.
The cell may be any cell, and examples include prokaryotic cells such as bacteria and archaea, fungal cells such as yeast, protists, plant cells, and animal cells.
The closed circular DNA may be any circular DNA having a superhelical structure in which the 3 ′ end and 5 ′ end of the DNA are self-ligated by a covalent bond, including plasmid DNA, cosmid DNA, P1 DNA, Examples thereof include BAC DNA, PAC DNA, and YAC DNA.
The liquid containing cells may be any liquid containing cells, and examples thereof include a cell culture solution and a solution in which cultured cells are precipitated by centrifugation and then suspended in a buffer or a medium.
In one embodiment of the invention, the method of the invention comprises the following steps:
(A) adding at least one alcohol and / or ketone to the liquid containing the cells;
(B) adding a flocculation aid and a flocculating agent to the liquid containing the cells, and separating the supernatant into a precipitate;
(C) removing the supernatant from the supernatant and precipitate produced in step (b);
(D) adding a cell lysate to the precipitate after removing the supernatant in step (c);
(E) A step of applying vibration to the liquid mixture produced in step (d);
(F) a step of adding an alcoholic solution to the mixed solution that has been vibrated in step (e); and (g) passing the supernatant of the mixed solution to which the alcoholic solution has been added in step (f) through an ultrafiltration filter. And a step of recovering the closed circular DNA.
According to the method of the present invention, closed circular DNA substantially free of genomic DNA can be obtained without using centrifugation, but the method of the present invention does not completely eliminate the centrifugation step. This method may be used in combination with centrifugation.
Here, “substantially free of genomic DNA” means that the amount of genomic DNA contained in the final preparation is an amount that is hardly visible when electrophoresis is performed on the amount of cccDNA visible. For example, Lane 2 in FIG. 9 is an electrophoresis of the final preparation isolated by this method, and two bands can be visually observed in this lane. The upper thin band is a linear plasmid DNA, and the lower dark band is a closed circular plasmid DNA. Genomic DNA is not visible. When genomic DNA is contained, the genomic DNA is larger in size than the plasmid DNA, and therefore a band appears on top of the linear plasmid DNA band.

  When culturing the cells in a liquid medium, it is preferable to perform the steps (a) to (g) in a state where the number of cells is most increased by culturing the cells in 0.1 mL to 10 L of medium. At this time, if the cells are Escherichia coli, the medium is LB medium (1% Trypton, 0.5% Yeast Extract, 1% NaCl), 2 × LB medium (2% Trypton, 1% Yeast Extract, 1% NaCl) or LB + 7 % Glycerol medium (1% Trypton, 0.5% Yeast Extract, 1% NaCl, 7% Glycerol) is preferred. In particular, when cultured in LB + 7% Glycerol medium, the number of cells increases and the yield of DNA is higher than that of LB medium or 2 × LB medium.

  Before performing the steps (a) to (g), it is preferable that the hypertonic solution is brought into contact with the cells (for example, a solution hypertonic than the cells is added to the medium). This takes water from the cells and shrinks the cells. This step has a function of suppressing as much as possible outflow of cytoplasm out of the cell at the time of cell destruction accompanying the subsequent alcohol contact treatment. Further, if the hypertonic solution is a salt solution, it has a function of enhancing the aggregating action between cells at the time of adding alcohol or ketone in the step (a). The hypertonic solution is preferably a sodium chloride aqueous solution from the viewpoint of low cost. Sodium chloride having a final concentration of 0.1 to 2.5M is preferred, and a sodium chloride aqueous solution having a final concentration of 0.83M is most preferred.

  In the step (a), at least one kind of alcohol and / or ketone is added (1 in FIG. 13)). In 1) of FIG. 13, isopropanol is described as “at least one kind of alcohol and / or ketone”, and Escherichia coli is described as “cell”. By directly adding alcohol and / or ketone to cultured cells, the cell surface is dehydrated, the hydrophilic groups of the cells are connected, and a large aggregate is formed (colloidal salting out action). For example, Escherichia coli is weakly charged negatively, and when they are agglomerated, they become aggregates that are strongly negatively charged. Moreover, by adding alcohol and / or ketone, a hole is opened in the cell, and alcohol and / or ketone enter from the hole. Thereby, intracellular proteins are denatured and aggregated. Furthermore, some proteins involve and fix genomic DNA during denaturation. Closed circular DNA (for example, plasmid DNA) is dehydrated by alcohol and / or ketone, binds to and aggregates with intracellular substances such as genomic DNA, and does not dissociate outside the cell. For this treatment, it is preferable to select one or more of ethanol or isopropyl alcohol for alcohol and acetone for ketone. In particular, isopropyl alcohol is most preferable because it can be processed with a small amount of liquid. The final concentration is preferably 1 to 80% isopropyl alcohol, and most preferably isopropyl alcohol having a final concentration of 33.3%.

In the step (b), an aggregating auxiliary agent and an aggregating agent are added (FIG. 13-2)). As flocculants, polyaluminum chloride, aluminum sulfate, sodium alginate, chitosan, ferric chloride, polyferric sulfate, polyacrylamide polymer flocculants, dimethylaminoethyl methacrylate polymer flocculants, dimethylaminoethyl acrylate Examples thereof include a polymer flocculant, an amidine polymer flocculant, and an amphoteric polymer flocculant. Examples of the coagulation aid include calcium carbonate, powdered activated carbon, activated silicic acid, and bentonite. In 2) of FIG. 13, calcium carbonate is described as “aggregation aid”, and polyaluminum chloride is described as “aggregation agent”. As an agglomeration aid, an insoluble substance having a large particle size, a specific gravity greater than that of water, and being negatively charged may be used. As the coagulation aid, calcium carbonate (CaCO ₃ ) is preferable. A final concentration of 0.1-100 mg / ml calcium carbonate is preferred, and a final concentration of 21.3 mg / ml calcium carbonate is most preferred. Since calcium carbonate naturally precipitates in distilled water and is difficult to handle in the separation operation, glycerol having a high viscosity (final concentration of 1 to 50%) may be added to distilled water in order to delay the sedimentation rate of calcium carbonate.

Furthermore, in the step (b), the agglutination aid negatively charged and the aggregate of cells negatively charged in the step (a) (E. coli in FIG. 13) are cross-linked using a positively charged aggregating agent, Coprecipitated by the weight of the coagulation aid. The flocculant preferably has a final concentration of 3 to 1000 μg / ml polyaluminum chloride, most preferably 83.3 μg / ml polyaluminum chloride. It is sufficient to wait for 4 to 8 minutes until the precipitate is formed, but the longer the time is set, the larger the amount of the precipitate is. The order of adding the coagulant and the coagulant is not particularly limited, but the coagulant is preferably attached first.
Next, in the step (c), the supernatant is removed from the supernatant and the precipitate produced in the step (b) (3 in FIG. 13).

  When a liquid containing water is added to the precipitate after removing the supernatant in the step (c), the concentration of alcohol and / or ketone in the water is reduced, and the closed circular DNA having high solubility is dissolved. Since proteins are difficult to recover once denatured, some proteins continue to hold dissolved genomic DNA firmly after addition of an aqueous solution. Further, by adding a cell lysate as a water-containing liquid (step (d), 4 in FIG. 13), the cell membrane and cell wall forming the cells are melted to widen the hole, and the closed circular DNA is released out of the cell. Make it easier. The cell lysate may be prepared by dissolving components such as a surfactant that dissolves the cell membrane and a cell lysis enzyme in a buffer. Surfactants that dissolve cell membranes include Triton X-100, Briji, Nonidet P-40, Tween 20, Tween 80, CHAPS, SDS, NP-40, cholic acid, and n-octyl glycoside. Cellulase, hemicellulase, pectinase, lysozyme, β-1,3-glucanase, collagenase, trypsin and the like. The buffer may be any buffer, but preferably contains EDTA that chelates Mg ions that may aid in DNA degradation. For example, TE buffer (10 mM Tris-HCl, 1 mM EDTA (pH 8)), TBE buffer (85 mM Tris, 85 mM boric acid, 2 mM EDTA), TAE buffer (Tris 40 mM, acetic acid 40 mM, 1 mM EDTA) and the like can be mentioned. When the cells are Escherichia coli, the cell lysate is preferably a mixed solution of Triton X-100 and lysozyme. The concentrations of Triton X-100 and lysozyme are as follows. Triton X-100 with a final concentration of 0.01-20% is preferred, and Triton X-100 with a final concentration of 1% is most preferred. A lysozyme having a final concentration of 0.01 to 40 mg / ml is preferred, and a lysozyme having a final concentration of 2.5 mg / ml is most preferred. Furthermore, it is desirable to add RNase simultaneously to degrade RNA. Here, RNases include RNase A, RNase T, RNase I, and RNase H, but are not limited thereto. When the RNase is RNase A, a final concentration of 0.1 to 200 μg / ml RNase A is preferred, and a final concentration of 34 μg / ml RNase A is most preferred.

  When the cell membrane and cell wall are dissolved, proteins, protein-genomic DNA conjugates, and other cell components may also be separated from the cell. However, these insoluble cell constituents are mainly negatively charged and are attracted to the positively charged flocculant to form large clumps. On the other hand, the solubilized closed circular DNA dissolves in the supernatant without being cross-linked by the flocculant, and is separated from the precipitate. Furthermore, in step (e), vibration is applied (preferably, weak vibration is intermittently applied (5 in FIG. 13)), thereby strengthening the aggregating action by ionic bond between substances and separating from closed circular DNA. Increase efficiency dramatically. That is, the greatest feature of the present invention is that closed circular DNA is separated from other cell components, particularly genomic DNA and proteins, by the difference in aggregation action. The vibration of the step (e) is preferably a vibration that gives a weak vibration of about 500 to 1700 rpm 2 to 20 times for 0.1 to 3 seconds at 0.1 to 3 second intervals, and most preferably vibration that gives 10 times for 0.5 seconds at 0.5 second intervals.

  In the step (f), an alcoholic solution is added to the supernatant in which the closed circular DNA produced in the step (e) is dissolved (FIG. 13-6)). In 6) of FIG. 13, polyethylene glycol is described as the alcohol contained in the “alcoholic solution”. As a result, the closed circular DNA is colloided and aggregated by salting out the colloid. Although the closed circular DNA is insolubilized by the addition of the alcoholic solution, it does not precipitate because it is not centrifuged, and remains in the supernatant. Examples of the alcohol contained in the alcoholic solution include polyethylene glycol, ethanol, and isopropyl alcohol. Although the alcoholic solution varies depending on the type of alcohol, water or a salt such as sodium chloride, sodium acetate, lithium chloride or ammonium acetate is used so that the concentration is 5 to 100%, preferably 10 to 100%. It is good to mix with the aqueous solution etc. which are mixed. The alcohol contained in the alcoholic solution is preferably polyethylene glycol. The final concentration is preferably 1-20% polyethylene glycol, and most preferably 5.7% polyethylene glycol. Moreover, the aggregation action is further promoted by adding high-concentration sodium chloride to the alcoholic solution. A final concentration of 0.01 to 2M sodium chloride is preferred, and a final concentration of 0.71M sodium chloride is most preferred.

After adding the alcoholic solution, in the step (g), only the supernatant containing the closed circular DNA aggregate is taken out and subjected to ultrafiltration through the filter (7 in FIG. 13). Here, the agglomerates of closed circular DNA are caught in the filter net. As this filter, those having a pore diameter of 0.01 to 10 μm are suitable, and an ultrafiltration filter having a diameter of 0.05 to 5 μm is preferable. For example, MultiScreen FB (1 μm) manufactured by Millipore can be used. Thereafter, the filter is washed with a washing solution, and then the closed circular DNA remaining on the filter is eluted with an eluent.
The washing solution may be obtained by dissolving ethanol, isopropyl alcohol or the like in a buffer or water so as to have a concentration of 10 to 100%, preferably 40 to 90%. Any buffer may be used, for example, a TE buffer (10 mM Tris-HCl, 1 mM EDTA (pH 8)) added with a salt such as sodium chloride, sodium acetate, lithium chloride, or ammonium acetate. The salt may be dissolved so as to have a concentration of 0.01 to 10M, preferably 0.1 to 8M.
The eluate may be anything that can elute the closed circular DNA remaining on the filter, but it contains EDTA that chelates Mg ions that may aid in DNA degradation. A buffer is preferred. For example, TE buffer (10 mM Tris-HCl, 1 mM EDTA (pH 8)), TBE buffer (85 mM Tris, 85 mM boric acid, 2 mM EDTA), TAE buffer (Tris 40 mM, acetic acid 40 mM, 1 mM EDTA) and the like can be mentioned.

The above steps (a) to (d) are steps for precipitating cells, but in another embodiment of the present invention, it is simpler to make a cell precipitate using a centrifuge. And the yield of closed circular DNA can be increased.
Specifically, in another embodiment of the present invention, a method for preparing closed circular DNA from cells comprising the following steps:
(A ′) the step of precipitating the cultured cells by centrifugation and removing the supernatant;
(B ′) suspending the precipitated cells with a buffer or a medium to prepare a cell suspension;
(C ′) adding at least one alcohol and / or ketone to the cell suspension;
(D ′) a step of adding a coagulant aid and a coagulant to the cell suspension;
(E ′) adding a cell lysate to the cell suspension;
(F ′) applying vibration to the mixed solution produced in step (e ′);
(G ′) adding the alcoholic solution to the mixed solution subjected to vibration in step (f ′); and (h ′) limiting the supernatant of the mixed solution to which the alcoholic solution is added in step (g ′). A method is provided comprising the step of recovering closed circular DNA through a filtration filter.
In this embodiment, the waiting time until the cells are precipitated in the step (c) in the embodiment described above is eliminated, and the operation for removing the supernatant is not necessary.
When culturing cells in a medium, it is preferable to perform the steps (a ′) to (h ′) in a state where the number of cells is most increased by culturing the cells in a medium of 0.1 mL to 10 L. At this time, if the cells are Escherichia coli, the medium is composed of Trypton with a final concentration of 0.1-5%, Yeast Extract with a final concentration of 0.05-2.5%, NaCl with a final concentration of 0-2.5%, Glycerol with a final concentration of 0-30%. A medium consisting of the LB medium (1% Trypton, 0.5% Yeast Extract, 1% NaCl) generally used in the world at present is preferable. 2 × LB medium (2% Trypton, 1% Yeast Extract, 1% NaCl) or LB + 7% Glycerol medium (1% Trypton, 0.5% Yeast Extract, 1% NaCl, 7% Glycerol) The cell density is increased, which increases the yield of DNA, which is most preferable.
In the centrifugation step (a ′), any cultured centrifuge may be used as long as the cultured cells are precipitated. For example, when the number of specimens is small, a high-speed centrifuge can be used, and it may be centrifuged at 20000 × g for 10 seconds. When the number of specimens is large and a culture plate is used, a low-speed plate centrifuge may be used and centrifuged at 1000 × g for 10 minutes.
The amount of the buffer or medium in the step (b ′) depends on the amount of precipitated cells. Since the amount of precipitated cells depends mainly on the amount of the culture solution, it may be suspended in a buffer or medium that is 1/2 to 1/40 of the amount of the culture solution. Further, the suspension may be suspended with a pipette, or may be suspended by applying vibration by vortexing or the like. When applying vibration by vortexing, it is sufficient to keep applying vibration for 5 to 10 minutes with vibration of about 1500 to 2000 rpm.
Furthermore, by replacing the cell culture medium with a new buffer or medium in the step (b ′), the DNA preparation inhibitor generated during the culture can be removed, and the yield of closed circular DNA increases. Any suspension buffer may be used, but 1 to 100 mM Tris-HCl (pH 7.5 to 9) is preferable, and 10 mM Tris-HCl (pH 8.5) is most preferable. In addition, the final amount of DNA to be prepared is larger when a medium is used than when an inorganic buffer is used for suspension. This seems to be because the protein contained in the medium works as a carrier for closed circular DNA. Any medium can be used, but LB medium (1% Trypton, 0.5% Yeast Extract, 1% NaCl) and 2 × LB medium (2% Trypton, 1% Yeast Extract, 1% NaCl) are preferable. The buffer or medium used in the step (b ′) is preferably a hypertonic solution. If the buffer or medium is a hypertonic solution, the cells are dehydrated and the cells shrink. Thereby, the outflow of cytoplasm out of the cell at the time of cell destruction accompanying the subsequent alcohol contact treatment is suppressed as much as possible. Further, if the hypertonic solution is a salt solution, it has a function of enhancing the aggregating action between cells at the time of adding alcohol and / or ketone in the step (c ′). The hypertonic solution is preferably a sodium chloride aqueous solution from the viewpoint of low cost. A final concentration of 0.1 to 2.5M sodium chloride is preferred, and a final concentration of 1M aqueous sodium chloride is most preferred.
The alcohol and / or ketone, the coagulant aid, and the coagulant used in the steps (c ′) and (d ′) (1 and 2 in FIG. 21) are the steps (a) and (b) (see FIG. 13 is the same as the chemical used in 1) and 2)), but the optimal concentration of calcium carbonate used as a coagulant aid is 58.8 mg / ml in final concentration, and the optimal concentration of polyaluminum chloride used as the coagulant The final concentration is 114 μg / ml. In addition, when preparing DNA in a 1.5 ml tube or 2 ml culture plate commonly used in laboratories, it was difficult to use a cell culture medium of 500 μl or more with a preparation method that does not use a centrifuge. By using a centrifuge, it is possible to prepare DNA from 1 to 1.5 ml of cell culture solution, and the yield of closed circular DNA increases.
Cell lysate, vibration, alcoholic solution used in steps (e ′), (f ′), (g ′) and (h ′) (3 in FIG. 21), 4), 5) and 6)) The ultrafiltration filter is the same as that used in the steps (c), (d), (e), (f) and (g) (4 in FIG. 13, 5), 6) and 7)). is there. Further, a washing solution for washing the filter, an elution solution for eluting the closed circular DNA remaining on the filter, and the like are the same as described above.

  The present invention is not limited to a small amount of medium (0.1 to 1 ml) in which cells are cultured, and closed circular DNA can be isolated from a large amount of 1 to 10 L of culture solution. Needless to say, it can also be isolated from 1 ml to 1 L of culture solution.

  The present invention can also be isolated when the closed circular DNA is cosmid DNA, P1 DNA, BAC DNA, PAC DNA or YAC DNA.

  In the present invention, even when a cell is a transformant, closed circular DNA can be prepared from the transformant. It goes without saying that closed circular DNA can be similarly prepared when the cells are transformants of E. coli. In addition, when the cells are transformants such as yeast, Bacillus subtilis, and animal cell transformants such as COS7 cells and 293T cells transformed with a plasmid having the SV40 virus replication origin, closed circular DNA from these cells. Can be prepared.

The present invention can isolate closed circular DNA from the following pathogenic bacteria.
Bacillus anthracis, Shigella, Salmonella, Salmonella, Vibrio parahaemolyticus, Vibrio parahaemolyticus, Campylobacter, Staphylococcus aureus, Clostridium perfringens, Bacillus cereus, Streptococcus syphilis, Treponema, Lyme disease Borrelia, Helicobacter pylori, Neisseria meningitidis, Neisseria gonorrhoeae, Fluorescent Bacteria, Rhinoceros, Rhinoceros Falcon, Maltese Fever, Bang Fung, Porcine Abortion Bacteria, Bordetella Pertussis, Wild Blight Fungus, Salmonella Typhi, Paratyphi Bacteria, Salmonella Typhimurium, Klebsiella Pneumoniae, Enterobacter Cloaca M. tuberculosis, Haemophilus influenzae, flexible gonococcus, fragilis, melaninogenicus, vibius, gingivalis, rash fever rickettsia, rocky mountain spotted fever rickettsia, helminth rickettsia, scorching rocharimea, q fever coccyella, pneumonia mycoplasma, epidermal grape Streptococcus, Streptococcus pyogenes, Streptococcus pneumoniae, Bacillus cereus, Bacillus subtilis, Kizufukin, botulinum, Listeria, Erysipelothrix rhusiopathiae, Corynebacterium diphtheriae, bifidobacteria, Mycobacterium tuberculosis, bovine bacterium, Mycobacterium leprae, Rhodococcus equi, phytoplasma, Shigella, E. coli

Furthermore, if the pathogenic bacterium is E. coli, closed circular DNA can be isolated from the following E. coli.
Verotoxin-producing Escherichia coli (VTEC), Toxigenic Escherichia coli (ETEC), Tissue invasive Escherichia coli (EIEC), Pathogenic serotype Escherichia coli (EPEC), Intestinal agglutinating E. coli (EAggEC), K12 strain

In the present invention, closed circular DNA can be isolated from the following drug-resistant bacteria.
Fission yeast, Saccharomyces cerevisiae, Vibrio spp., Vancomycin-resistant enterococci, Staphylococcus aureus, Shigella, Salmonella typhi, Salmonella, Vibrio cholerae, Vibrio parahaemolyticus, Staphylococcus aureus, Clostridium perfringens, Bacillus cereus, Streptococcus Syphilis treponema, Lyme disease Borrelia, Helicobacter pylori, Neisseria meningitidis, Neisseria gonorrhoeae, fluorescent fungus, nasal gonorrhoeae, nasal gonorrhea, malta fever, bang fungus, swine abortion, pertussis, wild gonorrhea, typhoid, paratyphi , Salmonella typhimurium, Klebsiella pneumoniae, Enterobacter cloacae, Pseudomonas, plague, pseudomycobacterium tuberculosis, Haemophilus influenzae, flexible gonococcus, fragilis, melaninogenicus, bibius, gingivalis, rash fever rickettsia, rocky mountain spotted fever rickettsia , Hookworm rickettsia, scorching rocharimere, Q fever Koxiella, pneumonia mycopra S. epidermidis, Streptococcus pyogenes, Streptococcus pneumoniae, Streptococcus pneumoniae, Bacillus subtilis, tetanus, Clostridium botulinum, Listeria monocytogenes, swine gonococcus, diphtheria, bifidobacteria, tuberculosis, bovine mold, gonorrhea, rhodococcus・ Equi, Phytoplasma, Shigella, Escherichia coli Drug-resistant bacteria are resistant to penicillin, cephem, aminoglycoside, tetracycline, chloramphenicol, lincomycin, macrolide, colistin, fosfomycin , Polymyxin, vancomycin, tricomycin, cycloserine and the like.

The present invention also provides a kit for use in the method of the present invention, comprising the following components:
(a) a solution comprising at least one alcohol and / or ketone;
(b) an aggregation aid;
(c) a flocculant;
(d) a cell lysate;
(e) an alcoholic solution;
(f) a cleaning solution; and
(g) Provide a kit containing the eluate.
For the solution containing at least one alcohol and / or ketone, select one or more from ethanol, isopropyl alcohol and acetone, and use water or the like so as to have a concentration of 30 to 100%, preferably 50 to 100%. It should be a mixture of
Examples of the coagulation aid include calcium carbonate, powdered activated carbon, activated silicic acid, and bentonite. In the kit of the present invention, the agglutination aid may be suspended in a solvent such as water so as to have a concentration of 0.1 to 70%, preferably 5 to 50%.
As the flocculant, polyaluminum chloride, aluminum sulfate, sodium alginate, chitosan, ferric chloride, polyferric sulfate, polyacrylamide polymer flocculant, dimethylaminoethyl methacrylate polymer flocculant, dimethylaminiethyl acrylate Examples thereof include a polymer flocculant, an amidine polymer flocculant, and an amphoteric polymer flocculant. In the kit of the present invention, the flocculant may be dissolved in a solvent such as water to a concentration of 0.001 to 10%, preferably 0.01 to 10%.
Surfactants that dissolve cell membranes contained in cell lysates include Triton X-100, Briji, Nonidet P-40, Tween 20, Tween 80, CHAPS, SDS, NP-40, cholic acid, n-octyl glycoside, etc. Cell wall lytic enzymes include cellulase, hemicellulase, pectinase, lysozyme, β-1,3-glucanase, collagenase, trypsin and the like. RNases contained in the cell lysate include RNase A, RNase T, RNase I, and RNase H. The cell lysate may be obtained by dissolving a surfactant, cell wall lytic enzyme, and RNase in a buffer. The buffer may be any buffer, but preferably contains EDTA that chelates Mg ions that may aid in DNA degradation. For example, TE buffer (10 mM Tris-HCl, 1 mM EDTA (pH 8)), TBE buffer (85 mM Tris, 85 mM boric acid, 2 mM EDTA), TAE buffer (Tris 40 mM, acetic acid 40 mM, 1 mM EDTA) and the like can be mentioned. The surfactant may be dissolved so as to have a concentration of 0.01 to 10%, preferably 0.1 to 10%. The cell wall lytic enzyme may be lysed so as to have a concentration of 0.01 to 10%, preferably 0.1 to 5%. RNase is dissolved in a buffer with a surfactant and cell wall lytic enzyme so as to have a concentration of 0.0001 to 1%, preferably 0.001 to 1%, or a concentration of 0.001 to 10%, preferably 0.01 to 5%. A method in which a solution dissolved in water or the like so as to have a concentration of 5% is attached in a small bottle separately is preferable.
Examples of the alcohol contained in the alcoholic solution include polyethylene glycol, ethanol, and isopropyl alcohol. Although the alcoholic solution varies depending on the type of alcohol, water or a salt such as sodium chloride, sodium acetate, lithium chloride or ammonium acetate is used so that the concentration is 5 to 100%, preferably 10 to 100%. It is good to mix with the aqueous solution etc. which are mixed. The salt may be dissolved in water to a concentration of 0.01 to 10M, preferably 0.1 to 8M.
The washing solution may be obtained by dissolving ethanol, isopropyl alcohol or the like in a buffer or water so as to have a concentration of 10 to 100%, preferably 40 to 90%. Any buffer may be used, for example, a TE buffer (10 mM Tris-HCl, 1 mM EDTA (pH 8)) added with a salt such as sodium chloride, sodium acetate, lithium chloride, or ammonium acetate. The salt may be dissolved so as to have a concentration of 0.01 to 10M, preferably 0.1 to 8M.
The eluate may be anything that can elute the closed circular DNA remaining on the filter, but it contains EDTA that chelates Mg ions that may aid in DNA degradation. A buffer is preferred. For example, TE buffer (10 mM Tris-HCl, 1 mM EDTA (pH 8)), TBE buffer (85 mM Tris, 85 mM boric acid, 2 mM EDTA), TAE buffer (Tris 40 mM, acetic acid 40 mM, 1 mM EDTA) and the like can be mentioned.

The kit of the present invention may further include a chip, a chip stopper, a culture plate, and the like. Kits containing these elements are suitable for processing multiple specimens.
The tip may be anything as long as it can suck and discharge liquid, such as Bio Gilson Yellow Tip (Fuebuki Office), Ibis Pipette Tip (As One), Universal Fit Tip (AXY), Beveled Pipette Tip (SSI), Multi Fit Tip (CLP), Standard Pipette Tip (Soken Bio), Assist Tip (Assist), etc. can be used.
When isolating multi-sample closed circular DNA, it is difficult to extract only the supernatant from the mixed solution divided into the supernatant and the precipitate from the plate. Therefore, as shown in Fig. 8, when the chip reaches a certain depth (here, just above the sediment), a device with a function to support and stop the chip so that the chip does not go deeper than a certain depth. Although it is convenient to use, a device having a function to support and stop the chip is called a “chip stopper”. The chip fastening device can be obtained by processing a device for fixing the chip in the chip case, but it can also be produced specially. FIG. 8 (a) shows the case of one well, but when it is performed on a plate, 96 of them are arranged (FIG. 8 (b)). Further, the chip stopper, the chip, and the culture plate are not limited to the shape shown in the figure.
The culture plate may be any material that can culture cells, such as Coster (Corning Incorporated), 2 ml Deep Well Plate (AXY), 2.2 ml 96-well Deep Well Plate (Brand), Falcon ^TM 96-well Deep-Well Plate (BD Biosciences), 96-Well Masterblock ^TM Deep Well Plate (Bellco Glass), etc. can be used.

The kit may further include a filter plate, a syringe-type filter, an elution plate, and an instruction manual.
The filter plate or syringe type filter may have any shape and material as long as the filter has a pore size of 0.01 to 10 μm, preferably 0.05 to 5 μm. The filter plate or syringe type filter can be specially made, but commercially available ones can also be used. As the filter plate, for example, MultiScreenFB (Millipore), Concert 96 filter plate (Invitrogen), AcroWell GHP membrane use filter plate (Nippon Genetics), Unifilter 350 (Whatman) and the like can be used. There are two types of syringe type filters: a type in which the syringe and the filter are separated and a type in which the syringe and the filter are integrated. If the syringe and the filter are separate types, for example, MILLEX ^™ -HV (Millipore), 25 mm GD / X syringe filter (Whatman), Minisart N (Sartorius), etc. can be used. Moreover, if it is an integrated type, for example, QIAfilter Midi Cartridges (Qiagen), PhoenIX ^™ Filter (Qbiogene), or the like can be used.
The elution plate is used for preparing cccDNA from multiple specimens, but may have any shape. If it is a commercial item, a polystyrene plate (Whatman), PS-Microplate 96 well V-form (Griner bio-one), a microwell plate (As One) etc. can be used, for example.
Instructions describing the kit's information, protocols, precautions, etc. can be included in the kit.

Furthermore, the present invention is an apparatus for preparing closed circular DNA (hereinafter sometimes referred to as “closed circular DNA preparation apparatus”), and the following apparatus:
(A) lateral movement device;
(B) Dispensing device;
(C) Supernatant suction device;
(D) Vibration device;
(E) a plate suction device; and
(F) An apparatus including a robot arm is provided.

A schematic diagram of an example of the closed circular DNA preparation apparatus of the present invention is shown in FIG.
The plate (2) moves on the lateral movement devices (20 and 21) along the following steps. As the plate, the aforementioned culture plate, for example, Coster (Corning Incorporated) may be used. The lateral movement device is driven by a motor (not shown). The belt structure of the lateral movement device (20 and 21) is shown in FIGS. In FIG. 2, the plate is placed on a frame (101) on which the plate is placed. Further, the pressing member (102) presses the plate inward by a horizontal pressing spring. Thus, when the plate is placed on the frame (101) on which the plate is placed, the plate is fixed to the center of the frame (101) on which the plate is placed. A frame (101) on which each plate is placed is connected by a connecting member (103) so as to rotate in a circle. FIG. 2 shows a state in which a shaker (5a) is disposed below the lateral movement device (the following steps 3), 5), 7), 9), 13), and 15). ). FIG. 3 shows a state in which the plate (2) is on the lateral movement device (the following steps 1) to 17). The plate is pressed by the pressing member (102) toward the center of the frame (101) on which the plate is placed.
1) A plate (2) containing E. coli is placed on the lateral transfer device (20) from the plate stocker (1) (FIG. 1). Here, the structure of the stocker is shown in FIG. Side X has a notch for two plates below, plate stopper 1 (801) is provided at the top of the notch, and robot arm (803) is provided at the bottom. The side Y has a notch on the upper side and a plate stopper 2 (802) on the lower side. Next, the operation of the stocker will be described. First, the robot arm (803) grabs the lowermost plate (16-1). Next, the plate stopper 2 (802) is opened ((1) in FIG. 17B). Next, the robot arm (803) places the grabbed plate (16-1) on the lateral movement device ((2) in FIG. 17B). In this state, there is space for one plate at the bottom of the stocker. Next, the plate stopper 2 (802) is closed ((3) in FIG. 17B). In this state, the plate stopper 1 (801) is opened, and the stocked plates (16-2, 16-3 and 16-4) are moved downward.
2) A sodium chloride aqueous solution is dispensed to the plate (2) containing E. coli by the hypertonic solution dispenser (3).
3) The plate (2) is then shaken by a shaker (5a-1). As shown in FIG. 5, the shaker (5a) is shaken in a state where the shaker (5a) moves upward from the lower side of the lateral movement device, lifts the plate, and is supported by the fixed support (5b) descending from the upper side. . In this process, the fixed support is indicated by 5b-1.
4) The liquid containing one or more kinds selected from alcohol and ketone is dispensed into the plate (2) by the alcohol / ketone dispenser (4).
5) The plate (2) is then shaken by a shaker (5a-2). As shown in FIG. 5, the shaker (5a) is shaken in a state where the shaker (5a) moves upward from the lower side of the lateral movement device, lifts the plate, and is supported by the fixed support (5b) descending from the upper side. . In this process, the fixed support is indicated by 5b-2.
6) The liquid containing calcium carbonate is dispensed into the plate (2) by the coagulant aid dispenser (6). When the liquid containing calcium carbonate is allowed to stand, calcium carbonate precipitates and accurate quantitative suction into the dispenser cannot be performed. Therefore, as shown in FIG. 14, a vibration device (311) is connected to a solution tray (306) of a dispenser (FIG. 6), which will be described later, via a connecting portion (310) as shown in FIGS. 14 (a) and 14 (b). Connecting. A solution containing calcium carbonate is aspirated quantitatively from this vibrating solution tray. (The suction dispensing method will be described later.) The solution is supplied to the solution tray by the mechanism shown in FIG. When the water level sensor (301) senses a drop in the water level of the solution, a signal is sent to the pump controller (309), the pump (304) is activated, and the solution tray (from the solution bottle (305) through the solution supply pipe (303) ( 306). Here, the solution bottle for storing the liquid containing calcium carbonate is constantly vibrated and stirred by the vibration device (312). When the solution reaches a predetermined water level in the solution tray, a signal is sent from the sensor to the pump controller and the pump stops. By comprising in this way, exact dispensing of the liquid containing a calcium carbonate is performed.
7) The plate (2) is then shaken by a shaker (5a-3). As shown in FIG. 5, the shaker (5a) is shaken in a state where the shaker (5a) moves upward from the lower side of the lateral movement device, lifts the plate, and is supported by the fixed support (5b) descending from the upper side. . In this process, the fixed support is shown as 5b-3.
8) The liquid containing polyaluminum chloride is dispensed into the plate (2) by the flocculant dispenser (7).
9) The plate (2) is then shaken by a shaker (5a-4). As shown in FIG. 5, the shaker (5a) is shaken in a state where the shaker (5a) moves upward from the lower side of the lateral movement device, lifts the plate, and is supported by the fixed support (5b) descending from the upper side. . In this process, the fixed support is indicated by 5b-4.
10) The plate (2) is allowed to stand for a certain period of time. However, in order to process the plate continuously, there is an interval of several plates between the shaker (5a-4) and the supernatant aspirating / discharging machine (8), and only lateral movement is performed during that interval.
11) The supernatant in the plate (2) is aspirated and discarded by the supernatant aspirating and discharging machine (8). The mechanism of the supernatant aspirator is the same as that of the dispensing device (FIG. 16). However, while the dispensing device sucks the solution from the solution tray and discharges it to the plate, the supernatant suction and discharge machine sucks the supernatant from the plate and discharges it to the discharge tray. The mechanism of the supernatant aspirator is shown below. The supernatant aspirator is lowered to a position suitable for aspirating the supernatant toward the plate on the lateral movement device and aspirates the supernatant. At this time, as shown in FIG. 8, when the chip reaches a certain depth (here, just above the sediment), it has a function of supporting and stopping the chip so that the chip does not go deeper than a certain depth. It is convenient to use a “chip stopper”. After that, it rises again to its original height. The supernatant is discharged to the discharge tray (FIG. 19). The discharge tray is installed on the side surface of the lateral movement device, and moves to a position immediately below the supernatant suction and discharge machine when the supernatant is discharged. After the supernatant is discharged, the discharge tray moves to the side again and returns to the original position. The discharged supernatant is collected in a collection bottle connected to a discharge tray. After the supernatant is discharged, the chip attached to the supernatant suction / discharge machine is cleaned by a chip cleaning device (described later). The chip cleaning device is installed on the side surface of the lateral movement device, and moves just below the supernatant aspirating and discharging machine when cleaning the chip. Thereafter, the supernatant aspirating / discharging machine descends and cleaning is performed by the chip cleaning device. After washing, the supernatant aspirating / discharging machine rises again to the original position, and the chip washing apparatus moves to the original position.
12) The liquid containing Triton X-100, Tris-HCl, EDTA, NaCl, lysozyme, and RNase is dispensed to the plate (2) by the cell lysate dispenser (9).
13) Thereafter, the plate (2) is intermittently vibrated by the shaker (5a-5). This vibration is programmed to be performed at a frequency of about 500 to 1700 rpm and a total of 10 to 20 times of vibration for 0.5 seconds at intervals of 0.5 seconds. As shown in FIG. 5, the shaker (5a) moves upward from below the lateral movement device, lifts the plate, and is vibrated while being supported by the fixed support (5b) descending from above. . In this process, the fixed support is shown as 5b-5.
14) A liquid containing polyethylene glycol and NaCl is dispensed into the plate (2) by the alcoholic solution dispenser (10).
15) The plate (2) is then shaken by a shaker (5a-6). As shown in FIG. 5, the shaker (5a) is shaken in a state where the shaker (5a) moves upward from the lower side of the lateral movement device, lifts the plate, and is supported by the fixed support (5b) descending from the upper side. . In this process, the fixed support is shown as 5b-6.
16) The plate (2) is allowed to stand for a certain time. However, in order to process the plate continuously, there is an interval of several plates between the shaker (5a-6) and the supernatant aspirating / moving device (11), and only the lateral movement is performed during that interval.
17) The supernatant in the plate (2) is sucked and transferred to the filter plate (12) by the supernatant suction moving machine (11). As the filter plate, those described above, for example, MultiScreenFB (Millipore) may be used. The mechanism of the supernatant aspirating and moving machine is the same as that of the dispensing device (FIG. 16). However, while the dispensing device aspirates the solution from the solution tray and discharges it to the plate, the supernatant aspirating machine aspirates the supernatant from the plate and discharges it to the filter plate. The mechanism of the supernatant aspirator is shown below. When the supernatant is aspirated, the supernatant aspirator moves down to a height suitable for aspirating the supernatant and aspirates the supernatant. After aspiration, the supernatant aspirator moves up again and then moves laterally to above the filter plate in lane B. Furthermore, the supernatant is lowered to a height suitable for discharging the supernatant to the filter plate, and the supernatant is discharged to the filter plate. Subsequently, it rises again, moves laterally to the original position, and is subsequently cleaned by a chip cleaning device (described later). The chip cleaning device is installed on the side surface of the lateral movement device, and moves out immediately below the supernatant aspirating and moving device during cleaning. Thereafter, the supernatant aspirating machine is lowered to a position suitable for cleaning, and the chip is cleaned by the chip cleaning device. After washing, the supernatant aspirating and moving machine moves up to the original position, and the chip washing device returns to the original position.
Here, you may comprise so that a supernatant may move to the 2nd lane (B) formed in parallel with the 1st lane (A) which performed each above process.
18) The solution in the filter plate (12) is aspirated by the plate aspirator (13-1), and the aspirated solution is discarded.
An example of the plate suction machine and its operation is shown in FIG.
As shown in FIG. 4, the plate suction container (201) rises from the lower side to the upper side of the lateral movement device so as to be in close contact with the lateral movement device. A suction tube (202a) is connected to the plate suction container, and the suction tube is connected to a collection bin (203). Another suction tube (202b) is connected to the collection bottle, and the suction tube is connected to a suction pump (204). By taking such a structure, the liquid can be sucked from the plate (12) and collected in the collecting bin (203) by operating the suction pump.
19) The filter of the filter plate (12) is washed with ethanol supplied from the washing liquid dispenser (14). During washing, ethanol is sucked with a plate suction machine (13-2).
20) The plasmid is eluted from the filter with water or TE buffer supplied from the eluent dispenser (15). At the time of washing, water or TE buffer is sucked by a suction elution machine (13-3). The suction elution machine in this step will be described. As shown in FIG. 15, the upper surface and the lower surface of the suction elution machine (13-3) are opened, and the upper surface is in contact with the filter plate (12) on the lateral movement device via the lateral movement device (21). It arrange | positions with a robot arm (602-1 and 602-2) with a titer plate (16) ((2) of FIG.15 (b)). As the titer plate, the above-described elution plate, for example, a polystyrene plate (Whatman) may be used. Here, the titer plates are supplied one by one by a robot arm (not shown) from a titer plate supply stocker (17) (FIG. 1) installed beside the lane B. The suction elution machine is hollow, and the air inside is sucked by the suction tube (601), and the inside becomes negative pressure. The suction elution machine is provided with rubber for preventing air leakage in the inside (for close contact with the titer plate, 603) and the upper part (for close contact with the lateral movement device, 604). This recovers the plasmid from the filter plate (12) along with water or TE buffer to the titer plate. Thereafter, the suction elution machine and the titer plate are returned to the state of (b) and (1) in FIG. 15 by the robot arm, and only the titer plate is separated and collected in the aspirated titer plate stocker (18) (FIG. 1). Thus, the eluted plasmid is collected in a titer plate (16). Here, the supply and storage mechanism of the titer plate will be described. FIG. 18 illustrates a mechanism for supplying and storing the titer plate. The titer plate is stocked in a titer plate supply stocker (17). The mechanism of the titer plate supply stocker is the same as in FIG. The titer plates are taken out one by one by the robot arm controller (901), and are carried to the lower part of the suction elution machine (13-3) by rotating. Next, the titer plate is pushed up and suction is performed. When the suction is completed, the titer plate moves downward, and the robot arm controller rotates, so that the titer plate is carried to above the sucked titer plate stocker (18) and stored therein.
21) The titer plate stocker (16) containing the plasmid was placed in the plate stocker (18) by the robot arm (602-2) (FIG. 15), and the aspirated titer plate stocker (18) (FIG. 1). ) Are stored one by one.
A schematic view of another example of the closed circular DNA preparation apparatus of the present invention is shown in FIG.
FIG. 20 shows an apparatus for preparing closed circular DNA from precipitated cells by manually separating the culture liquid and cells using a centrifuge as a pre-stage of the step of applying the culture liquid to a mechanical device.
As a pre-stage of the step of adding alcohol and / or ketone, the step of the supernatant aspirator (8) in FIG. 1 can be eliminated by separating the culture solution and cells in advance using a centrifuge. . Further, since no waiting time is required until the cells are precipitated, after adding the flocculant with the flocculant dispenser (7), the cells are mixed with the shaker (5a-4), and immediately thereafter the cell lysate dispenser. A cell lysate can be added in (9). Moreover, there exists an advantage of making a preservation | save of a cell easy by precipitating a cell using a centrifuge. That is, it takes time to freeze the culture medium with a large volume, and it also takes time to thaw, so there is a high possibility that cells will die during that time. On the other hand, when cells are precipitated, the volume is small, so that freezing and thawing can be done in a short time, and cell death can be greatly reduced. The cryopreservation of cells is an important step in order to proceed smoothly, especially when preparing closed circular DNA from multiple specimens. The hypertonic liquid dispenser (3) of FIG. 20 is the same as the hypertonic liquid dispenser (3) of FIG. 1, but that of FIG. 20 is not only for dispensing hypertonic liquid but also for suspension. It is a mixture of buffer or medium and hypertonic solution. Further, the shaker (5a-1) is shaken. At this time, the shaker (5a-1) in FIG. 20 needs to be stronger than the shaker (5a-1) in FIG. That is, the shaker (5a-1) in FIG. 20 not only simply mixes the solution, but also includes an element that suspends the precipitated cells. Specifically, the shaker (5a-1) in FIG. 1 has a vibration of 1000 to 1700 rpm, and the shaker (5a-1) in FIG. 20 has a vibration of 1500 to 2000 rpm. Further, in the apparatus of FIG. 20, a cleaning liquid dispenser (14) and a plate suction machine (13-2) are added one by one as compared with FIG. This is because a closed circular DNA with fewer impurities can be obtained by performing the washing step twice.
All devices constituting this device are connected to a computer via an interface board and managed collectively. Specifically, an operation completion signal or an operation incomplete signal is sent to the computer from the sensors of all the devices that operate, via the interface for each device. The computer collectively manages these signals and issues the next operation instruction to each device. That is, if no error is found from any device, a signal for the next operation is sent to each device, and if any error is found, a stop signal is sent to each device.
The (A) lateral movement apparatus in the closed circular DNA preparation apparatus of the present invention corresponds to the lateral movement apparatuses (20) and (21) (FIGS. 1 and 20), which include a belt, a motor, and the like. It is good to have. (B) The hypertonic liquid dispenser (3), the alcohol / ketone dispenser (4), the coagulant auxiliary shaker dispenser (6), the coagulant dispenser ( 7) Cell lysate dispenser (9), alcoholic solution dispenser (10), wash solution dispenser (14) and eluate dispenser (15) (FIGS. 1 and 20), A water level sensor, a solution supply pipe, a pump, a solution bottle, a solution tray, a chip, a pump control device, and the like may be provided. (C) The supernatant aspirator (8), the supernatant aspirator (11), and the supernatant aspirator (11) shown in FIG. 20 correspond to the supernatant aspirator. A discharge tray, a collection bin, a chip, a chip cleaning device, and the like may be provided. (D) The shaker (5a-1 to 5a-6) (FIGS. 1 and 20) and the vibration device (311 and 312) (FIG. 14) correspond to the vibration device, which should be specially manufactured. A commercially available product (for example, vortex etc.) can also be used. (E) The plate suction device (13-1 to 13-3 in FIGS. 1 and 20, FIGS. 4 and 15) corresponds to the plate suction device, which includes a suction container, a tube, and a collection device. It is good to have a bottle, pump, titer plate, etc.

FIG. 6 shows an example of a mechanism for dispensing the liquid in the above steps 2), 4), 6), 8), 12) and 14).
The liquid (302) to be dispensed is stored in the solution tray (306). The collected solution is aspirated quantitatively by the tip (307) and dispensed to the plate (2).
When the solution in the solution tray is depleted, it is detected by the water level sensor (301) and a signal is sent to the pump controller (309). The pump controller draws the solution from the solution bottle (305) and supplies the solution into the solution tray through the solution supply pipe (303). When a certain amount of solution accumulates in the solution tray, the water level sensor senses the water level and sends a signal to the pump controller. Accordingly, the pump control device stops the pump (304).
FIG. 16 is a perspective view of the outline of the dispensing apparatus. The dispensing device has a housing (712), and is connected to a motor (702) and a gear inside thereof by a piston (706) that moves up and down by a screw mechanism (703 and 704), and a fixing metal (711) to the housing. It has a fixed cylinder (705). When a suction instruction is issued from the computer, an electric current flows through the motor, and the piston is raised until the upper sensor (709) senses the solution to be dispensed. When a dispensing instruction is issued from the dispenser controller, a reverse current flows through the motor, the piston is lowered until it is detected by the lower sensor (710), and the solution in the cylinder is discharged from the dispensing port (707). The solution is dispensed from the tip (307) to the plate via the dispensing tube (708).

If the chip needs to be cleaned in the process, it is cleaned by a chip cleaning device. An example of a chip cleaning apparatus is shown in FIG.
The chip cleaning tank (403) is filled with RO (Reverse Osmosis) water (FIG. 7 (a)). The tip of the tip (401) to be cleaned (tip (307) in FIG. 6) is inserted into the cleaning cylinder (402). RO water supply ports are respectively provided on the bottom surface of the cleaning cylinder, and when a chip is inserted, water is supplied and the tip of the chip is cleaned. The RO water overflowing from the cleaning cylinder is drained from the drain port (FIG. 7 (b)).
The closed circular DNA preparation apparatus of the present invention is fully automatic and can isolate closed circular DNA from pathogenic bacteria in a safe space closed from the outside world and diagnose the presence or absence of pathogenicity derived from the closed circular DNA. it can. Furthermore, it can also be used for research to determine whether a pathogenic gene is derived from closed circular DNA.
Furthermore, when the pathogenic bacterium is Escherichia coli, closed circular DNA can be isolated from Escherichia coli in a safe space closed from the outside world to diagnose the presence of pathogenicity derived from the closed circular DNA. Furthermore, it can also be used for research to determine whether a pathogenic gene is derived from closed circular DNA.
With the closed circular DNA preparation apparatus of the present invention, the closed circular DNA is isolated from pathogenic bacteria in a fully automatic and safe space closed from the outside, and the presence or absence of drug resistance derived from the closed circular DNA is diagnosed. Is possible.

Hereinafter, the present invention will be specifically described by way of examples.
As Examples 1 to 3, a method for separating cccDNA from other cell components using an aggregating agent instead of performing centrifugation once will be described.
As Examples 4 and 5, a method for separating cccDNA from other cell constituents by combining centrifugation operation and use of an aggregating agent will be described.
It goes without saying that embodiments of the present invention are not limited to these.
The equipment and E. coli used in the examples are as follows.
Chip: Bio Gilson Yellow Chip (Fuebuki Office)
96-well culture plate: Costar (Corning Incorporated)
Filter plate: MultiScreenFB (Millipore)
Elution plate: PS-Microplate 96 well V-form (Griner)
Example 1, 3 and 4 E. coli Cloning and functional analysis of 60770 mouse full-length cDNAs completed in 2002 (The FANTOM Consortium and The RIKEN Genome Exploration Research Group Phase I & II Team, Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNA, Nature, 420, 563-573, 2002). 60770 cDNAs were obtained from the C57BL / 6J strain of mice using the cap trap method (Carninci, P. et al. Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discoverry of new genes.Genome Res 10, 1617-1630, 2000). The isolated gene was cloned (incorporating cDNA into a vector and introduced into Escherichia coli), cultured in Escherichia coli, purified with a plasmid, and then the entire nucleotide sequence was determined and functional analysis was performed. In this experiment, a gene (clone ID: 9930023M19, size: 3255 bp) incorporated into a vector called pBluescript KS (+) (Stratagene) and introduced into E. coli strain DH10B was used. The base sequence and annotation information are available on the web page (http://fantom2.gsc.riken.go.jp/).
Example 2 E. coli Cloning and functional analysis of 60770 full-length mouse cDNAs completed in 2002 (The FANTOM Consortium and The RIKEN Genome Exploration Research Group Phase I & II Team, Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNA, Nature, 420, 563-573, 2002), and experiments were carried out using 5 of them. 60770 cDNAs were obtained from the C57BL / 6J strain of mice using the cap trap method (Carninci, P. et al. Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discoverry of new genes.Genome Res 10, 1617-1630, 2000). The isolated gene was cloned (incorporating cDNA into a vector and introduced into Escherichia coli), cultured in Escherichia coli, purified with a plasmid, and then the entire nucleotide sequence was determined and functional analysis was performed. In this experiment, a gene (clone ID: 9930033A02, 9930023M19, 9930039L23, 9930022D09, A130007D10) incorporated into a vector called pBluescript KS (+) (Stratagene) and introduced into E. coli strain DH10B was used. The base sequence and annotation information are available on the web page ( http://fantom2.gsc.riken.go.jp/ ).

[Example 1]
Plasmid preparation from small-sample E. coli culture using 1.5 ml tube The plasmid DNA of pBluescript KS (+) previously incorporated into E. coli DH10B was isolated. In this plasmid DNA, mouse gene DNA (clone ID: 9930023 M19, size: 3255 bp) is incorporated.
material:
LB medium 500μl
5M sodium chloride 100μl
100% isopropanol 300 μl
500mg / ml calcium carbonate 40μl
4mg / ml polyaluminum chloride 20μl
2% Triton X-100, 4 mM Tris-HCl (pH 8), 0.4 mM EDTA, 20 mM NaCl, 5 mg / ml lysozyme, 67 μg / ml RNase A mixture 150 μl
120μl of 20% polyethylene glycol, 2.5M NaCl mixture
70% ethanol 300 μl
TE 100μl
MultiScreenFB (Millipore)

Procedure 1) LB medium containing ampicillin was inoculated with E. coli taken from a single colony and incubated at 37 ° C. for 12-20 hours. A culture tube or flask having a volume at least 4 times the culture was used. During the culture, aeration was performed, and the culture was tilted approximately 30 degrees and vigorously shaken (˜300 rpm).
2) About 500 μl of the culture solution was taken and transferred to a 1.5 ml tube.
3) 100 μl of 5M sodium chloride was added and mixed.
4) 300 μl of 100% isopropanol was added and mixed.
5) 40 μl of 500 mg / ml calcium carbonate was added and mixed.
6) 20 μl of 4 mg / ml polyaluminum chloride was added and mixed.
7) The tube was set up vertically and allowed to stand for 8 minutes.
8) Remove only the supernatant using Pipetman, taking care not to remove the precipitate. About 150 μl of precipitate with a slight supernatant remained at this time.
9) To this precipitate, 150 μl of a mixture of 2% Triton X-100, 4 mM Tris-HCl (pH 8), 0.4 mM EDTA, 20 mM NaCl, 5 mg / ml lysozyme, 67 μg / ml RNase A was added.
10) Immediately, weak intermittent vibration, that is, 0.5 second vibration → 0.5 second stationary, was repeated 10 times. Vibration (˜1700 rpm) is required so that the precipitate generated in (8) is completely mixed with the solution added in (9). However, if excessive vibration is applied, the precipitate decomposes and a clear supernatant is obtained. There is no need for attention. After applying a weak intermittent vibration, make sure that the supernatant is clear.
11) 120 μl of 20% polyethylene glycol, 2.5 M NaCl was added and mixed.
12) Let stand for 90 seconds.
13) The supernatant produced in (12) was placed on a filter capable of ultrafiltration (MultiScreenFB manufactured by Millipore), and suction filtration was performed.
14) 70% ethanol was added and suction filtration was performed.
15) Plasmid DNA was eluted from the filter with 100 μl TE and collected.

Electrophoresis of isolated plasmid DNA Agarose gel electrophoresis of the plasmid DNA isolated in Example 1 was performed.
Agarose-1 (Wako Pure Chemical Industries, Ltd.) having a concentration of 1% was prepared and set in an electrophoresis bottle filled with TAE buffer (Tris 40 mM, acetic acid 40 mM, 1 mM EDTA). 4 μl of 100 μl of the plasmid DNA isolated in (15) described in Example 1 was electrophoresed. Plasmid DNA isolated with Qiagen Mini Prep Kit was also electrophoresed with 4 μl of 100 μl eluted. As a marker DNA, GeneRuler ^{™ 1} Kb DNA Ladder (MBI fermentas) was used. The result is shown in FIG. The markers were run to a total of 200 ng. As a result of electrophoresis, RNA was not observed visually and almost no genomic DNA contamination was observed. When compared with the electrophoresis marker, it was found that the amount of plasmid DNA isolated from 500 μl of the bacterial solution was about 2.5 μg.

PCR using isolated plasmid DNA
Mouse gene DNA (clone ID: 9930023 M19, size: 3255 bp) incorporated into the plasmid DNA isolated in Example 1 was amplified by PCR. As the primer DNA for amplification, 1st-BS (TGTAAAACGACGGCCAGT) (SEQ ID NO: 1) and 2nd-NX / X (TCCTGTGTGAAATTGTTATCCGCT) (SEQ ID NO: 2) were used. The reaction buffer for amplification is as follows.
1) 10 × Buffer 2.5μl
2) 25 mM MgSO ₄ 1 μl
3) 2mM dNTP 2.5μl
4) 5 pmol/μl primer DNA 0.5μl each
5) 2 ng / μl of isolated plasmid DNA 1 μl
6) KOD plus 0.75μl
7) Distilled water 16.25μl
The reaction temperature and time are as follows: 1) 94 ° C 2 minutes 2) 94 ° C 1 minute 3) 60 ° C 30 seconds 4) 68 ° C 2 minutes (2) to (4) repeated 30 times
The results of PCR are shown in FIG. As shown in this figure, a sufficient amount of the target DNA was amplified, and it was found that the plasmid DNA isolated by this method can be used for PCR.

Transformation of isolated plasmid DNA Transformation of the isolated plasmid DNA was performed. Using the competent cells of Escherichia coli DH10B, the plasmid DNA was diluted to 2 ng / μl, and then the following operation was performed.
1) Remove 10 μl of competent cells from the -80 ° C freezer and thaw on ice 2) Put 1 μl of 2 ng / μl plasmid DNA into competent cells and mix gently 3) Mix the solution at 40 ° C 4) Incubate for 45 seconds 4) Place on ice again, mix 1 ml of LB medium without antibiotics 5) Incubate 1 hour at 37 ° C 6) Take 20 μl from the incubated solution and spread on plate medium with ampicillin 7 ) As a result of overnight culture at 37 ° C, 9 E. coli colonies were formed. From this, it was found that the plasmid DNA isolated by this method can be used for transformation.

[Example 2]
Plasmid preparation from multiple samples of E. coli using a 96-well plate Plasmid DNA of pBluescript KS (+) previously incorporated into E. coli DH10B was isolated. All specimens have plasmids containing different mouse genes (clone IDs: 9930033A02, 9930023M19, 9930039L23, 9930022D09, A130007D10).
material:
LB medium 500μl each
5M sodium chloride 100μl each
100% isopropanol each 300μl
500mg / ml calcium carbonate 40μl each
4mg / ml polyaluminum chloride 20μl each
2% Triton X-100, 4 mM Tris-HCl (pH 8), 0.4 mM EDTA, 40 mM NaCl, 5 mg / ml lysozyme, 67 μg / ml RNase A mixture 150 μl each
120μl each of 20% polyethylene glycol, 2.5M NaCl mixture
70% ethanol 300 μl each
TE 100μl each
MultiScreenFB (Millipore)

Procedure 1) E. coli taken from a single colony was inoculated into 500 μl of LB medium containing ampicillin in each well and incubated at 37 ° C. for 12 to 20 hours. A 96-well culture plate (Costar, Corning Incorporated) was used for culturing, and aeration was performed, and the cells were cultured at about 30 degrees and shaken vigorously (˜300 rpm).
2) 100 μl of 5M sodium chloride was added to each well and mixed.
3) 300 μl of 100% isopropanol was added to each well and mixed.
4) 40 μl of 500 mg / ml calcium carbonate was added to each well and mixed.
5) 20 μl of 4 mg / ml polyaluminum chloride was added to each well and mixed.
6) Allowed to stand for 8 minutes.
7) Remove only the supernatant using a special chip stopper, taking care not to remove the precipitate. About 150 μl of precipitate with a slight supernatant remained at this time.
9) To this precipitate, 150 μl of 2% Triton X-100, 4 mM Tris-HCl (pH 8), 0.4 mM EDTA, 20 mM NaCl, 5 mg / ml lysozyme, 67 μg / ml RNase A was added to each well.
10) Immediately, weak intermittent vibration, that is, 0.5 second vibration → 0.5 second stationary, was repeated 10 times. It requires vibration (~ 1700rpm) that the precipitate generated in 8 is completely mixed with the solution added in 9. However, if too much vibration is applied, the precipitate will decompose and a clear supernatant cannot be obtained. Cost. After applying a weak intermittent vibration, make sure that the supernatant is clear.
11) 120 μl of 20% polyethylene glycol, 2.5 M NaCl was added to each well and mixed.
12) Let stand for 90 seconds.
13) The supernatant produced in (12) was placed on a filter capable of ultrafiltration (such as MultiScreen FB manufactured by Millipore) using a dedicated chip stopper and subjected to suction filtration.
14) 70% ethanol was added and suction filtration was performed.
15) Plasmid DNA was eluted from the filter with 100 μl TE and collected.

Electrophoresis of isolated plasmid DNA Agarose gel electrophoresis of several plasmid DNAs isolated in Example 2 was performed.
Agarose-1 (Wako Pure Chemical Industries, Ltd.) having a concentration of 1% was prepared and set in an electrophoresis bottle filled with TAE buffer (Tris 40 mM, acetic acid 40 mM, 1 mM EDTA). 4 μl of 100 μl of each plasmid DNA isolated in (15) described in Example 2 was electrophoresed. As a marker DNA, GeneRuler ^{™ 1} Kb DNA Ladder (MBI fermentas) was used. The result is shown in FIG. The markers were run to a total of 200 ng. In the figure, 1 to 5 are plasmid DNAs containing different mouse genes. From the left in FIG. 11, clone IDs: 9930033A02, 9930023M19, 9930039L23, 9930022D09, and A130007D10.

[Example 3]
Large-scale preparation of plasmid from Escherichia coli culture solution using a culture tube Plasmid DNA of pBluescript KS (+) previously incorporated into Escherichia coli DH10B was isolated. In the plasmid DNA, mouse gene DNA (clone ID: 9930023 M19, size: 3255 bp) is incorporated.
material:
LB medium 20ml
5M sodium chloride 4ml
100ml isopropanol 12ml
500mg / ml calcium carbonate 1.6ml
4mg / ml polyaluminum chloride 0.8ml
2% Triton X-100, 4 mM Tris-HCl (pH 8), 0.4 mM EDTA, 20 mM NaCl, 5 mg / ml lysozyme, 67 μg / ml RNase A mixture 5 ml
4% 20% polyethylene glycol, 2.5M NaCl mixture
70% ethanol 5ml
TE 1ml
Millex ^R -HV (Millipore)

Procedure 1) E. coli taken from a single colony was inoculated into 20 ml of LB medium containing ampicillin and incubated at 37 ° C. for 20 hours. For the culture, a 50 ml culture tube (Falcon, Becton Dickinson) was used so that aeration was performed, and the culture was tilted approximately 30 degrees and vigorously shaken (˜300 rpm).
2) 4 ml of 5M sodium chloride was added and mixed.
3) 12 ml of 100% isopropanol was added and mixed.
4) 1.6 ml of 500 mg / ml calcium carbonate was added and mixed.
5) 0.8 ml of 4 mg / ml polyaluminum chloride was added and mixed.
6) Let stand for 15 minutes.
7) While taking care not to remove the precipitate, only the supernatant was removed with a pipetteman or pipette. Here, the precipitate containing a small amount of supernatant became about 5 ml.
9) To this precipitate, 5 ml of a mixture of 2% Triton X-100, 4 mM Tris-HCl (pH 8), 0.4 mM EDTA, 20 mM NaCl, 5 mg / ml lysozyme, 67 μg / ml RNase was added.
10) 500 μl of 6M potassium carbonate (pH 6) was added.
11) The tube lid was closed and inverted 10 times.
12) 4 ml of 20% polyethylene glycol, 2.5M NaCl was added and the tube was inverted.
13) Let stand for 90 seconds. Here, about 15 ml of supernatant was obtained.
14) 3 ml of the supernatant obtained in (13) was sucked up with a syringe and subjected to ultrafiltration using Millex ^R- HV manufactured by Millipore.
15) 5 ml of 70% ethanol was sucked with a syringe, and the filter was washed.
16) Plasmid DNA was eluted from the filter with 800 μl of TE and collected.
17) The above operations 14 to 16 were repeated 5 times to obtain a total of 4 ml of eluate.

Electrophoresis of isolated plasmid DNA Agarose gel electrophoresis of the plasmid DNA isolated in Example 3 was performed.
Agarose-1 (Wako Pure Chemical Industries, Ltd.) having a concentration of 1% was prepared and set in an electrophoresis bottle filled with TAE buffer (Tris 40 mM, acetic acid 40 mM, 1 mM EDTA). 4 μl of the plasmid DNA isolated from Example 1 (100 μl) and 4 μl of 4 ml of the plasmid DNA isolated in (17) described in Example 3 were compared. In Example 1, 100 μl was eluted from 0.5 ml of bacterial solution, and in Example 3, 4 ml was eluted from 20 ml of bacterial solution, so the elution ratio is the same. GeneRuler ^{™ 1} Kb DNA Ladder (MBI fermentas) was used as the marker DNA. The result is shown in FIG. The markers were run to a total of 200 ng. When isolated in a large amount, as in the case of a small amount, RNA was not observed at all visually, and contamination of genomic DNA was hardly observed. When compared with the electrophoresis marker, it was found that the amount of plasmid DNA isolated from 20 ml of the bacterial solution was about 100 μg.

[Example 4]
Preparation of plasmid from small sample E. coli culture using centrifuge (preparation using 1.5ml tube)
The plasmid DNA of pBluescript KS (+) previously incorporated into Escherichia coli DH10B was isolated. In this plasmid DNA, mouse gene DNA (clone ID: 9930023 M19, size: 3255 bp) is incorporated.
material:
1 ml of LB medium for culture
80 μl of LB medium for suspension
5M sodium chloride 20μl
100% isopropanol 50μl
500mg / ml calcium carbonate 20μl
4mg / ml polyaluminum chloride 5μl
2% Triton X-100, 4 mM Tris-HCl (pH 8), 0.4 mM EDTA, 20 mM NaCl, 5 mg / ml lysozyme, 67 μg / ml RNase A mixture 150 μl
120μl of 20% polyethylene glycol, 2.5M NaCl mixture
70% ethanol 600μl
TE 100μl
MultiScreenFB (Millipore)

Procedure 1) LB medium containing ampicillin was inoculated with E. coli taken from a single colony and incubated at 37 ° C. for about 16 hours. A culture tube or flask having a volume at least 4 times the culture was used. During the culture, aeration was performed, and the culture was tilted approximately 30 degrees and vigorously shaken (˜300 rpm).
2) 1 ml of the culture solution was taken and transferred to a 1.5 ml tube.
3) Using a centrifuge, the cells were centrifuged at 20000 × g for 10 seconds to precipitate the cells.
4) The supernatant was removed by decantation. The remaining liquid was completely removed using a pipette.
5) 80 μl of LB medium and 20 μl of 5M sodium chloride were mixed well, the whole amount was added to a 1.5 ml tube, and the precipitated bacteria were well suspended using a pipette.
6) 50 μl of 100% isopropanol was added and mixed.
7) 20 μl of 500 mg / ml calcium carbonate was added and mixed.
8) 5 μl of 4 mg / ml polyaluminum chloride was added and mixed.
9) 150 μl of 2% Triton X-100, 4 mM Tris-HCl (pH 8), 0.4 mM EDTA, 20 mM NaCl, 5 mg / ml lysozyme, 67 μg / ml RNase A was added to the precipitate.
10) Immediately, with a weak intermittent vibration (˜1700 rpm), 0.5 second vibration → 0.5 second stationary was repeated 10 times. Then, it was mixed by inverting 5 times up and down. Care should be taken because if the vibration is too strong, the precipitate will decompose and a clear supernatant cannot be obtained.
11) 120 μl of 20% polyethylene glycol, 2.5M NaCl was added and mixed.
12) Let stand for 90 seconds.
13) 300 ul of the supernatant produced in (12) was placed on a filter capable of ultrafiltration (MultiScreenFB manufactured by Millipore), and suction filtration was performed.
14) 300 μl of 70% ethanol was added and suction filtration was performed.
15) 300 μl of 70% ethanol was added again, and suction filtration was performed.
16) Plasmid DNA was eluted from the filter with 100 μl TE and collected.

Electrophoresis of isolated plasmid DNA Agarose gel electrophoresis of the plasmid DNA isolated in Example 4 was performed.
Agarose-1 (Wako Pure Chemical Industries, Ltd.) having a concentration of 1% was prepared and set in an electrophoresis bottle filled with TAE buffer (Tris 40 mM, acetic acid 40 mM, 1 mM EDTA). 4 μl of 100 μl of the plasmid DNA isolated in (16) described in Example 4 was electrophoresed. For comparison, the plasmid DNA isolated in (16) described in Example 1 was also electrophoresed. Further, GeneRuler ^{™ 1} Kb DNA Ladder (MBI fermentas) was used as the marker DNA. The result is shown in FIG. The marker DNA was electrophoresed to a total of 200 ng. As a result of electrophoresis, RNA was not observed visually and almost no genomic DNA contamination was observed. When compared with the electrophoresis marker, it was found that the amount of plasmid DNA isolated from 1 ml of the bacterial solution was about 8 μg.

  According to the present invention, closed circular DNA with low cost and good quality can be purified in a large amount in a short time, and can greatly contribute to research or medical care using closed circular DNA.

It is the schematic of one example of the closed circular DNA preparation apparatus of this invention. It represents the mechanism of the lateral movement device and the position of the shaker. A plate is set on a lateral movement device. The plate suction machine and its operation are shown. It represents the movement of the shaker and the stationary support. It represents a solution dispenser. (a) shows the configuration of each element. (b) schematically shows an operation in which a dispensing solution is aspirated from a solution tray and dispensed onto a plate. It represents a chip cleaning apparatus. (a) is a perspective view, (b) is a cross-sectional view taken along line AA. It shows a chip stopper. (a) is a cross-sectional view of AA shown in (b), and (b) is a perspective view. The result of the electrophoresis of the plasmid DNA isolated in Example 1 is shown. M: marker DNA, 1: plasmid DNA isolated by Qiagen Mini Prep Kit, 2: plasmid DNA isolated by the method of the present invention. The result of having amplified the mouse | mouth gene DNA integrated in the plasmid DNA isolated in Example 1 by PCR is shown. M: marker DNA, 1: mouse gene DNA incorporated into plasmid DNA isolated by Qiagen Mini Prep Kit, amplified by PCR, 2: mouse gene DNA incorporated into plasmid DNA isolated by the method of the present invention Is amplified by PCR. The result of the electrophoresis of the plasmid DNA isolated in Example 2 is shown. M: Marker DNA, 1-5: Plasmid DNA isolated by the method of the present invention. The result of the electrophoresis of the plasmid DNA isolated in Examples 1 and 3 is shown. M: marker DNA, 1: plasmid DNA isolated by the method of the present invention in Example 1, 2: plasmid DNA isolated by the method of the present invention in Example 3. 1 shows a scheme of one example of a method for preparing a closed circular DNA of the present invention. It represents a coagulant aid dispenser. A suction elution machine is shown. It represents a dispensing device. It shows the structure of the plate stocker. It shows the supply and storage mechanism of the titer plate. It represents the discharge tray. It is the schematic of another example of the closed circular DNA preparation apparatus of this invention. It represents the scheme of another example of the closed circular DNA preparation method of the present invention. The result of the electrophoresis of the plasmid DNA isolated in Examples 1 and 4 is shown. M: marker DNA, 1: plasmid DNA isolated in Example 1, 2: plasmid DNA isolated in Example 4.

Explanation of symbols

1: Plate stocker 2: Plate 3: Hypertonic liquid dispenser 4: Alcohol / ketone dispenser 5a, 5a-1, 5a-2, 5a-3, 5a-4, 5a-5, 5a-6: Shaker 5b, 5b-1, 5b-2, 5b-3, 5b-4, 5b-5, 5b-6: Fixed support 6: Aggregation aid shaking dispenser 7: Aggregant dispenser 8: Supernatant suction Ejector 9: Cell lysate dispenser 10: Alcoholic solution dispenser 11: Supernatant suction transfer machine 12: Filter plate 13-1, 13-2: Plate aspirator 13-3: Suction elution machine 14: Washing liquid Dispenser 15: eluent dispenser 16: titer plate 16-1: plate 16-2: plate 16-3: plate 16-4: plate 17: titer plate supply stocker 18: aspirated titer plate stocker 20, 21 : Horizontal movement device A: First B: second lane 101: frame 102: holding member 103: connecting member 201: suction container 202a, 202b: tube 203: collection bottle 204: pump 301: water level sensor 302: dispensing solution 303: solution supply pipe 304 : Pump 305: solution bottle 306: solution tray 307: tip 309: pump control device 310: connecting part 311: vibration device 312: vibration device 401: tip 402: cleaning cylinder 403: tip cleaning tank 501: tip stopper 502: tip 503: Supernatant 504: Precipitation 601: Suction tube 602-1: Robot arm 602-2: Robot arm 603: Sealing rubber 604: Sealing rubber 701: Motor wiring 702: Motor 703: Screw mechanism 704: Screw mechanism 705: Cylinder 706: Piston 707: Dispensing port 708: Note Tube 709: Sensor 710: Sensor 711: fixing bracket 712: housing 801: plate stopper 1
802: Plate stopper 2
803: Robot arm 804: Housing 901: Robot arm controller

<SEQ ID NO: 1>
SEQ ID NO: 1 shows the base sequence of 1st-BS used as the primer DNA for amplification in Example 1.
<SEQ ID NO: 2>
SEQ ID NO: 2 shows the base sequence of 2nd-NX / X used as the primer DNA for amplification in Example 1.

Claims (15)

A method for preparing closed circular DNA from cells, comprising the step of adding an aggregating agent to a liquid containing cells. The following steps:
(A) adding at least one alcohol and / or ketone to the liquid containing the cells;
(B) adding a flocculation aid and a flocculating agent to the liquid containing the cells, and separating the supernatant into a precipitate;
(C) removing the supernatant from the supernatant and precipitate produced in step (b);
(D) adding a cell lysate to the precipitate after removing the supernatant in step (c);
(E) A step of applying vibration to the liquid mixture produced in step (d);
(F) a step of adding an alcoholic solution to the mixed solution that has been vibrated in step (e); and (g) passing the supernatant of the mixed solution to which the alcoholic solution has been added in step (f) through an ultrafiltration filter. The method according to claim 1, further comprising the step of recovering the closed circular DNA. The method according to claim 2, which does not include a step of performing centrifugation. The method according to claim 2 or 3, wherein the hypertonic solution is brought into contact with cells as a pre-step of the step (a). The following steps:
(A ′) the step of precipitating the cultured cells by centrifugation and removing the supernatant;
(B ′) suspending the precipitated cells with a buffer or a medium to prepare a cell suspension;
(C ′) adding at least one alcohol and / or ketone to the cell suspension;
(D ′) a step of adding a coagulant aid and a coagulant to the cell suspension;
(E ′) adding a cell lysate to the cell suspension;
(F ′) applying vibration to the mixed solution produced in step (e ′);
(G ′) adding the alcoholic solution to the mixed solution subjected to vibration in step (f ′); and (h ′) limiting the supernatant of the mixed solution to which the alcoholic solution is added in step (g ′). The method of claim 1 comprising the step of recovering closed circular DNA through a filtration filter. The method according to claim 5, wherein the buffer or medium in step (b ') is a hypertonic solution. The method according to any one of claims 1 to 6, wherein the cell is a unicellular organism. The method of claim 7, wherein the unicellular organism is a bacterium. The method according to claim 8, wherein the bacterium is Escherichia coli. The method according to any one of claims 1 to 9, wherein the cell is a transformant. The method according to any one of claims 1 to 10, wherein the closed circular DNA is selected from the group consisting of plasmid DNA, cosmid DNA, P1 DNA, BAC DNA, PAC DNA, and YAC DNA. A kit for use in the method according to any one of claims 1 to 11, comprising the following components:
(a) a solution comprising at least one alcohol and / or ketone;
(b) an aggregation aid;
(c) a flocculant;
(d) a cell lysate;
(e) an alcoholic solution;
(f) a cleaning solution; and
(g) A kit containing the eluate. In addition, the following elements:
(h) chip;
(i) a tipping device; and
(j) The kit of Claim 12 containing a culture plate. An apparatus for preparing closed circular DNA comprising the following apparatuses:
(A) lateral movement device;
(B) Dispensing device;
(C) Supernatant suction device;
(D) Vibration device;
(E) a plate suction device; and
(F) A device including a robot arm. A method of separating closed circular DNA from other cellular constituents using an aggregating agent.

Images