JP2006050974A - Method for isolating cardiac muscle precursor cell and device for isolation - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a surface marker specific to cardiac muscle precursor cells, to provide a method for isolating cardiac muscle precursor cells using the surface marker, to provide a device therefor, and to provide a device for introducing cardiac muscle precursor cells into a body. <P>SOLUTION: This method for isolating the cardiac muscle precursor cells from a cell group containing mesodermal cells comprises a process for analyzing the expression of at least kind of protein selected from the group consisting of CD44, Flk1 and PDGFRα in a cell group containing the mesodermal cells and a process for recovering a cell or cells expressing at least one kind of protein selected from the group consisting of CD44, Flk1 and PDGFRα. A device used for the method is provide. <P>COPYRIGHT: (C)2006,JPO&NCIPI

Description

  The present invention relates to the identification of myocardial progenitor cells. More particularly, it relates to a method for isolating cardiac progenitor cells, and a device for isolating.

  Conventionally, devices for purifying and collecting stem cells from living tissues include blood separation devices for separating mononuclear cell fractions containing hematopoietic stem cells from peripheral blood under extracorporeal blood circulation, and further for isolating hematopoietic stem cells An anti-CD34 antibody column mounting apparatus is known. Stem cells are collected by such a two-stage stem cell purification operation, but there are currently devices for purifying and collecting living tissue stem cells from living tissues, including myocardial stem cells that can become myocardial tissues other than blood stem cells. Absent.

  In regenerative medicine for heart disease, selective collection of myocardial stem cells and subsequent cell transplantation to the affected area of myocardial stem cells are necessary, and development of a device for purifying and collecting myocardial stem cells is strongly desired. However, the reason why such a device did not exist is that the differentiation process of myocardial stem cells and myocardial progenitor cells was searched mainly when genes such as transcription factors and signal molecules were used as markers for myocardial development, destroying the cell membrane. (Speaking of cells), and the behavior of those molecules had to be detected. On the other hand, there is a method of distinguishing the differentiation / maturity of myocardial stem cells by the surface antigen expression pattern of cells in order to distinguish live cells, but to date, appropriate markers for myocardial stem cells / progenitor cells, especially surface markers As a result, there has been no progress in identifying myocardial stem cells / progenitor cells using surface markers.

  The mesoderm is one of the most studied germ layers that can be induced to differentiate from ES cells. Among them, cardiomyocytes are included in the cell line derived from the lateral mesoderm. Among cells derived from lateral mesoderm, cells characterized as Flk1 positive (hereinafter also referred to as Flk1 (+)) to vascular cells (blood cells, vascular endothelial cells, vascular smooth muscle cells) ) Has been reported that differentiation was induced (Non-patent Document 1).

The mesodermal progenitor cells fractionated by Flk1 + similar to mouse ES cells have not been identified from human stem cell sources (bone marrow, umbilical cord blood, human ES cell lines), but studies published in Japan From the plan (http://www.tanabe.co.jp/kenkyu/reports/shinsa/es1.pdf), etc., it is soon planned as a mesodermal differentiation experiment using the same marker from human ES cells. It is assumed that something exists.
In addition, it has been reported that human bone marrow-derived mesenchymal stem cells can induce differentiation of CD44-positive cells in an undifferentiated state into Flk1 + vascular endothelial cells in semisolid culture in the presence of VEGF (non-) Patent Document 5).
Yamashita Jay. (Yamashita J.) et al., “Nature”, 2000, 408, 6808, p. 92-96 Susan Sea. (Susan C.) et al., “Cell Adhesion and Communication, 1995, Vol. 3, p. 217-230. Nobuyuki Takakura et al., “The Journal of Histochemistry & Cytochemistry”, 1997, Vol. 45, p. 883-893 Naoki Nakayama et al., “Journal of Cell Science”, 2003, 116, p. 2015-2028 Joachim Oswald et al., “Stem Cells”, 2004, Vol. 22, p. 377-384

  An object of the present invention is to establish and provide a surface marker peculiar to myocardial progenitor cells, and further to a method for isolating myocardial progenitor cells and a device therefor and a device for in vivo introduction of myocardial progenitor cells using the surface marker. For the purpose of provision.

In view of the above problems, the present inventors have selected a myocardial differentiation process using mouse ES cells for examination of the expression pattern of surface markers, and a culture that can analyze the process of differentiation of undifferentiated cells into cardiomyocytes over time. The system was used. That is, ES cells were cultured under mesoderm differentiation-inducing conditions to induce differentiation into cardiomyocyte-like cells having pulsatile activity, and changes in the expression pattern of surface markers were analyzed.
As a result, it was confirmed that Flk1, which has been reported as a surface marker characterizing differentiation into vasculature cells, is also significantly increased in expression in myocardial progenitor cells. Furthermore, in addition to the feature of increasing the expression level of Flk1, culturing ES cells under mesoderm differentiation-inducing conditions also confirmed a marked increase in the expression of CD44 and PDGFRα. Obtaining these findings, the present inventors have found a method for efficiently isolating myocardial progenitor cells from a cell population containing mesoderm cells, and have completed the present invention.

That is, the present invention is as follows.
[1] (i) analyzing the expression of at least one protein selected from the group consisting of CD44, Flk1 and PDGFRα for a cell population containing mesoderm cells, and (ii) consisting of CD44, Flk1 and PDGFRα A method for isolating myocardial progenitor cells from a cell population containing mesoderm cells, comprising the step of recovering cells expressing at least one protein selected from the group.
[2] (i) analyzing the expression of at least two proteins selected from the group consisting of CD44, Flk1 and PDGFRα for a cell population containing mesoderm cells, and (ii) consisting of CD44, Flk1 and PDGFRα A method for isolating myocardial progenitor cells from a cell population containing mesoderm cells, comprising a step of recovering cells expressing at least two proteins selected from the group.
[3] The method according to [2] above, wherein the at least two proteins are Flk1 and PDGFRα.
(4) (i) analyzing the expression of CD44, Flk1 and PDGFRα for a cell population containing mesoderm cells, and (ii) recovering cells expressing all of CD44, Flk1 and PDGFRα. A method of isolating cardiac progenitor cells from a cell population containing mesoderm cells.
[5] The method according to any one of [1] to [4] above, wherein the mesoderm cells are derived from stem cells.
[6] The method according to [5] above, wherein the stem cells are embryonic stem cells (ES cells), embryonic tumor cells (EC cells), primordial germ cell-derived cells (EG cells) or tissue stem cells.
[7] The method according to any one of [1] to [4] above, wherein the mesoderm cells are obtained by inducing differentiation of ES cells into mesoderm system.
[8] The method described in [7] above, wherein the ES cell is a mouse EB5 cell.
[9] The method according to [7] above, wherein the induction of mesoderm differentiation is performed by culturing on a gelatin-coated culture dish.
[10] The cell population containing mesoderm cells is obtained from at least one tissue selected from the group consisting of skeletal muscle tissue, adipose tissue, peripheral blood, bone marrow tissue, and umbilical cord blood, [1] to [4].

[11] A myocardial progenitor cell isolated by the method according to any one of [1] to [10] above.
[12] The method according to any one of [1] to [4] above, wherein the step of analyzing the expression of CD44 is performed using a substance having specific affinity for CD44.
[13] The method described in [12] above, wherein the substance having specific affinity for CD44 is an anti-CD44 antibody.
[14] The method according to any one of [1] to [4] above, wherein the step of analyzing the expression of Flk1 is performed using a substance having specific affinity for Flk1.
[15] The method described in [14] above, wherein the substance having specific affinity for Flk1 is an anti-Flk1 antibody.
[16] The method according to any one of [1] to [4] above, wherein the step of analyzing the expression of PDGFRα is performed using a substance having specific affinity for PDGFRα.
[17] The method described in [16] above, wherein the substance having specific affinity for PDGFRα is an anti-PDGFRα antibody.
[18] A method for producing cardiomyocytes in vitro, comprising co-culturing the myocardial progenitor cell according to [11] above with stromal cells.
[19] A screening method for a factor capable of inducing differentiation from a myocardial progenitor cell into a cardiomyocyte,
(I) dividing the myocardial progenitor cells described in [11] into two groups, culturing one in the presence of a test substance and culturing the other in the absence of the test substance;
(Ii) measuring the presence or absence of pulsation and / or the expression of a myocardial marker for myocardial progenitor cells cultured in the presence or absence of the test substance,
(Iii) Regarding myocardial progenitor cells cultured in the presence or absence of the test substance, cells in which pulsation was confirmed or expression of myocardial marker was confirmed, or pulsation was confirmed, and myocardial marker (Iv) a step of calculating the appearance rate of cells in which the expression of the cardiomyocytes is confirmed, and (iv) a subject in which the appearance rate of cardiomyocytes is significantly increased compared to the case of culturing in the absence of the test substance. A method comprising the step of identifying a test substance as a factor capable of inducing differentiation into cardiomyocytes.
[20] The method according to [19] above, wherein the culture of the myocardial progenitor cell in the step (i) in the presence or absence of a test substance is carried out in the presence of stromal cells.

[21] A screening method for a factor capable of inducing mesodermal differentiation from a stem cell to a myocardial progenitor cell,
(I) dividing stem cells into two groups, culturing one in the presence of a test substance and culturing the other in the absence of the test substance;
(Ii) a step of measuring the expression status of at least one kind of CD44, Flk1 and PDGFRα for stem cells cultured in the presence or absence of the test substance; and (iii) culture in the absence of the test substance. A step of recognizing a test substance having significantly increased expression of at least one of CD44, Flk1 and PDGFRα as a factor capable of inducing mesodermal differentiation into myocardial progenitor cells,
Including methods.
[22] A screening method for a factor capable of inducing mesodermal differentiation from a stem cell to a myocardial progenitor cell,
(I) dividing stem cells into two groups, culturing one in the presence of a test substance and culturing the other in the absence of the test substance;
(Ii) a step of measuring expression status of at least two kinds consisting of CD44, Flk1, and PDGFRα for stem cells cultured in the presence or absence of the test substance; and (iii) culture in the absence of the test substance. A step of recognizing a test substance having significantly increased the expression of at least two kinds of CD44, Flk1 and PDGFRα as a factor capable of inducing mesodermal differentiation into myocardial progenitor cells,
Including methods.
[23] The method described in [22] above, wherein at least two types are Flk1 and PDGFRα.
[24] In the step (ii), all the expression states of CD44, Flk1, and PDGFRα are measured, and in the step (iii), the test substance that has significantly increased the expression of all CD44, Flk1, and PDGFRα is used as a myocardial progenitor The method according to [21] above, which is recognized as a factor capable of inducing mesodermal differentiation.
[25] The method according to [21] or [22] above, wherein the stem cells are embryonic stem cells (ES cells), embryonic tumor cells (EC cells), primordial germ cell-derived cells (EG cells) or tissue stem cells.
[26] (a) Means for recovering a cell population expressing CD44 from a cell population containing mesoderm cells using a substance having specific affinity for CD44, (b) Specific affinity for Flk1 Means for recovering a cell population expressing Flk1 from a cell population containing mesodermal cells using a substance having sex, and (c) mesodermal cells using a substance having specific affinity for PDGFRα A device for isolating myocardial progenitor cells, comprising at least two means among the means for recovering a cell population expressing PDGFRα from a cell population comprising
[27] At least two means are means for recovering a cell population expressing Flk1 from a cell population containing mesodermal cells using a substance having specific affinity for Flk1, and specific for PDGFRα The device according to [26] above, which is a means for recovering a cell population expressing PDGFRα from a cell population containing mesoderm cells using a substance having affinity.
[28] (a) Means for recovering a cell population expressing CD44 from a cell population containing mesoderm cells using a substance having specific affinity for CD44, (b) Specific affinity for Flk1 Means for recovering a cell population expressing Flk1 from a cell population containing mesodermal cells using a substance having sex, and (c) mesodermal cells using a substance having specific affinity for PDGFRα A device for isolating myocardial progenitor cells, comprising means for recovering a cell population expressing PDGFRα from a cell population containing
[29] An anti-CD44 antibody-immobilized solid phase carrier is a means for recovering a cell population expressing CD44 from a cell population containing mesoderm cells using a substance having specific affinity for CD44. The device according to [26] or [28] above.
[30] An anti-Flk1 antibody-immobilized solid phase carrier is a means for recovering a cell population expressing Flk1 from a cell population containing mesodermal cells using a substance having specific affinity for Flk1. The device according to any one of [26] to [28] above.

[31] A means for recovering a cell population expressing PDGFRα from a cell population containing mesodermal cells using a substance having specific affinity for PDGFRα is an anti-PDGFRα antibody-immobilized solid phase carrier The device according to any one of [26] to [28] above.
[32] The above, wherein the cell population containing mesoderm cells is obtained from at least one tissue selected from the group consisting of skeletal muscle tissue, adipose tissue, peripheral blood, bone marrow tissue, and umbilical cord blood [ 26] to [31].
[33] A device for administering myocardial progenitor cells, comprising the device according to any one of [26] to [32] and means for administering myocardial progenitor cells to a patient.
[34] The device according to [33] above, wherein the means for administering myocardial progenitor cells to a patient is a syringe or a catheter.
[35] The device described in [34] above, wherein the administration of cardiac progenitor cells to a patient is performed by transplantation.
[36] The device according to [35] above, wherein the transplantation is performed in the form of a sheet-like tissue having a monolayer or multilayer structure obtained by culturing the cells outside the body.
[37] The device according to [35] above, wherein the transplantation is performed in the form of a sheet-like tissue obtained by culturing the cells outside the body on a non-biological or biological support.

  The method or device of the present invention using a myocardial progenitor cell-specific surface marker makes it possible to isolate a cell source from mesodermal tissue and rapidly purify and collect myocardial progenitor cells at the treatment site. Therefore, there is no need to worry about the culture of transplanted cells, the cost of the culture, induction of differentiation into other cells due to culture. In addition, rapid purification and collection of transplanted cells enables a one-step operation and reduces the burden on the patient.

Hereinafter, the present invention will be described in detail.
In the present invention, the myocardial progenitor cell is a cell population having the property of self-pulsing and having myocardial-specific gene expression (becomes a cardiomyocyte) when differentiated from mesoderm-derived (Flk1-positive) cells. Point to.
In the present invention, the cell population containing mesoderm cells is not particularly limited as long as it is an aggregate of cells containing cells that can form mesoderm-derived tissue. For example, it may be derived from tissue stem cells obtained from peripheral blood, bone marrow tissue, adipose tissue, skeletal muscle tissue, amniotic tissue, placental tissue, umbilical cord blood, etc., embryonic stem cells (ES cells), embryonic They may be those induced to differentiate from tumor cells (EC cells) or primordial germ cell-derived cells (EG cells).

  EB5 cells are used as mouse ES cells, H9.2 cells (Kehat et al. JCI, 2001 vol.108 p.407-414), HES-2 cells (Mummery et al. Journal of Anatomy, 2002 vol.200 p.233-242), H1, H7, H9 cells (Xu et al. Circulation Research, 2002 vol.91 p.501-508) and the like are known. In these human ES cells, a differentiation induction model from the embryoid body has been reported.

Moreover, when using cord blood as a supply source, there are the following advantages.
Currently, the use of bone marrow transplantation (umbilical cord blood bank) is widespread, and public organizations have already been established, so there are problems that are fundamental in ethical, technical, and social cognitive aspects of cord blood collection. It has been overcome. In transplantation between allogeneic unrelated individuals, the expression of graft-versus-host reaction, so-called GVHD (graft-versus-host disease), is known to be less in both umbilical cord blood and bone marrow transplant than in bone marrow transplantation. And immune tolerance can be expected. Umbilical cord blood, which is a neonatal tissue, has less cellular senescence than adult tissues (bone marrow, etc.), and therefore, efficient separation and proliferation of pluripotent immature cells can be expected.

Differentiation induction from ES cells to mesoderm cells may be performed using a technique that is usually performed in this field (Yamashita J: Nature 2000: 408 (6808): 92-6, Nishikawa SI: Development 1998 125 ( 9) 1747). For example, the case where mouse EB5 is used will be described. EB5 cells are gelatin (preferably about 0.1%)-coated culture dishes, and culture medium (eg, 1% fetal calf serum (EQUITECH, Cotton Gin Lane Kerrville, TX), 10% knockout serum replacement (GIBCO / BRL)) 1% L-glutamine (GIBCO / BRL), 1% non-essential amino acid (GIBCO / BRL), 1% penicillin-streptomycin (GIBCO / BRL), 100 μM 2-mercaptoethanol (SIGMA, St. Louis, MO), 1000 U Glasgow minimum essential medium (GIBCO / BRL, Long Island, NY, etc.) supplemented with 10 ml / ml leukemia inhibitory factor (Chemicon International Inc. Temecula, CA) and 10 μg / ml blasticidin (FUNAKOSHI, Tokyo, Japan) Examples of differentiation-inducing conditions include the following protocol, but a small amount selected from the group consisting of Flk1, CD44, and PDGFRα. The details are not particularly limited as long as a significant increase in the expression of at least one, preferably two, and more preferably all three is confirmed, and may be appropriately changed depending on factors such as the state of cells. Can be done.
(Differentiation induction protocol)
1 × 10 ⁵ EB5 cells per 10 cm culture dish (0.1% gelatin coated) differentiation medium (10% fetal bovine serum (EQUITECH, Cotton Gin Lane Kerrville, TX), 1% penicillin-streptomycin (GIBCO / BRL) And a minimum essential medium α medium (GIBCO / BRL) supplemented with 100 μM 2-mercaptoethanol (SIGMA)) at 37 ° C. in a 5% CO ₂ atmosphere for 5 days.

  Differentiation into mesoderm cells can be confirmed by analyzing the expression pattern of cell surface markers. That is, the expression status of Flk1, CD44, and PDGFRα, which are cell surface antigens (cell surface markers) that are not detected before differentiation induction, or are small even if detected, and whose expression level increases significantly after differentiation induction Are measured alone or in combination. When ES cells are used as a source of mesoderm cells, the expression of cell surface markers in cells (cell population) after culturing under mesoderm differentiation inducing conditions is measured and selected from the group consisting of Flk1, CD44 and PDGFRα Cardiomyocyte progenitor cells can be isolated by recovering cells expressing at least one, preferably two, and particularly preferably all three of Flk1, CD44 and PDGFRα. When tissue stem cells obtained from peripheral blood, bone marrow tissue, adipose tissue, skeletal muscle tissue, amniotic tissue, placental tissue, umbilical cord blood, etc. are used as the source of mesoderm cells, Flk1, CD44 and The expression status of PDGFRα is measured alone or in combination, and at least one selected from the group consisting of Flk1, CD44 and PDGFRα, preferably two, particularly preferably all three of Flk1, CD44 and PDGFRα are expressed. The myocardial progenitor cells can be isolated by recovering the remaining cells.

  The method for analyzing the expression of Flk1, CD44 and PDGFRα is not particularly limited as long as the expression of these proteins, which are cell surface markers, can be analyzed, but generally a method using an immune reaction is simple, Preferred without damaging cells. The advantage of not damaging the cells is particularly advantageous for the purposes of the present invention of introducing myocardial progenitor cells into the body. Specifically, a substance having specific affinity for Flk1, a substance having specific affinity for CD44, and a substance having specific affinity for PDGFRα are used.

Flk1 functions as a receptor for the vascular endothelial growth factor receptor VEGF, and is a one-transmembrane tyrosine kinase. It has seven immunoglobulin-like structures outside the cell, and has a kinase domain and this in the cell. is characterized by having a kinase insert which bisects ^{(Developmental Biology SFGilbert 7 th Edition Chapter} 15 Lateral Plate mesoderm. Sinauer). It is becoming clear that it plays an extremely important role in the formation of normal blood vessels and tumor blood vessels, and vascular permeability. It is also considered a marker of vascular endothelial progenitor cells and a marker of mesoderm (Cortes et al. 1999, Mech Dev. 83 (1-2): 161-4, Ogawa et al. Blood 1999 93; (4) : 1168-77)

  CD44 is a type I transmembrane glycoprotein having a cell adhesion function and is a hyaluronic acid receptor. It is known that alternative isoforms are created by alternative splicing and that CD44 with various molecular sizes is expressed in specific cells. It has been reported that its expression is induced during the differentiation process of fetal cancer cells (EC cells) and embryonic stem cells (ES cells) (Non-patent Document 2).

PDGFR (platelet-derived growth factor receptor) is a membrane protein having a sugar chain with a molecular weight of about 180,000 expressed in various mesenchymal cells and has tyrosine kinase activity. There are α and β receptors with similar amino acid residue sequences.
Strong expression is observed in the paraxial mesoderm during the gastrulation phase of mouse development, and it is widely distributed in mesenchymal tissues as the development progresses (Non-patent Document 3). It is induced by BMP4 stimulation from mouse ES cells. It has been reported that chondrogenesis of mesoderm tissue is efficiently induced from the PDGFRα-positive cell group (Non-patent Document 4).

  The present invention is based on the new finding that the expression level of these proteins is significantly increased in myocardial progenitor cells. In the present specification, unless otherwise specified, “marker (or surface marker)” means each of a group consisting of a series of proteins exhibiting an expression pattern unique to the above-described myocardial progenitor cells. Such marker proteins may have different amino acid sequences depending on the type of mammal and the like, and in particular, may have several isoforms due to various splicing like CD44. In the present invention, such a protein can also be used as a marker protein as long as the expression pattern in the myocardial progenitor cells is the same, and is within the scope of the present invention.

  In the present specification, the method for the term “use” is not particularly limited, and specifically, for example, when a substance having specific affinity for the marker protein is used, the method may be used in combination with the marker protein antibody. A method using an antigen-antibody reaction is mentioned (the detailed procedure will be described later).

Examples of the substance having specific affinity for the marker protein include an antibody having a specific affinity for the protein or a fragment thereof, and the specific affinity specifically recognizes the protein by an antigen-antibody reaction. And the ability to combine. The antibody or a fragment thereof is not particularly limited as long as it can specifically bind to the protein, and may be a polyclonal antibody, a monoclonal antibody, or a functional fragment thereof. These antibodies or functional fragments thereof can be produced by methods generally performed in the art. For example, in the case of using a polyclonal antibody, there is a method of immunizing by injecting the protein subcutaneously or intraperitoneally or into a vein of an animal such as a mouse or a rabbit, and waiting for the antibody titer to rise and then collecting antiserum. In the case of using a monoclonal antibody, a method of preparing a hybridoma according to a conventional method and collecting the secreted solution thereof can be mentioned. As a method for producing an antibody fragment, a method in which a cloned antibody gene fragment is expressed in a microorganism or the like is often used. The purity of the antibody, antibody fragment, etc. is not particularly limited as long as it retains specific affinity with the protein. These antibodies or fragments thereof may be labeled with a fluorescent substance, an enzyme, a radioisotope, or the like.
Further, these may be commercially available.

  The method for isolating myocardial progenitor cells of the present invention, or a device therefor, and a device for administering myocardial progenitor cells using the method or device, have a specific affinity for marker proteins, ie, Flk1, CD44 and PDGFRα, respectively. Among them, one type, preferably two types, particularly preferably all three types are used. Further, the combination of Flk1 and PDGFRα is particularly preferable as the two types. In the isolation method of the present invention, or using a device, the expression of the marker protein is analyzed. When each protein is expressed, it may be expressed as “+”, and when it is not expressed, it may be expressed as “−”. For example, a cell co-expressing Flk1 and PDGFRα which is a preferred embodiment of the myocardial progenitor cell of the present invention can be described as [Flk1 +, PDGFRα +].

  As a method for isolating and recovering cells expressing each marker protein using a substance having specific affinity, a method practiced in the art and a combination thereof are usually used. . Specific examples of using anti-CD44 antibody as a substance having specific affinity for CD44, anti-Flk1 antibody as a substance having specific affinity for Flk1, and anti-PDGFRα antibody as a substance having specific affinity for PDGFRα Although an exemplary technique is described below, the present invention is not limited to such examples.

(1) Step of preparing anti-CD44 antibody-immobilized solid phase carrier, anti-Flk1 antibody-immobilized solid phase carrier and anti-PDGFRα antibody-immobilized solid phase carrier Usually used in the art using anti-CD44 antibody, anti-Flk1 antibody or anti-PDGFRα antibody This is done in the same way as in practice. Specifically, the solid phase carrier is activated by cyanogen bromide treatment or the like, and an antibody having an amino group or a hydroxyl group is bound thereto. Each antibody is commercially available, and can be appropriately prepared according to the procedure described above. The solid phase carrier used in the present invention is an antigen-antibody reaction between an anti-CD44 antibody and a CD44 antigen (or an antigen-antibody reaction between an anti-Flk1 antibody and a Flk1 antigen or an antigen-antibody reaction between an anti-PDGFRα antibody and a PDGFRα antigen). If it occurs, it will not specifically limit, What is normally used in this field | area can be utilized. As the material, for example, resin (polystyrene, methacrylate resin, polyacrylamide, etc.), glass or the like is used. These solid phase carriers may have any shape, and are appropriately determined according to the types of materials described above, the subsequent steps, and the like. For example, a plate shape, a bead shape, a thin film shape, a thread shape, a coil shape and the like can be mentioned. If the beads are made of resin, the subsequent operation can be simplified by filling the column.

(2-1) Step of recovering a cell population expressing CD44 from a cell population containing mesoderm cells using an anti-CD44 antibody-immobilized solid phase carrier First, the anti-CD44 antibody immobilization prepared in (1) above A solid phase carrier (hereinafter also simply referred to as an anti-CD44 antibody-immobilized column) is brought into contact with a cell population containing mesodermal cells. The cell population containing mesoderm cells may be derived from tissues such as skeletal muscle tissue, adipose tissue, peripheral blood, bone marrow tissue or umbilical cord blood as described above, or undifferentiated ES cells and EC cells. Alternatively, it may be obtained by culturing EG cells under mesoderm differentiation induction conditions. A sample obtained by solubilizing tissue or a cell suspension after differentiation induction is passed through an anti-CD44 antibody-immobilized column. The column through which the sample has passed is washed once to several times, preferably a plurality of times, with a buffer solution that does not adversely affect cells such as phosphate buffered saline (hereinafter also referred to as PBS). After washing, the cells bound to the anti-CD44 antibody-immobilized solid phase carrier are separated from the solid phase carrier by changing the polarity of the buffer or adding an excess of CD44 antigen to express CD44. Cell population ([CD44 +] cells) is recovered ([CD44 +] cell suspension).

(2-2) Step of recovering a cell population expressing Flk1 from a cell population containing mesoderm cells using an anti-Flk1 antibody-immobilized solid phase carrier First, the anti-Flk1 antibody immobilized prepared in (1) above A solid phase carrier (hereinafter also simply referred to as an anti-Flk1 antibody-immobilized column) is contacted with a cell population containing mesodermal cells. The cell population containing mesoderm cells may be derived from tissues such as skeletal muscle tissue, adipose tissue, peripheral blood, bone marrow tissue or umbilical cord blood as described above, or undifferentiated ES cells and EC cells. Alternatively, it may be obtained by culturing EG cells under mesoderm differentiation-inducing conditions. The sample obtained by solubilizing the tissue or the cell suspension after differentiation induction is passed through an anti-Flk1 antibody-immobilized column. The column through which the sample has passed is washed once to several times, preferably a plurality of times, with a buffer solution that does not adversely affect cells such as PBS. After washing, the cells bound to the anti-Flk1 antibody-immobilized solid phase carrier are separated from the solid phase carrier by changing the polarity of the buffer or adding an excess of Flk1 antigen to express Flk1. Cell population ([Flk1 +] cells) is recovered ([Flk1 +] cell suspension).

(2-3) Step of recovering a cell population expressing PDGFRα from a cell population containing mesoderm cells using an anti-PDGFRα antibody-immobilized solid phase carrier First, the anti-PDGFRα antibody immobilized prepared in (1) above A solid phase carrier (hereinafter also simply referred to as an anti-PDGFRα antibody-immobilized column) is brought into contact with a cell population containing mesodermal cells. The cell population containing mesoderm cells may be derived from tissues such as skeletal muscle tissue, adipose tissue, peripheral blood, bone marrow tissue or umbilical cord blood as described above, or undifferentiated ES cells and EC cells. Alternatively, it may be obtained by culturing EG cells under mesoderm differentiation-inducing conditions. The sample obtained by solubilizing the tissue or the cell suspension after differentiation induction is passed through an anti-PDGFRα antibody-immobilized column. The column through which the sample has passed is washed once to several times, preferably a plurality of times, with a buffer solution that does not adversely affect cells such as PBS. Separate the cells bound to the anti-PDGFRα antibody-immobilized solid phase carrier by changing the polarity of the buffer in the column after washing or adding excess PDGFRα antigen to express PDGFRα. Cell population ([PDGFRα +] cells) is recovered ([PDGFRα +] cell suspension).

  The above steps (2-1) to (2-3) can be carried out independently, but in order to obtain myocardial progenitor cells more efficiently, two steps, preferably all three steps are preferably combined. . The mode at the time of combining a process (2-2) and a process (2-3) as an example of 2 processes is as follows. In the step (2-3), when the [Flk +] cell suspension prepared in the step (2-2) is used as a cell population containing mesoderm cells, the finally recovered cells are [Flk1 +, PDGFRα +] cells, and when the fraction passed through the anti-Flk + antibody-immobilized column in step (2-2) (ie, [Flk1-] cell suspension) is used, the cells obtained are [Flk1-, PDGFRα + ] Cells. Of course, in the opposite case, that is, in the step (2-2), when the [PDGFRα +] cell suspension prepared in the step (2-3) is used as a cell population containing mesoderm cells, it is finally recovered. The cells are [PDGFRα +, Flk1 +] cells. When the fraction passed through the anti-PDGFRα antibody-immobilized column in step (2-2) (ie, [PDGFRα−] cell suspension) is used, the cells obtained are [PDGFRα−, Flk1 +] cells.

Further, when all three steps are performed, the cells (cell suspension) having various phenotypes obtained through the two steps as described above are subjected to the remaining one step. For example, by subjecting a suspension of [PDGFRα +, Flk1 +] cells to a step (2-1) as a cell population containing mesoderm cells, [PDGFRα +, Flk1 +, CD44 +] cells or [PDGFRα +, Flk1 +, CD44−] cells are obtained. can get.
The recovery step is preferably performed in the order of CD44, Flk1, and PDGFRα, or in the order of CD44, PDGFRα, and Flk1.

Various known means can be applied to the separation and recovery, but filtration using a membrane is preferred. For example, the suspension of myocardial progenitor cells obtained through each step is trapped in the filter in the syringe using, for example, a syringe with a filter inside, and then the plunger in the syringe is pressed to remove the suspension from the filter. Remove progenitor cells and collect. Although an example of the device for collection | recovery of the myocardial progenitor cell using 2 processes is shown in FIG. 1, it is not limited at all.
In FIG. 1, “sample” is a cell population containing mesoderm cells, and antibody columns 1 and 2 are two types selected from an anti-CD44 antibody-immobilized column, an anti-Flk1 antibody-immobilized column, and an anti-PDGFRα antibody-immobilized column. Column. Preferred are an anti-Flk1 antibody immobilization column and an anti-PDGFRα antibody immobilization column, and the order is not particularly limited. A desired cell fraction can be easily obtained by using a three-way stopcock.

Recovery of cells having various phenotypes can also be performed by magnetic cell separation. For example, [Flk1 +, PDGFRα +] cells are separated by the magnetic cell separation method as follows. A schematic diagram is shown in FIG.
[Flk1 +, PDGFRα +] cells are separated and collected on the same principle as that of commercially available “Isolex ^™ 300i” (manufactured by Nexell Therapeutics, USA) (medical device approval number 21300BZY00469000) which can efficiently recover CD34 positive cells. To do.
<Structure / Principle>
Magnetic beads immobilized with monoclonal antibodies (anti-Flk1 antibody and anti-PDGFRα antibody) are specifically bound to Flk1 and PDGFRα-positive cells, sorted using a magnet (immunomagnetic bead method), and finally the magnetic beads are separated. This is a system that collects only Flk1 and PDGFRα-positive cells. Separation of Flk1-positive cells and PDGFRα-positive cells are performed separately. Either can be used first.
In addition to the separation device, a disposable set and / or a stem cell separation kit component can be included.
In order to separate and collect Flk1 (PDGFRα) cells from a cell group containing stem cells, this is a magnetic cell separation system in which a disposable set is attached to a separation device and magnetically separated using a stem cell separation kit. .
<Operation method and usage>
Separation of Flk1-positive cells and PDGFRα-positive cells are performed separately. Either order may be used first (hereinafter, the order of Flk1 → PDGFRα is illustrated).
(A) Separation of Flk1-positive cells Attach the disposable set to the separator.
2. In the bag, the Flk1-positive cells in the cell group including the stem cells and the anti-Flk1 monoclonal antibody (mouse) are bound and connected to the disposable set.
3. A bag containing a washing buffer, a bag for collecting separated Flk1-positive cells, and a waste solution bag are connected to a disposable set.
4). The cell suspension containing Flk1-positive cells is transferred from the bag to the primary separation chamber, anti-mouse antibody-conjugated paramagnetic beads are added, and the rotator is activated and mixed.
5. Flk1-positive cells bound to paramagnetic beads are held by a primary magnet, and unretained cells are passed to a waste bag.
6). After the Flk1-positive cells bound to the separated paramagnetic beads are washed, peptide 9069N (Flk1-positive cells are released from the beads by competitive reaction) is added and the rotator is activated again, and the Flk1-positive cells are separated from the paramagnetic beads. Free from.
7). Anti-mouse antibody (sheep) paramagnetic beads are held by a primary magnet, and the released Flk1-positive cells are collected in a collection bag through a secondary separation chamber. Paramagnetic beads not held by the primary magnet are held by the secondary magnet.
8). Collected Flk1-positive cells are repeatedly centrifuged and washed to remove excess peptide 9069N and obtain final Flk1-positive cells.
(B) Isolation method of [Flk1 +, PDGFRα +] cells [Flk1 +, PDGFRα +] cells are obtained by subjecting the Flk1 positive cells obtained in (A) to a method in which Flk1 is read as PDGFRα in the operation of (A). .

  A device for administering myocardial progenitor cells can be constructed including the above-mentioned device and means for administering the obtained myocardial progenitor cells to a patient. As means for administering myocardial progenitor cells to a patient, means, tools and the like that are usually used for treatment using cells are used, and examples thereof include a syringe and a catheter. The syringe may be the same as the collection syringe shown in FIG. 1, or the collected cells can be filled into another new syringe and administered to the patient. Similarly, the catheter may be the same as that used for collection or may be prepared separately.

  Furthermore, the myocardial progenitor cells of the present invention may be cultured outside the body to form a sheet-like tissue having a monolayer or multilayer structure, and then the sheet may be transplanted into an administration subject (patient). A sheet-like tissue obtained by cultivating a non-biologically or biologically-derived support outside the body may be transplanted into the administration subject (patient). As the support, those commonly used in the art can be used. Examples of non-biological supports include (1) polyglycolic acid (PGA), (2) polylactic acid (PLA). ), (3) polylactic acid-polyglycolic acid copolymer (PLGA), (4) polycaprolactone (Polycaprolactone) and the like are (1) surfactants. , A tissue composed of an extracellular matrix such as collagen or elastin obtained by performing a decellularization treatment using ribonuclease, etc., (2) a tissue artificially constructed using an extracellular matrix component such as collagen or elastin Etc.

  The application of the myocardial progenitor cells of the present invention to humans is assumed to be transplanted to a patient with a subacute stage of myocardial infarction or a chronic stage of cardiomyopathy, for example. In terms of therapeutic evaluation, in addition to the standard criteria for evaluating the effects on heart failure treatment, the therapeutic criteria for allogeneic umbilical cord blood stem cell transplantation in the blood disease area already in practical use (especially, the evaluation criteria for adverse side reactions such as GVHD) Is considered appropriate. More specifically, it is possible to refer to the therapeutic effect evaluation of a large-scale clinical trial protocol that has already been published (for example, http://poppy.ac/j-chf/doc/jchfplot_ver2_030925.pdf).

As will be described later in Examples, the myocardial progenitor cells of the present invention can be differentiated into cardiomyocytes under specific culture conditions, preferably under co-culture conditions with stromal cells. By using such a differentiation induction system using myocardial progenitor cells of the present invention, a screening method for factors that can induce differentiation from myocardial progenitor cells to cardiomyocytes can be constructed. Specifically, a method comprising the following steps can be mentioned.
(I) As described above, the myocardial progenitor cells of the present invention obtained by the method of the present invention are divided into two groups, one is cultured in the presence of the test substance, and the other is in the absence of the test substance. Culturing with,
(Ii) measuring the presence or absence of pulsation and / or the expression of a myocardial marker for myocardial progenitor cells cultured in the presence or absence of the test substance,
(Iii) About a myocardial progenitor cell cultured in the presence or absence of a test substance, a pulsation was confirmed or a myocardial marker expression was confirmed, or a pulsation was confirmed and a myocardial marker (Iv) a step of calculating the appearance rate of cells in which the expression of the cardiomyocytes is confirmed, and (iv) a subject in which the appearance rate of cardiomyocytes is significantly increased compared to the case of culturing in the absence of the test substance. The step of identifying the test substance as a factor capable of inducing differentiation into cardiomyocytes.

  The test substance used in this screening method may be new or known, and conditions such as the preparation method and use concentration are appropriately determined according to the characteristics of each substance. In addition, it is preferable to determine the optimum concentration in advance by serially diluting the test substance. The culture time of the cells in the step (i) is not particularly limited as long as differentiation from myocardial progenitor cells to cardiomyocytes can be induced. Usually, when the myocardial progenitor cells are co-cultured with stromal cells, The standard is about 7 days when the occurrence is confirmed. Step (i) is preferably carried out under co-culture conditions with stromal cells, but is not essential if it can be induced into cardiomyocytes. Another object of the screening method of the present invention is to obtain a substance that can be induced into cardiomyocytes in the absence of stromal cells.

  The presence or absence of pulsation and / or the expression of a myocardial marker is measured for the myocardial progenitor cells obtained through step (i). The presence or absence of pulsation is visually observed under an optical microscope, and the number of colonies observed for pulsation in the culture dish is measured. Examples of the target myocardial marker include Nlkx2.5, GATA4, αMHC, MLC2v, MLC2a, Tbx5, cTnT, HAND1, HAND2, VE-Cadherin, c-Kit, PCAM, and the like. Expression at the protein level or expression at the gene level may be used. When measuring expression at the protein level, it is performed by Western blot etc. using the specific antibody of each protein, and when measuring expression at the gene level, it is carried out by performing Northern blot etc. using the specific probe of each gene To do.

  For the myocardial progenitor cells cultured in the presence and absence of the test substance, the presence or absence of pulsation and / or the expression of myocardial marker, preferably the presence or absence of pulsation and the expression of myocardial marker, The appearance rate of cells in which the expression of the myocardial marker is confirmed is calculated and compared in the presence and absence of the test substance (based on the time point before differentiation induction). A test substance having a significantly increased appearance rate as compared with the case where the test substance is cultured in the absence of the test substance can be identified as a factor that can induce differentiation from myocardial progenitor cells to cardiomyocytes.

Furthermore, the present invention provides a screening method for factors that can induce mesodermal differentiation from stem cells to myocardial progenitor cells. That is, at least one selected from the group consisting of CD44, Flk1, and PDGFRα is used as a marker for mesodermal differentiation into myocardial progenitor cells. Specifically, a method comprising the following steps is exemplified.
(I) dividing stem cells into two groups, culturing one in the presence of a test substance and culturing the other in the absence of the test substance;
(Ii) a step of measuring the expression status of at least one kind of CD44, Flk1 and PDGFRα for stem cells cultured in the presence or absence of the test substance; and (iii) culture in the absence of the test substance. And a step of recognizing a test substance having significantly increased the expression of at least one of CD44, Flk1 and PDGFRα as a factor capable of inducing mesodermal differentiation into myocardial progenitor cells.

The stem cell is not particularly limited as long as it can be mesodermally differentiated into myocardial progenitor cells, but is preferably pluripotent, and for example, ES cells or tissue stem cells are used.
The test substance used in this screening method may be new or known, and conditions such as the preparation method and use concentration are appropriately determined according to the characteristics of each substance. In addition, it is preferable to determine the optimum concentration in advance by serially diluting the test substance. The cell culture time in step (i) is not particularly limited as long as differentiation from stem cells to myocardial progenitor cells can be induced. Usually, when EB5 cells are induced to induce mesoderm differentiation, the expression of each marker is expressed. The estimated time is about 5 days.

  Regarding the myocardial progenitor cells obtained through step (i), the expression of at least one selected from the group consisting of CD44, Flk1 and PDGFRα, preferably 2 types (particularly Flk1 and PDGFRα), particularly preferably 3 types is measured. . Since the present invention aims at a screening method, it does not involve recovery of myocardial progenitor cells. Therefore, in addition to the method using a specific antibody of each protein at the protein level, particularly on the membrane surface, it can also be measured by expression at the gene level. In that case, it carries out by performing Northern blot etc. using the specific probe of each gene.

  Expression of at least one, preferably two (particularly Flk1 and PDGFRα), particularly preferably three, selected from the group consisting of CD44, Flk1 and PDGFRα for stem cells cultured in the presence and absence of the test substance, respectively. Is measured and the degree thereof is calculated (based on the time before differentiation induction) and compared in the presence and absence of the test substance. A test substance having a significantly increased level of expression compared to when cultured in the absence of the test substance can be identified as a factor capable of inducing differentiation from stem cells to myocardial progenitor cells.

  The present invention provides a cell population containing mesoderm cells expressing at least one, preferably two (particularly Flk1 and PDGFRα), particularly preferably three selected from the group consisting of CD44, Flk1 and PDGFRα, It is based on the finding that it can be a myocardial progenitor cell and can be induced to differentiate into a myocardial progenitor cell under specific conditions. In addition, when a cell population having such a phenotype is cultured in BIT9500 medium, vascular endothelial cells having a tubular structure and blood cells that are floating cells are induced. That is, it was shown that the flk1 + and PDGFRa + myocardial progenitor cells of the present invention also include hemangioblasts (angioblasts) that originate from the lateral plate mesoderm and are blood vessel / blood progenitor cells.

EXAMPLES Hereinafter, the present invention will be described in more detail with reference to examples. However, the examples are described for explaining the present invention and are not intended to limit the present invention.
Example 1: Examination of differentiation from Flk1 + cells, CD44 + cells, PDGFRα + cells into cardiomyocytes EB5 cells were used as ES cells. EB5 cells are 6 cm culture dishes coated with 0.1% gelatin. Culture medium (1% fetal calf serum (EQUITECH, Cotton Gin Lane Kerrville, TX), 10% knockout serum replacement (GIBCO / BRL), 1% L-glutamine) (GIBCO / BRL), 1% non-essential amino acid (GIBCO / BRL), 1% penicillin-streptomycin (GIBCO / BRL), 100 μM 2-mercaptoethanol (SIGMA, St. Louis, MO), 1000 U / ml leukemia inhibitory factor ( In Glasgow minimum essential medium (GIBCO / BRL, Long Island, NY, etc.) supplemented with Leukemia inhibitory factor; Chemicon International Inc. Temecula, CA) and 10 μg / ml blasticidin (FUNAKOSHI, Tokyo, Japan) The 0.1% gelatin coating was performed by laminating 0.1% gelatin (Nakarai Japan) / distilled water on a culture dish and solidifying it at room temperature.

Differentiation induction was performed by using 1 × 10 ⁵ EB5 cells per 10 cm culture dish (0.1% gelatin coat) in differentiation medium (10% fetal calf serum (EQUITECH, Cotton Gin Lane Kerrville, TX), 1% penicillin-streptomycin ( GIBCO / BRL) and 100 μM 2-mercaptoethanol (SIGMA) supplemented minimum essential medium α medium (GIBCO / BRL)) was cultured at 37 ° C. under 5% CO ₂ atmosphere for 5 days. After differentiation induction, the expression of Flk1, CD44 and PDGFRα was measured by performing flow cytometry analysis (FACS analysis) over time.
As the Flk1 antibody, a mouse monoclonal antibody “AVAS12α1” (provided by Dr. Nishikawa, RIKEN) was used for biotin labeling, and then FACS analysis was performed. The analysis was performed using “calibur” and “Aria” (both BD Bioscience (Nippon Becton Dickinson Co., Ltd.)). The CD44 antibody used was Clone IM7 manufactured by BD Biosciences, and the PDGFRα antibody used was biotin-labeled Clone APA5 provided by Dr. Nishikawa of RIKEN. The Flk1 antibody is described in detail in Shin-Ichi Nishikawa et al. Development, 1998 vol. 125 p.1747-1757, Kataoka H et al. Dev Growth Differ. 1997 vol. 39, p.729-740, etc.
The results are shown in FIG.
Flk1 + cells were sorted from the cells on day 5 of differentiation induction. The resulting Flk1 + cells were co-cultured on stromal cells OP9.
It is already known that ES cells are induced to differentiate into blood cells, nerve cells, lymphocytes, etc. by co-culture with stromal cells OP9 (Nishikawa SI: Development 1998 125 (9) 1747, Yamashita J: Nature 2000: 408 (6808): 92-6, Ogawa et al. Blood 1999 93; (4): 1168-77), also in this example, co-culture with stromal cells OP9 was performed in anticipation of differentiation into cardiomyocytes. went. OP9 cells are also available from public institutions such as ATCC, and were provided by Mr. Kodama in this example.
As a control, Flk1-cells were also co-cultured with stromal OP9 cells and examined for differentiation into cardiomyocytes.
A group of cells (3.6 × 10 ⁴ cells) separated by a cell sorter was cultured in a differentiation medium (described above) for 7 days on OP9 and 6 cm culture dishes.
The appearance rate of cardiomyocytes (number of pulsatile cell colonies) was confirmed when 7 days had passed since co-culture with OP9. The results are shown in Table 1.

Furthermore, a cell population (colony) pulsating on day 7 was collected by culture ring and subjected to quantitative RT-PCR (QRT-PCR; quantitative reverse-PCR) analysis, and Flk1 + cells Expression of a myocardial differentiation marker was confirmed for the derived pulsatile cell colonies. The synthesized primers are as follows.
・ Nkx2-5
Foward: cggggcggataaaaaaagct (SEQ ID NO: 1)
Reverse: ccatccgtctcggctttgt (SEQ ID NO: 2)
・ GATA4
Foward: ggaagaccaccccatactcgat (SEQ ID NO: 3)
Reverse: ggccccacaattgacact (SEQ ID NO: 4)
・ ΑMHC
Foward: gctgacagacatcgggagaatcag (SEQ ID NO: 5)
Reverse: gctggcaaaagtactggatgaca (SEQ ID NO: 6)
・ MLC2v
Foward: gaccattctcaacgcattcaag (SEQ ID NO: 7)
Reverse: gtcagcatctccccggacatagt (SEQ ID NO: 8)
・ MLC2a
Forward: tcagctgcattaccacagaaca (SEQ ID NO: 9)
Reverse: cgagctgggaatagggtctcctt (SEQ ID NO: 10)
・ Tbx5
Foward: tgaacgtgaactgtggctgaa (SEQ ID NO: 11)
Reverse: tcctcccctgccttgggtat (SEQ ID NO: 12)
・ CTnT
Foward: tcccctaaaagacaggatcgaa (SEQ ID NO: 13)
Reverse: gcggttctgccttttccttct (SEQ ID NO: 14)
・ Flk1
Foward: tcgagagagaataacgttgagaac (SEQ ID NO: 15)
Reverse: gcaactggtgtgtgagtgattcg (SEQ ID NO: 16)
・ C-Kit
Foward: ggaagcgtgactcgtttttttc (SEQ ID NO: 17)
Reverse: ctccgtttgagtgcaagagtt (SEQ ID NO: 18)
・ HAND1
Foward: ctcccccgttgcctacagaaaa (SEQ ID NO: 19)
Reverse: cgagcaagggctggagatagac (SEQ ID NO: 20)
・ HAND2
Foward: ccactatacatcccccactcat (SEQ ID NO: 21)
Reverse: ctttcacgtcgggtcttttgatc (SEQ ID NO: 22)
・ VE-Cadherin
Foward: gtggccaaaaacccctgacaa (SEQ ID NO: 23)
Reverse: tcggagaagaattggccctctgt (SEQ ID NO: 24)
・ PCAM1
Foward: tctgcagaagtttttcaggattca (SEQ ID NO: 25)
Reverse: gcatagagcaccagcgtgagt (SEQ ID NO: 26)
The expression of any marker was remarkably increased compared to other colony groups.

  When Flk1 + cells are cocultured with OP9, pulsatile cells are observed more frequently than when Flk1 cells are cocultured with OP9. Since these beating cells express a myocardial marker, it was confirmed that they were cardiomyocytes.

  Hereinafter, the present invention will be further described with reference to examples. However, cell culture techniques, cell isolation techniques, and the like are performed according to Example 1 unless otherwise specified.

Example 2: Examination of surface antigen in mesodermal differentiation induction system The surface antigen of mesodermal cells on the differentiation induction day 5 at which Flk1 expression reached a peak was analyzed. The analysis was performed by immunostaining using specific antibodies against each surface antigen. Of the specific antibodies against the surface antigen, all except anti-Flk1 antibody and anti-PDGFRα antibody were obtained from BD Bioscience. The anti-Flk1 antibody and the anti-PDGFRα antibody used were provided by Dr. Nishikawa of RIKEN. The anti-Gr1 antibody and the anti-Mac1 antibody were subjected to the reaction at a dilution of 400 times, and the other antibodies were subjected to the reaction at a dilution of 200 times. Since anti-PDGFRα, Flk1, Integrin a2, ICAM-1, ICAM-2, Integrin b1, and Integrin b7 antibodies were biotin-labeled, streptavidin-APC-Cy7 was used as a secondary antibody at a 400-fold dilution.
Differentiation induction is generally based on the same method as in Example 1, but the experimental protocol is shown in FIG.
PDGFRα, CD24, CD44, Flk1 antigen and the like enhanced their expression levels with differentiation.

Example 3: Examination of relationship between Flk1 / PDGFRα and cardiomyocyte appearance rate The cell population was sorted into four fractions, Flk1 +/−, PDGFRα +/−, and myocardial differentiation was induced in the same manner as in Example 1 to The appearance rate of moving colonies was measured. The experimental protocol is schematically shown (FIG. 4), and the results are shown in FIG.
When the myocardial progenitor cells co-expressing PDGFRα and Flk1 were co-cultured with stromal cells OP9, the number of beating colonies significantly increased.

Example 4: Isolation of myocardial progenitor cells from human umbilical cord blood <Protocol>
Umbilical cord blood was diluted 2-fold with physiological saline, and a mononuclear cell fraction was obtained by specific gravity centrifugation using Lymphoprep ^™ Tube (www.axis-shield-poc.com). MACS (registered name) ) After reaction with a bead-anti-human CD34 monoclonal antibody (www.miltenyi.com), CD34 positive mononuclear cells are obtained with an automatic cell separator autoMACS ^™ . A myocardial progenitor cell group was obtained by collecting cell colony groups adhering to the bottom of the culture dish in methylcellulose culture (below the culture conditions). Quantitative RT-PCR analysis was performed on this cell group. A group of cells in which cord blood CD34-positive cells were cultured in an undifferentiated growth medium (below the culture conditions) for 5 days was used as a control.
<Conditions of “methylcellulose culture” for obtaining myocardial progenitor cells>
MethoCult GF + H4435 (Stem Cell Technologies) (http://www.veritastk.co.jp/productdb/sho_detail.asp?t=1&Sho=0200&Chu=035#GF+C#0ul#Cul 035
ΑMEM 10% FCS (GIBCO) with cytokine cocktail (100 ng / ml hr SCF, 50 ng / ml hr IL-6, 50 ng / ml hr sIL-6R, 10 ng rh TPO, 30 ng / ml rh Flt2 / 3L; “rh” 100 CD34 + cells cultured for 3 days in a mixture of human recombinant) are seeded in a 3 cm culture dish with 1.2 ml MethoCult GF + H4435.
<Culture conditions using "undifferentiated growth medium">
2 × 10 ⁴ CD34 + cells (purity 98%) were added to αMEM 10% FCS (GIBCO) with cytokine cocktail (100 ng / ml hr SCF, 50 ng / ml hr IL-6, 50 ng / ml hr sIL-6R, 10 ng rh TPO , 30 ng / ml rh Flt2 / 3L; “rh” indicates a human recombinant) and cultured for 5 days.
<Data>
The surface markers (PDGFRα, KDR (human Flk-1)) of the obtained cord blood CD34-positive cell-derived adherent cells were analyzed by real-time RT-PCR (Quantification based on GAPDH control). Both surface markers showed increased expression in the myocardial progenitor cell group (FIG. 6).

Sequence Listing Free Text SEQ ID NO: 1: Nkx2-5 PCR primer (forward)
SEQ ID NO: 2: Nkx2-5 PCR primer (reverse)
SEQ ID NO: 3: PCR primer for GATA4 (forward)
SEQ ID NO: 4: PCR primer for GATA4 (reverse)
SEQ ID NO: 5: Primer for PCR of αMHC (forward)
SEQ ID NO: 6: Primer for PCR of αMHC (reverse)
SEQ ID NO: 7: PCR primer for MLC2v (forward)
SEQ ID NO: 8: PCR primer for MLC2v (reverse)
SEQ ID NO: 9: PCR primer for MLC2a (forward)
SEQ ID NO: 10: PCR primer for MLC2a (reverse)
SEQ ID NO: 11: Tbx5 PCR primer (forward)
SEQ ID NO: 12: Tbx5 PCR primer (reverse)
SEQ ID NO: 13: PCR primer for cTnT (forward)
SEQ ID NO: 14: PCR primer for cTnT (reverse)
SEQ ID NO: 15: PCR primer for Flk1 (forward)
SEQ ID NO: 16: Flk1 PCR primer (reverse)
SEQ ID NO: 17: PCR primer for c-Kit (forward)
SEQ ID NO: 18: PCR primer for c-Kit (reverse)
Sequence number 19: Primer for PCR of HAND1 (forward)
SEQ ID NO: 20: PCR primer for HAND1 (reverse)
SEQ ID NO: 21: PCR primer for HAND2 (forward)
SEQ ID NO: 22: PCR primer for HAND2 (reverse)
SEQ ID NO: 23: Primer for PCR of VE-Cadherin (forward)
SEQ ID NO: 24: PCR primer for VE-Cadherin (reverse)
SEQ ID NO: 25: PCR primer for PCAM1 (forward)
SEQ ID NO: 26: PCR primer for PCAM1 (reverse)

FIG. 1 is a schematic diagram showing an example of a device for isolating myocardial progenitor cells or a device for administering myocardial progenitor cells according to the present invention. FIG. 2 is a schematic diagram of a method for separating [Flk1 +, PDGFRα +] cells by magnetic cell separation. FIG. 3 is a diagram showing the results of time-dependent expression of Flk1, CD44 and PDGFRα in the induction of EB5 cell differentiation. FIG. 4 schematically shows an experimental protocol for examining surface antigens in the mesodermal differentiation induction system of EB5 cells. It is a graph which shows the number of beating colonies obtained by performing myocardial differentiation induction (co-culture on OP9) for sorted Flk1 + / PDGFRα + cells. It is a figure which shows the result of having investigated the expression of the surface markers (PDGFR (alpha) and KDR (human Flk1)) about the cell which culture | cultivated the cord blood CD34 positive cell, and adhered to the culture dish bottom. The white column shows the result of cells before methylcellulose culture, and the black column shows the result of cells attached to the bottom of the culture dish after methylcellulose culture. Increased expression of both surface markers was observed in myocardial progenitor cells obtained after methylcellulose culture.

Claims (37)

(I) analyzing the expression of at least one protein selected from the group consisting of CD44, Flk1 and PDGFRα for a cell population containing mesoderm cells, and (ii) selecting from the group consisting of CD44, Flk1 and PDGFRα A method for isolating myocardial progenitor cells from a cell population containing mesoderm cells, comprising the step of recovering cells expressing at least one protein. (I) analyzing the expression of at least two proteins selected from the group consisting of CD44, Flk1 and PDGFRα for a cell population containing mesoderm cells, and (ii) selecting from the group consisting of CD44, Flk1 and PDGFRα A method for isolating myocardial progenitor cells from a cell population containing mesoderm cells, comprising the step of recovering cells expressing at least two kinds of proteins. The method according to claim 2, wherein the at least two proteins are Flk1 and PDGFRα. (I) analyzing the expression of CD44, Flk1 and PDGFRα for a cell population containing mesoderm cells, and (ii) recovering cells expressing all of CD44, Flk1 and PDGFRα. Of isolating myocardial progenitor cells from a cell population containing The method according to any one of claims 1 to 4, wherein the mesoderm cells are derived from stem cells. The method according to claim 5, wherein the stem cells are embryonic stem cells (ES cells), embryonic tumor cells (EC cells), primordial germ cell-derived cells (EG cells) or tissue stem cells. The method according to any one of claims 1 to 4, wherein the mesoderm cells are obtained by inducing differentiation of ES cells into mesoderm system. The method according to claim 7, wherein the ES cell is a mouse EB5 cell. The method according to claim 7, wherein the induction of mesoderm differentiation is performed by culturing on a gelatin-coated culture dish. The cell population containing mesoderm cells is obtained from at least one tissue selected from the group consisting of skeletal muscle tissue, adipose tissue, peripheral blood, bone marrow tissue, and umbilical cord blood. The method of any one of these. The myocardial progenitor cell isolated by the method of any one of Claims 1-10. The method according to any one of claims 1 to 4, wherein the step of analyzing the expression of CD44 is performed using a substance having specific affinity for CD44. The method according to claim 12, wherein the substance having specific affinity for CD44 is an anti-CD44 antibody. The method according to any one of claims 1 to 4, wherein the step of analyzing the expression of Flk1 is performed using a substance having specific affinity for Flk1. 15. The method according to claim 14, wherein the substance having specific affinity for Flk1 is an anti-Flk1 antibody. The method according to any one of claims 1 to 4, wherein the step of analyzing the expression of PDGFRα is performed using a substance having specific affinity for PDGFRα. The method according to claim 16, wherein the substance having specific affinity for PDGFRα is an anti-PDGFRα antibody. A method for producing cardiomyocytes in vitro, comprising co-culturing the myocardial progenitor cells according to claim 11 with stromal cells. A method for screening a factor capable of inducing differentiation from a cardiac progenitor cell into a cardiac myocyte,
(I) dividing the myocardial progenitor cells according to claim 11 into two groups, culturing one in the presence of a test substance and culturing the other in the absence of the test substance;
(Ii) measuring the presence or absence of pulsation and / or the expression of a myocardial marker for myocardial progenitor cells cultured in the presence or absence of the test substance,
(Iii) About a myocardial progenitor cell cultured in the presence or absence of a test substance, a pulsation was confirmed or a myocardial marker expression was confirmed, or a pulsation was confirmed and a myocardial marker (Iv) a step of calculating the appearance rate of cells in which the expression of the cardiomyocytes is confirmed, and (iv) a subject in which the appearance rate of cardiomyocytes is significantly increased compared to the case of culturing in the absence of the test substance. A method comprising the step of identifying a test substance as a factor capable of inducing differentiation into cardiomyocytes. 20. The method according to claim 19, wherein the culture of the myocardial progenitor cells in the step (i) in the presence or absence of a test substance is carried out in the presence of stromal cells. A screening method for a factor capable of inducing mesodermal differentiation from a stem cell to a cardiac progenitor cell,
(I) dividing stem cells into two groups, culturing one in the presence of a test substance and culturing the other in the absence of the test substance;
(Ii) a step of measuring the expression status of at least one kind of CD44, Flk1 and PDGFRα for stem cells cultured in the presence or absence of the test substance; and (iii) culture in the absence of the test substance. A step of recognizing a test substance having significantly increased expression of at least one of CD44, Flk1 and PDGFRα as a factor capable of inducing mesodermal differentiation into myocardial progenitor cells,
Including methods. A screening method for a factor capable of inducing mesodermal differentiation from a stem cell to a cardiac progenitor cell,
(I) dividing stem cells into two groups, culturing one in the presence of a test substance and culturing the other in the absence of the test substance;
(Ii) a step of measuring expression status of at least two kinds consisting of CD44, Flk1, and PDGFRα for stem cells cultured in the presence or absence of the test substance; and (iii) culture in the absence of the test substance. A step of recognizing a test substance having significantly increased the expression of at least two kinds of CD44, Flk1 and PDGFRα as a factor capable of inducing mesodermal differentiation into myocardial progenitor cells,
Including methods. 23. The method of claim 22, wherein at least two are Flk1 and PDGFRα. In the step (ii), all the expression states of CD44, Flk1 and PDGFRα were measured, and in the step (iii), the test substance which significantly increased all the expression of CD44, Flk1 and PDGFRα was transferred to the myocardial progenitor cells. The method according to claim 21, wherein the method is identified as a factor capable of inducing lineage differentiation. The method according to claim 21 or 22, wherein the stem cells are embryonic stem cells (ES cells), embryonic tumor cells (EC cells), primordial germ cell-derived cells (EG cells) or tissue stem cells. (A) Means for recovering a cell population expressing CD44 from a cell population containing mesoderm cells using a substance having specific affinity for CD44, (b) Specific affinity for Flk1 Means for recovering a cell population expressing Flk1 from a cell population containing mesoderm cells using a substance, and (c) containing mesoderm cells using a substance having specific affinity for PDGFRα A device for isolating myocardial progenitor cells, comprising at least two means among means for recovering a cell population expressing PDGFRα from a cell population. At least two means are means for recovering a cell population expressing Flk1 from a cell population containing mesodermal cells using a substance having a specific affinity for Flk1, and a specific affinity for PDGFRα. 27. The device according to claim 26, which is a means for recovering a cell population expressing PDGFRα from a cell population containing mesoderm cells using a substance possessed. (A) Means for recovering a cell population expressing CD44 from a cell population containing mesodermal cells using a substance having specific affinity for CD44, (b) Specific affinity for Flk1 Means for recovering a cell population expressing Flk1 from a cell population containing mesoderm cells using a substance, and (c) containing mesoderm cells using a substance having specific affinity for PDGFRα A device for isolating myocardial progenitor cells, comprising means for recovering a cell population expressing PDGFRα from the cell population. The means for recovering a cell population expressing CD44 from a cell population containing mesodermal cells using a substance having specific affinity for CD44 is an anti-CD44 antibody-immobilized solid phase carrier. 29. A device according to 26 or 28. The means for recovering a cell population expressing Flk1 from a cell population containing mesodermal cells using a substance having specific affinity for Flk1 is an anti-Flk1 antibody-immobilized solid phase carrier. The device according to any one of 26 to 28. The means for recovering a cell population expressing PDGFRα from a cell population containing mesoderm cells using a substance having specific affinity for PDGFRα is an anti-PDGFRα antibody-immobilized solid phase carrier. The device according to any one of 26 to 28. 32. The cell population containing mesoderm cells is obtained from at least one tissue selected from the group consisting of skeletal muscle tissue, adipose tissue, peripheral blood, bone marrow tissue, and umbilical cord blood. The device according to any one of the above. 33. A device for administering myocardial progenitor cells, comprising the device according to any one of claims 26 to 32 and means for administering myocardial progenitor cells to a patient. 34. The device of claim 33, wherein the means for administering myocardial progenitor cells to a patient is a syringe or a catheter. 35. The device of claim 34, wherein the administration of cardiac progenitor cells to the patient is performed by transplantation. 36. The device according to claim 35, wherein the transplantation is performed in the form of a sheet-like tissue having a monolayer or multilayer structure obtained by culturing the cells outside the body. 36. The device according to claim 35, wherein the transplantation is performed in the form of a sheet-like tissue obtained by culturing the cells outside the body on a non-biological or biological support.