JP2006020525A - Method for detecting gene - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for highly sensitively detecting a gene having a specific sequence. <P>SOLUTION: This method for detecting the gene includes a process for hybridizing a nucleic acid probe fixed on an electrode with a gene sample, a process for adding an insertion agent comprising a compound which is specifically inserted into a double-stranded nucleic acid and has a double-stranded nucleic acid binding site for forming a double bond with the double-stranded nucleic acid by being irradiated with light, an electrochemical active site having electrochemical activity, and a link site for together linking the double-stranded nucleic acid binding site and the electrochemical active site, a light irradiating process for covalently binding the double-stranded nucleic acid to the insertion agent, and a detecting process for detecting the insertion agent covalently bound to the double-stranded nucleic acid by electrochemical measurement, wherein the electrochemical active site of the insertion agent comprises a metal complex having a heterocyclic compound into which a functional group is introduced as a ligand. <P>COPYRIGHT: (C)2006,JPO&NCIPI

Description

  The present invention relates to a gene detection method for detecting a specific gene sequence present in a sample with high sensitivity, and more particularly to a technique for electrochemically detecting a gene with an intercalating agent.

  In a conventional DNA chip for electrochemically detecting a specific gene sequence, a single-stranded nucleic acid probe having a base sequence complementary to a target gene to be detected is immobilized on the surface of the electrode, After hybridizing with a target gene sample denatured into a single strand, an insertion agent that specifically binds to the double-stranded nucleic acid of the nucleic acid probe and the target gene sample and is electrochemically active is added to the nucleic acid. The nucleic acid probe which is added to the reaction system of the probe and the gene sample, detects the intercalating agent bound to the double-stranded nucleic acid by electrochemical measurement via an electrode, and thereby hybridizes with the target gene sample Is detected to confirm the presence of the target gene (see, for example, Patent Document 1 and Patent Document 2).

  Here, the intercalating agent refers to a substance that recognizes the double-stranded nucleic acid and specifically binds to the double-stranded nucleic acid. Each of the intercalating agents has a plate-like insertion group such as a phenyl group in the molecule, and the insertion group intervenes between the base pair of the double-stranded nucleic acid, Join. The binding between the intercalating agent and the double-stranded nucleic acid is binding by electrostatic interaction or hydrophobic interaction, and the intercalation of the intercalating agent between the base strand of the double-stranded nucleic acid and between the base pair This is a binding by an equilibrium reaction in which the release from is repeated at a constant rate.

  Furthermore, some of the intercalating agents cause an electrically reversible oxidation-reduction reaction. By using such an intercalating agent that causes an electrochemically reversible oxidation-reduction reaction, electrochemical changes can be prevented. By the measurement, the presence of the intercalating agent bound to the double-stranded nucleic acid can be detected. Examples of the output signal of the electrochemical change include current generated during oxidation / reduction and light emission.

  As described above, in the detection method, it is important that the intercalating agent specifically binds only to the double-stranded nucleic acid and that the amount of intercalating agent bound to the double-stranded nucleic acid is detected. . However, due to causes such as chemical bonds such as coordination bonds and covalent bonds, electrostatic interactions, hydrophobic interactions, etc., the intercalating agent is also applied to single-stranded nucleic acid probes and electrode surfaces to which the nucleic acid probes are immobilized. Non-specific adsorption occurs. The nonspecifically adsorbed intercalating agent becomes background noise when detecting the amount of intercalating agent bound to the double-stranded nucleic acid, causing a decrease in detection sensitivity.

In order to solve this problem, the detection method requires washing after the addition of the intercalating agent to remove the single-stranded nucleic acid probe and the intercalating agent that is nonspecifically adsorbed on the electrode surface. It has become.
Japanese Patent No. 2573443 Japanese Patent No. 3233851

  However, in the conventional detection method, the binding between the intercalating agent and the double-stranded nucleic acid is due to electrostatic interaction or hydrophobic interaction, and the binding force is weak. During the washing step that removes the nucleic acid probe and the intercalating agent adsorbed nonspecifically on the electrode surface to which the nucleic acid probe is immobilized, the intercalating agent bound to the double-stranded nucleic acid is also dissociated and detected in reverse. There is a problem that sensitivity is lowered.

  On the other hand, in the washing considering that the intercalating agent bound to the double-stranded nucleic acid does not dissociate, the removal of the nonspecifically adsorbing intercalating agent becomes insufficient, resulting in an increase in background noise and detection. There is a problem that the sensitivity is reduced.

  The present invention has been made to solve the above-mentioned problem, and binds firmly and irreversibly to the double-stranded nucleic acid of the nucleic acid probe and the target gene sample, and further suppresses non-specific adsorption and washing. It is an object of the present invention to provide a gene detection method that can detect the nucleic acid probe hybridized with a target gene sample with high sensitivity by using an intercalating agent that can easily remove non-specifically adsorbed components.

  In order to solve the above-mentioned conventional problems, the gene detection method of the present invention comprises an electrode on which a single-stranded nucleic acid probe having a base sequence complementary to the gene sequence to be detected is immobilized, A double-stranded nucleic acid forming step of reacting a denatured gene sample to form a double-stranded nucleic acid in which the nucleic acid probe immobilized on the electrode and the gene sample are hybridized, and specific to the double-stranded nucleic acid A double-stranded nucleic acid binding site that forms a covalent bond with the double-stranded nucleic acid upon irradiation with light, an electrochemically active site having electrochemical activity, the double-stranded nucleic acid binding site, and the electrochemical activity An insertion agent addition step of adding an insertion agent comprising a compound having a linking site for linking sites, and a light irradiation step of covalently bonding the double-stranded nucleic acid and the insertion agent by performing light irradiation And the two A step of detecting an intercalating agent covalently bound to the strand nucleic acid by electrochemical measurement, wherein the electrochemically active site of the intercalating agent has a heterocyclic compound having a functional group introduced as a ligand It is a metal complex.

  As a result, the double-stranded nucleic acid obtained by hybridizing the gene sample and the nucleic acid probe and the insertion agent can be irreversibly and firmly bound to each other. As a result, the single-stranded nucleic acid probe and the electrode can be combined. When washing is performed to remove the intercalating agent that has nonspecifically adsorbed on the surface, the intercalating agent bound to the double-stranded nucleic acid is not dissociated. Furthermore, by introducing non-specific adsorption to the electrode surface by introducing a functional group, non-specific adsorption can be suppressed, and non-specific adsorption components can be easily removed by washing. It can be detected with high sensitivity.

  Furthermore, in the gene detection method of the present invention, the functional group is composed of a combination of an alkyl group, an alcohol, an ether, an aldehyde, a ketone, a carboxylic acid, an amide, and an ester.

  Furthermore, in the gene detection method of the present invention, the linking site is composed of a combination of an alkyl group, an amide, an ether, a ketone and an ester.

  As a result, non-specific adsorption factors on the electrode surface of the intercalating agent are further reduced, non-specific adsorption is suppressed, non-specific adsorption components can be easily removed by washing, and the gene sample to be detected is highly sensitive. Can be detected.

  The gene detection method of the present invention comprises an electrode on which a single-stranded nucleic acid probe having a base sequence complementary to the gene sequence to be detected is immobilized, and a gene sample denatured into a single strand. A double-stranded nucleic acid forming step of reacting and forming a double-stranded nucleic acid in which the nucleic acid probe immobilized on the electrode and the gene sample are hybridized; and specifically inserting the double-stranded nucleic acid and irradiating with light A double-stranded nucleic acid binding site that forms a covalent bond with the double-stranded nucleic acid, an electrochemically active site having electrochemical activity, and a linking site that links the double-stranded nucleic acid binding site and the electrochemically active site An intercalating agent adding step for adding an intercalating agent consisting of a compound comprising: a light irradiation step for covalently binding the double-stranded nucleic acid and the intercalating agent by light irradiation; and the double-stranded nucleic acid. Inserts covalently linked to Detecting step of detecting by electrochemical measurement of agents include city, the connecting portion is an alkyl group, are those amides, ethers, ketones, is composed of a combination of esters.

  As a result, non-specific adsorption factors on the electrode surface of the intercalating agent are reduced, non-specific adsorption is suppressed, non-specific adsorption components can be easily removed by washing, and gene samples to be detected can be detected with high sensitivity. can do.

  Further, in the gene detection method of the present invention, the electrochemical measurement is a method in which a voltage is applied to the electrode, and the amount of electrochemiluminescence by the intercalating agent covalently bonded to the double-stranded nucleic acid is measured. .

  Thereby, the double-stranded nucleic acid fixed to the electrode can be detected with high sensitivity, and as a result, the gene sample subjected to the hybridization reaction with the nucleic acid probe can be detected with high sensitivity.

  Furthermore, in the gene detection method of the present invention, the metal complex is a compound having redox properties.

  Furthermore, in the gene detection method of the present invention, the compound having redox properties is a compound exhibiting electrochemiluminescence.

  Thus, when a voltage is applied to the electrode, the intercalating agent bonded to the nucleic acid dioxide immobilized on the electrode undergoes an oxidation-reduction reaction and emits light, and the amount of electrochemiluminescence is measured, whereby the gene sample to be detected Can be detected.

  Furthermore, in the gene detection method of the present invention, the metal complex is a metal complex having a pyridine moiety as a ligand.

  Furthermore, in the gene detection method of the present invention, the metal complex having a pyridine moiety in the ligand is a metal bipyridine complex or a metal phenanthroline complex.

  Furthermore, in the gene detection method of the present invention, the central metal of the metal complex is ruthenium or osnium.

  Thereby, when a voltage is applied to the electrode, a better amount of electrochemiluminescence can be obtained, and the gene sample can be detected with higher sensitivity.

  Furthermore, in the gene detection method of the present invention, the double-stranded nucleic acid binding site is a photosensitive insertion agent.

  Thus, the double-stranded nucleic acid and the intercalating agent can be irreversibly and firmly bound by irradiating with light.

  Furthermore, in the gene detection method of the present invention, the photosensitive intercalating agent is a furocoumarin derivative.

  Furthermore, in the gene detection method of the present invention, the furocoumarin derivative is a psoralen derivative.

  According to the gene detection method of the present invention, the double-stranded nucleic acid and the intercalating agent can be irreversibly and firmly bound, the intercalating agent bound to the double-stranded nucleic acid is not dissociated, and Nonspecific adsorption of the intercalating agent not bound to the double-stranded nucleic acid can be suppressed, and the formation state of the double-stranded nucleic acid can be detected with high sensitivity.

  Hereinafter, the gene detection method of the present invention will be described in detail. In addition, the gene sample in the following embodiments refers to, for example, blood, leukocytes, serum, urine, feces, semen, saliva, cultured cells, tissue cells such as various organ cells, and any sample containing other genes. The cells in the sample are destroyed to release double-stranded nucleic acids, which are dissociated into single-stranded nucleic acids by heat treatment or alkali treatment. In addition, the gene sample in this embodiment may be a nucleic acid fragment that has been cut with a restriction enzyme and purified by electrophoresis separation or the like.

(Embodiment 1)
Hereinafter, the gene detection method in Embodiment 1 is demonstrated. First, a gene sample to be tested is created. As described above, this gene sample destroys cells in an arbitrary sample to release double-stranded nucleic acid, and is denatured to single-stranded by heat treatment or alkali treatment.

  At this time, the destruction of the cells in the sample can be performed by a conventional method, for example, by applying a physical action such as shaking or ultrasonic waves from the outside. In addition, nucleic acid can be released from cells using a nucleic acid extraction solution (for example, a solution containing a surfactant such as SDS, Triton-X, or Tween-20, or a saponin, EDTA, or protease). .

  Next, a single-stranded nucleic acid probe having a base sequence complementary to the gene sequence to be detected is generated. As the nucleic acid probe, a nucleic acid extracted from a biological sample by cleaving with a restriction enzyme and purified by separation by electrophoresis or the like or a single-stranded nucleic acid obtained by chemical synthesis can be used. In the case of nucleic acid extracted from a biological sample, it is preferable to dissociate into single-stranded nucleic acid by heat treatment or alkali treatment. Thereafter, the nucleic acid probe obtained as described above is fixed to the electrode.

  The electrode used in the present invention may be any electrode as long as it can be used as an electrode. For example, noble metal electrodes such as gold, platinum, platinum black, palladium, rhodium, graphite, glassy carbon, pyro Carbon electrodes such as lithic graphite, carbon paste, and carbon fiber, oxide electrodes such as titanium oxide, tin oxide, manganese oxide, and lead oxide, and semiconductor electrodes such as Si, Ge, ZnO, CdS, TiO, and GaAs Etc. These electrodes may be coated with a conductive polymer, and by coating in this way, a more stable probe-immobilized electrode can be prepared.

  A known method is used as a method for immobilizing the nucleic acid probe on the electrode. For example, when the electrode is gold, for example, a thiol group is introduced into the 5′- or 3′-end (preferably 5′-end) of the nucleic acid probe to be immobilized, and the covalent bond between gold and sulfur is introduced. The nucleic acid probe is fixed to the gold electrode via Methods for introducing a thiol group into this nucleic acid probe are described in the literature (M. Maeda et al., Chem. Lett., 1805-1808 (1994) and BA Connolly, Nucleic Acids Res., 13, 4484 (1985). ) Are listed.

  That is, the nucleic acid probe having a thiol group obtained by the above method is dropped onto a gold electrode and left at low temperature for several hours, whereby the nucleic acid probe is fixed to the electrode and a nucleic acid probe is produced.

  As another example, for example, when the electrode is glassy carbon, first, by oxidizing the glassy carbon with potassium permanganate, a carboxylic acid group is introduced on the surface of the electrode. It is fixed to the glassy carbon electrode surface by an amide bond. The actual immobilization method for immobilizing a nucleic acid probe to this glassy carbon electrode is described in detail in the literature (KM Millan et al., Analytical Chemistry, 65, 2317-2323 (1993)). .

    The gene sample having a sequence complementary to the nucleic acid probe is hybridized by bringing the electrode having the nucleic acid probe bound thereto into contact with the solution containing the gene sample, and the double strand is obtained. Nucleic acids are formed. Since the method of hybridizing the nucleic acid probe and the gene sample is well known, description thereof is omitted here.

  After forming a double-stranded nucleic acid in this way, an intercalating agent is added and the intercalating agent is inserted into the double-stranded nucleic acid. The intercalating agent may be added to the specimen sample before forming the double-stranded nucleic acid, that is, before the hybridization reaction.

  And after inserting an insertion agent in a double stranded nucleic acid, light irradiation is performed and a covalent bond is formed between a double stranded nucleic acid and an insertion agent.

  Hereinafter, the insertion agent inserted into the double-stranded nucleic acid will be described. The intercalating agent of the present invention uses a substance that is specifically inserted into the double-stranded nucleic acid and has a characteristic of being covalently bonded to the double-stranded nucleic acid by light irradiation. As a result, the intercalating agent binds strongly and irreversibly to the double-stranded nucleic acid, so that the intercalating agent bound to the double-stranded nucleic acid does not dissociate during the subsequent washing step. . Furthermore, the intercalating agent of the present invention uses a substance having the characteristics that are electrochemically active. Accordingly, the presence of the double-stranded nucleic acid can be detected with high sensitivity by an electrochemical signal derived from the intercalating agent specifically bound to the double-stranded nucleic acid.

  The intercalating agent that satisfies the above-mentioned two properties specifically inserts into the double-stranded nucleic acid and has a double-stranded nucleic acid binding site (I) that is covalently bonded to the double-stranded nucleic acid by light irradiation, and has an electrochemical activity. A compound having an electrochemically active site (F) and a linking site (L) for linking the double-stranded nucleic acid binding site and the electrochemically active site.

  For example, such an intercalating agent can be represented by the following general formula (1).

Formula F-L-I (1)
(In the formula, F represents an electrochemically active group, L represents a linking group, and I represents a double-stranded nucleic acid insertion group having a site that crosslinks with a double-stranded nucleic acid upon irradiation with light.)
Here, the substance that can be used as the double-stranded nucleic acid insertion group I shown in the general formula (1) is specifically inserted into the double-stranded nucleic acid and covalently bonded to the double-stranded nucleic acid by light irradiation. It is a substance that can be used, and includes an intercalator having photosensitivity.

  Examples of such a photosensitive intercalating agent include furocoumarin derivatives, and psoralen derivatives are particularly preferable. When this psoralen derivative is inserted into a double-stranded nucleic acid, it causes a non-covalent interaction with the double-stranded nucleic acid. When this psoralen derivative is further irradiated with long-wavelength ultraviolet light (300 to 400 nm), a stable covalent bond is formed.

  As a result, the psoralen derivative portion inserted into the double-stranded nucleic acid is strongly and irreversibly covalently bonded to the double-stranded nucleic acid, and the single-stranded nucleic acid probe or the electrode to which the nucleic acid probe is fixed The operation of washing the non-specifically adsorbing agent on the surface prevents the intercalating agent bonded to the double-stranded nucleic acid from falling off. As a result, the single-stranded nucleic acid probe and the intercalating agent non-specifically adsorbed on the electrode surface can be removed by strong washing.

  Specific examples of such psoralen derivatives include psoralen, methoxypsoralen, trimethylpsoralen and the like.

  Next, the substance that can be used as the electrochemically active group F shown in the general formula (1) is an electrochemically detectable substance, and includes a metal complex having a heterocyclic compound as a ligand. be able to.

  Such a metal complex is a compound having redox properties, and a substance can be detected by measuring a redox current generated during a reversible redox reaction.

  Furthermore, some of these metal complexes generate electrochemiluminescence during the oxidation-reduction reaction, and detection can be performed by measuring the luminescence.

  Furthermore, as the above-mentioned metal complexes, there are heterocyclic compounds containing oxygen, nitrogen, etc., for example, metal complexes having a pyridine moiety, a pyran moiety, etc. as a ligand, and particularly metal complexes having a pyridine moiety as a ligand. preferable.

  Furthermore, examples of the metal complex having the above-mentioned pyridine moiety as a ligand include a metal bipyridine complex and a metal phenanthroline complex.

  Furthermore, in the metal complex, as the central metal, for example, ruthenium, osnium, zinc, cobalt, platinum, chromium, molybdenum, tungsten, technetium, rhenium, rhodium, iridium, palladium, copper, indium, lanthanum, praseodymium, neodymium, Samarium etc. can be mentioned.

  In particular, a complex in which the central metal is ruthenium or osmium has good electrochemiluminescence properties, and examples of the material having such good electrochemiluminescence properties include ruthenium bipyridine complexes, ruthenium phenanthroline complexes, and osmium. Bipyridine complex, osnium phenanthroline complex, etc. can be mentioned.

  Furthermore, by introducing a functional group into the ligand of the metal complex as described above, π electrons in the ligand skeleton of the complex are prevented from entering the vacant orbit of the electrode. Adsorption can be suppressed.

  Examples of the functional group to be introduced into the ligand of the metal complex include functional groups composed of alkyl groups, alcohols, ethers, aldehydes, ketones, carboxylic acids, amides, esters, and combinations thereof.

  Furthermore, alcohols, aldehydes, carboxylic acids, and amides are polar functional groups and have hydrophilicity, and thus effectively act to reduce adsorption due to hydrophobic interactions.

  In particular, carboxylic acid is a functional group having a negative charge in an aqueous solution, and when a noble metal such as gold is used for the electrode, the electrode surface is negatively charged and repels. Therefore, it works effectively to reduce adsorption due to electrostatic interaction.

  In the general formula (1), the substance represented by L is a linking site for linking F and I. The connecting portion is characterized by being composed of an alkyl group, an amide, an ether, a ketone, an ester, or a combination thereof, and does not have an unshared electron pair that is coordinated to the electrode surface. Therefore, it is possible to reduce the occurrence of non-specific adsorption due to the structure of the linking site.

As described above, the intercalating agent of the present invention can reduce non-specific adsorption by introducing a functional group into the ligand of the metal complex and configuring the linking part. Furthermore, the effect of reducing non-specific adsorption by introducing a functional group into the ligand of the metal complex and the structure of the linking part works independently of each other. In order to effectively work for reduction, an intercalating agent to which either one is applied may be used. However, the effect of reducing nonspecific adsorption is most effective when the two effects are combined, and it is more preferable to use an intercalating agent to which both are applied.
The intercalating agent as described above is added before or after hybridizing the nucleic acid probe immobilized on the gene sample and the electrode, and the double-stranded nucleic acid hybridized with the nucleic acid probe and the gene sample and the After covalently binding the intercalating agent by light irradiation, washing is performed to remove the single-stranded nucleic acid probe and the intercalating agent adsorbed nonspecifically on the electrode surface on which the nucleic acid probe is immobilized.

  As a result, only the intercalating agent specifically covalently bound remains in the hybridized double-stranded nucleic acid, and the presence of the double-stranded nucleic acid is determined by measuring the electrochemical signal derived from the intercalating agent. Can be detected with high sensitivity.

  The electrochemical signal derived from the intercalating agent varies depending on the type of intercalating agent to be added, but when an intercalating agent that generates an oxidation-reduction current is used, it can be measured by a measurement system including a potentiostat, a function generator, and the like. On the other hand, when an intercalating agent that generates electrochemiluminescence is used, measurement can be performed using a photomultiplier or the like.

  Examples of the present invention will be described below, but the present invention is not limited thereto.

(1) Immobilization of a nucleic acid probe on the surface of a gold electrode By forming a gold layer of 200 nm on a glass substrate using a sputtering apparatus (SH-350 made by ULVAC) with a base of 10 nm of titanium and forming an electrode pattern by a photolithography process, A gold electrode was prepared. The electrode surface was washed with a piranha solution (hydrogen peroxide: concentrated sulfuric acid = 1: 3) for 1 minute, rinsed with pure water, and then dried by nitrogen blowing.

  The nucleic acid probe includes a 40-base oligo modified with a thiol group via a phosphate group at the 5 ′ end having a CCCCCTGGATCCAGATATGCAATAATTTTTCCCACTATCAT sequence located 629-668 from the 5 ′ end of the human Cytochrome P-450 gene sequence. Deoxynucleotide (manufactured by Takara Bio) was used. The nucleic acid probe was dissolved in 10 mM PBS (pH 7.4 sodium phosphate buffer) and adjusted to 100 μM.

  The prepared solution of the nucleic acid probe was dropped on the gold electrode, and left at room temperature for 4 hours under saturated humidity to bond the thiol group and gold, thereby fixing the nucleic acid probe to the gold electrode.

(2) Hybridization As a gene sample, an oligodeoxynucleotide (manufactured by Takara Bio Inc.) having a sequence of ATGATAGTGGGGAAAATTATTGCATATCTGGATCCAGGGG from the 5 ′ end complementary to the nucleic acid probe was used. The gene sample was dissolved in a hybridization solution in which 10 mM PBS and 2XSSC were mixed, and adjusted to 20 μM.

  The adjusted hybridization solution in which the gene sample was dissolved was dropped onto the gold electrode on which the nucleic acid probe was fixed, and reacted in a constant temperature bath at 40 ° C. for 4 hours to form double-stranded nucleic acid. Thereby, a gold electrode x on which a double-stranded nucleic acid was formed was obtained.

  Furthermore, in this example, a gold electrode y on which no double-stranded nucleic acid is formed is created as a comparison target. The gold electrode y on which the double-stranded nucleic acid is not formed is formed by the double-stranded nucleic acid using a gene sample having a non-complementary sequence with the nucleic acid probe (hereinafter referred to as “comparative gene sample”). The same processing as that for obtaining the gold electrode x is performed. Here, as the comparative gene sample, a 40-mer Poly-A (manufactured by Takara Bio Inc.), AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA was used.

(3) Addition of Insertion Agent A psoralen-modified ruthenium complex represented by Chemical Formula 1 below was used as the insertion agent.

  The synthesis of psoralen-modified ruthenium complex can be obtained by the following procedure.

  Sodium hydride 60% 2.2 g (55 mmol) dissolved in 50 mL of dry dimethylformamide was placed in a nitrogen atmosphere container, and 0.49 g (5.44 mmol) of 1,4-butanediol was added dropwise thereto and refluxed for 1 hour. . Next, 4′-chloromethyl-4,5,8-trimethylpsoralen (0.5 g, 1.81 mmol) synthesized by a known method (Biochemistry, vol. 16, No. 6, 1977) was added to 10 mL of dry dimethylformamide. Dissolved and added dropwise. After reacting for 12 hours, the sodium hydride was quenched with distilled water. The reaction solution was put into an aqueous sodium hydrogen carbonate solution, stirred, and extracted with chloroform. After the solvent was distilled off, the crude product was purified by silica gel chromatography to obtain product A (yield 62%).

After injecting a solution of 2.50 g (1.35 × 10 ⁻² mol) of 4,4′-dimethyl-2,2′bipyridine dissolved in 60.0 mL of THF into a container in a nitrogen atmosphere, a solution of lithium diisopropylamide 2M 16. 9 mL (2.70 × 10 ⁻² mol) was added dropwise and stirred for 30 minutes while cooling. On the other hand, 7.61 g (4.05 × 10 ⁻² mol) of 1,2-dibromoethane and 10 mL of THF were added to a container that was similarly dried in a nitrogen stream, and stirred while cooling. The previous reaction solution was dropped into this container and allowed to react for 2.5 hours. The reaction solution was neutralized with 2N hydrochloric acid, and THF was distilled off, followed by extraction with chloroform. The crude product obtained by distilling off the solvent was purified with a silica gel column to obtain the product B (yield 47%).

  Sodium hydride (60 mg, 11 mg, 0.46 mmol) dissolved in 5.0 mL of dry dimethylformamide was placed in a nitrogen atmosphere container, and 0.10 g (0.30 mmol) of product A was added thereto and refluxed for 1 hour. Next, product B (0.13 g, 0.45 mmol) was dissolved in 5.0 mL of dry dimethylformamide and added dropwise. After reacting for 8 hours, the sodium hydride was quenched with distilled water. The reaction solution was put into an aqueous sodium hydrogen carbonate solution, stirred, and extracted with chloroform. After the solvent was distilled off, the crude product was purified by silica gel chromatography to obtain product C (yield 48%).

  2,2'-bipyridine-4,4'-dicarboxylic acid (1.0 g, 4.1 mmol; manufactured by Wako Pure Chemical Industries, Ltd.) was placed in 20 mL of ethanol, a few drops of concentrated sulfuric acid was added, and the mixture was refluxed for 2 hours. After neutralization with an aqueous sodium hydrogen carbonate solution, the solvent was distilled off and recrystallization was performed from ethanol to obtain product D (4,4′-dicarboxyethyl-2,2′-bipyridine) (yield 90). %).

  After ruthenium (III) chloride dihydrate (0.24 g, 1.0 mmol) and product D (0.66 g, 2.2 mmol) were refluxed in dimethylformamide (80.0 mL) for 6 hours, the solvent was removed. Distilled off. Then, acetone was added and the black precipitate obtained by cooling overnight was extract | collected, 170 mL of ethanol aqueous solution (ethanol: water = 1: 1) was added, and it heated and refluxed for 1 hour. After filtration, 20 g of lithium chloride was added, ethanol was distilled off, and the mixture was further cooled overnight. The deposited black substance was collected by suction filtration to obtain a product E (yield 51.3%).

Product C (0.17 g, 0.31 mmol) and product E (0.30 g, 0.39 mmol) were dissolved in dimethylformamide and refluxed for 5 hours. After the reaction, distilled water was added to the black purple substance obtained by distilling off the solvent to dissolve it. The unreacted complex was removed by filtration, and then the solvent was distilled off. The obtained crude product was purified by silica gel chromatography and then hydrolyzed in an alkaline solution (1N NaOH) to obtain a psoralen-modified ruthenium complex (yield 62%). Table 1 shows ¹ H-NMR results of the psoralen-modified ruthenium complex obtained as described above.
(Table 1)
¹ H-NMR (300 MHz, DMSOd-6)
σ:
1.5-2.0 (12H, m)
2.4-2.6 (12H, m)
2.74 (2H, t)
4.33 (2H, s)
6.32 (1H, s)
7.34 (2H, s)
7.48 (1H, s)
7.61 (2H, d)
7.82 (4H, m)
8.22 (4H, d)
8.74 (2H, d)
8.82 (4H, d)
The psoralen-modified ruthenium complex thus obtained was adjusted to 2 μM with 10 mM PBS. The prepared solution was added to the gold electrode x on which double-stranded nucleic acid was formed and the gold electrode y on which double-stranded nucleic acid was not formed, and a dark reaction was performed in a refrigerator at 4 ° C. for 30 minutes.

(4) Covalent bond between double-stranded nucleic acid and intercalating agent 30 minutes later, UV rays of 365 nm and 5 mW / cm 2 were irradiated for 10 minutes using UV crosslinker (Funakoshi UVPCL1000L type), and psoralen and double-stranded nucleic acid And were covalently bonded. After covalent bonding, the gold electrode was rock-washed with 10 mM PBS for 10 minutes to remove unreacted Ru complex.

(5) Electrochemical measurement After the above steps, 0.1M PBS and 0.1M triethylamine were applied to each of the electrode x on which the double-stranded nucleic acid was formed and the electrode y on which the double-stranded nucleic acid was not formed. The electrolyte solution mixed with was dropped. Thereafter, a voltage was applied to each of the electrodes x and y, and electrochemiluminescence derived from the intercalating agent generated at this time was measured. The voltage was applied by scanning from 0 V to 1.3 V and performing electrochemical measurement for 1 second. The electrochemiluminescence amount was measured using a photomultiplier tube (H7360-01 manufactured by Hamamatsu Photonics), and the maximum luminescence amount during voltage scanning was measured.

  FIG. 1 shows the maximum amount of electrochemiluminescence detected at the electrode x where the double-stranded nucleic acid was formed and the electrode y where the double-stranded nucleic acid was not formed, in this example.

  As is clear from FIG. 1, the amount of light emitted from the electrode x on which the double-stranded nucleic acid was formed was significantly higher than the amount of light emitted from the electrode y on which the double-stranded nucleic acid was not formed. It can be seen that the use of the intercalating agent of this example enables the detection of double-stranded nucleic acid with high sensitivity.

  The gene detection method according to the present invention can detect a gene having a specific sequence with high sensitivity, and can be applied to uses such as gene diagnosis, infectious disease diagnosis, and genome drug discovery.

The figure which shows the maximum amount of electrochemiluminescence detected in the electrode x in which the double stranded nucleic acid was formed, and the electrode y in which the double stranded nucleic acid was not formed in Example 1 of this invention.

Claims (13)

A gene detection method for detecting a gene having a specific sequence,
An electrode on which a single-stranded nucleic acid probe having a base sequence complementary to the gene sequence to be detected was immobilized was reacted with a gene sample denatured into a single strand, and immobilized on the electrode. A double-stranded nucleic acid forming step of forming a double-stranded nucleic acid in which a nucleic acid probe and the gene sample are hybridized;
A double-stranded nucleic acid binding site that specifically inserts into the double-stranded nucleic acid and forms a covalent bond with the double-stranded nucleic acid by light irradiation; an electrochemically active site having electrochemical activity; and the double-stranded nucleic acid An intercalating agent adding step of adding an intercalating agent consisting of a compound having a binding site that links the binding site and the electrochemically active site;
A light irradiation step of covalently bonding the double-stranded nucleic acid and the intercalating agent by performing light irradiation;
Detecting the intercalating agent covalently bound to the double-stranded nucleic acid by electrochemical measurement,
The electrochemically active site of the intercalating agent is a metal complex having a heterocyclic compound having a functional group introduced as a ligand,
A gene detection method characterized by the above. The gene detection method according to claim 1,
The functional group is composed of a combination of an alkyl group, alcohol, ether, aldehyde, ketone, carboxylic acid, amide, ester,
A gene detection method characterized by the above. The gene detection method according to claim 1,
The linking site is composed of a combination of an alkyl group, amide, ether, ketone, ester,
A gene detection method characterized by the above. A gene detection method for detecting a gene having a specific sequence,
An electrode on which a single-stranded nucleic acid probe having a base sequence complementary to the gene sequence to be detected was immobilized was reacted with a gene sample denatured into a single strand, and immobilized on the electrode. A double-stranded nucleic acid forming step of forming a double-stranded nucleic acid in which a nucleic acid probe and the gene sample are hybridized;
A double-stranded nucleic acid binding site that specifically inserts into the double-stranded nucleic acid and forms a covalent bond with the double-stranded nucleic acid by light irradiation; an electrochemically active site having electrochemical activity; and the double-stranded nucleic acid An intercalating agent adding step of adding an intercalating agent comprising a compound having a binding site and a linking site that links the electrochemically active site;
A light irradiation step of covalently bonding the double-stranded nucleic acid and the intercalating agent by performing light irradiation;
Detecting the intercalating agent covalently bound to the double-stranded nucleic acid by electrochemical measurement,
The linking site is composed of a combination of an alkyl group, amide, ether, ketone, ester,
A gene detection method characterized by the above. The gene detection method according to claim 1, wherein
In the electrochemical measurement, a voltage is applied to the electrode, and the amount of electrochemiluminescence by the intercalating agent covalently bonded to the double-stranded nucleic acid is measured.
A gene detection method characterized by the above. In the gene detection method of Claim 1 to 3,
The metal complex is a compound having redox properties,
A gene detection method characterized by the above. The gene detection method according to claim 6,
The compound having redox properties is a compound exhibiting electrochemiluminescence,
A gene detection method characterized by the above. The gene detection method according to claim 7, wherein
The metal complex having a heterocyclic compound in the ligand is a metal complex having a pyridine moiety in the ligand,
A gene detection method characterized by the above. The gene detection method according to claim 8,
The metal complex having a pyridine moiety in the ligand is a metal bipyridine complex, a metal phenanthroline complex,
A gene detection method characterized by the above. The gene detection method according to claim 9, wherein
The central metal of the metal complex having a heterocyclic compound as the ligand is ruthenium or osnium.
A gene detection method characterized by the above. The gene detection method according to claim 1, wherein
The double-stranded nucleic acid binding site is a photosensitive intercalator;
A gene detection method characterized by the above. The gene detection method according to claim 11,
The photosensitive intercalator is a furocoumarin derivative;
A gene detection method characterized by the above. The gene detection method according to claim 12,
The furocoumarin derivative is a psoralen derivative;
A gene detection method characterized by the above.

Images