JP2006095139A - Separating apparatus using nucleic acid ligand - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide an apparatus for separating a separated object selectively and efficiently from a biological liquid, such as blood. <P>SOLUTION: The apparatus for separating the separated object from a biological liquid has (A) a substrate and (B) a nucleic acid ligand having selective high affinity to the separated object. In the apparatus, the nucleic acid ligand is immobilized on a surface of the substrate. <P>COPYRIGHT: (C)2006,JPO&NCIPI

Description

  The present invention relates to a separation device for selectively removing a separation object from a biological fluid such as blood.

  Humoral cells such as leukocytes (neutrophils, eosinophils, basophils, lymphocytes, monocytes), platelets, and cytokines with various cell surface molecules classified by CD number are extremely important in the immune system. It is known to play a role. Human CD4 is a glycoprotein, exists on the cell membrane as a monomer, and is mainly expressed in T lymphocytes. T lymphocytes expressing CD4 (CD4 positive T lymphocytes) have the properties of helper T lymphocytes and recognize antigens presented by class II MHC molecules. It is also known that CD4-positive T lymphocytes bind to HIV (AIDS virus) and act as a receptor during infection. In the immune system, T lymphocytes are essential to respond appropriately to antigens.

  In order to prevent autoimmune disorders in healthy individuals, various mechanisms are available such as removal of lymphocyte clones with autoreactive antigen receptors, their dereactivity, and suppression of their function (immune tolerance). . Although the mechanism related to the development of autoimmune diseases has not been fully elucidated, it is thought that such abnormal immune tolerance causes autoimmune diseases. Lymphocyte clones with self-reactive antigen receptors are not only T4 lymphocytes expressing CD4, but the importance of CD4 positive T lymphocytes in autoimmune diseases is recognized.

  On the other hand, cytokines, which are representative of humoral factors, are a diverse group of proteins that induce cell signaling / cell interactions. They exert biological functions through their specific receptors that are expressed on the surface of target cells. Cytokines can be subdivided into several groups including immuno / hematopoietin, interferon, tumor necrosis factor (TNF) -related molecules, and chemokines. Representative immuno / hematopoietins include erythropoietin (EPO), granulocyte / macrophage colony stimulating factor (GM-CSF), granulocyte colony stimulating factor (G-CSF), leukemia inhibitory factor (LIF), oncostatin-M. (OSM), chorionic neurotrophic factor (CNTF), growth hormone (GH), prolactin (PRL), interleukin (IL) -2, IL-3, IL-4, IL-5, IL-6, IL- 7, IL-9, IL-10 and IL-12. Exemplary interferons (IFN) include IFNα, IFNβ and IFNγ. Exemplary TNF family members include TNFα, interferon (IFN) β, gp39 (CD40-L), CD27-L, CD30-L, and nerve growth factor (NGF). Representative chemokines are platelet factor (PF) 4, platelet basic protein (PBP), groα, MIG, ENA-78, macrophage inflammatory protein (MIP) 1α, MIP1β, monocyte chemotactic protein (MCP) -1, I-309, HC14, C10, Regulated on Activation, Normal T-cell Expressed, and Secreted (RANTES), and IL-8.

  Leukocytes such as CD4 positive T lymphocytes, humoral factors such as platelets and cytokines are used in autoimmune diseases such as Sjogren's syndrome such as rheumatoid arthritis, juvenile diabetes, myasthenia gravis, severe inflammatory bowel disease, In addition to multiple sclerosis, human systemic lupus erythematosus (SLE), or atopic condition (allergy / asthma), graft body disease (GVHD), sepsis, SIRS (systemic inflammatory response syndrome), ARDS (acute (Respiratory distress syndrome), infection, interstitial pneumonia, cerebral malaria, AIDS, Parkinson's disease, or endometriosis is known to have a great effect and influence.

  As a treatment method for autoimmune diseases and sepsis, administration of a corticosteroid agent, removal of the spleen, or administration of an immunosuppressive agent is performed depending on the degree of the symptoms. However, there are many cases in which such drug therapy and splenectomy are not effectively recovered. A treatment method that is surely effective for such patients has not yet been established, and the development of such methods is urgently needed.

  As other treatment methods such as autoimmune diseases and sepsis, various attempts have been made to adsorb and remove leukocytes such as CD4-positive T lymphocytes and cytokines by extracorporeal circulation of blood using an immunoadsorption column. For example, application of a column in which an anti-CD4 antibody having a binding property with a CD4 antigen is immobilized on a carrier is also being studied. However, anti-CD4 antibodies are extremely expensive, and various problems remain in using the above column as a medical device that requires high stability and safety. Further, CD4 positive cell adsorbents or cytokine adsorbents on which a polypeptide having affinity for CD4 positive T lymphocytes or cytokines is immobilized have been studied. However, the affinity and specificity of the polypeptide used for the ligand are considered. There is a problem and sufficient selective adsorption capacity is not achieved.

  An object of the present invention is to provide means capable of selectively separating a specific separation object from a biological fluid such as blood. More specifically, it is an object of the present invention to provide an apparatus for efficiently and safely separating separation objects such as white blood cells such as CD4 positive T lymphocytes and cytokines from biological fluids such as blood. is there.

  In order to solve the above-mentioned problems, the present inventor has high selectivity and affinity for leukocytes such as CD4-positive T lymphocytes or humoral factors such as platelets and cytokines, and is inexpensive and has extracorporeal blood circulation. Research has been conducted to provide highly safe ligands that do not cause problems such as side effects even when used in medical applications. As a result, nucleic acid ligands created and optimized by applying a method known as SELEX (Systematic Evolution of Ligands by Exponential Enrichment) have a strong affinity for leukocytes such as CD4-positive T lymphocytes and platelets and cytokines. It has been found that it has selectivity and can be safely used as a ligand that can be prepared at low cost for medical use such as extracorporeal circulation. The present invention has been completed based on the above findings.

That is, according to the present invention, an apparatus for separating an object to be separated in a biological fluid, comprising (A) a base material and (B) a nucleic acid ligand having a selective and high affinity for the object to be separated. And a device in which the nucleic acid ligand is immobilized on the surface of the substrate is provided.
According to a preferred embodiment of the present invention, the nucleobase constituting the nucleic acid ligand contains at least one nucleobase selected from the group consisting of 2′-aminopyrimidine, 2′-fluoropyrimidine, and 2′-methoxypurine. The above-mentioned device in which the biological fluid is blood; the above-mentioned device in which the blood is blood in extracorporeal circulation; the above-described device in which the separation object is CD4-positive nucleated cells; A device packed in a column; the device used for the treatment and / or prevention of autoimmune disease; and Sjogren's syndrome such as rheumatoid arthritis, juvenile diabetes, severe muscle There is provided a device as described above that is asthenia, severe inflammatory bowel disease, multiple sclerosis, human systemic lupus erythematosus (SLE), or atopic condition (allergy / asthma). It is.

  From another aspect, the present invention provides a method for separating an object to be separated from a biological fluid using the apparatus described above. From another aspect, autoimmune diseases, preferably Sjogren's syndrome such as rheumatoid arthritis, juvenile diabetes, myasthenia gravis, severe inflammatory bowel disease, multiple sclerosis, human systemic lupus erythematosus (SLE) ), Or a method for the treatment and / or prevention of an atopic condition (allergy / asthma), the method comprising the step of separating the separation object involved in the disease from the blood using the above device.

  The device of the present invention has a selective affinity for separation objects such as leukocytes such as CD4 positive T lymphocytes or humoral factors such as platelets and cytokines, and can be manufactured at low cost, and can be manufactured at a low cost. When used for medical purposes, it has a feature that it can be used with high safety without causing problems such as side effects. Using the device of the present invention, cells such as T lymphocytes and humoral factors such as cytokines for the purpose of treating and / or preventing diseases such as autoimmune diseases, sepsis, or cancer from biological fluids such as blood Can be removed safely and efficiently.

  In the present specification, the “biological liquid” means a liquid containing a biological substance such as a biological substance, cell, tissue or the like. Examples of biological substances include biological constituents such as proteins, lipids, sugars, or nucleic acids, as well as cells, viruses, bacteria, or tissues. The biological fluid may contain one or more organic or inorganic substances in addition to the above-described biological substances. The solvent constituting the biological liquid is mainly water, but may contain a small amount of an organic solvent such as alcohols within a physiologically acceptable range. More specifically, examples of the biological fluid include blood, lymph, bone marrow, organ digestive fluid, or culture fluid. Among these, blood, lymph fluid, bone marrow fluid, or organ digestive fluid contains many impurities that interfere with selective adsorption by various conventionally used adsorbents, and selectively removes separation objects. It was difficult. In particular, blood contains a large amount of contaminants, and also contains a large amount of degrading enzymes for conventional adsorbents such as antibodies and polypeptides. It was difficult. On the other hand, since the nucleic acid ligand of the present invention is hardly affected by the impurities as described above, the separation target contained in blood, lymph fluid, bone marrow fluid, or organ digestive fluid is removed very efficiently and selectively. It becomes possible.

  In the present specification, “separation target” means a specific biological product to be removed from biological materials such as biological materials, cells, tissues, etc. contained in a biological fluid. ing. Examples of separation objects include leukocytes (neutrophils, eosinophils, basophils, lymphocytes, or monocytes) having various cell surface molecules classified by CD numbers, blood cells such as platelets, cytokines, etc. Can be mentioned. Further, the separation object may be a foreign-derived biological material such as bacteria, virus, endotoxin, or prion.

  Examples of leukocytes include CD4 positive T lymphocytes, CD4 positive CD25 positive T lymphocytes, CD4 positive nucleated cells such as CD4 positive monocytes, CD14 positive nucleated cells, and the like. Cytokines can be subdivided into several groups including immuno / hematopoietin, interferon, tumor necrosis factor (TNF) -related molecules, and chemokines. Representative immuno / hematopoietins include, for example, erythropoietin (EPO), granulocyte / macrophage colony stimulating factor (GM-CSF), granulocyte colony stimulating factor (G-CSF), leukemia inhibitory factor (LIF), oncogene. Statins-M (OSM), chorionic neurotrophic factor (CNTF), growth hormone (GH), prolactin (PRL), interleukin (IL) -2, IL-3, IL-4, IL-5, IL-6 , IL-7, IL-9, IL-10, and IL-12. Exemplary interferons (IFN) include, for example, IFNα, IFNβ, and IFNγ. Exemplary TNF family members include, for example, TNFα, interferon (IFN) β, gp39 (CD40-L), CD27-L, CD30-L, and nerve growth factor (NGF). Representative chemokines include, for example, platelet factor (PF) 4, platelet basic protein (PBP), groα, MIG, ENA-78, macrophage inflammatory protein (MIP) 1α, MIP1β, monocyte chemotactic protein (MCP). ) -1, I-309, HC14, C10, Regulated on Activation, Normal T-cell Expressed, and Secreted (RANTES), and IL-8. Examples of humoral factors such as cytokines include, for example, anandamide (ANA), 2-arachidonoyllycerol (2-AG), high mobility protein group 1 (HMG-1), advanced glycation end products (AG), IgM, IgA, IgE, IgD) and the like. But in this invention, the isolation | separation target object is not limited to the specific thing demonstrated above. In addition, it is also possible to remove two or more types of separation objects with one nucleic acid ligand.

In the present specification, the “nucleic acid ligand” refers to a nucleic acid that selectively has a high affinity for the separation target, or a nucleic acid that includes one or more of the nucleic acids as a partial structure, or these It means a complex composed of one or more kinds of nucleic acids and one or more kinds of other substances. In general, the affinity is represented by a dissociation constant between the nucleic acid ligand and the separation target. Usually, the dissociation constant is 10 ⁻² or less, preferably 10 ⁻⁴ or less, more preferably 10 ⁻⁶ or less, particularly preferably. Is 10 ^-9 or less. More specifically, the nucleic acid is a natural nucleobase such as adenine, guanine, cytosine, uracil, or thymine, or 5-methylcytosine, 6-methylaminopurine, 2′-aminopyrimidine, 2′-fluoropyrimidine. Or a nucleic acid composed of a non-natural nucleobase such as 2′-methoxypurine. For example, when the device of the present invention is used for use in contact with blood, such as a blood extracorporeal circulation device, 2′-aminopyrimidine, 2′-fluoro is contained in the nucleic acid in order to improve stability to nucleolytic enzymes. It preferably contains at least one non-natural nucleobase selected from the group consisting of pyrimidine and 2'-methoxypurine. The size of the nucleic acid is not particularly limited, but is usually 10 bases or more and 200 bases or less, preferably 10 bases or more and 100 bases or less, and more preferably 20 bases or more and 70 bases or less.

  The nucleic acid contained in the nucleic acid ligand can be designed to have a sufficiently high affinity for the separation target and selectively have an affinity for the separation target. For the design of the nucleic acid, for example, a SELEX method (SELEX method) can be used. Examples of the SELEX method include the method of B, Polisky et al. Described in Methods Enzymol, 1996, 267, 275, and William James described in The Journal of Immunology, 1998, 160 (11), 5209-5212. Although these methods etc. can be used, it is not limited to these.

The SELEX method typically includes the following steps. By performing the following steps with the separation target as a target, a nucleic acid having a high affinity for the separation target can be obtained. . However, the following steps are given as examples, and those skilled in the art can obtain a desired nucleic acid by appropriately changing or modifying these steps and adopting other steps as necessary. .
(1) Prepare a candidate mixture of nucleic acids of different sequences. In general, a candidate mixture includes a region of fixed sequence and a region of randomized sequence.
(2) Contact the candidate mixture with the selected target. This contacting is performed under conditions that favor binding between the target and members of the candidate mixture.
(3) separating nucleic acids having a relatively high affinity for the target from nucleic acids having a lower affinity for the target.
(4) A new candidate obtained by amplifying the nucleic acid (nucleic acid having a relatively high affinity for the target) separated in the above step (3) and enriching the nucleic acid having a relatively high affinity for the target Create a mixture.
(5) By repeating the separation and amplification steps described above, candidate mixtures containing one or a few nucleic acids with the highest affinity for the target are obtained.

  The separation device of the present invention can be produced by immobilizing the above-mentioned nucleic acid ligand on the substrate surface. The type of the substrate is not particularly limited as long as it is in a solid state in a biological liquid at normal temperature, and the shape is not particularly limited. Examples of the shape include a spherical shape, a cubic shape, a planar shape, a chip shape, a fiber shape, a flat membrane shape, a sponge shape, and a hollow fiber shape. Among these, the ease of fine packing, the point that the nucleic acid ligand is easily held on the surface relatively uniformly, the point that a relatively large effective area can be secured, and the passage of biological fluids are easy From the viewpoint, spherical, granular, and fibrous shapes are preferable. Furthermore, fibrous shapes, particularly fibrous unwoven cloths, are excellent in terms of handling and the passage of biological fluids such as blood.

  The material of the substrate may be either an inorganic substrate or an organic substrate as long as it can hold the nucleic acid ligand on the surface, but it is an eluate upon contact with a biological fluid such as a cell suspension. A base material made of an organic polymer is preferable because of its small amount and easier shape control. Examples of the organic polymer include polymers or copolymers of vinyl compounds such as polypropylene, polystyrene, polymethacrylate esters, polyacrylate esters, polyacrylic acid, or polyvinyl alcohol, or derivatives thereof, nylon 6 or nylon 66, and the like. Examples thereof include polyamide compounds, polyester compounds such as polyethylene terephthalate, and plant-derived polysaccharide compounds such as cellulose. Among these, polyester-based compounds such as polypropylene or polyethylene terephthalate, or plant-derived polysaccharide compounds such as cellulose are preferable because they do not elute harmful impurities when contacted with biological fluids such as blood. In particular, polypropylene or polyethylene terephthalate is excellent in that it does not activate blood when it comes into contact with a biological fluid such as blood, and is preferably used in the present invention.

  These base materials and magnets can be combined to facilitate recovery of the base materials. It is also preferable to employ a means for modifying the substrate and imparting hydrophilicity to the surface. Hydrophilicity can be imparted to the surface of the base material by immobilizing a biological protein such as albumin or globulin, or by introducing an appropriate hydrophilic functional group synthetically. Examples of the hydrophilic functional group for imparting hydrophilicity include a polyethylene glycol chain having 2 to 1500 repeating units, a hydroxyl group, an amide group, an ether group, or an ester group. Examples of the monomer having a polyethylene glycol chain for imparting hydrophilicity include, for example, terminal methoxy methacrylate such as methoxydiethylene glycol methacrylate, methoxytriethylene glycol methacrylate, methoxypolyethylene glycol methacrylate, methoxydiethylene glycol acrylate, methoxytriethylene glycol acrylate, Examples thereof include terminal methoxy acrylates such as methoxy polyethylene glycol acrylate, and methacrylates and acrylates having terminal hydroxyl groups bonded with hydrogen instead of methyl groups. Examples of monomers having other substituents for imparting hydrophilicity include vinyl pyrrolidone and the like. As the hydrophilic substituent, for example, an amide group such as a dimethylamide group, a diethylamide group, or a diisopropylamide group may be used. Examples of the polymer chain constituting the substrate include, for example, an aromatic polyester chain such as a polyethylene terephthalate chain, a polybutylene terephthalate chain, and a polyester chain such as an aliphatic polyester chain, a polyether chain such as a methylene glycol chain, propylene glycol, or the like. Examples of the monomer capable of forming these polymer chains include a vinyl monomer having a hydrophilic functional group. Moreover, an acetylene monomer, a diene monomer, etc. can be mentioned besides a vinyl monomer. A polyethylene glycol derivative having a repeating unit of 2-1500 can be directly bonded to a substrate using a functional group such as an epoxy group. However, the means for imparting hydrophilicity is not limited to those exemplified above.

  The means for modifying the surface of the substrate and imparting hydrophilicity to the surface is not particularly limited. For example, covalent bonding, ionic bonding, radiation or plasma grafting method, physical adsorption, embedding, or substrate surface Various means available to those skilled in the art, such as precipitation insolubilization, can also be used. For example, a method of performing surface modification by a known method such as graft polymerization or covalent bonding of a polymer compound or its monomer using radiation or plasma is preferably used in the present invention. The method for immobilizing the nucleic acid ligand on the substrate surface is not particularly limited. For example, the nucleic acid ligand is covalently bonded directly to the substrate surface using radiation or electron beam, or the functional group on the substrate surface by a chemical method. There is a method of covalently bonding through the network.

  Examples of the method for introducing a functional group for immobilizing a nucleic acid ligand on the substrate surface include a cyanogen halide method, an epichlorohydrin method, a bisepoxide method, a bromoacetyl bromide method, and a halogenated acetamide method. . More specifically, an amino group, carboxyl group, hydroxyl group, thiol group, acid anhydride, succinimide group, substitutable halogen group, aldehyde group, epoxy group, or tresyl group can be introduced. From the viewpoint of ease of nucleic acid ligand immobilization, for example, the bromocyan method, the N-hydrosuccinimide group method, or the halogenated acetamide method is preferred.

  As the haloacetaminomethylating agent used for introducing the functional group, N-hydroxymethylchloroacetamide, N-hydroxymethylfluoroacetamide, N-hydroxymethylbromoacetamide, N-hydroxymethyliodoacetamide, or the like is preferably used. Of these, N-hydroxymethyl bromoacetamide, N-hydroxymethyl iodoacetamide, or the like can be used more preferably from the viewpoints of economy and stability. The fluoro group or chloro group introduced into the substrate can be easily converted into an iodine group or a bromine group by treating with a solution of potassium iodide or potassium bromide after the introduction of the functional group. The kind of the acid catalyst used in the production of the base material into which these functional groups are introduced is not particularly limited, and any acid may be used as long as it is a strong acid, particularly a proton acid. For example, a sulfonic acid derivative such as trifluoromethane, methane, benzene, or toluene, or a Friedel-Crafts catalyst such as sulfuric acid, zinc chloride, aluminum chloride, or tin tetrachloride is preferably used. When the nucleic acid ligand is immobilized on the substrate, a linker can be introduced usually on the 5 'end or 3' end of the nucleic acid constituting the nucleic acid ligand, or on its strand. As the linker, an amino group represented by the following formula (1), a thiol group represented by the formula (2), or a biotin group represented by the formula (3) is useful, but the linker is not limited thereto. Never happen.

  When immobilizing a nucleic acid ligand on a substrate, a molecule (spacer) of any length may be placed between the nucleic acid ligand and the substrate, and the nucleic acid ligand may be bound to the substrate via this spacer. preferable. Examples of the spacer include a polymethylene chain or a polyethylene glycol chain. As a method for binding a nucleic acid ligand to a substrate through a spacer, for example, when agarose is used as a substrate, a hydroxyl group of agarose is reacted with an isocyanate group on one side of hexamethylene diisocyanate which is a spacer. Examples include a method of forming a bond and reacting the remaining isocyanate group with the amino group or thiol group of the nucleic acid ligand to form a bond.

  Separation objects such as leukocytes such as CD4 positive T lymphocytes, blood cells such as platelets, and humoral factors such as cytokines are separated efficiently and safely from biological fluids such as blood using the separation device of the present invention. be able to. For example, it is possible to efficiently separate separation objects such as blood cells such as leukocytes and liquid factors such as cytokines from the blood cell suspension outside the body or from the blood by extracorporeal circulation. In addition, biological fluids such as blood containing blood cells such as leukocytes and cells from which humoral factors such as cytokines have been removed can be used for the treatment of various diseases. Alternatively, the removed CD4-positive T lymphocytes can be recovered and a cell suspension containing the lymphocytes as a main component can be prepared.

  As a method for separating the separation object, for example, means such as separation by a column or separation by magnetic beads can be adopted. In the column method, for example, a nucleic acid ligand selectively having affinity for a membrane antigen present on a target cell as a separation target is immobilized on the surface of the base material, and the base material is packed into a column and a living organism such as blood is used. By passing a biological liquid, cells that are separation objects can be separated easily and efficiently. In the magnetic bead method, first, a biological fluid such as a cell mixture is incubated with magnetic beads to which a nucleic acid ligand is bound to label target cells, which are separation targets, with magnetic beads, and then labeled using a magnetic device. Labeled cells can be separated from untreated cells.

  By separating and removing leukocytes such as the CD4-positive T lymphocytes, humoral factors such as platelets and cytokines from biological fluids such as blood using the separation device of the present invention, treatment of various diseases and / or Prevention can be performed. Examples of such diseases include Sjogren's syndrome such as rheumatoid arthritis, juvenile diabetes, myasthenia gravis, severe inflammatory bowel disease, multiple sclerosis, human systemic lupus erythematosus (SLE), atopic condition ( And autoimmune diseases such as allergy / asthma). In addition, leukocytes such as the CD4-positive T lymphocytes or humoral factors such as platelets and cytokines may cause diseases other than the autoimmune diseases such as graft host disease (GVHD), sepsis, SIRS (systemic inflammatory response syndrome). ), ARDS (acute respiratory distress syndrome), infectious diseases, interstitial pneumonia, cerebral malaria, AIDS, Parkinson's disease, endometriosis, and the like. Furthermore, humoral factors such as leukocytes such as CD4 positive T lymphocytes, CD4 positive CD25 positive T lymphocytes, CD4 positive monocytes, CD4 positive nucleated cells, CD14 positive nucleated cells, and CD14 positive nucleated cells, and cytokines, etc. It is also known to be deeply involved in the development of other diseases. Therefore, the separation device of the present invention can be used to treat and / or prevent these diseases by separating and removing these leukocytes or humoral factors such as platelets and cytokines from biological fluids such as blood. it can.

  A blood extracorporeal circulation separation apparatus provided as an example of a preferred embodiment of the present invention includes a column packed with a substrate having a nucleic acid ligand immobilized on the surface as a selective adsorbent, or a flask-like case filled with the selective adsorbent. And is configured as a separation system including piping and pumps for extracorporeal circulation of blood. The configuration of such a blood extracorporeal circulation apparatus can be appropriately selected according to, for example, an artificial dialysis apparatus. By adopting an appropriate configuration together with the separation apparatus of the present invention, those skilled in the art can easily use the blood extracorporeal circulation separation apparatus. Can be manufactured. The flow rate when performing extracorporeal blood treatment using this separation apparatus is usually 30 to 300 ml / min, preferably 50 to 200 ml / min, and more preferably 80 to 120 ml / min.

Hereinafter, the present invention will be described more specifically with reference to examples. However, the scope of the present invention is not limited by the following examples.
Example 1
(1) Materials and methods Base Nucleobases such as adenine, guanine, cytosine, and thymine Modified nucleobases such as 2′-fluoropyrimidine were purchased from Amersham.
B. The SELEX procedure is described in B. Polsky et al., Described in Methods Enzymol, 1996, 267, 275, and William James et al., Described in The Journal of Immunology, 1998, 160 (11), 5209-5212. Performed according to the method.
In the RNA nucleic acid library obtained by the above method, 36 bases in the random region have 24 bases at 5 ′ position on one side and 23 bases at 3 ′ position on the other side.
The recombinant CD4 antigen is described in J. Org. Mol. Biol. , 1990, 213, 7 and Science, 1993, 260, 979. F. It was created in accordance with the method of Williams et al. Recombinant CD4 antigen was immobilized on Pharmacia CNBr activated Sepharose beads.

After the Sepharose beads immobilized with the CD4 antigen were incubated with a phosphate buffer (1 mM MgCl ₂ , 1 mM CaCl ₂ ) containing the RNA nucleic acid library, the beads were separated by filtration, and the beads were separated from the phosphorous containing no nucleic acid. Washed 5 times with acid buffer. Nucleic acids bound to the beads were eluted with 7M aqueous urea. The recovered nucleic acid was reverse transcribed into DNA using a reverse transcriptase of Avian myeloblastosis virus (AMV) manufactured by Pharmacia. The obtained DNA was amplified by Polymerase chain reaction (PCR) by the method of B, Polsky et al. Described in Methods Enzymol, 1996, 267, 275, and further transcribed into RNA with a transcriptase. Thereafter, the same operation was repeated 15 times to obtain RNA having selective affinity for CD4 antigen. This RNA is again converted into DNA using the above reverse transcriptase and amplified by PCR, and then primers (GCIGGATCCCCGCTGTTGGAGCCCTCTGTCGAA, primer 2: CCGAAGCTTAATACGACTCACTATAGGGAGACACAAGAATAAAACGCTCCAAA) at both ends are digested with a degrading enzyme to obtain an RNA nucleic acid ligand of pUC19 vector. . The resulting clones were sequenced by an automated sequencer from Warrington Applied Biosystems 360. As a result, the RNA nucleic acid ligand had the following sequence. ACUUCAGCUCUAU-UAACAGC-UCAAGGACUG-GCCACA

C. Linker introduction at the 5 ′ end of RNA nucleic acid ligand The above nucleic acid ligand was converted into [1- (benzyldithio) hexyl] -6-oxy-cyanoethyl-N, N-diisopropylamino- with an automatic DNA synthesizer (Applied Biosystems). After reacting with phosphoramidites, Tetrahedron Lett. The benzyl mercaptan group was removed by the method of Takahashi et al., 56, 5907 (1968), and an RNA nucleic acid ligand having a 5′-C6-thiol group as a linker at the 5 ′ end was synthesized.

D. Separation of CD4-positive cells in blood 50 g of 2-iodoacetamide (Tokyo Kasei Co., Ltd.) was suspended in 100 ml of distilled water, 20 ml of 37% formaldehyde (Wako Pure Chemical Industries, Ltd.) was added and dissolved under stirring at 50 ° C. 25.2 g of potassium carbonate was gradually added, stirred for 10 minutes with a stirrer, and allowed to stand at room temperature for 2 hours. After standing at 4 ° C. overnight, the supernatant is discarded by decantation, 40 ml of distilled water is added, the precipitate is dissolved at 50 ° C., allowed to stand at room temperature for 2 hours, and again at 4 ° C. overnight. I put it. After repeating this operation once more, the resulting precipitate was recovered by passing it through a glass filter of G-3 (filter diameter 30 mm: Nihon Riken Kikai Co., Ltd.), suctioned and dried with an aspirator for 1 hour, It was freeze-dried for 24 hours to prepare N-hydroxymethyliodoacetamide, which is an active group for immobilizing nucleic acid ligands.

  To a glass flask, 5.7 ml of sulfuric acid, 7.2 ml of nitrobenzene and 0.0363 g of paraformaldehyde were added, dissolved under stirring, and then 0.58 g of N-hydroxymethyl iodoacetamide was added and stirred. To this was added 0.3 g of a nonwoven fabric made of polypropylene (average fiber diameter 3.3 μm) and reacted overnight at room temperature. After the reaction, the nonwoven fabric was taken out, washed with pure water, and vacuum-dried to obtain a nonwoven fabric into which an active group for immobilizing nucleic acid ligands was introduced. This non-woven fabric was cut into a circle having a diameter of 0.7 cm, and each 4 pieces of RNA nucleic acid ligand (RNA nucleic acid ligand having a 5′-C6-thiol group as a linker at the 5 ′ end) dissolved in PBS (12 μg / 400 μl) at room temperature for 2.5 hours to immobilize the RNA nucleic acid ligand. After 2.5 hours, it was washed with PBS. A column was prepared by filling four sheets of this nonwoven fabric into a 1 ml container having an inlet and an outlet. As a comparative control, a column in which bovine serum albumin (BSA; Pierce Albumin Standard) was similarly immobilized instead of the nucleic acid ligand was also prepared.

Collect 15 ml of peripheral blood from a healthy person, make 30 ml with Hanks Balanced Saline (Gibco), and gently layer 13 ml each on two centrifuge tubes into which 10 ml each of Ficoll Pack (Pharmacia) is dispensed. / Min for 20 minutes, and the cells in the nucleated cell layer were recovered. Cells of the nucleated cell layer were collected from human healthy human blood by density gradient centrifugation using Ficoll Pack (Pharmacia). The collected cells were washed with PBS and adjusted to 1.2 × 10 ⁶ cells / ml. 4 ml of this nucleated cell suspension was fed at a flow rate of 1 ml / min using a syringe pump, and flowed from the inlet of the column prepared above. The treated liquid was recovered from the column outlet. The ratio of CD4 positive cells at this time was measured by a known flow cytometry method (FACS). Cell staining during FACS analysis was measured using FITC-labeled anti-CD4 antibody (Pharmingen) and FACSCalibur (Beckton Dickinson). Table 1 shows the ratio of CD4 positive nucleated cells and other nucleated cells (CD4 negative nucleated cells) before and after passing through the column. CD4 positive nucleated cells were efficiently and selectively removed by passing through a column immobilized with a nucleic acid ligand.

Claims (9)

An apparatus for separating an object to be separated in a biological fluid, comprising: (A) a base material; and (B) a nucleic acid ligand having high affinity selective for the object to be separated, the nucleic acid ligand Is fixed to the surface of the substrate. The apparatus according to claim 1, wherein the nucleobase constituting the nucleoside ligand contains at least one nucleobase selected from the group consisting of 2'-aminopyrimidine, 2'-fluoropyrimidine, and 2'-methoxypurine. The device according to claim 1 or 2, wherein the biological fluid is blood. The device according to claim 3, wherein the blood is blood in extracorporeal circulation. The apparatus according to any one of claims 1 to 4, wherein the separation object is a CD4-positive nucleated cell. The apparatus according to any one of claims 1 to 5, wherein the substrate is a nonwoven fabric. The apparatus according to any one of claims 1 to 6, wherein the apparatus is packed in a column. The device according to any one of claims 1 to 7, which is used for treatment and / or prevention of an autoimmune disease. A method for separating an object to be separated from a biological fluid using the apparatus according to any one of claims 1 to 7.