JP2005534287A - Nucleic acids named 98P4B6 and corresponding proteins useful in the treatment and detection of cancer - Google Patents

Abstract

A novel gene 098P4B6 (also referred to as STEAP-2) and its encoded protein and variants thereof are described, wherein 98P4B6 exhibits tissue-specific expression in normal adult tissues and in cancer The anomalies are listed in Table 1. As a result, 98P4B6 provides a diagnostic, prognostic, prophylactic and / or therapeutic target for cancer. The 98P4B6 gene or fragment thereof, or its encoded protein, or a variant thereof, or fragment thereof can be used to elicit a humoral immune response or a cellular immune response; an antibody or T cell reactive with 98P4B6 can be It can be used in active or passive immunization.

Description

(Citation of related application)
This application is a continuation-in-part of pending US patent application USSN 09 / 455,486, filed on December 6, 1999, and now filed on June 1, 1999. Claimed priority of US patent application USSN 09 / 323,873, which is US Pat. No. 6,329,503, and this application is an unnumbered US provisional application filed on December 20, 2002. USSN priority and US Provisional Patent Application No. 60 / 317,840 filed September 6, 2001 and US Provisional Patent Application No. 60 / 370,387 filed April 5, 2002. Insist. This application is filed with US Provisional Patent Application No. 60 / 087,520 filed June 1, 1998 and US Provisional Patent Application Nos. 60 / 091,183 and December 2001, filed June 30, 1998. US Patent Application No. 10 / 011,095 filed on the 6th and US Patent Application No. 10 / 010,667 filed on the 6th December 2001 and US Provisional Patent Application filed on the 6th June 2001 No. 60 / 296,656 and US patent application Ser. No. 10 / 165,044 filed Jun. 6, 2002. The contents of the applications listed in this paragraph are hereby incorporated by reference in their entirety.

(Statement of rights to the present invention made under research supported by the US federation)
Not applicable.

(Field of Invention)
The invention described herein relates to genes expressed in specific cancers and proteins encoded by them (referred to as 98P4B6 or STEAP-2), and the invention is in the management of cancers that express 98P4B6 It relates to diagnostic and therapeutic methods and compositions that are useful.

(Background of the Invention)
Cancer is the second leading cause of death in humans after coronary disease. Worldwide, millions of people die from cancer each year. In the United States alone, as reported by the American Cancer Society, cancer causes death of well over 500,000 people each year, and more than 1.2 million new cases are diagnosed each year. While deaths from heart disease have decreased significantly, deaths from cancer are generally on the rise. In the early part of the next century, cancer is predicted to be a major cause of death.

  Worldwide, several cancers are prominent as major killers. In particular, lung, prostate, breast, colon, pancreas, and ovarian carcinomas represent the leading cause of death from cancer. These and virtually all other carcinomas share common lethal characteristics. With very few exceptions, metastatic disease caused by carcinoma is fatal. Furthermore, even in the early stages, even cancer patients who survived the primary cancer have shown a common experience that their lives have changed dramatically. Many cancer patients experience strong anxiety driven by recognizing the possibility of recurrence or treatment failure. Many cancer patients experience physical weakness after treatment. In addition, many cancer patients have experienced recurrence.

  Worldwide, prostate cancer is the fourth most prevalent cancer in men. In North America and Scandinavia, prostate cancer is by far the most common cancer in men and the second leading cause of cancer death in men. In the United States alone, well after pulmonary cancer, well over 30,000 men die each year from this disease. Despite the scale of these numbers, there is still no effective treatment for metastatic prostate cancer. Surgical prostatectomy, radiation therapy, hormone ablation therapy, surgical castration and chemotherapy continue to be the main treatment modalities. Unfortunately, these procedures are ineffective for many and often have undesirable consequences.

  The lack of prostate tumor markers that can accurately detect early stage local tumors in the diagnostic setting leaves significant limitations in the diagnosis and management of the disease. Serum prostate specific antigen (PSA) assay is a very useful tool, but its specificity and general utility are widely considered lacking some significant points.

Advances in identifying additional specific markers for prostate cancer have been improved by the generation of prostate cancer xenografts that can reproduce different stages of the disease in mice. LAPC (L os A ngeles P rostate C ancer) xenografts survived passage in severe combined immunodeficiency (SCID) mice and have exhibited the capacity to mimic the transition from androgen dependence to androgen independence Prostate cancer xenografts (Klein et al., 1997, Nat. Med. 3: 402). More recently identified prostate cancer markers include: PCTA-1 (Su et al., 1996, Proc. Natl. Acad. Sci. USA 93: 7252), prostate specific membrane (PSM) antigen (Pinto et al., Clin Cancer Res, September 2, 1996 (9): 1445-51), STEAP (Hubert et al., Proc Natl Acad Sci USA. December 7, 1999; 96 (25): 14523-8) and prostate stem cell antigen ( (PSCA) (Reiter et al., 1998, Proc. Natl. Acad. Sci. USA 95: 1735).

  Previously identified markers such as PSA, PSM, PCTA and PSCA have facilitated efforts to diagnose and treat prostate cancer, but to further improve diagnosis and therapy, prostate cancer and related cancers There is a need to identify additional markers and therapeutic targets for.

  Renal cell carcinoma (RCC) accounts for about 3% of adult malignancies. Once the adenoma reaches a diameter of 2-3 cm, there is potential for malignancy. In adults, the two main malignant kidney tumors are renal cell adenomas and transitional cell carcinomas of the renal pelvis or ureter. The incidence of renal cell adenocarcinoma is estimated to exceed 29,000 cases in the United States, and in 1998, more than 11,600 patients died from the disease. Transitional cell carcinoma is less frequent, with an incidence of about 500 cases per year in the United States.

  Surgery has been the main treatment for renal cell adenocarcinoma for decades. Until recently, metastatic disease was refractory to any systemic treatment. With the recent development of systemic treatment (especially immunotherapy), metastatic renal cell carcinoma can be aggressively approached in appropriate patients with the potential for a durable response. Nevertheless, there remains a need for effective treatments for these patients.

  Of all new cases of cancer in the United States, bladder cancer represents approximately 5% in men (5th of the most common neoplasms) and 3% (8th of the most common neoplasms) in women . The number of outbreaks increases slowly, consistent with an increase in the elderly population. In 1998, there were an estimated 54,500 cases, including 39,500 cases in men and 15,000 cases in women. The age-adjusted incidence in the United States is 32 per 100,000 for men and 8 per 100,000 for women. The 3: 1 historical male / female ratio may decrease in relation to smoking patterns in women. In 1998, an estimated 11,000 people died of bladder cancer (7,800 men and 3,900 women). Bladder cancer incidence and mortality increase greatly with age, and the problems increase as the population ages.

  Most bladder cancers recur in the bladder. Bladder cancer is managed using a combination of transurethral resection (TUR) of the bladder and intravesical chemotherapy or immunotherapy. The multifocal and recurrent nature of bladder cancer points to the limitations of TUR. Most muscle invasive cancers are not cured by TUR alone. Radical cystectomy and urinary diversion are the most effective means to remove cancer, but possess undeniable effects on urine and sexual function. There continues to be a significant need for treatment modalities that are beneficial to patients with bladder cancer.

  In the United States in 2000, an estimated 130,200 colorectal cancers occurred, including 93,800 colon cancers and 36,400 rectal cancers. Colorectal cancer is the third most common cancer in men and women. Incidence decreased significantly between 1992 and 1996 (−2.1% per year). Studies suggest that these reductions are due to increased screening and polyp removal that prevent the polyps from progressing to invasive cancers. In 2000, there were an estimated 56,300 deaths (47,700 due to colon cancer and 8,600 due to rectal cancer), accounting for about 11% of all cancer deaths in the United States.

  Currently, surgery is the most common form of treatment for colorectal cancer and cancer that has not spread, which is often curative. Chemotherapy or radiation in addition to chemotherapy is provided to most patients whose cancer has penetrated deep into the intestinal wall or spread to lymph nodes before or after surgery. Permanent colostomy (formation of the abdominal opening to remove bodily excretion) is sometimes required for colon cancer and rarely required for rectal cancer. There remains a need for effective diagnostic and treatment modalities for colorectal cancer.

  In 2000, there were an estimated 164,100 new cases of lung and bronchial cancer, accounting for 14% of all US cancer diagnoses. The incidence of lung and bronchial cancer has decreased significantly in men, from as high as 86.5 out of 100,000 in 1984 to 70.0 in 1996. In the 1990s, the rate of increase among women began to decline. In 1996, the incidence in women was 42.3 out of 100,000.

  Lung and bronchial cancer caused an estimated 156,900 deaths in 2000, accounting for 28% of all cancer deaths. Between 1992 and 1996, mortality from lung cancer decreased significantly among men (-1.7% per year), while mortality for women still increased significantly (1 0.9% per year). Since 1987, more women have died every year due to lung cancer than breast cancer and have been the leading cause of cancer death in women for longer than 40 years. The decrease in lung cancer incidence and mortality is most likely due to a decrease in smoking rates over the past 30 years; however, the decrease in smoking patterns among women lags behind in men. Although the decline in tobacco use in adults has slowed, it is significant that tobacco use in youth has increased again.

  Treatment options for lung cancer and bronchial cancer are determined by the type and stage of the cancer, and options include surgery, radiation therapy and chemotherapy. For many local cancers, surgery is usually the preferred treatment. Because the disease is usually spread by the time it is discovered, radiation therapy and chemotherapy are often required in combination with surgery. Chemotherapy alone or in combination with radiation therapy is a selective treatment for small cell lung cancer; with this regimen, a large percentage of patients experience remission, which in some cases lasts long. However, there remains a need for effective treatment and diagnostic approaches for lung and bronchial cancer.

  An estimated 182,800 new invasive cases of breast cancer were predicted to occur among US women during 2000. In addition, approximately 1,400 new cases of breast cancer were predicted to be diagnosed in men in 2000. After an increase of about 4% per year in the 1980s, the incidence of breast cancer in women peaked at about 110.6 cases per 100,000 in the 1990s.

  In the United States alone, there were an estimated 41,200 deaths in 2000 due to breast cancer (40,800 women and 400 men). Breast cancer is the second leading cause of cancer death in women. According to the most recent data, mortality was significantly decreased between 1992 and 1996, with the greatest decrease among both white and black young women. These reductions were probably the result of earlier detection and treatment improvements.

  Taking into account the medical environment and patient preferences, breast cancer treatment may include the following: tumor removal (local removal of tumor) and removal of armpit lymph nodes; mastectomy (surgical removal of the breast) And removal of armpit lymph nodes; radiation therapy; chemotherapy; or hormone therapy. Often, two or more methods are used in combination. Numerous studies have shown that for early stage disease, long-term survival after radiation therapy in addition to tumor resection is similar to survival after modified radical mastectomy. Significant advances in reconstruction techniques offer several options for breast reconstruction after mastectomy. In recent years, such reconstruction has been performed simultaneously with mastectomy.

  Local resection of in situ ductal carcinoma (DCIS) with an appropriate amount of surrounding normal breast tissue may prevent local recurrence of DCIS. Chest radiation and / or tamoxifen can reduce the chance of DCIS occurring in the remaining breast tissue. This is important because if left untreated, DCIS can develop into invasive breast cancer. Nevertheless, these treatments have serious side effects or sequelae. Therefore, there is a need for effective breast cancer treatment.

  There were an estimated 23,100 new cases of ovarian cancer in the United States in 2000. Ovarian cancer accounts for 4% of all cancers in women and is ranked second in gynecological cancers. Between 1992 and 1996, the incidence of ovarian cancer decreased significantly. As a result of ovarian cancer, there were an estimated 14,000 deaths in 2000. Ovarian cancer causes more deaths than any other cancer in the female reproductive system.

  Surgery, radiation therapy, and chemotherapy are treatment options for ovarian cancer. Surgical procedures typically include excision of one or both of the ovaries, resection of the fallopian tube (tubal ovariectomy), and uterine resection (hysterectomy). In some very early tumors, only the involved ovaries are removed, especially in young women who want to have children. In advanced disease, attempts are made to eliminate all intra-abdominal disease and enhance the effectiveness of chemotherapy. There remains an important need for effective treatment options for ovarian cancer.

  There were an estimated 28,300 new cases of pancreatic cancer in the United States in 2000. Over the past 20 years, the proportion of pancreatic cancer has decreased in men. The proportion among women remains roughly constant but may begin to decrease. Pancreatic cancer caused an estimated 28,200 deaths in the United States in 2000. Over the past 20 years, mortality in men has been modestly reduced (significantly -0.9% per year), while that rate has increased slightly in women.

  Surgery, radiation therapy, and chemotherapy are treatment options for pancreatic cancer. These treatment options can prolong survival and / or alleviate the symptoms in many patients, but do not appear to produce cure for most people. There is a significant need for additional therapeutic and diagnostic options for pancreatic cancer.

(Summary of the Invention)
The present invention relates to the gene designated 98P4B6, which has been found to be overexpressed in the cancers listed in Table I. Northern blot expression analysis of 98P4B6 gene expression in normal tissues shows a restricted expression pattern in adult tissues. The nucleotide sequence (Figure 2) and amino acid sequence (Figures 2 and 3) of 98P4B6 are provided. The tissue-related profile of 98P4B6 in normal adult tissues, combined with the overexpression observed in the tissues listed in Table I, is that 98P4B6 is abnormally overexpressed in at least some cancers and is therefore listed in Table I It serves as a useful diagnostic, prophylactic, prognostic and / or therapeutic target for cancers of tissues such as the treated tissue.

  The present invention provides the following: polynucleotides corresponding to or complementary to all or part of the 98P4B6 gene, mRNA and / or coding sequence (preferably in isolated form) The following may be mentioned: 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or Polynucleotides encoding 98P4B6-related proteins and 98P4B6-related fragments of more than 25 consecutive amino acids); at least 30, 35, 40, 45, 50, 55, 60, 65, 70, 80, 85, 90, 95, 100 or more than 100 consecutive amino acids of 98P4B6-related protein, as well as the peptide / protein itself; DNA, RNA, DNA / RNA hybrids and related molecules, polynucleotides or oligonucleotides, and the 98P4B6 gene that are complementary or have at least 90% homology to a child or mRNA sequence or part thereof A polynucleotide or oligonucleotide that hybridizes to the mRNA or 98P4B6-encoding polynucleotide. Also provided are means for isolating cDNA and genes encoding 98P4B6. Also provided are recombinant DNA molecules comprising 98P4B6 polynucleotides, cells transformed or transduced with such molecules, and host-vector systems for expression of 98P4B6 gene products. The present invention further provides antibodies that bind to 98P4B6 proteins and polypeptide fragments thereof, which include polyclonal and monoclonal antibodies, mouse and other mammalian antibodies, chimeric antibodies, humanized antibodies and complete antibodies. Human antibodies as well as antibodies labeled with a detectable marker or therapeutic agent are included. In certain embodiments, however, the entire nucleic acid sequence of FIG. 2 is not encoded and / or the entire amino acid sequence of FIG. 2 is not prepared. In certain embodiments, the entire nucleic acid sequence of FIG. 2 is encoded and / or the entire amino acid sequence of FIG. 2 is prepared, any of which is a respective human unit dosage form.

  The present invention further provides methods for detecting the presence and status of 98P4B6 polynucleotides and proteins in various biological samples, as well as methods for identifying cells that express 98P4B6. Exemplary embodiments of the present invention provide a method for monitoring 98P4B6 gene product in a tissue or hematological sample that has or is suspected of having some form of growth dysregulation such as cancer. To do.

  The present invention relates to various immunogenic or therapeutic compositions and strategies for treating cancers that express 98P4B6 (eg, cancers of tissues listed in Table I) (98P4B6 transcription, translation, processing or Further provided are cancer vaccines, including treatments aimed at inhibiting function. In one aspect, the present invention provides compositions for treating cancers that express 98P4B6 in human subjects, as well as methods comprising them, wherein the compositions are suitable carriers for human use. As well as human unit doses of one or more agents that inhibit the production or function of 98P4B6. Preferably, this carrier is a unique human carrier. In another aspect of the invention, the agent is a 98P4B6 protein and an immunoreactive moiety. Non-limiting examples of such moieties include antibodies (eg, single chain antibodies, monoclonal antibodies, polyclonal antibodies, humanized antibodies, chimeric antibodies or human antibodies), (naturally occurring or synthesized) These functional equivalents, as well as combinations thereof, can be mentioned, but are not limited to these. These antibodies can be conjugated to a diagnostic or therapeutic moiety. In another aspect, the agent is a small molecule as defined herein.

  In another aspect, the agent comprises one or more peptides comprising a cytotoxic T lymphocyte (CTL) epitope that binds an HLA class I molecule in humans to induce a CTL response to 98P4B6 and / or an HLA class in humans. It includes one or more peptides comprising a helper T lymphocyte (HTL) epitope that binds to a II molecule and elicits an HTL response. The peptides of the invention can be the same or one or more separate polypeptide molecules. In a further aspect of the invention, the agent comprises one or more nucleic acid molecules that express one or more of the peptides that stimulate a CTL or HTL response as described above. In yet another aspect of the invention, the one or more nucleic acid molecules can express a moiety that immunologically reacts with 98P4B6 as described above. The one or more nucleic acid molecules can also be or encode a molecule that inhibits the production of 98P4B6. Non-limiting examples of such molecules include molecules complementary to a nucleotide sequence essential for 98P4B6 production (eg, molecules that form a triple helix having an antisense sequence or a nucleotide double helix essential for 98P4B6 production). ) Or ribozymes effective to lyse 98P4B6 mRNA.

  Determine the starting position of any peptide shown in Tables VIII-XXI and XXII-XLIX (collectively referred to as HLA Peptides Table) with respect to the parent protein (eg, variant 1, variant 2, etc.) Note that for reference, the following three factors: specific variants, peptide lengths in the HLA peptide table, and search peptides in Table VII. In general, a unique search peptide is used to obtain a specific HLA peptide for a specific variant. The position of each search peptide relative to its respective parent molecule is listed in Table VII. Thus, if the search peptide starts at position “X”, the value “X-1” is assigned to each position in Tables VIII-XXI and XXII-XLIX to obtain the actual position of the HLA peptide in these parent molecules. Must be added. For example, when a particular search peptide starts at position 150 of its parent molecule, 150-1 or 149 must be added to each HLA peptide amino acid position to calculate the amino acid position in the parent molecule.

  One embodiment of the present invention encompasses HLA peptides that appear at least twice in Table VIII to Table XXI and Table XXII to Table XLIX, or oligonucleotides encoding HLA peptides. Another embodiment of the invention encompasses an HLA peptide that appears at least once in Table VIII to Table XXI and at least once in Table XXII to Table XLIX, or an oligonucleotide encoding an HLA peptide.

Another embodiment of the invention is an antibody epitope comprising a peptide region having one, two, three, four, or five of the following features, or an oligonucleotide encoding the peptide region:
i) A peptide region of at least 5 amino acids of the particular peptide of FIG. 3 (in any integer increment up to the full length of the protein in FIG. 3) (in the hydrophilic profile of FIG. 5, 0.5, 0.6, 0. Including amino acid positions having a value greater than or equal to 7, 0.8, 0.9 or equal to 1.0);
ii) A peptide region of at least 5 amino acids of the particular peptide of FIG. 3 (in any integer increment up to the full length of the protein in FIG. 3) (in the hydropathic profile of FIG. 6, 0.5, 0.4, 0. Including amino acid positions having values less than or equal to 3, 0.2, 0.1 or equal to 0.0);
iii) A peptide region of at least 5 amino acids of the particular peptide of FIG. 3 (in any integer increment up to the full length of the protein in FIG. 3) (Percent Accessible Residues) profile in FIG. Including amino acid positions having a value greater than or equal to 5, 0.6, 0.7, 0.8, 0.9 or equal to 1.0);
iv) A peptide region of at least 5 amino acids of the particular peptide of FIG. 3 (in any integer increment up to the full length of the protein in FIG. 3) (in the Average Flexibility profile of FIG. 8, 0.5, Including amino acid positions having a value greater than or equal to 0.6, 0.7, 0.8, 0.9 or equal to 1.0); or
v) A peptide region of at least 5 amino acids of the particular peptide of FIG. 3 (in any integer increment up to the full length of the protein in FIG. 3) (in the β-turn profile of FIG. 9, 0.5, 0.6, 0. Including amino acid positions having a value greater than 7, 0.8, 0.9 or equal to 1.0).

(Detailed description of the invention)
(Summary of section)
I. ) Definition II. ) 98P4B6 polynucleotide II. A. ) Use of 98P4B6 polynucleotides II. A. 1. ) Monitoring genetic abnormalities II. A. 2. ) Antisense Embodiments II. A. 3. ) Primers and primer pairs II. A. 4). ) Isolation of 98P4B6-encoding nucleic acid molecule II. A. 5. ) Recombinant nucleic acid molecules and host vector systems III. ) 98P4B6-related protein III. A. ) Embodiment of motif-bearing protein III. B. ) Expression of 98P4B6-related proteins III. C. ) Modification of 98P4B6-related proteins III. D. ) Use of 98P4B6-related proteins IV. ) 98P4B6 antibody V. ) 98P4B6 cell immune response VI. ) 98P4B6 transgenic animals VII. ) 98P4B6 detection method VIII. ) Methods for monitoring the status of 98P4B6-related genes and their products IX. ) Identification of molecules that interact with 98P4B6 X. ) Treatment methods and compositions X. A. ) Anti-cancer vaccine X. B. ) 98P4B6 as a target for antibody-based therapy
X. C. ) 98P4B6 as a target for cellular immune responses
X. C. 1. Minigene vaccine X. C. 2. Combination of helper peptide and CTL peptide X. C. 3. Combination of T cell priming agent and CTL peptide X. C. 4). Vaccine composition comprising DC pulsed with CTL peptide and / or HTL peptide X. D. ) Adoptive immunotherapy X. E. ) Administration of vaccines for therapeutic or prophylactic purposes XI. ) 98P4B6 diagnostic and prognostic embodiments XII. ) Inhibition of 98P4B6 protein function XII. A. ) Inhibition of 98P4B6 using intracellular antibodies XII. B. ) Inhibition of 98P4B6 using recombinant proteins XII. C. ) Inhibition of transcription or translation of 98P4B6 XII. D. ) General considerations for therapeutic strategies XIII. ) Identification, characterization and use of modulators of 98P4B6 XIV. ) Production of kits / articles (I.) Definition)
Unless otherwise defined, all terms, symbols, and other scientific or technical terms used in this specification are commonly used by those of ordinary skill in the art to which this invention belongs. It is intended to have the meaning understood by In some cases, terms having a generally understood meaning are defined herein for clarity and / or easy reference, and such definitions are used herein. The inclusion of should not be construed as indicating a substantial difference beyond what is commonly understood in the art. Techniques and procedures described or referenced herein (see, eg, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, (1989), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. The widely used molecular cloning methodologies described in Y. are generally well understood and commonly used by those skilled in the art using conventional methodologies. Where appropriate, procedures involving the use of commercially available kits and reagents are generally in accordance with the protocol defined by the manufacturer and / or otherwise described parameters. Done.

  The terms "advanced prostate cancer", "locally advanced prostate cancer", "advanced disease", and "locally advanced disease" mean prostate cancer that has spread through the prostate capsule and is an American Stage C disease under the Urological Association (AUA) system, stage C1-C2 disease under the Whitmore-Jewett system, and TNM (tumor, node, metastasis) system It is meant to include the original stages T3-T4 and N + disease. In general, surgery is not recommended for patients with locally advanced disease, and these patients have prostate cancer that is clinically localized (organ limited) Have substantially less favorable results compared to existing patients. Locally advanced disease is clinically identified by a lump beyond the lateral edges of the prostate, or by clear evidence of asymmetry or lump above the base of the prostate. Locally advanced prostate cancer is now available after radical prostatectomy if the tumor invades or invades the prostate capsule, extends to the surgical edge, or invades the sperm parcel. Diagnosed pathologically.

  “Modifying the native glycosylation pattern” is, for the purposes herein, removing one or more carbohydrate moieties found in the native sequence 98P4B6 (removing an endogenous glycosylation site). Meaning or by removing glycosylation by chemical and / or enzymatic means) and / or adding one or more glycosylation sites not present in native sequence 98P4B6 Intended to be. Furthermore, this phrase includes qualitative changes in glycosylation of the native protein and relates to changes in the nature and proportion of the presence of various carbohydrate moieties.

  The term “analog” refers to a molecule that is structurally similar or that shares similar or consistent properties with another molecule (eg, 98P4B6-related protein). For example, an analog of 98P4B6 protein can be specifically bound by an antibody or T cell that specifically binds to 98P4B6.

  The term “antibody” is used in the broadest sense. Thus, an “antibody” can be naturally occurring or artificial, such as a monoclonal antibody produced by conventional hybridoma technology. Anti-98P4B6 antibodies include monoclonal and polyclonal antibodies as well as fragments that contain an antigen binding domain and / or one or more complementary determining regions of these antibodies.

  An “antibody fragment” is defined as at least a portion of a variable region of an immunoglobulin molecule that binds to a target (ie, an antigen binding region). In one embodiment, this specifically covers a single anti-98P4B6 antibody and its clones (including agonists, antagonists and neutralizing antibodies) and anti-98P4B6 antibody compositions having polyepitopic specificity. .

  The term “codon optimized sequence” refers to a nucleotide sequence that has been optimized for a particular host species by replacing any codons having a usage frequency of less than about 20%. Nucleotide sequences optimized for expression in a given host species by removal of pseudopolyadenylation sequences, removal of exon / intron splicing signals, removal of transposon-like repeats and / or optimization of GC content in addition to codon optimization Are referred to herein as “expression enhancing sequences”.

  A “combinatorial library” is a collection of diverse chemical compounds generated by either chemical or biological synthesis by combining a number of chemical “building blocks” such as reagents. For example, a linear combinatorial chemical library (eg, a polypeptide (eg, mutein) library) can be a chemical building block in all possible ways for a given compound length (ie, the number of amino acids in a polypeptide compound). It is formed by using together a set of (so-called (called) amino acids). A number of chemical compounds are synthesized by such combinatorial mixing of chemical building blocks (Gallop et al., J. Med. Chem. 37 (9): 1233-1251 (1994)).

  The preparation and screening of combinatorial libraries is well known to those skilled in the art. Such combinatorial chemical libraries include, but are not limited to, peptide libraries (eg, US Pat. No. 5,010,175, Furka, Pept. Prot. Res. 37: 487-493 (1991)). , Houghton et al., Nature, 354: 84-88 (1991)), peptoids (PCT publication number WO 91/19735), coding peptides (PCT publication WO 93/20242), random bio-oligomers (PCT publication WO 92). / 00091), benzodiazepines (US Pat. No. 5,288,514), diversomers (eg, hydantoins, benzodiazepines and dipeptides (Hobbs et al., Proc. Nat. Acad. Sci. US). A90: 6909-6913 (1993)), vinylogous polypeptide (Hagihara et al., J. Amer. Chem. Soc. 114: 6568 (1992)), non-peptidyl peptide mimic with β-D-glucose backbone (Hirschmann et al., J. Amer. Chem. Soc. 114: 9217-9218 (1992)), similar organic synthesis of small compound libraries (Chen et al., J. Amer. Chem. Soc. 116: 2661 (1994) ), Oligocarbonates (Cho et al., Science 261: 1303 (1993)) and / or peptidyl phosphonates (Campbell et al., J. Org. Chem. 59: 658 (1994)), generally Gordon et al., J. Med. Chem. 37: 1385 (1994), nucleic acid libraries (see, eg, Stratagene, Corp.), peptide nucleic acid libraries (see, eg, US Pat. No. 5,539,083), antibody libraries (See, eg, Vaughn et al., Nature Biotechnology 14 (3): 309-314 (1996) and PCT / US96 / 10287), carbohydrate libraries (eg, Liang et al., Science 274: 1520-1522 (1996) and US Pat. No. 5,593,853) and small organic libraries (eg, benzodiazepines, Baum, C & EN, Jan 18, page 33 (1993); isoprenoids, US Pat. No. 5,569) 588; thiazolidinones and metathiazanones, US Pat. No. 5,549,974; pyrrolidine, US Pat. Nos. 5,525,735 and 5,519,134; morpholino compounds, US Pat. No. 5,506,337 See benzodiazepines, US Pat. No. 5,288,514;

  Devices for the preparation of combinatorial libraries are commercially available (eg, 357 NIPS, 390 NIPS, Advanced Chem Tech, Louisville KY; Symphony, Rainin, Woburn, MA; 433A, Applied Biosystems, Foster, CA 90; Plus, Millipore, Bedford, NIA). A number of well-known robotic systems have also been developed for solution phase chemistry. These systems include automated workstations (for example, automated synthesizers developed by Takeda Chemical Industries, LTD. (Osaka, Japan)) and many robotic systems (Zymate H, Zymmark Corporation, Hopkinton) that use robotic arms. , Mass .; Orca, Hewlett-Packard, Palo Alto, Calif.), Which mimics manual synthesis operations performed by chemists). Any of the above devices are suitable for use with the present invention. The nature and implementation of modifications to these devices (if any, so that they can be manipulated as discussed herein) will be understood by those skilled in the art. In addition, a number of combinatorial libraries are commercially available per se (eg, ComGenex, Princeton, NJ; Asinex, Moscow, RU; Tripos, Inc., St. Louis, MO; ChemStar, Ltd, Moscow, RU; 3D Pharmaceuticals, Exton, PA; Martek Biosciences, Columbia, MD;

The term “cytotoxic agent” refers to a substance that inhibits or prevents cell expression activity, cell function, and / or causes destruction of cells. The term includes radioactive isotope chemotherapeutic agents and toxins (eg, small molecule toxins or enzymatically active toxins of bacterial, fungal, plant or animal origin), including fragments and / or variants thereof. Is intended. Examples of cytotoxic reagents include, but are not limited to: auristatin, auromycin, maytansinoid, yttrium, bismuth, lysine, ricin A chain, combrestatin (Combrestatin), duocammycin, dorostatin, doxorubicin, daunorubicin, taxol, cisplatin, cc1065, ethidium bromide, mitomycin, etoposide, tenoposid, vincristine, vinblastine, coltrathine dimine Toxin, Pseudomonas exotoxin (PE) A, PE40, abrin Abrin A chain, modeccin A chain, α-sarcin, gelonin, mitogellin, retortostrictin, phenomycin, enomycin, curicin, crotin, Calicheamicin, Saponiaria officinalis inhibitors, and glucocorticoids, as well as other chemotherapeutic agents, and radioisotopes (eg, At ²¹¹ , I ¹³¹ , I ¹²⁵ , Y ⁹⁰ , Re ¹⁸⁶ , Re ¹⁸⁸ , Sm ¹⁵³ , Bi ²¹² or Bi ²¹³ , P ³² and Lu radioisotopes (including Lu ¹⁷⁷ )). The antibody may also bind to an anti-cancer prodrug activating enzyme that can convert the prodrug to an active form.

  A “gene product” is sometimes referred to herein as a protein or mRNA. For example, “gene products of the invention” are sometimes referred to herein as “cancer amino acid sequences”, “cancer proteins”, “cancer proteins listed in Table I”, “cancer mRNA”, “Table I It is said to be “mRNA of enumerated cancer”. In one embodiment, the oncoprotein is encoded by the nucleic acid of FIG. The oncoprotein can be a fragment, or alternatively can be a full-length protein for the fragment encoded by the nucleic acid of FIG. In one embodiment, cancer amino acid sequences are used to determine sequence identity or sequence similarity. In another embodiment, the sequence is a naturally occurring allelic variant of the protein encoded by the nucleic acid of FIG. In another embodiment, the sequence is a sequence variant as further described herein.

  “High-throughput screening” assays for the presence, absence, quantification, or other properties of a particular nucleic acid or protein product are well known to those skilled in the art. Similarly, binding assays and reporter gene assays are similarly well known. Thus, US Pat. No. 5,559,410 discloses a high-throughput screening method for proteins; US Pat. No. 5,585,639 discloses a high-throughput screening method for nucleic acid binding (ie, in an array). However, US Pat. Nos. 5,576,220 and 5,541,061 disclose high-throughput methods for ligand / antibody binding screening.

  In addition, high-throughput screening systems are commercially available (eg Amersham Biosciences, Piscataway, NJ; Zymark Corp., Hopkinton, MA; Air Technical Industries, Mentor, OH; Beckman Instruments, Inc., Beckman Instruments, Inc .; , Natick, MA; These systems typically automate the entire procedure, which comprises all sample and reagent pipetting, liquid dispensing, timed incubation and final reading of the microplate in a detector suitable for the assay. These configurable systems provide high throughput and rapid start-up as well as a flexible and custom-made degree. The manufacture of such systems provides detailed protocols for various high throughput systems. Thus, for example, Zymark Corp. Provides technical bulletins describing screening systems for detecting modulation of gene transcription, ligand binding, and the like.

  The term “homologue” refers to a molecule that exhibits homology to another molecule (eg, having a sequence of chemical residues that are similar or similar at corresponding positions).

  “Human leukocyte antigen” or “HLA” is a human class I or class II major histocompatibility complex (MHC) protein (eg, Stites et al., IMMUNOLOGY, 8th edition., Lange Publishing, Los Altos, (See CA (1994)).

  As used in the context of polynucleotides, the terms “hybridize”, “hybridizing”, “hybridize” and the like refer to conventional hybridization conditions (preferably, for example, 50% formamide / 6 × SSC / 0.1% SDS / hybridization in 100 μg / ml ssDNA). Here, the temperature of hybridization is above 37 ° C. and the temperature for washing in 0.1 × SSC / 0.1% SDS is higher than 55 ° C.

  The phrase “isolated” or “biologically pure” refers to material that is substantially or essentially free from components that normally accompany the material as found in its native state. Thus, an isolated peptide according to the present invention is preferably free of substances normally associated with the peptide in an in situ environment. For example, if the polynucleotide corresponds to or is complementary to a gene other than the 98P4B6 gene, or is substantially separated from a contaminant polynucleotide encoding a polypeptide other than the 98P4B6 gene product or fragment thereof, Said to be “isolated”. One skilled in the art can readily utilize nucleic acid isolation procedures to obtain isolated 98P4B6 polynucleotides. A protein is said to be “isolated” if, for example, physical, mechanical or chemical methods are utilized to remove 98P4B6 protein from cellular components normally associated with the protein. One skilled in the art can readily utilize standard purification methods to obtain isolated 98P4B6 protein. Alternatively, isolated protein can be prepared by chemical means.

  The term “mammal” refers to any organism classified as a mammal, including mice, rats, rabbits, dogs, cats, cows, horses and humans. In one embodiment of the invention, the mammal is a mouse. In another embodiment of the invention, the mammal is a human.

  The terms “metastatic prostate cancer” and “metastatic disease” refer to prostate cancer that has spread to local lymph nodes or distant sites, and stage D disease under the AUA system, and TNM It is meant to include the stage T × N × M + under the system. In the case of locally advanced prostate cancer, surgery is generally not intended for patients with metastatic disease and hormonal (androgen excision) treatment is preferred Treatment style. Patients with metastatic prostate cancer eventually develop an androgen therapy refractory condition within 12-18 months of the start of treatment. Nearly half of these androgen refractory patients die within 6 months after the onset of the condition. The most common site of prostate cancer metastasis is the bone. Prostate cancer bone metastases are often osteoblastic (ie, resulting in net bone formation) rather than osteolysis. Bone metastases are most frequently found in the spine, followed by the femur, pelvis, rib cage, skull, and humerus. Other common sites of metastasis include lymph nodes, lungs, liver, and brain. Metastatic prostate cancer is typically diagnosed by open pelvic lymphadenectomy or laparoscopic pelvic lymphadenectomy, whole body radionuclide scans, skeletal radiographs, and / or biopsy of bone lesions Is done.

  As used herein, the term “modulator” or “test compound” or “drug candidate” or their equivalents is a cancer phenotype or cancer sequence (eg, nucleic acid sequence or protein sequence). Or any molecule (eg, protein, oligopeptide, small organic molecule) that is tested for the ability to directly or indirectly alter the expression of or the effects of cancer sequences (eg, signal transduction, gene expression, protein interactions, etc.) , Polysaccharides, polynucleotides, etc.). In one aspect, the modulator neutralizes the effects of the oncoprotein of the present invention. “Neutralize” means that the activity of the protein is inhibited or blocked, with subsequent effects on the cell. In another aspect, the modulator neutralizes the effects of the gene of the invention and its corresponding protein by normalizing the protein level. In preferred embodiments, the modulator alters the expression profile, or the expression profile of a nucleic acid or protein provided herein, or a downstream effector pathway. In one embodiment, the modulator suppresses a cancer phenotype (eg, a phenotype for a normal tissue fingerprint). In another embodiment, the modulator induced a cancer phenotype. In general, multiple assay mixtures are run in parallel at different reagent concentrations, resulting in different responses to different concentrations. Typically, one of these concentrations serves as a negative control (ie, zero concentration or below detection level).

  Modulators, drug candidates, or test compounds comprise many chemical classes, but typically they are organic molecules, preferably small organic compounds having a molecular weight greater than 100 and less than about 2,500 daltons. is there. Preferred small molecules are less than 2000D, or less than 1500D or less than 1000D or less than 500D. Candidate factors include functional groups necessary for structural interaction (particularly hydrogen bonding) with proteins, and typically include at least one amine group, carbonyl group, hydroxyl group, or carboxyl group, preferably Contains at least two functional chemical groups. Candidate factors often include ring carbon or heterocyclic structures and / or aromatic or polyaromatic structures substituted with one or more of the above functional groups. Modulators also include biomolecules such as peptides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs, or combinations thereof. Peptides are particularly preferred. One class of modulator is a peptide, for example a peptide of about 5 to about 35 amino acids, preferably about 5 to about 20 amino acids, particularly preferably about 7 to about 15 amino acids. Preferably, the cancer modulator protein is soluble, includes a non-transmembrane region, and / or has an N-terminal Cys that aids solubility. In one embodiment, the C-terminus of the fragment is maintained as a free acid and the N-terminus is a free amine to assist in coupling (ie, coupling to cysteine). In one embodiment, oncoproteins of the invention are conjugated to immunogenic factors as discussed herein. In one embodiment, the oncoprotein is conjugated to BSA. Polypeptides of the invention (eg, preferred length polypeptides) can be linked together or linked to other amino acids to produce longer peptides / proteins. A regulatory peptide can be a digest of a naturally occurring protein, a random peptide, or a “biased” random peptide, as described above. In a preferred embodiment, the peptide / protein based modulator is an antibody and fragments thereof as defined herein.

  The modulator of cancer can also be a nucleic acid. Nucleic acid modulators can be naturally occurring nucleic acids, random nucleic acids, or “biased” random nucleic acids. For example, digested products of prokaryotic or eukaryotic genomes can be used in a similar approach as described above for proteins.

  The term “monoclonal antibody” refers to an antibody obtained from a population of substantially homogeneous antibodies. That is, the antibody comprising this population refers to the same except for mutations that may occur in nature (present in small amounts).

  A “motif” as a biological motif of a 98P4B6-related protein is any pattern of amino acids that form part of the primary sequence of a protein (specific function (eg, protein-protein interaction, protein-DNA interaction, etc.)). , Or modification (eg, phosphorylation, glycosylation, or amidation), or localization (eg, secretion sequence, nuclear localization sequence, etc.), or immunogenic (either humoral or cellular) )) And related sequences. Motifs can either be adjacent to or aligned with a particular location generally associated with a particular function or property. In the context of an HLA motif, a “motif” is a residue in a peptide of a defined length that is recognized by a particular HLA molecule (usually about 8 to about 13 amino acids for a class I HLA motif, and class II A pattern of about 6 to about 25 amino acids to the HLA motif). The peptide motif for HLA binding is typically different for each protein encoded by each human HLA allele and is different in the pattern of primary and secondary anchor residues.

  “Pharmaceutical excipients” include substances such as adjuvants, carriers, pH adjusting and buffering agents, isotonic agents, wetting agents, preservatives and the like.

  “Pharmaceutically acceptable” refers to a composition that is non-toxic, inert, and / or physiologically compatible with humans or other mammals.

  The term “polynucleotide” refers to a polymorphic form of nucleotides (either ribonucleotides or deoxynucleotides, or a modified form of either nucleotide type) of at least 10 bases or base pairs in length. And is meant to include single and double stranded forms of DNA and / or RNA. In the art, this term is often used interchangeably with “oligonucleotide” if necessary. The polynucleotide can comprise a nucleotide sequence disclosed herein, wherein thymidine (T) (eg, as shown in FIG. 2) can also be uracil (U). This definition relates to the difference between the chemical structures of DNA and RNA, particularly the finding that one of the four main bases in RNA is uracil (U) instead of thymidine (T).

  The term “polypeptide” means a polymer of at least about 4, 5, 6, 7 or 8 amino acids. Throughout this specification, standard three-letter or single-letter code for amino acids is used. In the art, this term is often used interchangeably with “peptide” or “protein”.

  A “primary anchor residue” of HLA is an amino acid at a specific position along the peptide sequence that is understood to provide a point of contact between the immunogenic peptide and the HLA molecule. The primary anchor residues within one to three, usually two, defined length peptides generally define a “motif” for an immunogenic peptide. It is understood that these residues are adapted in close contact with the peptide binding groove of the HLA molecule and their side chains embedded in the specific pocket of this binding groove. In one embodiment, for example, the primary anchor residue for an HLA class I molecule is in accordance with the present invention at position 2 (from the amino terminal position) and residue peptide epitopes 8, 9, 10 at the carboxy terminal position. , Localized at the 11th or 12th position. Alternatively, in another embodiment, the primary anchor residues of the peptide that bind to the HLA class II molecule are spaced relative to each other rather than at the end of the peptide. Here, the peptides are generally at least 9 amino acids long. The primary anchor positions for each motif and supermotif are shown in Table IV. For example, analog peptides can be made by altering the presence or absence of certain residues at the primary and / or secondary anchor positions shown in Table IV. Such analogs are used to modulate the binding affinity and / or population coverage of peptides containing specific HLA motifs or supermotifs.

“Radioactive isotopes” include, but are not limited to the following (non-limiting exemplary uses are also indicated):
Examples of medical isotopes:
Description of isotope use Actinium-225
(AC-225)
See Thorium-229 (Th-229). Actinium-227
(AC-227)
The parent bismuth-212 of radium-223 (Ra-223), an alpha emitter used in the treatment of cancer (ie, breast and prostate cancer) and intraskeletal metastases resulting from cancer radioimmunotherapy
(Bi-212)
See Thorium-228 (Th-228), Bismuth-213
(Bi-213)
See Thorium-229 (Th-229) Cadmium-109
(Cd-109)
Cancer detection cobalt-60
(Co-60)
Radiation source copper-64 for cancer radiotherapy, food irradiation, and pharmaceutical sterilization
(Cu-64)
Positron emitter copper-67 used in cancer therapy and SPECT imaging
(Cu-67)
Β / γ emitter dysprosium-166 used for cancer radioimmunotherapy and diagnostic tests (ie, breast cancer, colon cancer and lymphoma)
(Dy-166)
Cancer radioimmunotherapy erbium-169
(Er-169)
Rheumatoid arthritis treatment Europium-152, especially for small joints associated with fingers and toes
(Eu-152)
Radiation source Europium-154 for food irradiation and pharmaceutical sterilization
(Eu-154)
Radiation source gadolinium-153 for food irradiation and pharmaceutical sterilization
(Gd-153)
Osteoporosis Detection and Nuclear Medical Quality Assurance Device Gold-198
(Au-198)
Transplantation and intracavitary treatment of ovarian, prostate, and brain tumors Holmium-166
(Ho-166)
Multiple myeloma treatment, cancer radioimmunotherapy, bone marrow removal, and rheumatoid arthritis treatment iodine-125 in targeted bone treatment
(I-125)
Osteoporosis detection, diagnostic imaging, follow-up drugs, brain cancer treatment, radiolabeling, tumor imaging, receptor mapping in the brain, interstitial radiation therapy, brachytherapy for prostate cancer treatment, measurement of glomerular filtration rate (GFR) , Measurement of plasma volume, detection of deep vein thrombosis in the leg iodine-131
(I-131)
Thyroid function assessment, detection of thyroid disease, treatment of thyroid cancer and other non-malignant thyroid diseases (ie, Graves' disease, goiter, and hyperthyroidism), leukemia using cancer radioimmunotherapy, lymphoma, and other Treatment of cancer forms (eg breast cancer) Iridium-192
(Ir-192)
Brachytherapy, treatment of brain tumors and myeloma, treatment of arterial occlusion (ie, arteriosclerosis and restenosis), and implant lutetium-177 for breast and prostate tumors
(Lu-177)
Cancer radioimmunotherapy and arterial occlusion treatment (ie, arteriosclerosis and restenosis)
Molybdenum-99
(Mo-99)
The parent of Technetium-99m (Tc-99m) used for imaging of the brain, liver, lungs, heart, and other organs. Currently, Tc-99m is used for imaging of various cancers and diseases including brain, heart, liver, lung; and is the most radioisotope used for detection of deep vein thrombosis in the legs Widely used.
Osmium-194
(Os-194)
Cancer Radioimmunotherapy Palladium-103
(Pd-103)
Prostate cancer treatment platinum-195m
(Pt-195m)
Test of cisplatin, chemotherapeutic drug biodistribution and metabolism Phosphorus-32
(P-32)
Treatment of true primary erythrocytosis (hemocytic disease) and leukemia, diagnosis / treatment of bone cancer; treatment of colon cancer, pancreatic cancer, and liver cancer; radiolabeling of nucleic acids for in vitro testing, diagnosis of surface tumors, Treatment of arterial occlusion (ie, arteriosclerosis and restenosis) and intraluminal therapy phospho-33
(P-33)
Treatment of leukemia, diagnosis / treatment of bone disease, radiolabeling, and arterial occlusion (ie, arteriosclerosis and restenosis) Radium-223
(Ra-223)
Actinium-227 (Ac-227) Reference Rhenium-186
(Re-186)
Reduction of bone cancer pain, rheumatoid arthritis treatment, and diagnosis of lymphoma, bone cancer, breast cancer, colon cancer, and liver cancer using radioimmunotherapy, and treatment rhenium-188
(Re-188)
Diagnosis and treatment of cancer using radioimmunotherapy, reduction of bone cancer pain, treatment of rheumatoid arthritis, and treatment of prostate cancer Rhodium-105
(Rh-105)
Cancer radioimmunotherapy samarium-145
(Sm-145)
Eye Cancer Treatment Samarium-153
(Sm-153)
Cancer radioimmunotherapy and bone cancer pain relief scandium-47
(Sc-47)
Cancer Radioimmunotherapy and Bone Cancer Pain Relief Selenium-75
(Se-75)
Radiotracer used for brain examination, imaging of the adrenal cortex using γ-scintigraphy, lateral location of steroid-secreting tumors, pancreatic scanning, detection of hyperparathyroidism, bile acids from the endogenous pool Decrease rate measurement Strontium-85
(Sr-85)
Bone cancer detection and brain scan strontium-89
(Sr-89)
Reduction of bone cancer pain, treatment of multiple myeloma, and osteoblast therapy Technetium-99m
(Tc-99m)
See Molybdenum-99 (Mo-99) Thorium-228
(Th-228)
Thorium-229, parent of bismuth-212 (Bi-212), an alpha emitter used in cancer radioimmunotherapy
(Th-229)
The parent of actinium-225 (Ac-225) and the grand parent of bismuth-213 (Bi-213) which are alpha emitters used in cancer radioimmunotherapy
Thulium-170
(Tm-170)
Gamma ray source for blood irradiator, energy source tin-117m for medical device for implantation
(Sn-117m)
Cancer radioimmunotherapy and bone cancer pain relief Tungsten-188
(W-188)
Parental xenon for rhenium-188 (Re-188) used for diagnosis / treatment of cancer, reduction of bone cancer pain, rheumatoid arthritis treatment, and arterial occlusion (ie, arteriosclerosis and restenosis) 127
(Xe-127)
Neuroimaging of brain disorders, high resolution SPECT examination, pulmonary function examination, and cerebral blood flow examination ytterbium-175
(Yb-175)
Cancer radioimmunotherapy yttrium-90
(Y-90)
Micro-species yttrium-91 obtained from irradiation of yttrium-89 (Y-89) for the treatment of liver cancer
(Y-91)
Yttrium-90 (Y-90) gamma radiation used for cancer radioimmunotherapy (ie, lymphoma, breast cancer, colon cancer, kidney cancer, lung cancer, ovarian cancer, prostate cancer, pancreatic cancer, and inoperable liver cancer) Signs.

  "Randomization" or its synonyms as applied herein to nucleic acids and proteins means that each nucleic acid and peptide consists essentially of random nucleotides and amino acids, respectively. These random peptides (or nucleic acids as discussed herein) can be incorporated into any nucleotide or amino acid at any position. To generate randomized proteins or nucleic acids, allowing the formation of all or most possible combinations across sequences, and thus forming a library of randomized candidate bioactive proteinaceous factors The synthesis process can be designed.

  In one embodiment, the library is “fully randomized” and there are no preferred or invariant sequences at all positions. In another embodiment, the library is a “biased random” library. That is, some positions in the sequence are either kept constant or selected from a limited number of possibilities. For example, nucleotides or amino acid residues are within a defined class (eg, of hydrophobic amino acids), hydrophilic residues, sterically biased (either small or large) residues of the nucleic acid binding domain. Randomized towards the generation of serine, threonine, tyrosine, histidine, or purine for generation, cysteine generation for cross-linking, proline for SH-3 domains, phosphorylation sites, etc. .

  A “recombinant” DNA or RNA molecule is a DNA or RNA molecule that is subjected to molecular manipulation in vitro.

  Non-limiting examples of small molecules include compounds that bind or interact with 98P4B6 (hormones, neuropeptides, chemokines, fragrances, phospholipids, and their functional equivalents that bind to and preferably inhibit the function of 98P4B6 protein. Ligands containing products). Such non-limiting small molecules preferably have a molecular weight of less than about 10 kDa, more preferably less than about 9, less than about 8, less than about 7, less than about 6, less than about 5, or less than about 4 kDa. In certain embodiments, the small molecule physically associates with or binds to 98P4B6 protein; and is not found in naturally occurring metabolic pathways; and / or is more soluble in aqueous solution than non-aqueous solution.

  The “stringency” of a hybridization reaction is readily determinable by one of ordinary skill in the art, and is generally an empirical calculation that depends on probe length, wash temperature, and salt concentration. In general, longer probes require higher temperatures for proper annealing, while shorter probes require lower temperatures. Hybridization generally depends on the ability of the denatured nucleic acid to anneal again when complementary strands exist in an environment below their melting temperature. The higher the degree of desired homology between the probe and hybridizable sequence, the higher the relative temperature that can be used. As a result, higher relative temperatures tend to make the reaction conditions more stringent, while lower temperatures result in less. For further details and explanation of the stringency of hybridization reactions, see Ausubel et al., Current Protocols in Molecular Biology, Wiley Interscience Publishers (1995).

  “Stringent conditions”, or “high stringent conditions”, as defined herein, may be identified by, but not limited to: (1) low ionic strength and Use high temperature (eg 0.015 M sodium chloride / 0.0015 M sodium citrate / 0.1% sodium dodecyl sulfate, 50 ° C.); (2) Denaturing agents (eg formamide) during hybridization (E.g. 50% (v / v) formamide with 0.1% bovine serum albumin / 0.1% Ficoll / 0.1% polyvinylpyrrolidone / 750 mM sodium chloride, 75 mM 50 mM sodium phosphate buffer pH 42 with sodium acid, 42 ° C.); or (3) 50% pH Muamide, 5 × SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 × Denhardt's solution, sonicated Salmon sperm DNA (50 μg / ml), 0.1% SDS, and 10% dextran sulfate were used at 42 ° C., at 42 ° C. in 0.2 × SSC (sodium chloride / sodium citrate), It is then washed at 55 ° C. in 50% formamide, followed by a high stringency wash consisting of 0.1 × SSC containing EDTA at 55 ° C. “Moderate stringent conditions” are described by, but not limited to, Sambrook et al., Molecular Cloning: A Laboratory Manual, New York: Cold Spring Harbor Press, 1989, and more than the hybridization conditions described above. Includes the use of low stringency wash solutions and hybridization conditions (eg, temperature, ionic strength and% SDS). Examples of moderate stringency conditions are 20% formamide, 5 × SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5 × Denhardt's solution, 10% Of dextran sulfate and 20 mg / mL denatured sheared salmon sperm DNA overnight incubation at 37 ° C. followed by about 37 ° C.-50 ° C. in 1 × SSC Cleaning the filter with Those skilled in the art will recognize methods for adjusting temperature, ionic strength, etc., as needed to accommodate factors such as probe length.

  An HLA “supermotif” is a peptide bond specifically shared by HLA molecules encoded by two or more HLA alleles. The frequency of all phenotypes of HLA supertypes in various racial populations is shown in Table IV (F). Non-limiting components of the various supertypes are as follows:

。

.

  The calculated population coverage obtained by the combination of different HLA supertypes is shown in Table IV (G).

  As used herein, “treating” or “therapeutic” and grammatically related terms are any improvement in any outcome of the disease (eg, prolonged survival, less morbidity, and // reduction of side effects (which is a byproduct of alternative treatment modalities), and complete eradication of the disease is not required.

  A “transgenic animal” (eg, a mouse or rat) is an animal that has cells that contain a transgene that has been introduced into the animal or is ancestor of the animal prior to birth (eg, at the embryonic stage). Was introduced. A “transgene” is a DNA that is integrated into the genome of a cell from which a transgenic animal develops.

  As used herein, an HLA or cellular immune response “vaccine” refers to a composition comprising or encoding one or more peptides of the invention. Such vaccines (eg, one or more distinct peptides; one or more peptides of the invention encompassed by the polyepitope peptide; or such separate peptides or polyepitopes (eg, mini-encoding polyepitope peptides) There are numerous embodiments of a cocktail of nucleic acids encoding a gene). “One or more peptides” refers to 1 to 150 or more (eg, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 of the present invention). 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 , 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125 , 130, 135, 140, 145, or 150 or more peptides). A peptide or polypeptide can be modified as needed (eg, by lipidation, targeting sequences, or addition of other sequences). The HLA class I peptides of the present invention can be mixed or linked with HLA class II molecules to promote the activation of both cytotoxic and helper T lymphocytes. The HLA vaccine may also include peptide pulse antigen presenting cells (eg, dendritic cells).

  The term “variant” refers to one or more of the corresponding portions of a molecule (eg, a specifically described protein (eg, 98P4B6 protein shown in FIG. 2 or FIG. 3)) that exhibits a modification from the type or reference described. Protein having different amino acid residues). An analog is an example of a modified protein. Splicing isoforms and single nucleotide polymorphisms (SNPs) are examples of further variants.

  The “98P4B6-related proteins” of the present invention include the proteins specifically identified herein, as well as allelic variants (methods outlined herein or methods readily available in the art). Conservative substitution variants, analogs and homologues that can be isolated / generated and characterized without performing experiments according to Also included are fusion proteins that bind to portions of different 98P4B6 proteins or fragments thereof, and fusion proteins of 98P4B6 proteins and heterologous polypeptides. Such 98P4B6 protein is collectively referred to as 98P4B6-related protein, or 98P4B6, which is the protein of the present invention. The term “98P4B6 related protein” means 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24. 25 or more amino acids; or at least 30, 35, 40, 45, 50, 55, 60, 65, 70, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, Refers to a polypeptide fragment or 98P4B6 protein sequence of 500, 525, 550, 575 or more than 576 amino acids.

(II.) 98P4B6 polynucleotide)
One aspect of the present invention provides a polynucleotide, preferably in isolated form, corresponding to or complementary to all or part of the 98P4B6 gene, mRNA and / or coding sequence, including 98P4B6 related Polynucleotides encoding proteins and fragments thereof, DNA, RNA, DNA / RNA hybrids, and related molecules, polynucleotides or oligonucleotides complementary to the 98P4B6 gene or mRNA sequence, or portions thereof, and the 98P4B6 gene, mRNA, Or polynucleotides or oligonucleotides that hybridize to 98P4B6 encoding polynucleotides (collectively “98P4B6 polynucleotides”). As referenced in this section, in all examples, T can also be U in FIG.

Embodiments of 98P4B6 polynucleotides include: 98P4B6 polynucleotide having the sequence shown in FIG. 2, 98P4B6 nucleotide sequence as shown in FIG. 2 (where T is U); At least 10 consecutive nucleotides of a polynucleotide having the sequence as shown; or at least 10 consecutive nucleotides of a polynucleotide having the sequence shown in FIG. 2 (where T is U). For example, embodiments of 98P4B6 nucleotides include, but are not limited to:
(I) a polynucleotide comprising a sequence as shown in FIG. 2, consisting essentially of such a sequence, or consisting of such a sequence (where T can also be U);
(II) a sequence as shown in FIG. 2A comprising, consisting essentially of, or consisting of, nucleotide residue number 355 to nucleotide residue number 1719 (including a stop codon) A polynucleotide consisting of (where T can also be U);
(III) a sequence as shown in FIG. 2B comprising, consisting essentially of, or consisting of nucleotide residue number 4 to nucleotide residue number 138 (including a stop codon) A polynucleotide consisting of (where T can also be U);
(IV) a sequence as shown in FIG. 2C comprising, consisting essentially of, or consisting of nucleotide residue number 188 to nucleotide residue number 1552 (including a stop codon) A polynucleotide consisting of (where T can also be U);
(V) a sequence as shown in FIG. 2D comprising, consisting essentially of, or consisting of nucleotide residue number 318 to nucleotide residue number 1682 (including a stop codon) A polynucleotide consisting of (where T can also be U);
(VI) a sequence as shown in FIG. 2E comprising, consisting essentially of, or consisting of nucleotide residue number 318 to nucleotide residue number 1577 (including a stop codon) A polynucleotide consisting of (where T can also be U);
(VII) a sequence as shown in FIG. 2F comprising, consisting essentially of, or consisting of nucleotide residue number 318 to nucleotide residue number 1790 (including stop codon) A polynucleotide consisting of (where T can also be U);
(VIII) a sequence as shown in FIG. 2G, comprising nucleotide residue number 295 to nucleotide residue number 2025 (including a stop codon), consisting essentially of such a sequence, or such a sequence A polynucleotide consisting of (where T can also be U);
(IX) a sequence as shown in FIG. 2H comprising, consisting essentially of, or consisting of nucleotide residue no. 394 to nucleotide residue no. 1866 (including a stop codon) A polynucleotide consisting of (where T can also be U);
(X) a sequence as shown in FIG. 2I comprising nucleotide residue number 355 to nucleotide residue number 1719 (including a stop codon), consisting essentially of such a sequence, or such a sequence A polynucleotide consisting of (where T can also be U);
(XI) a sequence as shown in FIG. 2J comprising, consisting essentially of, or consisting of nucleotide residue number 355 to nucleotide residue number 1719 (including the stop codon) A polynucleotide consisting of (where T can also be U);
(XII) a sequence as shown in FIG. 2K comprising, consisting essentially of, or consisting of nucleotide residue number 355 to nucleotide residue number 1719 (including a stop codon) A polynucleotide consisting of (where T can also be U);
(XIII) a sequence as shown in FIG. 2L comprising, consisting essentially of, or consisting of nucleotide residue number 355 to nucleotide residue number 1719 (including a stop codon) A polynucleotide consisting of (where T can also be U);
(XIV) a sequence as shown in FIG. 2M comprising, consisting essentially of, or consisting of nucleotide residue number 355 to nucleotide residue number 1719 (including a stop codon) A polynucleotide consisting of (where T can also be U);
(XV) a sequence as shown in FIG. 2N comprising, consisting essentially of, or consisting of nucleotide residue number 355 to nucleotide residue number 1719 (including a stop codon) A polynucleotide consisting of (where T can also be U);
(XVI) a sequence as shown in FIG. 2O comprising, consisting essentially of, or consisting of nucleotide residue no. 355-nucleotide residue no. 1719 (including a stop codon) A polynucleotide consisting of (where T can also be U);
(XVII) a sequence as shown in FIG. 2P comprising, consisting essentially of, or consisting of nucleotide residue number 355 to nucleotide residue number 1719 (including the stop codon) A polynucleotide consisting of (where T can also be U);
(XVIII) a sequence as shown in FIG. 2Q comprising, consisting essentially of, or consisting of nucleotide residue number 355 to nucleotide residue number 1719 (including a stop codon) A polynucleotide consisting of (where T can also be U);
(XIX) a sequence as shown in FIG. 2R comprising, consisting essentially of, or consisting of nucleotide residue number 355 to nucleotide residue number 1719 (including a stop codon) A polynucleotide consisting of (where T can also be U);
(XX) a sequence as shown in FIG. 2S comprising, consisting essentially of, or consisting of nucleotide residue number 355 to nucleotide residue number 1719 (including a stop codon) A polynucleotide consisting of (where T can also be U);
(XXI) a sequence as shown in FIG. 2T comprising, consisting essentially of, or consisting of nucleotide residues 295 to 2025 (including a stop codon) A polynucleotide consisting of (where T can also be U);
(XXII) a sequence as shown in FIG. 2U comprising, consisting essentially of, or consisting of nucleotide residue number 295 to nucleotide residue number 2025 (including a stop codon) A polynucleotide consisting of (where T can also be U);
(XXIII) a sequence as shown in FIG. 2V comprising, consisting essentially of, or consisting of, nucleotide residue number 295 to nucleotide residue number 2025 (including a stop codon) A polynucleotide consisting of (where T can also be U);
(XXIV) a sequence as shown in FIG. 2W comprising, consisting essentially of, or consisting of nucleotide residue number 295 to nucleotide residue number 2025 (including a stop codon) A polynucleotide consisting of (where T can also be U);
(XXV) a sequence as shown in FIG. 2X comprising, consisting essentially of, or consisting of nucleotide residue number 295 to nucleotide residue number 2025 (including a stop codon) A polynucleotide consisting of (where T can also be U);
(XXVI) a sequence as shown in FIG. 2Y comprising, consisting essentially of, or consisting of nucleotide residue no. 394 to nucleotide residue no. 1866 (including a stop codon) A polynucleotide consisting of (where T can also be U);
(XXVII) a sequence as shown in FIG. 2Z comprising, consisting essentially of, or consisting of nucleotide residue no. 394 to nucleotide residue no. 1866 (including a stop codon) A polynucleotide consisting of (where T can also be U);
(XXVIII) a sequence as shown in FIG. 2AA comprising, consisting essentially of, or consisting of nucleotide residue no. 394 to nucleotide residue no. 1866 (including a stop codon) A polynucleotide consisting of (where T can also be U);
(XXIX) a sequence as shown in FIG. 2AB comprising, consisting essentially of, or consisting of nucleotide residue number 394 to nucleotide residue number 1866 (including a stop codon) A polynucleotide consisting of (where T can also be U);
(XXX) a sequence as shown in Figure 2AC comprising, consisting essentially of, or consisting of nucleotide residue no. 394 to nucleotide residue no. 1866 (including a stop codon) A polynucleotide consisting of (where T can also be U);
(XXXI) a sequence as shown in FIG. 2AD comprising, consisting essentially of, or consisting of nucleotide residue number 394 to nucleotide residue number 1866 (including a stop codon) A polynucleotide consisting of (where T can also be U);
(XXXII) a sequence as shown in FIG. 2AE comprising, consisting essentially of, or consisting of nucleotide residue number 394 to nucleotide residue number 1866 (including a stop codon) A polynucleotide consisting of (where T can also be U);
(XXXIII) a sequence as shown in FIG. 2AF comprising, consisting essentially of, or consisting of nucleotide residue number 394 to nucleotide residue number 1866 (including a stop codon) A polynucleotide consisting of (where T can also be U);
(XXXIV) a sequence as shown in FIG. 2AG comprising, consisting essentially of, or consisting of nucleotide residue no. 394 to nucleotide residue no. 1866 (including a stop codon) A polynucleotide consisting of (where T can also be U);
(XXXV) a sequence as shown in FIG. 2AH comprising, consisting essentially of, or consisting of nucleotide residue number 394 to nucleotide residue number 1866 (including a stop codon) A polynucleotide consisting of (where T can also be U);
(XXXVI) a sequence as shown in Figure 2AI comprising, consisting essentially of, or consisting of nucleotide residue no. 394 to nucleotide residue no. 1866 (including a stop codon) A polynucleotide consisting of (where T can also be U);
(XXXVII) a sequence as shown in FIG. 2AJ comprising, consisting essentially of, or consisting of nucleotide residue number 394 to nucleotide residue number 1866 (including a stop codon) A polynucleotide consisting of (where T can also be U);
(XXXVIII) a sequence as shown in FIG. 2AK comprising, consisting essentially of, or consisting of nucleotide residue number 394 to nucleotide residue number 1866 (including a stop codon) A polynucleotide consisting of (where T can also be U);
(XXXIX) a sequence as shown in FIG. 2AL comprising, consisting essentially of, or consisting of nucleotide residue number 394 to nucleotide residue number 1866 (including a stop codon) A polynucleotide consisting of (where T can also be U);
(XL) a polynucleotide encoding a 98P4B6-related protein that is at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% homologous to the full length amino acid sequence shown in FIGS. 2A-AL;
(XLI) a polynucleotide encoding a 98P4B6-related protein that is at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% identical to the full length amino acid sequences shown in FIGS. 2A-AL;
(XLII)
A polynucleotide encoding at least one peptide shown in Table VIII-XXI and XXII-XLIX;
(XLIII)
At least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 having a value greater than 0.5 in the hydrophilic profile of FIG. , 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 in any integer increment up to 454, including amino acid positions, 3A, 3G and 3H of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, A polynucleotide encoding a peptide region of 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids;
(XLIV)
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, having a value of less than 0.5 in the hydropathic profile of FIG. Figure 18, in any integer increment up to 454 including 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid positions At least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 of 3A, 3G and 3H peptides A polynucleotide encoding a peptide region of 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids;
(XLV)
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 having values greater than 0.5 in the accessible residue percentage profile of FIG. , 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 any integer increment up to 454 including amino acid positions 3A, 3G and 3H, at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, A polynucleotide encoding a peptide region of 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids;
(XLVI)
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, having a value greater than 0.5 in the average flexibility profile of FIG. In any integer increment up to 454 including 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid positions 3A, 3G and 3H, at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 A polynucleotide encoding a peptide region of 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids;
(XLVII)
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 having a value greater than 0.5 in the β-turn profile of FIG. , 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 in any integer increment up to 454, including amino acid positions, 3A, 3G and 3H of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, A polynucleotide encoding a peptide region of 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids;
(XLVIII)
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, having a value greater than 0.5 in the hydrophilic profile of FIG. Figure 18, in any integer increment up to 45, including 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid positions At least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 of the peptide of 3B , 28, 29, 30, 31, 32, 33, 34, a polynucleotide encoding a peptide region of 35 amino acids;
(XLIX)
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, having a value of less than 0.5 in the hydropathic profile of FIG. Figure 18, in any integer increment up to 45, including 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid positions At least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 of the peptide of 3B , 28, 29, 30, 31, 32, 33, 34, a polynucleotide encoding a peptide region of 35 amino acids;
(L)
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 having values greater than 0.5 in the accessible residue percentage profile of FIG. , 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 any integer increment up to 45 including amino acid positions 3B, at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, A polynucleotide encoding a peptide region of 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids;
(LI)
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, having a value greater than 0.5 in the average flexibility profile of FIG. In any integer increment up to 45 including 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid positions 3, at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 of FIG. 3B , 27, 28, 29, 30, 31, 32, 33, 34, a polynucleotide encoding a peptide region of 35 amino acids;
(LII)
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 having a value greater than 0.5 in the β-turn profile of FIG. , 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 in any integer increment up to 45 including amino acid positions, 3B, at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, A polynucleotide encoding a peptide region of 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids;
(LIII)
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, having a value greater than 0.5 in the hydrophilic profile of FIG. Figure 18, in any integer increment up to 419 including 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid positions At least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 of 3C peptides , 28, 29, 30, 31, 32, 33, 34, a polynucleotide encoding a peptide region of 35 amino acids;
(LIV)
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, having a value of less than 0.5 in the hydropathic profile of FIG. Figure 18, in any integer increment up to 419 including 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid positions At least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 of 3C peptides , 28, 29, 30, 31, 32, 33, 34, a polynucleotide encoding a peptide region of 35 amino acids;
(LV)
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 having values greater than 0.5 in the accessible residue percentage profile of FIG. , 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 any integer increment up to 419 including amino acid positions 3C, at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, A polynucleotide encoding a peptide region of 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids;
(LVI)
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, having a value greater than 0.5 in the average flexibility profile of FIG. In any integer increment up to 419 including 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid positions 3, at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 of FIG. 3C , 27, 28, 29, 30, 31, 32, 33, 34, a polynucleotide encoding a peptide region of 35 amino acids;
(LVII)
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 having a value greater than 0.5 in the β-turn profile of FIG. , 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 in any integer increment up to 419, including amino acid positions, At least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, of the peptide of FIG. A polynucleotide encoding a peptide region of 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids;
(LVIII)
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, having a value greater than 0.5 in the hydrophilic profile of FIG. Figure 18, in any integer increment up to 490 including 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid positions At least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 of 3D, 3F and 3J peptides A polynucleotide encoding a peptide region of 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids;
(LIX)
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, having a value of less than 0.5 in the hydropathic profile of FIG. Figure 18, in any integer increment up to 490 including 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid positions At least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 of 3D, 3F and 3J peptides A polynucleotide encoding a peptide region of 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids;
(LX)
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 having values greater than 0.5 in the accessible residue percentage profile of FIG. , 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 any integer increment up to 490 including amino acid positions And at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, of the peptides of FIGS. 3D, 3F and 3J, A polynucleotide encoding a peptide region of 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids;
(LXI)
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, having a value greater than 0.5 in the average flexibility profile of FIG. In any integer increment up to 490 including 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid positions 3D, 3F and 3J, at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 A polynucleotide encoding a peptide region of 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids;
(LXII)
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 having a value greater than 0.5 in the β-turn profile of FIG. , 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 in any integer increment up to 490, including amino acid positions, 3D, 3F, and 3J of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, A polynucleotide encoding a peptide region of 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids;
(LXIII)
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, having a value greater than 0.5 in the hydrophilic profile of FIG. Figure 18, in any integer increment up to 576 including 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid positions At least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 of 3E and 3I peptides , 27, 28, 29, 30, 31, 32, 33, 34, a polynucleotide encoding a peptide region of 35 amino acids;
(LXIV)
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, having a value of less than 0.5 in the hydropathic profile of FIG. Figure 18, in any integer increment up to 576 including 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid positions At least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 of 3E and 3I peptides , 27, 28, 29, 30, 31, 32, 33, 34, a polynucleotide encoding a peptide region of 35 amino acids;
(LXV)
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 having values greater than 0.5 in the accessible residue percentage profile of FIG. , 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 any integer increment up to 576 including amino acid positions 3E and 3I of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, A polynucleotide encoding a peptide region of 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids;
(LXVI)
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, having a value greater than 0.5 in the average flexibility profile of FIG. In any integer increment up to 576 including 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid positions 3E and at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 of the peptides of FIGS. 3E and 3I A polynucleotide encoding a peptide region of 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids;
(LXVII)
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 having a value greater than 0.5 in the β-turn profile of FIG. , 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 any number increments up to 576 including amino acid positions 3E and 3I of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, Polynucleotide encoding a peptide region of 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids
(LXVIII)
A polynucleotide that is completely complementary to any one of the polynucleotides (I) to (LXVII).

(LXIX)
A peptide encoded by any one of (I)-(LXVIII); and (LXX)
A composition comprising a polynucleotide of any of (I) to (LXVIII) or a peptide of (LXIX) with a pharmaceutical excipient and / or in human unit dosage form.

(LXXI)
98. A method of modulating a cell that expresses 98P4B6, the method using a polynucleotide of any one of (I) to (LXVIII) or a peptide of (LXIX) or a composition of (LXX).

(LXXII)
In a method for diagnosing, preventing, prognosing, or treating an individual having cells expressing 98P4B6, a polynucleotide of any one of (I) to (LXVIII) or a peptide of (LXIX), or a composition of (LXX) How to use things.

(LXXIII)
In a method for diagnosing, preventing, prognostic or treating an individual carrying cells expressing 98P4B6 derived from a cancer of the tissues listed in Table 1, a polynucleotide of any of (I)-(LXVIII) or A method of using a peptide of (LXIX) or a composition of (LXX).

(LXXIV)
A method of using any one of the polynucleotides (I) to (LXVIII) or the peptide (LXIX), or the composition (LXX) in a method for diagnosing, preventing, prognosing, or treating cancer.

(LXXV)
In the method for diagnosing, preventing, prognosing or treating cancer of the tissues listed in Table 1, a polynucleotide of any one of (I) to (LXVIII) or a peptide of (LXIX), or a composition of (LXX) And (LXXVI)
In a method for identifying or characterizing a modulator of a cell expressing 98P4B6, a method of using any of the polynucleotides (I) to (LXVIII) or the peptide of (LXIX), or the composition of (LXX).

  As used herein, a range is understood to specifically disclose all unit positions therein.

Exemplary embodiments of the invention disclosed herein include a 98P4B6 polynucleotide that encodes a specific portion of a 98P4B6 mRNA sequence (and a sequence complementary to such a sequence) (eg, its protein and / or Sequence encoding the fragment). For example:
(A) 4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24 of 98P4B6 variant 1 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 225, 250, 275, 300, 325, 350, 375, 400, 410, 420, 430, 440, 450 or 454 or more The maximum equivalent length for other variants is as follows: variant 2 (44 amino acids); variant 5 (419 amino acids), variant 6 (490 amino acids), Variant 7 (576 amino acids), variant 8 (490 amino acids), variant 13 (454 amino acids), variant 14 (454 amino acids), variant 21 (576 amino acids) and variants 25 (490 amino acids).

  For example, exemplary embodiments of the invention disclosed herein include the following: A polynucleotide encoding about amino acid 1 to about amino acid 10 of the 98P4B6 protein shown in FIG. 2 or FIG. A polynucleotide encoding from about amino acid 10 to about amino acid 20 of the 98P4B6 protein shown in FIG. 2 or FIG. 3, a polynucleotide encoding from about amino acid 20 to about amino acid 30 of the 98P4B6 protein shown in FIG. 2 or FIG. A polynucleotide encoding from about amino acid 30 to about amino acid 40 of the 98P4B6 protein shown in FIG. 2 or FIG. 3, a polynucleotide encoding from about amino acid 40 to about amino acid 50 of the 98P4B6 protein shown in FIG. 2 or FIG. 2 or shown in Figure 3 A polynucleotide encoding about amino acid 50 to about amino acid 60 of 98P4B6 protein, a polynucleotide encoding about amino acid 60 to about amino acid 70 of 98P4B6 protein shown in FIG. 2 or FIG. 3, and 98P4B6 protein shown in FIG. 2 or FIG. A polynucleotide encoding about amino acid 70 to about amino acid 80, a polynucleotide encoding about amino acid 80 to about amino acid 90 of the 98P4B6 protein shown in FIG. 2 or FIG. 3, and about a 98P4B6 protein shown in FIG. 2 or FIG. Polynucleotides encoding from amino acid 90 to about amino acid 100, which end in carboxyl-terminal amino acids shown in FIG. 2 or FIG. 3 in increments of about 10 amino acids. Thus, a polynucleotide encoding a portion of the amino acid sequence (of about 10 amino acids) of the amino acid at the carboxyl terminus of amino acid 100 to 98P4B6 protein is an embodiment of the invention. Here, it is understood that each particular amino acid position discloses position ± 5 amino acid residues.

  Polynucleotides that encode a relatively long portion of the 98P4B6 protein are also within the scope of the invention. For example, a polynucleotide encoding from about amino acid 1 (or 20 or 30 or 40 or the like) to about amino acid 20 (or 30 or 40 or 50 or the like) of the 98P4B6 protein or “variant” shown in FIG. 2 or FIG. It can be generated by various techniques well known in the art. These polynucleotide fragments can include any portion of the 98P4B6 sequence shown in FIG.

  Further exemplary embodiments of the invention disclosed herein include 98P4B6 protein or one or more of the biological motifs contained within the “variant” sequence (98P4B6 protein shown in Tables VIII-XXI and XXII-XLIX). Or a 98P4B6 polynucleotide fragment that encodes a subsequence comprising one or more motifs of “variants”). In another embodiment, representative polynucleotide fragments of the invention encode one or more of the 98P4B6 protein or variant regions that exhibit homology to a known molecule. In another embodiment of the invention, a representative polynucleotide fragment is a 98P4B6 protein or a modified N-glycosylation site, a phosphorylation site of cAMP and cGMP-dependent protein kinases, a phosphorylation site of casein kinase II, or N- It can encode one or more of a myristoylation site and an amidation site.

  To determine the starting position of any peptide listed in Tables VIII-XXI and Tables XXII-XLIX (collectively HLA peptide tables) relative to the parent protein (eg, variant 1, variant 2, etc.) Note that it is done for three factors: the particular variant, the length of the peptide in the HLA peptide table, and the search peptide listed in Table VII. In general, a unique search peptide is used to obtain an HLA peptide for a particular variant. The position of each search peptide relative to its parent protein molecule is listed in Table VII. Thus, if the search peptide begins at the “X” position, to obtain the actual position of the HLA peptide in the parent molecule, an “X-1” value is assigned to each position in Table VIII-XXI and Table XXII-IL. Must be added. For example, if the search peptide begins at position 150 of the parent molecule, 150-1 or 149 must be added to the amino acid position of each HLA peptide to calculate the amino acid position in the parent molecule.

(II.A) Use of 98P4B6 polynucleotide)
II. A. 1. ) Monitoring genetic abnormalities The polynucleotides in the previous chapters have a number of different specific uses. The gene map of human 98P4B6 is mapped to the chromosomal location shown in the example entitled “98P4B6 Chromosome Mapping”. For example, to map the 98P4B6 gene to this chromosome, a polynucleotide encoding a different region of the 98P4B6 protein has cytogenetic abnormalities at this chromosomal location (eg, abnormalities identified as being associated with various cancers). Used to characterize. In certain genes, various chromosomal abnormalities (including rearrangements) have been identified as frequent cytogenetic abnormalities in a number of different cancers (eg, Krajinovic et al., Mutat. Res. 382 (3-4 ): 81-83 (1998); see Johansson et al., Blood 86 (10): 3905-3914 (1995) and Finger et al., PNA S. 85 (23): 9158-9162 (1988). about). Thus, a polynucleotide encoding a particular region of 98P4B6 protein exhibits cytogenetic abnormalities in the chromosomal region encoding 98P4B6 that may contribute to a malignant phenotype with greater accuracy than previously possible. Provides new tools that can be used to outline. In this context, these polynucleotides meet the need in the art to increase the sensitivity of chromosomal screening to identify smaller and less common chromosomal abnormalities (eg, Evans et al., Am. J. Obstet). Gynecol 171 (4): 1055-1057 (1994)).

  In addition, since 98P4B6 has been shown to be highly expressed in prostate and other cancers, 98P4B6 polynucleotides are used in a method to assess the status of the 98P4B6 gene product in normal versus cancerous tissues. Typically, a polynucleotide encoding a particular region of the 98P4B6 protein has an abnormality (eg, deletion, insertion, point mutation, or in a particular region of the 98P4B6 gene (eg, a region containing one or more motifs) Used to assess the presence of changes that cause loss of antigen). Exemplary assays include RT-PCR assays and single-stranded structural polymorphism (SSCP) analysis (see, eg, Marrogi et al., J. Cutan. Pathol. 26 (8); 369-378 (1999)). Both of which utilize a polynucleotide encoding a particular region of the protein to test these regions within the protein.

II. A. 2. ) Antisense Embodiments Embodiments of the invention disclosed herein for other specifically complementary nucleic acids are based on or alternative to genomic DNA, cDNA, ribozymes, and antisense molecules, and alternative backbones Nucleic acid molecules containing bases (which may be derived from natural sources or synthesized) and include molecules capable of inhibiting the 98P4B6 RNA or protein expression. For example, antisense molecules include RNA or other molecules, including peptide nucleic acids (PNA) or non-nucleic acid molecules (eg, phosphorothioate derivatives that specifically bind to DNA or RNA in a base-pair dependent manner). It can be. One skilled in the art can readily obtain these classes of nucleic acid molecules using the 98P4B6 polynucleotides and polynucleotide sequences disclosed herein.

  Antisense technology requires the administration of exogenous oligonucleotides that bind to target polynucleotides placed within the cell. The term “antisense” refers to the fact that such oligonucleotides are complementary to their intracellular target (eg, 98P4B6). See, for example, Jack Cohen, Oligodeoxynucleotides, Antisense Inhibitors of Gene Expression, CRC Press, 1989; and Synthesis 1: 1-5 (1998). The 98P4B6 antisense oligonucleotides of the present invention include derivatives such as S-oligonucleotides (phosphorothioate derivatives or S-oligos, Jack Cohen, supra). This shows an enhanced cancer cell growth inhibitory action. S-oligo (nucleoside phosphorothioate) is an isoelectric analog of an oligonucleotide (O-oligo) where the non-bridging oxygen atom of the phosphate group is replaced with a sulfur atom. The S-oligos of the present invention can be prepared by treatment of the corresponding O-oligo with 3H-1,2-benzodithiol-3-one-1,1-dioxide, a sulfur transport reagent. Iyer, R.A. P. Et al. Org. Chem. 55: 4693-4698 (1990); and Iyer, R .; P. Et al. Am. Chem. Soc. 112: 1253-1254 (1990). Additional 98P4B6 antisense oligonucleotides of the present invention include morpholino antisense oligonucleotides known in the art (see, eg, Partridge et al., 1996, Antisense & Nucleic Acid Development 6: 169-175).

  The 98P4B6 antisense oligonucleotides of the present invention are typically complementary to and stable with the first 100 5 ′ codons or the last 100 3 ′ codons of the 98P4B6 genomic sequence or corresponding mRNA. RNA or DNA that hybridizes to Absolute complementarity is not required, but a high degree of complementarity is preferred. The use of oligonucleotides complementary to this region allows selective hybridization to 98P4B6 mRNA and not to mRNA specific for other regulatory subunits of protein kinases. In one embodiment, a 98P4B6 antisense oligonucleotide of the invention is a 15-30 mer fragment of an antisense DNA molecule having a sequence that hybridizes to 98P4B6 mRNA. Optionally, the 98P4B6 antisense oligonucleotide is a 30-mer oligonucleotide that is complementary to a region in the first 10 5 'codons or the last 10 3' codons of 98P4B6. Alternatively, antisense molecules are modified to use ribozymes in the inhibition of 98P4B6 expression (see, eg, LA Couture & DT Stinchcomb; Trends Genet 12: 510-515 (1996)).

II. A. 3. ) Primers and primer pairs Further specific embodiments of these nucleotides of the present invention provide primer and primer pairs that allow specific amplification of the polynucleotide of the present invention or any particular portion thereof, and Probes that selectively or specifically hybridize to a nucleic acid molecule or any portion thereof. The probe can be labeled with a detectable marker (eg, a radioisotope, a fluorescent compound, a bioluminescent compound, a chemiluminescent compound, a metal chelator, or an enzyme). Such probes and primers can be used to detect the presence of 98P4B6 polynucleotides in a sample and as a means to detect cells that express 98P4B6 protein.

  Examples of such probes include polypeptides comprising all or part of the human 98P4B6 cDNA shown in FIG. Examples of primer pairs that can specifically amplify 98P4B6 mRNA are also described in the Examples. As those skilled in the art will appreciate, a large number of different primers and probes can be prepared based on the sequences provided herein and effectively used to amplify and / or detect 98P4B6 mRNA. .

  The 98P4B6 polynucleotides of the present invention are useful for a variety of purposes. Such purposes include use as probes and primers for amplification and / or detection of 98P4B6 gene, mRNA, or fragments thereof; as reagents for the diagnosis and / or prognosis of prostate cancer and other cancers Use as a coding sequence capable of inducing expression of 98P4B6 polypeptide; use as a tool to regulate or inhibit expression of 98P4B6 gene and / or translation of 98P4B6 transcript; and use as a therapeutic agent Although not mentioned, it is not limited to these.

  The present invention relates to 98P4B6 or 98P4B6-related nucleic acid sequences from naturally occurring sources (human or other mammals) and isolated nucleic acids themselves (all or most of the sequences found in the probes used). Use of any of the probes described herein for identifying and isolating.

(II.A.4.) Isolation of nucleic acid molecule encoding 98P4B6)
The 98P4B6 cDNA sequence described herein can be used to isolate other polynucleotides that encode the 98P4B6 gene product (s), as well as polynucleotides that encode homologs of the 98P4B6 gene product, the 98P4B6 gene. Allows isolation of polynucleotides encoding alternatively spliced isoforms, allelic variants, and mutant forms of the product, and analogs of 98P4B6-related proteins. Various molecular cloning methods that can be used to isolate the full-length cDNA encoding the 98P4B6 gene are well known (eg, Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, 2nd edition, Cold Spring Harbor Press). New York, 1989; Current Protocols in Molecular Biology, edited by Aubel et al., Wiley and Sons, 995). For example, lambda phage cloning methodologies can be conveniently used using commercially available cloning systems (eg, Lambda ZAP Express, Stratagene). Phage clones containing the 98P4B6 gene cDNA can be identified by probing with a labeled 98P4B6 cDNA or fragment thereof. For example, in one embodiment, 98P4B6 cDNA (eg, FIG. 2) or a portion thereof can be synthesized and used as a probe to recover full-length cDNA that overlaps and corresponds to the 98P4B6 gene. The 98P4B6 gene itself can be isolated by screening genomic DNA libraries, bacterial artificial chromosome libraries (BAC), yeast artificial chromosome libraries (YAC), etc., using 98P4B6 DNA probes or primers.

II.A.5. Recombinant nucleic acid molecules and host-vector systems)
The present invention also includes recombinant DNA or RNA molecules, fragments, analogs, or homologues containing 98P4B6 polynucleotides (phages, plasmids, phagemids, cosmids, YACs, BACs, and various viruses well known in the art). Vectors and non-viral vectors), and cells transformed or transfected with such recombinant DNA or RNA molecules. Methods for making such molecules are well known (see, eg, Sambrook et al., 1989 (supra)).

  The present invention further provides a host-vector system containing a recombinant DNA molecule, fragment, analog or homologue containing the 98P4B6 polynucleotide in a suitable prokaryotic or eukaryotic host cell. provide. Examples of suitable eukaryotic host cells include yeast cells, plant cells, or animal cells (eg, mammalian cells), or insect cells (eg, cells that can be infected with baculovirus (eg, Sf9 cells or HighFive cells)). ). Examples of suitable mammalian cells include various prostate cancer cell lines (eg, DU145 and TsuPr1, other transfectable or transducible prostate cancer cell lines), primary cells (PrEC) and recombinant protein expression For example, COS cells, CHO cells, 293 cells, and 293T cells. More particularly, polynucleotides containing 98P4B6 coding sequences, fragments, analogs or homologues thereof are routinely used and any number of host-vector systems widely known in the art are used. Can be used to make 98P4B6 protein or fragments thereof.

  A wide range of host-vector systems suitable for the expression of 98P4B6 protein or fragments thereof are available. See, for example, Sambrook et al., 1989 (supra); Current Protocols in Molecular Biology, 1995 (supra). Preferred vectors for mammalian expression include, but are not limited to: pcDNA 3.1 myc-His-tag (Invitrogen) and the retroviral vector pSRαtkneo (Muller et al., 1991, MCB 11: 1785). Using these expression vectors, 98P4B6 can be expressed in several prostate cancer and non-prostate cell lines, including, for example, 293, 293T, rat-1, NIH 3T3 and TsuPr1. The host-vector system of the present invention is useful for the production of 98P4B6 protein or fragments thereof. Such host-vector systems can be used to study the functional properties of 98P4B6 and 98P4B6 mutations or 98P4B6 analogs.

  Recombinant human 98P4B6 protein or analog or homologue or fragment thereof can be produced by mammalian cells transfected with a construct encoding 98P4B6-related nucleotides. For example, 293T cells can be transfected with expression plasmids encoding 98P4B6, or fragments, analogs or homologs thereof, 98P4B6-related proteins are expressed in the 293T cells, and standard purification methods (eg, anti-98P4B6 antibodies Is used to isolate recombinant 98P4B6 protein. In another embodiment, the 98P4B6 coding sequence is subcloned into the retroviral vector pSRαMSVtkneo and various mammalian cell lines (eg, NIH 3T3, TsuPr1,293 and rat-1) to establish a 98P4B6 expressing cell line. Used to infect. Various other expression systems well known in the art can also be used. An expression construct encoding a leader peptide linked in-frame with the 98P4B6 coding sequence can be used to generate a secreted form of the recombinant 98P4B6 protein.

  As discussed herein, the degeneracy of the genetic code allows changes in the 98P4B6 gene sequence. In particular, specific host species are often known to have specific codon preferences, and thus the disclosed sequences can be adapted to be preferred for the desired host. For example, a preferred analog codon sequence typically replaced a rare codon (ie, a codon having less than about 20% usage in a known sequence of the desired host) with a higher frequency codon. Has a codon. The codon preference for a particular species is calculated, for example, by utilizing available codon usage tables on the Internet (eg, URL dna.affrc.go.jp/-nakamura/codon.html).

  Additional sequence modifications that increase protein expression in cellular hosts are known. These include removal of pseudo-adenylation signals, exon / intron splice site signals, transposon-like repeats, and / or other such well-characterized sequences that are detrimental to gene expression. The GC content of the sequence is adjusted to the average level of a given cell host calculated with reference to known genes expressed in the host cell. Where possible, the sequence can be modified to avoid putative hairpin secondary mRNA structures. Other useful modifications include Kozak, Mol. Cell Biol. 9: 5073-5080 (1989), including the addition of a translation initiation consensus sequence at the start of the open reading frame. One skilled in the art understands that the general rule that eukaryotic ribosomes initiate translation exclusively at the 5 ′ proximal AUG codon is discarded only under rare conditions (eg, Kozak). PNAS 92 (7): 2662-2666 (1995) and Kozak NAR 15 (20): 8125-8148 (1987)).

(III.) 98P4B6-related protein)
Another aspect of the invention provides 98P4B6-related proteins. Particular embodiments of the 98P4B6 protein comprise a polypeptide having all or part of the amino acid sequence of human 98P4B6 shown in FIG. 2 or FIG. Alternatively, 98P4B6 protein embodiments include variant, homologue or analog polypeptides having changes in the amino acid sequence of human 98P4B6 shown in FIG. 2 or FIG.

Embodiments of 98P4B6 polypeptides include at least 10 of the 98P4B6 polypeptide having the sequence shown in FIG. 2, the peptide sequence of 98P4B6 shown in FIG. 2 where T is U, and the polypeptide having the sequence shown in FIG. Examples include contiguous nucleotides or at least 10 contiguous nucleotides of a polypeptide having the sequence shown in FIG. 2 where T is U. For example, embodiments of 98P4B6 peptides include, but are not limited to:
(I) a protein comprising, consisting essentially of, or consisting of the amino acid sequences shown in FIGS. 2A-AL or FIGS. 3A-J;
(II) a 98P4B6-related protein that is at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% homologous to the entire amino acid sequence shown in FIGS. 2A-AL;
(III) 98P4B6 related that is at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identical to the entire amino acid sequence shown in FIGS. 2A-AL or FIGS. 3A-J protein;
(IV) a protein comprising at least one peptide described in Tables VIII-XLIX, but optionally with the condition that it is not the entire protein of FIG.
(V) includes at least one peptide collectively described in Tables VIII-XXI (a peptide also collectively described in Tables XXII-XLIX) but, if necessary, not the entire protein of FIG. With the condition, protein;
(VI) a protein comprising at least two peptides selected from the peptides listed in Tables VIII-XLIX, but optionally with the condition that it is not the entire protein of FIG. 2;
(VII) a protein comprising at least two peptides selected from the peptides collectively listed in Tables VIII-XLIX, provided that it is not a contiguous sequence derived from the amino acid sequence of FIG.
(VIII) comprising at least one peptide selected from the peptides listed in Tables VIII-XXI and at least one peptide selected from the peptides listed in Tables XXII-XLIX, but derived from the amino acid sequence of FIG. Protein, provided that it is not a continuous sequence
(IX) FIGS. 3A, 3B, 3C, 3D, 3E, 3F, 3G, 3H, in any integer increment up to 454, 45, 419, 490, 576, 490, 454, 454, 576, or 490, respectively. At least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 3I or 3J protein A polypeptide comprising 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids having at least 1, 2, 3 having a value greater than 0.5 in the hydrophilic profile of FIG. 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 , 29, 30, 31, 32 Containing 33, 34, 35 amino acid positions, the polypeptide;
(X) FIGS. 3A, 3B, 3C, 3D, 3E, 3F, 3G, 3H, in any integer increment up to 454, 45, 419, 490, 576, 490, 454, 454, 576, or 490, respectively. At least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 3I or 3J protein A polypeptide comprising 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids having at least 1, 2, 3 having a value of less than 0.5 in the hydropathic profile of FIG. 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 , 29, 30, 31, 3 , Including 33, 34, 35 amino acid positions, the polypeptide;
(XI) FIGS. 3A, 3B, 3C, 3D, 3E, 3F, 3G, 3H, in any integer increment up to 454, 45, 419, 490, 576, 490, 454, 454, 576, or 490, respectively. At least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 3I or 3J protein A polypeptide comprising 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids, having at least 1 having a value greater than 0.5 in the accessible residue% profile of FIG. 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 3 , Including 32, 33, 34, 35 amino acid positions, the polypeptide;
(XII) FIGS. 3A, 3B, 3C, 3D, 3E, 3F, 3G, 3H, in any integer increment up to 454, 45, 419, 490, 576, 490, 454, 454, 576, or 490, respectively. At least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 3I or 3J protein A polypeptide comprising 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids having at least 1, 2 having a value greater than 0.5 in the average flexibility profile of FIG. 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 , 28, 29, 30, 31 Containing 32, 33, 34 and 35 amino acid positions, the polypeptide;
(XIII) FIGS. 3A, 3B, 3C, 3D, 3E, 3F, 3G, 3H, in any integer increment up to 454, 45, 419, 490, 576, 490, 454, 454, 576, or 490, respectively. At least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 3I or 3J protein A polypeptide comprising 26, 27, 28, 29, 30, 31, 32, 33, 34 amino acids having at least 1, 2, 3, 4 having a value greater than 0.5 in the β-turn profile of FIG. 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 , 30, 31, 32 Containing 33, 34, 35 amino acid positions, the polypeptide;
(XIV) peptides present at least twice, collectively, in Tables VIII-XXI and XXII-XLIX;
(XV) peptides present at least three times collectively in Tables VIII-XXI and XXII-XLIX;
(XVI) peptides present at least four times collectively in Tables VIII-XXI and XXII-XLIX;
(XVII) peptides present at least 5 times collectively in Tables VIII-XXI and XXII-XLIX (XVIII) peptides present at least once in Tables VIII-XXI and at least once in XXII-XLIX;
(XIX) Peptides present at least once in Tables VIII-XXI and at least twice in XXII-XLIX;
(XX) peptides present at least twice in Tables VIII-XXI and at least once in XXII-XLIX;
(XXI) Peptides that are present at least twice in Tables VIII-XXI and at least twice in XXII-XLIX;
(XXII) a peptide comprising one, two, three, four or five of the following features, or an oligonucleotide encoding such a peptide:
i) A region of at least 5 amino acids of the specific peptide of FIG. 3 in integer increments up to the full length of the protein of FIG. 3, which is 0.5 or more, 0.6 or more, 0 in the hydrophilic profile of FIG. A region comprising amino acid positions having a value of .7 or more, 0.8 or more, 0.9 or more, or 1.0;
ii) a region of at least 5 amino acids of the specific peptide of FIG. 3 in integer increments up to the full length of the protein of FIG. 3, wherein the hydropathic profile of FIG. A region comprising an amino acid position having a value of 0.7 or more, 0.8 or more, 0.9 or more, or 1.0;
iii) A region of at least 5 amino acids of the specific peptide of FIG. 3 in integer increments to the full length of the protein of FIG. A region containing an amino acid position having a value of 0.7 or more, 0.8 or more, 0.9 or more, or 1.0;
iv) A region of at least 5 amino acids of the specific peptide of FIG. 3 in integer increments up to the full length of the protein of FIG. 3, which is 0.5 or more, 0.6 or more in the average flexibility profile of FIG. A region comprising an amino acid position having a value of 0.7, 0.7, 0.8, 0.9, or 1.0;
v) A region of at least 5 amino acids of the specific peptide of FIG. 3, which is an integer increment up to the full length of the protein of FIG. 3, wherein the β turn profile of FIG. A region comprising an amino acid position having a value of 0.7 or more, 0.8 or more, 0.9 or more, or 1.0;
(XXIII) a composition comprising a peptide of (I) to (XXII), or an antibody or a binding region thereof together with a pharmaceutical excipient and / or in human unit dosage form;
(XXIV) In a method for modulating cells expressing 98P4B6, a method using the peptide of (I) to (XXII), or the antibody or the binding region thereof, or the composition of (XXIII);
(XXV) In a method for diagnosing, preventing, prognosticating or treating an individual having cells expressing 98P4B6, the peptide of (I) to (XXII), or the antibody or the binding region thereof, or (XXIII) A method of using the composition;
(XXVI) In a method for diagnosing, preventing, prognosing, or treating an individual having cells expressing 98P4B6 derived from a cancer of the tissues listed in Table I, the peptide of (I) to (XXII), or A method of using an antibody or a binding region thereof, or a composition of (XXIII);
(XXVII) A method of using a peptide of (I) to (XXII), or an antibody or a binding region thereof, or a composition of (XXIII) in a method for diagnosing, preventing, prognosing or treating cancer;
(XXVIII) In the method for diagnosing, preventing, prognosing or treating cancer of the tissues listed in Table I, the peptide of (I) to (XXII), the antibody or the binding region thereof, or the composition of (XXIII) How to use things;
(XXIX) A method of using a peptide of (I) to (XXII), an antibody or a binding region thereof, or a composition of (XXIII) in a method for identifying or characterizing a modulator of a cell expressing 98P4B6.

  As used herein, a range is understood to specifically disclose the position of all its units.

An exemplary embodiment of the invention disclosed herein comprises 98P4B6 nucleotides that encode a particular portion of the 98P4B6 mRNA sequence (and the mRNA sequence complementary to such a sequence). Such nucleotides are, for example, polynucleotides encoding the following proteins and / or fragments thereof:
(A) 4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24 of 98P4B6 variant 1 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 225, 250, 275, 300, 325, 350, 375, 400, 410, 420, 430, 440, 450, or 454 The maximum length suitable for other variants is: variant 52, 45 amino acids; variant 5, 419 amino acids, variant 6, 490, variant 7, 5 6, variant 8,490 amino acids, variants 13,454 amino acids, variants 14,454 amino acids, variants 21,576 amino acids, and variants 25,490 amino acids.

  In general, naturally occurring allelic variants of human 98P4B6 share a high degree of structural identity and structural homology (eg, greater than 90% homology). Typically, allelic variants of the 98P4B6 protein contain conservative amino acid substitutions within the 98P4B6 sequences described herein, or substitutions of amino acids at corresponding positions in the 98P4B6 homolog. One class of 98P4B6 allelic variants share a high degree of homology to at least a small region of a particular 98P4B6 amino acid sequence, but extreme deviations from that sequence (eg, non-conservative amino acid substitutions, truncations, Protein, including insertion or frameshift). In comparing protein sequences, the terms similarity, identity, and homology each have a clear meaning as understood in the field of genetics. Furthermore, orthology and paralogy can be important concepts that describe the relationship of members of a given protein family in one organism to members of the same family of other organisms.

  Table II provides amino acid abbreviations. Conservative amino acid substitutions can often be made in a protein without altering any of the protein's conformation or function. The protein of the invention may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 conservative substitutions. Such changes can be achieved by substituting one of isoleucine (I), valine (V), and leucine (L) for any of these hydrophobic amino acids; replacing glutamic acid (E) Substitution with aspartic acid (D) and vice versa; substitution with glutamine (Q) instead of asparagine (N) and vice versa; and substitution with serine (S) instead of threonine (T) and The reverse is mentioned. Other substitutions can also be considered conservative, depending on the environment of the particular amino acid and its role in the three-dimensional structure of the protein. For example, glycine (G) and alanine (A) can often be interchangeable, as can alanine (A) and valine (V). Methionine (M), which is relatively hydrophobic, can often be compatible with leucine and isoleucine, and sometimes compatible with valine. Lysine (K) and arginine (R) are often interchangeable at positions where an important property of the amino acid residue is the change and the different pKs of these two amino acid residues are not important. Still other changes may be considered “conservative” under certain circumstances (eg, Table III herein; “Biochemistry” 2nd edition, edited by Lubert Stryer (Stanford University), page 13- 15; see Henikoff et al., PNAS 1992 89, 10915-10919; Lei et al., J BioChem 1995 May 19; 270 (20): 11882-6).

  Embodiments of the invention disclosed herein include a wide variety of art-recognized 98P4B6 protein variants, such as polypeptides having amino acid insertions, deletions, and substitutions. Or include analog. 98P4B6 variants can be made using methods known in the art, such as site-directed mutagenesis, alanine scanning, and PCR mutagenesis. Site-directed mutagenesis [Carter et al., Nucl. Acids Res. 13: 4331 (1986); Zoller et al., Nucl. Acids Res. , 10: 6487 (1987)], cassette mutagenesis [Wells et al., Gene, 34: 315 (1985)], restriction selective mutagenesis [Wells et al., Philos. Trans. R. Soc. London SerA, 317: 415 (1986)] or other known techniques can be performed on the cloned DNA to produce 98P4B6 variant DNA.

  Scanning amino acid analysis can also be used to identify one or more amino acids along a contiguous sequence involved in a particular biological activity (eg, protein-protein interaction). Among these, preferred scanning amino acids are relatively small neutral amino acids. Such amine acids include alanine, glycine, serine, and cysteine. Alanine is typically a preferred scanning amino acid within this group. This is because alanine eliminates the side chain after the β carbon and is less likely to alter the conformation of the variant backbone. Alanine is also typically preferred because it is the most common amino acid. In addition, alanine is frequently found in both buried and exposed sites (Creighton, The Proteins, (WH Freeman & Co., NY); Chothia, J. Mol. Biol., 150: 1 (1976)). If alanine substitution does not produce a sufficient amount of modification, an isosteric amino acid can be used.

  As defined herein, 98P4B6 variants, analogs or homologs have the characteristic property of having at least one epitope that is “cross-reactive” with the 98P4B6 protein having the amino acid sequence of FIG. As used in this sentence, “cross-reactivity” means that an antibody or T cell that specifically binds to a 98P4B6 variant also specifically binds to a 98P4B6 protein having the amino acid sequence described in FIG. It means to do. A polypeptide is no longer a variant of the protein shown in FIG. 3 when it no longer contains an antibody that specifically binds to the original 98P4B6 protein or an epitope that can be recognized by T cells. Antibodies that recognize proteins bind to epitopes of various sizes, and groups of about 4 amino acids or 5 amino acids that are continuous or not continuous are a representative number of amino acids in the smallest epitope. Those skilled in the art understand that this is possible. For example, Nair et al. See Immunol 2000 165 (12): 6949-6955; Hebbes et al., Mol Immunol (1989) 26 (9): 865-73; Schwartz et al., J Immunol (1985) 135 (4): 2598-608.

  Other classes of 98P4B6-related protein variants share more than 70%, 75%, 80%, 85% or 90% similarity to the amino acid sequence of FIG. 3 or fragments thereof. Another specific class of 98P4B6 protein variants or analogs includes one or more of the 98P4B6 biological motifs described herein or currently known in the art. Thus, analogs of 98P4B6 fragments (nucleic acids or amino acids) with altered functional (immunogenic) properties relative to the original fragment are included in the present invention. It should be understood that current motifs or motifs that become part of the art can be applied to the nucleic acid or amino acid sequences shown in FIG. 2 or FIG.

  As discussed herein, embodiments of the present invention include a polypeptide comprising the less than complete amino acid sequence of the 98P4B6 protein shown in FIG. 2 or FIG. For example, exemplary embodiments of the present invention may be any of 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more of the 98P4B6 protein shown in FIG. 2 or FIG. Includes peptides / proteins with consecutive amino acids.

  Furthermore, exemplary embodiments of the invention disclosed herein include a 98P4B6 protein approximately amino acid 1 to approximately amino acid 10 polypeptide shown in FIG. 2 or FIG. 3, a 98P4B6 protein shown in FIG. 2 or FIG. Polypeptide consisting of about amino acid 10 to about amino acid 20, 98P4B6 protein shown in FIG. 2 or FIG. 3 polypeptide consisting of about amino acid 20 to about amino acid 30, 98P4B6 protein shown in FIG. 2 or FIG. 3 about amino acid 30 to about amino acid A polypeptide consisting of 40, a 98P4B6 protein shown in FIG. 2 or FIG. 3 from about amino acid 40 to about amino acid 50, a 98P4B6 protein shown in FIG. 2 or FIG. 3 from about amino acid 50 to about amino acid 60 2 or FIG. 3, a polypeptide consisting of about amino acid 60 to about amino acid 70 shown in FIG. 2 or FIG. 3, a 98P4B6 protein shown in FIG. 2 or FIG. 2 or the 98P4B6 protein shown in FIG. 3 consisting of about amino acid 80 to about amino acid 90, the 98P4B6 protein shown in FIG. 2 or FIG. 3 consisting of about 90 amino acid to about 100 amino acid, etc. Included). Furthermore, a polypeptide consisting of approximately amino acid 1 (or 20 or 30 or 40 or the like) to approximately amino acid 20 (or 130 or 140 or 150 or the like) of the 98P4B6 protein shown in FIG. 2 or FIG. 3 is an embodiment of the present invention. is there. The first and last positions in this paragraph refer to a specific position and its position ± 5 residue positions.

  98P4B6-related proteins are produced using standard peptide synthesis techniques or using chemical cleavage methods well known in the art. Alternatively, recombinant methods can be used to generate nucleic acid molecules that encode 98P4B6-related proteins. In one embodiment, the nucleic acid molecule provides a means for generating a defined fragment of the 98P4B6 protein (or a variant, homolog or analog thereof).

(III. A.) Embodiment of motif-bearing protein)
Further exemplary embodiments of the invention disclosed herein are 98P4B6 polys containing amino acid residues of one or more biological motifs contained in the 98P4B6 polypeptide sequence shown in FIG. 2 or FIG. Includes peptides. Various motifs are well known in the art, and proteins are available from many publicly available internet sites (eg, URL address: pfam.wustl.edu/; searchlauncher.bcm.tmc.edu/seq-search/struc -predict.html; psort.ims.u-tokyo.ac.jp/; cbs.dtu.dk/; ebi.ac.uk/interpro/scan.html; expasy.ch/tools/scnpsit1.html; Epimatrix TM and Epimer ^™ , Brown University, brown.edu/Research/TB-HIV_Lab/epimatrix/epimatrix.html; and BIMA S, bimas.dcrt.nih.gov/) can be evaluated for the presence of such motifs.

  All 98P4B6 variant protein motif-bearing subsequences are shown and identified in Tables VIII-XXI and Tables XXII-XLIX.

  Table V shows some frequently occurring motifs based on pfam searches (see URL address pfam.wustl.edu/). The columns in Table V are: (1) Motif name abbreviation, (2) Identity found between different members of this motif family (%), (3) Motif name or details, and (4) Most common The location information is included if the motif is related to location.

  Polypeptides containing one or more of the 98P4B6 motifs discussed above are in view of the observation that the 98P4B6 motif discussed above is associated with growth dysregulation, and why 98P4B6 is overexpressed in certain cancers Are useful for elucidating specific features of malignant phenotypes (see, eg, Table I). Casein kinase II, cAMP and camp-dependent protein kinase, and protein kinase C are, for example, enzymes that are known to be associated with the development of malignant phenotypes (eg, Chen et al., Lab Invest., 78 (2 ): 165-174 (1998); Gaiddon et al., Endocrinology 136 (10): 4331-4338 (1995); Hall et al., Nucleic Acids Research 24 (6): 1119-1126 (1996); Peterziel et al., Oncogene 1846 ): 6322-6329 (1999), and O'Brian, Oncol. Rep. 5 (2): 305-309 (1998)). In addition, both glycosylation and myristoylation are protein modifications that are also associated with cancer and cancer progression (eg, Dennis et al., Biochem. Biophys. Acta 1473 (1): 21-34 (1999); Raju et al., Exp. Cell Res. 235 (1): 145-154 (1997)). Amidation is another protein modification that is also associated with cancer and cancer progression (see, eg, Treston et al., J. Natl. Cancer Inst. Monogr. (13): 169-175 (1992)).

In another embodiment, the protein of the invention comprises one or more immunoreactive epitopes identified according to art-recognized methods (eg, peptides shown in Tables VIII-XXI and Tables XXII-XLIX). . CTL epitopes can be determined using a special algorithm for identifying peptides in the 98P4B6 protein that can optimally bind to a particular HLA allele (eg, Table IV: Epimatrix ^™ and Epimer ^™ , Brown University, URL brown.edu/Research/TB-HIV_Lab/epimatrix/epimatrix.html; and BIMAS, URL bimas.dcrt.nih.gov/). Furthermore, processes for identifying peptides with sufficient binding affinity for HLA molecules and associated with being immunogenic epitopes are well known in the art and without undue experimentation To be implemented. In addition, processes for identifying peptides that are immunogenic epitopes are well known in the art and are performed without undue experimentation, either in vitro or in vivo.

  The principles for making analogs of such epitopes to modulate immunogenicity are also known in the art. For example, start with an epitope that has a CTL or HTL motif (see, eg, HLA class I and HLA class II motif / supermotif in Table IV). This epitope is made analog by replacing one amino acid at a particular position and replacing it with another amino acid specified for that position. For example, based on the residues as defined in Table IV, harmful residues can be substituted to favor any other residue, such as preferred residues; less preferred residues Can be substituted with a preferred residue; or a preferred residue present from the beginning can be substituted with another preferred residue. Substitutions can occur at major anchor positions or other positions in the peptide; see, for example, Table IV.

  Various references reflect techniques relating to the identification and generation of epitopes in proteins of interest and analogs thereof. See, for example, WO 97/33602 to Chesnut et al; Sette, Immunogenetics 1999 50 (3-4): 201-212; Immunol. 2001 166 (2): 1389-1397; Sidney et al., Hum. Immunol. 1997 58 (1): 12-20; Kondo et al., Immunogenetics 1997 45 (4): 249-258; Sidney et al., J. Biol. Immunol. 1996 157 (8): 3480-90; and Falk et al., Nature 351: 290-6 (1991); Hunt et al., Science 255: 1261-3 (1992); Parker et al., J. Biol. Immunol. 149: 3580-7 (1992); Parker et al., J. Biol. Immunol. 152: 163-75 (1994); Kast et al., 1994 152 (8): 3904-12; Borras-Cuesta et al., Hum. Immunol. 2000 61 (3): 266-278; Alexander et al., J. Biol. Immunol. 2000 164 (3); 164 (3): 1625-1633; Alexander et al., PMID: 7895164, UI: 95202582; O'Sullivan et al., J. Biol. Immunol. 1991 147 (8): 2663-2669; Alexander et al., Immunity 1994 1 (9): 751-761, and Alexander et al., Immunol. Res. 1998 18 (2): 79-92.

  Related embodiments of the invention include different motifs shown in Table VI, and / or one or more putative CTL epitopes of Tables VIII-XXI and XXII-XLIX, and / or one or more of Table XLVI-Table XLIX. Polypeptides comprising a combination of a putative HTL epitope and / or one or more T cell binding motifs known in the art. Preferred embodiments do not include insertions, deletions, or substitutions within any of the polypeptide motifs or intervening sequences. Furthermore, embodiments that include any of a number of N-terminal and / or C-terminal amino acid residues on either side of these motifs may be desirable (eg, a larger portion of the polypeptide structure in which the motif is located). To include). Typically, the number of N-terminal and / or C-terminal amino acid residues on either side of the motif is between about 1 and about 100 amino acid residues, preferably between 5 and about 50 amino acid residues. .

  98P4B6-related proteins are embodied in many forms, preferably isolated forms. A purified 98P4B6 protein molecule is substantially free of other proteins or molecules that impair 98P4B6 binding to antibodies, T cells or other ligands. The nature and degree of isolation and purification will depend on the intended use. Embodiments of 98P4B6-related proteins include purified 98P4B6-related proteins and functional soluble 98P4B6-related proteins. In one embodiment, the functional soluble 98P4B6 protein or fragment thereof maintains the ability to be bound by antibodies, T cells or other ligands.

  The present invention also provides a 98P4B6 protein comprising a biologically active fragment of the 98P4B6 amino acid sequence shown in FIG. 2 or FIG. Such proteins exhibit the properties of the starting 98P4B6 protein as follows: the ability to induce the production of antibodies that specifically bind to epitopes associated with the starting 98P4B6 protein; the ability to be bound by such antibodies; HTL Or the ability to induce activation of CTL; and / or the ability to be recognized by HTL or CTL that also specifically binds to this starting protein.

  98P4B6-related polypeptides containing structures of particular interest can be predicted and / or identified using various analytical techniques well known in the art or based on immunogenicity, including, for example, Chou -Methods of Fasman, Garnier-Robson, Kyte-Doolittle, Eisenberg, Karplus-Schultz or Jameson-Wolf analysis. Fragments containing such structures are particularly useful in the generation of subunit-specific anti-98P4B6 antibodies or T cells or in the identification of cellular factors that bind to 98P4B6. For example, a hydrophilic profile can be generated and immunogenic peptide fragments can be obtained from Hopp, T .; P. And Woods, K .; P. , 1981, Proc. Natl. Acad. Sci. U. S. A. 78: 3824-3828 can be identified. A hydropathic profile can be generated and immunogenic peptide fragments are described in Kyte, J. et al. And Doolittle, R .; F. , 1982, J. et al. Mol. Biol. 157: 105-132. A profile of% accessible residues can be generated and immunogenic peptide fragments can be obtained from Janin J. et al. 1979, Nature 277: 491-492. An average flexibility profile can be generated and Bhaskaran R. Ponuswamy P. K. , 1988, Int. J. et al. Pept. Protein Res. The method of 32: 242-255 can be used to identify immunogenic peptide fragments. A β-turn profile can be generated and immunogenic peptide fragments can be obtained as described in Release, G. et al. , Roux B. , 1987, Protein Engineering 1: 289-294.

CTL epitopes use specific algorithms to identify peptides within the 98P4B6 protein that can optimally bind to a designated HLA allele (see, eg, World Wide Web URL syfepeithi.bmi-heidelberg.com/). SYFPEITHI site; Tables in Tables IV (A)-(E); Epimatrix ^™ and Epimer ^™ , Brown University, URL (brown. Edu / Research / TB-HIV_Lab / epimatrix / epimatrix. dcrt.nih.gov/). To illustrate this, peptide epitopes derived from 98P4B6 (eg, HLA-A1, A2, A3, A11, A24, B7 and B35) shown in the context of human MHC class I molecules were predicted (eg, Table VIII- XXI and Tables XXII-XLIX). Specifically, the complete amino acid sequence of the 98P4B6 protein and related portions of other variants (ie, for the prediction of HLA class I, located on either side of the mutation point or exon junction corresponding to this variant) Nine adjacent residues, and for HLA class II predictions, the 14-residue located on either side of the mutation point or exon junction) is described above on the Bioinformatics and Molecular Analysis Section (BIMAS) website (URL The HLA Peptide Motif Search algorithm found at (in addition to the site SYFPEITHI at syffpeithi.bmi-heidelberg.com/).

  HLA peptide motif search algorithms are available for HLA class I molecules, particularly HLA-A2 (eg, Falk et al., Nature 351: 290-6 (1991); Hunt et al., Science 255: 1261-3 (1992); Parker et al., J Immunol.149: 3580-7 (1992); see Parker et al., J. Immunol.152: 163-75 (1994)), based on the binding of specific peptide sequences. Developed by Ken Parker. This algorithm locates and ranks 8-mer, 9-mer, and 10-mer peptides from the complete protein sequence for predicted binding to HLA-A2 and many other HLA class I molecules. to enable. A number of HLA class I binding peptides are 8-mer, 9-mer, 10-mer or 11-mer. For example, for class I HLA-A2, the epitope preferably includes leucine (L) or methionine (M) at position 2 and valine (V) or leucine (L) at the C-terminus (eg, Parker et al. J. Immunol. 149: 3580-7 (1992)). The results of selection of 98P4B6 predicted binding peptides are shown in Tables VIII-XXI and XXII-XLIX herein. In Tables VIII-XXI and XXII-XLVII, candidate 9-mers and 10-mers selected for each family member are shown along with their position, the amino acid sequence of each particular peptide, and a putative binding score. In Tables XLVI-XLIX, 15-mers that are candidates for selection for each family member are shown along with their position, the amino acid sequence of each particular peptide, and a putative binding score. This binding score corresponds to the estimated half-life of the dissociation of the complex containing the peptide at 37 ° C. (pH 6.5). The peptide with the highest binding score is expected to be bound most closely to HLA class I on the cell surface over the best period and represent the best immunogenic target for T cell recognition.

  The actual binding of the peptide to the HLA allele can be assessed by stabilizing HLA expression on the antigen processing deficient cell line T2 (eg, Xue et al., Prostate 30: 73-8 (1997) and Peshwa et al. Prostate 36: 129-38 (1998)). The immunogenicity of a particular peptide can be assessed in vitro by stimulating CD8 + cytotoxic T lymphocytes (CTLs) in the presence of antigen presenting cells (eg, dendritic cells).

By HLA class I motifs or HLA class II motifs predicted by BIMAS sites, Epimer ^TM sites and Epimatrix ^TM sites or available in the field or part of the fields as shown in Table IV All epitopes specified (or determined using the World Wide Web site URL symphpeithi.bmi-heidelberg.com/ or BIMAS, bimas.dcrt.nih.gov /) according to the present invention are 98P4B6 protein It is understood that “applies” to: As used in this context, “applied” means that the 98P4B6 protein is evaluated, for example, by visual or by computer-based pattern recognition methods as understood by one skilled in the art. All partial sequences of 98P4B6 protein of 8, 9, 10 or 11 amino acid residues carrying the HLA class I motif, or partial sequences of 9 amino acid residues or more carrying the HLA class II motif are within the scope of the present invention. Is within.

(III.B.) Expression of 98P4B6-related protein)
In the embodiments described in the examples below, 98P4B6 is expressed using commercially available expression vectors (eg, C-terminal 6 × His and MYC tag (pcDNA3.1 / mycHIS, Invitrogen or Tag5, GenHunter Corporation, Nashville TN). It can be conveniently expressed in cells (eg, 293T cells) transfected with a CMV driven expression vector encoding 98P4B6. The Tag5 vector provides an IgGK secretion signal that can be used to facilitate the production of secreted 98P4B6 protein in transfected cells. Secreted HIS-tagged 98P4B6 in the culture medium can be purified, for example, using a nickel column using standard techniques.

(III.C.) 98P4B6-related protein modification)
Modifications of 98P4B6 related proteins (eg, covalent modifications) are included within the scope of the present invention. One type of covalent modification involves reacting a targeted amino acid residue of a 98P4B6 polypeptide with an organic derivatization factor (which is a selected side chain residue or N-terminal or C-terminal residue of the 98P4B6 protein). And reacting with). Another type of covalent modification of the 98P4B6 polypeptide included within the scope of the invention involves altering the native glycosylation pattern of the protein of the invention. Another type of covalent modification of 98P4B6 is the conversion of 98P4B6 polypeptide into one of a variety of non-proteinaceous polymers (eg, polyethylene glycol (PEG), polypropylene glycol, or polyoxyalkylene). No. 4,640,835; No. 4,496,689; No. 4,301,144; No. 4,670,417; No. 4,791,192; or No. 4,179, Ligation in the manner described in No. 337.

  The 98P4B6-related proteins of the present invention can also be modified to form a chimeric molecule, which comprises 98P4B6 fused to another heterologous polypeptide or amino acid sequence. Such chimeric molecules can be synthesized chemically or recombinantly. A chimeric molecule may have a protein of the invention fused to another tumor associated antigen or fragment thereof. Alternatively, a protein according to the invention may comprise a fusion (amino acid or nucleic acid) of a fragment of the 98P4B6 sequence, so that due to its length, it is directly in the amino acid or nucleic acid sequence shown in FIG. 2 or FIG. Molecules that are not homologous are created. Such a chimeric molecule can comprise multiple identical subsequences of 98P4B6. The chimeric molecule may comprise a fusion of a 98P4B6-related protein with a polyhistidine epitope tag, which provides a cytokine or growth factor for the epitope to which immobilized nickel can selectively bind. The epitope tag is generally located at the amino terminus or carboxyl terminus of the 98P4B6 protein. In an alternative embodiment, the chimeric molecule may comprise a fusion of a 98P4B6-related protein with an immunoglobulin or a specific region of an immunoglobulin. For the bivalent form of the chimeric molecule (also referred to as “immunoadhesin”), such a fusion may be to the Fc region of an IgG molecule. This Ig fusion preferably comprises a substitution with a soluble (deleted or inactivated transmembrane domain) form of 98P4B6 polypeptide replacing at least one variable region within the Ig molecule. In a preferred embodiment, the immunoglobulin fusion comprises the hinge region, CH2 region and CH3 region, or hinge region, CH1 region, CH2 region and CH3 region of an IgGI molecule. For the production of immunoglobulin fusions, see, for example, US Pat. No. 5,428,130 (issued June 27, 1995).

(III.D.) Use of 98P4B6-related protein)
The proteins of the present invention have many different specific uses. Since 98P4B6 is highly expressed in prostate cancer and other cancers, 98P4B6-related proteins are used in cancer tissues in a method to assess the status of 98P4B6 gene product in normal tissues, whereby the malignant phenotype is It becomes clear. Typically, polypeptides from specific regions of the 98P4B6 protein assess the presence of perturbations (eg, deletions, insertions, point mutations, etc.) in those regions (eg, regions that contain one or more motifs) Used to do. Exemplary assays include one or more biological motifs included in the 98P4B6 polypeptide sequence to assess the characteristics of a region in normal tissue relative to cancerous tissue or to elicit an immune response against an epitope. Antibodies or T cells that target 98P4B6-related proteins containing the amino acid residues are used. Alternatively, a 98P4B6 related protein containing one or more biological motif amino acid residues in the 98P4B6 protein is used to screen for factors that interact with that region of 98P4B6.

  A 98P4B6 protein fragment / subsequence is an agent that binds to 98P4B6 or a specific structural domain thereof in making and characterizing a domain-specific antibody (eg, an antibody that recognizes an extracellular or intracellular epitope of 98P4B6 protein) It is particularly useful for identifying cellular factors and in a variety of therapeutic and diagnostic situations, including but not limited to diagnostic assays, cancer vaccines and methods of preparing such vaccines.

  Proteins encoded by the 98P4B6 gene, or proteins encoded by analogs, homologs or fragments thereof, have a variety of uses, including the production of antibodies and ligands that bind to the 98P4B6 gene product. Methods include but are not limited to methods for identifying other drugs and cell constructs. Antibodies raised against 98P4B6 protein or fragments thereof are imaging methods in diagnostic and prognostic assays and in the management of human cancers characterized by expression of 98P4B6 protein (eg, cancers as listed in Table 1) Useful for. Such antibodies can be expressed intracellularly and used in methods of treating patients with such cancers. 98P4B6-related nucleic acids or 98P4B6-related proteins are also used in generating an HTL response or a CTL response.

  Various immunological assays useful for detecting 98P4B6 protein are used, including various types of radioimmunoassay, enzyme-linked immunosorbent assay (ELISA), enzyme-linked immunofluorescence assay ( ELIF), immunocytochemical methods and the like, but are not limited thereto. The antibody can be labeled and used as an immunological imaging reagent capable of detecting 98P4B6-expressing cells (eg, in radioscintigraphic imaging methods). The 98P4B6 protein is also particularly useful in making cancer vaccines, as further described herein.

(IV.) 98P4B6 antibody)
Another aspect herein provides antibodies that bind to 98P4B6-related proteins. Preferred antibodies bind specifically to 98P4B6-related proteins under physiological conditions and do not bind (or bind weakly) to peptides or proteins that are not 98P4B6-related proteins. In this context, examples of physiological conditions include: 1) phosphate buffered saline; 2) Tris buffered with 25 mM Tris and 150 mM NaCl or normal saline (0.9% NaCl). Physiological saline; 4) animal serum such as human serum; or 5) any combination of 1) to 4); these reactions are preferably pH 7.5 or pH 7.0 to 8.0 In the range or in the range of pH 6.5 to 8.5; and these reactions are carried out at temperatures between 4 ° C and 37 ° C. For example, an antibody that binds to 98P4B6 can bind to a 98P4B6-related protein (eg, a homolog or analog thereof).

  The 98P4B6 antibodies of the present invention are particularly useful in cancer (see Table I) diagnostic and prognostic assays, and imaging methodologies. Similarly, such antibodies are useful in treating, diagnosing and / or prognosing these other cancers to the extent that 98P4B6 is also expressed or overexpressed in other cancers. . In addition, antibodies expressed intracellularly (eg, single chain antibodies) are therapeutically useful in the treatment of cancers that involve 98P4B6 expression (eg, advanced or metastatic prostate cancer).

  The present invention also provides various immunological assays useful for the detection and quantification of 98P4B6 protein and mutant 98P4B6-related proteins. Such assays can include one or more 98P4B6 antibodies, where appropriate, that can recognize and bind to 98P4B6-related proteins. These assays can be performed within various immunological assay formats well known in the art, including various types of radioimmunoassays, enzyme-linked immunosorbent assays (ELISAs), enzymes Examples include, but are not limited to, a binding immunofluorescence assay (ELIFA).

  The immunological non-antibody assays of the present invention also include T cell immunogenicity assays (inhibitory or stimulatory) as well as major histocompatibility complex (MHC) binding assays.

  In addition, immunological imaging methods that can detect prostate and other cancers expressing 98P4B6 are also provided by the present invention, including radionuclide imaging methods that use labeled 98P4B6 antibodies. Examples include but are not limited to these. Such assays are clinically useful in the detection, monitoring, and prognosis of cancers that express 98P4B6 (eg, prostate cancer).

  The 98P4B6 antibody can also be used in methods for purifying 98P4B6-related proteins, and methods for isolating 98P4B6 homologs and 98P4B6-related molecules. For example, a method for purifying 98P4B6-related protein includes the following steps: 98P4B6 antibody bound to a solid matrix is combined with lysate or other solution containing 98P4B6-related protein, and 98P4B6 antibody becomes 98P4B6-related protein. Incubating under conditions capable of binding; washing the solid matrix to remove impurities; and eluting 98P4B6-related protein from the bound antibody. Other uses of the 98P4B6 antibody according to the invention include producing anti-idiotype antibodies that mimic the 98P4B6 protein.

  Various methods for preparing antibodies are well known in the art. For example, antibodies can be prepared in isolated or immunoconjugate form by immunizing a suitable mammalian host using 98P4B6-related proteins, peptides, or fragments (Antibodies: A Laboratory Manual, CSH Press, Hen, Harlow, and Lane (1988); Harlow, Antibodies, Cold Spring Harbor Press, NY (1989)). In addition, 98P4B6 fusion proteins such as 98P4B6 GST fusion proteins can also be used. In certain embodiments, a GST fusion protein comprising all or most of the amino acid sequence of FIG. 2 or FIG. 3 is generated and then used as an immunogen to produce an appropriate antibody. In another embodiment, 98P4B6-related protein is synthesized and used as an immunogen.

  In addition, naked DNA immunization techniques known in the art are used (with or without purified 98P4B6-related protein or 98P4B6-expressing cells) to generate an immune response against the encoded immunogen (as a review). (See Donnelly et al., 1997, Ann. Rev. Immunol. 15: 617-648).

  A specific region of the 98P4B6 protein may be selected for analyzing the amino acid sequence of the 98P4B6 protein shown in FIG. 2 or FIG. 3 to produce antibodies. For example, hydrophobic analysis and hydrophilicity analysis of the 98P4B6 amino acid sequence is used to identify hydrophilic regions in the 98P4B6 structure. Regions of the 98P4B6 protein that exhibit immunogenic structure, as well as other regions and domains, can be obtained by various other methods known in the art (eg, Chou-Fasman, Garnier-Robson, Kyte-Doolittle, Eisenberg, Karplus-Schultz, or Jameson). -Wolf analysis) can be easily identified. The hydrophilic profile is described in Hopp, T .; P. And Woods, K .; R. , 1981, Proc. Natl. Acad. Sci. U. S. A. 78: 3824-3828 can be used. Hydropathic profiles are described in Kyte, J. et al. And Doolittle, R .; F. , 1982, J. et al. Mol. Biol. 157: 105-132. The accessible percent (%) residue profile is given by Janin J. et al. 1979, Nature 277: 491-492. The average flexibility profile was determined by Bhaskaran R.C. Ponuswamy P. K. , 1988, Int. J. et al. Pept. Protein Res. 32: 242-255. The β-turn profile is described in Release, G. et al. , Roux B. , 1987, Protein Engineering 1: 289-294. Thus, each region identified by any of these programs or methods is within the scope of the present invention. The methods for producing 98P4B6 antibodies are further illustrated by the examples provided herein. Methods for preparing proteins or polypeptides for use as immunogens are well known in the art. Methods for preparing immunogenic conjugates of a carrier (eg, BSA, KLH or other carrier protein) and protein are also well known in the art. In some situations, for example, direct conjugation using a carbodiimide reagent is used; in another example, Pierce Chemical Co. Binding reagents supplied by Rockford, IL are effective. Administration of the 98P4B6 immunogen is often performed by injection using an appropriate adjuvant for an appropriate period of time, as is understood in the art. During the immunization schedule, antibody titers can be used to determine the validity of antibody formation.

  98P4B6 monoclonal antibodies can be generated by various means well known in the art. For example, an immortalized cell line that secretes the desired monoclonal antibody is prepared using standard hybridoma technology from Kohler and Milstein, or a modification that immortalizes antibody-producing B cells, as is generally known. Immortalized cell lines that secrete the desired antibody are screened by immunoassay (in which the antigen is a 98P4B6-related protein). If a suitable immortalized cell culture is identified, the cells can be expanded and antibodies can be generated from either in vitro culture or ascites.

  The antibodies or fragments of the invention can also be produced by recombinant means. Regions that specifically bind to the desired region of 98P4B6 protein can also be produced in the context of chimeric or complementarity determining region (CDR) grafted antibodies from multiple species. Humanized 98P4B6 antibodies or human 98P4B6 antibodies can also be produced and are preferred for use in therapeutic situations. Methods for humanizing mouse antibodies and other non-human antibodies by replacing one or more non-human antibody CDRs with the corresponding human antibody sequences are well known (eg, Jones et al., 1986, Nature). 321: 522-525; Riechmann et al., 1988, Nature 332: 323-327; Verhoeyen et al., 1988, Science 239: 1534-1536). Carter et al., 1993, Proc. Natl. Acad. Sci. USA 89: 4285, and Sims et al., 1993, J. MoI. Immunol. See also 151: 2296.

  Methods for producing fully human monoclonal antibodies include phage display methods and transgenic methods (for an overview, see Vaughan et al., 1998, Nature Biotechnology 16: 535-539). Fully human 98P4B6 monoclonal antibodies can be generated using cloning techniques using large human Ig gene combinatorial libraries (ie, phage display) (Protein Engineering of Antibiotic for Proliferative and Therapeutic Apps. Ed.), Nottingham Academic, pages 45-64 (1993), Griffiths and Hoogenboom, Building an in vitro imprint system: human antigens bas, Human Antibodies from combinatorial libraries (ibid.) pages 65-82). A fully human 98P4B6 monoclonal antibody is also a transgenic engineered to contain human immunoglobulin loci as described in PCT patent application WO 98/24893 (Kucherlapati and Jakobovits et al.) Published Dec. 3, 1997. Can be produced using mice (Jakobovits, 1998, Exp. Opin. Invest. Drugs 7 (4): 607-614; US Pat. No. 6,162,963 (issued December 19, 2000); See also 6,150,584 (issued 12 November 2000); and US Pat. No. 6,114,598 (issued 5 September 2000)). This method avoids the in vitro manipulation required for phage display technology and efficiently produces high affinity authentic human antibodies.

The reactivity of 98P4B6 antibodies with 98P4B6-related proteins can be established by a number of well-known methods including Western blot, immunoprecipitation, ELISA, and, where appropriate, 98P4B6-related proteins, 98P4B6-expressing cells or their FACS analysis using extract is mentioned. The 98P4B6 antibody or fragment thereof can be labeled with a detectable marker or conjugated to a second molecule. Suitable detectable markers include, but are not limited to, radioisotopes, fluorescent compounds, bioluminescent compounds, chemiluminescent compounds, metal chelators or enzymes. In addition, bi-specific antibodies specific for two or more 98P4B6 epitopes are produced using methods generally known in the art. Homodimeric antibodies can also be produced by cross-linking techniques known in the art (eg, Wolff et al., Cancer Res. 53: 2560-2565).
(V.) 98P4B6 cell immune response)
The mechanism by which T cells recognize antigens has been elucidated. An effective peptide epitope vaccine composition of the present invention induces a therapeutic or prophylactic immune response in a very broad segment of the worldwide population. In order to understand the value and efficacy of the compositions of the present invention for inducing cellular immune responses, a brief review of immunology related techniques is provided.

  Complexes of HLA molecules and peptide antigens act as ligands recognized by HLA-restricted T cells (Bus, S et al., Cell 47: 1071, 1986; Babbitt, BP et al., Nature 317: 359, 1985). Townsend, A. and Bodmer, H., Annu. Rev. Immunol.7: 601, 1989; German, RN, Annu.Rev. Immunol.11: 403, 1993). Through sequencing of single amino acid substituted antigen analogs and naturally bound naturally processed peptides, key residues corresponding to motifs required for specific binding to HLA antigen molecules are identified. And described in Table IV (see, eg, Southwood et al., J. Immunol. 160: 3363, 1998; Ramsensee et al., Immunogenetics 41: 178, 1995; Ramsensee et al., SYFPEITHI (URL 134.2. 96.221 / scripts.hlaserber.dll / home.htm); Sette, A. and Sidney, J. Curr. Opin. Immunol. 10: 478, 1998; hard, V.H., Curr.Opin.Immunol.6: 13,1994; Sette, A. and Grey, HM, Curr.Opin.Immunol.4: 79, 1992; Sinigaglia, F. and Hammer, J. Curr. Biol.6: 52, 1994; Ruppert et al., Cell 74: 929-937, 1993; Kondo et al., J. Immunol.155: 4307-4312, 1995; Sidney et al., J. Immunol. 3490, 1996; Sidney et al., Human Immunol. 45: 79-93, 1996; Sette, A. and Sidney, J. Immunogenetics 1999 nov; 50 (3-4): 201-12, see review. Of it).

Furthermore, X-ray crystallographic analysis of the HLA-peptide complex reveals a pocket within the peptide binding gap / groove of the HLA molecule that accommodates residues carried by the peptide ligand in an allele-specific manner; These residues determine the HLA binding ability of the peptide in which this residue is present (eg, Madden, DR Annu. Rev. Immunol. 13: 587, 1995; Smith et al., Immunity 4: 203, 1996). Fremont et al., Immunity 8: 305, 1998; Stern et al., Structure 2: 245, 1994; Jones, EY Curr. Opin. Immunol.9: 75, 1997; Brown, J.H. et al., Nature 364: 33, 1993; Guo, HC. Proc. Natl. Acad. Sci. USA 90: 8053, 1993; Guo, HC et al., Nature 360: 364, 1992; Silver, ML et al., Nature 360: 367, 1992; Science 257: 927, 1992; Madden et al., Cell 70: 1035, 1992; Fremont, DH et al., Science.
257: 919, 1992; A. , Bjorman, P .; J. et al. And Wiley, D .; C. , J .; Mol. Biol. 219: 277, 1991).

  Thus, the definition of class I and class II allele-specific HLA binding motifs and class I or class II supermotifs allows the identification of regions within proteins associated with binding to specific HLA antigens.

  Thus, the identification process of HLA motifs has identified candidate epitope-based vaccines; such candidates determine the binding affinity and / or duration of the association of the epitope with its corresponding HLA molecule. In addition, it can be further evaluated by an HLA-peptide binding assay. From these vaccine candidates, further validation experiments can be performed to select epitopes with favorable characteristics in terms of population coverage and / or immunogenicity.

A variety of strategies can be used to assess cellular immunogenicity, including the following:
1) Evaluation of primary T cell cultures from normal individuals (eg, Wentworth, PA et al., Mol, Immunol. 32: 603, 1995; Celis, E. et al., Proc. Natl. Acad. Sci. USA). 91: 2105, 1994; Tsai, V. et al., J. Immunol. 158: 1796, 1997; Kawashima, I. et al., Human Immunol. 59: 1, 1998). This procedure involves stimulating peripheral blood lymphocytes (PBL) from normal subjects with a test peptide in the presence of antigen presenting cells for a period of several weeks in vitro. T cells specific for this peptide are activated during this time and detected using, for example, a lymphokine release assay or ⁵¹ Cr release assay involving target cells sensitized with the peptide.

2) Immunization of HLA transgenic mice (eg, Wentworth, PA et al., J. Immunol. 26:97, 1996; Wentworth, PA et al., Int. Immunol. 8: 651, 1996; Alexander, J. et al.). Et al., J. Immunol. 159: 4753, 1997). For example, in such a method, a peptide in incomplete Freund's adjuvant is administered subcutaneously to HLA transgenic mice. Several weeks after immunization, splenocytes are removed and cultured in vitro in the presence of the test peptide for about a week. Peptide-specific T cells are detected using, for example, a ⁵¹ Cr release assay that includes target cells sensitized with peptides and target cells that express endogenously generated antigens.

3) Demonstration of recall T cell responses from either effectively vaccinated immunized individuals and / or chronically ill patients (eg, Rehermann, B. et al., J. Exp. Med. 181: 1047, 1995; Doolan, DL, et al. Immunity.
7:97, 1997; Bertoni, R .; Et al. Clin. Invest. 100: 503, 1997; Threlkeld, S .; C. Et al. Immunol. 159: 1648, 1997; M.M. Et al. Virol. 71: 6011, 1997). Thus, a recall response is achieved by culturing PBL from a subject that has been exposed to an antigen due to disease and thus produced a “naturally” immune response, or from a patient vaccinated against the antigen. Detected. Subject-derived PBLs are cultured in vitro for 1-2 weeks in the presence of test peptide + antigen presenting cells (APCs), enabling activation of “memory” T cells compared to “unstimulated” T cells To. At the end of this culture period, T cell activity is detected using assays involving ⁵¹ Cr release, T cell proliferation or lymphokine release including peptides sensitized targets.

(VI.) 98P4B6 transgenic animals)
Nucleic acids encoding 98P4B6-related proteins can also be used to produce either transgenic or “knock-out” animals, which are then useful in the development and screening of therapeutically useful reagents. . By established techniques, cDNA encoding 98P4B6 can be used to clone genomic DNA encoding 98P4B6. This cloned genomic sequence can then be used to produce transgenic animals that contain cells that express DNA encoding 98P4B6. Methods for producing transgenic animals (especially animals such as mice or rats) are routine in the art and are described, for example, in US Pat. No. 4,736,866 (Apr. 12, 1988). Issue) and 4,870,009 (issued September 26, 1989). Typically, specific cells are targeted for 98P4B6 transgene integration using a tissue-specific enhancer.

  Transgenic animals containing a copy of the transgene encoding 98P4B6 can be used to test the effect of increasing the expression of DNA encoding 98P4B6. Such animals can be used, for example, as tester animals for reagents believed to confer protection from pathological conditions associated with its overexpression. According to this aspect of the invention, the animal is treated with a reagent and the incidence of reduced pathological condition compared to an untreated animal with the transgene is a potential for this pathological condition. Indicates therapeutic intervention.

  Alternatively, a non-human homologue of 98P4B6 can be used to construct a 98P4B6 “knockout” animal, which is an endogenous gene encoding 98P4B6 and 98P4B6 introduced into the embryonic cells of this animal. As a result of homologous recombination with the altered genomic DNA encoding, have a defective gene or altered gene encoding 98P4B6. For example, cDNA encoding 98P4B6 can be used to clone genomic DNA encoding 98P4B6 according to established techniques. A portion of the genomic DNA encoding 98P4B6 can be deleted or replaced with another gene (eg, a gene encoding a selectable marker that can be used to monitor integration). Typically, several kilobases of unaltered flanking DNA (both 5 'and 3' ends) are included in the vector (see, eg, Thomas and Capecchi, for a description of homologous recombination vectors). Cell, 51: 503 (1987)). This vector is introduced into an embryonic stem cell line (eg, by electroporation), and cells in which the introduced DNA is homologously recombined with endogenous DNA are selected (eg, Li et al., Cell, 69: 915 (1992)). The selected cells are then injected into an animal (eg, mouse or rat) blastocyst to form an aggregated chimera (eg, Bradley, Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, E.J. Edited by Robertson (IRL, Oxford, 1987), pp. 113-152). The chimeric embryo can then be transferred to an appropriate pseudopregnant female surrogate mother and the embryo is born to produce a “knockout” animal. Offspring with DNA homologously recombined in germ cells can be identified by standard techniques and used to breed animals where all cells of the animal contain DNA that has been homologously recombined. Knockout animals can be characterized, for example, for the ability to protect against a particular pathological condition, or for the development of a pathological condition resulting from the absence of 98P4B6 polypeptide.

(VII.) Method for detection of 98P4B6)
Another aspect of the invention relates to methods for detecting 98P4B6 polynucleotides and 98P4B6-related proteins, and methods for identifying cells that express 98P4B6. The expression profile of 98P4B6 makes 98P4B6 a diagnostic marker for metastatic disease. Thus, the status of the 98P4B6 gene product provides useful information for estimating various factors including susceptibility to advanced stage disease, rate of progression, and / or tumor aggressiveness. As discussed in detail herein, the status of 98P4B6 gene product in a patient sample can be analyzed by various protocols well known in the art, including immunohistochemical analysis, various Northern Blot techniques (including in situ hybridization), RT-PCR analysis (eg, for laser captured microdissection samples), Western blot analysis and tissue array analysis.

  More particularly, the present invention provides assays for the detection of 98P4B6 polynucleotides in biological samples (eg, serum, bone, prostate and other tissues, urine, semen, cell preparations, etc.). Detectable 98P4B6 polynucleotides include, for example, recombinant DNA or RNA molecules comprising the 98P4B6 gene or fragment thereof, 98P4B6 mRNA, alternative splice variants 98P4B6 mRNA, and 98P4B6 polynucleotides. Numerous methods for amplifying a 98P4B6 polynucleotide and / or detecting the presence of a 98P4B6 polynucleotide are well known in the art and can be used in the practice of this aspect of the invention.

  In one embodiment, the method for detecting 98P4B6 mRNA in a biological sample uses at least one primer to generate cDNA from this sample by reverse transcription; 98P4B6 as sense and antisense primers. Using the polynucleotide to amplify the cDNA thus generated to amplify the 98P4B6 cDNA therein; and detecting the presence of the amplified 98P4B6 cDNA. If necessary, the sequence of this amplified 98P4B6 cDNA can be determined.

  In another embodiment, a method of detecting a 98P4B6 gene in a biological sample first comprises isolating genomic DNA from the sample; using 98P4B6 polynucleotides as sense and antisense primers, Amplifying the isolated genomic DNA; and detecting the presence of the amplified 98P4B6 gene. A number of suitable sense probe and antisense probe combinations can be designed from the 98P4B6 nucleotide sequence (see, eg, FIG. 2) and used for this purpose.

  The invention also provides an assay for detecting the presence of 98P4B6 protein in a tissue or other biological sample (eg, serum, semen, bone, prostate, urine, cell preparation, etc.). Methods for detecting 98P4B6-related proteins are also well known and include, for example, immunoprecipitation, immunohistochemical analysis, Western blot analysis, molecular binding assays, ELISA, ELIFA, and the like. For example, a method for detecting the presence of 98P4B6-related protein in a biological sample first comprises: Contacting; then detecting the binding of 98P4B6-related protein in the sample.

  Methods for identifying cells that express 98P4B6 are also within the scope of the present invention. In one embodiment, the assay for identifying a cell that expresses the 98P4B6 gene comprises detecting the presence of 98P4B6 mRNA in the cell. Methods for detecting specific mRNAs in cells are well known and include, for example, hybridization assays using complementary DNA probes (eg, in situ hybridization using labeled 98P4B6 riboprobes, Northern blots and Related technology), and various nucleic acid amplification assays (eg, RT-PCR using complementary primers specific for 98P4B6, and other amplified detection methods (eg, branched DNA, SISBA, TMA, etc.) )). Alternatively, an assay for identifying a cell that expresses a 98P4B6 gene includes detecting the presence of a 98P4B6-related protein that is present in or secreted by the cell. Various methods for the detection of proteins are well known in the art and are used for the detection of 98P4B6-related proteins and cells expressing 98P4B6-related proteins.

  98P4B6 expression analysis is also useful as a tool for identifying and evaluating factors that modulate 98P4B6 gene expression. For example, 98P4B6 expression is significantly upregulated in prostate cancer and is expressed in cancers of tissues listed in Table I. The identification of molecules or biological factors that inhibit 98P4B6 expression or 98P4B6 overexpression in cancer cells has therapeutic value. For example, such factors can be identified by using a screen that quantifies 98P4B6 expression by RT-PCR, nucleic acid hybridization, or antibody binding.

(VIII.) Method for monitoring the status of 98P4B6-related genes and their products)
Tumor formation is known to be a multi-step process in which cell growth becomes progressively dysregulated and cells progress from a normal physiological state to a pre-cancerous state and then to a cancerous state (eg, Allers Et al., Lab Invest. 77 (5): 437-438 (1997) and Isaacs et al., Cancer Surv. 23: 19-32 (1995)). In this situation, testing biological samples for evidence of dysregulated cell growth (eg, abnormal 98P4B6 expression in cancer) makes pathological conditions such as cancer more restrictive of treatment options It is possible to detect such abnormal physiology early before proceeding to the stage and / or before prognosis worsens. In such tests, the status of 98P4B6 in the biological sample of interest is, for example, in the corresponding normal sample (eg, a sample from this individual or another alternative individual that is not affected by the pathology). Can be compared to the state of 98P4B6. Changes in the status of 98P4B6 in biological samples (as compared to normal samples) provide evidence of dysregulated cell growth. In addition to using a biological sample unaffected by pathology as a normal sample, a given standard value (eg, a given normal level of mRNA expression) (eg, Grever et al., J. Comp. Neurol). 1996 Dec 9; 376 (2): 306-14 and US Pat. No. 5,837,501) can be used to compare the status of 98P4B6 in samples.

  In this context, the term “condition” is used according to the art-recognized meaning and refers to the condition of a gene and its products. Typically, a person skilled in the art uses a number of parameters to assess the condition of a gene and its product. This includes the location of the expressed gene product (including the location of 98P4B6 expressing cells), as well as the level and biological activity of the expressed gene product (eg, 98P4B6 mRNA, polynucleotides and polypeptides). However, it is not limited to these. Typically, changes in the state of 98P4B6 include changes in the location of 98P4B6 and / or 98P4B6 expressing cells, and / or increased expression of 98P4B6 mRNA and / or 98P4B6 protein.

  The status of 98P4B6 in a sample can be analyzed by a number of means well known in the art, including immunohistochemical analysis, in situ hybridization, RT-PCR analysis on laser-captured microdissection samples, Western blot analysis and Examples include, but are not limited to, tissue array analysis. Representative protocols for assessing the status of the 98P4B6 gene and gene product are described, for example, in Ausubel et al., 1995, Current Protocols In Molecular Biology, Units 2 (Northern Blotting), 4 (Southern Blotting), 15 (Immuning). 18 (PCR Analysis). Thus, the status of 98P4B6 in a biological sample can be assessed by various methods used by those skilled in the art, including genomic Southern analysis (eg, to test perturbation in the 98P4B6 gene). ), Northern analysis and / or PCR analysis of 98P4B6 mRNA (eg, to test for changes in polynucleotide sequence or expression level of 98P4B6 mRNA), and Western analysis and / or immunohistochemical analysis (eg, changes in polypeptide sequence) , Changes in the localization of the polypeptide within the sample, changes in the expression level of the 98P4B6 protein, and / or association of the 98P4B6 protein with the polypeptide binding partner). However, it is not limited to these. Detectable 98P4B6 polynucleotides include, for example, 98P4B6 gene or fragments thereof, 98P4B6 mRNA, alternative splice variants, 98P4B6 mRNA, and recombinant DNA molecules or recombinant RNA molecules comprising 98P4B6 polynucleotides.

  The 98P4B6 expression profile makes 98P4B6 a diagnostic marker for local and / or metastatic disease and provides information about the potential for growth or tumor formation of biological samples. In particular, the status of 98P4B6 provides information useful for estimating susceptibility to a particular disease stage, progression and / or tumor aggressiveness. The present invention provides methods and assays for determining the status of 98P4B6 and diagnosing cancers that express 98P4B6 (eg, cancers of tissues listed in Table I). For example, since 98P4B6 mRNA is highly expressed in prostate and other cancers compared to normal prostate tissue, an assay that assesses the level of 98P4B6 mRNA transcript or 98P4B6 protein in a biological sample is 98P4B6. Can be used to diagnose diseases associated with dysregulation of cancer and provide prognostic information useful in defining appropriate treatment options.

  98P4B6 expression status assesses information predicting susceptibility to various stages of disease, including the presence, stage and location of dysplastic cells, precancerous cells and cancer cells, and / or tumor aggressiveness Provide information for Furthermore, the expression profile makes 98P4B6 useful as an imaging reagent for metastatic disease. Consequently, an aspect of the invention is a sample from an individual suffering from a biological sample (eg, a pathology characterized by dysregulated cell growth (eg, cancer), or affected by such a pathology. The present invention relates to various molecular prognostic methods and molecular diagnostic methods for testing the status of 98P4B6 in a sample from a suspected individual.

  As described above, the status of 98P4B6 in a biological sample can be tested by a number of procedures well known in the art. For example, the status of 98P4B6 in a biological sample taken from a particular location in the body evaluates this sample for the presence or absence of 98P4B6 expressing cells (eg, cells expressing 98P4B6 mRNA or 98P4B6 protein). Can be tested. This test can provide evidence of dysregulated cell growth, for example, when 98P4B6 expressing cells are found in biological samples that normally do not contain such cells (eg, lymph nodes). . This is because such changes in the state of 98P4B6 in a biological sample are often associated with dysregulated cell growth. In particular, one indication of dysregulated cell growth is metastasis of cancer cells from an organ of origin (eg, prostate) to a different region of the body (eg, lymph nodes). In this situation, evidence of dysregulated cell growth is important. This is because, for example, in a significant proportion of patients with prostate cancer, latent lymph node metastases can be detected and such metastases are associated with known predictors of disease progression (eg, Murphy et al., Prostate 42 (4): 315-317 (2000); Su et al., Semin. Surg. Oncol. 18 (1): 17-28 (2000) and Freeman et al., J Urol 1995 Aug 154 (2 Pt 1). ): See 474-8).

  In one aspect, the present invention determines the status of the 98P4B6 gene product expressed by cells from an individual suspected of having a disease (eg, hyperplasia or cancer) associated with dysregulated cell proliferation, A method for monitoring the 98P4B6 gene product is provided by comparing the status determined in this way to the status of the 98P4B6 gene product in the corresponding normal sample. The presence of an abnormal 98P4B6 gene product in the test sample compared to a normal sample provides an indication of the presence of dysregulated cell proliferation within the individual's cells.

  In another aspect, the present invention provides an assay useful in determining the presence of cancer in an individual, the assay comprising a test cell sample as compared to expression levels in corresponding normal cells or normal tissues. Or detecting a significant increase in expression of 98P4B6 mRNA or 98P4B6 protein in the test tissue sample. For example, the presence of 98P4B6 mRNA can be assessed in tissues including, but not limited to, those listed in Table I. The presence of significant 98P4B6 expression in any of these tissues is useful to indicate the onset, presence and / or severity of cancer. This is because the corresponding normal tissue does not express 98P4B6 mRNA or only expresses it at a low level.

  In a related embodiment, 98P4B6 status is determined at the protein level rather than at the nucleic acid level. For example, such methods determine the level of 98P4B6 protein expressed by cells in the test tissue sample and compare the level thus determined to the level of 98P4B6 expressed in the corresponding normal sample. Process. In one embodiment, the presence of 98P4B6 protein is assessed using, for example, immunohistochemical methods. A 98P4B6 antibody or 98P4B6 binding partner capable of detecting 98P4B6 protein expression is used for this purpose in various assay formats well known in the art.

  In further embodiments, the status of the 98P4B6 nucleotide sequence and 98P4B6 amino acid sequence in the biological sample can be evaluated to identify variations in the structure of these molecules. These variations can include insertions, deletions, substitutions, and the like. Such an evaluation is useful. Because variations in nucleotide and amino acid sequences are observed in a number of proteins associated with growth dysregulated phenotypes (eg, Marrogi et al., 1999, J. Cutan. Pathol. 26 (8): 369-378). For example, mutations in the sequence of 98P4B6 may indicate the presence of a tumor or an oncogenic effect. Thus, such assays have diagnostic and predictive value when mutations in 98P4B6 indicate potential loss of function or increased tumor growth.

  Various assays for observing variations in nucleotide and amino acid sequences are well known in the art. For example, the size and structure of the 98P4B6 gene product nucleic acid or amino acid sequence is observed by the Northern, Southern, Western, PCR, and DNA sequencing protocols discussed herein. In addition, other methods for observing variations in nucleotide and amino acid sequences (eg, single-stranded conformational polymorphism analysis) are well known in the art (eg, US Pat. No. 5,382,510). (See September 7, 1999) and 5,952,170 (issued January 17, 1995).

In addition, the methylation status of the 98P4B6 gene in a biological sample can be tested. Aberrant demethylation and / or hypermethylation of CpG islands in the 5 ′ regulatory region of genes often occurs in immortalized and transformed cells, resulting in altered expression of various genes. For example, promoter hypermethylation of the π class glutathione S-transferase (a protein that is expressed in normal prostate and not expressed in more than 90% of prostate cancers) seems to permanently stop transcription of this gene. And is the most frequently detected genomic alteration in prostate cancer (De Marzo et al., Am. J. Pathol. 155 (6): 1985-1992 (1999)). Furthermore, this change is present in at least 70% of cases of advanced prostate intraepithelial neoplasia (PIN) (Brooks et al., Cancer Epidemiol. Biomarkers Prev., 1998, 7: 531-536). In another example, expression of a LAGE-I tumor-specific gene (which is not expressed in normal prostate but is expressed in 25-50% of prostate cancer) is caused by deoxy-azacytidine in lymphoblastoid cells Induced, suggesting that tumor expression is due to demethylation (Lethe et al., Int. J. Cancer 76 (6): 903-908 (1998)). Various assays for testing the methylation status of a gene are well known in the art. For example, one skilled in the art can assess the methylation status of CpG islands using a methylation sensitive restriction enzyme that cannot cleave sequences containing methylated CpG sites in a Southern hybridization approach. Furthermore, MSP (methylation specific PCR) can easily profile the methylation status of all CpG sites present in a CpG island of a given gene. This procedure is specific for DNA that is first modified with sodium bisulfite (which converts all unmethylated cytosine to uracil) and then methylated against unmethylated DNA. Amplification using simple primers. Protocols involving methylation interference can also be found, for example, in Current Protocols.
In Molecular Biology, Unit 12, Frederick M. et al. Can be found in Ausubel et al., 1995.

  Gene amplification is an additional method for assessing the status of 98P4B6. Gene amplification is based on the sequences provided herein, eg, conventional Southern blotting or Northern blotting (Thomas, 1980, for quantifying mRNA transcription, using appropriately labeled probes). Proc. Natl. Acad. Sci. USA, 77: 5201-5205), dot blotting (DNA analysis), or in situ hybridization. Alternatively, antibodies that recognize specific duplexes (including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes) are used. The antibody is then labeled and an assay is performed in which the duplex is bound to a surface such that when a duplex is formed on the surface, the duplex is The presence of antibody bound to can be detected.

  Biopsy tissue or peripheral blood can be conveniently assayed for the presence of cancer cells using, for example, Northern analysis, dot blot analysis or RT-PCR analysis to detect 98P4B6 expression. The presence of 98P4B6 mRNA capable of RT-PCR amplification provides an indication of the presence of cancer. RT-PCR assays are well known in the art. RT-PCR detection assays for tumor cells in peripheral blood are currently being evaluated for use in the diagnosis and management of many human solid tumors. In the field of prostate cancer, this assay includes RT-PCR assays for detection of cells expressing PSA and PSM (Verkaik et al., 1997, Urol. Res. 25: 373-384; Ghossein et al., 1995). J. Clin. Oncol. 13: 1195-2000; Heston et al., 1995, Clin. Chem. 41: 1687-1688).

  A further aspect of the invention is an assessment of the susceptibility an individual has for developing cancer. In one embodiment, the method for predicting susceptibility to cancer comprises detecting 98P4B6 mRNA or 98P4B6 protein (the presence of which indicates susceptibility to cancer) in a tissue sample, wherein 98P4B6 mRNA expression. The degree of correlates with the degree of sensitivity. In certain embodiments, the presence of 98P4B6 in the prostate or other tissue is tested, wherein the presence of 98P4B6 in this sample provides an indication of prostate cancer susceptibility (or prostate tumor development or presence). . Similarly, the integrity of 98P4B6 nucleotide and 98P4B6 amino acid sequences in biological samples can be assessed and variations in the structure of these molecules (eg, insertions, deletions, substitutions, etc.) can be identified. The presence of one or more variations of the 98P4B6 gene product in this sample is an indication of cancer susceptibility (or tumor development or presence).

  The invention also includes a method for assessing tumor aggressiveness. In one embodiment, the method for assessing tumor aggressiveness comprises the step of determining the level of 98P4B6 mRNA or 98P4B6 protein expressed by tumor cells, the level thus determined being referred to the same individual or normal tissue. Comparing the level of 98P4B6 mRNA or 98P4B6 protein expressed in the corresponding normal tissue taken from the sample, wherein the degree of expression of 98P4B6 mRNA or 98P4B6 protein in the tumor sample relative to the normal sample is aggressive Indicates the degree. In certain embodiments, tumor aggressiveness is assessed by determining the extent to which 98P4B6 is expressed in tumor cells, where a higher expression level indicates a more aggressive tumor. Another embodiment is an assessment of the integrity of this 98P4B6 nucleotide and amino acid sequence in a biological sample to identify variations in the structure of 98P4B6 nucleotides and amino acids (eg, insertions, deletions, substitutions, etc.) . The presence of one or more fluctuations indicates a more aggressive tumor.

  Another embodiment of the invention relates to a method for observing the progression of malignancy in an individual over time. In one embodiment, the method for observing the progression of a malignant tumor in an individual over time comprises determining the level of 98P4B6 mRNA or 98P4B6 protein expressed by cells in a sample of the tumor, thus determined. Comparing the measured levels to the levels of 98P4B6 mRNA or 98P4B6 protein expressed in equivalent tissue samples taken from the same individual at different times, wherein 98P4B6 mRNA or 98P4B6 in tumor samples over time The degree of protein expression provides information about cancer progression. In certain embodiments, cancer progression is assessed by determining 98P4B6 expression in tumor cells over time, wherein increased expression over time indicates cancer progression. Also, the integrity of 98P4B6 nucleotide sequences and 98P4B6 amino acid sequences in biological samples can be assessed, and variations in the structure of 98P4B6 nucleotides and 98P4B6 amino acids (eg, insertions, deletions, substitutions, etc.) can be identified, where The presence of one or more fluctuations indicates cancer progression.

  The above diagnostic approach can be combined with any one of a variety of prognostic and diagnostic protocols known in the art. For example, another embodiment of the present invention may be used as a means to diagnose and predict 98P4B6 gene expression and 98P4B6 gene product expression (or 98P4B6 gene variation and 98P4B6 gene product variation), tissue sample status. The present invention relates to a method for observing co-occurrence between factors associated with tumors. Various factors associated with malignant tumors, such as genes associated with malignant tumors (eg, expression of PSA, PSCA and PSM for prostate cancer, and macroscopic cytological findings) can be used (eg, Bocking et al., 1984, Anal.Quant.Cytol.6 (2): 74-88; Epstein, 1995, Hum.Pathol.26 (2): 223-9; Torson et al., 1998, Mod.Pathol.11 (6 ): 543-51; see Baisden et al., 1999, Am. J. Surg. Pathol. 23 (8); Methods for observing co-occurrence between expression of 98P4B6 gene and expression of 98P4B6 gene product (or variation in 98P4B6 gene and 98P4B6 gene product) and another factor associated with malignancy are useful. This is because, for example, the presence of a particular set of factors that coincide with the disease provides important information for diagnosing and prognosing the condition of a tissue sample.

  In one embodiment, the method for observing co-occurrence between expression of 98P4B6 gene and expression of 98P4B6 gene product (or variation in 98P4B6 gene and 98P4B6 gene product) and another factor associated with malignancy is: Detecting overexpression of 98P4B6 mRNA or 98P4B6 protein in a tissue sample, detecting overexpression of PSA mRNA or PSA protein (or PSCA or PSM expression) in a tissue sample, and of 98P4B6 mRNA or 98P4B6 protein It involves observing the coincidence of overexpression and overexpression of PSA mRNA or PSA protein (or PSCA expression or PSM expression). In certain embodiments, the expression of 98P4B6 mRNA and PSA mRNA in prostate tissue is tested, wherein the concomitant 98P4B6 mRNA overexpression and PSA mRNA overexpression in this sample is indicative of the presence of prostate cancer, prostate cancer Indicates the onset or status of susceptibility or prostate tumor.

  Methods for detecting and quantifying 98P4B6 mRNA or 98P4B6 protein expression are described herein, and standard nucleic acid and protein detection and quantification techniques are well known in the art. Standard methods for detection and quantification of 98P4B6 mRNA include in situ hybridization using labeled 98P4B6 riboprobe, Northern blot using 98P4B6 polynucleotide probe and related techniques, using primers specific for 98P4B6 RT-PCR analysis, as well as other amplification type detection methods (eg, branched DNA, SISBA, TMA, etc.) can be mentioned. In certain embodiments, semi-quantitative RT-PCR is used to detect and quantify 98P4B6 mRNA expression. Any number of primers capable of amplifying 98P4B6 can be used for this purpose, including but not limited to the various primer sets specifically described herein. . In certain embodiments, polyclonal or monoclonal antibodies that specifically react with wild-type 98P4B6 protein may be used in immunohistochemical assays of biopsy tissues.

(Identification of molecules that interact with IX.98P4B6)
The 98P4B6 protein and nucleic acid sequences disclosed herein allow one of ordinary skill in the art to use any one of proteins, small molecules and other agents that interact with 98P4B6, and protocols accepted in various fields. Through which makes it possible to identify the pathway activated by 98P4B6. For example, one of the so-called interaction trap systems (also called “two-hybrid assays”) may be utilized. In such a system, the molecule interacts with and reconstitutes a transcription factor that directs expression of the reporter gene, while assaying for expression of this reporter gene. Other systems identify protein-protein interactions in vivo via reconstruction of eukaryotic transcriptional activators (eg, US Pat. No. 5,955,280 issued Sep. 21, 1999). No. 5,925,523 issued July 20, 1999, No. 5,846,722 issued December 8, 1998, and issued December 21, 1999 No. 6,004,746). Algorithms are also available in the art for genome-based prediction of protein function (see, eg, Marcotte et al., Nature 402: November 4, 1999, 83-86).

  Alternatively, peptide libraries can be screened to identify molecules that interact with the 98P4B6 protein sequence. In such methods, peptides that bind to 98P4B6 are identified by screening a library that encodes a random or controlled collection of amino acids. Peptides encoded by this library are expressed as bacteriophage coat protein fusion proteins, and then the bacteriophage particles are screened against 98P4B6 protein.

  Thus, peptides having a wide variety of uses (eg, therapeutic, prognostic or diagnostic agents) are identified without previous information regarding the structure of the expected ligand or receptor molecule. Exemplary peptide libraries and screening methods that can be used to identify molecules that interact with the 98P4B6 protein sequence are described, for example, in US Pat. No. 5,723,286, issued Mar. 3, 1998, And in US Pat. No. 5,733,731 issued March 31, 1998.

Alternatively, cell lines expressing 98P4B6 are used to identify protein-protein interactions mediated by 98P4B6. Such interactions can be tested using immunoprecipitation techniques (see, eg, Hamilton BJ et al., Biochem. Biophys. Res. Commun, 1999, 261: 646-51). 98P4B6 protein can be immunoprecipitated from a 98P4B6 expressing cell line using an anti-98P4B6 antibody. Alternatively, antibodies against His-tag can be used in cell lines engineered to express a fusion of 98P4B6 and His-tag (the above vector). This immunoprecipitation complex can be tested for proteins along procedures such as Western blot, ³⁵ S-methionine labeling of proteins, protein microsequencing, silver staining and two-dimensional gel electrophoresis.

  Small molecules and ligands that interact with 98P4B6 can be identified through related embodiments of such screening assays. For example, small molecules that interfere with protein function (including phosphorylation and dephosphorylation, including molecules that interfere with 98P4B6's ability to mediate interaction with DNA or RNA molecules), cell cycle, second messenger signaling Or as an indicator of modulation of tumorigenesis. Similarly, small molecules that modulate 98P4B6-related ion channels, protein pumps, or cell communication functions are identified and used to treat patients with cancer that express 98P4B6 (eg, Hille, B., Ionic). Channels of Excitable Membranes, 2nd edition, Sinauer Assoc., Sunderland, MA, 1992). In addition, ligands that modulate 98P4B6 function can be identified based on their ability to bind to 98P4B6 and activate the reporter construct. Exemplary methods are discussed, for example, in US Pat. No. 5,928,868, issued July 27, 1999, and to form hybrid ligands in which at least one ligand is a small molecule. Including methods. In an exemplary embodiment, cells engineered to express a 98P4B6 and DNA binding protein fusion protein are used to co-express the hybrid ligand / small molecule fusion protein and the cDNA library transcription activation protein. The cell further comprises a reporter gene (this expression is regulated such that the first and second fusion proteins are adjacent to each other), and this event causes the hybrid ligand to be in the target site of both hybrid proteins. Only occurs when joining. Those cells expressing the reporter gene are selected and the unknown small molecule or unknown ligand is identified. This method provides a means to identify modulators that activate or inhibit 98P4B6.

  Embodiments of the invention include a method of screening for a molecule that interacts with the 98P4B6 amino acid sequence shown in FIG. 2 or FIG. 3, wherein the method comprises contacting a group of molecules with the 98P4B6 amino acid sequence, Interacting the molecule with the 98P4B6 amino acid sequence under conditions that facilitate interaction, determining the presence of a molecule that interacts with the 98P4B6 amino acid sequence, and then interacting with molecules that do not interact with the 98P4B6 amino acid sequence. Separating from acting molecules. In certain embodiments, the method further comprises purifying, characterizing and identifying molecules that interact with the 98P4B6 amino acid sequence. This identified molecule can be used to modulate the function performed by 98P4B6. In a preferred embodiment, the 98P4B6 amino acid sequence is contacted with a peptide library.

(X. Treatment methods and compositions)
The identification of 98P4B6, which is normally expressed in a limited set of tissues but is also expressed in prostate cancer and other cancers, extends numerous therapeutic approaches to the treatment of such cancers. As contemplated herein, 98P4B6 functions as a transcription factor associated with activating tumor promoting genes or suppressing genes that block tumorigenesis.

  Accordingly, therapeutic approaches that inhibit the activity of 98P4B6 protein are useful for patients suffering from cancers that express 98P4B6. Such therapeutic approaches generally fall into two classes. One class includes various methods for inhibiting the binding or association of 98P4B6 protein with its binding partner or other proteins. Another class includes various methods for inhibiting transcription of the 98P4B6 gene or translation of 98P4B6 mRNA.

(X.A. Anticancer vaccine)
The present invention provides a cancer vaccine comprising 98P4B6-related protein or 98P4B6-related nucleic acid. With respect to 98P4B6 expression, cancer vaccines prevent and / or treat 98P4B6-expressing cancer with minimal or no effect in non-target tissues. The use of tumor antigens in vaccines that produce humoral and / or cell-mediated immune responses as anti-cancer treatments is well known in the art and is utilized in prostate cancer using human PSMA and rodent PAP immunogens. (Hodge et al., 1995, Int. J. Cancer 63: 231-237; Fong et al., 1997, J. Immunol. 159: 3113-3117).

  Such methods utilize a 98P4B6-related protein, or a recombinant vector that can express and display a 98P4B6-encoding nucleic acid molecule and a 98P4B6 immunogen, which typically includes a number of antibodies or T-cell epitopes. Can be easily implemented. One skilled in the art understands that a wide variety of vaccine systems for the delivery of immunoreactive epitopes are well known in the art (eg, Heryln et al., Ann Med February 1999, 31 (1): 66-). 78; Maruyama et al., Cancer Immunol Immunother June 2000, 49 (3): 123-32). Briefly, such methods for generating an immune response (eg, a humoral immune response and / or a cell-mediated immune response) in a mammal include the following steps: an immunoreactive epitope (eg, an epitope is Exposing the mammal's immune system to the 98P4B6 protein shown in FIG. 3, or an analog or homologue thereof, which results in the mammal producing a specific immune response against the epitope (eg, Generating an antibody that specifically recognizes this epitope). In a preferred method, the 98P4B6 immunogen comprises a biological motif (eg, from Table VIII-XXI and XXII-XLIX or from 98P4B6 as shown in FIGS. 5, 6, 7, 8, and 9). See size range peptides).

The complete 98P4B6 protein, immunogenic region or epitope thereof can be combined and delivered by various means. Examples of such vaccine compositions include: lipopeptides (eg, Vitiello, A. et al., J. Clin. Invest. 95: 341, 1995), poly (DL-lactide-co-glycolide). (“PLG”) peptide compositions encapsulated in microcapsules (eg Eldridge et al., Molec. Immunol. 28: 287-294, 1991: Alonso et al., Vaccine 12: 299-306, 1994; Jones et al., Vaccine 13: 675-681, 1995), peptide compositions contained in immune stimulating complexes (ISCOMS) (eg, Takahashi et al., Nature 344: 873-875, 1990; Hu et al., Clin Exp Immunol. 1). 3: 235-243, 1998), multi-antigen peptide systems (MAP) (eg Tam, JP, Proc. Natl. Acad. Sci. USA 85: 5409-5413, 1988; Tam, JP, J. Immunol. Methods 196: 17-32, 1996), peptides formulated as multivalent peptides, peptides for use in ballistic delivery systems (typically Crystallized peptides), viral delivery vectors (Perkus, ME, et al., Concepts in vaccine development, Kaufmann, SH, Ed., Page 379, 1996; Chakrabarti, S. et al., Nature 320: 535, 1986; Hu, SL, et al., Nature 320: Kiney, MP, et al., AIDS Bio / Technology 4: 790, 1986; Top, FH, et al., J. Infect. Dis. 124: 148, 1971; , Virology 175: 535, 1990), particles of viral or synthetic origin (eg Kofler, N. et al., J. Immunol. Methods. 192: 25, 1996; Eldridge, J. H. et al., Sem. Hematol. 30). Faro, LD Jr. et al., Nature Med. 7: 649, 1995), adjuvant (Warren, HS, Vogel, FR, and Chedid, LA Annu. Rev. Immunol.4: 369, 1986; ta, R.D. K. Et al, Vaccine
11: 293, 1993), liposomes (Reddy, R. et al., J. Immunol. 148: 1585, 1992; Rock, KL, Immunol. Today 17: 131, 1996) or naked or particle-absorbing cDNA ( Ulmer, JB et al., Science 259: 1745, 1993; Robinson, HL, Hunt, LA and Webster, RG, Vaccine 11: 957, 1993; Shiver, JW et al., Concepts in vaccine development, Kaufmann, S. H. E., 423, 1996; Cease, K. B. and Berzofsky, JA, Annu. Rev. Immunol. 12: 923, 1994 and E. . Dridge, J.H et al., Sem.Hematol.30: 16,1993). Toxin-targeted delivery techniques, such as receptor-mediated targeting (also known as receptor-mediated targeting of Avant Immunotherapeutics, Inc. (Needham, Massachusetts)), can also be used.

  In patients with cancer associated with 98P4B6, the vaccine compositions of the invention may also be used for other treatments used for cancer (eg, surgery, chemotherapy, drug therapy, radiation therapy, etc. (IL-2, IL- 12, including use in combination with immune adjuvants such as GM-CSF).

(Cell vaccine)
CTL epitopes can be determined using specific algorithms to identify peptides within the 98P4B6 protein that bind to the corresponding HLA allele: (eg, Table IV; Epimer ^™ and Epimatrix ^™ , Brown University (URL brown. edu / Research / TB-HIV_Lab / epimatrix / epimatrix.html); and BIMAS (URL bimas.dcrt.nih.gov/; In a preferred embodiment, the 98P4B6 immunogen comprises one or more amino acid sequences identified using techniques well known in the art, which are the sequences shown in Tables VIII-XXI and XXII-XLIX, or HLA An 8, 9, 10 or 11 amino acid peptide identified by a class I motif / supermotif (eg, Table IV (A), Table IV (D), or Table IV (E)), and / or Or a peptide of at least 9 amino acids (eg, Table IV (B), or Table IV (C)) containing an HLA class II motif / supermotif. As understood in the art, the HLA class I binding groove is essentially closed, so that only peptides of a specific size region can fit into and be bound to the groove, In general, HLA class I epitopes are 8, 9, 10, or 11 amino acids long. In contrast, the HLA class II binding groove is essentially openly terminated, so that peptides of about 9 or more amino acids can be bound by HLA class II molecules. Due to the difference in the binding groove between HLA class I and HLA class II, the HLA class I motif is length specific. That is, the two positions of the class I motif are the second amino acid in the amino to carboxyl direction of this peptide. The amino acid positions of class II motifs only correlate with each other and not with the whole peptide. That is, additional amino acids can be attached to the amino terminus and / or carboxyl terminus of the motif bearing sequence. HLA class II epitopes are often 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acids long, or 25 amino acids long Also long.

(Antibody-based vaccine)
A wide variety of methods for generating an immune response in a mammal are known in the art (eg, as a first step in the generation of hybridomas). A method of generating an immune response in a mammal includes exposing the mammalian immune system to an immunogenic epitope on a protein (eg, 98P4B6 protein), thereby generating an immune response. Exemplary embodiments contact a sufficient amount of at least one 98P4B6 B cell or cytotoxic T cell epitope or analog thereof with the host; and after at least one periodic interval, 98P4B6 B cells or Consists of a method for generating an immune response against 98P4B6 in a host by re-contacting the cytotoxic T cell epitope or analog thereof with the host. Certain embodiments consist of a method of generating an immune response against a 98P4B6-related protein or an artificial multi-epitope peptide comprising: a 98P4B6 immunogen (eg, 98P4B6 protein or peptide fragment thereof, 98P4B6 fusion protein or analog, etc.), Administering to a human or another mammal as a vaccine preparation. Typically, such vaccine preparations further comprise a suitable adjuvant (eg, US Pat. No. 6,146,635) or a universal helper epitope such as PADRE ^™ peptide (Epimmune Inc., San Diego, Calif .; For example, Alexander et al., J. Immunol. 2000 164 (3); 164 (3): 1625-1633; : 79-92). An alternative method involves in vivo administration of a DNA molecule encoding a 98P4B6 immunogen, a DNA molecule comprising a DNA sequence operably linked to a preparative sequence that controls expression of the DNA sequence, to an individual's body muscle or skin. Generating an individual's immune response against the 98P4B6 immunogen, wherein the DNA molecule is taken up by the cell, the DNA sequence is expressed in the cell, and the immune response is (See, for example, US Pat. No. 5,962,428). Optionally, genetic vaccine facilitators (eg, anionic lipids; saponins; lectins; estrogen compounds; hydroxylated lower alkyls; dimethyl sulfoxides; and ureas) are also administered. In addition, anti-idiotype antibodies that mimic 98P4B6 can be administered to generate a response to the target antigen.

(Nucleic acid vaccine)
The vaccine composition of the present invention comprises a nucleic acid mediated mode. DNA or RNA encoding the protein of the invention can be administered to a patient. Genetic immunization methods can be utilized to generate prophylactic or therapeutic humoral and cellular immune responses against cancer cells expressing 98P4B6. A construct comprising DNA encoding a 98P4B6-related protein / immunogen and appropriate regulatory sequences can be injected directly into the muscle or skin of an individual so that the muscle or skin cells take up the construct and code Expressed 98P4B6 protein / immunogen. Alternatively, the vaccine comprises 98P4B6-related protein. Expression of the 98P4B6-related protein immunogen results in the development of prophylactic or therapeutic humoral and cellular immunity against cells carrying the 98P4B6 protein. Various prophylactic and therapeutic gene immunization techniques known in the art can be used (for review, see information and references published at the internet address genweb.com). Nucleic acid-based delivery is described, for example, by Wolff et al., Science 247: 1465 (1990) and US Pat. Nos. 5,580,859; 5,589,466; 5,804,566; 739,118; 5,736,524; 5,679,647; WO 98/04720. Examples of DNA-based delivery techniques include “naked DNA”, enhanced (bupivacaine, polymer, peptide mediated) delivery, cationic lipid complexes, and particle mediated delivery (“gene gun”) or pressure Mediated delivery (see, eg, US Pat. No. 5,922,687).

  For therapeutic or prophylactic immunization purposes, the proteins of the invention can be expressed via viral or bacterial vectors. Various viral gene delivery systems that can be used in the practice of the present invention include vaccinia virus, fowlpox virus, canarypox virus, adenovirus, influenza virus, poliovirus, adeno-associated virus, lentivirus, and Sindbis virus (eg, Ristifo, 1996, Curr. Opin. Immunol. 8: 658-663; see Tsang et al., J. Natl. Cancer Inst. 87: 982-990 (1995)), but is not limited thereto. Non-viral delivery systems can also be utilized by introducing naked DNA encoding a 98P4B6-related protein (eg, intramuscularly or intradermally) into a patient to induce an anti-tumor response.

  Vaccinia virus is used, for example, as a vector for expressing a nucleotide sequence encoding a peptide of the invention. Upon introduction into the host, the recombinant vaccinia virus expresses a protein immunogenic peptide and thereby elicits a host immune response. Vaccine vectors and methods useful in immunization protocols are described, for example, in US Pat. No. 4,722,848. Another vector is BCG (Bacile Calmette Guerin). BCG vectors are described in Stover et al., Nature 351: 456-460 (1991). A wide variety of other vectors useful for therapeutic administration or immunization of the peptides of the invention (eg, adenovirus vectors and adeno-associated virus vectors, retrovirus vectors, Salmonella typhi vectors, detoxified anthrax toxin vectors, etc.) Will be apparent to those skilled in the art from the description herein.

  Thus, gene delivery systems are used to deliver 98P4B6-related nucleic acid molecules. In one embodiment, full length human 98P4B6 cDNA is used. In another embodiment, 98P4B6 nucleic acid molecules encoding specific cytotoxic T lymphocytes (CTLs) and / or antibody epitopes are used.

(Ex vivo vaccine)
A variety of ex vivo strategies can also be used to generate an immune response. One approach involves the use of antigen presenting cells (APCs) such as dendritic cells (DCs) that present the 98P4B6 antigen to the patient's immune system. Dendritic cells express MHC class I and MHC class II molecules, B7 costimulators, and IL-12 and are therefore highly specific antigen presenting cells. In prostate cancer, autologous dendritic cells pulsed with a peptide of prostate specific membrane antigen (PSMA) are used in phase I clinical trials to stimulate the immune system of prostate cancer patients (Tjoa et al., 1996). , Prostate 28: 65-69; Murphy et al., 1996, Prostate 29: 371-380). Thus, dendritic cells can be used to present 98P4B6 peptides to T cells in the contents of MHC class I or MHC class II molecules. In one embodiment, autologous dendritic cells are pulsed with 98P4B6 peptides that can bind to MHC class I and / or MHC class II molecules. In another embodiment, dendritic cells are pulsed with complete 98P4B6 protein. Yet another embodiment relates to manipulating the overexpression of the 98P4B6 gene in dendritic cells using various execution vectors known in the art (see, eg, adenovirus (Arthur et al., 1997, Cancer Gene Ther. 4: 17-25), retrovirus (Henderson et al., 1996, Cancer Res. 56: 3763-3770), lentivirus, adeno-associated virus, DNA transfection (Ribas et al., 1997, Cancer Res. 57: 2865-2869). Or tumor-induced RNA transfection (Ashley et al., 1997, J. Exp. Med. 186: 1177-1182)). Cells expressing 98P4B6 can also be engineered to express immunomodulators (eg, GM-CSF) and used as immunizing agents.

(98B4B6 as a target for XB antibody-based therapy)
98P4B6 is an attractive target for antibody-based therapeutic strategies. A number of antibody strategies are known in the art to target both extracellular and intracellular molecules (see, eg, complement and ADCC mediated killing and use in the body). Since 98P4B6 is expressed by various lines of cancer cells against the corresponding normal cells, toxic effects, non-specific effects and / or non-targets caused by binding the immunoactive composition to non-target organs and tissues A systemic administration of a 98P4B6 immunoactive composition is prepared that exhibits excellent sensitivity without effect. Antibodies that specifically react with the domain of 98P4B6 treat cancers that develop 98P4B6 systemically, either in combination with toxins or therapeutic agents, or as naked antibodies that can inhibit cell proliferation or function Useful for.

  The 98P4B6 antibody allows the antibody to bind to 98P4B6 and modulate function (eg, interaction with a binding partner) and consequently mediate tumor cell destruction and / or inhibit tumor cell growth. Can be introduced to the patient. The mechanisms by which such antibodies exert therapeutic effects include complement-mediated cell lysis, antibody-dependent cellular cytotoxicity, modulating physiological functions of 98P4B6, inhibiting ligand binding or signaling pathways, Modulating tumor cell differentiation, altering tumor angiogenic profile, and / or apoptosis may be involved.

  One skilled in the art understands that antibodies can be used to specifically target and bind immunogenic molecules (eg, the immunogenic region of the 98P4B6 sequence shown in FIG. 2 or FIG. 3). Furthermore, one skilled in the art understands that it is conventional to conjugate antibodies to cytotoxic agents (see, eg, Slivers et al., Blood 93:11 3678-3684 (June 1, 1999)). ) Cytotoxic agents and / or therapeutic agents are delivered directly to the cells, for example, by conjugating the agents to antibodies specific for molecules expressed by the cells (eg, 98P4B6). In some cases, the cytotoxic agent exerts a known biological effect (eg, cytotoxicity) on those cells.

  A wide variety of compositions and methods for killing cells using antibody-cytotoxic drug conjugates are known in the art. In the context of cancer, an exemplary method involves administering a biologically effective amount of a conjugate to an animal having a tumor, wherein the conjugate is expressed or accessible for binding, Or a selected cytotoxic agent and / or therapeutic agent linked to a target reagent (eg, anti-98P4B6 antibody) that binds to a marker (eg, 98P4B6) localized on the cell surface. An exemplary embodiment is a method of delivering a cytotoxic agent and / or therapeutic agent to a cell that expresses 98P4B6, wherein the method includes applying a cytotoxic agent to an antibody that immunospecifically binds to a 98P4B6 epitope. Conjugating and exposing the cell to the antibody drug conjugate. Another exemplary embodiment is a method of treating an individual suspected of having metastatic cancer, wherein the method comprises treating a therapeutically effective amount of an antibody conjugated to a cytotoxic agent and / or therapeutic agent. Including parenterally administering to the individual a pharmaceutical composition comprising.

Cancer immunotherapy using anti-98P4B6 antibodies can be made according to various approaches successfully used to treat other types of cancer, including but not limited to: colon cancer ( Arlen et al., 1998, Crit. Rev. Immunol. 18: 133-138), multiple myeloma (Ozaki et al., 1997, Blood 90: 3179-3186; Tsusunari et al., 1997, Blood 90: 2437-2444), gastric cancer ( Kasprzyk et al., 1992, Cancer Res. uk.Res.20: 581-589), colorectal cancer (Moun et al., 1994, Cancer Res. 54: 6160-6166; Velders et al., 1995, Cancer Res. 55: 4398-4403), and breast cancer (Shepard et al., 1991, J. Clin. Immunol. 11: 117-127). Some therapeutic approaches include the binding of naked antibodies to toxins or radioisotopes (eg, binding of Y ⁹¹ or I ¹³¹ to anti-CD20 antibodies (eg, Zevalin ^™ , IDEC Pharmaceuticals Corp., or Bexar ^™ , Coulter). While other approaches include co-administration of antibodies and other therapeutic agents (eg, Herceptin ^™ (eg, trastuzumab and paclitaxel (Genenttech, Inc.)). For the treatment of prostate cancer, for example, 98P4B6 antibody can be administered in combination with irradiation, chemotherapy or hormonal resection, and the antibody can be calichemycin (eg, Ylotarg (TM), Wyeth-Ayerst, Madison, NJ, antitumor antibiotics Cali - toxins or maytansinoid, such as conjugation to Choi clarithromycin recombinant humanized IgG ₄ kappa antibody) (e.g., taxane-based Can be conjugated to a tumor active prodrug, TAP, platform, immunogen, Cambridge, MA; see also, eg, US Pat. No. 5,416,064).

  98P4B6 antibody therapy is useful for all stages of cancer, but may be particularly appropriate in advanced or metastatic cancer. Treatment with the antibody therapy of the present invention is indicated for patients undergoing one or more series of chemotherapy. Alternatively, the antibody therapy of the invention is combined with a chemotherapeutic or irradiation regimen for patients who have not received chemotherapy treatment. In addition, antibody therapy may allow the use of reduced dosages of concurrent chemotherapy, particularly for patients who are less tolerant of the toxicity of the chemotherapeutic agent. Fan et al. (Cancer Res. 53: 4637-4642, 1993), Prewett et al. (International Onco. J. 9: 217-224, 1996), and Hancock et al. (Cancer Res. 51: 4575-4580, 1991) are: It describes the use of various antibodies along with chemotherapeutic agents.

  98P4B6 antibody therapy is useful for all stages of cancer, but may be particularly appropriate in advanced or metastatic cancer. Treatment with the antibody therapy of the present invention is indicated for patients undergoing one or more series of chemotherapy. Alternatively, the antibody therapy of the invention is combined with a chemotherapeutic or radiation regimen for patients who have not received chemotherapy treatment. In addition, antibody therapy may allow the use of reduced dosages of concurrent chemotherapy, particularly for patients who are less tolerant of the toxicity of the chemotherapeutic agent.

  Cancer patients are preferably assessed for the presence and level of 98P4B6 expression using immunohistochemical assessment of tumor tissue, quantitative 98P4B6 imaging, or other techniques that can reliably indicate the presence and extent of 98P4B6 expression. Can be done. Tumor biopsies or immunohistochemical analysis of surgical specimens are preferred for this purpose. Methods for immunohistochemical analysis of tumor tissue are well known in the art.

  Anti-98P4B6 monoclonal antibodies that treat prostate cancer and other cancers include antibodies that can initiate a strong immune response against the tumor, or antibodies that can be directly cytotoxic. In this regard, anti-98P4B6 monoclonal antibodies (mAbs) can cause tumor cell lysis by either complement-mediated cytotoxicity or antibody-dependent cellular cytotoxicity (ADCC) mechanisms, both of which are Interaction with the effector cell Fc receptor site on the body protein requires the intact Fc portion of the immunoglobulin molecule. Furthermore, anti-98P4B6 mAbs that exert a direct biological effect on tumor growth are useful for treating cancers that express 98P4B6. The mechanisms by which cytotoxic mAbs act directly include inhibition of cell proliferation, regulation of cell differentiation, regulation of tumor angiogenic factor profiles, and induction of apoptosis. The mechanism by which a particular anti-98P4B6 mAb exerts an anti-tumor effect can be any number of cells that assess cell death such as ADCC, ADMMC, complement-mediated cell lysis, as is generally known in the art. Assessed using in vitro assays.

  In some patients, the use of murine or other non-human monoclonal antibodies, or the use of human / mouse chimeric mAbs can induce a moderate to strong immune response against non-human antibodies. This can lead to clearance of the antibody from the circulation and reduced efficacy. In the most severe cases, such an immune response can result in extensive formation of immune complexes that can potentially cause renal failure. Accordingly, preferred monoclonal antibodies used in the therapeutic methods of the invention specifically bind to the target 98P4B6 antigen with high affinity, but exhibit low or no antigenicity in the patient. An antibody that is either human or humanized.

  The therapeutic methods of the present invention contemplate administration of a single anti-98P4B6 mAb, as well as administration of different mAb combinations or cocktails. Such mAb cocktails have particular advantages because they contain mAbs that target different epitopes, use different effector mechanisms, or combine mAbs directly dependent on immune effector functionality with cytotoxic mAbs. Can have. Such mAbs in combination may show a synergistic therapeutic effect. In addition, the anti-98P4B6 mAb is administered concurrently with other therapeutic agents, including but not limited to various chemotherapeutic agents, androgen blockers, immunomodulators (eg, IL-2, GM-CSF), surgery or radiation. Can be done. The anti-98P4B6 mAb can be administered in its “naked” or unbound form, or can have a therapeutic agent bound to them.

  The anti-98P4B6 antibody formulation is administered via any route that can deliver the antibody to the tumor cells. The route of administration includes, but is not limited to, intravenous route, intraperitoneal route, intramuscular route, intratumoral route, intradermal route and the like. Treatment is typically typically about 0.1, 0.2, 0, 3, 0, 4, 0, 5, 0, 6, 0, 7, 0, 8, 0, 9, 1, 2. At doses in the range of 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 or 25 mg / kg body weight via an acceptable route of administration (eg, intravenous injection (IV)) Includes repeated administration of 98P4B6 antibody preparations. In general, doses ranging from 10 to 1000 mg mAb per week may be effective and well tolerated.

Based on clinical experiments using Herceptin ^™ mAb in the treatment of metastatic breast cancer, an initial loading dose of about 4 mg / kg patient weight (IV) of anti-98P4B6 mAb preparation was followed by a weekly dose of about 2 mg / kg (IV). The dose indicates an acceptable dosing regimen. Preferably, this initial loading dose is administered as a 90 minute or longer infusion. If the initial dose is well tolerated, a periodic maintenance dose is administered as an infusion over 30 minutes. As those skilled in the art will appreciate, a variety of factors can affect the ideal dosage regimen in a particular case. Such factors include, for example, the binding affinity and half-life of the Ab or mAb used, the extent of 98P4B6 expression in the patient, the degree of circulating 98P4B6 antigen, the desired steady state antibody Concentration levels, frequency of treatment, and the effects of chemotherapeutic drugs or other factors used in combination with the treatment methods of the present invention as well as the health status of a particular patient.

  If necessary, patients are evaluated for the level of 98P4B6 in a given sample (eg, the level of circulating 98P4B6 antigen and / or 98P4B6 expressing cells) to assist in determining the most effective dosing regimen, etc. Should. Such assessments are also used for monitoring purposes throughout the treatment, and other parameters such as urinary cytology and / or ImmunoCyt levels in bladder cancer treatment or, according to analogy, prostate cancer Useful for assessing therapeutic success in combination with assessing serum PSA levels in therapy.

  Anti-idiotype anti-98P4B6 antibodies can also be used as vaccines to induce an immune response against cells expressing 98P4B6-related proteins in anti-cancer therapy. In particular, the generation of anti-idiotype antibodies is well known in the art; this methodology can be readily adapted to generate anti-idiotype anti-98P4B6 antibodies that mimic epitopes on 98P4B6-related proteins (eg, Wagner et al., 1997, Hybridoma 16: 33-40; see Foon et al., 1995, J. Clin. Invest. 96: 334-342; Herlyn et al., 1996, Cancer Immunol. Immunother.43: 65-76). . Such anti-idiotype antibodies can be used in cancer vaccine strategies.

(XC) 98P4B6 as a target for cellular immune response)
Vaccines comprising an immunogenically effective amount of one or more HLA-binding peptides and methods of preparing the vaccines described herein are further embodiments of the invention. Furthermore, the vaccine according to the invention comprises a composition of one or more claimed peptides. The peptides can be present individually in the vaccine. Alternatively, the peptides can exist as homopolymers containing multiple copies of the same peptide or as heteropolymers of various peptides. The polymer has the advantage of increased immunological response, and when different peptide epitopes are used to make up the polymer, different antigenic determinants of pathogenic organisms or tumor-related peptides that target the immune response It has the additional ability to induce reactive antibodies and / or CTLs. The composition can be present in a naturally occurring region of the antigen or can be prepared, for example, by recombinant or chemical synthesis.

Carriers that can be used with the vaccines of the invention are well known to those skilled in the art and include, for example, thyroglobulin, albumin (eg, human serum albumin), tetanus toxoid, polyamino acids (eg, poly L-lysine, poly L-glutamic acid). , Influenza, hepatitis B virus core protein, and the like. The vaccine may include a physiologically acceptable (ie, acceptable) diluent (eg, water or saline, preferably phosphate-releasing saline). Vaccines also typically include an adjuvant. Adjuvants such as incomplete Freund's adjuvant, aluminum phosphate, aluminum hydroxide, or alum are examples of materials well known in the art. Furthermore, as disclosed herein, a CTL response conjugated a peptide of the invention to a lipid (eg, tripalmitoyl-S-glycerylcysteinyl seryl-serine (P ₃ CSS)). Can be primed. Furthermore, adjuvants (eg, synthetic cytosine-phosphorothiolated guanine-containing (CpG) oligonucleotides) were found to increase the CTL response by 10-100 fold (eg, Davila and Celis, J. Immunol. 165). : 539-547 (2000)).

  Upon immunization with a peptide composition according to the present invention by injection, aerosol, oral, transdermal, transmucosal, intrapleural, intrathecal, or other suitable route, the host immune system is specific for the desired antigen. It responds to the vaccine by producing large amounts of CTL and / or HTL. As a result, the host is at least partially immunized for the late development of cells that express or overexpress the 98P4B6 antigen, or if the antigen was tumor associated, leads to at least some therapeutic benefit.

In some embodiments, it may be desirable to combine a class I peptide component with a neutralizing antibody specific for the target antigen and / or a component that induces or promotes a helper T cell response. Preferred embodiments of such compositions comprise class I and class II epitopes according to the present invention. Alternative embodiments of such compositions include cross-reactive HTL epitopes (eg, PADRE ^™ (Epimmune, San Diego, CA) molecules (eg, described in US Pat. No. 5,736,142)). A class I epitope and / or a class II epitope according to the invention.

  The vaccines of the present invention can also include antigen presenting cells (APC) (eg, dendritic cells (DC)) as a vehicle for presenting the peptides of the present invention. After the dendritic cells are mobilized and collected, thereby creating a load of dendritic cells in vitro, a vaccine composition can be made in vitro. For example, dendritic cells are, for example, transfected with a minigene according to the invention or pulsed with a peptide. The dendritic cells can then be administered to the patient to elicit an immune response in vivo. Vaccine compositions (either DNA-based or peptide-based) can also be administered in vivo with dendritic cell mobilization, which causes dendritic cell loading in vivo.

  Preferably, the following principles are separate for inclusion in a polyepitope composition for use in a vaccine, or to be included in a vaccine and / or encoded by a nucleic acid (eg, a minigene) Used when selecting an array of epitopes to select epitopes. Each of the following principles is preferably balanced to make a selection: The multi-epitope incorporated into a given vaccine composition can be (but is not necessary) a contiguous sequence in the native antigen from which the epitope is derived.

  1. When administered, epitopes are selected that mimic the observed immune response in correlation with tumor clearance. For HLA class I, this includes 3-4 epitopes derived from at least one tumor associated antigen (TAA). Similar principles are used for HLA class II; again, 3-4 epitopes are selected from at least one TAA (see, eg, Rosenberg et al., Science 278: 1447-1450). Epitopes from one TAA can be used in combination with epitopes from one or more additional TAAs to produce vaccines that target tumors with various expression patterns of TAA that are frequently expressed.

2. ) Epitopes with the essential binding affinity established to be associated with immunogenicity are selected: IC _{50 of} 500 nM or less (often 200 nM or less) for HLA class I; and 1000 nM or less for class II IC ₅₀ .

  3. ) Sufficient supermotif-bearing peptides, or sufficient arrays of allele-specific motif-bearing peptides are selected to give a broad population range. For example, it is preferable to have a population range of at least 80%. Monte Carlo analysis (statistical assessments known in the art) can be used to assess the breadth or overlap of population ranges.

  4). ) When epitopes from cancer-associated antigens are selected, it is often useful to select an analog. This is because this patient can develop resistance to the native epitope.

  5). ) Of particular relevance are epitopes referred to as “nested epitopes”. A nested epitope occurs when at least two epitopes overlap with a given peptide sequence. The nested peptide sequence can comprise a B cell epitope, an HLA class I epitope and / or an HLA class II epitope. When providing nested epitopes, the general goal is to provide the highest number of epitopes per sequence. Thus, one aspect is to avoid providing peptides that are longer than the amino terminus of the amino terminal epitope and the carboxyl terminus of the carboxyl terminal epitope in the peptide. When providing multi-epitope sequences (eg, sequences containing nested epitopes), it is common to screen sequences to ensure that they do not have pathological or other harmful biological properties Is important to.

  6). ) When producing polyepitope proteins or minigenes, the goal is to produce the smallest peptide that contains the epitope of interest. This principle is similar if it is not the same as that used when selecting peptides containing nested epitopes. However, when using artificial polyepitope peptides, the objective of size minimization is balanced against the need to incorporate any spacer sequence between the epitopes in the polyepitope protein. For example, spacer amino acid residues may be used to avoid junctional epitopes (epitopes that are recognized by the immune system, are not present in the target antigen, and are only created by artificial juxtaposition of epitopes) or between epitopes It can be introduced to facilitate cleavage and thereby enhance epitope presentation. Junction epitopes should generally be avoided. This is because the recipient can generate an immune response against that non-native epitope. Of particular interest are junctional epitopes that are “dominant epitopes”. Dominant epitopes can lead to a strong response such that the immune response to other epitopes is reduced or suppressed.

  7). ) If there are diverse variant sequences of the same target protein, potential peptide epitopes can also be selected based on their conservation. For example, a criterion for conservation is that the entire sequence of HLA class I binding peptides or the entire 9-mer core of class II binding peptides is conserved at a specified percentage of the sequence evaluated for a particular protein antigen. Can be defined.

(X.C.1.) Minigene vaccine)
Many different approaches are available that allow simultaneous delivery of diverse epitopes. Nucleic acids encoding the peptides of the present invention are particularly useful embodiments of the present invention. The epitope for inclusion in the minigene is preferably selected according to the guidelines described in the previous section. A preferred means of administering a nucleic acid encoding a peptide of the invention uses a minigene construct that encodes a peptide comprising one epitope or multiple epitopes of the invention.

  The use of multi-epitope minigenes is described below and by Ishioka et al. Immunol. 162: 3915-3925, 1999; An, L .; And Whitton, J .; L. , J .; Virol. 71: 2292, 1997; Thomson, S .; A. Et al. Immunol. 157: 822, 1996; Whitton, J. et al. L. Et al. Virol. 67: 348, 1993; Hanke, R .; Et al., Vaccine 16: 426, 1998. For example, 98P4B6 derived supermotif-bearing epitope and / or multi-epitope DNA plasmid encoding motif-bearing epitope, PADRE® universal helper T cell epitope (or multiple HTL epitopes derived from 98P4B6) (eg, Tables VIII and XXII) ~ XLIX), and the endoplasmic reticulum translocation signal sequence can be manipulated. The vaccine may also include other TAA-derived epitopes.

  The immunogenicity of the multi-epitope minigene can be confirmed in transgenic mice to assess the magnitude of the CTL-induced response to the epitope being tested. Furthermore, the immunogenicity of DNA-encoded epitopes in vivo can correlate with the in vitro response of specific CTL lines to target cells transfected with a DNA plasmid. Thus, these experiments can show both that the minigene 1) helps to generate a CTL response, and 2) that the induced CTL recognized cells expressing the encoded epitope.

  For example, the amino acid sequence of an epitope can be back-translated to create a DNA sequence that encodes an epitope (minigene) selected for expression in human cells. A human codon usage table can be used to guide codon selection for each amino acid. These epitope-encoding DNA sequences can be directly adjacent, resulting in a continuous polypeptide sequence when translated. Additional elements can be incorporated into the minigene design to optimize expression and / or immunogenicity. Examples of amino acid sequences that can be back-translated into and included in a minigene sequence include: HLA class I epitope, HLA class II epitope, antibody epitope, ubiquitination signal sequence, and / or endoplasmic reticulum targeting signal. Furthermore, HLA presentation of CTL and HTL epitopes can be improved by including synthetic (eg, poly-alanine) or naturally occurring flanking sequences flanking the CTL or HTL epitope; these larger peptides containing the epitope Is within the scope of the present invention.

  Minigene sequences can be converted to DNA by assembling oligonucleotides that encode the plus and minus strands of the minigene. Overlapping oligonucleotides (30-100 bases long) can be synthesized, phosphorylated, purified, and annealed using well-known techniques and under appropriate conditions. The ends of the oligonucleotides can be joined using, for example, T4 DNA ligase. This synthetic minigene (encoding the epitope polypeptide) can then be cloned into the desired expression vector.

  Standard regulatory sequences well known to those skilled in the art are preferably included in the vector to ensure expression in the target cells. Several vector elements are desirable: a promoter with a downstream cloning site for minigene insertion; a polyadenylation signal for efficient transcription termination; E. coli origin of replication; E. coli selectable markers (eg ampicillin resistance or kanamycin resistance). A number of promoters can be used for this purpose, such as the human cytomegalovirus (hCMV) promoter. See, eg, US Pat. Nos. 5,580,859 and 5,589,466 for other suitable promoter sequences.

  Further vector modifications may be desired to optimize minigene expression and immunogenicity. In some cases, introns are required for efficient gene expression, and one or more synthetic or naturally occurring introns can be incorporated into the transcription region of the minigene. Inclusion of mRNA stabilizing sequences and sequences for replication in mammalian cells can also be considered to increase minigene expression.

  Once an expression vector is selected, the minigene is cloned into the polylinker region downstream of the promoter. This plasmid is suitable E. coli. E. coli strains are transformed and DNA is prepared using standard techniques. The orientation and DNA sequence of the minigene and all other elements contained in the vector are confirmed using restriction mapping and DNA sequence analysis. Bacterial cells with the correct plasmid can be stored as a master cell bank and a working cell bank.

  Furthermore, immunostimulatory sequences (ISS or CpG) appear to play a role in the immunogenicity of DNA vaccines. These sequences can be included in the vector outside the minigene coding sequence if it is desired to enhance immunogenicity.

In some embodiments, a bi-cistronic expression vector is used that allows for the production of both a minigene-encoded epitope and a second protein (included to enhance or decrease immunogenicity). obtain. Examples of proteins or polypeptides that can advantageously enhance the immune response when co-expressed include cytokines (eg, IL-2, IL-12, GM-CSF), cytokine-inducing molecules (eg, LeIF), co- For stimulatory molecules or HTL responses, pan-DR binding proteins (PADRE ^™ , Epimmune, San Diego, CA) are included. Helper (HTL) epitopes can be bound to intracellular targeting signals and can be expressed separately from expressed CTL epitopes; this allows the orientation of HTL epitopes to a different cellular compartment than the CTL epitope To do. If required, this can facilitate more efficient entry of HTL epitopes into the HLA class II pathway, thereby improving HTL induction. In contrast to HTL induction or CTL induction, specifically reducing the immune response by co-expression of an immunosuppressive molecule (eg, TGF-β) may be beneficial in certain diseases.

  A therapeutic amount of plasmid DNA is described, for example, in E. coli. It can be produced by fermentation in E. coli followed by purification. An aliquot from the working cell bank is used to inoculate the growth medium and grown to saturation in a shaker flask or bioreactor according to well known techniques. Plasmid DNA is available from QIAGEN, Inc. It can be purified using standard bioseparation techniques such as solid phase anion exchange resins supplied by (Valencia, California). If necessary, supercoiled DNA can be isolated from open and linear forms using gel electrophoresis or other methods.

  Purified plasmid DNA can be prepared for injection using a variety of formulations. The simplest of these is the reconstitution of lyophilized DNA in sterile phosphate buffered saline (PBS). This approach (known as “naked DNA”) is currently used for intramuscular (IM) administration in clinical trials. Alternative methods for formulating purified plasmid DNA may be desirable in order to maximize the immunotherapeutic effect of the minigene DNA vaccine. Various methods have been described and new techniques can be made available. Cationic lipids, glycolipids, and fusogenic liposomes can also be used in the formulation (eg, WO 93/24640; Mannino & Gold-Fogate, BioTechniques 6 (7): 682 (1988); US Patents). No. 5,279,833; WO 91/06309; and Felgner et al., Proc. Nat'l Acad. Sci. USA 84: 7413 (1987)). In addition, peptides and compounds collectively referred to as protective interactive non-condensing compounds (PINCs) may also affect variables such as stability, intramuscular dispersibility, or transport to specific organs or cell types. Alternatively, it can be complexed to purified plasmid DNA.

Target cell sensitization can be used as a functional assay for expression and HLA class I presentation of minigene-encoded CTL epitopes. For example, plasmid DNA is introduced into a mammalian cell line suitable as a target for a standard CTL chromium release assay. The transfection method used will depend on the final formulation. Electroporation can be used for “naked” DNA, but cationic lipids allow direct in vitro transfection. A plasmid expressing green fluorescent protein (GFP) can be co-transfected using a fluorescent cell separation analyzer (FACS) to allow enrichment of the transfected cells. These cells can then chrome ^{-51 (51} Cr) labeled and used as target cells for epitope-specific CTL lines; ^(detected by a 51 Cr release) cell lysis, the minigene encoding CTL epitope Both production and HLA presentation are shown. Expression of HTL epitopes can be assessed in a similar manner using an assay to assess HTL activity.

In vivo immunogenicity is a second approach for functional testing of minigene DNA formulations. Transgenic mice expressing the appropriate human HLA protein are immunized with the DNA product. The dose and route of administration will depend on the formulation (eg, IM for DNA in PBS, intraperitoneal (ip) for lipid complexed DNA). After 21 days of immunization, splenocytes are collected and restimulated for 1 week in the presence of peptides encoding each epitope to be tested. The CTL effector cells are then assayed for cytolysis of peptide-loaded ⁵¹ Cr labeled target cells using standard techniques. Lysis of target cells sensitized by HLA loaded with peptide epitopes corresponding to minigene-encoded epitopes demonstrates DNA vaccine function for in vivo introduction of CTL. The immunogenicity of the HTL epitope is confirmed in transgenic mice in a similar manner.

  Alternatively, the nucleic acid can be administered using ballistic delivery, eg, as described in US Pat. No. 5,204,253. Using this technique, particles composed solely of DNA are administered. In a further alternative embodiment, the DNA can be attached to particles (eg, gold particles).

  Minigenes can also be delivered using other bacterial or viral delivery systems well known in the art (eg, an expression construct encoding an epitope of the invention can be incorporated into a viral vector such as vaccinia. ).

(X.C.2.) Combination of CTL peptide and helper peptide)
Vaccine compositions comprising CTL peptides of the present invention are modified (eg, analogs) to provide the desired properties (eg, improved serum half-life, extended population coverage, or enhanced immunogenicity). ).

  For example, the ability of a peptide to induce CTL activity can be enhanced by linking the peptide to a sequence comprising at least one epitope that can induce a T helper cell response. CTL peptides can be linked directly to T helper peptides, but often CTL epitope / HTL epitope conjugates are linked by a spacer molecule. The spacer is typically composed of a relatively small neutral molecule (eg, an amino acid or amino acid mimetic) that is substantially uncharged under physiological conditions. This spacer is typically selected from, for example, Ala, Gly, or other neutral spacers of nonpolar or neutral polar amino acids. It is understood that the optional spacers need not be composed of the same residues, and thus can be hetero-oligomers or homo-oligomers. When present, the spacer is usually at least one or two residues, more usually 3 to 6 residues, sometimes 10 or more residues. The CTL peptide epitope can be linked to the T helper peptide, either directly or through a spacer, at either the amino terminus or the carboxy terminus of the CTL peptide. The amino terminus of either the immunogenic peptide or the T helper peptide can be acylated.

  In certain embodiments, T helper peptides are peptides that are recognized by T helper cells that are present in the majority of genetically diverse populations. This can be accomplished by selecting peptides that bind to many, most, or all HLA class II molecules. Examples of such amino acids that bind to many HLA class II molecules are the Tetanus toxin 830-843 positions QYIKANSKFIGITE (SEQ ID NO: 97), Plasmodium falciparum circumsporozoite (CS) SKNVSKNVSKV No. 98), and sequences from antigens such as Streptococcus 18 kD protein at positions 116-131 GAVDSILGGVATYGAA (SEQ ID NO: 99). Other examples include peptides having either the DR 1-4-7 supermotif or the DR3 motif.

Alternatively, amino acid sequences not found in nature can be used to prepare synthetic peptides that can stimulate T helper lymphocytes in a loose HLA-restricted fashion (eg, PCT publication). (See WO95 / 07707). These synthetic compounds, called Pan-DR binding epitopes (eg PADRE ^™ , Epimmune, Inc., San Diego, Calif.) Are designed to bind most favorably to most HLA-DR (human HLA class II) molecules. Is done. For example, the formula: XKXVAAWTLKAAX (SEQ ID NO: 100), where “X” is either cyclohexylalanine, phenylalanine, or tyrosine, and a is either D-alanine or L-alanine. It has been found that the pan-DR binding epitope peptides that bind to most HLA-DR alleles and stimulate the response of T helper lymphocytes from most individuals, regardless of their HLA type. It was. Alternatives to pan-DR binding epitopes all include the “L” natural amino acid and can be provided in the form of nucleic acids encoding the epitope.

  HTL peptide epitopes can also be modified to alter their biological properties. For example, they can be modified to include D-amino acids to increase their resistance to proteases and thus increase their serum half-life, or they increase their biological activity. Can be conjugated to other molecules such as lipids, proteins, carbohydrates and the like. For example, a T helper peptide can be conjugated to one or more palmitic acids, either at the amino terminus or the carboxyl terminus.

(XC.3.) Combination of CTL peptide and T cell priming agent)
In some embodiments, it may be desirable to include in the pharmaceutical composition of the invention at least one component that primes B lymphocytes or T lymphocytes. Lipids have been identified as factors that can prime CTL in vivo. For example, palmitic acid residues can be linked to the ε-amino and α-amino groups of lysine residues, and then one or more linkages such as, for example, Gly, Gly-Gly, Ser, Ser-Ser, etc. It can be linked to an immunogenic peptide via a residue. The lipidated peptide can then be administered directly in micelles or particles, incorporated into liposomes, or emulsified in an adjuvant (eg, incomplete Freund's adjuvant). In a preferred embodiment, a particularly effective immunogenic composition comprises palmitic acid attached to the ε-amino and α-amino groups of Lys (which is linked to the amino terminus of the immunogenic peptide (eg, Ser- Ser)).

As another example of lipid priming of a CTL response, E. coli lipoproteins (eg, tripalmitoyl-S-glyceryl cysteinyl seryl-serine (P ₃ CSS)) can be used to prime virus specific CTLs when covalently attached to the appropriate peptide (eg, Deres et al., Nature 342: 561, 1989). The peptides of the invention can be conjugated, for example, to P ₃ CSS, and the lipopeptide can be administered to an individual to specifically prime an immune response to a target antigen. In addition, since the introduction of neutralizing antibodies can also be primed with a P ₃ CSS binding epitope, two such compositions can be combined to elicit both humoral and cell-mediated responses more efficiently. Can be.

(XC.4.) Vaccine composition comprising DC pulsed with CTL peptide and / or HTL peptide)
Embodiments of vaccine compositions according to the present invention include ex vivo administration of a cocktail of epitope-bearing peptides to PBMC from patient blood, or isolated DCs derived therefrom. Drugs that facilitate DC collection, such as Progenipoietin ^™ (Pharmacia-Monsanto, St. Louis, MO) or GM-CSF / IL-4, can be used. After DC is pulsed with peptide and before reinfusion into the patient, the DC is washed to remove unbound peptide. In this embodiment, the vaccine comprises peptide-pulsed DC presenting a pulsed peptide epitope complexed with HLA molecules on their surface.

  DC can be pulsed ex vivo with a cocktail of peptides, some of which stimulate a CTL response to 98P4B6. If desired, helper T cell (HTL) peptides (eg, natural or artificial loosely restricted HLA class II peptides) can be included to promote CTL responses. Thus, the vaccine according to the invention is used to treat cancers that express or overexpress 98P4B6.

(X.D.) Adoptive immunotherapy)
Antigenic 98P4B6-related peptides are used to elicit CTL and / or HTL responses ex vivo. CTL cells or HTL cells obtained according to the present invention can be used to treat tumors in patients who do not respond to other conventional forms of therapy or do not respond to therapeutic vaccine peptides or nucleic acids. An ex vivo CTL response or HTL response to a particular antigen is expressed in a tissue culture by replacing the patient's or genetically compatible CTL or HTL progenitor cells with antigen presenting cells (APCs) (eg, dendritic cells). Induced by incubating with the source and the appropriate immunogenic peptide. After an appropriate incubation time (typically about 7-28 days) (where progenitor cells are activated and proliferate into effector cells), the cells are returned to the patient by infusion, where these Destroys (CTL) or promotes destruction (HTL) of specific target cells (eg, tumor cells). Transfected dendritic cells can also be used as antigen presenting cells.

(X.E.) Administration of vaccines for therapeutic or prophylactic purposes)
The pharmaceutical and vaccine compositions of the invention are typically used to treat and / or prevent cancers that express or overexpress 98P4B6. In therapeutic applications, the peptide composition and / or nucleic acid composition elicits an effective B cell response, CTL response and / or HTL response to the antigen and cures or at least partially the symptoms and / or complications. Is administered to the patient in an amount sufficient to stop or delay. An amount adequate to accomplish this is defined as a “therapeutically effective dose”. Effective amounts for this use will depend, for example, on the particular composition being administered, the method of administration, the stage and severity of the disease being treated, the weight and general state of the patient, and the judgment of the prescribing physician. .

  For pharmaceutical compositions, the immunogenic peptides of the invention, or the DNA encoding them, are generally administered to an individual who already has a tumor that expresses 98P4B6. The peptides or the DNA encoding them can be administered individually or as a fusion with one or more peptide sequences. Patients can be treated with immunogenic peptides separately or in conjunction with other treatments (eg, surgery) as appropriate.

  For therapeutic use, administration should generally begin in the first diagnosis of 98P4B6-related cancer. This will continue to boost the dose at least until symptoms are substantially stopped and for a period thereafter. Embodiments of vaccine compositions delivered to patients (ie, such as but not limited to peptide cocktails, polyepitope polypeptides, minigenes, or TAA-specific CTLs or pulsed dendritic cells) Not) can vary according to the stage of the disease or the health status of the patient. For example, in patients with tumors that express 98P4B6, vaccines comprising 98P4B6 specific CTLs may be more effective at killing tumor cells in patients with advanced disease than alternative embodiments.

  It is generally important to provide an amount of peptide epitope delivered by a mode of administration sufficient to efficiently stimulate a cytotoxic T cell response; a composition that stimulates a helper T cell response is also Can be provided according to this embodiment of the present invention.

  Dosages for initial therapeutic immunization generally have a lower limit of about 1 μg, 5 μg, 50 μg, 500 μg, or 1,000 μg and an upper limit of about 10,000 μg; 20,000 μg; 30 Present in a unit dose range that is 50,000 μg; or 50,000 μg. Dosage values for humans typically range from about 500 μg to about 50,000 μg per 70 kg patient. According to a boost regimen over weeks to months, a boost dosage of between about 1.0 μg to about 50,000 μg of peptide is determined by measuring the specific activity of CTL and HTL obtained from the patient's blood Depending on the patient's response and condition. Administration should continue until at least clinical symptoms or laboratory tests indicate that neoplasia is eliminated or reduced and then for a period of time. Dosages, routes of administration, and dosage schedules are adjusted according to methodologies known in the art.

  In certain embodiments, the peptides and compositions of the invention are used in severe disease states (ie, life-threatening or potentially life-threatening conditions). In such cases, the preferred composition of the present invention has a substantial excess compared to these stated dosages as a result of the minimal amount of extraneous material and the relatively non-toxic nature of the peptide. Of these peptide compositions can be administered and may be desirable by the treating physician.

  The vaccine composition of the present invention can also be used purely as a prophylactic agent. In general, dosages for initial prophylactic immunization are generally low values of about 1, 5, 50, 500 or 1000 μg and high values of about 10,000; 20,000; 30,000; or 50 Present in a unit dosage range that is 1,000,000 μg. Dosage values for humans typically range from about 500 μg to about 50,000 μg per 70 kg patient. This is followed by a boost dosage of between about 1.0 μg and about 50,000 μg of peptide at defined intervals about 4 weeks to 6 months after the initial vaccine administration. The immunogenicity of a vaccine can be assessed by measuring the specific activity of CTL and HTL obtained from a patient blood sample.

  Pharmaceutical compositions for therapeutic treatment are parenteral, topical, oral, nasal, intrathecal, or local (e.g., Intended as a cream or topical ointment). Preferably, the pharmaceutical composition is administered parenterally (eg intravenously, subcutaneously, intradermally or intramuscularly). Accordingly, the present invention provides a composition for parenteral administration comprising a solution of an immunogenic peptide dissolved or suspended in an acceptable carrier (preferably an aqueous carrier).

  A variety of aqueous carriers can be used (eg, water, buffered water, 0.8% saline, 0.3% glycine, hyaluronic acid, etc.). These compositions can be sterilized by conventional, well-known sterilization techniques, or can be sterile filtered. The resulting aqueous solution can be packaged as is for use or lyophilized (the lyophilized preparation is combined with a sterile solution prior to administration).

  This composition may be pharmaceutically acceptable auxiliary substances (eg, pH and buffering agents, tonicity adjusting agents, wetting agents, preservatives, etc.) as necessary to approximate physiological conditions (eg, , Sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, sorbitan monolaurate, triethanolamine oleate, and the like)).

  The concentration of the peptide of the invention in the pharmaceutical formulation can vary widely (ie, from less than about 0.1% by weight, usually from about 2%, or at least from about 2%, from 20% to 50%. And so on) and is selected primarily by fluid volume, viscosity, etc., according to the particular mode of administration selected.

The human unit dose form of the composition is typically included in a pharmaceutical composition comprising a human unit dose of an acceptable carrier (in one embodiment, an aqueous carrier), and such composition to humans. Volumes known to those skilled in the art to be used for administration of products (see, eg, Remington's Pharmaceutical Sciences, 17th Edition, Editor A. Gennaro, Mack Publishing Co., Easton, Pennsylvania, 1985). / Dose. For example, the peptide dose for the first immunization may be about 1 to about 50,000 μg, generally 100 to 5,000 μg, for a 70 kg patient. For example, for nucleic acids, the initial immunization can be performed using the expression vector in the form of naked nucleic acid and can be administered IM (or SC or ID) in multiple sites in an amount of 0.5-5 mg. Nucleic acids (0.1-1000 μg) can also be administered using a gene gun. After a 3-4 week incubation period, a booster dose is then administered. The booster can be a recombinant fowlpox virus administered at a dose of 5 × 10 ^{7 to} 5 × 10 ⁹ pfu.

For antibodies, treatment is generally via an acceptable route of administration, such as intravenous injection (IV), typically at a dose in the range of about 0.1 to about 10 mg / kg body weight, and an anti-98P4B6 antibody preparation. Is repeatedly administered. In general, doses in the range of 10-500 mg mAb per week are effective and well tolerated. Further, an anti-98P4B6 mAb preparation given at an initial loading dose of about 4 mg / kg patient body weight IV, followed by weekly IV doses of about 2 mg / kg represents an acceptable dosing regimen. As will be appreciated by those skilled in the art, various factors can affect the ideal dosage in a particular case. Such factors include, for example, the half-life of the composition, the binding affinity of the Ab, the immunogenicity of the substance, the degree of expression of 98P4B6 in the patient, the degree of circulating shed 98P4B6 antigen desired Examples include steady state concentration levels, frequency of treatment, and the effects of chemotherapeutic or other agents used in combination with the treatment methods of the invention, and the health status of a particular patient. Non-limiting preferred human unit doses are, for example, 500 μl to 1 mg, 1 mg to 50 mg, 50 mg to 100 mg, 100 mg to 200 mg, 200 mg to 300 mg, 400 mg to 500 mg, 500 mg to 600 mg, 600 to 700 mg, 700 mg to 800 mg, 800 mg -900 mg, 900 mg-1 g, or 1 mg-700 mg. In certain embodiments, the dosage ranges from 2-5 mg / kg body weight (eg, 1-3 mg / kg weekly dose); 0.5 mg, 1, 2, 3, 4, 5, 6 , 7, 8, 9, 10 mg / kg body weight (eg 2, 3, or 4 weeks at weekly doses; 0.5-10 mg / kg body weight (eg 2, 3, or 4 weeks at weekly doses; weekly body Range 225, 250, 275, 300, 325, 350, 375, 400 mg m ² ; weekly body range 1-600 mg m ² ; weekly body range 225-400 mg m ² ; these are 2, 3, 4 May be followed by weekly doses for 5, 6, 7, 8, 9, 19, 11, 12 or more weeks.

  In one embodiment, the human unit dosage form of the polynucleotide comprises a suitable dosage range or effective amount that provides any therapeutic effect. As will be appreciated by those skilled in the art, the therapeutic effect depends on a number of factors including the sequence of the polynucleotide, the molecular weight of the polynucleotide, and the route of administration. The dosage is generally selected by a physician or other medical professional according to various parameters known in the art, such as the severity of the symptoms, the patient's medical history, and the like. In general, for polynucleotides of about 20 bases, the dosage ranges are, for example, about 0.1, 0.25, 0.5, 1, 2, 5, 10, 20, 30, 40, 50, 60. , 70, 80, 90, 100, 200, 300, 400 or 500 mg / kg, from an independently selected lower limit to about 60, 80, 100, 200, 300, 400, 500, It can be selected from up to an independently selected upper limit of 750, 1000, 1500, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000 or 10,000 mg / kg. For example, the dose can be almost any of the following: 0.1-100 mg / kg, 0.1-50 mg / kg, 0.1-25 mg / kg, 0.1-10 mg / kg, 1-500 mg / kg kg, 100-400 mg / kg, 200-300 mg / kg, 1-100 mg / kg, 100-200 mg / kg, 300-400 mg / kg, 400-500 mg / kg, 500-1000 mg / kg, 500-5000 mg / kg, Or 500-10,000 mg / kg. In general, parenteral routes of administration may require higher doses of polynucleotide compared to more direct polynucleotide application to diseased tissue (when done with increasing lengths of polynucleotide). .

In one embodiment, the human unit dosage form of T cells comprises an appropriate dosage range or effective amount that provides any therapeutic effect. As will be appreciated by those skilled in the art, the therapeutic effect depends on a number of factors. The dosage is generally selected by a physician or other medical professional according to various parameters known in the art, such as the severity of the symptoms, the patient's medical history, and the like. The dose can be from about 10 ⁴ cells to about 10 ⁶ cells, from about 10 ⁶ cells to about 10 ⁸ cells, from about 10 ⁸ cells to about 10 ¹¹ cells, or from about 10 ⁸ cells to about 5 × 10 ¹⁰ cells. The dose can also be about 10 ⁶ cells / m ² to about 10 ¹⁰ cells / m ² , or about 10 ⁶ cells / m ² to about 10 ⁸ cells / m ² .

  The protein (s) of the invention and / or nucleic acids encoding the protein (s) can also be administered via liposomes, which can also serve for: 1) the lymphatic system Targeting protein (s) to a specific tissue, such as a tissue; 2) selective targeting to diseased cells; or 3) increasing the half-life of the peptide composition. Liposomes include emulsions, foams, micelles, insoluble monolayers, liquid crystals, phospholipid dispersions, layered layers, and the like. In these preparations, the peptide to be delivered is either alone or in combination with a molecule that binds to a receptor that is prevalent in lymphoid cells (eg, a monoclonal antibody that binds to the CD45 antigen) or other therapeutic composition. In combination with a product or immunogenic composition. Thus, liposomes that are either loaded or applied with the desired peptide of the invention can be directed to the site of lymphoid cells, which then deliver the peptide composition to the lymphoid cells. To do. Liposomes for use in accordance with the present invention are formed from standard vesicle-forming lipids, which generally include neutral and negatively charged phospholipids, and sterols (eg, cholesterol). The choice of lipid is generally guided by considerations of, for example, liposome size, acid instability, and liposome stability in the bloodstream. For preparing liposomes, see, for example, Szoka et al., Ann. Rev. Biophys. Bioeng. 9: 467 (1980) and U.S. Pat. Nos. 4,235,871, 4,501,728, 4,837,028, and 5,019,369. In addition, various methods can be used.

  In order to target cells of the immune system, the ligand to be incorporated into the liposome can include, for example, an antibody or fragment thereof specific for the cell surface determinant of the desired immune system cell. Liposomal suspensions containing peptides can be administered intravenously, locally, topically, etc., in particular at doses that vary according to the mode of administration, the peptide to be delivered, and the stage of the disease being treated.

  For solid compositions, conventional non-toxic solid carriers can be used, such as pharmaceutical grade mannitol, lactose, starch, magnesium stearate, sodium saccharin, talc, cellulose, glucose, sucrose, magnesium carbonate Etc. For oral administration, a pharmaceutically acceptable non-toxic composition will generally be 10-95% active with any commonly used excipient, such as the carriers listed above. Formed by incorporating an ingredient (ie one or more peptides of the invention) and more preferably an active ingredient at a concentration of 25% to 75%.

  For aerosol administration, the immunogenic peptide is preferably supplied in finely divided form with a surfactant and a propellant. A typical percentage of peptides is about 0.01% to 20% by weight, preferably about 1% to 10%. Of course, the surfactant must be non-toxic and preferably soluble in the propellant. Representative examples of such agents are fatty acids containing about 6-22 carbon atoms with aliphatic polyhydric alcohols or cyclic anhydrides thereof (eg, caproic acid, octanoic acid, lauric acid, palmitic acid, stearic acid). , Linoleic acid, linolenic acid, olesteric acid, and oleic acid) and partial esters. Mixed esters such as mixed glycerides or natural glycerides can be used. The surfactant may constitute about 0.1% to 20% by weight of the composition, preferably about 0.25 to 5%. The remainder of the composition is usually a propellant. A carrier may also be included if desired, such as in the case of lecithin for intranasal delivery.

(XI.) 98P4B6 Diagnostic and Prognostic Embodiments)
As disclosed herein, 98P4B6 polynucleotides, 98P4B6 polypeptides, 98P4B6 reactive cytotoxic T cells (CTL), 98P4B6 reactive helper T cells (HTL) and anti-polypeptide antibodies are Conditions associated with dysregulated cell growth, such as cancers listed in Table I (eg, specific patterns of their tissue expression, and eg, “analysis of 98P4B6 in normal tissues and patient specimens” Used in well-known diagnostic, prognostic, and therapeutic assays to test both for its overexpression in specific cancers as described in the examples entitled The

  98P4B6 can be similar to PSA, a prostate-related antigen. PSA is a prototype marker that has been used by healthcare professionals for several years to identify and monitor the presence of prostate cancer (eg, Merrill et al., J. Urol. 163 (2): 503-5120 (2000). Polasik et al., J. Urol. Aug; 162 (2): 293-306 (1999) and Fortier et al., J. Nat. Cancer Inst. 91 (19): 1635-1640 (1999)). A variety of other diagnostic markers are also used under similar circumstances, including p53 and K-ras (eg, Tulckinsky et al., Int J Mol Med 1999 Jul 4 (1): 99-102 and Minimoto). Et al., Cancer Detect Prev 2000; 24 (1): 1-12). Thus, with this disclosure regarding 98P4B6 polynucleotides and 98P4B6 polypeptides (as well as 98P4B6 polynucleotide probes and anti-98P4B6 antibodies used to identify the presence of these molecules) and their properties, one skilled in the art was used. These molecules can be utilized in a manner similar to that (eg, in various diagnostic assays relating to testing conditions associated with cancer).

  Exemplary embodiments of diagnostic methods utilizing 98P4B6 polynucleotide, 98P4B6 polypeptide, 98P4B6 reactive T cells and antibodies include, for example, PSA polynucleotides, PSA polypeptides and PSA reactive T cells and antibodies. Similar to methods from well-established diagnostic assays used. For example, in methods of monitoring PSA overexpression or prostate cancer metastasis, to observe the presence and / or level of PSA mRNA, just a PSA polynucleotide can be detected in a probe (eg, Northern analysis (eg, Sharief et al., Biochem.Mol.Biol.Int.33 (3): 567-74 (1994))) and primers (eg, in PCR analysis (eg, Okegawa et al., J. Urol.163 (4): 1189-). 1190 (2000)))), the 98P4B6 polynucleotides described herein detect 98P4B6 overexpression or metastasis of prostate cancer and other cancers that express this gene. Can be utilized in the same manner. Alternatively, just the PSA polypeptide is used to generate an antibody specific for PSA, and then this antibody can be expressed by overexpression of the PSA protein (eg, Stephan et al., Urology 55 (4): 560-3 (2000)). The presence and / or level of PSA protein in methods of monitoring metastasis of prostate cells (see, eg, Alanen et al., Pathol. Res. Pract. 192 (3): 233-7 (1996)). The 98P4B6 polypeptides described herein are used in detecting 98P4B6 overexpression or metastasis of prostate cells and other cancer cells that express this gene. Can be used to generate antibodies for

  Specifically, because metastasis involves the migration of cancer cells from the original organ (eg, lung or prostate) to a different area of the body (eg, lymph nodes), the 98P4B6 polynucleotide and / or 98P4B6 polypeptide Assays that test biological samples for the presence of expressing cells can be used to provide evidence of metastasis. For example, a biological sample from a tissue that normally does not contain 98P4B6-expressing cells (lymph node) appears to be 98P4B6 expression found in LAPC4 and LAPC9 (xenografts isolated from lymph node and bone metastasis, respectively). If found to contain 98P4B6 expressing cells, this finding indicates metastasis.

  Alternatively, the 98P4B6 polynucleotide and / or the 98P4B6 polypeptide may, for example, have cells in a biological sample that normally do not express 98P4B6 or express 98P4B6 at different levels, express 98P4B6 or increase expression of 98P4B6. Can be used to provide evidence of cancer if found to have (see, eg, 98P4B6 expression in cancers listed in Table I and patient samples shown in the accompanying drawings) . In such assays, one of skill in the art can provide additional evidence for metastasis by testing biological samples (in addition to 98P4B6) for the presence of a second tissue restriction marker (eg, PSA, PSCA, etc.). It may be further desired to produce (see, for example, Alanen et al., Pathol. Res. Pract. 192 (3): 233-237 (1996)).

  98P4B6 polynucleotide fragments and 98P4B6 polynucleotide variants are used in a similar manner, just as PSA polynucleotide fragments and PSA polynucleotide variants are utilized by those skilled in the art for use in methods of monitoring PSA. . In particular, typical PSA polynucleotides used in methods for monitoring PSA are probes or primers composed of fragments of PSA cDNA sequences. Taking this as an example, the primer used to PCR amplify a PSA polynucleotide must contain a sequence that is shorter than the entire PSA sequence in order to function in the polymerase chain reaction. In the context of such a PCR reaction, one of ordinary skill in the art generally creates a variety of different polynucleotide fragments that can be used as primers to amplify different portions of the polynucleotide of interest or to optimize the amplification reaction. (See, eg, Caetano-Anoles, G. Biotechniques 25 (3): 472-476, 478-480 (1998); Robertson et al., Methods Mol. Biol. 98: 121-154 (1998)). A further illustration of the use of such a fragment is provided in the example titled “Expression analysis of 98P4B6 in normal tissues and patient subjects”, wherein the 98P4B6 polynucleotide fragment is 98P4B6 in cancer cells. Used as a probe to show RNA expression. In addition, variant polynucleotide sequences are typically used as primers and probes for the corresponding mRNA in PCR and Northern analysis (eg, Sawai et al., Fetal Diagnostic. Ther. 1996 Nov-Dec; 11 ( 6): 407-13 and Current Protocols In Molecular Biology, Volume 2, Unit 2, Frederick M. Ausubel et al., 1995). Polynucleotide fragments and variants are useful in situations where they can bind to a target polynucleotide sequence (eg, a 98P4B6 polynucleotide shown in FIG. 2 or a variant thereof) under high stringency conditions.

  In addition, PSA polypeptides comprising an epitope that can be recognized by an antibody or T cells that specifically bind to that epitope are used in methods of monitoring PSA. 98P4B6 polypeptide fragments, and 98P4B6 polypeptide analogs or variants can also be used in a similar manner. This practice of generating antibodies (eg, anti-PSA antibodies or T cells) using polypeptide fragments or polypeptide variants is well known in the art with a wide variety of systems such as fusion proteins used by practitioners. It is representative in the art (see, eg, Current Protocols in Molecular Biology, Volume 2, Unit 16, edited by Frederick M. Ausubel et al., 1995). In this situation, each epitope or epitopes functions to provide a structure that is reactive with antibodies or T cells. Typically, those skilled in the art generate a variety of different polypeptide fragments that can be used to generate an immune response specific for different portions of the polypeptide of interest (see, eg, US Pat. No. 5,840,501). And U.S. Pat. No. 5,939,533). For example, utilizing a polypeptide comprising one of the motif-bearing subsequences readily identified by one of ordinary skill in the art based on the 98P4B6 biological motifs discussed herein or motifs available in the art May be preferred. Polypeptide fragments, variants or analogs are typically as long as they contain an epitope capable of generating antibodies or T cells specific for the target polypeptide sequence (eg, 98P4B6 polypeptide shown in FIG. 3), Useful in this situation.

  As shown herein, 98P4B6 and 98P4B6 polypeptides (and 98P4B6 polynucleotide probes and anti-98P4B6 antibodies or T cells used to identify the presence of these molecules) are listed in Table I. It shows the specific properties that make them useful in diagnosing cancers such as those listed. Diagnostic assays that measure the presence of the 98P4B6 gene product to assess the presence or development of the disease states described herein, such as prostate cancer, appear to be very successful using PSA. And used to identify patients for prophylactic measurement or further monitoring. Furthermore, these substances cannot be made, for example, with a clear diagnosis of metastases of prostate origin based on testing for PSA alone (eg, Alanen et al., Pathol. Res. Pract. 192 (3): 233-237 ( 1996) and, as a result, substances such as 98P4B6 and 98P4B6 polypeptides (and 98P4B6 polynucleotide probes and anti-98P4B6 antibodies used to identify the presence of these molecules) In situations where it is necessary to be used to confirm metastases of prostate origin, the need in the art for molecules with similar or complementary characteristics to PSA is met.

  Finally, in addition to their use in diagnostic assays, the 98P4B6 polynucleotides disclosed herein are chromosomal regions to which the 98P4B6 gene is mapped (the following implementation titled “Chromosome Mapping of 98P4B6”). It has many other uses, such as their use in identifying oncogene-related chromosomal abnormalities in (see examples). Furthermore, in addition to their use in diagnostic assays, the 98P4B6-related proteins and 98P4B6-related polynucleotides disclosed herein have other utilities such as their use in forensic analysis of tissues of unknown origin. (See, for example, Takahama K Forensic Sci Int 1996 Jun 28; 80 (1-2): 63-9).

  Furthermore, the 98P4B6-related proteins or 98P4B6-related polynucleotides of the present invention may be used to treat pathological conditions characterized by overexpression of 98P4B6. For example, the amino acid sequence or nucleic acid sequence of FIG. 2 or FIG. 3, or any fragment can be used to generate an immune response against the 98P4B6 antigen. Antibodies or other molecules reactive with 98P4B6 can be used to modulate the function of this molecule, thereby providing a therapeutic benefit.

(XII.) Inhibition of 98P4B6 protein function)
The present invention provides various methods and compositions for inhibiting the binding of 98P4B6 to its binding partner or for inhibiting its binding to other protein (s) and to inhibit the function of 98P4B6. Including methods.

(XII.A.) Inhibition of 98P4B6 using intracellular antibodies)
In one approach, a recombinant vector encoding a single chain antibody that specifically binds to 98P4B6 is introduced into cells expressing 98P4B6 via gene transfer techniques. Thereby, the encoded single chain anti-98P4B6 antibody is expressed intracellularly, binds to the 98P4B6 protein, and thereby inhibits its function. Methods for manipulating such intracellular single chain antibodies are well known. Such intracellular antibodies (also known as “intrabodies”) are specifically targeted to specific compartments within the cell and provide control over where the inhibitory activity of the treatment is focused. . This technique has been successfully applied in the art (for review, see Richardson and Marasco, 1995, TIBTECH, Volume 13). Intrabodies have been shown to substantially eliminate the expression of other abundant cell surface receptors (eg, Richardson et al., 1995, Proc. Natl. Acad. Sci. USA 92: 3137-3141; Beerli et al. 1994, J. Biol. Chem. 289: 23931-23936; Desane et al., 1994, Gene Ther. 1: 332-337).

  Single chain antibodies comprise heavy and light chain variable domains joined by a flexible linker polypeptide and are expressed as a single polypeptide. If desired, single chain antibodies are expressed as single chain variable region fragments linked to their light chain constant regions. Well-known intracellular transport signals are engineered into recombinant polynucleotide vectors encoding such single chain antibodies to accurately target the internal antibody to the desired intracellular compartment. For example, an internal antibody targeted to the endoplasmic reticulum (ER) is engineered to incorporate a leader peptide and, optionally, a C-terminal ER retention signal (eg, a KDEL amino acid motif). An internal antibody that is intended to exert activity in the nucleus is engineered to contain a nuclear localization signal. A lipid moiety is linked to the internal antibody to connect it to the cytosolic side of the plasma membrane. Intrabodies can also be targeted to exert function in the cytosol. For example, cytosolic internal antibodies are used to sequester factors within the cytosol, thereby preventing them from being transported to their natural destination in the cell.

  In one embodiment, an internal antibody is used to capture 98P4B6 in the nucleus, thereby preventing its activity in the nucleus. A nuclear targeting signal is engineered into such 98P4B6 internal antibody to achieve the desired targeting. Such 98P4B6 internal antibodies are designed to specifically bind to a particular 98P4B6 domain. In another embodiment, a cytosolic internal antibody that specifically binds to 98P4B6 protein is used to prevent 98P4B6 from approaching the nucleus, such that 98P4B6 exerts any biological activity in the nucleus. (Eg, prevent 98P4B6 from forming transcription complexes with other factors).

  In order to specifically direct the expression of such an internal antibody to a particular cell, the transcription of that internal antibody is placed under the regulatory control of an appropriate tumor-specific promoter and / or enhancer. For example, the PSA promoter and / or promoter / enhancer can be utilized to specifically target expression of the internal antibody to the prostate (eg, US Pat. No. 5, issued July 6, 1999). , 919, 652).

(XII.B.) Inhibition of 98P4B6 using recombinant protein)
In another approach, the recombinant molecule binds to 98P4B6, thereby preventing 98P4B6 function. For example, such recombinant molecules prevent or inhibit 98P4B6 from approaching / binding to its binding partner (s) or associating with other protein (s). Such recombinant molecules can include, for example, the reactive part (s) of a 98P4B6 specific antibody molecule. In certain embodiments, the 98P4B6 binding domain of the 98P4B6 binding partner is engineered into a dimeric fusion protein, whereby the fusion protein is linked to two 98P4B6 linked to the Fc portion of human IgG (eg, human IgG1). Contains a ligand binding domain. Such IgG moieties can include, for example, C _H 2 and C _H 3 domains and a hinge region, but do not include a C _H 1 domain. Such a dimeric fusion protein is administered in a soluble form to a patient suffering from cancer associated with 98P4B6 expression, whereby the dimeric fusion protein specifically binds to 98P4B6 and Block interaction with the binding partner. Such dimeric fusion proteins are further combined into multimeric proteins using known antibody linking techniques.

(XII.C.) Inhibition of transcription or translation of 98P4B6)
The invention also includes various methods and compositions for inhibiting transcription of the 98P4B6 gene. Similarly, the present invention also provides methods and compositions for inhibiting 98P4B6 mRNA to protein translation.

  In one approach, the method of inhibiting transcription of the 98P4B6 gene includes contacting the 98P4B6 gene with a 98P4B6 antisense polynucleotide. In another approach, a method of inhibiting translation of 98P4B6 mRNA comprises contacting 98P4B6 mRNA with an antisense polynucleotide. In another approach, 98P4B6 specific ribozymes are used to cleave the 98P4B6 message and thereby inhibit translation. Such antisense-based methods and ribozyme-based methods can also relate to regulatory regions of the 98P4B6 gene (eg, 98P4B6 promoter elements and / or enhancer elements). Similarly, proteins that can inhibit the 98P4B6 gene transcription factor are used to inhibit transcription of 98P4B6 mRNA. Various polynucleotides and compositions useful in the above methods are described above. The use of antisense and ribozyme molecules to inhibit transcription and translation is well known in the art.

  Other factors that inhibit transcription of 98P4B6 by interfering with transcriptional activation of 98P4B6 are also useful for treating cancers that express 98P4B6. Similarly, agents that interfere with 98P4B6 processing are useful for treating cancers that express 98P4B6. Cancer treatment methods utilizing such factors are also within the scope of the present invention.

(XII.D.) General considerations for therapeutic strategies)
Gene transfer and gene therapy techniques deliver therapeutic polynucleotide molecules (ie, antisense, ribozyme, polynucleotide encoding internal antibodies, and other 98P4B6 inhibitory molecules) to tumor cells synthesizing 98P4B6 Can be used for. A number of gene therapy approaches are known in the art. Recombinant vectors encoding 98P4B6 antisense polynucleotides, ribozymes, factors that can interfere with transcription of 98P4B6, and the like can be delivered to target tumor cells using such gene therapy approaches.

  The therapeutic approaches described above can be combined with any one of a wide variety of surgical, chemotherapeutic or radiation therapy regimens. The therapeutic approach of the present invention is a reduced dosage of chemotherapy (or other therapy) that is advantageous for all patients and particularly for patients who are not well resistant to the toxicity of chemotherapeutic agents. Use and / or less frequent administration.

  The antitumor activity of a particular composition (eg, antisense, ribozyme, internal antibody), or a combination of such compositions can be assessed using a variety of in vitro and in vivo assay systems. In vitro assays for evaluating therapeutic activity include cell proliferation assays, soft agar assays and other assays that exhibit tumor promoting activity, binding assays that can determine the extent to which the therapeutic composition inhibits 98P4B6 binding to a binding partner. Etc.

  In vivo, the efficacy of the 98P4B6 therapeutic composition can be evaluated in an appropriate animal model. For example, a cross-species prostate cancer model can be used, where human prostate cancer explants or passaged xenograft tissues are introduced into immunocompromised animals (eg, nude mice or SCID mice). (Klein et al., 1997, Nature Medicine 3: 402-408). For example, PCT patent application WO 98/16628 and US Pat. No. 6,107,540 describe a human who can repeat the formation of primary tumors, micrometastasis, and the formation of osteoblastic metastases characteristic of later stages of the disease. Various xenograft models of prostate cancer are described. Efficacy can be predicted using assays that measure inhibition of tumor formation, tumor regression or metastasis, and the like.

  In vivo assays that evaluate the promotion of apoptosis are useful in evaluating therapeutic compositions. In one embodiment, xenografts from tumor-bearing mice treated with the therapeutic composition can be tested for the presence of apoptotic lesions and compared to untreated control xenograft-bearing mice. The degree to which apoptotic lesions are found in the tumors of treated mice provides an indication of the therapeutic efficacy of the composition.

  The therapeutic composition used in the practice of the foregoing methods can be formulated into a pharmaceutical composition comprising a carrier suitable for the desired delivery method. Suitable carriers include any substance that, when combined with a therapeutic composition, retains the antitumor function of the therapeutic composition and is generally unresponsive to the patient's immune system. Examples include, but are not limited to, any number of standard pharmaceutical carriers (eg, sterile phosphate buffered saline, bacteriostatic water, etc.) (generally Remington's Pharmaceutical Sciences (No. 1 16)), A. Osal., 1980).

  The therapeutic formulation can be solubilized and administered via any route that can deliver the therapeutic composition to the tumor site. Potentially effective routes of administration include, but are not limited to, intravenous, parenteral, intraperitoneal, intramuscular, intratumoral, intradermal, intraorgan, orthotopic and the like. Preferred formulations for intravenous injection are diluted in a solution of preserved bacteriostatic water, sterile non-preserved water and / or in polyvinyl chloride or polyethylene bags (USP) containing 0.9% sterile sodium chloride for injection. Containing a therapeutic composition. The therapeutic protein preparation can be lyophilized and stored as a sterile powder, preferably under reduced pressure, and then reconstituted in bacteriostatic water (eg, containing benzyl alcohol preservatives) or sterile water prior to injection. Can be configured.

  Dosages and administration protocols for the treatment of cancer using the methods described above will vary with the method and target cancer and will generally depend on a number of other factors understood in the art.

(XIII.) Identification, characterization, and use of modulators of 98P4B6 (Method of identification and use of regulators)
In one embodiment, screening is performed to identify modulators that induce or suppress specific expression profiles, induce or suppress specific pathways, preferably thereby generating an associated phenotype. In another embodiment, when identifying differentially expressed genes that are important in a particular state; identifying modulators that alter (either increase or decrease) the expression of individual genes For screening. In another embodiment, screening is performed to identify modulators that alter the biological function of the expression product of a differentially expressed gene. Again, in identifying the importance of a gene in a particular state, screening is performed to identify factors that bind to and / or modulate the biological activity of the gene product.

  In addition, screening is performed on genes that are induced in response to the candidate agent. After identifying a regulator (a regulator that suppresses the cancer expression pattern that causes the normal expression pattern, or a regulator of the oncogene that causes the expression of the gene as in normal tissues), screening is performed to Identify genes that are specifically regulated in response. Comparison of expression profiles between normal tissue and drug-treated cancer tissue, but not expressed in normal tissue or cancer tissue, but expressed in drug-treated tissue or vice versa Becomes clear. These drug specific sequences are identified and used by the methods described herein for oncogenes or oncoproteins. In particular, these sequences and the proteins they encode are used in the production or identification of cells treated with drugs. In addition, antibodies are raised against drug-inducible proteins and used to target new therapeutic agents to treated cancer tissue samples.

(Identification and screening assays related to modulators)
(Assays related to gene expression)
The proteins, nucleic acids and antibodies of the invention are used in screening assays. Cancer-related proteins, antibodies, nucleic acids, modified proteins and cells containing these sequences may be used in screening assays (eg, “gene expression profiles”, polypeptide expression profiles or effects of drug candidates on altered biological function). Used in evaluation). In one embodiment, the expression profile is preferably used in combination with high-throughput screening techniques to monitor genes after treatment with a candidate agent for the expression profile (eg, Davis, GF et al., J Biol Screen 7:69 (2002); Zlokarnik et al., Science 279: 84-8 (1998); Heid, Genome Res 6: 986-94, 1996).

  Cancer proteins, antibodies, nucleic acids, modified proteins, and cells containing native or modified cancer proteins or genes are used in screening assays. That is, the present invention includes a method for screening for a composition that modulates the cancer phenotype or physiological function of the cancer protein of the present invention. This can be done on the gene itself or by evaluating the effect of drug candidates on a “gene expression profile” or biological function. In one embodiment, the expression profile is preferably used in combination with a high throughput screening technique that allows monitoring after treatment with a candidate agent. See Zlokamik (supra).

  Various assays are performed on the genes and proteins of the invention. Assays are performed for individual nucleic acid or protein levels. That is, once a particular gene is identified as being upregulated in cancer, test compounds are screened for the ability to modulate gene expression or for binding to the oncoproteins of the invention. In this context, “modulation” includes an increase or decrease in gene expression. The preferred amount of modulation is based on the natural change in gene expression in normal tissue versus cancer-affected cells, which change is at least 10%, preferably 50%, more preferably 100-300%, and some In embodiments, it is 300-1000% or more. Thus, if the gene shows a 4-fold increase in cancer tissue compared to normal tissue, a reduction of about 4-fold is often desirable; similarly, the gene is cancerous compared to normal tissue. A target value of a 10-fold increase in expression by a test compound is often desirable if it exhibits a 10-fold decrease in tissue. Regulators that exacerbate the type of gene expression observed in cancer are also useful as upregulated targets, for example, in further analysis.

  The amount of gene expression is monitored using nucleic acid probes and quantification of gene expression levels, or the gene product itself is monitored, for example, by using antibodies against cancer proteins and standard immunoassays. Is done. Proteomics and separation techniques also allow quantification of expression.

(Expression monitoring to identify compounds that alter gene expression)
In one embodiment, gene expression monitoring (ie, expression profile) is monitored for multiple entities simultaneously, such profile typically includes one or more of the genes of FIG. In, for example, cancer nucleic acid probes are coupled to a biochip to detect and quantify cancer sequences in specific cells, or PCR can be used, thus, for example, wells of a series of microtiter plates. Can be used with primers distributed to the desired wells, then a PCR reaction can be performed and analyzed for each well.

  Expression monitoring is performed to identify compounds that alter the expression of one or more cancer-related sequences (eg, the polynucleotide sequences set forth in FIG. 2). In general, test modulators are added to the cells prior to analysis. In addition, the screen also modulates cancer, modulates a cancer protein of the invention, binds to a cancer protein of the invention, or prevents binding of a cancer protein of the invention and an antibody or other binding partner. Provided to identify drugs.

  In one embodiment, the high-throughput screening method includes providing a library containing a large number of potential therapeutic compounds (candidate compounds). Such “combinatorial chemical libraries” are then screened in one or more assays to identify library members (specific chemical species or subclasses) that exhibit the desired characteristic activity. The compounds thus identified can serve as convenient “lead compounds”, as compounds for screening, or as therapeutic agents.

  In certain embodiments, a combinatorial library of potential modulators is screened for the ability to bind to a cancer polypeptide or to modulate activity. Conveniently, a new chemical entity with useful properties identifies a compound (referred to as a “lead compound”) that has some desired property or activity (eg, inhibitory activity), and variants of this lead compound And evaluating the properties and activities of these variant compounds. Often, high throughput screening (HTS) methods are used for such analyses.

  As noted above, gene expression monitoring is conveniently used to test candidate modulators (eg, proteins, nucleic acids or small molecules). After adding the candidate compound and incubating the cells for a period of time, a sample containing the target sequence to be analyzed is added to, for example, a biochip.

  If desired, the target sequence is prepared using known techniques. For example, the sample is processed to lyse cells using known lysis buffers, electroporation, etc., and purification and / or amplification (eg, PCR) is performed as needed. For example, in vitro transcription is performed using a label covalently attached to a nucleotide. In general, these nucleic acids are labeled with biotin-FITC or PE, or with cy3 or cy5.

  The target sequence can be labeled with, for example, a fluorescent signal, a chemiluminescent signal, a chemical signal, or a radioactive signal to provide a means of detecting specific binding of the target sequence to the probe. The label can also be an enzyme, such as alkaline phosphatase or horseradish peroxidase, which, when provided with the appropriate substrate, produces a product that is detected. Alternatively, the label is a labeled compound or small molecule, such as an enzyme inhibitor (binding by this enzyme but not catalyzed or altered). The label can be a labeled compound or a small molecule (eg, biotin that specifically binds to an epitope tag or streptavidin). For the biotin example, streptavidin is labeled as described above, thereby providing a detectable signal to the bound target sequence. Unbound labeled streptavidin is typically removed prior to analysis.

  As will be appreciated by those skilled in the art, these assays may be direct hybridization assays or may include “sandwich assays”, which include the use of multiple probes and generally include: U.S. Pat. Nos. 5,681,702; 5,597,909; 5,545,730; 5,594,117; 5,591 No. 5,571,670; No. 5,580,731; No. 5,571,670; No. 5,591,584; No. 5,624,802; 5,635,352; 5,594,118; 5,359,100; 5,124,246; and 5,681,697. In this embodiment, generally the target nucleic acid is prepared as outlined above and then added to a biochip containing a plurality of nucleic acid probes under conditions that allow the formation of a hybridization complex. The

  A variety of hybridization conditions as outlined above (including high stringency conditions, moderate stringency conditions and low stringency conditions) are used in the present invention. These assays are generally performed under stringency conditions that allow the formation of labeled probe hybridization complexes in the presence of target alone. Stringency is controlled by changing process parameters that are thermodynamic variables, including but not limited to temperature, formamide concentration, salt concentration, chaotropic salt concentration, pH, organic solvent concentration, etc. obtain. These parameters can also be used to control non-specific binding, as generally outlined in US Pat. No. 5,681,697. Thus, it may be desirable to perform certain steps at higher stringency conditions to reduce non-specific binding.

  The reactions outlined herein can be accomplished in a variety of ways. These reaction components can be added simultaneously or sequentially in a different order and preferred embodiments are outlined below. In addition, the reaction can include a variety of other reagents. This includes salts, buffers, neutral proteins (eg, albumin), detergents, etc., to facilitate optimal hybridization and detection, and / or non-specific interactions or Can be used to reduce background interactions. In other cases, reagents that improve the efficiency of the assay (eg, protease inhibitors, nuclease inhibitors, antibacterial agents, etc.) may also be used as needed, depending on the sample preparation method and target purity. Assay data is analyzed to determine the expression level of individual genes, and changes in expression levels between states, to generate a gene expression profile.

(Assays related to biological activity)
The present invention provides methods for identifying or screening for compounds that modulate the activity of the cancer-related genes or proteins of the present invention. This method includes the step of adding a test compound as described above to a cell containing the cancer protein of the present invention. These cells contain a recombinant nucleic acid encoding the oncoprotein of the present invention. In another embodiment, the library of candidate agents is tested on a plurality of cells.

  In one aspect, the assay may include physiological signals (eg, hormones, antibodies, peptides, antigens, cytokines, growth factors, action potentials, pharmacological agents including chemotherapeutic agents, radiation, carcinogenic or other cells ( That is, it is evaluated in the presence or absence of exposure before or after cell-cell contact)). In another example, this determination is made at different stages of the cell cycle process. In this manner, compounds that modulate the gene or protein of the invention are identified. A compound having pharmacological activity can increase the activity of the cancer protein of the present invention or can interfere with the activity of the cancer protein of the present invention. Once identified, similar structures are evaluated to identify important structural properties of the compound.

  In one embodiment, a method of modulating (eg, inhibiting) cancer cell division is provided; the method includes administration of a cancer modulator. In another embodiment, a method of modulating (eg, inhibiting) cancer is provided; the method includes administration of a cancer modulator. In a further embodiment, a method of treating a cell or individual having cancer is provided; the method includes administration of a cancer modulator.

  In one embodiment, a method is provided for modulating the state of a cell that expresses a gene of the invention. As used herein, conditions include parameters accepted in the art such as cellular proliferation, amplification, survival, function, apoptosis, senescence, location, enzymatic activity, signal transduction and the like. In one embodiment, the cancer inhibitor is an antibody as discussed above. In another embodiment, the cancer inhibitor is an antisense molecule. Various cell growth, proliferation, and metastasis assays are known to those skilled in the art, as described herein.

(High-throughput screening to identify regulators)
Assays to identify appropriate modulators are acceptable for high throughput screening. Accordingly, preferred assays detect oncogene transcription increase or inhibition, polypeptide expression inhibition or increase, and polypeptide activity inhibition or increase.

  In one embodiment, the modulator that is evaluated in a high-throughput screening method is a protein, often a naturally occurring protein, or a fragment of a naturally occurring protein. Thus, for example, cell extracts containing proteins or random or directed digests of proteinaceous cell extracts are used. In this manner, a library of proteins is created for screening in the methods of the invention. Bacterial, fungal, viral and mammalian protein libraries are particularly preferred in this embodiment, the latter is preferred, and human proteins are particularly preferred. Particularly useful test compounds are directed to the class of protein to which the target belongs (eg, substrates for enzymes, or ligands and receptors).

(Use of soft agar growth and colonization to identify and characterize modulators)
Normal cells require a solid support to bind and grow. When cells are transformed, they lose their phenotype and grow and detach from the support. For example, transformed cells can be grown in stirred suspension cultures or suspended in semi-solid media (eg, semi-solid agar or soft agar). This transformed cell, when transfected with a tumor suppressor gene, regenerates the normal phenotype and again requires a solid support to bind and grow. Soft agar growth or colony formation in the assay is used to identify regulators of cancer sequences that, when expressed in host cells, inhibit abnormal cell growth and transformation. Modulators reduce or eliminate the ability of host cells suspended in solid or semi-solid media (eg, agar) to grow.

  Techniques for soft agar growth or colony formation in suspension assays are described in Freshney, Culture of Animal Cells of Manual of Basic Technique (3rd edition, 1994). See also the method section of Garkavtsev et al. (1996) (supra).

(Evaluation of contact inhibition and growth density limitation to identify and characterize modulators)
Normal cells typically grow in a flat organized pattern of cell culture until they come into contact with other cells. When these cells come into contact with each other, they are contact-inhibited and stop growing. However, transformed cells are not contact-inhibited and continue to grow to high density in unorganized lesions. Thus, the transformed cells grow to a higher saturation density than the corresponding normal cells. This is detected morphologically by the formation of an undirected monolayer of cells in the lesion. Alternatively, the labeling index with ( ³ H) -thymidine at saturation density is used to measure density limitation of proliferation, and similarly, the MTT assay or Alamar blue assay can be used to determine whether the cell's proliferation ability and regulators are Demonstrate the ability to affect the growth ability of See Freshney (1994) (supra). When transformed cells are transfected with a tumor suppressor gene, they regenerate the normal phenotype and are contact-inhibited to grow to low density.

In this assay, the saturation density ^{(3 H)} - labeling index of thymidine is a preferred method of measuring density limitation of growth. Transformed host cells are transfected with cancer associated sequences and grown for 24 hours at saturating density in non-limiting medium conditions. The percentage of cell labeling with ( ³ H) -thymidine is determined by the incorporated cpm.

  Contact-independent growth is used to identify regulators of cancer sequences that have resulted in abnormal cell growth and transformation. Regulators reduce or eliminate contact-independent growth and return cells to a normal phenotype.

(Evaluation of growth factors or serum dependence to identify and characterize modulators)
Transformed cells have lower serum dependence than their normal counterparts (eg, Temin, J. Natl. Cancer Inst. 37: 167-175 (1966); Eagle et al., J. Exp. Med 131: 836). -879 (1970); Freshney, (supra)). This is partly due to the release of various growth factors by the transformed cells. The degree of growth factor or serum dependence of the transformed host cell can be compared to that under control. For example, cellular growth factor or serum dependence is monitored in a method for identifying and characterizing compounds that modulate cancer-associated sequences of the invention.

(Use of tumor-specific marker levels to identify and characterize modulators)
Tumor cells release an increased amount of certain factors (hereinafter “tumor-specific markers”) over their normal counterparts. For example, plasminogen activator (PA) is released from human gliomas at higher levels from normal brain cells (eg, Gullino, Angiogenesis, Tumor Vascularization, and Potential interference with Tumor Growth, in Biologics). 178-184 (see Mich (ed.) 1985). Similarly, tumor angiogenic factor (TAF) is released in tumor cells at a higher level than its normal counterpart. See, for example, Folkman, Angiogenesis and Cancer, Sem Cancer Biol. (1992)). On the other hand, bFGF is released from endothelial cell tumors (Ensoli, B et al.).

  Various techniques for measuring the release of these factors are described in Freshney (1994) (supra). Unkless et al. Biol. Chem. 249: 4295-4305 (1974); Strickland & Beers, J. MoI. Biol. Chem. 251: 5694-5702 (1976); Whur et al., Br. J. et al. Cancer 42: 305 312 (1980); Gullino, Angiogenesis, Tumor Vascularization, and Potential Interference with Tumor Growth, Biological Responses in Cancer, pp. 178-184 (h); 5: 111-130 (1985). For example, tumor-specific marker levels are monitored with methods for identifying and characterizing compounds that modulate the cancer-associated sequences of the present invention.

(Invasion to matrigel to identify and characterize modulators)
The degree of invasiveness to Matrigel or extracellular matrix components can be used as an assay to identify and characterize compounds that modulate cancer associated sequences. Tumor cells exhibit a positive correlation between malignancy and the invasiveness of cells into Matrigel or some other extracellular matrix component. In this assay, tumorigenic cells are typically used as host cells. Expression of tumor suppressor genes in these host cells reduces host cell invasiveness. Cancer Res. 1999; 59: 6010; Freshney (1994) (supra) can be used. Briefly, the level of host cell invasion is measured by using a filter coated with Matrigel or some other extracellular matrix component. Penetration into the gel or through the distal side of the filter is rated as invasive and is pre-labeled by the number of cells and the distance traveled, or ¹²⁵ 1 and the distal side of the filter Or histologically rated by counting the radioactivity at the bottom of the dish. See, for example, Freshney (1984) (supra).

(Evaluation of tumor growth in vivo to identify and characterize modulators)
The effect of cancer associated sequences on cell proliferation is tested in transgenic or immunosuppressed organisms. Transgenic organisms are prepared in a variety of ways accepted in the art. For example, a knockout transgenic organism (eg, a mammal such as a mouse) is produced in which the oncogene is disrupted or the oncogene is inserted. Knockout transgenic mice are created by inserting a marker gene or other heterologous gene into the endogenous oncogene site in the mouse genome via homologous recombination. Such mice can also be made by replacing the endogenous oncogene with a mutated version of the oncogene or by mutating the endogenous oncogene, for example by exposure to a carcinogen.

  In order to prepare a transgenic chimeric animal (eg, a mouse), a DNA construct is introduced into the nucleus of the embryonic stem cell. Cells containing the newly engineered genetic lesion are injected into the host mouse embryo, which is reimplanted into the recipient female. Some of these embryos develop into chimeric mice where some germ cells are derived from mutant cell lines. Thus, by breeding this chimeric mouse, it is possible to obtain a new strain of mouse containing the introduced genetic lesion (see, eg, Capecchi et al., Science 244: 1288 (1989)). Chimeric mice are described in US Pat. No. 6,365,797 issued April 2, 2002; US Pat. No. 6,107,540 issued August 22, 2000; Hogan et al., Manipulating the Mouse. Embryo: A laboratory Manual, Cold Spring Harbor Laboratory (1988) and Teratocarcinomas and Embryonic Stem Cells: A Practical Approch, Robert. C. , (1987).

Alternatively, various immunosuppressed or immunodeficient host animals can be used. For example, genetically athymic “nude” mice (see, eg, Giovanella et al., J. Natl. Cancer Inst. 52: 921 (1974)), SCID mice, thymectomized mice, or irradiated Mice (see, for example, Bradley et al., Br. J. Cancer 38: 263 (1978); Selby et al., Br. J. Cancer 41:52 (1980)) can be used as the host. Transplantable tumor cells (typically about 10 ⁶ cells) injected into a syngeneic host produce invasive tumors in high proportions, while normal cells of similar origin Does not produce invasive tumors. In hosts that have developed invasive tumors, cells that express cancer-associated sequences are injected subcutaneously or in a normal position. The mice are then separated into groups comprising a control group and a treatment experimental group (eg, treated with a modulator). After an appropriate length of time (preferably 4-8 weeks), tumor growth is measured (eg, by volume or its two largest dimensions, or weight) and compared to a control. Tumors with statistically significant reduction (eg, using Student's t test) are said to have inhibited growth.

(In vitro assay to identify and characterize modulators)
Assays to identify compounds with modulatory activity can be performed in vitro. For example, a cancer polypeptide is first contacted with a potential modulator and incubated for an appropriate amount of time (eg, 0.5-48 hours). In one embodiment, the level of cancer polypeptide is determined in vitro by measuring the level of protein or mRNA. Protein levels are measured using immunoassays (eg, Western blotting, ELISA, etc.) using antibodies that selectively bind to cancer polypeptides or fragments thereof. For measurement of mRNA, amplification (eg, PCR, LCR, or hybridization assay (eg, Northern hybridization, RNAse protection, dot blotting)) is preferred. Protein or mRNA levels can be detected directly or indirectly labeled detection reagents (eg, fluorescently or radioactively labeled nucleic acids, radioactively or enzymatically as described herein). For example, an antibody labeled with a).

  Alternatively, a reporter gene system can be invented using an oncoprotein promoter operably linked to a reporter gene (eg, luciferase, green fluorescent protein, CAT, or P-gal). The reporter construct is typically transfected into the cell. After treatment with potential regulators, the amount of transcription, translation, or activity of the reporter gene is measured according to standard techniques known to those skilled in the art (Davis GF, supra; Gonzalez, J. & Neglescu , P. Curr. Opin. Biotechnol. 1998: 9: 624).

  As outlined above, in vitro screening is done on individual genes and gene products. That is, once a particular differentially expressed gene is identified as being important in a particular state, screening for regulators of expression of this gene or gene product itself is performed.

  In one embodiment, screening for regulators of expression of specific genes is performed. Typically, the expression of only one or a few genes is evaluated. In another embodiment, the screen is designed to first find compounds that bind to differentially expressed proteins. These compounds are then evaluated for their ability to modulate differentially expressed activity. Furthermore, once the first candidate compound is identified, variants can be further screened to better evaluate the structure-activity relationship.

(Binding assay to identify and characterize modulators)
In a binding assay according to the invention, a purified or isolated gene product of the invention is generally used. For example, antibodies are generated against the protein of the invention and an immunoassay is performed to determine the amount and / or location of the protein. Alternatively, cells containing oncoproteins are used in the assay.

  Accordingly, these methods include the steps of mixing a cancer protein of the invention with a candidate compound, such as a ligand, and determining the binding of the compound to the cancer protein of the invention. Preferred embodiments utilize human oncoproteins; animal models of human disease can also be developed and used. Other similar mammalian proteins can also be used, as will be appreciated by those skilled in the art. Furthermore, in some embodiments, variants or derived oncoproteins are used.

  In general, the oncoproteins or ligands of the invention are non-diffusibly bound to an insoluble support. The support can be, for example, one having a region for receiving an isolated sample (microtiter plate, array, etc.). An insoluble support can be made from any composition to which the composition can be bound, is easily separated from soluble material, and is otherwise compatible with the overall screening method. The surface of such a support can be solid or porous and can be of any convenient shape.

Examples of suitable insoluble supports include microtiter plates, arrays, membranes and beads. These are typically made of glass, plastic (eg, polystyrene), polysaccharides, nylon, nitrocellulose, or Teflon ^™ . Microtiter plates and arrays are particularly advantageous. This is because multiple assays can be performed simultaneously using small amounts of reagents and samples. The particular manner in which the composition is bound to the support is not critical as long as it is compatible with the reagents and overall method of the invention, maintains the activity of the composition and is non-diffusible. Preferred methods of conjugation include ligand binding sites when attaching the protein to a support (direct attachment to a “sticky” or ionic support, chemical cross-linking, protein or drug synthesis on the surface, etc.) And the use of an antibody that neither sterically blocks nor the activation sequence. Following binding of the protein or ligand / binding agent to the support, excess unbound material is removed by washing. The sample receiving area can then be blocked by incubating with bovine serum albumin (BSA), casein or other innocuous protein or other moiety.

  Once the oncoprotein of the invention is bound to the support, a test compound is added to the assay. Alternatively, the candidate binding agent is bound to the support and then the oncoprotein of the invention is added. Binding agents include specific antibodies, non-natural binding agents identified by chemical library screening, peptide analogs, and the like.

  Of particular interest are assays for identifying agents that have low toxicity to human cells. A wide variety of assays can be used for this purpose, including proliferation assays, cAMP assays, labeled in vitro protein-protein binding assays, electrophoretic mobility shift assays, immunoassays for protein binding. Functional assays (such as phosphorylation assays).

  Determination of the binding of test compounds (ligands, binding agents, modulators, etc.) to the oncoproteins of the invention can be made in a number of ways. The test compound can be labeled and binding can be accomplished, for example, by attaching all or part of the oncoprotein of the invention to a solid support, adding a labeled candidate compound (eg, a fluorescent label), and removing excess reagent. It can be determined directly by washing away and determining whether the label is present on the solid support. Various blocking and cleaning steps can be utilized as appropriate.

In certain embodiments, only one of the components is labeled. For example, the protein or ligand of the invention is labeled. Alternatively, more than one component is labeled with different labels (eg, I ¹²⁵ for proteins and fluorophores for compounds). Proximity reagents (eg, quenching agents or energy transfer agents) are also useful.

(Competitive binding to identify and characterize modulators)
In one embodiment, binding of a “test compound” is determined by a competitive binding assay using a “competitor”. A competitor is a binding moiety that binds to a target molecule (eg, a cancer protein of the invention). Competitors include compounds such as antibodies, peptides, binding partners, ligands and the like. Under certain circumstances, the competitive binding between the test compound and the competitor replaces the test compound. In one embodiment, the test compound is labeled. Either the test compound, the competitor, or both are added to the protein for a time sufficient to allow binding. Incubations are performed at a temperature that facilitates optimal activity (typically between 4 ° C. and 40 ° C.). Incubation times are typically optimized to facilitate, for example, rapid high throughput of screening; typically between 0 and 1 hour is sufficient. Excess reagent is generally removed or washed away. A second component is then added and the presence or absence of the labeled component is followed to indicate binding.

  In one embodiment, the competitor is added first, followed by the test compound. Displacement of the competitor is an indication that the test compound binds to the oncoprotein, and thus can bind to the oncoprotein and potentially modulate the activity of the oncoprotein. In this embodiment, any component can be labeled. Thus, for example, if the competitor is labeled, the presence of the label in the post-test compound wash solution indicates replacement by the test compound. Alternatively, when the test compound is labeled, the presence of the label on the support is an indication of displacement.

  In an alternative embodiment, the test compound is added first, incubated and washed, then the competitor is added. The absence of binding by the competitor indicates that the test compound binds to the oncoprotein with a higher affinity than the competitor. Thus, when the test compound is labeled, the presence of the label on the support (combined with the lack of binding of the competitor) will cause the test compound to bind to and thus potentially modulate the cancer protein of the invention. It is an indicator.

  Thus, competitive binding methods include differential screening to identify agents that can modulate the activity of the oncoproteins of the invention. In this embodiment, the method includes mixing the oncoprotein and the competitor in the first sample. The second sample contains the test compound, oncoprotein, and competitor. The binding of the competitor is determined for both samples, and the change or difference in binding between these two samples is indicative of the presence of an agent that can bind to the cancer protein and potentially modulate its activity. Show. That is, if the binding of the competitor is different in the second sample relative to the first sample, the agent can bind to the oncoprotein.

  Alternatively, differential screening is used to identify drug candidates that bind to the native oncoprotein but cannot bind to the modified oncoprotein. For example, the structure of oncoproteins can be modeled and used in rational drug design to synthesize factors that interact with the site, i.e., factors that generally do not bind to site-modified protein. . In addition, drug candidates that affect the activity of native oncoproteins are also identified by screening drugs for the ability to either enhance or decrease the activity of such proteins.

  Positive and negative controls can be used in this assay. Preferably, control and test samples are performed at least in triplicate to obtain statistically significant results. Incubation of all samples is performed for a time sufficient to allow binding of this factor to the protein. Following incubation, the sample is washed free of non-specific binding material and the amount of genetically labeled factor bound is determined. For example, if a radiolabel is used, these samples can be counted using a scintillation counter to determine the amount of compound bound.

  A variety of other reagents may be involved in this screening assay. These reagents include salts, neutral proteins (eg, albumin), surfactants that are used to facilitate optimal protein-protein binding and / or reduce non-specific or background interactions. And the like. Reagents that improve the efficiency of this assay in other ways (eg, protease inhibitors, nuclease inhibitors, antimicrobial agents, etc.) can also be used. The mixture of ingredients is added in an order that provides the requisite binding.

(Use of polynucleotides to down-regulate or inhibit proteins of the invention)
Polynucleotide modulators of cancer can be introduced into cells containing the target nucleotide sequence by formation of a conjugate with a ligand binding molecule, as described in WO 91/04753. Suitable ligand binding molecules include, but are not limited to: cell surface receptors, growth factors, other cytokines, or other ligands that bind to cell surface receptors. Preferably, the conjugate of the ligand binding molecule does not interfere sufficiently with the ability of the ligand binding molecule to bind to its corresponding molecule or receptor, and the sense oligonucleotide or antisense oligonucleotide or conjugate version thereof to the cell. Do not block the entry sufficiently. Alternatively, a polynucleotide modulator of cancer can be introduced into a cell containing the target nucleic acid sequence by formation of a polynucleotide-lipid complex, eg, as described in WO 90/10448. It will be appreciated that the use of antisense molecules or knockout models and knock-in models can also be used in screening assays as discussed above, in addition to processing methods.

(Inhibition and antisense nucleotides)
In certain embodiments, the activity of a cancer-associated protein is associated with an antisense polynucleotide or inhibitory micronuclear RNA (snRNA) (ie, a coding mRNA nucleic acid sequence (eg, a cancer protein, mRNA of the invention, or a subsequence thereof). Complementary and preferably down-regulated or completely inhibited by the use of nucleic acids) that are preferably capable of hybridizing to them. Binding of the antisense polynucleotide to the mRNA reduces the translation and / or stability of the mRNA.

  In the context of the present invention, antisense polynucleotides can include naturally occurring nucleotides, or synthetic species formed from naturally occurring subunits or related homologues thereof. Antisense polynucleotides can also have altered sugar moieties or linkages between sugars. Phosphorothioates and other sulfur-containing species known to be used in the art are illustratively included among these. Analogs are included in the invention as long as they function effectively so that they hybridize to the nucleotides of the invention. See, for example, Isis Pharmaceuticals, Carlsbad, CA; See, Natick, MA.

  Such antisense polynucleotides can be readily synthesized using recombinant means, or can be synthesized in vitro. Equipment for such synthesis is commercially available from a variety of vendors including Applied Biosystems. The preparation of other oligonucleotides (eg, phosphorothioates and alkylated derivatives) is also well known to those skilled in the art.

  As used herein, an antisense molecule includes an antisense oligonucleotide or a sense oligonucleotide. Sense oligonucleotides can be used, for example, to block transcription by binding to the antisense strand. The antisense and sense oligonucleotides comprise a single stranded nucleic acid sequence (either RNA or DNA) that can bind to a target mRNA (sense) sequence or target DNA (antisense) sequence for the cancer molecule. Antisense oligonucleotides or sense oligonucleotides according to the present invention generally comprise a fragment of at least about 12 nucleotides, preferably from about 12 nucleotides to about 30 nucleotides. The ability to derive antisense or sense oligonucleotides based on a cDNA sequence encoding a given protein is described, for example, by Stein & Cohen (Cancer Res. 48: 2659 (1988) and van der Krol et al. (BioTechniques 6: 958 (1988)). )It is described in.

(Ribozyme)
In addition to antisense polynucleotides, ribozymes can be used to target or inhibit transcription of cancer-associated nucleotide sequences. Ribozymes are RNA molecules that catalytically cleave other RNA molecules. Various types of ribozymes have been described. These ribozymes include group I ribozymes, hammerhead ribozymes, hairpin ribozymes, RNase P, and axhead ribozymes (see, eg, Castanotto et al., Adv. In Pharmacology 25 for a general review of the properties of various ribozymes). : 289-317 (1994)).

  The genetic features of hairpin ribozymes are described, for example, in Hampel et al., Nucl. Acid Res. 18: 299-304 (1990); European Patent Application No. 0360257; U.S. Pat. No. 5,254,678. Preparation methods are well known to those skilled in the art (eg, WO 94/26877; Ojwang et al., Proc. Natl. Acad. Sci. USA 90: 6340-6344 (1993); Yamada et al., Human Gene Therapy 1: 39-45). (1994); Leavitt et al., Proc. Natl. Acad Sci. USA 92: 699-703 (1995); Leavitt et al., Human Gene Therapy 5: 1151-120 (1994); and Yamada et al., Virology 205: 121-126. 1994)).

(Use of regulators in phenotypic screening)
In one embodiment, the test compound is administered to a population of cancer cells having an associated cancer expression profile. As used herein, “administering” or “contacting” refers to this modulation in such a manner that the modulator acts on the cell either by uptake and intracellular action or by action on the cell surface. It means adding a factor to the cell. In some embodiments, a nucleic acid encoding a proteinaceous factor (ie, a peptide) is added to a viral construct (eg, an adenoviral construct or a retroviral construct) and added to a cell to express the peptide factor. Is achieved (eg PCT US97 / 01019). Regulatable gene therapy systems can also be used. Once the modulator is administered to the cells, the cells are washed if desired and incubated for some period of time under favorable physiological conditions. These cells are then collected and a new gene expression profile is created. Thus, for example, cancerous tissue is screened for factors that modulate (eg, induce or suppress) the cancer phenotype. A change in at least one gene, preferably many genes, in the expression profile indicates that this factor has an effect on the activity of the cancer. Similarly, altering a biological function or signal transduction pathway indicates the activity of a modulator. By defining such a signature for the cancer phenotype, screening for new drugs that alter the phenotype is devised. In this approach, the drug target need not be known, need not be represented in the original gene / protein expression screening platform, and the level of transcript for the target protein need not change. Regulators that inhibit function serve as surrogate markers.

  Screening is performed to evaluate the gene or gene product as outlined above. That is, a step of identifying a specific differentially expressed gene as important in a specific state and a step of screening for any regulator of expression of the gene or gene product itself are performed.

(Use of modulators affecting the peptides of the invention)
Measurement of cancer polypeptide activity, or cancer phenotype, is performed using a variety of assays. For example, the effect of a modulator on the function of a cancer polypeptide is measured by testing the above parameters. Physiological changes that affect activity are used to assess the effect of a test compound on the polypeptides of the invention. When functional results are determined using intact cells or animals, various effects are known (eg, by solid tumor, tumor growth, tumor metastasis, neovascularization, hormone release, eg, by Northern plot) In the case of cancers associated with transcriptional changes to both genetic and uncharacterized genetic markers, changes in cellular metabolism (eg, cell proliferation or pH changes) and changes in intracellular secondary messengers (eg, cGNIP) Can be evaluated).

(Method for identifying and characterizing cancer-related sequences)
The expression of various gene sequences is associated with cancer. Accordingly, a disorder based on a mutant oncogene or a modified oncogene is determined. In one embodiment, the present invention provides a method for identifying a cell comprising a variant oncogene (eg, determining the presence of all or part of a sequence of at least one endogenous oncogene in the cell). provide. This is accomplished using a number of sequencing techniques. The invention encompasses a method of identifying an individual's cancer genotype (eg, determining all or part of the sequence of at least one gene of the invention in an individual). This is generally done in at least one tissue of the individual (eg, the tissue shown in Table 1) and may include evaluation of multiple tissues or different samples of the same tissue. The method includes the step of comparing the sequence of the sequenced gene with the sequence of a known oncogene (ie, a wild type gene) to determine the presence of a family member, homolog, variant, or variant. obtain. The sequence of all or part of this gene can then be compared to the sequence of known oncogenes to determine if any differences exist. This is done using a number of known homology programs (eg BLAST, Bestfit, etc.). The presence of sequence differences between the oncogenes of the present invention and known oncogenes is associated with a disease state or trend for a disease state, as outlined herein.

  In a preferred embodiment, these oncogenes are used as probes to determine the copy number of oncogenes in the genome. These oncogenes are used as probes for determining the chromosomal location of the oncogene. Information such as chromosomal location finds use in diagnosis or prognosis, particularly when chromosomal abnormalities (eg, translocations, etc.) are identified at the oncogene locus.

(XIV.) Kit / article of manufacture)
Kits are also within the scope of the invention for use in the diagnostic and therapeutic applications described herein. Such a kit may comprise a carrier, a package or a container that is partitioned to receive one or more containers (eg, vials, tubes, etc.), each of which is used in the method. Contains one separate element. For example, the container can include a probe that is detectably labeled or can be labeled. Such probes can be antibodies or polynucleotides specific for the protein associated with FIG. 2 or the gene or message of FIG. 2, respectively. If the method uses nucleic acid hybridization to detect the target nucleic acid, the kit may also include a container containing nucleotides for amplifying the target nucleic acid sequence and / or reporter means (eg, a reporter molecule (eg, an enzyme A container containing a biotin-binding protein (eg avidin or streptavidin) bound to a label, a fluorescent label, or a radiolabel) may also be included. The kit can include all or part of the amino acid sequence in FIG. 2 or FIG. 3 or an analog thereof, or a nucleic acid molecule encoding such an amino acid sequence.

  The kits of the present invention typically contain the desired materials (buffers, diluents, filter papers, needles, syringes; carriers, packages, containers, vials, and / or the above containers and commercial and user aspects). Or one or more other containers containing tubes, labels listing the contents, and / or instructions for use, and package inserts with instructions for use).

  The label may be present on the container to indicate that the composition is to be used for a particular therapeutic or non-therapeutic application (eg, diagnostic or research application) and used in vivo or in vitro (eg, as described herein) Instructions for use) described in the document. Instructions and / or other information may also be included with the kit or on an insert or label provided on the kit.

  The terms “kit” and “article of manufacture” may be used as synonyms.

  In another embodiment of the invention, the composition (eg, amino acid sequence, small molecule, nucleic acid sequence, and / or antibody (eg, diagnosis of neoplasia of tissue, prognosis, prevention and / or as shown in Table 1) Or a material useful for treatment) is provided, which typically comprises at least one container and at least one label, suitable containers include, for example, bottles, These include vials, syringes, and test tubes, which can be formed from a variety of materials (eg, glass or plastic) that hold amino acid sequences, small molecules, nucleic acid sequences, and / or antibodies. In one embodiment, the container may contain a polynucleotide for use in testing cellular mRNA expression profiles. It can hold with reagents used for.

  The container may alternatively comprise a composition effective for treating, diagnosing, prognosing or preventing a condition and may comprise a sterile access port (eg, the container may be an intravenous solution bag or subcutaneous It can be a vial with a stopper that can be penetrated by a syringe needle). The active agent in the composition can be an antibody that can specifically bind 98P4B6 and modulate the function of 98P4B6.

  The label can be on the container or attached to the container. If the letters, numbers or other features that form this label are formed on or etched into the container itself, the label can be on the container; the container or carrier that also holds this container If present (eg, package insert), a label can be attached to the container. The label may indicate that the composition is used for diagnosing, treating, preventing or prognosing certain conditions (eg, tissue neoplasia shown in Table 1). The article of manufacture may further comprise a second container, the second container being a pharmaceutically acceptable buffer (eg, phosphate buffered saline, Ringer's solution, and / or dextrose solution). including. The container may contain other materials desired from a commercial and user standpoint (other buffers, diluents, filter paper, stir bars, needles, syringes, and / or package inserts and / or uses with instructions. For further instructions).

  Various aspects of the invention are described and illustrated by the following examples. These examples are not intended to limit the scope of the invention.

(Example 1: SSH generation isolation of cDNA fragment of 98P4B6 gene)
To isolate genes that are overexpressed in prostate cancer, we used a Suppression Subtractive Hybridization (SSH) procedure using cDNA from prostate tissue. The 98P4B6 SSH cDNA sequence was derived from normal prostate excluding the LAPC-4AD prostate xenograft cDNA. 98P4B6 cDNA was identified as being highly expressed in prostate cancer.

(Materials and methods)
(Human tissue)
Patient cancer tissue and normal tissue were purchased from another source (eg, NDRI (Philadelphia, PA)). MRNA for some normal tissues was purchased from Clontech, Palo Alto, CA.

(Isolation of RNA)
Tissue was homogenized in Trizol reagent (Life Technologies, Gibco BRL) with 10 ml / g of tissue to isolate total RNA. Poly A RNA was purified from total RNA using Qiagen's Oligotex mRNA Mini and Midi kits. Total RNA and mRNA were quantified by spectrophotometric analysis (OD 260/280 nm) and analyzed by gel electrophoresis.

(Oligonucleotide)
The following HPLC purified oligonucleotides were used.

（抑制サブトラクティブハイブリダイゼーション）
抑制サブトラクティブハイブリダイゼーション（ＳＳＨ）を使用して、前立腺癌において差次的に発現し得る遺伝子に対応するｃＤＮＡを同定した。このＳＳＨ反応は、前立腺異種移植片および正常組織由来のｃＤＮＡを使用した。

(Suppression subtractive hybridization)
Suppressive subtractive hybridization (SSH) was used to identify cDNAs corresponding to genes that can be differentially expressed in prostate cancer. This SSH reaction used prostate xenografts and cDNA from normal tissues.

  Gene 98P4B6 was derived from normal prostate tissue excluding prostate cancer xenograft LAPC-4AD cDNA subtraction. The SSH DNA sequence (Figure 1) was identified.

LAPC-4AD-derived cDNA was used as the source of “driver” cDNA, while normal prostate-derived cDNA was used as the source of “tester” cDNA. Double-stranded cDNAs corresponding to tester and driver cDNAs were isolated from the relevant tissues using CLONTECH PCR-Select cDNA Subtraction Kit and 1 ng oligonucleotide DPNCN as primers as described above. Synthesized from (A) ⁺ RNA (2 μg). First and second strand synthesis was performed as described in the kit user manual protocol (CLONTECH protocol number PT1117-1, catalog number K1804-1). The resulting cDNA was digested with Dpn II for 3 hours at 37 ° C. Digested cDNA was extracted with phenol / chloroform (1: 1) and precipitated with ethanol.

  Driver cDNA was made by combining DpnII digested cDNA from the relevant tissue source (see above) with digested cDNA from normal tissue in a 1: 1 ratio.

  Tester cDNA was made by diluting DpnII digested cDNA (1 μl) from the relevant tissue source (see above) (400 ng) in 5 μl of water. This diluted cDNA (2 μl, 160 ng) was then used in a separate ligation reaction using 400 u of T4 DNA ligase (CLONTECH) in a total volume of 10 μl, overnight at 16 ° C., 2 μl Adaptor 1 and Adapter Ligated to 2 (10 μM). Ligation was terminated by heating at 72 ° C. for 5 minutes with 1 μl of 0.2M EDTA.

  The first hybridization was performed by adding driver cDNA (1.5 μl, 600 ng) to each of the two tubes containing 1.5 μl (20 ng) of Adapter 1 ligated tester cDNA and Adapter 2 ligated tester cDNA. . In a final volume of 4 μl, these samples were covered with mineral oil, denatured with an MJ Research thermal cycler for 1.5 minutes at 98 ° C., and then hybridized at 68 ° C. for 8 hours. The two hybridization products were then mixed with additional fresh denatured driver cDNA (1 μl) and hybridized overnight at 68 ° C. This second hybridization product was then diluted in 20 mM Hepes (pH 8.3), 50 mM NaCl, 0.2 mM EDTA (200 μl), heated at 70 ° C. for 7 minutes, and stored at −20 ° C.

(PCR amplification, cloning and sequencing of gene fragments generated by SSH)
Two PCR amplifications were performed to amplify the gene fragment obtained from the SSH reaction. In the first PCR reaction, the diluted final hybridization mixture (1 μl) is mixed with 1 μl PCR primer 1 (10 μM), 0.5 μl dNTP mixture (10 μM), 2.5 μl 10 × reaction buffer (CLONTECH) and To 0.5 μl of 50 × Advantage cDNA polymerase mixture (CLONTECH) was added in a final volume of 25 μl. PCR1 was performed using the following conditions. 27 cycles of 75 ° C for 5 minutes, 94 ° C for 25 seconds, then 94 ° C for 10 seconds, 66 ° C for 30 seconds, 75 ° C for 1.5 minutes. Five separate first PCR reactions were performed for each experiment. The product was pooled and diluted 1:10 with water. For the second PCR reaction, 1 μl from this pooled and diluted first PCR reaction was the same as that used for PCR 1 except that primers NP1 and NP2 (10 μM) were used instead of PCR primer 1. Added to the mixture. PCR2 was performed using 10-12 cycles of 94 ° C. for 10 seconds, 68 ° C. for 30 seconds and 72 ° C. for 1.5 minutes. The PCR product was analyzed using 2% agarose gel electrophoresis.

  This PCR product was inserted into pCR2.1 using the T / A vector cloning kit (Invitrogen). Transformed E. coli E. coli was subjected to blue / white sorting and ampicillin sorting. White colonies were picked and placed in 96 well plates and grown overnight in liquid culture. To identify the insert, PCR amplification was performed on 1 ml of bacterial culture using PCR1 conditions and NP1 and NP2 as primers. PCR products were analyzed using 2% agarose gel electrophoresis.

  Bacterial clones were stored in 20% glycerol in a 96 well format. Plasmid DNA was prepared, sequenced, and subjected to nucleic acid homology searches of the GenBank, dBest and NCI-CGAP databases.

(RT-PCR expression analysis)
First-strand cDNA can be generated from 1 μg of mRNA using oligo (dT) 12-18 priming using the Gibco-BRL Superscript Preamplification system. The manufacturer's protocol was used, which included incubation with reverse transcriptase at 42 ° C for 50 minutes, followed by RNAse H treatment at 37 ° C for 20 minutes. After the reaction was complete, the volume could be increased to 200 μl with water prior to normalization. First strand cDNA from 16 different normal human tissues can be obtained from Clontech.

Normalization of first strand cDNA from multiple tissues amplifies β-actin using the following primers: 5'atatcccgcgctcgtcgtcgaca3 '(SEQ ID NO: 109) and 5'agccacacgacctcattgtagaagg3' (SEQ ID NO: 110) It carried out by. First strand cDNA (5 μl) was added in a total volume of 50 μl (0.4 μM primer, 0.2 μM dNTP, 1 × PCR buffer (Clontech, 10 mM Tris-HCl, 1.5 mM MgCl ₂ , 50 mM KCl, Amplified with pH 8.3) and 1 × Klentaq DNA polymerase (Clontech). 5 μl of the PCR reaction can be removed at 18, 20, and 22 cycles and used for agarose gel electrophoresis. PCR was performed using the MJ Research thermal cycler under the following conditions: The first denaturation step was 94 ° C for 15 seconds, followed by 94 ° C for 15 minutes, 65 ° C for 2 minutes, 72 ° C. 5 seconds can be 18 cycles, 20 cycles and 22 cycles. The final extension step at 72 ° C. was performed for 2 minutes. After agarose gel electrophoresis, the band intensities of 283 bp β-actin bands from multiple tissues were compared by visual inspection. The dilution factor of the first strand cDNA was calculated to obtain an equal β-actin band intensity in all tissues after 22 cycles of PCR. In all tissues after 22 cycles of PCR, 3 rounds of normalization may be required to achieve equal band intensity.

  To determine the expression level of the 98P4B6 gene, 5 μl of normalized first strand cDNA was analyzed by PCR using 26 and 30 cycles of amplification. Semi-quantitative expression analysis can be accomplished by comparing PCR products at a cycle number that gives light band intensity. Primers used for RT-PCR are designed using 98P4B6 SSH sequences and are listed below:

（実施例２：全長９８Ｐ４Ｂ６コードｃＤＮＡの単離）
９８Ｐ４Ｂ６ ＳＳＨ ｃＤＮＡ配列は、正常な前立腺から前立腺癌異種移植片を差し引いたサブトラクションから誘導した。ＳＳＨ ＤＮＡ配列（図１）を、９８Ｐ４Ｂ６と指定した。

(Example 2: Isolation of full length 98P4B6-encoding cDNA)
The 98P4B6 SSH cDNA sequence was derived from a subtraction of normal prostate minus prostate cancer xenografts. The SSH DNA sequence (FIG. 1) was designated 98P4B6.

  The 183 bp 98P4B6 SSH DNA sequence is shown in FIG. 2453 bp full length 98P4B6 v. 1 (clone GTD3) was cloned from a prostate cDNA library and revealed a 454 amino acid ORF (FIGS. 2 and 3). 98P4B6 v. 6 was also cloned from a normal prostate library. Other variants of 98P4B6 were also identified and listed in FIGS.

  98P4B6 v. 2, v. 3, v. 4, v. 5, v. 6, v. 7 and v. 8 is 98P4B6 v. 1 splice variant. 98P4B6 v. 9-v. 19 is a SNP variant, v. 1 differs from 1 amino acid. 98P4B6 v. 20-v. 24, v. 7 SNP variants. 98P4B6 v. 25-v. 38 is v. 8 SNP variants. Although these SNP variants are shown separately, they can also be present in any combination and in any transcription variant.

(Example 3: Chromosome mapping of 98P4B6)
Chromosomal localization can be associated with genes in the pathogenesis of the disease. Several chromosome mapping approaches are available, including fluorescence in situ hybridization (FISH), human / hamster radiation hybrid (RH) panel (Walter et al., 1994; Nature Genetics 7:22; Research Genetics, Huntsville A1 ), Human-rodent somatic cell hybrid panels (such as those available from Cornell Institute (Camden, New Jersey)), and genomic viewers using BLAST homology to sequenced and mapped genomic clones (NCBI, Bethesda, Maryland).

  98P4B6 is located on chromosome 7q21 using the 98P4B6 sequence and NCBI BLAST tool (located on the World Wide Web (.ncbi.nlm.nih.gov / genome / seq / page.cgi? F = HsBlast.html && ORG = Hs)). Map.

(Example 4: Expression analysis of 98P4B6)
Expression analysis by RT-PCR showed that 98P4B6 was strongly expressed in prostate cancer patient specimens (FIG. 14). First strand cDNA is extracted from normal stomach, normal brain, normal heart, normal liver, normal skeletal muscle, normal testis, normal prostate, normal bladder, normal kidney, normal colon, normal lung, normal pancreas, and prostate cancer patients, bladder Prepared from a pool of cancer specimens from cancer patients, kidney cancer patients, colon cancer patients, lung cancer patients, pancreatic cancer patients, and a pool of prostate metastases to the lymph nodes of two patients. Normalization was performed by PCR using primers for actin. 98P4B6v. 1, v. 13 or / and v. 14 (A), or in particular splice variant 98P4B6v. 6, and v. Semi-quantitative PCR using primers for 8 (B) was performed with 26 and 30 cycles of amplification. Samples were electrophoresed on agarose gels and PCR products were quantified using Alphamager software. The results show that 98P4B6 and its splice variants in normal prostate and prostate cancer v. 6 and v. A strong expression of 8 is shown. Expression was also detected in bladder cancer, kidney cancer, colon cancer, lung cancer, pancreatic cancer, breast cancer, cancer metastasis and prostate cancer metastasis to lymph nodes compared to all normal tissues tested. As shown below (eg, Example 6), 98P4B6 v. 1 is expressed, for example, in cancer tissues as listed in Table 1, and 98P4B6 variants encoding other proteins are also expressed in these tissues; this principle is described herein. Protein 98P4B6 v. 6 or v. 8 is, for example, prostate, lung, ovary, bladder, breast, colon, kidney and pancreas, cancer, and 98P4B6 v. Reinforced by data in the literature (Porkka et al., Lab Invest, 2002 and Koraz et al., JBC, 2002) where 8 has been identified in normal prostate and prostate cancer.

  In genomic regions where the genetic map is regulated in a particular cancer, alternative transcripts or splice variants of this gene are also regulated. Disclosed herein is that 98P4B6 has a specific expression profile for cancer. Alternative transcripts and splice variants of 98P4B6 are also involved in cancer in the same or additional tissues and thus serve as tumor associated markers / antigens.

  98P4B6 v. 1, v. 13 and / or v. Expression of 14 was detected in specimens of cancer patients of prostate, lung, ovary, bladder, cervix, uterus and pancreas (FIG. 15). First strand cDNA was prepared from a panel of patient cancer specimens. Normalization was performed with PCR products using primers for actin. Semi-quantitative PCR using primers for 98P4B6 was performed with 26 and 30 cycles of amplification. Samples were electrophoresed on agarose gels and PCR products were quantified using Alphamager software. Expression was recorded as absent, low, moderate or strong. The results show 98P4B6 expression in the majority of all patient cancer specimens tested.

  FIG. 16 shows that 98P4B6 is expressed in gastric cancer patient specimens. (A) RNA was extracted from normal stomach (N) and 10 different gastric cancer patient specimens (T). Northern blots with 10 μg total RNA / lane were followed with 98P4B6 sequences. The results show strong expression of 98P4B6 in gastric tumor tissue and low expression in normal stomach. The lower panel represents ethidium bromide staining of the blot showing the quality of the RNA sample. (B) 98P4B6 expression was assessed in a panel of RNA dot blots of human gastric cancer (T) and its respective matched normal tissue (N). 98P4B6 was detected in 7 out of 8 gastric tumors but not in matching normal tissues.

(Example 5: Transcriptional variant of 98P4B6)
A transcript variant is a variant of the mature mRNA from the same gene by alternative transcription or alternative splicing. Selective transcripts are transcripts from the same gene but initiate transcription at different points. Splicing variants are mRNA variants that are differentially spliced from the same transcript. In eukaryotes, when a multi-exon gene is transcribed from genomic DNA, the first RNA is spliced to have only the exon and be used for translation into an amino acid sequence Produces functional mRNA. Thus, a given gene can have zero to many alternative transcripts, and each transcript can have zero to many splicing variants. Each transcript variant has a unique exon makeup and may have different coding and / or non-coding portions (5 ′ or 3 ′ end) from the original transcript. Transcript variants may encode similar or different proteins with the same or similar function, may encode proteins with different functions, and may be expressed in the same tissue at the same time point It may be expressed in different tissues at different times, in the same tissue at different times, or in different tissues at different times. Proteins encoded by transcript variants can have similar or different intracellular or extracellular locations (eg, secreted versus intracellular).

  Transcript variants are identified by various methods accepted in the art. For example, alternative transcripts and splicing variants are identified by full-length cloning experiments or by use of full-length transcripts and EST sequences. First, all human ESTs were grouped into clusters that showed direct or indirect identity with each other. Second, ESTs in the same cluster were further grouped into sub-clusters and assembled into a consensus sequence. The original gene sequence is compared to a consensus sequence or other full-length sequence. Each consensus sequence is a potential splicing variant for that gene. Even if a variant that is not a full-length clone is identified, that portion of the variant is very useful for antigen generation using techniques known in the art and for further cloning of full-length splicing variants.

  In addition, computer programs that identify transcript variants based on genomic sequences are available in the art. As a genome-based transcript variant identification program, FgenesH (A. Salamov and V. Solovyev, “Ab initio gene finding in Drosophila genomic DNA,” Genome Research. 2000 April; 22 (4) 51; (URL compbio.ornl.gov/Grail-bin/EmptyGrailForm) and GenScan (URL genes.mit.edu/GENSCAN.html). For a general discussion of splicing variant identification protocols see, for example, Southan, C .; , A genomic perspective on human protocols, FEBS Lett. 2001 Jun 8; 498 (2-3): 214-8; de Souza, S .; J. et al. Et al, Identification of human chromosome 22 translated sequences with ORF expressed sequence tags, Proc. Natl Acad Sci USA. 2000 Nov 7; 97 (23): 12690-3.

  Various techniques are available in the art to further confirm the transcript variant parameters, such as full-length cloning, protein validation, PCR-based confirmation, and 5'RACE confirmation, etc. ( For example, protein confirmation: Brennan, S.O., et al., Albumin banks peninsula: a new termination variant characterized by electrospray mass spectrometry, Biochem Biophys Acta. Differential splicing of pre-messenger RNA products multiple forms of maturity capsule alpha (sl) -casein, Eur J Biochem. 1997 Oct 1; 249 (1): 1-7, for PCR-based confirmation: Wellmann S etr. Vascular endothelial growth factor (VEGF) splice variants by LightCycler technology, Clin Chem. 2001 Apr; 47 (4): es f et al. Sing a genomics-based approach, Gene.2001 Jan 24; 263 (1-2): 211-8, for PCR-based confirmation and 5'RACE confirmation: Brigle, KE et al., Organization of the reduced for example, carrier carrier gene and identification of variant splice forms, Biochem Biophys Acta. 1997 Aug 7; 1353 (2): 191-8).

  It is known in the art that genomic regions are regulated in cancer. Recently, Porka et al. (2002) reported that transcriptional variants of STEAP2 were expressed and found in both normal and malignant prostate tissues (Porkka, K.P. et al., Cloning and charactrization). of a novel six-transmembrane protein STEAP2, expressed in normal and migrated prostate. Laboratory Investigation 2002 Nov; 82 (11): 1573-1582). Another group of scientists also reported that a transcriptional variant of STEAP2 (here 98P4B6 v.6) was also expressed significantly higher in prostate cancer than in normal prostate (Korkmaz, K S. et al., Molecular cloning and characterization of STAMP1, a highly prosthesis-specific 6 tran e s s s s s s e n s e n s e n e s e n e n e n e n e n e n e n e n e n e n e n e n e n e n e n e n e n e n e e n e n e n e n When the genomic region for a genetic map is regulated in a particular cancer, the selective transcript or splicing variant of that gene is also regulated. It is disclosed herein that 98P4B6 has a specific expression profile associated with cancer. Alternative transcripts and splicing variants of 98P4B6 may also be involved in cancer in the same or different tissues and thus serve as tumor associated markers / antigens.

  Using the full-length gene and EST sequence, seven transcriptional variants were identified and, as shown in FIG. 12, 98P4B6 v. 2, v. 3, v. 4, v. 5, v. 6, v. 7 and v. Designated as 8. 98P4B6, the original transcript, v. The exon boundaries of 1 are shown in Table LI. v. The first 22 bases of 1 are v. In recent assembly of the human genome. It was not near the 1 '5' region. 98P4B6 v. 1 compared to v. 2, the 3 'portion is v. It was a transcript of a single exon that was the same as one final exon. v. The first two exons of 3 are v. 1 in the first intron. Variant v. 4, v. 5 and v. 6 is v. The first exon of 224-334 was spliced out. Furthermore, v. 5 splices out exon 5, while v. 6 spliced out exon 6, but v. 1 exon 5 was elongated. Variant v. 7 used an alternative transcription start and another 3 'exon. Variant v. 8 extends the 5 'end, v. One full fifth intron was maintained. Theoretically, in spatial order, each different combination of exons (eg, exon 2 and exon 3) is a potential splicing variant.

  Tables LII-LV show the principle for each variant. Tables LII (a)-(g) show the nucleotide sequences of transcriptional variants. Table LIII (a)-(g) shows transcription variants and 98P4B6 v. 1 shows alignment with one nucleic acid sequence. Tables LIV (a)-(g) describe the amino acid translation of the transcriptional variants for the identified reading frame directions. Tables LV (a)-(g) show the amino acid sequence encoded by the splice variant and 98P4B6 v. The alignment with the amino acid sequence of 1 is shown. In addition, single nucleotide polymorphisms (SNPs) are noted in the alignment.

(Example 6: Single nucleotide polymorphism of 98P4B6)
A single nucleotide polymorphism (SNP) is a single base pair modification at a particular position in a nucleotide sequence. There are four possible nucleotide base pairs (A / T, C / G, G / C and T / A) at a particular point in the genome. A genotype refers to a specific base pair sequence at one or more positions in an individual genome. A haplotype often refers to the base pair organization of more than one altered position on the same DNA molecule (a chromosome in a higher organism) in the context of one gene or in the context of several closely linked genes. Say. SNPs that occur on cDNA are called cSNPs. These cSNPs can change the amino acids of the protein encoded by the gene and thus change the function of the protein. Some SNPs cause genetic diseases, and others contribute to quantitative variation in phenotype and response to environmental factors (including diet and drugs) between individuals. Thus, combinations of SNPs and / or alleles (called haplotypes) have many applications (diagnosis of genetic diseases, determination of drug response and dosage, identification of genes responsive to diseases, and inheritance between individuals. (P. Nowotny, JM Kwon and AM Goate, "SNP analysis to detect human traits" Curr. Opin. Neurobiol. 2001 Oct; 11 (5): 637-641; M. Pirhamhamed and B. K. Park, “Genetic Susceptibility to Adverse Drug Reactions,” Trends Pharmacol. Sci. 2001 Jun; 22 (6): 298-305; ey, C. J. Allan, E. Lai, and A. Roses, “The use of single nucleotides in the isolation of common diseases genes”, J. Ron. C. Stephens and A. Windemuth, “The predictive power of haplotypes in clinical response” Pharmacogenomics. 2000 feb; 1 (1): 15-26).

  SNPs are identified by a variety of methods accepted in the art (P. Bean, “The proposing voice of SNP target discovery” Am. Clin. Lab. 2001 Oct-Nov; 20 (9): 18-20; K. M. Weiss, “In search of human variation” Genome Res. 1998 Jul; 8 (7): 691-697: MM She, and “Effective large-scale pharmacogenetics by the biotechnology” Clin. Chem. 2001 Feb; 47 (2): 64-172). For example, SNPs are identified by sequencing DNA fragments that exhibit polymorphism by gel-based methods (eg, restriction fragment length polymorphism (RFLP) and denaturing gradient gel electrophoresis (DGGE)). These can also be found by direct sequencing of DNA samples pooled from different individuals or by comparing sequences from different DNA samples. Using the rapid accumulation of sequence data in public and private databases, computer programs (Z. Gu, L. Hillier and PY Kwok, “Single nucleotide polymorphism hunting in cyberspace” Hum. Mutat. 1998; 12; SNPs can be found by comparing sequences using (4): 221-225). SNPs can be confirmed and individual genotypes or haplotypes can be determined by various methods including direct sequencing and high-throughput microarrays (PY Kwok, “Methods for genetyping single nucleotide polymorphisms” Annu. Rev. Genomics Hum.Genet.2001; 2: 235-258; M.Kokoris, K.Dix, K.Moynihan, J.Mathis, B.Erwin, P.Grass, B.Hines and A.Dusterhoeft, "High-ThroughPh Genotyping with the Masscode system "Mol. Diagnostic. 2000 Dec; 5 (4 : 329-340).

  Using the method described above, 11 SNPs were converted from the original transcript 98P4B6 v. 1 at positions 46 (A / G), 179 (C / T), 180 (A / G), 269 (A / G), 404 (G / T), 985 (C / T), 1170 (T / C), 1497 (A / G), 1746 (T / G), 2046 (T / G) and 2103 (T / C). Transcripts or proteins with alternative alleles can be obtained from 98P4B6 v. 9-v. Designated as 19. FIG. 11 shows a schematic alignment of protein variants corresponding to nucleotide variants. 98P4B6 v. A nucleotide variant encoding the same amino acid sequence as 1 is shown in FIG. These alleles of the SNP are shown separately here, but in different combinations (haptotype) and any one of the transcriptional variants (eg 98P4B6 v.5) (SNP sequence content) It may be present). Furthermore, v. SNPs in other transcriptional variants were also present in the region not shared with 1. For example, transcriptional variants v. 2, v. 6 and v. 8 is part of v. There were 14 SNPs in one fifth intron. These SNPs are shown in FIG. 10c and are listed below (numbers for v.8): 1760 (G / A), 1818 (G / T), 1870 (C / T), 2612 (T / C), 2926 (T / A), 4241 (T / A), 4337 (A / G), 4338 (A / C), 4501 (A / G), 4506 (C / T), 5434 (C / A), 5434 ( C / G), 5434 (C / T) and 5589 (C / A). FIG. 10b shows transcription variants v. SNPs in 7 unique regions are shown: 1956 (A / C), 1987 (T / A), 2010 (G / C), 2010 (G / T) and 2059 (G / A) (v. 7 nucleotides) Number corresponding to the array).

(Example 7: Production of recombinant 98P4B6 in prokaryotic systems)
To express recombinant 98P4B6 and 98P4B6 variants in prokaryotic cells, the full length or partial length 98P4B6 cDNA sequence and 98P41B6 variant cDNA sequence are cloned into any one of various expression vectors known in the art. Can do. Express one or more of the following regions of 98P4B6: full length sequences presented in FIGS. 2 and 3; alternatively, any 8, 9, 10, 11, 12 from 98P4B6, variants or analogs thereof 13, 13, 15, 16, 17, 18, 19, 20, 21, 21, 23, 24, 25, 26, 27, 28, 29, 30 or more consecutive amino acids.

(A. In vitro transcription and translation constructs)
pCRII: To create 98P4B6 sense and antisense RNA probes for RNA in situ studies, a pCRII construct (Invitrogen, Carlsbad CA) is generated, which encodes either the entire 98P4B6 cDNA or a fragment ). The pCRII vector has Sp6 and T7 promoters flanking the insert and drives transcription of 98P4B6 RNA for use as a probe in RNA in situ hybridization experiments. These probes are used to analyze cellular and tissue expression of 98P4B6 at the RNA level. Transcribed 98P4B6 RNA, which represents the cDNA amino acid coding region of the 98P4B6 gene, is used in an in vitro translation system, such as the TnT ^™ Coupled Reticulylate System (Promega, Corp., Madison, WI) to synthesize 98P4B6 protein.

(B. Bacterial construct)
pGEX construct: To produce a recombinant 98P4B6 protein, which is fused to a glutathione S-transferase (GST) protein, in bacteria, all or part of the 98P4B6 cDNA protein coding sequence is converted to a GST-fusion of the pGEX family. Cloning into a vector (Amersham Pharmacia Biotech, Piscataway, NJ). These constructs allow for controlled expression of recombinant 98P4B6 protein sequences with GST fused at the amino terminus and six histidine epitopes at the carboxyl terminus (6 × His). This GST and 6 × His tag allows for purification of recombinant fusion proteins from bacteria derived using an appropriate affinity matrix and allows recognition of fusion proteins using anti-GST and anti-His antibodies. . The 6 × His tag is created, for example, by adding six histidine codons to the cloning primer at the 3 ′ end of the open reading frame (ORF). A protein cleavage site (eg, the PreScience ^™ recognition site in pGEX-6P-1) may be used to allow cleavage of the GST tag from 98P4B6-related proteins. The ampicillin resistance gene and the pBR322 origin are E. coli. Allows selection and maintenance of the pGEX plasmid in E. coli. A glutathione-S-transferase (GST) fusion protein comprising amino acids 2-204 of the STEAP-2 protein sequence was made in the pGEX vector. Recombinant GST-STEAP-2 fusion protein was purified from bacteria derived by glutathione-Sepharose affinity chromatography and used as an immunogen for the production of polyclonal antibodies.

  pMAL construct: In order to produce a recombinant 98P4B6 protein fused to maltose binding protein (MBP) in bacteria, all or part of the 98P4B6 cDNA protein coding sequence is transformed into a pMAL-c2X vector and a pMAL-p2X vector (New England). Fusion to the MBP gene by cloning into Biolabs, Beverly, MA). These constructs allow controlled expression of recombinant 98P4B6 protein sequences with MBP fused at the amino terminus and a 6 × His epitope tag at the carboxyl terminus. This MBP and 6 × His tag allows for the purification of recombinant fusion proteins from bacteria derived using an appropriate affinity matrix and allows for the recognition of fusion proteins using anti-MBP and anti-His antibodies. . The 6 × His epitope tag is created by the addition of 6 histidine codons to the 3 ′ cloning primer. The factor Xa recognition site allows cleavage of the pMAL tag from 98P4B6. The pMAL-c2X and pMAL-p2X vectors are each optimized to express the recombinant protein in the cytoplasm or periplasm. Periplasmic expression increases the folding of proteins with disulfide bonds.

pET construct: To express 98P4B6 in bacterial cells, all or part of the 98P4B6 cDNA protein coding sequence is cloned into the pET family of vectors (Novagen, Madison, WI). These vectors provide fusion to proteins that increase solubility (eg, NusA and thioredoxin (Trx)), and epitope tags (eg, 6 × His and S-Tag ^™ ) to aid in purification and detection of recombinant proteins. Allows tightly controlled expression of recombinant 98P4B6 protein in bacteria with and without. For example, the construct is made using the pET NusA fusion system 43.1 so that the region of 98P4B6 protein is expressed as an amino-terminal fusion to NusA.

(C. Yeast construct)
pESC constructs: To study the production and function of recombinant proteins, in order to express 98P4B6 in the yeast species Saccharomyces cerevisiae, all or part of the 98P4B6 cDNA protein coding sequence was transformed into a pESC family of vectors (each of which (Including one of four selectable markers, HIS3, TRP1, LEU2, and URA3) (Stratagene, La Jolla, Calif.). These vectors allow for controlled expression from the same plasmid of up to two different genes or cloned sequences containing either Flag ^™ or Myc epitope tags in the same yeast cell. This system is useful for confirming the protein-protein interaction of 98P4B6. Furthermore, expression in yeast results in post-translational modifications (eg, glycosylation and phosphorylation) similar to those found when expressed in eukaryotic cells.

pESP construct: To express 98P4B6 in the yeast species Saccharomyces pombe, all or part of the 98P4B6 cDNA protein coding sequence is cloned into a vector of the pESP family. These vectors allow for controlled high level expression of 98P4B6 protein sequences fused to GST, which assists in purification of the recombinant protein, either at the amino terminus or the carboxyl terminus. The Flag ^™ epitope tag allows detection of recombinant protein using anti-Flag ^™ antibody.

(Example 8: Production of recombinant 98P4B6 in higher eukaryotic systems)
(A. Mammalian construct)
To express recombinant 98P4B6 in eukaryotic cells, the full length or partial length of the 98P4B6 cDNA sequence can be cloned into any one of a variety of expression vectors known in the art. One or more of the following regions of 98P4B6 are expressed in these constructs: 98P4B6 v. 1-v. Amino acids 1 to 255 from 11; or any 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 28, 29, 30 or more contiguous amino acids; or 98P4B6 v. 12 and v. 13, any amino acid 1-1266 from these variants or analogs, or 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more consecutive amino acids.

  These constructs were transfected into any one of a wide variety of mammalian cells such as 293T cells. Transfected 293T cell lysates were probed with the anti-98P4B6 polyclonal serum described herein.

pcDNA4 / HisMax construct: To express 98P4B6 in mammalian cells, the 98P4B6 ORF, or a portion of 98P4B6, was cloned into pcDNA4 / HisMax Version A (Invitrogen, Carlsbad, Calif.). Protein expression is driven by the cytomegalovirus (CMV) promoter and SP16 transcription enhancer. This recombinant protein has Xpress ^™ and six histidine (6 × His) epitopes fused to its amino acid ends. The pcDNA4 / HisMax vector is also a bovine growth hormone (BGH) polyadenylation signal and transcription to increase mRNA stability, along with SV40 origin for episomal replication and simple vector rescue in cell lines expressing large T antigen. Contains termination sequence. The zeocin resistance gene allows selection of mammalian cells that express the protein, and the ampicillin resistance gene and the ColE1 origin are E. coli. Allows selection and maintenance of plasmids in E. coli.

  pcDNA3.1 / MycHis construct: To express 98P4B6 in mammalian cells, the 98P4B6 ORF, or a part thereof, with a consensus Kozak translation initiation site was transferred into pcDNA3.1 / MycHis Version A (Invitrogen, Carlsbad, CA). Cloned. Protein expression is driven from the cytomegalovirus (CMV) promoter. This recombinant protein has a myc epitope and a 6 × His epitope fused to its carboxyl terminus. The pcDNA3.1 / MycHis vector is also a bovine growth hormone (BGH) polyadenylation signal to increase mRNA stability along with SV40 origin for episomal replication and simple vector rescue in cell lines expressing large T antigen. And a transcription termination sequence. A neomycin resistance gene may be used. This is because the neomycin resistance gene allows selection of mammalian cells that express the protein, and the ampicillin resistance gene and the ColE1 origin are E. coli. This is because it enables selection and maintenance of the plasmid in E. coli.

  pcDNA3.1 / GFP construct: To express 98P4B6 in mammalian cells and to allow detection of recombinant proteins using fluorescence, the 98P4B6 ORF sequence was codon optimized according to Mizavekov et al. (1999) cloned into pcDNA3.1 / GFP vector and 98P4B6. GFP. A pcDNA3.1 construct was made. Protein expression is driven from the cytomegalovirus (CMV) promoter. This recombinant protein has a green fluorescent protein (GFP) fused to its carboxyl terminus, facilitating non-invasive in vivo detection and cell biological studies. The pcDNA3.1 / GFP vector is also a bovine growth hormone (BGH) polyadenylation signal to increase mRNA stability, along with SV40 origin for episomal replication and simple vector rescue in cell lines expressing large T antigen. And a transcription termination sequence. The neomycin resistance gene allows selection of mammalian cells that express the protein, and the ampicillin resistance gene and the ColE1 origin are E. coli. Allows selection and maintenance of plasmids in E. coli.

  As shown in FIGS. 17 and 18, 98P4B6. GFP. Transfection of pcDNA3.1 into 293T cells was performed. The results show strong expression of the fusion protein by Western blot analysis (Figure 17), flow cytometry (Figure 18A) and fluorescence microscopy (Figure 18B).

  A further construct with a GFP fusion at the amino terminus was made in pcDNA3.1 / NT-GFP-TOPO, which complements the full length of the 98P4B6 protein.

  pAptag: 98P4B6 ORF, or a portion thereof, was cloned into pAPtag (GenHunter Corp. Nashville, TN). This construct results in the fusion of alkaline phosphatase to the carboxy terminus of 98P4B6 while fusing the IgG kappa signal sequence to the amino terminus. This construct is also made such that an alkaline phosphatase is fused to the amino terminus of the 98P4B6 protein at the amino terminus with an amino terminal IgGκ signal sequence. The resulting recombinant 98P4B6 protein is optimized for secretion into the medium of transfected mammalian cells and used to identify a protein such as a ligand or receptor that interacts with the 98P4B6 protein. Can be done. Protein expression is driven from the CMV promoter and the recombinant protein has a myc epitope and a 6 × His epitope fused to its carboxy terminus, which facilitate detection and purification. The zeocin resistance gene present in the vector allows selection of mammalian cells expressing the recombinant protein and the ampicillin resistance gene is E. coli. Allows selection of plasmids in E. coli.

  pTag5: 98P4B6 ORF, or a portion thereof, is cloned into pTag-5. This vector is similar to pAPtag but does not contain an alkaline phosphatase fusion. This construct produces a 98P4B6 protein with an amino-terminal IgGκ signal sequence and a carboxyl-terminal myc and 6 × His epitope tag that facilitates detection and affinity purification. The resulting recombinant 98P4B6 protein is optimized for secretion into the medium of transfected mammalian cells and used as an immunogen or ligand to produce a protein such as a ligand or receptor that interacts with the 98P4B6 protein. Identified. Protein expression is driven from the CMV promoter. The Zeocin resistance gene present in the vector allows selection of mammalian cells expressing the protein, and the ampicillin resistance gene is E. coli. Allows selection of plasmids in E. coli.

  PsecFc: 98P4B6 ORF, or part thereof, is also cloned into psecFc. This psecFc vector was assembled by cloning human immunoglobulin G1 (IgG) Fc (hinge region, CH2 region, CH3 region) into pSecTag2 (Invitrogen, California). This construct produced a carboxy-terminal IgG1 Fc fusion of 98P4B6 protein, while an IgGK signal sequence was fused to the N-terminus. A 98P4B6 fusion utilizing the mouse IgG1 Fc region is also used. The resulting recombinant 98P4B6 protein is optimized for secretion into the medium of transfected mammalian cells and used as an immunogen or to identify a protein such as a ligand or receptor that interacts with the 98P4B6 protein obtain. Protein expression is driven from the CMV promoter. The hygromycin resistance gene present in the vector allows selection of mammalian cells expressing the recombinant protein, and the ampicillin resistance gene is E. coli. Allows selection of plasmids in E. coli.

  pSRα construct: To create a mammalian cell line that constitutively expresses 98P4B6, the 98P4B6 ORF of 98P4B6 or a portion thereof is cloned into the pSRα construct. Amphoteric and ecotropic retroviruses were transfected with pSRα into 293T-10A1 packaging strain and pSRα and helper plasmids (including deleted packaging sequences) into 293 cells, respectively. Prepared by co-transfection. This retrovirus is used to infect various mammalian cell lines, resulting in the incorporation of the cloned gene 98P4B6 into the host cell line. Protein expression is driven from a long terminal repeat (LTR). The neomycin resistance gene present in the vector allows selection of mammalian cells expressing the protein, and the ampicillin resistance gene and the ColE1 origin are E. coli. Allows selection and maintenance of the plasmid in E. coli. This retroviral vector can then be used for infection and production of various cell lines using, for example, PC3 cells, NIH 3T3 cells, TsuPr1 cells, 293 cells or rat-1 cells.

Additional pSRα constructs were made. These fuse an epitope tag such as FLAG ^{™ to} the carboxy terminus of the 98P4B6 sequence, allowing detection using anti-Flag antigen. For example, the FLAG ^™ sequence: 5 ′ gat tac aag gat gac gac gat aag 3 ′ (SEQ ID NO: 113) is added to the cloning primer at the 3 ′ end of the ORF. An additional pSRα construct is made to generate the full length 98P4B6 protein GFP and myc / 6 × His fusion protein at both the amino and carboxy termini.

  Additional viral vectors: Additional constructs are made for virus-mediated delivery and expression of 98P4B6. High viral titers leading to high level expression of 98P4B6 are achieved in viral delivery systems such as adenoviral vectors and herpes amplicon vectors. The 98P4B6 coding sequence or fragment thereof is amplified by PCR and subcloned into the AdEasy shuttle vector (Stratagene). Recombination and viral packaging are performed according to the manufacturer's instructions to create an adenoviral vector. Alternatively, the 98P4B6 coding sequence or fragment thereof is cloned into an HSV-1 vector (Imgenex) to create a herpesvirus vector. This viral vector is then used for infection of various cell lines such as PC3 cells, NIH 3T3 cells, 293 cells or rat-1 cells.

  Regulated expression system: To control the expression of 98P4B6 in mammalian cells, the coding sequence of 98P4B6, or a part thereof, can be transferred to T-Rex System (Invitrogen), GeneSwitch System (Invitrogen), and tightly-regulated Ecdysystem (Ecdysyston). Cloning into a regulated mammalian expression system such as Stratagene). These systems allow the study of time-dependent and concentration-dependent effects of recombinant 98P4B6. These vectors are then used to control the expression of 98P4B6 in various cell lines such as PC3 cells, NIH 3T3 cells, 293 cells, or rat-1 cells.

(B. Baculovirus expression system)
To produce recombinant 98P4B6 protein in a baculovirus expression system, the 98P4B6 ORF, or a portion thereof, is replaced with the baculovirus transfer vector pBlueBac 4.5 (Invitrogen) (which provides a His tag at the N-terminus) Cloning into. Specifically, pBlueBac-98P4B6 is co-transfected into SF9 (Spodoptera frugiperda) insect cells using the helper plasmid pBac-N-Blue (Invitrogen) to produce a recombinant baculovirus (for details) See Invitrogen's instruction manual). The baculovirus is then collected from the cell supernatant and purified by plaque assay.

  Recombinant 98P4B6 protein is then produced by infection of High Five insect cells (Invitrogen) with purified baculovirus. Recombinant 98P4B6 protein can be detected using anti-98P4B6 antibody or anti-His tag antibody. The 98P4B6 protein can be purified and used in various cell-based assays or as an immunogen to generate polyclonal and monoclonal antibodies specific for 98P4B6.

Example 9 Antigenic profile and secondary structure
5 (AE), FIG. 6 (AE), FIG. 7 (AE), FIG. 8 (AE) and FIG. 9 (AE) are 98P4B6 variants 1, 2, 5 7 illustrates five amino acid profiles (each evaluation is available by accessing the ProtScale molecular biology server ProtScale website (.expasy.ch / cgi-bin / protscale.pl)).

  These profiles: FIG. 5, hydrophilicity (Hopp TP, Woods KR, 1981. Proc. Natl. Acad. Sci. USA 78: 3824-3828); (Kyte J., Doolittle RF, 1982. J. Mol. Biol. 157: 105-132); FIG. 7,% of accessible residues, (Janin J., 1979 Nature 277: 491-492). Figure 8, average flexibility, (Bhaskaran R., and Ponwaswamy P.K., 1988. Int. J. Pept. Protein Res. 32: 242-255); Roux B. 1987 Protein Engineering 1: 289-294); And, if necessary, for example, as in ProtScale website, using other profiles available in the art, to identify each of the antigenic regions 98P4B6 variant proteins. Each of the above amino acid profiles of 98P4B6 variants were generated for analysis using the following ProtScale parameters: 1) window size 9; 2) 100% weight of window edge compared to window center; and 3) 0 Amino acid profile value normalized to be between 1 and 1.

  Using the hydrophilic profile (FIG. 5), hydropathy profile (FIG. 6) and% accessible residue profile (FIG. 7), the hydrophilic amino acid (ie, hydrophilic profile and% accessible residue) Stretches with values greater than 0.5 in the profile and less than 0.5 in the hydropathy profile were determined. Such regions can be exposed to an aqueous environment, can be present on the protein surface, and are therefore available for immune recognition (eg, by antibodies).

  The average flexibility profile (FIG. 8) and β-turn profile (FIG. 9) are amino acids that are not constrained to secondary structures (eg, β-sheet and α-helix) (ie, β-turn profile and average flexibility profile). To determine a stretch with a value greater than 0.5). Such regions are also likely to be exposed portions of the protein and are therefore available for immune recognition (eg, by antibodies).

  For example, illustrated by the profiles shown in FIGS. 5 (AE), 6 (AE), 7 (AE), 8 (AE), and / or 9 (AE). The antigenic sequence of the 98P4B6 variant protein is used to prepare an immunogen (either a peptide or a nucleic acid encoding the peptide) to produce therapeutic and diagnostic anti-98P4B6 antibodies. The immunogen is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, or more than 50 consecutive, listed in FIGS. 2 and 3 It can be any amino acid derived from 98P4B6 protein variant 1, 2, 5-7, or the corresponding nucleic acid encoding it. In particular, the peptide immunogens of the present invention may comprise: at least 5 of any integer increments of FIGS. 2 and 3 including amino acid positions having a value greater than 0.5 in the hydrophilic profile of FIG. A peptide region of at least 5 amino acids of FIG. 2 and FIG. 3 in any integer increments, including amino acid positions having a value of less than 0.5 in the hydropathy profile of FIG. 6; The peptide region of at least 5 amino acids of FIGS. 2 and 3 in any integer increments, including amino acid positions having a value greater than 0.5 in the% accessible residue profile; The peptide region of at least 5 amino acids of FIGS. 2 and 3 in any integer increments, including amino acid positions having a value greater than 0.5 in the profile And it includes an amino acid position having a value greater than 0.5 in β- turn profile of Figure 9, any at least five amino acids of the peptide regions of the integer incremental FIGS. 2 and 3. The peptide immunogens of the invention can also include a nucleic acid encoding any of the above.

  All of the immunogens, peptides, or nucleic acids of the invention can be implemented in human unit dosage forms or can be contained by a composition comprising pharmaceutical excipients that are compatible with human physiology.

  The secondary structure of 98P4B6 variants 1, 2, 5-7 (ie, the presence and location of the predicted α-helix, extended chain, and random coil) was determined by the HNN-Hierarchical Neural Network method (Guermeur, 1997, http: / /Pbil.ibcp.fr/cgi-bin/npsa_automat.pl?page=npsa_nn.html (expasy molecular web server (accessed from world wide web URL: expasy.ch/tools/)) Deduced from the primary amino acid sequence. This analysis shows that 98P4B6 variant 1 is composed of 54.41% α-helix, 12.33% extended strand, and 33.26% random coil (FIG. 13A). 98P4B6 variant 2 is composed of 17.78% α-helix, 6.67% extended strand, and 75.56% random coil (FIG. 13B). 98P4B6 variant 5 is composed of 51.55% α-helix, 13.13% extended strand, and 35.32% random coil (FIG. 13C). 98P4B6 variant 6 is composed of 54.49% α-helix, 11.84% extended strand, and 33.67% random coil (FIG. 13D). 98P4B6 variant 7 is composed of 48.26% α-helix, 15.28% extended strand, and 36.46% random coil (FIG. 13E).

  Analysis of the potential presence of transmembrane domains in 98P4B6 variant proteins was performed using various transmembrane estimation algorithms accessed from the ExPasy molecular biology server (http://www.expasy.ch/tools/). And executed. Illustrated in FIGS. 13F and 13G are the results of analysis of variant 1, the presence and location of the 6th transmembrane domain using the TMpred program (FIG. 13F) and the 5th transmembrane domain using the TMHMM program. The presence and location (FIG. 13G) is shown. Illustrated in FIGS. 13H and 13I are the results of analysis of variant 2, the presence and position of the single transmembrane domain using the TMpred program (FIG. 13H) and the absence of the transmembrane domain using the TMHMM program. (FIG. 13I). Illustrated in FIGS. 13J and 13K are the results of analysis of variant 5, the presence and location of the 6th transmembrane domain using the TMpred program (FIG. 13J) and the 4th transmembrane domain using the TMHMM program. The presence and location (Figure 13K) is shown. Illustrated in FIGS. 13L and 13M are the results of analysis of variant 6, the presence and location of the 6 transmembrane domain using the TMpred program (FIG. 13L) and the 6 transmembrane domain using the TMHMM program. The presence and location (FIG. 13M) is shown. Illustrated in FIGS. 13N and 13O are the results of analysis of variant 7, the presence and location of the 6th transmembrane domain using the TMpred program (FIG. 13N) and the 4th transmembrane domain using the TMHMM program. The presence and location (FIG. 13O) is indicated. The results of each program (ie, the amino acids encoding the transmembrane domain) are summarized in Table VI.

(Example 10: Production of 98P4B6 polyclonal antibody)
Polyclonal antibodies can be raised in a mammal, for example, by one or more injections of an immune factor and (if desired) an adjuvant. Typically, the immune factor and / or adjuvant is injected into the mammal by multiple subcutaneous or intraperitoneal injections. In addition to immunizing with a full-length 98P4B6 protein variant, in designing an immunogen with characteristics that are antigenic and available for recognition by the immune system of the immunized host based on amino acid sequence analysis, a computer algorithm (See Example 9 entitled “Antigenic Profile and Secondary Structure”). Such regions are presumed to be hydrophilic, flexible, β-turn conformations, and exposed on the surface of the protein (eg, such as 98P4B6 protein variants). See FIG. 5 (AE), FIG. 6 (A and B), FIG. 7 (AE), FIG. 8 (AE), or FIG. )

  For example, a bacterial recombinant fusion protein or peptide containing the hydrophilic, flexible, β-turn region of a 98P4B6 protein variant is described for generating polyclonal antibodies in New Zealand white rabbits or in Example 11. It is used as an antigen to generate such monoclonal antibodies. For example, in 98P4B6 variant 1, such regions include amino acids 153 to 165, amino acids 240 to 260, and amino acids 345 to 358, but are not limited thereto. In a sequence specific for variant 2, such a region includes, but is not limited to, amino acids 26-38. In a sequence specific to variant 5, such a region includes, but is not limited to, amino acids 400-410. In variant 6, such a region includes, but is not limited to, amino acids 455-490. In a sequence specific for variant 7, such regions include, but are not limited to, amino acids 451-465 and amino acids 472-498. It is useful to conjugate the immune factor to a protein known to be immunogenic in the mammal being immunized. Examples of such immunogenic proteins include, but are not limited to, keyhole limpet hemocyanin (KLH), serum albumin, bovine thyroglobulin, and soybean trypsin inhibitor. In one embodiment, a peptide encoding amino acids 153 to 165 of 98P4B6 variant 1 is conjugated to KLH and used to immunize rabbits. Alternatively, the immune factor can comprise all or part of a 98P4B6 variant protein, analog or fusion protein thereof. For example, the amino acid sequence of 98P4B6 variant 1 is transferred to any one of a variety of fusion protein partners well known in the art, such as glutathione-S-transferase (GST) tagged fusion proteins and HIS tagged fusion proteins. Fusion can be done using recombinant DNA technology. In another embodiment, amino acids 2-204 of variant 1 were fused, expressed, purified, and used to immunize rabbits using recombinant techniques and pGEX expression vectors. Such fusion proteins are purified from bacteria derived using an appropriate affinity matrix.

  Other recombinant bacterial fusion proteins that may be used include maltose binding protein, LacZ, thioredoxin, NusA, or immunoglobulin constant region (see section entitled “Production of 98P4B6 in Prokaryotic Systems”, as well as Current Protocols In Molecular). Biology, Volume 2, Unit 16, edited by Frederick M. Ausubul et al., 1995; Linsley, PS, Brady, W., Urnes, M., Grosmail, L., Damle, N., and Ledbetter, L. ( 1991) J. Exp. Med. 174, 561-566).

  In addition to bacterial-derived fusion proteins, protein antigens expressed by mammals are also used. These antigens are expressed from mammalian expression vectors (eg, Tag5 and Fc fusion vectors) (see section entitled “Production of Recombinant 98P4B6 in Eukaryotic Systems”). These antigens retain post-translational modifications (eg, glycosylation) found in native proteins. In one embodiment, amino acids 324-359 of variant 1 (encoding the extracellular loop between transmembrane domains) are cloned into a Tag5 mammalian secretion vector. The recombinant protein is purified by metal chelate chromatography from tissue culture supernatants of 293T cells that stably express the recombinant vector. The purified Tag5 98P4B6 protein is then used as an immunogen.

  During this immunization protocol, it is useful to mix or emulsify the antigen in an adjuvant that enhances the host animal's immune response. Examples of adjuvants include, but are not limited to, complete Freund's adjuvant (CFA) and MPL-TDM adjuvant (monophosphoryl lipid A, synthetic trehalose dicorynomycolate).

  In a typical protocol, rabbits are first immunized subcutaneously with up to 200 μg (typically 100-200 μg) of fusion protein or peptide conjugated to KLH mixed in complete Freund's adjuvant (CFA). Rabbits are then injected subcutaneously every 2 weeks with up to 200 μg (typically 100-200 μg) of immunogen in incomplete Freund's adjuvant (IFA). Approximately 7-10 days after each immunization, test bleeds are collected and used to monitor antiserum titers by ELISA.

  To test the reactivity and specificity of immune sera (eg, rabbit serum induced by immunization with Tag5-98P4B6 variant protein 1), the full-length 98P4B6 variant 1 cDNA was transformed into a pCDNA3.1 myc-his expression vector ( Invitrogen) (see example entitled “Production of recombinant 98P4B6 in eukaryotic systems”). After transfection of the construct into 293T cells, cell lysates were probed with anti-98P4B6 serum and anti-His antibody (Santa Cruz Biotechnologies, Santa Cruz, Calif.) And specific for denatured 98P4B6 protein using Western blot technology. To determine mechanical reactivity. Detection of 98P4B6 variant 1 expressed in 293T using polyclonal antibodies raised against GST fusion proteins and peptides is shown in FIGS. 17B and 17C, respectively. In addition, the immune serum is tested against 293T cells and other recombinant 98P46B6 expressing cells by fluorescence microscopy, flow cytometry, and immunoprecipitation to determine specific recognition of the native protein. To do. Cells that endogenously express 98P4B6 are used to perform Western blot, immunoprecipitation, fluorescence microscopy, and flow cytometry techniques to test reactivity and specificity.

  Antisera from rabbits immunized with 98P4B6 variant fusion proteins (eg, GST and MBP fusion proteins), either alone or in conjunction with an irrelevant fusion protein Purify by removing the antibody against its fusion partner sequence by passing it through an affinity column. For example, antisera from GST-98P4B6 variant 1 fusion protein is purified by passing through a column of GST protein covalently linked to an Affigel matrix (BioRad, Hercules, Calif.). The antiserum is then affinity purified by passing through a column composed of MBP-98P4B6 fusion protein covalently linked to an Affigel matrix. The serum is then further purified by protein G affinity chromatography to isolate the IgG fraction. Columns composed of sera from other His-tagged antigen and peptide immunized rabbits, as well as fusion partner-removed sera, from the original protein immunogen or free peptide (eg, anti-peptide polyclonal antibody used in FIG. 17C) Affinity purification by passing through a matrix.

(Example 11: Production of 98P4B6 monoclonal antibody (mAb))
In one embodiment, therapeutic mAbs against 98P4B6 variants are mAbs that react with epitopes specific for each variant protein, or variants that disrupt or modulate the biological function of the 98P4B6 variant (eg, ligands). And variants that disrupt the interaction with the binding partner) include mAbs that react with epitopes specific for sequences common to them. Immunogens for the production of such mAbs include the entire 98P4B6 protein variant sequence, the 98P4B6 variant region predicted to be antigenic from computer analysis of its amino acid sequence (eg, FIGS. 5A-E). 6 (A-E), FIG. 7 (A-E), FIG. 8 (A-E), or FIG. See Immunogens include peptides, recombinant bacterial proteins, and Tag5 proteins expressed by mammals, as well as human and mouse IgG FC fusion proteins. In addition, to immunize mice with cells engineered to express high levels of individual 98P4B6 variants (eg, 293T-98P4B6 variant 1 or 300.19-98P4B6 variant 1 mouse Pre-B cells). Used for.

To generate mAbs against 98P4B6 variants, mice were first injected intraperitoneally (IP), typically with 10-50 μg of protein immunogen or 10 ⁷ 98P4B6 expressing cells mixed in complete Freund's adjuvant. Immunize. Mice are then IP immunized every 2-4 weeks with 10-50 μg of protein immunogen or 10 ⁷ cells mixed in incomplete Freund's adjuvant. Alternatively, MPL-TDM adjuvant is used in immunization. In addition to the protein and cell-based immunization strategies described above, DNA-based immunization protocols are used. In this protocol, a mammalian expression vector encoding a 98P4B6 variant sequence is used to immunize mice by direct injection of the plasmid DNA. For example, amino acids 324-359 are cloned into a Tag5 mammalian secretion vector and the recombinant vector is used as an immunogen. In another example, the same amino acid is cloned into an Fc fusion secretion vector. In this vector, this 98P4B6 variant 1 sequence is fused to the IgK leader sequence at the amino acid terminus and to the coding sequence of the human IgG Fc region or mouse IgG Fc region at the carboxy terminus. This recombinant vector is then used as an immunogen. This plasmid immunization protocol is used in combination with purified protein expressed from the same vector and in combination with cells expressing individual 98P4B6 variants.

  During this immunization protocol, test bleeds are obtained 7-10 days after injection to monitor the titer and specificity of the immune response. Once the appropriate reactivity and specificity has been determined by ELISA, Western blotting, immunoprecipitation, fluorescence microscopy, and flow cytometry analysis, fusion and hybridoma production is then well known in the art. Perform using established procedures (see, eg, Harlow and Lane, 1988).

  In one embodiment for generating 98P4B6 monoclonal antibodies, Tag5-98P4B6 variant 1 antigen encoding amino acids 324-359 is expressed and purified from stably transfected 293T cells. Balb C mice are first immunized intraperitoneally with 25 μg of Tag5-98P4B6 variant 1 protein mixed in complete Freund's adjuvant. The mice are then immunized 3 times every 2 weeks with 25 μg of the light source mixed in incomplete Freund's adjuvant. This ELISA using Tag5 antigen determines the titer of serum from immunized mice. Serum reactivity and specificity for full length 98P4B6 variant 1 protein is monitored by Western blotting, immunoprecipitation and flow cytometry using 293T cells transfected with an expression vector encoding 98P4B6 variant 1 cDNA ( See, for example, the example entitled “Recombinant 98P4B6 Production in Eukaryotic Systems” and FIG. 20). Other recombinant 98P4B6 variant 1 expressing cells or cells that endogenously express 98P4B6 variant 1 are also used. Mice showing the strongest reactivity are rested and given a final injection of Tag5 antigen in PBS and sacrificed 4 days later. The spleens of sacrificed mice are collected and fused to SPO / 2 myeloma cells using standard procedures (Harlow and Lane, 1988). Supernatants from HAT selective growth wells are screened by ELISA, Western blot, immunoprecipitation, fluorescence microscopy, and flow cytometry to identify clones that produce 98P4B6-specific antibodies.

  In order to generate monoclonal antibodies specific for each 98P4B6 variant protein, the immunogen is designed to encode a sequence that is unique for each variant. In one embodiment, a Tag5 antigen encoding the complete sequence of 98P4B6 variant 2 (AA 1-45) is generated, purified, and used as an immunogen to produce a monoclonal antibody specific for 98P4B6 variant 2 To induce. In another embodiment, an antigenic peptide composed of amino acids 400-410 of 98P4B6 variant 5 binds to KLH and is used as an immunogen. In another embodiment, a GST fusion protein encoding amino acids 455-490 of 98P4B6 variant 6 is used as an immunogen to induce variant 6 specific monoclonal antibodies. In another embodiment, a peptide composed of amino acids 472-498 of variant 7 is conjugated to KLH and used as an immunogen to generate variant 7 specific monoclonal antibodies. The hybridoma supernatant is then screened for individual antigens, then further screened for cells expressing that particular variant, cross-screened for cells expressing other variants, and variant-specific monoclonal antibodies To induce.

  The binding affinity of the 98P4B6 variant monoclonal antibody is determined using standard techniques. The affinity measurement quantifies the strength of antigen binding to the epitope. Affinity measurements are used to help define which 98P4B6 variant monoclonal antibodies are preferred for diagnostic or therapeutic use, as will be appreciated by those skilled in the art. The BIAcore system (Uppsala, Sweden) is a preferred method for determining binding affinity. The BIAcore system uses surface plasmon resonance (SPR, Welford K. 1991, Opt. Quant. Elect. 23: 1; Morton and Myszka, 1998, Methods in Enzymology 295: 268) in real time. To monitor. BIAcore analysis conveniently generates association rate constants, dissociation rate constants, equilibrium dissociation constants, and affinity constants.

Example 12: HLA class I binding assay and HLA class II binding assay
HLA class I binding assays and HLA class II binding assays using purified HLA molecules can be performed using the disclosed protocols (eg, PCT publications WO94 / 201527 and WO94 / 03205; Sidney et al., Current Protocols in Immunology 18.3.1 (1998). Sidney et al., J. Immunol. 154: 247 (1995); Sette et al., Mol. Immunol. 31: 813 (1994)). Briefly, purified MHC molecules (5-500 nM) are incubated with various unlabeled peptide inhibitors and 1-10 nM ¹²⁵ I radiolabeled probe peptide as described. Following incubation, the MHC-peptide complex is separated from free peptide by gel filtration and the fraction of bound peptide is measured. Typically, in preliminary experiments, each MHC preparation is titrated in the presence of a certain amount of radiolabeled peptide and the HLA molecules required to bind 10-20% of the total radioactivity. Determine the concentration of. All subsequent inhibition and direct binding assays are performed using these HLA concentrations.

Under these conditions [label] <[HLA] and IC ₅₀ ≧ [HLA], the measured IC ₅₀ value is a reasonable approximation of the true _KD value. Peptide inhibitors are typically tested at concentrations ranging from 120 μg / ml to 1.2 ng / ml and are tested in 2 to 4 completely independent experiments. In order to allow comparison of the data obtained in the various experiments, the relative binding number is calculated for each peptide. This calculation, the IC ₅₀ of a positive control for inhibition, _(typically unlabeled versions of the radiolabeled probe peptide) IC 50 of each peptide was tested by dividing by. Relative binding values are tabulated for database purposes and for comparison between experiments. These values can then be converted back to IC ₅₀ nM values. This conversion is by dividing the positive control IC ₅₀ nM for inhibition by the relative binding of the peptide of interest. This data aggregation method is accurate and consistent for comparison of peptides tested on different days or peptides tested with different lots of purified MHC.

  Binding assays as outlined above can be used to analyze HLA supermotif and / or HLA motif-bearing peptides (see Table IV).

(Example 13: Identification of CTL candidate epitope with HLA supermotif and CTL candidate epitope with HLA motif)
The HLA vaccine composition of the present invention may comprise multiple epitopes. The multiple epitopes can include multiple HLA supermotifs or HLA motifs to achieve a broad population range. This example demonstrates the identification and confirmation of supermotif and motif-bearing epitopes for inclusion in such vaccine compositions. Population range calculations are performed using the following strategy.

(Computer search and algorithm for identification of supermotif and / or motif-bearing epitopes)
An example entitled “Antigenic Profile” and searches performed to identify motif-bearing peptide sequences in Tables VIII-XXI and XXII-XLIX were performed using protein sequence data from the 98P4B6 gene product shown in FIGS. The specific search peptides used to generate the table are listed in Table VII.

  A computer search for epitopes carrying an HLA class I super motif or HLA class I motif or HLA class II super motif or HLA class II motif is performed as follows. All 98P4B6 protein sequences to be translated are analyzed using a string search software program to identify peptide sequences that may contain the appropriate HLA binding motif; Considering the supermotif disclosure, it is easily created according to information in the field. Furthermore, such calculations can be done in the head.

The identified A2, A3, and DR supermotif sequences are scored using a polynomial algorithm, and these motifs bind to specific HLA-class I or HLA-class II molecules Guess the ability to do. These polynomial algorithms consider the effects of different amino acids at different positions. These polynomial algorithms show that the total affinity of peptide-HLA molecule interactions (ie ΔG) is
“ΔG” = a _1i × a _2i × a _3i . . . × a _ni
Based on the premise that can approximate as type linear polynomial function of the essentially where, a _ji is a predetermined along the peptide sequence of n amino acids in position (i) amino acids in the presence of (j) A coefficient indicating the effect. The critical assumption of this method is that the effects at each position are essentially independent of each other (ie, independent bonds of individual side chains). If residue j is present at position i in the peptide, it is assumed that it contributes a certain amount j _i to the free energy of binding of the peptide, regardless of the rest of the sequence of the peptide.

Specific algorithm coefficient derivation methods are described in Gulukota et al. Mol. Biol. 267: 1258-126, 1997 (see also Sidney et al., Human Immunol. 45: 79-93, 1996; and Southwood et al., J. Immunol. 160: 3363-3373, 1998). Briefly, for all i positions, the anchor and non-anchor as well as the geometric mean of the average relative binding (ARB) of all peptides carrying j are calculated against the rest of the group, and j Used as an estimate of _i . For multiple class II peptides, if multiple alignments are possible, only the highest scoring alignment is utilized according to an iterative procedure. To calculate the algorithm score for a given peptide in the test set, the ARB value corresponding to the sequence of that peptide is multiplied. If this product exceeds the selected threshold, the peptide is presumed to bind. Appropriate thresholds are selected as a function of the desired degree of estimated stringency.

(Selection of HLA-A2 supertype cross-reactive peptide)
Protein sequences from 98P4B6 are scanned using motif identification software to identify 8-mer, 9-mer, 10-mer, and 11-mer sequences that contain the HLA-A2 supermotif major anchor specificity. Typically, these sequences are then scored using the protocol described above, and peptides corresponding to sequences with positive scores are synthesized, and these in vitro purified HLA-A ^* 0201 molecules (HLA-A ^* 0201 is considered a prototype A2 supertype molecule).

These peptides are then tested for the ability to bind to additional A2 supertype molecules (A ^* 0202, A ^* 0203, A ^* 0206, and A ^* 6802). Peptides that bind to at least three of the five A2 supertype alleles tested are typically considered A2 supertype cross-reactive conjugates. Preferred peptides bind to 3 or more HLA-A2 supertype molecules with an affinity of 500 nM or less.

(Selection of epitope bearing HLA-A3 supermotif)
The 98P4B6 protein sequence scanned above is also tested for the presence of peptides with the HLA-A3 supermotif major anchor. A peptide corresponding to the HLA-A3 supermotif carrying sequence is then synthesized and into HLA-A ^* 0301 and HLA-A ^* 1101 molecules (molecules encoded by the two most prominent A3 supertype alleles) Test for binding. A peptide that binds to at least one of its two alleles with a binding affinity of ≦ 500 nM, often ≦ 200 nM, is then transferred to other common A3 supertype alleles (eg, A ^* 3101, A ^* 3301). And A ^* 6801) to identify binding molecules that can bind to at least three of the five HLA-A3 supertype molecules tested.

(Selection of epitope bearing HLA-B7 supermotif)
The 98P4B6 protein scanned above is also analyzed for the presence of 8-mer, 9-mer, 10-mer, or 11-mer peptides containing the HLA-B7 supermotif. Corresponding peptides are synthesized and tested for binding to HLA-B ^* 0702 (the molecule encoded by the most common B7 supertype allele (ie, the prototype B7 supertype allele)). Peptides that bind B ^* 0702 with an IC ₅₀ ≦ 500 nM are identified using standard methods. These peptides are then tested for binding to other common B7 supertype molecules (eg, B ^* 3501, B ^* 5101, B ^* 5301 and B ^* 5401). Thereby, peptides that can bind to three or more of the five B7 supertype alleles to be tested are identified.

(Selection of A1 motif-bearing epitope and A24 motif-bearing epitope)
To further increase the population range, HLA-A1 and HLA-A24 epitopes can also be incorporated into the vaccine composition. Analysis of 98P4B6 protein can also be performed to identify HLA-A1 motif-containing sequences and HLA-A24 motif-containing sequences.

  High affinity and / or cross-reactive binding epitopes carrying other motifs and / or supermotifs are identified using similar methodologies.

(Example 14: Confirmation of immunogenicity)
Cross-reactive candidate CTL A2 supermotif-bearing peptides identified as described herein are selected to confirm in vitro immunogenicity. Confirmation is performed using the following methodology.

(Target cell line for cell screening)
The HLA-A2.1 gene was generated by transfer to 721.221, an HLA-A, HLA-B, HLA-C null mutant human B lymphoblast cell line. The 221A2.1 cell line is used as a peptide loading target to measure the activity of HLA-A2.1 restricted CTL. This cell line is grown in RPMI-1640 medium supplemented with antibiotics, sodium pyruvate, non-essential amino acids, and 10% (v / v) heat inactivated FCS. A cell expressing the antigen of interest, or a transfectant containing a gene encoding the antigen of interest can be used as a target cell to confirm the ability of the peptide-specific CTL to recognize the endogenous antigen.

(Primary CTL induction culture)
(Production of dendritic cells (DC)) PBMCs were thawed in RPMI containing 30 μg / ml DNAse, and complete medium (RPMI-1640 + 5% AB human serum, non-essential amino acids, sodium pyruvate, L-glutamine and penicillin) / Streptomycin) and resuspend in this complete medium. The monocytes are purified by plating at 10 × 10 ⁶ PBMC / well in 6 well plates. After 2 hours at 37 ° C., non-adherent cells are removed by gently shaking the plate and aspirating the supernatant. The wells are washed a total of 3 times with 3 ml RPMI to remove most non-adherent and loosely adherent cells. Thereafter, 3 ml of complete medium containing 50 ng / ml GM-CSF and 1,000 U / ml IL-4 is added to each well. On day 6, TNFα is added to DC at 75 ng / ml and on day 7, the cells are used for CTL-induced culture.

Induction of CTL using DCs and peptides CD8 + T cells are isolated by positive selection using Dynal immunomagnetic beads (Dynabeads® M-450) and dechacha-bead® reagents. Typically, about 200 × 10 ⁶ to 250 × 10 ⁶ PBMC are processed to obtain 24 × 10 ⁶ CD8 ⁺ T cells (sufficient for 48-well plate culture). Briefly, PBMCs are thawed in RPMI containing 30 μg / ml DNAse and washed once with PBS containing 1% human AB serum and in PBS / 1% AB serum at a concentration of 20 × 10 Resuspend at ⁶ cells / ml. Magnetic beads are washed 3 times with PBS / AB serum, added to the cells (140 μl beads / 20 × 10 ⁶ cells) and incubated for 1 hour at 4 ° C. with continued mixing. The beads and cells were washed 4 times with PBS / AB serum to remove non-adherent cells and in PBS / AB serum containing 100 μl / ml detergent-bead® reagent and 30 μg / ml DNAse. Resuspend at 100 × 10 ⁶ cells / ml (based on the original cell number). The mixture is incubated for 1 hour at room temperature with continued mixing. The beads are washed again with PBS / AB / DNAse and CD8 + T cells are collected. DCs were collected and centrifuged at 1300 rpm for 5-7 minutes, washed once with PBS containing 1% BSA, counted and at 20 ° C. in the presence of 3 μg / ml β ₂ -microglobulin. Pulse with 40 μg / ml peptide at a cell concentration of 1 × 10 ⁶ to 2 × 10 ⁶ / ml for 4 hours. The DC is then irradiated (4,200 rad), washed once with media and counted again.

Induction culture settings 0.25 ml of cytokine-producing DC (1 × 10 ⁵ cells / ml) in the presence of 10 ng / ml IL-7 in 0.25 ml CD8 + T cells in each well of a 48-well plate Co-culture with (2 × 10 ⁶ cells / ml). The next day, recombinant human IL-10 is added at a final concentration of 10 ng / ml, and 48 hours later, rhuman IL-2 is added at 10 IU / ml.

Restimulation of induced cultures using adherent cells pulsed with peptide After 7 and 14 days of primary induction, the cells are restimulated with adherent cells pulsed with peptide. Thaw the PBMC and wash twice with RPMI and DNAse. The cells are resuspended at 5 × 10 ⁶ cells / ml and irradiated at about 4200 rad. PBMCs are plated at 2 × 10 ⁶ in 0.5 ml complete medium per well and incubated at 37 ° C. for 2 hours. The plate was washed twice with RPMI by gentle tapping to remove non-adherent cells and 10 μg / ml in the presence of 3 μg / ml β ₂ microglobulin in 0.25 ml RPMI / 5% AB / well. Adherent cells are pulsed with the peptide of 2 hours at 37 ° C. Peptide solution is aspirated from each well and the wells are washed once with RPMI. Most of the medium is aspirated from the induction culture (CD8 + cells) and made up to 0.5 ml with fresh medium. The cells are then transferred to a well containing adherent cells pulsed with the peptide. After 24 hours, recombinant human IL-10 is added at a final concentration of 10 ng / ml, and again the next day and 2-3 days later, recombinant human IL2 is added at 50 IU / ml (Tsai et al., Critical Reviews in Immunology 18 (1-2): 65-75, 1998). After 7 days, the culture is assayed for CTL activity in a ⁵¹ Cr release assay. In some experiments, the cultures are assayed for peptide specific recognition in an in situ IFNγ ELISA during the second re-stimulation, and after 7 days, an assay for endogenous recognition is performed. After growth, activity is measured in both assays for side-by-side comparison.

(Measurement of CTL dissolution activity by ⁵¹ Cr release)
Seven days after the second restimulation, cytotoxicity is determined in a standard (5 hour) ⁵¹ Cr release assay by assaying individual wells at a single E: T. Peptide pulsed targets are prepared by incubating the cells with 10 μg / ml peptide overnight at 37 ° C.

Adherent target cells are removed from the culture flask using trypsin-EDTA. Target cells are labeled with 200 μCi of ⁵¹ Cr sodium chromate (Dupont, Wilmington, DE) for 1 hour at 37 ° C. Labeled target cells are resuspended at 10 ⁶ per ml and using K562 cells (NK sensitive erythroblastoma line used to reduce non-specific lysis) at a concentration of 3.3 × 10 ⁶ / ml. Dilute 1:10. Target cells (100 μl) and effectors (100 μl) are plated in 96 well round bottom plates and incubated at 37 ° C. for 5 hours. At that time, 100 μl of supernatant is collected from each well and the formula:
[(Test sample cpm−spontaneously generated ⁵¹ Cr released sample cpm) / (maximum ⁵¹ Cr released sample cpm−spontaneously generated ⁵¹ Cr released sample cpm)] × 100
To determine the percent dissolution.

  Maximum release and spontaneous release are determined by incubating the labeled target with 1% Triton X-100 and media alone, respectively. As a culture with specific lysis (sample-background)> 10% for individual wells and> 15% at the highest two E: T ratios when assaying grown cultures Define a positive culture.

(In situ measurement of human IFNγ production as an indicator of peptide-specific and endogenous recognition)
Immulon 2 plates are coated overnight at 4 ° C. using mouse anti-human IFNγ monoclonal antibody (4 μg / ml 0.1 M NaHCO ₃ , pH 8.2). The plate was washed with Ca ²⁺ , Mg ²⁺ free PBS / 0.05% Tween 20, blocked for 2 hours using PBS / 10% FCS, then CTL (100 μl / well) and target (100 μl / well) Is added to each well, and the standard and blank wells are left empty (with medium only). Target cells (either peptide pulse or endogenous target) are used at a concentration of 1 × 10 ⁶ cells / ml. Plates are incubated for 48 hours at 37 ° C. with 5% CO ₂ .

Recombinant human IFN-γ is added to standard wells starting at 400 pg / 100 μl / well or 1200 pg / 100 μl / well and the plate is incubated at 37 ° C. for 2 hours. The plate is washed and 100 μl of biotinylated mouse anti-human IFN-γ monoclonal antibody (2 μg / ml in PBS / 3% FCS / 0.05% Tween 20) is added and incubated for 2 hours at room temperature. After washing again, 100 μl HRP-streptavidin (1: 4000) is added and the plate is incubated at room temperature for 1 hour. The plate is then washed 6 times with wash buffer, 100 μl / well of color development solution (TMB 1: 1) is added and the plate is allowed to develop for 5-15 minutes. The reaction is stopped using 50 μl / well 1M H ₃ PO ₄ and read at OD450. A culture is considered positive if at least 50 pg of IFN-γ / well is measured above background and is twice the background level of expression.

(CTL proliferation)
Cultures exhibiting specific lytic activity against peptide-pulsed targets and / or tumor targets are grown for 2 weeks with anti-CD3. Briefly, 5 × 10 ⁴ CD8 ⁺ cells are added to a T25 flask containing: RPMI-1640 (10% (v / v) human AB serum, nonessential amino acids, sodium pyruvate, 25 μM 2-mercaptoethanol. 1 × 10 ⁶ irradiated (4,200 rad) PBMC (autologous or allogeneic) / ml, 2 × 10 ⁵ irradiated (8,000 rad) EBV transformed cells in 1 ml containing L-glutamine and penicillin / streptomycin) / Ml, and 30 ng / ml OKT3 (anti-CD3). Recombinant human IL2 is added 24 hours later at a final concentration of 200 IU / ml, followed by fresh medium at 50 IU / ml every 3 days thereafter. When the cell concentration exceeds 1 × 10 ⁶ / ml, the cells are split and the cultures are divided into 13-15 at an E: T ratio of 30: 1, 10: 1, 3: 1 and 1: 1 in a ⁵¹ Cr release assay. Assay during the day or assay at 1 × 10 ⁶ / ml in an in situ IFNγ assay using the same target as before growth.

Cultures are grown in the absence of anti-CD3 ⁺ as follows. Cultures exhibiting specific lytic activity against peptides and endogenous targets are selected and 5 × 10 ⁴ CD8 ⁺ cells are added to a T25 flask containing: RPMI-1640 (10% (v / v) human AB serum 1 × 10 ⁶ autologous PBMC / ml (containing 10 μg / ml peptide for 2 hours at 37 ° C. in 1 ml, non-essential AA, containing sodium pyruvate, 25 mM 2-ME, L-glutamine and gentamicin) And irradiated (4,200 rad)); 2 × 10 ⁵ irradiated (8,000 rad) EBV transformed cells / ml.

(Immunogenicity of peptides with A2 supermotif)
A2 supermotif cross-reactive binding peptides are tested in a cellular assay for the ability to induce peptide-specific CTL in normal individuals. In this analysis, a peptide is typically considered an epitope if it induces at least a peptide-specific CTL in the individual, and preferably also recognizes an endogenously expressed peptide.

  Immunogenicity can also be confirmed using PBMCs isolated from patients bearing tumors that express 98P4B6. Briefly, PBMCs are isolated from patients and restimulated with peptide-pulsed monocytes and assayed for their ability to recognize peptide-pulsed target cells and transfected cells that endogenously express the antigen.

(Evaluation of A ^* 03 / A11 immunogenicity)
HLA-A3 supermotif-bearing cross-reactive binding peptides are also evaluated for immunogenicity using methods similar to those used to evaluate the immunogenicity of HLA-A2 supermotif peptides.

(Evaluation of B7 immunogenicity)
Immunogenicity screening of B7 supertype cross-reactive binding peptides identified as shown herein is confirmed in a manner similar to the confirmation of peptides carrying A2 and A3 supermotifs.

  Peptides carrying other supermotifs / motifs (eg, HLA-A1, HLA-A24, etc.) are also confirmed using similar methodology.

Example 15: Implementation of extended supermotif to improve native epitope binding ability by making analogs
HLA motifs and supermotifs (including primary and / or secondary residues) are useful in the identification and preparation of highly cross-reactive native peptides, as demonstrated herein. In addition, the definition of HLA motifs and supermotifs also makes it possible to engineer highly cross-reactive epitopes by identifying residues within the native peptide sequence. This native peptide sequence imparts certain properties to the peptide (eg, greater cross-reactivity within a group of HLA molecules including supertypes and / or greater binding affinity for some or all of those HLA molecules) To be analogized. Examples of analogized peptides that exhibit modulated binding affinity are shown in this example.

(Analogization at the primary anchor residue)
Peptide manipulation strategies are performed to further increase epitope cross-reactivity. For example, the major anchor of the A2 supermotif-bearing peptide is modified, for example, preferably to introduce L, I, V or M at position 2 and I or V at the C-terminus.

In order to analyze the cross-reactivity of analog peptides, each engineered analog was first tested for binding to the prototype A2 supertype allele A ^* 0201, and then A2 supertype if A ^* 0201 binding ability was maintained. Test for cross-reactivity.

  Alternatively, the peptide is confirmed to bind one or all supertype members, and then analogized to modulate the binding affinity for any one (or more) of the supertype members, and the population range Append.

Analog selection for immunogenicity in cell screening analysis typically involves the parental wild type (WT) peptide to bind at least weakly to 3 or more A2 supertype alleles (ie, with an IC _{50 of} 5000 nM or less). Further limited by ability to bind. The principle for this requirement is that the WT peptide must be endogenously present in an amount sufficient to be biologically relevant. Analogized peptides have been shown to have increased immunogenicity and cross-reactivity with T cells specific for the parent epitope (eg, Parkhurst et al., J. Immunol. 157: 2539, 1996; and Pogue et al., Proc. Natl. Acad. Sci. USA 92: 8166, 1995).

  In cell screening for these peptide analogs, confirm that analog-specific CTLs can also recognize wild-type peptides and, if possible, target cells that endogenously express this epitope. is important.

(Analogization of peptides carrying HLA-A3 and B7 supermotifs)
Analogs of HLA-A3 supermotif carrying epitopes are generated using a strategy similar to that used in the analogization of HLA-A2 supermotif carrying peptides. For example, a peptide that binds to 3/5 of the A3 supertype molecule is engineered with a primary anchor residue to carry a preferred residue (V, S, M or A) at position 2.

This analog peptide is then tested for the ability to bind A ^* 03 and A ^* 11 (prototype A3 supertype allele). Peptides exhibiting ≦ 500 nM binding ability are then confirmed to have A3 supertype cross-reactivity.

  Similar to A2 motif-bearing peptides and A3 motif-bearing peptides, improved peptides that bind three or more B7 supertype alleles, where possible, increased cross-reactivity binding or greater binding affinity or binding half The period can be achieved. Peptides carrying the B7 supermotif are preferred residues (V, I, L or F, for example, at the C-terminal primary anchor position, as shown in Sidney et al. (J. Immunol. 157: 3480-3490, 1996). ).

  Analogization at the primary anchor residue of other motif-bearing epitopes and / or supermotif-bearing epitopes is performed in a similar manner.

  The analog peptide is then typically checked for immunogenicity in a cell screening assay. Again, it is generally important to demonstrate that analog-specific CTLs can also recognize wild-type peptides and, if possible, targets that endogenously express this epitope.

(Analogization at secondary anchor residues)
In addition, the HLA supermotif identifies highly cross-reactive peptides and / or peptides that bind HLA molecules with increased affinity to specific residues at secondary anchor positions associated with such properties. It is valuable to operate. For example, the binding ability of a B7 supermotif-containing peptide having an F residue at position 1 is analyzed. The peptide is then analogized, for example, to replace F at position 1 with L. The analogized peptide is evaluated for increased binding affinity, binding half-life and / or increased cross-reactivity. Such a procedure identifies analogized peptides with enhanced properties.

  Engineered analogs with sufficiently improved binding capacity or cross-reactivity can also be tested for immunogenicity in HLA-B7 transgenic mice, eg, according to IFA immunity or lipopeptide immunity. Analogized peptides are further tested for the ability to stimulate a recall response using PBMC from patients with 98P4B6-expressing tumors.

(Other analog strategies)
Another form of peptide analogization involves replacing cysteine with α-aminobutyric acid, regardless of anchor position. Due to its chemical nature, cysteine has the property of structurally altering peptides enough to form disulfide bridges and reduce binding capacity. Substitution with α-aminobutyric acid instead of cysteine not only reduces this problem, but in some cases has also been shown to improve binding and cross-linking capabilities (eg, Sette et al., Persistent Viral). (See review by Infections, R. Ahmed and I. Chen, John Wiley & Sons, England, 1999).

  Thus, the use of single amino acid substitutions can modulate the binding properties and / or cross-reactivity of peptide ligands for HLA supertype molecules.

(Example 16: Identification and confirmation of 98P4B6-derived sequence having HLA-DR binding motif)
Peptide epitopes having HLA class II supermotifs or HLA class II motifs are identified and confirmed as outlined below using methodologies similar to those described for HLA class I peptides.

(Selection of epitope bearing HLA-DR supermotif)
To identify HLA class II HTL epitopes from 98P4B6, the 98P4B6 antigen is analyzed for the presence of sequences carrying the HLA-DR motif or HLA-DR supermotif. Specifically, a 15-mer sequence containing the DR supermotif (including a 9-mer core and a 3-residue N-terminus and a 3-residue C-terminal flanking region (15 amino acids total)) is selected.

  A protocol has been developed to estimate peptides that bind to DR molecules (Southwood et al., J. Immunol. 160: 3363-3373, 1998). These protocols specific for individual DR molecules allow for scoring and ranking of 9-mer core regions. Each protocol not only scores the peptide sequence for the presence of the DR supermotif primary anchor (ie, positions 1 and 6) within the 9-mer core, but also evaluates the sequence for the presence of the secondary anchor. Using allele-specific selection tables (see, eg, Southwood et al., Ibid), these protocols have been found to efficiently select peptide sequences that have a high probability of binding a particular DR molecule. . Furthermore, performing these protocols in tandem specifically found that implementations on DR1, DR4w4, and DR7 can efficiently select DR cross-reactive peptides.

  The 98P4B6-derived peptides identified above are tested for their binding ability for a variety of common HLA-DR molecules. All peptides are first tested for binding to DR molecules in the primary panel: DR1, DR4w4 and DR7. Peptides that bind at least two of these three DR molecules are then tested for binding to DR2w2β1, DR2w2β2, DR6w19, and DR9 molecules in a secondary assay. Finally, peptides that bind at least two of the four secondary panel DR molecules, and thus those that cumulatively bind at least four of the seven different DR molecules, are DR4w15, DR5w11, and DR8w2 Screened in a tertiary assay for binding to the molecule. Peptides that bind at least seven of the ten DR molecules, including primary screening assays, secondary screening assays, and tertiary screening assays, are considered cross-reactive DR binders. Of particular interest are peptides derived from 98P4B6 that have been found to bind common HLA-DR alleles.

(Selection of DR3 motif peptide)
Since HLA-DR3 is an allele that predominates in the White, Black and Latin American populations, DR3 binding ability is an appropriate criterion in the selection of HTL epitopes. Thus, peptides that have been shown to be candidates can also be assayed for their DR3 binding ability. However, given the binding specificity of the DR3 motif, peptides that bind only to DR3 can also be considered candidates for inclusion in vaccine formulations.

  In order to efficiently identify peptides that bind DR3, the target 98P4B6 antigen was selected from one of the two DR3-specific binding motifs reported by Geluk et al. (J. Immunol. 152: 5742-5748, 1994). Analyze for sequences with The corresponding peptide is then synthesized and confirmed to have the ability to bind DR3 with an affinity of 1 μM or better (ie, less than 1 μM). Peptides that meet this binding criteria and are considered HLA class II high affinity binding agents are found.

  The DR3 binding epitope thus identified is included in the vaccine composition along with the DR supermotif-bearing peptide epitope.

  As with HLA class I motif-carrying peptides, class II motif-carrying peptides are analogized to improve affinity or cross-reactivity. For example, aspartic acid at position 4 of the 9-mer core sequence is the optimal residue for DR3 binding, and substitution on that residue often improves DR3 binding.

Example 17: Immunogenicity of 98P4B6-derived HTL epitope
This example determines the immunogenic DR supermotif and DR3 motif-bearing epitopes from those identified using the methodology described herein.

  The immunogenicity of the HTL epitope is assessed in a manner similar to the determination of the immunogenicity of the CTL epitope by assessing its ability to stimulate the HTL response and / or by using an appropriate transgenic mouse model. Confirm. Immunogenicity is determined by screening for the following: 1.) In vitro primary induction, usually using PBMC or ) Recall response from patients with 98P4B6 expressing tumors.

Example 18: Calculation of phenotypic frequencies of HLA supertypes in various racial backgrounds to determine the breadth of population range
This example shows an assessment of the breadth of the population range of vaccine compositions composed of multiple supermotifs and / or multiple epitopes containing motifs.

To analyze population range, determine the gene frequency of the HLA allele. The gene frequency of each HLA allele is calculated from the antigen or allele frequency using the binomial distribution gf = 1- [SQRT (1-af)] (eg, Sidney et al., Human Immunol. 45: 79-). 93, 1996). To obtain the overall phenotypic frequency, the cumulative gene frequency is calculated and the cumulative antigen frequency is derived by using the inverse formula [af = 1- (1-Cgf) ² ].

If frequency data is not available at the level of DNA typing, a response to serologically defined antigen frequencies is assumed. In order to obtain the entire potential supertype population range, no linkage disequilibrium is assumed, and only alleles identified as belonging to each of the supertypes are included (minimum estimate). An assessment of the overall potential range achieved by the combination between loci is made by adding to the A range the proportion of populations not included in A that can be predicted to be encompassed by the considered B allele (eg, Total = A + B ^* (1-A)). The confirmed members of the A3-like supertype are A3, A11, A31, A ^* 3301, and A ^* 6801. The A3-like supertype may also include A34, A66, and A ^* 7401, but these alleles were not included in the overall frequency calculation. Similarly, identified members of the A2-like supertype family are A ^* 0201, A ^* 0202, A ^* 0203, A ^* 0204, A ^* 0205, A ^* 0206, A ^* 0207, A ^* 6802 and A ^* 6901. Finally, confirmed alleles of the B7-like supertype are B7, B ^* 3501-03, B51, B ^* 5301, B ^* 5401, B ^* 55001-2, B ^* 5601, B ^* 6701, and B ^*. 7801 (B ^* 1401, B ^* 3504-06, B ^* 4201, and B ^* 5602 are also potentially members).

  The population range achieved by combining the A2, A3 and B7 supertypes is approximately 86% in the five major racial groups. The range can be expanded by including peptides carrying the A1 and A24 motifs. On average, A1 is present in 12% of the population spanning five different major race groups (white, North American black, Chinese, Japanese, and Latino), and A24 is present in 29%. . Taken together, these alleles represent an average frequency of 39% in these same racial populations. When A1 and A24 are combined with a range of A2 supertype alleles, A3 supertype alleles and B7 supertype alleles, the total range across major races is over 95%. A similar approach can be used to assess the population range achieved by a combination of class II motif-bearing epitopes.

  Immunogenicity studies in humans (eg Bertoni et al., J. Clin. Invest. 100: 503, 1997; Doolan et al., Immunity 7:97, 1997; and Threlkeld et al., J. Immunol. 159: 1648, 1997) It was shown that highly cross-reactive binding peptides are almost always recognized as epitopes. The use of highly cross-reactive binding peptides is an important selection criterion in identifying candidate epitopes for inclusion in vaccines that are immunogenic in diverse populations.

  By using a sufficient number of epitopes (as disclosed herein and according to the art), the average population range is estimated to be greater than 95% in each of the five major racial populations. Monte Carlo simulation analysis, which is the theory of games (this is well known in the art (see, for example, Osborne, MJ and Rubinstein, A. “A course in game theory” MIT Press, 1994)) Estimate the percentage of individuals in the population consisting of ethnic groups of Caucasian, North American Black, Japanese, Chinese, and Latino that recognize the vaccine epitopes described herein Can be used to A preferred percentage is 90%. A more preferred percentage is 95%.

Example 19: CTL recognition of endogenously processed antigen after priming
In this example, a CTL induced by an epitope of a selected native peptide or analogized peptide identified as described herein produces an endogenously synthesized antigen (ie, a native antigen). Confirm that it recognizes.

Effector cells isolated from transgenic mice immunized with peptide epitopes (eg, epitopes bearing the HLA-A2 supermotif) are restimulated in vitro using peptide-coated stimulator cells. After 6 days, effector cells are assayed for cytotoxicity and cell lines containing peptide-specific cytotoxic activity are further restimulated. After an additional 6 days, these cell lines were tested for cytotoxic activity against ⁵¹ Cr-labeled Jurkat-A2.1 / ^Kb target cells in the presence or absence of peptides and have endogenously synthesized antigens. It is also tested against ⁵¹ Cr labeled target cells (ie cells stably transfected with 98P4B6 expression vector).

The results demonstrate that CTL lines obtained from animals primed with peptide epitopes recognize the endogenously synthesized 98P4B6 antigen. The choice of transgenic mouse model used for such analysis depends on the epitope being evaluated. In addition to HLA-A ^* 0201 / ^Kb transgenic mice, several other transgenic mice including human A11 (which can also be used to assess A3 epitopes) and mice with the B7 allele Models have been characterized and others (eg, transgenic mice for HLA-A1 and A24) have been developed. Mouse models of HLA-DR1 and HLA-DR3 have also been developed and can be used to assess HTL epitopes.

Example 20: Activity of CTL-HTL conjugated epitopes in transgenic mice
This example demonstrates the induction of CTL and HTL in transgenic mice by use of 98P4B6-derived CTL and HTL peptide vaccine compositions. The vaccine composition used herein comprises a peptide that is administered to a patient having a 98P4B6-expressing tumor. The peptide composition can comprise multiple CTL epitopes and / or HTL epitopes. This epitope is identified using the methodology described herein. This example also shows that enhanced immunogenicity can be achieved by including one or more HTL epitopes in the CTL vaccine composition; such peptide compositions are conjugated to the CTL epitope. HTL epitopes may be included. The CTL epitope can be an epitope that binds to multiple HLA family members or an analog of that epitope with an affinity of 500 nM or less. The peptide can be lipidated if desired.

Immunization procedure: Immunization of transgenic mice is performed as described (Alexander et al., J. Immunol. 159: 4753-4761, 1997). For example, to confirm the immunogenicity of an A2 / ^Kb mouse (which is transgenic for the human HLA A2.1 allele and carries the HLA-A ^* 0201 motif or the HLA-A2 supermotif. Used) in Freund's incomplete adjuvant, or if the peptide composition is a lipidated CTL / HTL conjugate, DMSO / saline, or PBS if the peptide composition is a polypeptide or Prime subcutaneously (base of tail) with 0.1 ml peptide in incomplete Freund's adjuvant. Seven days after priming, splenocytes from these animals are restimulated with syngeneic irradiated LPS activated lymphoblasts coated with peptide.

Cell lines: Target cells for peptide-specific cytotoxicity assays are transduced using the HLA-A2.1 / ^Kb chimeric gene (eg, Vitiello et al., J. Exp. Med. 173: 1007, 1991). The infected Jurkat cells.

In vitro CTL activation: One week after priming, spleen cells (30 × 10 ⁶ cells / flask) in 10 ml culture medium / T25 flask and syngeneic irradiation (3000 rad) peptide-coated lymph at 37 ° C. Co-culture with blasts (10 × 10 ⁶ cells / flask). After 6 days, effector cells are harvested and assayed for cytotoxic activity.

Assay for cytotoxic activity: Target cells (1.0-1.5 × 10 ⁶ ) are incubated at 37 ° C. in the presence of 200 μl ⁵¹ Cr. After 60 minutes, the cells are washed three times and resuspended in R10 medium. Peptides are added at a concentration of 1 μg / ml if necessary. For the assay, 10 ^{4 51} Cr labeled target cells are added to different concentrations of effector cells (final volume 200 μl) in U-bottom 96-well plates. After 6 hours incubation at 37 ° C., a 0.1 ml aliquot of the supernatant is removed from each well and the radioactivity is measured with a Micromedic automatic gamma counter. The% specific lysis is determined by the following formula:% specific release = 100 × (experimental release−spontaneous release) / (maximum release−spontaneous release). To facilitate comparison between separate CTL assays performed under the same conditions,% ⁵¹ Cr release data is expressed as lytic units / 10 ⁶ cells. One lysis unit is arbitrarily defined as the number of effector cells required to achieve 30% lysis of 10,000 target cells in a 6 hour ⁵¹ Cr release assay. To obtain the specific lytic unit / 10 ⁶ , the lytic unit / 10 ⁶ obtained in the absence of peptide is subtracted from the lytic unit / 10 ⁶ obtained in the presence of peptide. For example, 30% ⁵¹ Cr release is 50: 1 effector (E): target (T) ratio in the absence of peptide (ie, 5 × 10 ⁵ effectors for 10,000 targets). Cell) and in the presence of peptide at 5: 1 (ie 5 × 10 ⁴ effector cells for 10,000 targets), the specific lytic unit is [(1 / 50,000)-(1 / 500,000)] × 10 ⁶ = 18 LU.

  The results were analyzed to assess the magnitude of the CTL response of the animals injected with the immunogenic CTL / HTL conjugate vaccine preparation, as described above in the example title “Verification of immunogenicity”, for example, Compare the magnitude of the CTL response achieved using the CTL epitope. A similar analysis can be performed to confirm the immunogenicity of peptide conjugates containing multiple CTL epitopes and / or multiple HTL epitopes. According to these procedures, it is found that a CTL response is induced and at the same time an HTL response is induced upon administration of such a composition.

Example 21: Selection of CTL and HTL epitopes for inclusion in 98P4B6 specific vaccines
This example shows the procedure for selecting peptide epitopes for the vaccine composition of the invention. The peptides in this composition can be in the form of a nucleic acid sequence, either a single sequence encoding the peptide or one or more sequences (ie, a minigene), or of a single epitope and / or polyepitope It can be a peptide.

  The following principles are utilized when selecting multiple epitopes for inclusion in a vaccine composition. Each of the following principles are balanced to make a selection.

  Upon administration, an epitope is selected that mimics the immune response that correlates with 98P4B6 clearance. The number of epitopes used depends on patient observations that voluntarily purify 98P4B6. For example, if a patient who spontaneously clears 98P4B6 is observed to produce an immune response against at least three epitopes from the 98P4B6 antigen, three or four (3-4) epitopes for HLA class I are included Should be done. A similar principle is used to determine HLA class II epitopes.

Often, an epitope with a binding affinity of HLA class I The following _{IC 50} 500 nM for molecules or _{IC 50} of less 1000nM for class II,; high from or BIMAS web site (URL bimas.dcrt.nih.gov/) HLA class I peptides with binding scores are selected.

  In order to achieve a broad range of vaccines across diverse populations, a sufficient population range is given by selecting sufficient supermotif-bearing peptides or sufficient arrays of allele-specific motif-bearing peptides. In one embodiment, the epitope is selected to provide a population range of at least 80%. Monte Carlo analysis (statistical evaluation methods known in the art) can be used to assess the breadth of population ranges, ie overlap.

  When making a polyepitope composition, or minigene encoding it, it is typically desirable to produce the smallest possible peptide containing the epitope of interest. The principles used are similar to those used when selecting peptides containing a nested epitope, if not the same. For example, the protein sequence for a vaccine composition is selected because this sequence has the maximum number of epitopes contained within the sequence (ie, has a high concentration of epitopes). Epitopes may be nested or overlapping (ie, frame shifted from each other). For example, if overlapping epitopes are used, two 9-mer epitopes and one 10-mer epitope can be present in a 10 amino acid peptide. Each epitope can be exposed and is bound by an HLA molecule upon administration of such a peptide. Multi-epitope peptides can be produced synthetically, recombinantly, or by cleavage from native sources. Alternatively, an analog can be generated from the native sequence, whereby one or more epitopes include substitutions that alter the cross-reactivity and / or binding affinity properties of the peptide of the polyepitope. Such vaccine compositions are administered for therapeutic or prophylactic purposes. This embodiment, as an undiscovered aspect of the immune system, allows processing to be applied to native nested sequences, thereby facilitating the generation of therapeutic or prophylactic immune response inducing vaccine compositions Provide sex. Furthermore, such embodiments provide the possibility of motif-bearing epitopes for currently unknown HLA structures. Furthermore, this embodiment (which does not make analogs) directs the immune response to multiple peptide sequences that are actually present in 98P4B6, thus avoiding the need to evaluate any linked epitopes. Finally, this embodiment provides economies of scale in producing nucleic acid vaccine compositions. In connection with this embodiment, a computer program can be derived according to the principles of the art, which identifies the maximum number of epitopes per sequence length in the target sequence.

  Vaccine compositions composed of selected peptides are safe and effective when administered and are similar in magnitude to an immune response that controls or eliminates cells that have or overexpress 98P4B6 Elicit an immune response.

Example 22: Construction of “minigene” multi-epitope DNA plasmid
This example discusses the construction of a minigene expression plasmid. A minigene plasmid can of course contain B cell, CTL and / or HTL epitopes or epitope analogs of the various configurations described herein.

  Minigene expression plasmids typically include multiple CTL peptide epitopes and HTL peptide epitopes. In this example, HLA-A2 supermotif carrying peptide epitope, HLA-A3 supermotif carrying peptide epitope, HLA-B7 supermotif carrying peptide epitope, HLA-A1 motif carrying peptide epitope and HLA-A24 motif carrying peptide epitope Used in combination with supermotif-bearing epitopes and / or DR3 epitopes. HLA class I supermotifs derived from 98P4B6 or peptide epitopes carrying HLA class I motifs are selected such that multiple supermotifs / motifs are presented to ensure a broad population range. Similarly, HLA class II epitopes are selected from 98P4B6 to provide a broad population range. That is, both the HLA DR-1-4-7 supermotif-bearing epitope and the HLA DR-3 motif-bearing epitope are selected for inclusion in the minigene construct. Selected CTL and HTL epitopes are then incorporated into a minigene for expression in an expression vector.

  Such a construct may further comprise a sequence that directs the HTL epitope to the endoplasmic reticulum. For example, an Ii protein (Ii protein) can be fused to one or more HTL epitopes as described in the art, where the CLIP sequence of the Ii protein is removed and replaced with an HLA class II epitope sequence As a result, an HLA class II epitope is directed to the endoplasmic reticulum and this epitope binds to an HLA class II molecule.

  This example illustrates the method used for the construction of a minigene-bearing expression plasmid. Other expression vectors that can be used for minigene compositions are available and known to those of skill in the art.

  The minigene DNA plasmid of this example comprises a consensus Kozak sequence and a consensus mouse κIg light chain signal sequence followed by a CTL and / or HTL epitope selected according to the principles disclosed herein. This sequence encodes an open reading frame fused to the Myc and His antibody epitope tags encoded by the pcDNA3.1 Myc-His vector.

  For example, overlapping oligonucleotides that can be on average about 70 nucleotides long, with 15 nucleotides overlapping, are synthesized and HPLC purified. These oligonucleotides encode selected peptide epitopes as well as appropriate linker nucleotides, Kozak sequences, and signal sequences. The final multi-epitope minigene is assembled by extending overlapping oligonucleotides in three sets of reactions using PCR. A Perkin / Elmer 9600 PCR machine is used and a total of 30 cycles are performed using the following conditions: 95 ° C. for 15 seconds, 30 ° C. annealing temperature (5 ° C. below the lowest calculated Tm for each primer pair). Seconds, and 72 ° C. for 1 minute.

For example, a minigene is prepared as follows. In the first PCR reaction, each 5 μg of two oligonucleotides are annealed and extended. In an example using 8 oligonucleotides (ie, 4 pairs of primers), oligonucleotide 1 and oligonucleotide 2, oligonucleotide 3 and oligonucleotide 4, oligonucleotide 5 and oligonucleotide 6, and oligonucleotide 7 and oligo Nucleotide 8 was added to Pfu polymerase buffer (1 × = 10 mM KCL, 10 mM (NH 4) ₂ SO ₄ , 20 mM Tris-chloride (pH 8.75), 2 mM MgSO ₄ , 0.1% Triton X-100, 100 μg / ml BSA), each 0.25 mM dNTP, and 2.5 U Pfu polymerase in a 100 μl reaction. The full-length dimer product is gel purified and the two reactions including the 1 and 2 and 3 and 4 products and the 5 and 6 and 7 and 8 products are mixed, annealed, and 10 cycles Stretches over. Then, half of the two reactions were mixed, and adjacent primers were added to perform 5 cycles of annealing and extension before amplifying the full length product. This full-length product is gel purified, cloned into pCR-blunt (Invitrogen), and individual clones are screened by sequencing.

Example 23: Plasmid construct and degree of immunogenicity induced by the plasmid construct
The degree of immunogenicity that a plasmid construct (e.g., a plasmid constructed according to the previous example) can be induced is determined by transducing or transfecting APC with the epitope-expressing nucleic acid construct, followed by epitope presentation by this APC. Confirm in vitro by determining. Such studies determine “antigenicity” and allow the use of human APC. By quantifying the density of epitope-HLA class I complexes on the cell surface by this assay, the ability of the epitope presented by APC in a state recognized by T cells is determined. Quantification can be performed by directly measuring the amount of peptide eluted from the APC (see, eg, Sijts et al., J. Immunol. 156: 683-692, 1996; Demotz et al., Nature 342: 682-684, 1989). Or the number of peptide-HLA class I complexes is determined by measuring the amount of lysis or lymphokine release induced by the affected or transfected target cells, and then equal levels of lysis or lymphokine Can be assessed by determining the concentration of peptide required to obtain a release of (see, eg, Kageyama et al., J. Immunol. 154: 567-576, 1995).

  Alternatively, immunogenicity can be determined by in vivo injection into mice, followed by CTL activity and HTL activity (these activities can be determined by cytotoxicity and cell proliferation assays (eg, Alexander et al., Immunity 1: 751-761 respectively). , As described in detail in 1994).

For example, to confirm the ability of a DNA minigene construct having at least one HLA-A2 supermotif peptide to induce CTL in vivo, for example, HLA-A2.1 / ^Kb transgenic mice were treated with 100 μg of naked Immunize intramuscularly with cDNA. As a means of comparing the level of CTL induced by cDNA immunization, the control group of animals is also the actual peptide composition itself containing multiple epitopes synthesized as a single polypeptide as encoded by the minigene. Immunize with.

Spleen cells from immunized animals are stimulated twice with each composition (peptide epitope or polyepitope peptide encoded in the minigene), respectively, and then peptide specific cytotoxic activity in a ⁵¹ Cr release assay Assay for. These results indicate the magnitude of the CTL response to the A2-restricted epitope, thus indicating the in vivo immunogenicity of minigene vaccines and polyepitope vaccines.

  Thus, it is found that the minigene elicits an immune response against the HLA-A2 supermotif peptide epitope, such as that induced by a polyepitope peptide vaccine. Similar analyzes were also performed using other HLA-A3 and HLA-B7 transgenic mouse models to assess CTL induction by HLA-A3 and HLA-B7 motif or supermotif epitopes, thereby It is also found that the minigene elicits an appropriate immune response directed against the provided epitope.

To confirm the ability of minigenes encoding class II epitopes to induce HTL in vivo, for epitopes that cross-react with DR transgenic mice or with appropriate mouse MHC molecules, see, for example, IA ^b Restrained mice are immunized intramuscularly with 100 μg of plasmid DNA. As a means of comparing the level of HTL induced by DNA immunization, a group of control animals is also immunized with the actual peptide composition emulsified in Freund's complete adjuvant. CD4 + T cells (ie HTL) are purified from spleen cells of immunized animals and stimulated with each of the respective compositions (peptides encoded in the minigene). The HTL response is measured using a ³ H-thymidine incorporation proliferation assay (see, eg, Alexander et al., Immunity 1: 751-761, 1994). This result indicates the magnitude of the HTL response and thus demonstrates the in vivo immunogenicity of this minigene.

  A DNA minigene constructed as described in the previous example can also be identified as a vaccine in combination with a boost agent using a prime boost protocol. This boosting agent can be a recombinant protein (eg, Barnett et al., Aids Res. And Human Retroviruses 14, Supplement 3: S299-S309, 1998) or, for example, a recombinant vaccine expressing a minigene or DNA encoding the complete protein of interest ( For example, Hanke et al., Vaccine 16: 439-445, 1998; Sedegah et al., Proc. Natl. Acad. Sci USA 95: 7648-53, 1998; Nature Med.5: 526-34, 1999).

For example, the effectiveness of the DNA minigene used in the prime boost protocol is first evaluated in transgenic mice. In this example, A2.1 / ^Kb transgenic mice are IM immunized with 100 μg of a DNA minigene encoding an immunogenic peptide (including at least one HLA-A2 supermotif-bearing peptide). After an incubation period (ranging from 3 to 9 weeks), the mice are boosted with IP using 10 ⁷ pfu / mouse recombinant vaccinia virus expressing the same sequence encoded by the DNA minigene. Control mice are immunized with 100 μg of DNA or recombinant vaccinia without the minigene sequence, or with DNA encoding this minigene, but without vaccinia boost. After an additional incubation period of 2 weeks, spleen cells from this mouse are assayed immediately for peptide specific activity in an ELISPOT assay. In addition, spleen cells are stimulated in vitro using A2 restricted peptide epitopes encoded in the minigene and recombinant vaccinia, and then assayed for peptide specific activity in αIFN ELISA, βIFN ELISA, and / or γIFN ELISA.

  It is found that the minigene utilized in the prime boost protocol elicits a higher immune response than the DNA alone against the HLA-A2 supermotif peptide. Such analysis is also performed using HLA-A11 or HLA-B7 transgenic mouse models to assess CTL induction by HLA-A3 or HLA-B7 motif or supermotif epitopes. obtain. The use of the prime boost protocol in humans is described in the following example entitled “Induction of CTL Response Using Prime Boost Protocol”.

Example 24: Peptide composition for prophylactic use
The vaccine composition of the present invention may be used to prevent 98P4B6 expression in humans at risk for tumors carrying this antigen. For example, a polyepitope peptide epitope composition (or a nucleic acid comprising a polyepitope peptide epitope) comprising a plurality of CTL epitopes and HTL epitopes, such as the epitopes selected in the examples above (which also comprises more than 80% of the population Is selected to be targeted) to individuals at risk for 98P4B6-related tumors.

  For example, a peptide-based composition is provided as a single polypeptide that includes multiple epitopes. Typically, the vaccine is administered in a physiological solution containing an adjuvant (eg, Freund's incomplete adjuvant). The peptide dose for the first immunization is about 1 μg to about 50,000 μg for a 70 kg patient, generally 100 μg to 5,000 μg. Following the initial administration of the vaccine, boosters are administered at 4 weeks, followed by an assessment of the magnitude of the immune response in the patient by a technique that determines the presence of an epitope-specific CTL population in the PBMC sample. Additional booster doses are administered as necessary. This composition is found to be both safe and effective as a prophylactic against 98P4B6-related diseases.

  Alternatively, a composition that typically includes a transfected agent is used for the administration of nucleic acid based vaccines according to methodologies known in the art and disclosed herein.

Example 25: Polyepitope vaccine composition derived from native 98P4B6 sequence
Computers preferably defined for each class I and / or class II supermotif or motif to identify the native 98P4B6 polyprotein sequence as a “relatively short” region of a polyprotein containing multiple epitopes Analyze using algorithm. Preferably, this “relatively short” region is shorter than the full length native antigen. This relatively short region containing multiple distinct or overlapping “nested” epitopes is selected; this can be used to create a minigene construct. This construct is engineered to express a peptide corresponding to the native protein sequence. This “relatively short” peptide is generally less than 250 amino acids long, often less than 100 amino acids long, preferably less than 75 amino acids long, and more preferably less than 50 amino acids long. Since the protein sequence of the vaccine composition has the highest number of epitopes contained in the sequence (ie it has a high concentration of epitopes), the protein sequence of the vaccine composition is selected. As shown herein, epitope motifs may be nested or overlap (ie, may be frame shifted relative to each other). For example, using overlapping epitopes, two 9-mer epitopes and one 10-mer epitope can be present in a 10 amino acid peptide. Such vaccine compositions are administered for therapeutic or prophylactic purposes.

  Examples of the vaccine composition include a plurality of CTL epitopes derived from 98P4B6 antigen and at least one HTL epitope. The polyepitope native sequence is administered either as a peptide or as a nucleic acid sequence encoding the peptide. Alternatively, an analog can be made from its native sequence, whereby one or more epitopes contain substitutions that alter the cross-reactivity and / or binding affinity properties of the polyepitope peptide.

  Embodiments of this example apply an undeveloped aspect of immune system processing to native nested sequences, thereby producing a vaccine composition that induces a therapeutic or prophylactic immune response. Provides the possibility to make it easier. Furthermore, such embodiments provide the possibility of motif-bearing epitopes for currently unknown HLA structures. Furthermore, this embodiment (except for similar embodiments) directs the immune response to multiple peptide sequences that are actually present in native 98P4B6, thus eliminating the need to evaluate any linking epitopes. Finally, this embodiment provides economies of scale when producing peptide vaccine compositions or nucleic acid vaccine compositions.

  For this embodiment, computer programs are available in the art that can be used to identify the largest number of epitopes per sequence length in the target sequence.

Example 26: Polyepitope vaccine composition derived from multiple antigens
The 98P4B6 peptide epitopes of the present invention are used in combination with epitopes derived from other target tumor associated antigens to make vaccine compositions useful for the prevention and treatment of cancers expressing 98P4B6 and such other antigens. For example, the vaccine composition may be provided as a single polypeptide that incorporates multiple epitopes derived from 98P4B6 and a tumor associated antigen often expressed in a target cancer associated with 98P4B6 expression, or one or more separate It can be administered as a composition comprising a cocktail of epitopes. Alternatively, the vaccine can be administered as a minigene construct or as dendritic cells loaded with peptide epitopes in vitro.

Example 27: Use of peptides to assess immune response
The peptides of the present invention may be used to analyze immune responses for the presence of specific antibodies, CTL or HTL to 98P4B6. Such analysis can be performed in the manner described in Ogg et al., Science 279: 2103-2106, 1998. In this example, the peptides according to the invention are used as reagents (not as immunogens) for diagnostic or prognostic purposes.

In this example, a highly sensitive human leukocyte antigen tetramer complex (“tetramer”), eg, a post-immunization HLA A ^* containing a different stage of disease or a 98P4B6 peptide containing the A ^* 0201 motif ^. Used for cross-sectional analysis of 98P4B6 HLA-A ^* 0201-specific CTL frequencies from 0201 positive individuals.The tetrameric complex is described (Musey et al., N. Engl. J. Med. 337: 1267, 1997). Briefly, purified HLA heavy chain (A ^* 0201 in this example) and β2-microglobulin are synthesized by a prokaryotic expression system, which is synthesized from the transmembrane-cytosolic tail. Deletion and modification by COOH terminal addition of the sequence containing the BirA enzyme biotinylation site, heavy chain, β2-microglobulin, and The peptide is refolded by dilution and the 45 kD refold product is isolated using high performance protein liquid chromatography and then biotin (Sigma, St. Louis, Missouri), adenosine 5 ′ triphosphate and magnesium. Biotinylated with Bir A in the presence Streptavidin-phycoerythrin conjugate is added at a molar ratio of 1: 4 and the tetramer product is concentrated to 1 mg / ml. That's it.

For analysis of patient blood samples, approximately 1 million PBMCs are centrifuged at 300 g for 5 minutes and resuspended in 50 μl cold phosphate buffered saline. Three-color analysis is performed using tetramer-phycoerythrin with anti-CD8-Tricolor and anti-CD38. PBMC are incubated with tetramer and antibody on ice for 30-60 minutes and then washed twice prior to formaldehyde fixation. Apply a gate that contains more than 99.98% control samples. Controls for the tetramer include both A ^* 0201-negative individuals and A ^* 0201-positive unaffected donors. The percentage of cells stained with this tetramer is then determined using flow cytometry. This result indicates the number of epitope-restricted CTL-containing cells in the PBMC sample, thereby the extent of the immune response to the 98P4B6 epitope, and thus the state of exposure to 98P4B6, or a vaccine that elicits a prophylactic or therapeutic response Easily shows the state of exposure.

Example 28: Use of peptide epitopes to assess recall responses
The peptide epitopes of the invention are used as reagents for evaluating T cell responses (eg, acute or recall responses) in patients. Such an analysis may be performed in patients who have recovered from 98P4B6-related disease or who have been vaccinated with 98P4B6 vaccine.

  For example, vaccinated human class I restricted CTL responses can be analyzed. This vaccine may be any 98P4B6 vaccine. PBMC are collected from the vaccinated individuals and HLA typed. Then, for analysis of samples from individuals carrying that HLA type, the appropriate peptide epitope of the present invention optionally carrying a supermotif to provide cross-reactivity to complex HLA supertype family members. Used for.

  PBMCs from vaccinated individuals were isolated on a Ficoll-Histopaque density gradient (Sigma Chemical Co., St. Louis, Mo.), washed 3 times in HBSS (GIBCO Laboratories) and heat inactivated 10 Resuspended in RPMI-1640 (GIBCO Laboratories) (complete RPMI) supplemented with L-glutamine (2 mM), penicillin (50 U / ml), streptomycin (50 μg / ml) and Hepes (10 mM) containing 1% human AB serum. Cloudy and plate using microculture format. Synthetic peptides containing the epitopes of the invention are added to each well at 10 μg / ml and the HBV core 128-140 epitope is added to each well as a source of T cell help during the first week of stimulation. Add 1 μg / ml.

In a microculture format, 4 × 10 ⁵ PBMCs are stimulated with peptides in 8 replicate cultures in 100 μl / well complete RPMI 96 well round bottom plates. On days 3 and 10, 100 μl complete RPMI and 20 U / ml final concentration of rIL-2 are added to each well. On day 7, the culture was transferred to a flat bottom 96-well plates and peptide are restimulated with self feeder cells of radioactive (3,000 rad) of rIL-2 and 10 ^5. The culture is tested for cytotoxicity on day 14. Positive CTL responses are described as previously described (Rehermann et al., Nature Med. 2: 1104, 1108, 1996; Rehermann et al., J. Clin. Invest. 97: 1655-1665, 1996; and Rehermann et al., J. Biol. Clin. Invest. 98: 1432-1440, 1996) Based on a comparison with unaffected control subjects, two or more of the eight replicate cultures show more than 10% specific ⁵¹ Cr release. I need.

  The target cell line is autologous and allogeneic EBV transformed B-LCL, both of which were purchased or described from the American Society for Histocompatibility and Immunogenetics (ASHI, Boston, Mass.) (Guihot et al., J. Virol. 66: 2670-2678, 1992) either established from a pool of patients.

Cytotoxicity assays are performed in the following manner. Target cells consist of either allogeneic HLA-compatible B lymphoblast cell lines or autologous EBV transformed B lymphoblast cell lines, which are overnight with 10 μM of the synthetic peptide epitope of the present invention. Incubate and label with 100 μCi ⁵¹ Cr (Amersham Corp., Arlington Heights, IL) for 1 hour, after which they are washed 4 times with HBSS.

Cytotoxic activity is determined in a standard 4 hour, separate well ⁵¹ Cr release assay using a U-bottom 96 well plate containing 3,000 targets / well. Stimulated PBMC are tested on day 14 at an effector / target (E / T) ratio of 20-50: 1. The% cytotoxicity is determined from the formula: 100 × [(experimental release−spontaneous release) / (maximum release−spontaneous release)]. Maximum release is determined by lysis of the target with surfactant (2% Triton X-100; Sigma Chemical Co., St. Louis, MO). Spontaneous release is less than 25% of maximum release for all experiments.

  The results of such an analysis indicate the extent to which the HLA-restricted CTL population was stimulated by previous exposure to the 98P4B6 or 98P4B6 vaccine.

Similarly, class II constrained HTL responses can also be analyzed. Purified PBMCs are cultured in 96 well flat bottom plates at a density of 1.5 × 10 ⁵ cells / well and stimulated with 10 μg / ml of the synthetic peptide of the invention, whole 98P4B6 antigen, or PHA. Cells are routinely plated as 4-6 well replicas for each condition. After 7 days of culture, the medium is removed and replaced with fresh medium containing 10 U / ml IL-2. Two days later, 1 μCi of ³ H thymidine is added to each well and incubation is continued for an additional 18 hours. Cellular DNA is then collected on a glass fiber mat and analyzed for ³ H thymidine incorporation. Antigen-specific T cell proliferation, to calculate the ^{3 H-thymidine} incorporation in the presence of an antigen as divided by the ratio with ^{3 H-thymidine} incorporation in the absence of antigen.

Example 29: Induction of specific CTL responses in humans
Human clinical trials for immunogenic compositions comprising the CTL and HTL epitopes of the present invention are set up as an IND phase I, dose escalation study and are conducted as a randomized, double-blind placebo controlled trial. Such a test is designed, for example, as follows:
A total of about 27 individuals are enrolled and divided into three groups;
Group I: 3 subjects are injected with placebo and 6 subjects are injected with 5 μg of the peptide composition;
Group II: 3 subjects are injected with placebo and 6 subjects are injected with 50 μg of the peptide composition;
Group III: 3 subjects are injected with placebo and 6 subjects are injected with 500 μg of the peptide composition.

  Four weeks after the first injection, all subjects were boosted at the same dose.

  The endpoint measured in this study is related to the safety and tolerability of the peptide composition and its immunogenicity. The cellular immune response to the peptide composition is an indicator of the intrinsic activity of the peptide composition and can therefore be seen as a measure of biological effectiveness. The following summarizes clinical and laboratory data regarding safety and efficacy endpoints.

  Safety: The incidence of adverse events is monitored in placebo and drug treatment groups and evaluated with their extent and reversibility.

  Assessment of vaccine efficacy: Blood is drawn from the subject before and after injection for assessment of vaccine efficacy. Peripheral blood mononuclear cells are isolated from fresh heparinized blood by Ficoll-Hypaque density gradient centrifugation, aliquoted into freezing media, and stored frozen. Samples are assayed for CTL activity and HTL activity.

  Vaccines are found to be safe and effective.

Example 30: Phase II study in patients expressing 98P4B6
A phase II study is conducted to study the effects of administration of the CTL-HTL peptide composition to patients with cancer that express 98P4B6. The primary objective of this study is to determine the effective dose and regimen to induce CTL in cancer patients expressing 98P4B6, and to establish the safety of inducing CTL and HTL responses in these patients And to see how much CTL activation improves the clinical picture of these patients as revealed (eg, by lesion reduction and / or atrophy). Such a study is designed as follows, for example.

  This study will be conducted at multiple facilities. The study design is an open-label, uncontrolled dose escalation protocol, where the peptide composition is administered as a single dose followed by a single booster injection of the same dose 6 weeks later . This dose is 50 μg, 500 μg, and 5,000 μg per injection. Record adverse drug effects (severity and reversibility).

  There are three patient groups. The first group is injected with 50 μg of this peptide composition, and the second and third groups are injected with 500 μg and 5,000 μg of peptide composition, respectively. Patients within each group range from 21 years to 65 years and show different racial population backgrounds. All of them have 98P4B6 expressing tumors.

  Clinical expression or antigen-specific T cell responses are monitored to evaluate the effect of administering this peptide composition. This vaccine composition is found to be safe and effective in the treatment of 98P4B6-related diseases.

Example 31 Induction of CTL Response Using Prime Boost Protocol
Underlying protocols and protocols used to confirm the efficacy of DNA vaccines in transgenic mice, as described in the examples entitled "Plasmid constructs and the extent to which the plasmid constructs induce immunogenicity" Prime boost protocols with similar principles can also be used to administer vaccines to humans. Such vaccine regimens include, for example, an initial administration of naked DNA followed by a boost using administration of a recombinant virus encoding the vaccine or a recombinant protein / polypeptide or peptide mixture administered in an adjuvant. obtain.

For example, the first immunization can be expressed in an expression vector (eg, “Construction of a“ minigene ”multi-epitope DNA plasmid”) in an amount of 0.5 mg to 5 mg IM (or SC or ID) at multiple sites. Expression vectors as constructed in the form of naked nucleic acids to be administered. The nucleic acid (0.1 μg to 1000 μg) can also be administered using a gene cancer. After a 3-4 week incubation period, a booster dose is then administered. The booster can be a recombinant fowlpox virus administered at a dose of 5 × 10 ⁷ pfu to 5 × 10 ⁹ pfu. Alternative recombinant viruses (eg, MVA virus, canarypox virus, adenovirus, or adeno-associated virus) can also be used for boosters, or polyepitope proteins or mixtures of these peptides can be administered. For assessment of vaccine efficacy, patient blood samples are obtained at intervals before immunization and after administration of the first vaccine and vaccine booster dose. Peripheral blood mononuclear cells are isolated from fresh heparinized blood by Ficoll-Hypaque density gradient centrifugation, aliquoted into frozen media and stored frozen. Samples are assayed for CTL activity and HTL activity.

  Analysis of these results indicates that a response is generated that is strong enough to achieve therapeutic or protective immunity to 98P4B6.

(Example 32: Administration of vaccine composition using dendritic cells (DC))
Vaccines comprising the peptide epitopes of the invention may be administered using APC or “professional” APC (eg, DC). In this example, peptide-pulsed DC is administered to a patient to stimulate a CTL response in vivo. In this method, dendritic cells are isolated, expanded, and pulsed with a vaccine comprising a peptide CTL epitope and a peptide HTL epitope of the present invention. These dendritic cells are injected back into the patient to elicit CTL and HLT responses in vivo. The induced CTL and HTL then destroy or promote destruction of the target cells carrying the 98P4B6 protein from which the epitope in this vaccine is derived, respectively.

For example, a cocktail of epitope-containing peptides is administered to PBMCs ex vivo, or DCs isolated therefrom are administered. Medicaments (eg, Progenipoietin ^™ (Monsanto, St. Louis, MO) or GM-CSF / IL-4) to facilitate DC recovery may be used. After pulsing the DC with the peptide and prior to reinfusion into the patient, the DC is washed to remove unbound peptide.

The number of DCs reinjected into the patient can vary (eg, Nature Med. 4: 328, 1998; Nature, as clinically understood and readily determined by those skilled in the art based on clinical results). Med. 2:52, 1996 and Prostate 32: 272, 1997). Typically 2-50 × 10 ⁶ DCs are administered per patient, although higher numbers of DCs (eg, 10 ⁷ or 10 ⁸ ) may also be provided. Such cell populations typically contain between 50% and 90% DC.

In some embodiments, peptide loaded PBMCs are injected into a patient without DC purification. For example, PBMC produced after treatment with a drug (eg, Progenipoietin ^™ ) is injected into a patient without purifying the DC. The total number of PBMCs administered often ranges from 10 ⁸ to 10 ¹⁰ . In general, the cell dose injected into a patient is based on the percentage of DC in each patient's blood, as determined, for example, by immunofluorescence analysis using specific anti-DC antibodies. Thus, for example, if Progenipoietin ^™ mobilizes 2% DC in the peripheral blood of a given patient and that patient is receiving 5 × 10 ⁶ DC, this patient will receive a total of 2.5 × 10 ⁸ Inject PBMC loaded with peptide. The DC% mobilized by an agent (eg, Progenipoietin ^™ ) is typically estimated to be between 2-10%, but can vary as will be appreciated by those skilled in the art.

(Activation of CTL / HTL response ex vivo)
Alternatively, an ex vivo CTL response or HTL response to the 98P4B6 antigen can be obtained from a patient or genetically compatible CTL precursor cell or HTL precursor cell along with a source of APC such as DC and an immunogenic peptide. Can be induced by incubation in tissue culture. After an appropriate incubation time (typically about 7-28 days), the progenitor cells are activated and expanded into effector cells. The effector cells are injected into the patient and destroy (CTL) or promote destruction (HTL) of specific target cells (ie, tumor cells).

(Example 33: Alternative method for identification and confirmation of motif-bearing peptide)
Another way to identify and confirm a motif-bearing peptide is to elute the peptide from cells that carry a defined MHC molecule. For example, EBV-transformed B cell lines used for tissue typing have been extensively characterized to determine which HLA molecules they express. In certain cases, these cells express only a single type of HLA molecule. These cells can be transfected with a nucleic acid that expresses the antigen of interest (eg, 98P4B6). The peptides produced by endogenous antigen processing of the peptides produced as a result of transfection then bind to intracellular HLA molecules and are transported and presented on the cell surface. The peptides are then eluted from the HLA molecule by exposure to mild acid conditions, and these amino acid sequences are analyzed using, for example, mass spectrometry (eg, Kubo et al., J. Immunol. 152: 3913, 1994). decide. Since most of the peptides that bind to a particular HLA molecule carry a motif, this is an alternative way to obtain a motif-bearing peptide associated with a particular HLA molecule expressed on a cell.

  Alternatively, cell lines that do not express endogenous HLA molecules can be transfected with an expression construct that encodes a single HLA allele. These cells can then be used as described (ie, these cells are transfected with a nucleic acid encoding 98P4B6 to isolate the peptide corresponding to 98P4B6 displayed on the cell surface. Can be). Peptides obtained from such analyzes possess a motif that corresponds to binding to a single HLA allele expressed in cells.

  As will be appreciated by those skilled in the art, a similar analysis in cells carrying more than one HLA allele, followed by determination of specific peptides for each expressed HLA allele. Furthermore, those skilled in the art will also recognize that means other than transfection, such as loading with protein antigens, can be used to provide a source of antigen to the cells.

(Example 34: Complementary polynucleotide)
A sequence complementary to the 98P4B6 coding sequence or any portion thereof is used to detect, reduce or inhibit the expression of naturally occurring 98P4B6. Although the use of oligonucleotides comprising about 15-30 base pairs is described, substantially the same means are used with smaller or larger sequence fragments. Suitable oligonucleotides are designed using, for example, OLIGO 4.06 software (National Biosciences) and the coding sequence of 98P4B6. In order to inhibit transcription, a complementary oligonucleotide is designed from the most unique 5 'sequence and the complementary oligonucleotide is used to prevent promoter binding to the coding sequence. To inhibit translation, a complementary oligonucleotide is designed to prevent ribosome binding to the transcript encoding 98P4B6.

Example 35: Purification of naturally occurring 98P4B6 or recombinant 98P4B6 using 98P4B6 specific antibodies
Naturally occurring 98P4B6 or recombinant 98P4B6 is substantially purified by immunoaffinity chromatography using an antibody specific for 98P4B6. An immunoaffinity column is constructed by covalently coupling an anti-98P4B6 antibody to an activated chromatography resin (eg, CNBr-activated SEPHAROSE (Amersham Pharmacia Biotech)). After this bonding, the resin is blocked and washed according to the manufacturer's instructions.

  The medium containing 98P4B6 is passed through an immunoaffinity column and the column is washed under conditions that preferentially adsorb 98P4B6 (eg, a high ionic strength buffer in the presence of a surfactant). The column is eluted under conditions that interfere with antibody / 98P4B6 binding (eg, pH 2 to pH 3 buffer, or high concentration of chaotrope (eg, urea or thiocyanate ions)) and GCR. Collect P.

Example 36: Identification of molecules that interact with 98P4B6
98P4B6 or a biologically active fragment thereof is labeled with 121 1 Bolton-Hunter reagent. (See, eg, Bolton et al. (1973) Biochem. J. 133: 529.) Candidate molecules pre-ordered in the wells of a multi-well plate are incubated with labeled 98P4B6, washed, and labeled Any wells that contain the prepared 98P4B6 complex are assayed. Data obtained using different concentrations of 98P4B6 are used to calculate the number of 98P4B6, the affinity, and the value of association of 98P4B6 with the candidate molecule.

Example 37: In vivo assay for promoting 98P4B6 tumor growth
The effect of 98P4B6 protein on tumor cell growth is assessed in vivo by gene overexpression in tumor-bearing mice. For example, prostate (PC3), lung (A427), stomach, ovary (PA1) and uterine cell lines are engineered to express 98P4B6. SCID mice are injected subcutaneously into each flank with 1 × 10 ⁶ PC3, A427, PA1 or NIH-3T3 cells (including tkNeo empty vector or 98P4B6). At least two strategies may be used: (1) polyoma virus, fowlpox virus (UK2, 211,504 (published July 5, 1989)), adenovirus (eg adenovirus 2), bovine papilloma Constructed promoters derived from the genomes of viruses such as viruses, avian sarcoma virus, cytomegalovirus, retrovirus, hepatitis B virus and simian virus 40 (SV40), or heterologous mammalian promoters (eg, actin promoter or immunoglobulin promoter) ) Expression of constitutive 98P4B6 under the control of a promoter such as a constructed promoter obtained from (as long as these promoters are compatible with the host cell system), and (2) an inducible vector system (eg, ecdysone, tet Na Regulated expression under control of) (as long as it is compatible these promoters the host cell systems). Tumor volume was then monitored at the appearance of overt tumors and followed over time to see if 98P4B6-expressing cells proliferate at a faster rate and the tumor produced by 98P4B6-expressing cells has changed aggressiveness Confirm that it exhibits characteristics of (eg, enhanced metastasis, angiogenesis, decreased response to chemotherapeutic drugs).

In addition, mice were orthotopically transplanted with 1 × 10 ⁵ identical cells and 98P4B6 had an effect on local proliferation in the prostate or the ability of the cells to specifically metastasize to lung, lymph nodes, and bone marrow. Can be determined.

  This assay is also useful for determining the 98P4B6 inhibitory effect of candidate therapeutic compositions (eg, 98P4B6 intracellularly expressed antibodies (intrabody), 98P4B6 antisense molecules and ribozymes).

Example 38: 98P4B6 monoclonal antibody-mediated inhibition of tumors in vivo
The significant expression of 98P4B6 in prostate, lung, stomach, ovary, and uterine cancer tissues, along with its restricted expression in normal tissues with cell surface expression, makes 98P4B6 an excellent target for antibody therapy. Similarly 98P4B6 is a target for T cell-based immunotherapy. Thus, the therapeutic efficacy of anti-98P4B6 mAb in a human prostate cancer xenograft mouse model has been demonstrated by androgen-independent LAPC-4 xenografts and LAPC-9 xenografts (Craft, N. et al., Cancer Res, 1999.59 ( 19) 5030-6), and androgen-independent recombinant cell line PC3-98P4B6 (eg, Kaihn, ME, et al., Invest. Urol. 1979.17 (1): 16-23) is used. To evaluate. A similar approach using patient-derived xenografts or xenograft cell lines is used for the cancers listed in Table I.

  Antibody effects on tumor growth and metastasis formation are studied, for example, in mouse orthotopic prostate cancer xenograft models and mouse lung, uterus or stomach xenograft models. This antibody may be unbound as discussed in this example or may be combined in a therapeutic modality as is understood in the art. Anti-98P4B6 mAb inhibits the formation of both androgen-dependent LAPC-9 tumor xenografts and androgen-independent PC3-98P4B6 tumor xenografts. Anti-98P4B6 mAb also slows the growth of established orthotopic tumors and prolongs the survival of tumor-bearing mice. These results demonstrate the usefulness of anti-98P4B6 mAbs in the treatment of the localized and advanced stages of cancer (eg, Saffran, D. et al., PNAS 10: 1073-1078 or world wide web URL pnas.org/ cgi / doi / 10.1073 / pnas.0551624698).

  Administration of anti-98P4B6 mAb slows established orthotopic tumor growth and inhibits metastasis to distant sites, resulting in a significant increase in survival of tumor-bearing mice. These studies show that 98P4B6 is an attractive target for immunotherapy and show the therapeutic use of anti-98P4B6 mAb for the treatment of local and metastatic prostate cancer. This example demonstrates that an unconjugated 98P4B6 monoclonal antibody is effective to inhibit the growth of human prostate tumor xenografts grown in SCID mice and lung, uterus, or stomach xenografts. Thus; such effective monoclonal antibody combinations are also effective.

(Tumor inhibition using multiple unconjugated 98P4B6 mAbs)
(Materials and methods)
(98P4B6 monoclonal antibody):
Monoclonal antibodies are raised against 98P4B6 as described in the example under the heading “Generation of 98P4B6 Monoclonal Antibody (mAb)”. The antibodies are characterized for their ability to bind to 98P4B6 by ELISA, Western blot, FACS, and immunoprecipitation. Epitope mapping data for anti-98P4B6 mAb as measured by ELISA and Western analysis recognizes an epitope on 98P4B6 protein. Immunohistochemical analysis of cancer tissue and cancer cells is performed using these antibodies.

  Monoclonal antibodies are purified from ascites or hybridoma tissue culture supernatants by protein G sepharose chromatography, dialyzed against PBS, filter sterilized, and stored at -20 ° C. Protein measurements are performed by Bradford assay (Bio-Rad, Hercules, CA). Cocktails containing therapeutic monoclonal antibodies or a mixture of individual monoclonal antibodies are prepared and used for the treatment of mice receiving subcutaneous or orthotopic injections of LAPC-9 tumor xenografts.

(Cancer xenografts and cell lines)
LAPC-9 xenografts (expressing wild type androgen receptor and producing prostate specific antigen (PSA)) were obtained by subcutaneous trocar transplantation in 6-8 week old male ICR severe combined immunodeficiency (SCID) mice. Passage in (Taconic Farms) (Craft, N. et al., Supra). Prostate cell line (PC3), lung cell line (A427), ovarian cell line (PA1) (American Type Culture Collection) are maintained in RPMI or DMEM supplemented with L-glutamate and 10% FBS.

  PC3-98P4B6 cell population, A427-98P4B6 cell population, PA1-98P4B6 cell population and 3T3-98P4B6 cell population were obtained from Hubert, R .; S. STEAP: A Prostate-specific Cell-surface Antigen Highly Expressed in Human Prostate Tumors (as described in Proc Natl Acad Sci USA, 1999.96 (25): 14523-8). To make. Anti-98P4B6 staining is detected using FITC-conjugated goat anti-mouse antibody (Southern Biotechnology Associates) and then analyzed on a Coulter Epis-XL flow cytometer.

(Xenograft mouse model)
Subcutaneous (sc) tumors were placed in the right flank of male SCID mice at 1 × 10 ⁶ LAPC-9 cells, PC3 cells, PC3-98P4B6 mixed with Matrigel (Collaborative Research) at a 1: 1 dilution. Prepared by injecting cells, A427 cells, A427-98P4B6 cells, PA1 cells, PA1-98P4B6 cells, 3T3 cells or 3T3-98P4B6 cells. To test the antibody effect on tumor formation, i. p. Antibody injection begins on the same day as tumor cell injection. As a control, mice are injected with either purified mouse IgG (ICN) or PBS; or a purified monoclonal antibody that recognizes an irrelevant antigen that is not expressed in human cells. In preliminary studies, there is no difference between mouse IgG or PBS in tumor growth. Tumor size is determined by caliper measurements, and tumor volume is calculated as length x width x height. S. Of diameter greater than 1.5 cm. c. Mice with tumors are sacrificed. PSA levels are determined by using a PSA ELISA kit (Anogen, Mississauga, Ontario). Circulating levels of anti-98P4B6 mAb are determined by a capture ELISA kit (Bethyl Laboratories, Montgomery, TX). (See, eg, Saffran, D. et al., PNAS 10: 1073-1078 or world wide web URL pnas.org/cgi/doi/10.1073/pnas.051624698).

Orthotopic prostate injection is performed under anesthesia by using ketamine / xylazine. For orthotopic studies, an incision is made through the abdominal muscles to expose the bladder and seminal vesicles, and then through the incision to expose the back of the prostate. LAPC-9 cells or PC3 cells (5 × 10 ⁵ cells) mixed with Matrigel are injected into each posterior lobe in a volume of 10 μl. To monitor tumor growth, mice are bled every other week to measure PSA levels. The mice are grouped for appropriate treatment and injected with anti-98P4B6 or control mAb intraperitoneally.

(Anti-98P4B6 mAb inhibits the growth of 98P4B6-expressing xenograft cancer tumors)
The effect of anti-98P4B6 mAb on tumorigenesis is tested using the LAPC-9 orthotopic model and the PC3-98P4B6 orthotopic model. s. c. Compared to tumor models, orthotopic models require direct injection of tumor cells in the mouse's prostate, lung, or ovary, respectively, local tumor growth, development of metastases to distant sites, mouse Deteriorating health and subsequent death (Saffran, D. et al., PNAS (supra); Fu, X. et al., Int J Cancer, 1992.52 (6): p. 987-90; Kubota, T .; J Cell Biochem, 1994.56 (1): 4-8). This feature makes the orthotopic model more representative for human disease progression and allows the therapeutic effects of mAbs to be followed at clinically relevant endpoints.

  Therefore, tumor cells were injected into the prostate, lung, or ovary of mice and after 2 days, the mice were divided into two groups, a) either 200-500 μg) anti-98P4B6 Ab, or b) PBS, Treat 3 times a week for 2-5 weeks.

  A major advantage of the orthotopic prostate cancer model is the ability to study the development of metastases. The formation of metastases in mice bearing established orthotopic tumors was determined by IHC analysis in lung sections using antibodies against prostate-specific cell surface protein STEAP expressed at high levels in LAPC-9 xenografts (Hurbert, RS et al., Proc. Natl. Acad. Sci. USA 1999.96 (25): 14523-8).

  Mice bearing established orthotopic LAPC-9 or PC3-98P4B6 tumors are administered 1000 μg injections of either anti-98P4B6 mAb or PBS for 4 weeks. Both groups of mice can establish a high systemic tumor burden (PSA levels higher than 300 ng / ml for lAPC-9), ensuring a high frequency of metastasis formation in the mouse lungs. The mice are then sacrificed and their prostate and lungs are analyzed for the presence of tumor cells by IHC analysis.

These studies show the broad anti-tumor effect of anti-98P4B6 antibodies in the development and progression of prostate cancer in a xenograft mouse model. Anti-98P4B6 antibody inhibits tumor formation in both androgen-dependent and androgen-independent prostate tumors, delays the growth of previously established tumors and prolongs the survival of treated mice. Furthermore, anti-98P4B6 mAb shows a dramatic inhibitory effect on the spread of local prostate tumors to distal sites even in the presence of large systemic tumor burden. Therefore, anti-98P4B6 mAb is effective against major clinically relevant endpoints (tumor growth), prolonged survival and health.
Example 39: Curative and diagnostic use of anti-98P4B6 antibodies in humans
Anti-98P4B6 monoclonal antibodies are safe and are effectively used for diagnostic, prophylactic, prognostic and / or therapeutic purposes in humans. Western blot and immunohistochemical analysis of cancer tissues and cancer xenografts using anti-98P4B6 mAb shows strong and extensive coloration in cancer, but at significantly lower or undetectable levels in normal tissues . Detection of 98P4B6 in cancer and metastatic disease indicates the usefulness of mAbs as diagnostic and / or prognostic indicators. Anti-98P4B6 antibodies are therefore used in diagnostic applications (eg, immunohistology of renal biological specimens to detect cancer from suspicious patients).

  Anti-98P4B6 mAb specifically binds to cancer cells as detected by flow cytometry. Accordingly, anti-98P4B6 antibodies are used in diagnostic whole body imaging applications (eg, radioimmunoscintigraphy and radioimmunotherapy) for the detection of local and metastatic cancers that exhibit 98P4B6 expression (eg, Potamianos). S et al., Anticancer Res 20 (2A): 925-948 (2000)). The divergence or release of the extracellular domain of 98P4B6 into the extracellular environment (eg found in alkaline phosphatase B10 (Meerson, N, R, Hepatology 27: 563-568 (1998))) is associated with serum from suspicious patients and Allows diagnostic detection of 98P4B6 with anti-98P4B6 antibodies in / or urine samples.

Anti-98P4B6 antibodies that specifically bind 98P4B6 are used in therapeutic applications for the treatment of cancers that express 98P4B6. Anti-98P4B6 antibodies are used as non-binding modalities and binding modalities (eg, prodrugs, enzymes or radioisotopes) in which the antibody is conjugated to one of a variety of therapeutic modalities or imaging modalities well known in the art. The In preclinical studies, unbound and bound anti-antibodies are tested for efficacy in tumor prevention and growth inhibition in SCID mouse cancer xenograft models (eg, renal cancer models AGS-K3 and AGS-K6) (eg, “ 98P4B6 Monoclonal Antibody-Mediated Inhibition of Blader and Lung Tumors In Vivo ”). Either conjugated anti-98P4B6 antibody or unconjugated anti-98P4B6 antibody is used either as a therapeutic modality in human clinical trials alone or in combination with other therapies as described in the examples below.
Example 40: Human clinical trial for the treatment and diagnosis of human carcinomas through the use of human anti-98P4B6 antibodies in vivo
An antibody that recognizes an epitope on 98P4B6 is used in accordance with the present invention and this antibody is used in the treatment of specific tumors as listed in Table 1. Based on a number of factors (including 98P4B6 expression levels), tumors as listed in Table 1 are currently preferred indicators. In connection with each of these indicators, three clinical approaches are successfully implemented.
I. ) Adjunct therapy: In adjunct therapy, patients are treated with anti-98P4B6 antibody in combination with chemotherapeutic or anti-neoplastic agents and / or radiation therapy. Primary cancer targets as listed in Table I are treated under standard protocols by adding anti-98P4B6 antibody to the standard therapy of the first and second systems. The protocol design addresses the effectiveness as assessed by tumor mass reduction and the ability to reduce normal doses of standard chemotherapy. These dosage reductions allow for further and / or prolonged treatment by reducing the dose-related toxicity of the chemotherapeutic agent. The anti-98P4B6 antibody is a combination of the chemotherapeutic or anti-neoplastic agents adriamycin (advanced prostate carcinoma), cisplatin (advanced head and neck carcinoma, and lung carcinoma), taxol (breast cancer) and doxorubicin (preclinical). In combination, it is utilized in several ancillary clinical trials.
II. ) Monotherapy: In connection with the use of anti-98P4B6 antibodies in tumor monotherapy, these antibodies are administered to patients without chemotherapeutic or anti-neoplastic agents. In one embodiment, monotherapy is performed clinically in end-stage cancer patients with a wide range of metastatic disease. Patients show some disease stabilization. The study demonstrates efficacy in treatment resistant patients with cancerous tumors.
III. ) Contrast agent: Radiolabeled antibodies are utilized as diagnostic and / or contrast agents by binding radionuclides (eg iodine or yttrium (I ¹³¹ , Y ⁹⁰ )) to anti-98P4B6 antibodies. In such a role, the labeled antibody localizes to both solid tumors and metastatic lesions of 98P4B6-expressing cells. In connection with the use of anti-98P4B6 antibodies as contrast agents, these antibodies are useful for solid tumor surgical as both pre-operative screening and post-operative follow-up to determine which tumors remain and / or revert. Used as a treatment aid. In one ^embodiment, the (111 an In) 98P4B6 antibodies in patients with carcinomas expressing 98P4B6, as used to (analogy as contrast agent in a Phase I human clinical trials, e.g., Divgi et al., J.Natl.Cancer Inst .83: 97-104 (1991)). The patient is tracked with a standard front and rear gamma camera. These results indicate that primary and metastatic lesions are identified.

(Dose and route of administration)
As will be appreciated by those skilled in the art, dosing considerations can be determined relative to similar products present in the clinic. Thus, anti-98P4B6 antibody can be administered at doses ranging from 5 to 400 mg / m ² , eg, used at lower doses for safety studies. The affinity of an anti-98P4B6 antibody compared to the affinity of a known antibody for its target is one parameter used by those skilled in the art to determine a similar dosage regimen. Furthermore, anti-98P4B6 antibodies, which are fully human antibodies, have a slower clearance when compared to chimeric antibodies; therefore, administration in patients using such anti-98P4B6 antibodies, which are fully human antibodies, is more Can be low (probably in the range of 50-300 mg / m ² ) and still remain effective. Contrary to conventional dosimetry at mg / kg, administration at mg / m ² is a surface area-based scale and convenient administration designed to include patients of all sizes from infants to adults It is a scale.

  Three separate delivery approaches are useful for the delivery of anti-98P4B6 antibodies. Conventional intravenous delivery is one standard delivery technique for many tumors. However, for tumors in the peritoneal cavity (eg, tumors of the ovary, bile duct, other ducts, etc.) intraperitoneal administration is advantageous to obtain high doses of antibody in the tumor and also to minimize antibody clearance. It can be proved that In a similar manner, certain solid tumors have vasculature that is appropriate for local perfusion. Local perfusion allows high doses of antibody at the tumor site and minimizes short term clearance of the antibody.

(Clinical Development Plan (CDP))
Overview: CDP follows and develops the treatment of anti-98P4B6 antibodies as an adjunct therapy, monotherapy and as a contrast agent. The study first demonstrates safety and then confirms efficacy with repeated doses. The study is open label comparing standard chemotherapy with standard therapy plus anti-98P4B6 antibody. As will be appreciated, one criterion that can be utilized for patient enrollment is the expression level of 98P4B6 in the patient's tumor, as determined by biopsy.

  As with any protein or antibody injection-based therapy, safety concerns are primarily related to: (i) cytokine release syndrome (ie, hypotension, fever, shaking, chills) (Ii) development of an immunogenic response to the substance (ie, the patient's generation of a human antibody to an antibody therapeutic or a HAHA response); and (iii) toxicity to normal cells expressing 98P4B6. And follow-up is utilized to monitor each of these safety concerns.An anti-98P4B6 antibody is found to be safe upon human administration.

Example 41: Human clinical trial adjunct therapy with human anti-98P4B6 antibody and chemotherapeutic agent
A Phase I human clinical trial is initiated to evaluate the safety of six intravenous doses of human anti-98P4B6 antibody for the treatment of solid tumors (eg, cancer of tissues listed in Table I). In this study, it is used as an adjunct treatment for antineoplastic or chemotherapeutic agents as defined herein (eg, but not limited to cisplatin, topotecan, doxorubicin, adriamycin, taxol, etc.) If so, the safety of a single dose of anti-98P4B6 antibody is assessed. Test design includes delivery of six single doses of an anti-98P4B6 antibodies, the dosage of the antibody over a course of treatment according to the following schedule, increases from approximately about 25 mg / ^{m 2} to about 275 mg / ^{m 2:}

抗体および化学治療剤のそれぞれの投与後、患者を１週間密接に追跡する。特に、上記の安全性の懸念：（ｉ）サイトカイン放出症候群（すなわち、低血圧、発熱、振せん、悪寒）；（ｉｉ）その物質に対する免疫原性応答の発達（すなわち、ヒト抗体治療剤に対する、患者によるヒト抗体の発生、またはＨＡＨＡ応答）；ならびに（ｉｉｉ）９８Ｐ４Ｂ６を発現する正常細胞に対する毒性について、患者を評価する。標準的な試験および追跡試験を利用して、これらの安全性の懸念のそれぞれをモニタリングする。患者はまた、臨床結果について、そして特に、ＭＲＩまたは他の画像化によって証明されるような腫瘍質量の低減について、評価される。

Patients are followed closely for one week after each administration of antibody and chemotherapeutic agent. In particular, the above safety concerns: (i) cytokine release syndrome (ie, hypotension, fever, tremor, chills); (ii) development of an immunogenic response to the substance (ie, against human antibody therapeutics, Patients are evaluated for human antibody development or HAHA response); and (iii) toxicity to normal cells expressing 98P4B6. Monitor each of these safety concerns using standard and follow-up studies. Patients are also evaluated for clinical outcome and in particular for reduction of tumor mass as evidenced by MRI or other imaging.

  This anti-98P4B6 antibody has proven to be safe and effective, and phase II studies confirm this efficacy and refine the optimal dosing.

(Example 42: Human clinical trial: monotherapy using human anti-98P4B6 antibody)
Anti-98P4B6 antibodies are safe with respect to the ancillary studies discussed above, and Phase II human clinical trials confirm efficacy and optimal dosing for monotherapy. Such a test is accomplished except that the patient receives a dose of anti-98P4B6 antibody and does not receive chemotherapy at the same time, and includes the same safety and outcome analysis as the supplementary test described above.

Example 43 Human Clinical Trial: Diagnostic Imaging Using Anti-98P4B6 Antibody
Again, human clinical trials are conducted with respect to the use of anti-98P4B6 antibodies as diagnostic contrast agents because the adjuvant treatments discussed above are safe within the safety criteria discussed above. This protocol is designed in a manner substantially similar to that described in the art (eg, Divgi et al., J. Natl. Cancer Inst. 83: 97-104 (1991)). This antibody is found to be safe and effective when used as a diagnostic modality.

Example 44: Comparison of 98P4B6 homology with known sequences
The 98P4B6 gene is homologous to a previously cloned and sequenced gene, namely human STAMP1 (gi 15418732) (Korkmaz, KS et al., J. Biol. Chem. 2002, 277: 36689). Shows 99% identity and 99% homology to (Figure 4). 98P4B6 protein is also available in another human prostate 6 transmembrane epithelial antigen 2 (gi 23308593) (Walker, MG, et al., Genome Res. 1999, 9: 1198; Porka, K.P., Helenius, MA. And Visakorpi, T, Lab. Invest. 2002, 82: 1573), showing 99% identity and 99% homology. The closest mouse homologue to 98P4B6 is prostate 6 transmembrane epithelial antigen 2 (gi 28501136) with 97% identity and 99% homology. We have identified several variants of the 98P4B6 protein, including four splicing variants and three SNPs (FIG. 11). 98P4B6 v. One protein consists of 454 amino acids, has a calculated molecular weight of 52 kDa, and a pI of 8.7. This is a 6-transmembrane protein that can be localized to the cell surface or possibly the endoplasmic reticulum (Table VI). Some 98P4B6 variants (including v.1, v.5-v.8, v.13, v.14, v.21, v.25) share similar characteristics, such as Protein motifs have functional significance as well as structural commonality (eg, multiple transmembrane domains). 98P4B6 v. 2 is a short protein with no known motif.

  Motif analysis showed the presence of several known motifs, including oxidoreductase motifs, homocysteine hydrolase motifs, and dudulin motifs. A variant of this variant v. 7 and SNPs also carry Ets motifs that are often associated with transcriptional activity.

  Several oxidoreductases have been identified in mammalian cells, including NADH / quinone oxidoreductase. This protein is associated with the cell membrane and functions as a proton / Na + pump, which regulates the proteolysis of the tumor suppressor p53 and makes mammalian cells oxidative stress, cytotoxicity and mutagens. (Asher G et al., Proc Natl Acad Sci US A. 2002, 99: 13125; Jaiswal AK, Arch Biochem Biophys 2000, 375: 62 Yano T, Mol Aspects Med 2002, 23: 345). Homocysteine hydrolase catalyzes the degradation of S-adenosylhomocysteine to homocysteine and adenosine and ultimately regulates transmethylation, thereby regulating protein expression, cell cycle and cell proliferation. It is a known enzyme (Turner MA et al. Cell Biochem Biophys 2000; 33: 101; Zhang et al., J Biol Chem. 2001; 276: 35867).

  This information indicates that 98P4B6 plays a role in cell growth in mammalian cells and regulates gene transcription and electronic and small molecule transport. Thus, when 98P4B6 functions as a regulator of cell proliferation, tumorigenesis, or as a modulator of transcription involved in the activation of genes involved in inflammation, tumorigenesis or proliferation, 98P4B6 is therapeutic, diagnostic, prognostic. Used for purposes and / or preventive purposes. Furthermore, when a molecule (eg, a 98P4B6 variant or polymorphism) is expressed in cancerous tissue, it is used for therapeutic, diagnostic, prognostic and / or prophylactic purposes.

(Example 45: Effect of STEAP-2 expression on phenotype)
Expression of STEAP-2 protein having the amino acid sequence encoded by the cDNA insert in the plasmid shown in FIG. 2 and deposited with the American Type Culture Collection on July 2, 1999 and assigned ATCC Deposit Number PTA-311 Experiment on. As deduced from the coding sequence, this open reading frame encodes 454 amino acids with a 6-transmembrane domain. A summary of features associated with STEAP-2 protein is shown in FIG.

  The data presented in this patent application provides a STEAP-2 protein expression profile that is primarily specific to the prostate, among certain types of prostate tumors, as well as to other tumors, among normal tissues. This evidence is based on detecting messenger RNA using Northern blotting. Consistent with standard practice in this industry, Northern blots are routinely used to assess gene expression. This requires a time-consuming process required for Western blotting of proteins and histological examination of tissues to synthesize related proteins, raise antibodies and confirm the specificity of the antibodies. Because it does not. Northern blotting provides a reliable and efficient method of assessing RNA expression and expression levels.

  This example demonstrates that STEAP-2 protein is actually produced. In summary, this experiment shows that PC-3 cells and 3T3 cells modified to contain an expression system for STEAP-2 generally show enhanced levels of tyrosine phosphorylation, and in particular enhanced levels of ERK. It shows that it showed phosphorylation of protein. This data also shows that PC-3 cells containing an expression system for STEAP-2 showed altered calcium flux, altered response to paclitaxel, and general inhibition of drug-induced apoptosis. These are the effects shown at the protein level, so these data alone prove that STEAP-2 protein is present.

  Furthermore, although such phenotypic effects are mediated by the protein, further evidence indicates that the STEAP-2 protein itself is a mediator of this effect. This evidence is obtained by utilizing a modified STEAP-2 protein. The expression system is stably introduced into PC3 and 3T3 cells, allowing the expression of a modified form of STEAP-2 (referred to as STEAP-2CFl), where “Fl” represents flag . STEAP-2CF1 is a STEAP-2 protein with a peptide extension (ie, a Flag epitope that alters the physical conformation of the protein). This Flag epitope is a sequence of 8 amino acids and is often introduced at either the amino terminus or carboxy terminus of the protein as a means of identifying and tracking recombinant proteins in engineered cells (Slotstra JW et al., Mol Divers 1997, 2: 156). In most cases, introduction of a Flag epitope at either end of the protein has little effect on the natural function and location of the protein (Molloy SS et al., EMBO J 1994, 13:18). However, this depends on the characteristics of the protein tagged with Flag. Recent studies have shown that Flag tags affect the function and conformation of selected proteins (eg, CLN3 protein) (see, eg, Haskell RE, et al. Mol Genet Metab 1999, 66: 253). See As with CLN3, introducing a Flag epitope tag at the C-terminus of STEAP-2 alters the physical conformation and properties of this protein. Altering a STEAP-2 protein with a C-Flag epitope resulted in a marked decrease in otherwise observed effects, including ERK phosphorylation and resistance to drug-induced cell death. This data indicates that STEAP-2 protein mediates these phenotypic effects. Finally, in vitro translation studies using rabbit reticulocyte lysate showed that the STEAP-2 protein was translated to show the expected molecular weight.

  FIG. 20 and FIG. 21 show that PC-3 cells and 3T3 cells each contain a retroviral expression system pSR □ (containing STEAP-1, STEAP-2 and STEAP-2CF1, respectively) encoding the indicated proteins. Shows the results obtained when modified. Gene-specific protein expression was driven from the long terminal repeat (LTR) and the neomycin resistance gene was used for selection of mammalian cells that stably express this protein. PC-3 and 3T3 cells were transduced with retrovirus, selected in the presence of G418, and cultured under conditions that allowed expression of the STEAP-2 coding sequence. These cells were grown overnight in low concentrations of FBS (0.5-1% FBS) and then stimulated with 10% FBS. These cells were lysed in RIPA buffer and quantified for protein concentration. Whole cell lysates were separated by SDS-PAGE and analyzed by Western blotting using anti-phospho-ERK antibody (Cell Signaling Inc.) or anti-phosphotyrosine (UBI) antibody (FIGS. 20, 21, and 22). ). As shown in FIG. 20, compared to untransformed PC-3 cells, cells modified to contain STEAP-2 contain an enhanced amount of phosphorylated tyrosine. Similar results from similar experiments on 3T3 cells are shown on page 3. In this latter experiment, the STEAP-2CF1 expression system was also transfected into 3T3 cells, which were used as controls. As shown in FIG. 21, the enhanced phosphorylation found in the presence of native STEAP-2 was significantly reduced when the conformation of this protein was altered. These results thus conclude that STEAP-2 protein was produced and mediated the phenotypic effects described above.

  FIG. 22 shows similar results in both PC-3 and 3T3 cells, where ERK phosphorylation is specifically detected. This protocol does not probe the gel with an antibody specific for phosphotyrosine but instead probes the gel with both anti-ERK and anti-phospho-ERK antibodies, paragraph 5 above. It is similar to the protocol shown in. As shown in FIG. 22, both PC-3 cells and 3T3 cells modified to express STEAP-2 in the presence of 10% FBS showed phosphorylation of ERK. ERK phosphorylation was not detected in cells transformed to contain STEAP-2CF1. In contrast to control PC-3 cells which do not show background ERK phosphorylation, control 3T3-neo cells show low levels of endogenous ERK phosphorylation. Treatment with 10% FBS enhanced phosphorylation of ERK protein in cells expressing STEAP-2 as compared to 3T3-neo cells, while an increase in ERK phosphorylation was altered by STEAP- 2 (ie, STEAP-2 CF1) was not observed in 3T3 cells.

  Other effects on cellular metabolism in cells modified to include the STEAP-2 expression system were also shown in our data. FIG. 23 shows that cells with and without an expression system for STEAP-2 were measured for calcium flow in the presence of LPA and that calcium flow was enhanced in STEAP-2-containing cells. Show. Using FACS analysis and commercially available indicators (Molecular Probes), parental cells and cells expressing STEAP-2 were compared for their ability to transport calcium. PC3-neo and PC3-STEAP-2 cells were loaded with calcium-responsive indicators Fluo4 and Fura red, incubated in the presence or absence of calcium and LPA, and analyzed by flow cytometry. PC3 cells (Biochem Biophys Res Commun. 2001, 282: 729) expressing the known calcium transporter PC3-83P3H3 pCaT were used as a positive control. The table in FIG. 23 shows that STEAP-2 mediates calcium flow in response to LPA, and that the calcium flow magnitude is comparable to the calcium flow magnitude produced by known calcium channels.

  Furthermore, STEAP-2 expressing PC3 cells demonstrated an increased sensitivity to agatoxin, a calcium channel blocker, compared to PC3-neo cells. These results indicate that STEAP-2 expression sensitizes PC3 cells to treatment with Ca ++ channel inhibitors. Information derived from the above experiments provides a mechanism by which cancer cells are regulated. This is particularly appropriate for calcium. This is because calcium channel inhibitors have been reported to induce death of certain cancer cells (including prostate cancer cell lines) (eg, Batra S, Popper LD, Hartley-Asp B. Prostate. 1991, 19). : 299).

  FIG. 24 shows that cells transfected with the STEAP-2 expression system have an enhanced ability to survive exposure to paclitaxel. To determine the effect of STEAP-2 on survival, PC3 cells lacking or expressing STEAP-2 were treated with chemotherapeutic agents currently used in the clinic. The effect of treatment was assessed by measuring cell proliferation using the Alamar blue assay (Figure 23). Only 5.2% of PC3-neo cells were able to metabolize Almalare Blue and proliferate in the presence of 5 μM paclitaxel, while 44.8% of PC3-STEAP-2 cells survived under the same conditions. These results indicate that STEAP-2 expression confers resistance to paclitaxel. These findings have significant in vivo relevance. Because they show that STEAP-2 provides a proliferative advantage to prostate tumor cells in patients treated with conventional therapeutic agents.

  These results in a more detailed form are shown in FIGS. The results on these two pages demonstrate the mode of action that STEAP-2 supports PC3 cell survival. In these studies, PC3 cells expressing or deficient in STEAP-2 were treated for 60 hours with paclitaxel and assayed for apoptosis using Annexin V and propidium iodide staining conjugated to FITC. In apoptotic cells, the membrane phospholipid phosphatidylserine (PS) is translocated from the inner membrane to the outer membrane, thereby exposing the PS to the external cellular environment. PS is recognized by annexin V and binds to annexin V, providing scientists with a reliable means of identifying cells undergoing programmed cell death. Staining with propidium iodide identifies dead cells. FIG. 25 shows that STEAP-2 expression inhibits paclitaxel-mediated apoptosis by 45% compared to PC3-neo cells treated with paclitaxel. The protective effect of STEAP-2 is inhibited when STEAP-2 is modified by the presence of a Flag at its C-terminus (FIG. 26).

  Publicly available literature includes several examples of prostate cancer and other cancers that exhibit phenotypic characteristics similar to those observed in PC3 cells expressing STEAP-2. In particular, clinical studies have reported transient tumor regression and / or only partial responses in patients treated with paclitaxel. For example, when treated with doses of paclitaxel that induce third and fourth grade toxicity, only about 50% of prostate cancer patients entering paclitaxel single-drug clinical trials have reduced PSA levels. A much lower level of response was expected at this dose level. Thus, this data shows the development of paclitaxel resistance in prostate cancer patients (Beer TM et al., Ann Oncol 2001, 12: 1273). Similar phenomena of reduced responsiveness and progressive tumor recurrence have been observed in other studies (see, eg, Obasaju C, and Hudes GR. Hematol Oncol Clin North Am 2001, 15: 525). Furthermore, inhibition of calcium flow in cells that endogenously express STEAP-2 (eg, LNCaP cells) induces their cell death (Skrima R et al., J Physiol. 2000, 527: 71).

  Thus, STEAP-2 protein is produced not only in the cells tested, but also in unmodified tumor cells or unmodified prostate cells where the presence of mRNA has been shown. The Northern blot data herein clearly shows that messenger RNA encoding STEAP-2 is produced in certain prostate and tumor cells. 3T3 cells and PC-3 cells are themselves tumor cell lines and can clearly translate their messenger RNA into proteins. Like tumor cells and prostate cells that have been shown to produce mRNA, it has been shown that there is no impairment in the translation of this message in the cell, so this means that mRNA is produced. Can be reasonably concluded that the protein itself can be detected in unmodified tumor cells or prostate cells. This conclusion is also supported by the pattern of phenotypic changes seen in cells specifically modified to express STEAP-2, which are consistent with the changes seen in cancer cells. Based on the above data, it is scientifically concluded that cells and tissues that produce mRNA encoding STEAP-2 also produce the protein itself.

Example 46: Identification and confirmation of potential signaling pathways
Many mammalian proteins have been reported to interact with signaling molecules and to be involved in the regulation of signaling pathways (J Neurochem. 2001; 76: 217-223). Immunoprecipitation and Western blotting techniques are used to identify proteins that associate with 98P4B6 and mediate signaling events. Cancer organisms, including phospholipid pathways (eg, PI3K, AKT, etc.), adhesion and migration pathways (including FAK, Rho, Rac-1, etc.), and mitotic / survival cascades such as ERK, p38, etc. Several pathways known to play a role in science can be regulated by 98P4B6 (Cell Growth Differ. 2000, 11: 279; J Biol Chem. 1999, 274: 801; Oncogene. 2000, 19: 3003; J Cell Biol. 1997, 138: 913).

  To confirm that 98P4B6 activates known signaling pathways directly or indirectly in cells, luciferase (luc) based transcription reporter assays are performed in cells expressing individual genes. These transcription reporters contain consensus binding sites for known transcription factors located downstream of well-characterized signaling pathways. These related transcription factors, signal transduction pathways and reporters of activation stimuli and examples are listed below.

1. NFκB-luc, NFκB / Rel; Iκ-kinase / SAPK; proliferation / apoptosis / stress 2. SRE-luc, SRF / TCF / ELK1; MAPK / SAPK; proliferation / differentiation AP-1-luc, FOS / JUN; MAPK / SAPK / PKC; proliferation / apoptosis / stress 4. ARE-luc, androgen receptor; steroid / MAPK; proliferation / differentiation / apoptosis p53-luc, p53; SAPK; proliferation / differentiation / apoptosis CRE-luc, CREB / ATF2; PKA / p38; proliferation / apoptosis / stress.

  Gene-mediated effects can be assayed in cells exhibiting mRNA expression. A luciferase reporter plasmid can be introduced by lipid-mediated transfection (TFX-50, Promega). By incubating the cell extract with a luciferin substrate, luciferase activity, which is an indicator of relative transcriptional activity, is measured, and the luminescence of the reaction is monitored with a luminometer.

  The signaling pathway activated by 98P4B6 is mapped and used for therapeutic target identification and confirmation. When 98P4B6 is involved in cell signaling, it is used as a target for diagnostic, prognostic, prophylactic and / or therapeutic purposes.

(Example 47: 98P4B6 functions as a proton or small molecule transporter)
Sequence and homology analysis of 98P4B6 indicates that 98P4B6 can function as a transporter. To confirm that STEAP-1 functions as an ion channel, FACS analysis and fluorescence microscopy techniques are used (Gergely L et al., Clin Diagnostic Lab Immunol. 1997; 4:70; Skryma R et al., J Physiol. 2000, 527). : 71). Using FACS analysis and commercial indicators (Molecular Probes) for the ability to transport parental cells and cells expressing 98P4B6 in electrons, sodium, calcium; and other small molecules in cancer and normal cell lines Compare. For example, PC3 and PC3-98P4B6 cells are loaded with calcium responsive indicators Fluo4 and Fura Red, incubated in the presence or absence of calcium and lipophosphatidic acid (LPA), and analyzed by flow cytometry did. Ion flow represents an important mechanism by which cancer cells are regulated. This is especially true for calcium. This is because calcium channel inhibitors have been reported to induce the death of certain cancer cells, including prostate cancer cell lines (Batra S, Popper LD, Hartley-Asp B. Prostate. 1991, 19: 299). Similar studies are performed using sodium indicators, potassium indicators, pH indicators, and the like.

  Due to its homology to oxidoreductase, 98P4B6 may be involved in conferring drug resistance by recruiting and transporting small molecules. The effect of 98P4B6 on small molecule transport is investigated using a modified MDR assay. Control cells and 98P4B6-expressing cells are loaded with a small fluorescent molecule (eg, calcein AM). Release of calcein from the cells is measured by examining the supernatant for fluorescent compounds. MDR-like activity is confirmed using MDR inhibitors.

  If 98P4B6 functions as a transporter, it is used as a target for diagnostic, prognostic, prophylactic and / or therapeutic purposes.

(Example 48: Involvement in tumor progression)
The 98P4B6 gene can contribute to the growth of cancer cells. The role of 98P4B6 in tumor growth is confirmed in various primary and transfected cell lines, including prostate cell lines and NIH 3T3 cells engineered to stably express 98P4B6. Parental cells deficient in 98P4B6 and cells expressing 98P4B6 were tested for well-described proliferation assays (Fraser SP, Grimes JA, Djamoz MB. Prostate. 2000; 44:61, Johnson DE, Ocheng J, Evans SL. Atlantics 1996, 7: 288).

  To confirm the role of 98P4B6 in the transformation process, we investigate its impact in the colony formation assay. Express parental NIH-3T3 cells deficient in 98P4B6 and express 98P4B6 using a soft agar assay (Song Z. et al. Cancer Res. 2000; 60: 6730) under stringent and more permissive conditions Compare to NIH-3T3 cells.

  To confirm the role of 98P4B6 in cancer cell invasion and metastasis, a well established assay (eg, Transwell Insert System assay (Becton Dickinson) (Cancer Res. 1999, 59: 6010)) is used. Control cells (including prostate and fibroblast cell lines that lack 98P4B6) are compared to cells expressing 98P4B6. Cells are loaded with a fluorescent dye (calcein) and cells are plated in the upper wells of a Transwell insert coated with a basement membrane analog. Invasion is determined by the fluorescence of the cells in the lower chamber as compared to the fluorescence of the entire cell population.

  98P4B6 may also play a role in the cell cycle and apoptosis. Parental cells and cells expressing 98P4B6 are compared for differences in cell cycle regulation using a well established BrdU assay (Abdel-Malek ZA. J Cell Physiol. 1988, 136: 247). Briefly, cells are grown under both optimal conditions (sufficient serum) and limited conditions (low serum), labeled with BrdU, and stained with anti-BrdU Ab and propidium iodide. Cells are analyzed for entry into the G1, S and G2M phases of the cell cycle. Alternatively, the effect of stress on apoptosis is assessed in control parental cells and cells expressing 98P4B6, including normal and neoplastic prostate cells. Engineered cells and parental cells are treated with various chemotherapeutic agents (eg, etoposide, flutamide, etc.) and protein synthesis inhibitors (eg, cycloheximide). Cells are stained with Annexin V-FITC and cell death is measured by FACS analysis. Regulation of cell death by 98P4B6 may play an important role in regulating tumor progression and tumor burden.

  When 98P4B6 plays a role in cell proliferation, transformation, invasion or apoptosis, it is used as a target for diagnostic, prognostic, prophylactic and / or therapeutic purposes.

(Example 49: Involvement in angiogenesis)
Angiogenesis, or new capillary formation, is required for tumor growth (Hanahan D, Folkman J. Cell. 1996, 86: 353; Folkman J. Endocrinology. 1998 139: 441). Based on the effect of phosphodiesterase inhibitors on endothelial cells, 98P4B6 plays a role in angiogenesis (DeFouw L et al., Microvasc Res 2001, 62: 263). Several assays have been developed to measure angiogenesis in vitro and in vivo (eg, tissue culture assays for endothelial cell tube formation and endothelial cell proliferation). These assays and in vitro neovascularization are used to confirm the role (enhancement or inhibition) of 98P4B6 in angiogenesis.

  For example, endothelial cells engineered to express 98P4B6 are evaluated using tube formation and proliferation assays. The effect of 98P4B6 is also confirmed in vivo in animal models. For example, cells that either express or lack 98P4B6 are implanted subcutaneously in immunocompromised mice. Endothelial cell migration and angiogenesis are assessed 5-15 days later using immunohistochemical techniques. 98P4B6 has an effect on angiogenesis, which is used as a target for diagnostic, prognostic, prophylactic and / or therapeutic purposes.

(Example 50: Regulation of transcription)
The localization of 98P4B6 and its similarity to hydrolase and its Ets motif (v.7) indicate that 98P4B6 is effectively used as a modulator of transcriptional regulation of eukaryotic genes. Regulation of gene expression is confirmed, for example, by studying gene expression in cells that express or lack 98P4B6. For this purpose, two types of experiments are performed.

  In the first set of experiments, RNA from parental cells and RNA from 98P4B6 expressing cells were extracted and hybridized to a commercial gene array (Clontech) (Smid-Koopman E et al. Br J Cancer. 2000). .83: 246). Compare quiescent cells with cells treated with FBS or androgen. Differentially expressed genes are identified according to procedures known in the art. This differentially expressed gene is then mapped to a biological pathway (Chen K et al. Thyroid. 2001.11: 41).

  In a second set of experiments, specific transcription pathway activation is assessed using a commercially available (Stratagene) luciferase reporter construct. : NFκB-luc, SRE-luc, ELK1-luc, ARE-luc, p53-luc, and CRE-luc. These transcriptional reporters contain consensus binding sites for known transcription factors present downstream of a well-characterized signaling pathway and confirm pathway activation and positive modulators of pathway activation And represents a good tool for screening negative modulators.

  Thus, 98P4B6 plays a role in gene regulation. When 98P4B6 is involved in gene regulation, it is used as a target for diagnostic, prognostic, prophylactic and / or therapeutic purposes.

Example 51: Protein-protein association
Some 6TM proteins have been shown to interact with other proteins, thereby regulating signaling, gene transcription, transformation and cell adhesion. Immunoprecipitation techniques and the yeast two-hybrid system are used to identify proteins that associate with 98P4B6. Immunoprecipitates from cells expressing 98P4B6 and immunoprecipitates from cells lacking 98P4B6 are compared for specific protein-protein association.

  Studies are conducted to confirm the extent of association of effector molecules (eg, nuclear proteins, transcription factors, kinases, phosphates, etc.) with 98P4B6. Studies comparing 98P4B6 positive cells with 98P4B6 negative cells, and studies comparing unstimulated cells / resting cells with cells treated with epithelial cell activators (eg, cytokines, growth factors, androgens and anti-integrin Abs) Reveals a unique interaction.

  In addition, protein-protein interactions are confirmed using yeast two-hybrid methodology (Curr Opin Chem Biol. 1999, 3:64). A vector carrying a library of proteins fused to the activation domain of a transcription factor is introduced into yeast expressing 98P4B6-DNA-binding domain fusion protein and reporter construct. Protein-protein interactions are detected by colorimetric reporter activity. Specific association with effector molecules and transcription factors indicates to those skilled in the art the mode of action of 98P4B6 and thus identifies therapeutic, prognostic, prophylactic and / or diagnostic targets for cancer. This assay and similar assays are also used to identify small molecules that interact with 98P4B6 and screen for such small molecules.

  Thus, 98P4B6 is found to associate with proteins and small molecules. Thus, 98P4B6 and these proteins and small molecules are used for diagnostic, prophylactic, prognostic and / or therapeutic purposes.

  Throughout this application, various website data content, publications, patent applications, and patents are referenced. (A website is referenced by its uniform resource locator, or URL (address on the World Wide Web)). The disclosure of each of these references is hereby incorporated by reference in its entirety.

  The present invention should not be limited in scope by the embodiments disclosed herein. These embodiments are intended as merely illustrative of individual aspects of the invention, and any that are functionally equivalent are within the scope of the invention. Various modifications to the models and methods of the invention will become apparent to those skilled in the art from the foregoing description and teachings, in addition to the models and methods described herein. These are likewise intended to be within the scope of the present invention. Such modifications or other embodiments can be practiced without departing from the true scope and spirit of the invention.

FIG. 1 is a 183 nucleotide 98P4B6 SSH sequence. FIG. 2A shows the cDNA and amino acid sequences of 98P4B6 variant 1 (also referred to as “98P4B6 v.1” or “98P4B6 variant 1”). The starting methionine is underlined. The open reading frame extends from nucleic acid 355 to 1719, including the stop codon. 2B shows the cDNA and amino acid sequence of 98P4B6 variant 2 (also referred to as “98P4B6 v.2”) in FIG. 2B. The codon for the initiating methionine is underlined. The open reading frame extends from nucleic acids 4 to 138, including the stop codon. 2C shows the cDNA and amino acid sequence of 98P4B6 variant 3 (also referred to as “98P4B6 v.3”) in FIG. 2C. The codon for the initiating methionine is underlined. The open reading frame extends from nucleic acid 188 to 1552, including the stop codon. 2D shows the cDNA and amino acid sequence of 98P4B6 variant 4 (also referred to as “98P4B6 v.4”). The codon for the initiating methionine is underlined. The open reading frame extends from nucleic acid 318 to 1682, including the stop codon. FIG. 2E shows the cDNA and amino acid sequence of 98P4B6 variant 5 (also referred to as “98P4B6 v.5”) in FIG. 2E. The codon for the initiating methionine is underlined. The open reading frame extends from nucleic acid 318 to 1577, including the stop codon. FIG. 2F shows the cDNA and amino acid sequence of 98P4B6 variant 6 (also referred to as “98P4B6 v.6”) in FIG. 2F. The codon for the initiating methionine is underlined. The open reading frame extends from nucleic acid 318 to 1790, including the stop codon. 2G shows the cDNA and amino acid sequence of 98P4B6 variant 7 (also referred to as “98P4B6 v.7”). The codon for the initiating methionine is underlined. The open reading frame extends from nucleic acid 295 to 2025, including the stop codon. FIG. 2H shows the cDNA and amino acid sequence of 98P4B6 variant 8 (also referred to as “98P4B6 v.8”) in FIG. 2H. The codon for the initiating methionine is underlined. The open reading frame extends from nucleic acid 394 to 1866, including the stop codon. FIG. 2I shows the cDNA and amino acid sequence of 98P4B6 variant 9 (also referred to as “98P4B6 v.9”). The codon for the initiating methionine is underlined. The open reading frame extends from nucleic acid 355 to 1719, including the stop codon. FIG. 2J shows the cDNA and amino acid sequences of 98P4B6 variant 10 (also referred to as “98P4B6 v.10”). The codon for the initiating methionine is underlined. The open reading frame extends from nucleic acid 355 to 1719, including the stop codon. FIG. 2K shows the cDNA and amino acid sequence of 98P4B6 variant 11 (also referred to as “98P4B6 v.11”). The codon for the initiating methionine is underlined. The open reading frame extends from nucleic acid 355 to 1719, including the stop codon. FIG. 2L shows the cDNA and amino acid sequence of 98P4B6 variant 12 (also referred to as “98P4B6 v.12”). The codon for the initiating methionine is underlined. The open reading frame extends from nucleic acid 355 to 1719, including the stop codon. 2M shows the cDNA and amino acid sequence of 98P4B6 variant 13 (also referred to as “98P4B6 v.13”) in FIG. 2M. The codon for the initiating methionine is underlined. The open reading frame extends from nucleic acid 355 to 1719, including the stop codon. 2N shows the cDNA and amino acid sequence of 98P4B6 variant 14 (also referred to as “98P4B6 v.14”) in FIG. 2N. The codon for the initiating methionine is underlined. The open reading frame extends from nucleic acid 355 to 1719, including the stop codon. FIG. 2O shows the cDNA and amino acid sequence of 98P4B6 variant 15 (also referred to as “98P4B6 v.15”). The codon for the initiating methionine is underlined. The open reading frame extends from nucleic acid 355 to 1719, including the stop codon. FIG. 2P shows the cDNA and amino acid sequence of 98P4B6 variant 16 (also referred to as “98P4B6 v.16”). The codon for the initiating methionine is underlined. The open reading frame extends from nucleic acid 355 to 1719, including the stop codon. 2Q shows the cDNA and amino acid sequence of 98P4B6 variant 17 (also referred to as “98P4B6 v.17”) in FIG. 2Q. The codon for the initiating methionine is underlined. The open reading frame extends from nucleic acid 355 to 1719, including the stop codon. 2R shows the cDNA and amino acid sequence of 98P4B6 variant 18 (also referred to as “98P4B6 v.18”) in FIG. 2R. The codon for the initiating methionine is underlined. The open reading frame extends from nucleic acid 355 to 1719, including the stop codon. 2S shows the cDNA and amino acid sequence of 98P4B6 variant 19 (also referred to as “98P4B6 v.19”) in FIG. 2S. The codon for the initiating methionine is underlined. The open reading frame extends from nucleic acid 355 to 1719, including the stop codon. FIG. 2T shows the cDNA and amino acid sequence of 98P4B6 variant 20 (also referred to as “98P4B6 v.20”). The codon for the initiating methionine is underlined. The open reading frame extends from nucleic acid 295 to 2025, including the stop codon. 2U shows the cDNA and amino acid sequence of 98P4B6 variant 21 (also referred to as “98P4B6 v.21”). The codon for the initiating methionine is underlined. The open reading frame extends from nucleic acid 295 to 2025, including the stop codon. Figure 2V shows the cDNA and amino acid sequence of 98P4B6 variant 22 (also referred to as "98P4B6 v.22") in Figure 2V. The codon for the initiating methionine is underlined. The open reading frame extends from nucleic acid 295 to 2025, including the stop codon. 2W shows the cDNA and amino acid sequence of 98P4B6 variant 23 (also referred to as “98P4B6 v.23”) in FIG. 2W. The codon for the initiating methionine is underlined. The open reading frame extends from nucleic acid 295 to 2025, including the stop codon. 2X shows the cDNA and amino acid sequence of 98P4B6 variant 24 (also referred to as “98P4B6 v.24”) in FIG. 2X. The codon for the initiating methionine is underlined. The open reading frame extends from nucleic acid 295 to 2025, including the stop codon. FIG. 2Y shows the cDNA and amino acid sequence of 98P4B6 variant 25 (also referred to as “98P4B6 v.25”). The codon for the initiating methionine is underlined. The open reading frame extends from nucleic acid 394 to 1866, including the stop codon. Figure 2Z shows the cDNA and amino acid sequence of 98P4B6 variant 26 (also referred to as "98P4B6 v.26") in Figure 2Z. The codon for the initiating methionine is underlined. The open reading frame extends from nucleic acid 394 to 1866, including the stop codon. 2AA shows the cDNA and amino acid sequence of 98P4B6 variant 27 (also referred to as “98P4B6 v.27”) in FIG. 2AA. The codon for the initiating methionine is underlined. The open reading frame extends from nucleic acid 394 to 1866, including the stop codon. Figure 2AB shows the cDNA and amino acid sequence of 98P4B6 variant 28 (also referred to as "98P4B6 v.28") in Figure 2AB. The codon for the initiating methionine is underlined. The open reading frame extends from nucleic acid 394 to 1866, including the stop codon. 2AC shows the cDNA and amino acid sequence of 98P4B6 variant 29 (also referred to as “98P4B6 v.29”) in FIG. 2AC. The codon for the initiating methionine is underlined. The open reading frame extends from nucleic acid 394 to 1866, including the stop codon. 2AD shows the cDNA and amino acid sequence of 98P4B6 variant 30 (also referred to as “98P4B6 v.30”) in FIG. 2AD. The codon for the initiating methionine is underlined. The open reading frame extends from nucleic acid 394 to 1866, including the stop codon. 2AE shows the cDNA and amino acid sequence of 98P4B6 variant 31 (also referred to as “98P4B6 v.31”) in FIG. 2AE. The codon for the initiating methionine is underlined. The open reading frame extends from nucleic acid 394 to 1866, including the stop codon. 2AF shows the cDNA and amino acid sequence of 98P4B6 variant 32 (also referred to as “98P4B6 v.32”) in FIG. 2AF. The codon for the initiating methionine is underlined. The open reading frame extends from nucleic acid 394 to 1866, including the stop codon. 2AG shows the cDNA and amino acid sequence of 98P4B6 variant 33 (also referred to as “98P4B6 v.33”). The codon for the initiating methionine is underlined. The open reading frame extends from nucleic acid 394 to 1866, including the stop codon. 2AH shows the cDNA and amino acid sequence of 98P4B6 variant 34 (also referred to as “98P4B6 v.34”) in FIG. 2AH. The codon for the initiating methionine is underlined. The open reading frame extends from nucleic acid 394 to 1866, including the stop codon. FIG. 2AI shows the cDNA and amino acid sequence of 98P4B6 variant 35 (also referred to as “98P4B6 v.35”) in FIG. 2AI. The codon for the initiating methionine is underlined. The open reading frame extends from nucleic acid 394 to 1866, including the stop codon. 2AJ shows the cDNA and amino acid sequence of 98P4B6 variant 36 (also referred to as “98P4B6 v.36”) in FIG. 2AJ. The codon for the initiating methionine is underlined. The open reading frame extends from nucleic acid 394 to 1866, including the stop codon. Figure 2AK shows the cDNA and amino acid sequence of 98P4B6 variant 37 (also referred to as "98P4B6 v.37") in Figure 2AK. The codon for the initiating methionine is underlined. The open reading frame extends from nucleic acid 394 to 1866, including the stop codon. FIG. 2AL shows the cDNA and amino acid sequence of 98P4B6 variant 38 (also referred to as “98P4B6 v.38”) in FIG. 2AL. The codon for the initiating methionine is underlined. The open reading frame extends from nucleic acid 394 to 1866, including the stop codon. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. Continuation of FIG. 98P4B6 v. The amino acid sequence of 1 is shown in FIG. 3A; it has 454 amino acids. 98P4B6 v. The amino acid sequence of 2 is shown in FIG. 3B; it has 45 amino acids. 98P4B6 v. The amino acid sequence of 5 is shown in FIG. 3C; it has 419 amino acids. 98P4B6 v. The amino acid sequence of 6 is shown in FIG. 3D; it has 490 amino acids. 98P4B6 v. The amino acid sequence of 7 is shown in FIG. 3E; it has 576 amino acids. 98P4B6 v. The amino acid sequence of 8 is shown in Figure 3F; it has 490 amino acids. 98P4B6 v. The 13 amino acid sequence is shown in FIG. 3G; it has 454 amino acids. 98P4B6 v. The 14 amino acid sequence is shown in FIG. 3H; it has 454 amino acids. 98P4B6 v. The amino acid sequence of 21 is shown in FIG. 3I; it has 576 amino acids. 98P4B6 v. The 25 amino acid sequence is shown in FIG. 3J; it has 490 amino acids. As used herein, reference to 98P4B6 includes all variants thereof (including those shown in FIGS. 2, 3, 10 and 11) unless the context clearly indicates otherwise. . Comparison of 98P4B6 with known genes: human STAMP1, human prostate 6 transmembrane epithelial antigen 2 and mouse prostate 6 transmembrane epithelial antigen 2. Alignment of 98P4B6 variant 1 to human STAMP1 (gi 15418732). Comparison of 98P4B6 with known genes: human STAMP1, human prostate 6 transmembrane epithelial antigen 2 and mouse prostate 6 transmembrane epithelial antigen 2. Alignment of 98P4B6 variant 1 with human STEAP2 (gi 23308593). Comparison of 98P4B6 with known genes: human STAMP1, human prostate 6 transmembrane epithelial antigen 2 and mouse prostate 6 transmembrane epithelial antigen 2. Alignment of 98P4B6 variant 1 with mouse STEAP2 (gi 28501136). Comparison of 98P4B6 with known genes: human STAMP1, human prostate 6 transmembrane epithelial antigen 2 and mouse prostate 6 transmembrane epithelial antigen 2. Three 98P4B6 variants showing that 98P4B6 V1B has an additional 62aa at its N-terminus compared to V1, and 98P4B6 V2 has a point mutation from I to T at aa225 compared to V1 Cluster alignment. Hopp and Woods methods (Hopp TP, Woods K, accessed on the Protscale website (present on the World Wide Web (expasy.ch/cgi-bin/protscale.pl)) via the ExPasy Molecular Biology Server R., 1981. Proc. Natl. Acad. Sci. USA 78: 3824-3828), determined by computer algorithm sequence analysis, 98P4B6v. 1, v. 2, v. 5, v. 6 and v. 7 hydrophilic amino acid profiles. The Kyte and Doolittle method (Kyte J., Doottle R., et al.) Accessed on the ProtScale web site (present on the World Wide Web (.expasy.ch / cgi-bin / protscale.pl)) via the ExParsy molecular biology server. F., 1982. J. Mol. Biol.157: 105-132), determined by computer algorithm sequence analysis, 98P4B6v. 1, v. 2, v. 5, v. 6 and v. 7 Hydropathic amino acid profiles. Janin's method (Janin J., 1979 Nature 277: 491) accessed on the ProtScale website (existing on the World Wide Web (.expasy.ch / cgi-bin / protscale.pl)) via the ExParsy molecular biology server. -492) as determined by computer algorithm sequence analysis, 98P4B6v. 1, v. 2, v. 5, v. 6 and v. Amino acid profile of 7 accessible residues. Bhaskaran and Ponuswamy methods (Bhaskaran R., and Ponus) accessed on the ProtScale web site (present on the World Wide Web (.expasy.ch / cgi-bin / protscale.pl)) via the ExPasy molecular biology server. K., 1988. Int. J. Pept. Protein Res.32: 242-255), determined by computer algorithm sequence analysis, 98P4B6v. 1, v. 2, v. 5, v. 6 and v. 7. Average flexible amino acid profile. The Delage and Roux methods (Deleage, G., Roux B, accessed on the ProtScale website (present on the World Wide Web (.expasy.ch / cgi-bin / protscale.pl)) via the ExPasy molecular biology server 1987 Protein Engineering 1: 289-294), determined by computer algorithm sequence analysis, 98P4B6v. 1, v. 2, v. 5, v. 6 and v. Amino acid profile of 7 β-turns. FIG. 10 (a): SNP variant 98P4B6 v. 1 labeled alignment. Variant 98P4B6v. 9-v. 19 is v. It was a variant with a single nucleotide difference different from 1. Although these SNP variants have been shown separately, as shown in FIG. 12, they can also occur in any combination and any transcriptional variant containing that base. v. SNPs (eg, v.2, v.6, and v.8) in regions of other transcriptional variants that are not in common with 1 are not shown herein. The numbers are 98P4B6v. Corresponds to one variant. The black square is 98P4B6v. 1 shows the same sequence as 1. The SNP is indicated above with a square. Figure 10 (b): SNP variant 98P4B6 v. 7 labeled alignments. Variant 98P4B6v. 20-v. 24, v. It was a variant with a single nucleotide difference different from 7. Although these SNP variants have been shown separately, they can also occur in any combination and any transcription variant containing its base, as shown in FIG. v. These SNPs in the common region with 1 are not shown here. The numbers are 98P4B6v. Corresponds to 7 variants. The black square is 98P4B6v. The same sequence as 7 is shown. The SNP is indicated above with a square. Figure 10 (c): SNP variant 98P4B6 v. 8 labeled alignments. Variant 98P4B6v. 25-v. 38 is v. It was a variant with a single nucleotide difference different from 8. Although these SNP variants have been shown separately, they can also occur in any combination and any transcription variant containing its base, as shown in FIG. v. These SNPs in the common region with 1 are not shown here. The numbers are 98P4B6v. This corresponds to 8 variants. The black square is 98P4B6v. 8 shows the same sequence. The SNP is indicated above with a square. Labeled alignment of 98P4B6 protein variants. Protein variants corresponded to nucleotide variants. Nucleotide variants 98P4B (v.3 via v.12, v.4, v.9 to v.12, and v.15 via v.15 to v.19) are Coded the same protein as 1. Nucleotide variant 98P4B6v. 6 and v. 8 encoded the same protein other than a single amino acid at 475 (“M” in v.8). Variant v. 25 has one amino acid difference at 565 v. 25 (v.8 SNP variant). Similarly, v. 21 is represented by one amino acid at 565, v. It was different from 7. Single amino acid differences are indicated above with squares. The black square is 98P4B6v. 1 shows the same sequence as 1. The numbers below the squares are 98P4B6 v. Corresponding to 1. The structure of the transcriptional variant of 98P4B6. Variant 98P4B6v. 2 to v. 8 is v. 1 transcriptional variant. Variant v. 2, the 3 'portion is v. It was a single exon transcript that was the same as the last exon of 1. v. The first two exons of 3 are v. 1 intron 1 Variant v. 4, v. 5 and v. 6 is v. Splicing from 224 to 334 in the first exon of one. Furthermore, v. 5 is spliced with exon 5, while v. Exon 5 of 1 was elongated, but v. 6 was spliced with exon 6. Variant v. 7 used an alternative transcription start and a different 3 'exon. Variant v. 8 extends the 5 'end, v. 1 whole intron 5 was kept. v. The first 35 bases of 1 for the current assembly of the human genome, v. 1 in the 5 'proximity region. The exon end of the transcript is shown above the square. Potential exons of this gene are shown in turn, as in the human genome. Poly A tails and single nucleotide differences are not shown in the figure. The number in parentheses below the square is 98P4B6v. Corresponds to one variant. Intron and exon lengths are not proportional. Secondary structure and transmembrane prediction for 98P4B6 protein variants.

13 (A), 13 (B), 13 (C), 13 (D), 13 (E): 98P4B6 protein variant 1 (SEQ ID NO: 193), variant 2 (SEQ ID NO: 194), variant 5 (SEQ ID NO: 195), Variant 6 (SEQ ID NO: 196) and Variant 7 (SEQ ID NO: 197) secondary structures were obtained from the HNN-Hierarchical Neural Network method (Guermeur, 1997, World Wide Web. Pbil. estimated using ibcp.fr/cgi-bin/npsa_automat.pl?page=npsa_nn.html, and this method can be found in the Expasy molecular biology server (World Wide Web at .expasy.ch / tools). Is present). This method shows the presence and location of alpha helices, extended strands, and random coils from the primary protein sequence. The percentage of protein of a given secondary structure is also shown.
13 (F), 13 (H), 13 (J), 13 (L) and 13 (N); TMBASE (K. Hofmann, W. Stoffel. TMBASE-A database of membrane spanning proteins segment Biol. Chem-Hoppe. Schematic of the possible presence of transmembrane regions and orientations of each of 98P4B6 variants 1, 2, 5-7 based on Hofmann and Stoffel's TMpred algorithm using Seyler 374: 166, 1993).
13 (G), 13 (I), 13 (K), 13 (M) and 13 (O): Sonnhammer, von Heijne, and Klogh's TMHMM algorithm (Erik L. L. Sonnhammer, Gunnar von Heijne and Anders Krog: A. Hidden Markov model for predicting transmembrane helices in protein sequences.In Proc.of Six int.Cont. Of Int. Sankoff and C. Sensen Ed., Menlo Park, CA: AAAI Press, 1998). Schematic of the transmembrane region of each of 98P4B6 variants 1, 2, 5-7 and the possible presence of extracellular and intracellular directions. The TMpred and TMHMM algorithms are accessed from the ExParsy molecular biology server (present in World Wide Web .expasy.ch / tools).
Expression of 98P4B6 in human normal tissue and patient cancer tissue. First strand cDNA, normal stomach, normal brain, normal heart, normal liver, normal skeletal muscle, normal testis, normal prostate, normal bladder, normal kidney, normal colon, normal lung Of normal pancreas and prostate cancer patients, bladder cancer patients, kidney cancer patients, colon cancer patients, lung cancer patients, pools of cancer types from pancreatic cancer patients, and prostate cancer metastases to lymph nodes of two patients Made from the pool. Normalization was performed by PCR using primers for actin. 98P4B6 v. 1, v. 13 and v. 14 (A) or splicing variant 98P4B6 v. 6 and v. Semi-quantitative PCR using primers directly corresponding to 8 (B) was performed with 26 and 30 amplification cycles. Samples were separated on an agarose gel and PCR products were quantified using AlphaImager software. The results are 98P4B6 v. In normal prostate and prostate cancer. 1, v. 13 and v. 14 and its splicing variants v. 6 and v. A strong expression of 8 is shown. Expression was detected in bladder cancer, kidney cancer, colon cancer, lung cancer, pancreatic cancer, breast cancer, cancer metastases and prostate cancer metastases samples to lymph nodes compared to all normal tissues tested. 98P4B6 expression in patient cancer samples of lung, ovary, prostate pain, bladder, cervix, uterus and pancreas. First strand cDNA was prepared from a panel of patient cancer samples. Normalization was performed by PCR using primers for actin. 98P4B6 v. 1, v. 13 and v. Semi-quantitative PCR using primers corresponding to 14 was performed with 26 and 30 amplification cycles. Samples were electrophoresed on agarose gels and PCR products were quantified using AlphaImager software. Expression was recorded as absent, low, moderate or strong. The results show 98P4B6 expression in the majority of all patient cancer samples tested. Expression of 98P4B6 in gastric cancer patient samples.

(A) RNA was extracted from normal stomach (N) and 10 different gastric cancer patient samples (T). A Northern plot with 10 μg total RNA / lane was probed with the 98P4B6 sequence. The results show strong expression of 98P4B6 in gastric cancer tissue and weak expression in normal stomach. The lower panel represents ethidium bromide staining of the blot showing the quality of the RNA sample.
(B) For RNA dot blots, 98P4B6 expression was assayed in a panel of human gastric cancer (T) and normal tissues (N) corresponding to each of them. 98P4B6 was detected in 7 of 8 gastric cancers but not in normal tissues.
Detection of 98P4B6 expression using a polyclonal antibody. 293T cells were transformed into 98P4B6. GFP. pcDNA 3.1 / mychis constructs were transfected with clone A12 or clone B12. STEAP1. GFP vector was used as a positive control. An empty vector was used as a negative control. After 40 hours, cell lysates were collected. Samples were separated on SDS-PAGE acrylamide gels, blotted, and anti-GFP antibodies (anti-98P4B6 antibody raised against (A) amino acids 198-389 or (B) anti-raised against amino acids 153-165). Any of the 98P4B6 antibodies). The blot was luminescent using an ECL chemiluminescence kit and visualized by autoradiography. Since the results were detected by anti-GFP antibody, the expected 98P4B6. The expression of GFP fusion protein is shown. In addition, as shown in B and C, the inventors have 98P4B6. Two different polyclonal antibodies that recognized GFP could be made. Detection of 98P4B6 expression using a polyclonal antibody. 293T cells were transformed into 98P4B6. GFP. pcDNA 3.1 / mychis constructs were transfected with clone A12 or clone B12. 98P4B6. GFP fusion protein expression was detected by (A) flow cytometry and (B) fluorescence microscopy. The result showed strong green fluorescence in the majority of the cells. This fusion protein was located in the perinuclear region and the cell membrane. Features of STEAP-2. STEAP-2 expression in normal tissues is largely restricted to the prostate. STEAP-2 is expressed in several cancer tissues. Samples in patients induced prostate cancer, colon cancer and lung cancer; and multiple cancer cell lines including prostate, colon, Ewing's sarcoma, lung, kidney, pancreas and testis. By ISH, STEAP-2 expression appears to be mainly restricted to ductal epithelial cells. STEAP-2 induces tyrosine phosphorylation in PC3 cells. STEAP-2 induces tyrosine phosphorylation of proteins 140-150 kDa, 120 kDa, 75-80 kDa, 62 kDa and 40 kDa. STEAP-2 enhances tyrosine phosphorylation in NIH 3T3 cells. STEAP-2 enhances phosphorylation of p135-140 and p78-75 by STEAP-2 of NIH3T3 cells. STEAP-2 C-Flag enhances the phosphorylation of p180 and induces the dephosphorylation of p132, p82 and p75. STEAP-2 induces ERK phosphorylation. STEAP-2 induces ERK phosphorylation of PC3 and 3T3 cells in 0.5% FBS and 10% FBS. Phosphorylation deficiency or ERK phosphorylation in 3T3-STEAP-2-cflag cells. Potential role as dominant negative. STEAP enhances calcium flux in PC3 cells. PC-STEAP-1 and PC3-STEAP-2 show enhanced calcium flux in response to LPA. PC3-STEAP-1 exhibits sensitivity to L-type calcium channel inhibitor (conotoxin). PC3-STEAP-2 shows sensitivity to PQ type calcium channel inhibitor (agatoxin). NDGA and TEA had no effect on PC3-STEAP-2 cell proliferation. STEAP-2 alters the effect of paclitaxel on PC3 cells. Other chemotherapeutic agents tested without producing different responses between STEAP-expressing cells and control cells are flutamide, genistein, rapamycin. STEAP-2 confers partial resistance to PC3 cells on paclitaxel. Relative to PC3-Neo cells, the percent survival of PC3-STEAP-2 increases more than 8-fold. Inhibition of apoptosis by STEAP-2. PC3 cells were treated with paclitaxel for 60 hours and analyzed for apoptosis by Annexin V-PI staining. STEAP-2 expression partially inhibits apoptosis by paclitaxel. STEAP-2 attenuates paclitaxel-mediated apoptosis. PC3 cells were treated with paclitaxel for 68 hours and analyzed for apoptosis. STEAP-2 expression, but not STEAP-2CFlag, partially inhibits apoptosis by paclitaxel.

[Sequence Listing]

Claims (46)

A composition comprising:
a) a peptide of 8, 9, 10, or 11 consecutive amino acids of the protein of FIG. 2;
b) the peptides of Tables VIII-XXI;
c) peptides of Tables XXII-XLV; or d) peptides of Tables XLVI-XLIX,
A composition comprising, consisting essentially of, or consisting of.   The composition of claim 1, comprising a protein related to the protein of FIG. 2.   3. At least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homologous to the entire amino acid sequence shown in FIG. The protein according to 1.   The composition of claim 1, wherein the substance comprises a CTL polypeptide derived from the amino acid sequence of the protein of FIG. 2 or an analog thereof.   5. The composition of claim 4, further limited by the condition that the epitope is not the entire amino acid sequence of FIG.   2. The composition of claim 1, further limited by the condition that the polypeptide is not the entire amino acid sequence of the protein of FIG.   2. The composition of claim 1, comprising an antibody polypeptide epitope derived from the amino acid sequence of FIG.   8. The composition of claim 7, further limited by the condition that the epitope is not the entire amino acid sequence of FIG. An antibody epitope comprises a region of the peptide in any integer increment up to the end of the peptide of the amino acid of FIG. 2, wherein the epitope is:
a) an amino acid position having a value greater than 0.5 in the hydrophilic profile of FIG.
b) amino acid positions having a value of less than 0.5 in the hydropathic profile of FIG. 6;
c) an amino acid position having a value greater than 0.5 in the% accessible residue profile of FIG. 7;
d) an amino acid position having a value greater than 0.5 in the average flexibility profile of FIG. 8;
e) an amino acid position having a value greater than 0.5 in the β-turn profile of FIG. 9;
f) a combination of at least two of a) -e);
g) a combination of at least three of a) -e);
h) a combination of at least four of a) to e); or i) a combination of at least five of a) to e);
8. The composition of claim 7, comprising an amino acid position selected from:   A polynucleotide encoding the protein of claim 1.   The polynucleotide of claim 10 comprising the nucleic acid molecule described in FIG.   11. The polynucleotide of claim 10, further limited by the condition that the encoded protein is not the entire amino acid sequence of FIG.   12. The composition of claim 11, wherein the substance comprises a polynucleotide comprising the coding sequence of the amino acid sequence of FIG.   23. The polynucleotide of claim 22, further comprising an additional nucleotide sequence encoding the additional peptide of claim 1.   11. A composition comprising a polynucleotide that is fully complementary to the polynucleotide of claim 10. A method for generating a mammalian immune response to the protein of FIG. 2 comprising:
The cells of the mammalian immune system are:
a) a 98B4B6-related protein, and / or b) a nucleotide sequence encoding the protein,
Exposing to a portion of the protein, thereby generating an immune response against the protein. Said method is as follows:
Providing a 98B4B6-related protein comprising at least one T cell or at least one B cell epitope; and contacting the epitope with a T cell or B cell of a mammalian immune system, respectively, thereby The T cell or B cell is activated,
17. A method of generating an immune response according to claim 16, comprising:   18. The method of claim 17, wherein the immune system cell is a B cell, whereby the induced B cell produces an antibody that specifically binds to the 98B4B6-related protein.   18. The immune system cell of claim 17, wherein the immune system cell is a T cell that is a cytotoxic T cell (CTL), whereby the activated CTL kills autologous cells that express the 98B4B6-related protein. Method.   The immune system cell is a T cell that is a helper T cell (HTL), whereby the activated THL has cytotoxic activity of cytotoxic T cell (CTL) or antibody production activity of B cell. 18. The method of claim 17, wherein the method secretes a promoting cytokine. A method for detecting the presence of a 98B4B6-related protein or a 98B4B6-related polynucleotide in a sample, the method comprising the following steps:
Contacting the sample with a substance that specifically binds to 98B4B6-related protein or 98B4B6-related polynucleotide, respectively; and determining that the respective complex of the substance and 98B4B6-related protein or 98B4B6-related polynucleotide is present. The process of
Including the method. Contacting the sample with an antibody or fragment that specifically binds to the 98B4B6-related protein; and determining that a complex of the antibody or fragment thereof with the 98B4B6-related protein is present;
24. The method of claim 21, for detecting the presence of 98B4B6-related protein in a sample. In addition:
Collecting said sample from a patient having or suspected of having cancer;
The method of claim 21, comprising: Producing cDNA from the sample by reverse transcription using at least one primer;
Amplifying the cDNA thus produced using the 98B4B6 polynucleotide as a sense primer and an antisense primer, wherein the 98B4B6 polynucleotide used as the sense primer and the antisense primer is a 98B4B6 cDNA Acting to amplify; and detecting the presence of amplified 98B4B6 cDNA;
24. The method of claim 21 for detecting the presence of the mRNA of FIG. 2 in a sample. Said method is as follows:
Determining the status of one or more 98B4B6 gene products expressed by cells in a tissue sample from the individual;
Comparing the status thus determined to the status of one or more 98B4B6 gene samples in a corresponding normal sample; and one or more abnormal samples of 98B4B6 in the sample relative to the normal sample Identifying the presence,
23. The method of claim 21, for monitoring one or more 98B4B6 gene products in a biological sample from a patient having or suspected of having cancer, comprising:   Further comprising determining whether one or more elevated gene products of 98B4B6 mRNA or 98B4B6 protein are present, wherein one or more elevated gene products in the test sample relative to said normal tissue sample. 26. The method of claim 25, wherein the presence indicates the presence or condition of cancer.   27. The method of claim 26, wherein the cancer is present in the tissues listed in Table 1. A composition comprising:
a) a substance that modulates the state of the protein of FIG. 2, or b) a molecule that is regulated by the protein of FIG.
Wherein the condition of cells expressing the protein of FIG. 2 is regulated.   30. The composition of claim 28, further comprising a physiologically acceptable carrier.   30. A pharmaceutical composition comprising the composition of claim 28 in a human unit dosage form.   29. The composition of claim 28, wherein the substance comprises an antibody or fragment thereof that specifically binds to the protein of FIG.   32. The antibody or fragment thereof of claim 31 which is monoclonal.   32. The antibody of claim 31, which is a human antibody, a humanized antibody, or a chimeric antibody.   32. A non-human transgenic animal that produces the antibody of claim 31.   33. A hybridoma producing the antibody of claim 32. A method of delivering a cytotoxic or diagnostic agent to a cell that expresses the protein of FIG. 2, comprising the following:
Providing the cytotoxic agent or diagnostic agent conjugated to the antibody or fragment thereof of claim 4; and exposing the cell to the antibody-drug conjugate or fragment-drug conjugate. ,
Including the method.   29. The composition of claim 28, wherein the substance comprises a polynucleotide encoding an antibody or fragment thereof that immunospecifically binds to any of the proteins of FIG.   29. The composition of claim 28, wherein the substance comprises a) a ribozyme that cleaves a polynucleotide having a 98B4B6 coding sequence, or b) a nucleic acid molecule that encodes the ribozyme, and a physiologically acceptable carrier.   29. The composition of claim 28, wherein the substance comprises human T cells, wherein the T cells specifically recognize a 98B4B6 peptide subsequence in the context of a particular HLA molecule. A method of inhibiting the growth of cancer cells expressing the protein of FIG. 2 comprising:
Administering to the cells the composition of claim 28,
Including the method. 41. The method of claim 40, wherein the method inhibits the growth of cancer cells that express the protein of FIG. 2 and comprises the following steps:
Administering to the cell an antibody or fragment thereof that specifically binds to a 98B4B6-related protein;
Including the method. 41. The method of claim 40, wherein the method inhibits the growth of cancer cells that express the protein of FIG. 2 and comprises the following steps:
Administering 98B4B6-related protein to the cells;
Including the method. 41. The method of claim 40, wherein the method inhibits the growth of cancer cells that express the protein of FIG. 2 and comprises the following steps:
Administering to the cell a polynucleotide comprising a coding sequence for a 98B4B6-related protein or a polynucleotide complementary to a coding sequence for a 98B4B6-related protein;
Including the method. 41. The method of claim 40, wherein the method inhibits the growth of cancer cells that express the protein of FIG. 2 and comprises the following steps:
Administering to the cell a ribozyme that cleaves a polynucleotide encoding the protein of FIG.
Including the method. 41. The method of claim 40, wherein the method inhibits the growth of cancer cells that express the protein of FIG. 2 and a particular HLA molecule, the method comprising:
Administering a human T cell to the cancer cell, wherein the T cell specifically recognizes a peptide subsequence of the protein of FIG. 2, while the subsequence is associated with the particular HLA molecule. The process,
Including the method. Said method comprises the following steps:
Administering a vector that delivers a nucleotide encoding a single chain monoclonal antibody, whereby the encoded single chain antibody is expressed intracellularly in a cancer cell expressing the protein of FIG. ,
41. The method of claim 40, comprising:

Images