JP2005530512A - Nucleic acid isolated from the 5 'untranslated region (5'NTR) end of the human FGF-1 gene having IRES activity - Google Patents

Abstract

The present invention relates to an isolated nucleic acid of a human FGF-1 gene having an IRES (internal ribosome entry site) and the nucleotide sequence derived from the 5 ′ untranslated region (5′NTR) end of the human FGF-1 gene. The invention also relates to an expression cassette of at least one molecule of interest having at least one said sequence in eukaryotic cells. The cassette can be inserted directly or in the form of a vector into a host cell, and therefore the invention further relates to recombinant vectors and host cells transfected with the vector or cassette.

Description

  The present invention relates to an isolated nucleic acid having IRES (internal ribosome entry site) activity, wherein the nucleotide sequence is derived from the 5 ′ untranslated region (5′NTR) end of the human FGF-1 gene. The invention also relates to a cassette for expressing at least one molecule of interest in eukaryotic cells, said cassette comprising FGF-1 IRES and co-expressing several molecules from the same mRNA Enable. Since the cassette can be introduced directly into the host cell or inserted in the form of a vector, recombinant vectors and host cells transfected with the vector or cassette are also part of the invention.

  Regulation of gene expression occurs at several levels: transcription, maturation, mRNA stability, and translation. Translation of mRNA is subject to tight regulation and turns out to be an important step in the regulation of gene expression. For example, increased translation of the c-myc proto-oncogene has been associated with Bloom syndrome (20). This translational control abnormality may contribute to an increased risk of these patients progressing to cancer development.

  Regulation at the translational level involves many proteins and occurs primarily through the 5 ′ and 3 ′ untranslated regions (NTRs), but naturally also includes specific structural elements of the coding portion of mRNAs. The translation initiation step itself is also subject to adjustment.

  Conventional translation initiation occurs by recognition of a cap located at the 5 ′ end of the transcript. This structure allows translation initiation factors to bind. In this step, it is the eIF4F complex that acts as a linker between the cap and the small ribosomal subunit of 40S. This complex consists of three factors, eIF4E (cap-binding protein), eIF4A (RNA helicase), and other translation initiation factors, mRNA and eIF4G, which play a role in bridging the 40S small subunit. Once the latter is replenished, the mRNA will be “scanned” until a translational start codon (canonical or non-canonical) is encountered, after which the 60S subunit associates with the 40S subunit and translation of the reading frame occurs. It is initiated until the step codon is reached or until the ribosome dissociates.

  Certain messenger mRNAs have no cap and therefore cannot be translated by the mechanism described by Marylin Kozak. This is the case for picornavirus RNAs (14), where other systems that initiate translation have been demonstrated, with internal ribosome entry sites or IRES in the 5 'untranslated region (5'NTR) Involved. This site allows ribosomes to bind directly into mRNA by mechanisms that are not yet fully understood. Since this discovery, IRESs have been identified in other groups of RNAs of viruses such as flaviviruses, pestiviruses, tobamoviruses and retroviruses (19).

  The involvement of cellular proteins in the translation of these viral RNAs prompted research into this mechanism of internal entry in transcripts of cellular origin. In 1991, such sites were characterized by BIP (immunoglobulin heavy chain binding protein) (8) mRNA, and more recently, fibroblast growth factor FGF-2 (18), c-myc cancer. It was characterized by mRNA of the original gene (12), growth factor PDGF (platelet-derived growth factor) (2) and VEGF (vascular endothelial growth factor) (6).

  FGF-2 mRNA has a long 5 'NTR of approximately 500 peptides whose alternative translation initiation has been demonstrated with non-canonical CUG codons (1), and five isoforms of FGF-2 are formed. Will be. An internal ribosome entry site is also located between nucleotides 154 and 318 (data not published).

  VEGF mRNA itself also has a long untranslated sequence, most recently the existence of alternative initiation has been demonstrated with a non-canonical CUG codon. In this 5'NTR, the presence of two IRESs has been demonstrated, one located upstream of the CUG and the other located in the traditional AUG start codon (6).

  Surprisingly, the production of these two growth factors is controlled at the translational level by IRESs with angiogenic activity. These two factors are induced during the process of neovascularization of the expressing tumor. There is a third major angiogenic factor, FGF-1, but the translation of that mRNA has not been studied to date.

  Thus, the applicants have demonstrated that translation initiation of FGF-1 mRNA is involved in an internal entry site located in the 5 ′ untranslated region. In addition, FGF-1 transcript A in particular has been shown to unexpectedly have better in vivo IRES activity (mouse muscle) than other cellular RNA IRESs tested to date .

  The genomic structure of FGF-1 (11) has three exons containing the coding sequence (Figure number 1). The latter is spliced resulting in the formation of a single reading frame. Exon 3 contains a 3 ′ NTR terminus with a polyadenylation site.

  There are four different promoters for the human FGF-1 gene, which once activated result in the formation of four different major transcripts. After maturation, the differences between these four transcripts are only present in their respective 5 ′ NTRs (Figure 2). Exon 1 has a splice receptor site to which one of the four non-coding exons (A, B, C, D) binds following activation of the respective promoter.

  Transcripts A and B are the main transcripts expressed primarily in the brain, kidney and retina (Figure No. 2). These two transcripts have 5 'NTRs of 435 and 147 nucleotides, respectively.

  Transcripts C and D are minor transcripts that are very weakly expressed in vivo (11). However, they exist in glioblastoma derived systems and can be induced in fibroblasts or smooth muscle cells of vascular origin when subjected to serum deprivation or PMA (phorbol 12-myristate 13-acetate) treatment . These two transcripts have 5 'NTRs of 149 and 92 nucleotides, respectively.

  The presence of these four mRNA variants encoding FGF-1 is common to humans, mice (9) and cattle (16). Comparison of these human 5'NTR sequences showed good homology with that of bovine and mouse (9). Indeed, the sequence alignment of FGF-1 5'NTR from these different organisms (9, 11, 16) showed good conservation of these non-coding sequences with close to 70% similarity to 5'NTR A . Such conservation in the sequence of the untranslated region is usually provided at a relatively low selective pressure, thus allowing one to infer the important function of these 5'NTRs, which are regions that are subject to rapid evolution Let me.

  The IRES activity of the 5′NTR of each transcript A, B, C and D of human and mouse FGF-1 is demonstrated in the following description (Example 1, B1).

  In most cases, the presence of IRES is determined by transfecting Cos-7 cells with CAT-I-NuCAT vectors containing EGF-1 5′NTRs, and then subjecting the transfected cells to Western blotting. NuCAT protein expression is seen in the presence of transcripts A, B, C and D and reflects these four transcript IRES activities (quantitative analysis). The strong homology between bovine and especially mouse (9) and human 5′NTR sequences infers that IRES sites are also present in mouse and bovine FGF-1.

  The in vitro IRES activity of the 5'NTRs of each human FGF-1 transcript is also studied as a function of cell type and state (quantitative analysis) (Example 1B1).

  To do this, IRES activity is measured by a bicistronic vector encoding a reporter gene (in fact, LucF / LucR gene) in various systems. Calculation of the LucF / LucR ratio provides information on the internal entry ability of the 5′NTR sequence and defines the IRES activity of this sequence. Among the various results, very good IRES activity of transcript A is found in Hela and Sk-Hep-1 cells and is greater than that of FGF-2 IRES.

  Applicants further compared the IRES activity of human 5′NTRs (transcripts A and B) structure to that of mouse 5′NTR against human cells in vitro (Example 1B2). In order to perform a direct comparison with the human sequence, transfection was performed in Cos-7 cells, Sk-Hep-1 cells and Saos-2 cells. These experiments showed that the IRES activity profiles for human and mouse A and B variants were similar.

  The present invention not only demonstrated for the first time the IRES activity of the 5′NTRs of FGF-1, but also demonstrated that the IRES sites in various transcripts A, B, C and D of human FGF-1 This is because the characteristics were determined (Example 2). More specifically, Applicants have successfully identified the minimal sequence of each transcript A, B, C, and D that has IRES activity both in vitro and in vivo. To do this, various contiguous nucleotide sequences derived from FGF-1 messenger RNA were subcloned into a biocistron vector encoding a luciferase reporter gene. Various mammalian and human cell lines (in vitro) were transfected and mouse muscle (in vivo) was transduced with these vectors.

  Accordingly, the IRES activity of mouse FGF-1 due to the IRES activity and homology of human FGF-1 is disclosed for the first time in this application. This activity has been demonstrated for each transcript A, B, C, and D because it has in certain fragments of the 5 ′ NTRs of these transcripts.

  In the remaining description and claims, the phrase “homologous sequence” means a sequence that exhibits at least 60% identity, advantageously 80%, preferably 95%, with a given sequence, in which case one species Homology resulting from variability from one species to another, especially from mouse to human.

  Accordingly, the present invention is primarily identical to SEQ ID NO: 1 located between nucleotides 1 and 435 of the 5 ′ NTR of human FGF-1 mRNA transcript A (hereinafter referred to as A), or It relates to the use of isolated nucleic acids containing homologous sequences in terms of their IRES activity. This sequence corresponds to the entire sequence of the 5 ′ NTR of transcript A.

  As already described, Applicants have also succeeded in identifying nucleotide sequences on transcript A that are shorter than SEQ ID NO: 1 and have IRES activity, and therefore IRES sites are included in these sequences. Suggests that

The subject of the present invention is therefore also its use especially for its IRES activity:
The isolated nucleic acid having IRES activity comprises the same sequence as SEQ ID NO: 2 (hereinafter referred to as A2) located between nucleotides 1 and 390 of SEQ ID NO: 1,
An isolated nucleic acid having IRES activity is identical or homologous to SEQ ID NO: 3 (hereinafter referred to as A3) located between nucleotides 39 and 435 of SEQ ID NO: 1 Including
An isolated nucleic acid having IRES activity is identical or homologous to SEQ ID NO: 4 (hereinafter referred to as A4) located between nucleotides 122 and 435 of SEQ ID NO: 1 Including
-The isolated nucleic acid having IRES activity is identical or homologous to SEQ ID NO: 5 (hereinafter referred to as A5) located between nucleotides 214 and 435 of SEQ ID NO: 1. Including
An isolated nucleic acid having IRES activity is identical or homologous to SEQ ID NO: 6 (hereinafter referred to as A6) located between nucleotides 122 and 390 of SEQ ID NO: 1 Including
An isolated nucleic acid having IRES activity is identical or homologous to SEQ ID NO: 7 (hereinafter referred to as A7) located between nucleotides 214 and 390 of SEQ ID NO: 1. Including
An isolated nucleic acid having IRES activity is identical or homologous to SEQ ID NO: 8 (hereinafter referred to as A8) located between nucleotides 269 and 435 of SEQ ID NO: 1 Including
An isolated nucleic acid having IRES activity is identical to or is homologous to SEQ ID NO: 9 (hereinafter referred to as A9) located between nucleotides 269 and 390 of SEQ ID NO: 1. Including
An isolated nucleic acid having IRES activity is identical or homologous to SEQ ID NO: 12 (hereinafter referred to as A12) located between nucleotides 1 and 366 of SEQ ID NO: 1 Including
An isolated nucleic acid having IRES activity is identical or homologous to SEQ ID NO: 16 (hereinafter referred to as A16) located between nucleotides 122 and 366 of SEQ ID NO: 1 Including
-An isolated nucleic acid having IRES activity is identical or homologous to SEQ ID NO: 17 (hereinafter referred to as A17) located between nucleotides 214 and 366 of SEQ ID NO: 1. Including
An isolated nucleic acid having IRES activity is identical or homologous to SEQ ID NO: 18 (hereinafter referred to as A18) located between nucleotides 269 and 366 of SEQ ID NO: 1. Including
-An isolated nucleic acid having IRES activity is identical or homologous to SEQ ID NO: 19 (hereinafter referred to as A19) located between nucleotides 1 and 344 of SEQ ID NO: 1. Including
-An isolated nucleic acid having IRES activity is identical or homologous to SEQ ID NO: 20 (hereinafter referred to as A20) located between nucleotides 1 and 330 of SEQ ID NO: 1. including.

The nucleic acid corresponding to SEQ ID NO: 18 (A18) constitutes the shortest human FGF-1 transcript A fragment having IRES activity. For shorter sequences of 100 nucleotide order, significant IRES activity is
It cannot be obtained at least in human adenocarcinoma cells. In fact, as will be apparent from the examples that follow, IRES activity is determined by the following fragments:
A sequence identical to or homologous to SEQ ID NO: 10 (hereinafter referred to as A10) located between nucleotides 303 and 435 of SEQ ID NO: 1.
-A sequence identical to or homologous to SEQ ID NO: 11 (hereinafter referred to as A11) located between nucleotides 303 and 390 of SEQ ID NO: 1.
-A sequence identical to or homologous to SEQ ID NO: 13 (hereinafter referred to as A13) located between nucleotides 282 and 435 of SEQ ID NO: 1.
A sequence identical to or homologous to SEQ ID NO: 14 (hereinafter referred to as A14) located between nucleotides 282 and 390 of SEQ ID NO: 1,
-Not significant with respect to sequences identical to or homologous to SEQ ID NO: 15 (hereinafter referred to as A15) located between nucleotides 282 and 366 of SEQ ID NO: 1.

  As already described, Applicants have demonstrated that the 5 ′ NTR end of human FGF-1 transcript B has significant IRES activity, particularly in myoblasts.

  As a result, the present invention also provides SEQ ID NO: 30 located between nucleotides 1 and 147 of SEQ ID NO: 1 of the 5 ′ NTR of transcript B of human FGF-1 mRNA (hereinafter referred to as B). The present invention relates to an isolated nucleic acid having IRES activity, characterized in that it contains the same sequence or a homologous sequence (hereinafter referred to as A19). In other words, SEQ ID NO: 30 corresponds to the entire sequence of the 5 ′ NTR of transcript B.

  Applicants have also successfully identified nucleotide sequences on transcript B that are shorter than SEQ ID NO: 30 and have IRES activity, thus suggesting that these sequences are included in these sequences.

Therefore, the subject of the present invention is also:
-An isolated nucleic acid having IRES activity has IRES activity comprising the same sequence as SEQ ID NO: 31 (hereinafter referred to as B2) located between nucleotides 1 and 93 of SEQ ID NO: 30 Isolated nucleic acid.

The nucleic acid corresponding to SEQ ID NO: 31 (B2) constitutes the shortest human FGF-1 transcript B fragment having IRES activity. For sequences where the first 39th is deleted, no significant IRES activity is obtained at least in human adenocarcinoma cells. Indeed, as is clear from the following examples (FIG. 8B), the IRES activity is determined by the following fragments:
-A sequence identical to or homologous to SEQ ID NO: 32 (hereinafter referred to as B3) located between nucleotides 39 and 147 of SEQ ID NO: 30;
-Not significant for sequences identical to or homologous to SEQ ID NO: 33 (hereinafter referred to as B4) located between nucleotides 39 and 93 of SEQ ID NO: 30.

  Applicants have also demonstrated that the 5 ′ NTR end and subfragments of human FGF-1 transcript C have significant IRES activity.

  As a result, the subject of the present invention is also identical to SEQ ID NO: 36 located between nucleotides 1 and 149 of the 5 ′ NTR of transcript C of human FGF-1 mRNA (hereinafter referred to as C). It relates to an isolated nucleic acid having IRES activity, characterized in that it contains a sequence or a homologous sequence. This sequence corresponds to the entire sequence of the 5 'NTR of transcript C.

  Since an IRES site has been identified by the Applicant between nucleotides 1 and 103 of SEQ ID NO: 36, the present invention also includes SEQ ID NO: 37 (positioned between nucleotides 1 and 103 of SEQ ID NO: 36). The present invention relates to an isolated nucleic acid having IRES activity, characterized in that it contains the same sequence or a homologous sequence (hereinafter referred to as C2).

For sequences in which the first 59th is deleted, no significant IRES activity is obtained at least in human adenocarcinoma cells. Indeed, as is clear from the following examples (FIG. 8B), the IRES activity is determined by the following fragments:
An isolated nucleic acid exhibiting IRES activity comprising the same sequence as SEQ ID NO: 38 (hereinafter referred to as C3) located between nucleotides 59 and 149 of SEQ ID NO: 36;
-An isolated nucleic acid exhibiting IRES activity comprising the same sequence as SEQ ID NO: 39 (hereinafter referred to as C4) located between nucleotides 59 and 103 of SEQ ID NO: 36;
Is not significant.

  In addition, Applicants have demonstrated that the 5 ′ NTR terminus of human FGF-1 transcript D has significant IRES activity, particularly in myoblasts.

  As a result, the present invention also relates to a sequence identical to SEQ ID NO: 42 located between nucleotides 1 and 92 of the 5 ′ NTR of transcript D of human FGF-1 mRNA (hereinafter referred to as D). Or an isolated or recombinant nucleic acid having IRES activity, characterized in that it contains a homologous sequence. SEQ ID NO: 42 corresponds to the entire sequence of the 5 ′ NTR of transcript D.

  Furthermore, Applicants have demonstrated that the IRES activity of certain fragments can be increased by adding a certain number of nucleotides located 3 ′ of the IRES.

In particular, the present invention
-An isolated nucleic acid having IRES activity, containing the same or homologous sequence as SEQ ID NO: 26 (A26),
-An isolated nucleic acid having IRES activity, containing the same or homologous sequence as SEQ ID NO: 21 (A21),
-An isolated nucleic acid having IRES activity, containing the same or homologous sequence as SEQ ID NO: 34 (B10),
-An isolated nucleic acid having IRES activity, containing the same or homologous sequence as SEQ ID NO: 40 (C10),
-Includes an isolated nucleic acid having IRES activity, containing the same or homologous sequence as SEQ ID NO: 41 (C11).

  Because human FGF-1 and mouse FGF-1 have IRES activity, they are related to the production of cassettes that express one or more genes of interest in eukaryotic cells from the same mRNA under the control of a single promoter. Become a potential candidate.

  In the remaining description and claims, the phrase “gene of interest” refers to a nucleic acid encoding a polypeptide such as a protein of interest, an antigenic protein, an anti-antigenic protein, a pre-antigenic protein, or a tumor suppressor protein. Or other genes intended to compensate for genetic abnormalities such as mutations.

  As a result, according to another aspect, the present invention relates to a cassette that expresses at least one gene of interest in a eukaryotic cell, wherein said cassette contains at least one of said nucleic acids. And

  As will continue to be seen, cassettes containing single genes can be used to produce molecules of interest in vitro or in gene therapy.

  It is also possible to create a bicistronic cassette that results from the insertion of one of the nucleic acid sequences between two genes of interest, the second gene expression being coordinated with the first gene expression. More precisely, the first gene (first cistron) provides a cap-dependent translation level, while the second gene (second cistron) is internal to various FGF-1 5'NTRs. It is expressed in proportion to the activity of ribosome entry.

  This principle can be extended to their co-expression as long as three, four or more molecules are separated by the IRES sequences defined above, resulting in the expression of a multicistron cassette. Of course, the multiple cistron cassettes of the present invention include FGF-1 IRESs characterized in this application, such as those identified on BIP (immunoglobulin heavy chain binding protein), fibroblast growth factor FGF -2, with or without other IRESs such as c-myc proto-oncogene, growth factor PDGF (platelet derived growth factor), and VEGF (vascular endothelial growth factor).

  As a result, in certain embodiments, the expression cassette contains at least two genes of interest separated by the nucleic acid, and the first gene (first cistron) provides a cap-dependent translation level. On the other hand, the second gene (second cistron) is expressed in proportion to the activity of the IRES site present in the nucleic acid.

  In a known manner, the cassette also contains a promoter for controlling gene (s) expression.

  The major application of multicistron expression cassettes arises from gene therapy, as long as such cassettes allow the identical expression in vivo of the nucleotide (s) or gene product contained from the mRNA. These cassettes may also make it possible to express various molecules of industrial interest such as receptors, enzymes and the like. Gene therapy can be inferred by two different techniques generally known to those skilled in the art.

  The first technique consists in directly in vivo introducing a pharmaceutical composition containing a naked cassette contained in double-stranded DNA into a host organism (human or animal), said pharmaceutical composition comprising the present invention. Is part of.

  When using a naked cassette, the cassette is conjugated to any compound in the pharmaceutical composition that can facilitate penetration of the cassette into cells, particularly PEI and its derivatives, liposomes and derivatives, and the like.

  A recombinant vector contained in a pharmaceutical composition into which the expression cassette is inserted is also part of the invention. Thus, the expression cassette can be inserted into plasmid vectors or viral vectors such as retroviruses, lentiviruses, adenoviruses and AAVs.

  A second gene therapy technique consists in removing cells from the host organism, introducing a naked cassette or cassette inserted into the vector into the cell in vitro, and then reintroducing the modified cell into the host organism. In this way, the cassette product can be expressed in the patient's body.

  As already mentioned, if the expression cassette contains only one molecule of interest, this cassette can be used to produce said molecule from cell culture in vitro. As noted above, the cassette can be in naked form or inserted into a vector. The cassette or vector is then introduced into the host cell by transfection techniques well known to those skilled in the art. Such techniques can be, for example, physical techniques (electroporation), chemical techniques, synthetic vectors, calcium phosphate precipitation, or other methods such as cell fusion, conjugation.

  As a result, the invention also relates to a recombinant host cell characterized in that it comprises an expression cassette or a recombinant vector as described above.

The recombinant host cell of the present invention is not particularly limited, but in particular:
911 Human fetal retinoblast, no ATCC number Genethon
C2 / 7 mouse myoblast; no ATCC number Genethon line
CHQ5B Human fetal myoblast
C2C12 mouse myoblast-derived system 91031101
CV-1 CRL-1654 transformed with Cos-7 SV-40 virus T antigen
Hela human uterine cancer epithelial cell CCL-2
L929 Immunosuppressive mouse connective tissue CCL-1
NIH-3T3 mouse fetal fibroblast CRL1658
Saos-2 human osteosarcoma epithelial cells (p53-/-) HTB-85
SK-Hep-1 Human liver adenocarcinoma HTB-52
SK-N-AS Human neuroblastoma cells 94092302
SK-N-BE human neuroblastoma cells 95011815
It is.

  Indeed, peptide production is obtained by transfection of host cells placed in culture with a naked cassette or a cassette inserted into a vector in vitro.

  Analysis of peptide expression is performed using cell extracts prepared from transfected cells. Depending on the nature of the peptide of interest, its expression level is analyzed by various detection techniques (enzyme assay, immunodetection, etc.). For industrial use purposes of the molecules of interest, they can be purified. For other uses, cells genetically modified with an expression cassette are used to generate the molecule of interest (ex vivo gene therapy, pharmacological screening).

  Expression cassettes produced from the IRES sequences that are the subject of the present invention can also be inserted into animal cells (eggs) in order to create transformed animals.

  As a result, the present invention also relates to a transformed animal characterized in that the cell contains a naked cassette or a cassette inserted into the vector. Indeed, the animal is obtained by introducing a cassette or vector into the cells at the fetal stage. This type of technique is generally known to those skilled in the art.

  The present invention will become apparent from the following embodiments with reference to the accompanying drawings.

IRES activity of four types of transcripts A, B, C and D of human and mouse FGF-1 in vitro
A / Materials and methods
mRNA extraction: For all cell types, RNA extraction was performed on a dense dish of cells (10 cm in diameter). Each plate was washed twice with sterile PBS and then treated with 1 ml of RNAble lysis buffer (Eurobio). Subsequently, total RNA was treated with chloroform, precipitated with isopropanol, and washed with 80% ethanol. After drying, it was adjusted to 50 μl with water and analyzed at 260 nm.
Reverse transcription: For all cell types, reverse transcription reactions were performed according to the superscript II protocol (Gibco BRL). 2 μg of total RNA extract was used per reaction. A hexamer degenerate primer was used for cDNA synthesis of human FGF-1. For mouse cDNA synthesis, a 3 ′ primer specific for mouse FGF-1 was used.
Oligonucleotide: represents the sequence of the primer in the 5 'to 3' direction. The SpeI cloning site in the 3 ′ primer and the NcoI cloning site in the 5 ′ primer are underlined. Due to exon 1 ATG pairing, the 3 ′ primer is common to all 5 ′ untranslated regions (5′NTR) of homologous organisms.
Human FGF-1 primer
3 'primer: CTGCTGAG CCATGG CTGAAGGG SEQ ID NO: 43;
5 'Primer A: ACA ACTAGT GGGCATACCAGTGTCAGCTGCA SEQ ID NO: 44;
B: CTA ACTAGT AGAGAGCCGGGCTACTCTGAGAA SEQ ID NO: 45;
C: ACA ACTAGT CCAGGCAGTGGGGCCGGCTGGCCAGACTCTTGGGGGATTCCTT AG SEQ ID NO: 46;
D: ACA ACTAGT AGAGAGAGAGAAAAAATACTGTTGGCAGCAGCACAATG SEQ ID NO: 47.
Mouse FGF-1 primer
3 's primer: ACCACCGCTGCTTGCTGCCGAG CCATGG CTGAA SEQ ID NO: 48;
5'sA primer: CTCT ACTAGT GTCCTTTAGTGCCAGCTAGCCTTACA SEQ ID NO: 49;
sB: TCTCCA ACTAGT AGAGCTGCAGAAATCCTGAGG SEQ ID NO: 50.
PCR: PCR was performed using platinum TAQ polymerase (Gibco BRL), which can amplify DNA with high GC content and has high specificity. For each PCR, 3 μl of the cDNA synthesized above was used. For PCR aimed at amplification of 5′NTR C and D, 50 ng of a plasmid fragment having a part of these various 5′NTRs (defined by IM Chiu (11)) was added. Mouse transcripts A and B were amplified in a similar manner. Amplified according to the “touchdown PCR” method. 5′NTR A was amplified with 5′A primer and 3 ′ primer under the following conditions. 94 ° C 5 minutes, 94 ° C 30 seconds 76 ° C 2 minutes 3 times, 94 ° C 30 seconds 74 ° C 2 minutes 3 times, 94 ° C 30 seconds 72 ° C 2 minutes 25 times, and finally 72 ° C 5 minutes.

  5′NTR B was amplified under the following conditions. 94 ° C 5 minutes, 94 ° C 30 seconds 68 ° C 2 minutes 3 times, 94 ° C 30 seconds 66 ° C 1 minute 68 ° C 1 minute 3 times, 94 ° C 30 seconds 64 ° C 1 minute 68 ° C 1 minute 25 times, last At 68 ℃ for 5 minutes. A 3 ′ primer and a 5 ′ B primer were used. Similarly, 5′NTR C and D and mouse 5′NTR A and B were amplified with corresponding primers. Amplification conditions are the same as those for 5'NTR B. Hybridization temperatures are 70 ° C for 5'NTR C, 70 ° C for 5'NTR D, 68 ° C for mouse 5'NTR A, and 66 for mouse 5'NTR B. ° C.

  Cell culture: Obtain cell lines from the American Type Culture Collection (ATCC) or the European Collection of Cell Culture (ECACC), and follow the manufacturer's instructions. Cultured.

  Plasmid construction: SpeI (located within the 5 ′ PCR primer) and NcoI (located within the 3 ′ PCR primer) were used to incorporate various 5 ′ NTRs of FGF-1 into the bicistronic vector. . Various plasmids were obtained by conventional molecular biology techniques. Ligation, transformation, selection of positive clones, sequencing, preparation of concentrated solution (1 μg / ml).

  Transfection: All transfections were performed using the FUGENE6 reagent with a ratio of 2.5 μl / μg of plasmid DNA according to the protocol specified by Boeringher-Roche. Transfections for luciferase assays were performed in 12 well dishes (80000 cells per well and 1 μg plasmid).

  For Western blotting, transfection was performed using 2 μg of plasmid DNA in a 5 cm diameter dish containing 200,000 Cos-7 cells.

  Luciferase Assay: LucR and LucF activity was measured using a “Dual Luciferase Reporter Assay” system (Promega). The transfected cells placed in a 12-well dish were washed twice with PBS. 48 hours after transfection, the cells were detached and homogenized in 100 μl of lysis buffer included in the kit. The chemiluminescent LucF and LucR signals were measured with a luminometer with automatic injector (Berthold).

  Western blotting: 48 hours after transfection, Cos-7 cells were washed twice with PBS and harvested in 1 ml PBS. After centrifugation (2000 g, 2 minutes), the precipitate was resuspended in 1% SDS solution (containing protease inhibitor) and sonicated. Protein analysis was performed spectrophotometrically at 595 nm using BCA reagent (Pierce. 20 μg of protein from each cell extract was used for Western blotting. Briefly, cell lysates were After heat treatment at 95 ° C. for 2 minutes in 1% SDS, 0.1M DTT and loading buffer, the proteins were separated on a 12.5% polyacrylamide gel and transferred to a nitrocellulose membrane.CAT and NuCAT proteins were isolated from rabbit polyclonal anti-CAT. Immunodetection was performed with antibody (diluted 1/10000 in the laboratory) After antibody binding, peroxidase-conjugated anti-rabbit IgG antibody was detected with a chemiluminescent reagent (Amersham).

B / Result
Presence of IRES in various 5'NTRs of B1 / human FGF-1 Cloning of 5'NTR cDNA of human FGF-1: The first step is cloning of various 5'NTRs of human FGF-1. To do this, total RNA was extracted from a laboratory human cell line. After reverse transcription, PCR was performed for the purpose of amplifying various 5′NTR sequences of FGF-1. If the expected fragment is present after amplification, it indicates that each transcript is present in the examined cell type. Amplification of various 5 ′ NTRs of human FGF-1 was observed from cDNA derived from SK-Hep-1, SK-N-BE and SK-N-AS cells. The amount of cDNA from SK-Hep-1 cells was higher, allowing cloning with bicistronic vectors.

  Bicistron vector: In order to examine various 5 ′ NTR activities of FGF-1 in various cell types, the bicistron vector method (14) used for demonstrating the presence of IRES was applied (FIG. 3). These constructs allow the expression of two different reporter genes from the same mRNA. Various 5 'NTRs of FGF-1 were inserted between these two reporter genes. The first cistron gives a cap-dependent translation level. The second cistron is expressed in proportion to IRES (internal ribosome entry) activity in various 5 ′ NTRs of FGF-1.

B1.1 Assay for IRES activity of 5'NTR of FGF-1 in Cos-7 cells
CAT-1-NuCAT bicistronic vector: The CAT-I-NuCAT bicistronic vector was the first vector used to qualitatively examine the IRES activity of various 5'NTRs of FGF-1 by Western blotting. . In practice, these vectors contain a chloramphenicol acetyltransferase (or CAT) cDNA in the first cistron and a nucleolin-CAT fusion protein (NuCAT) cDNA in the second cistron (Figure 4). The difference in molecular weight between these two types of proteins can be easily separated on polyacrylamide gels under denaturing conditions. Following transcription to the membrane, antibodies to the C-terminal region of CAT can be easily visualized using CAT and NuCAT proteins. Evaluation of the ratio of the second cistron to the first cistron gives information about the IRES capability of the incorporated sequence and defines the IRES activity.

  Results: Cos-7 cells were transfected with various CAT-I-NuCAT vectors containing 5'NTR of FGF-1. Western blotting after these transfections is shown in FIG.

  Variation due to differences in transfection efficiency is observed in the CAT band (first cistron). However, NuCAT protein expression is observed in the presence of transcripts A, B and C. These results suggest strong IRES activity of mutant B of FGF-1 and sufficient activity of mutant A (which is lower in this case if it is related to transfection efficiency). The activity of 5'NTR C and D is much lower. Overexposure of the film also indicates that there is no alternative initiation of FGF-1 in the four 5 'NTRs. This phenomenon described and observed for FGF-2 (1) results in the formation of an isoform with a higher molecular weight (Figure number 4, blue arrow).

  This result is consistent with the sequence published by Chiu et al., Which indicated that there was a stop codon (a few bases before FGF-1 AUG) in exon 1 (11 ). The presence of IRES activity for variants A, B and C facilitates a quantitative comparison of the IRES activity of these various transcripts in different cell types. Other bicistronic vectors encoding a luciferase reporter gene were used for this study because Western blotting is not a suitable method.

B.1.2 Comparison of 5'NTR IRES activity of FGF-1 in various cell types
LucR-I-LucF bicistronic vector: The LucR-I-LucF bicistronic vector (4) expresses two types of luciferases, which use different substrates. Renilla luciferase (LucR) is the first cistron and firefly luciferase (LucF) is the second cistron (FIG. 5A). LucF conveys IRES activity and, like LucR, can be analyzed with high sensitivity. The non-specific re-start phenomenon observed when a highly stable (△ G = -40kcal / mol) stem loop structure is located at position 3 'of the LucR gene and a short sequence is incorporated at the site between cistrons. It was possible to suppress (figure number 5A). The use of such a system based on the high detection sensitivity of the reporter gene allows for rapid, accurate and concomitant quantification of each reporter activity. The LucF / LucR ratio calculation shows the IRES ability of the 5'NTR sequence and defines the IRES activity of this sequence.

  RHL vector (4) was used to standardize IRES activity between various cell types in the laboratory. This vector has a stem-loop structure but no IRES between the two cistrons. This vector makes it possible to determine the value of non-specific initiation of the second cistron and eliminates variability in transfection efficiency between cell types.

Results: In order to examine the difference in IRES activity depending on the cell type, various cell lines were selected according to the expression of the four types of FGF-1 transcripts and the known results regarding IRES of FGF-2. Cos-7 cells (already used in the CAT-I-NuCAT vector), cell lines that can amplify the 4 types of 5'NTR of FGF-1 (SK-Hep-1 cells) and cell lines that did not amplify (Hela cells) Selected. The p53 ^{− / −} osteosarcoma-derived Saos-2 cells are the last model chosen for this study because of their very high IRES activity of FGF-2 (4). FIG. 5B shows the result of transfection using the LucR-I-LucF vector in Cos-7, Hela, SK-Hep-1 and Saos-2 cells. As seen in FIG. 4, it is apparent that 5′NTR A, B and C have IRES activity. On the other hand, the activity of 5'NTR D was very low, the lowest among the cell types examined. However, the activity of 5'NTR A, B and C was very variable.

  The most active is usually 5'NTR A, which ranges from 5.5 to 12.7. The activity of 5′NTR A in Hela cells and SK-Hep-1 cells is higher than the IRES activity of FGF-2. On the other hand, the ARES of mutant A does not function as well as the IRES of FGF-2 in Cos-7 and Saos-2 cells (although the values recorded in these cell types are the highest).

  FGF-1 mutant B is more active (10 units) than mutant A in Cos-7 cells. Its activity is moderate in Saos-2 cells. In the other cell types examined, 5'NTR B has no activity.

  Mutant C has moderate activity in SK-Hep-1 and Saos-2 cells (5.8 and 7.5 in order, respectively). Nevertheless, the activity of 5'NTR C is highest in the latter cell type. Its activity is very low in Cos-7 cells and Hela cells.

  It may be added that the information obtained with the CAT-I-NuCAT vector in Cos-7 cells correlates with the values obtained with the LucR-I-LucF vector.

IRES in various 5'NTRs of B2 / mouse FGF-1
The same genetic structure as that of humans is found in mice (Figure No. 6A), cows, pigs and chickens. Arrangement of FGF-1 5′NTR sequences (9, 11, 16) of these various organisms showed that these untranslated sequences were sufficiently conserved. In particular, this conservation has been confirmed between mouse and human, and 5'NTR A has nearly 70% homology (Fig. 7A).

  Assuming the hypothesis that the IRES mechanism is conserved from mouse to human, we conducted a comparative study of human and mouse FGF-1 variants A and B.

  To do this, it was amplified by RT-PCR and 5′NTR A and B of mouse FGF-1 (FIG. 6B) were cloned from the mouse cell line cDNA. And the same research method was used. Construction of LucR-I-LucF bicistronic vector, transfection in cell types used for human homologue studies.

  Cloning of mouse FGF-1 5'NTR A and B cDNAs: For human 5'NTR, a similar cloning method was used by RT-PCR. The same amplification problem resulted and the same enzyme and stringency were used. Mouse 5′NTR was amplified from the cDNA of L929 cells and recloned.

  Comparison of 5'NTR A and B IRES activity of mouse and human FGF-1 in human cells: For direct comparison with human sequences, transfer was performed in Cos-7, Sk-Hep-1 and Saos-2 cells. Was performed. The results after the luciferase assay are shown in Figure No. 7B.

  The characteristics of IRES activity of human and mouse variant A are equal. With the exception of Saos-2, both have similar values depending on the cell type and appear to be similarly controlled. Indeed, the IRES activity of mouse variant A is higher in these cells, equal to the value observed for FGF-2 IRES. Similar magnitude IRES values are seen for 5'NTR B in humans and mice. Furthermore, the highest IRES activity is observed in Cos-7 cells for constructs containing 5'NTR B of human FGF-1. This is also true for mouse homologues.

Characterization of IRES of four transcripts A, B, C and D of human FGF-1 in vitro Example 2A: Characterization in human adenocarcinoma cells (SK-Hep-1)
Characterization of the IRES activity of the four transcripts, which of fragments A to D, most has sufficient IRES activity (so that the IRES site of each transcript can be located relatively accurately) Consisting of determining whether it is a short nucleotide sequence. This experiment was performed on human adenocarcinoma cells (SK-Hep-1). The following was investigated as follows.
-Full length 5'NTR of transcript A (A)
-5'NTR contiguous fragments of transcript A (A2, A3, A4, A5, A6, A7, A8, A9, A10, A11, A12, A13, A14, A15, A16, A17, A18, A19, A20 20 nucleotide sequence corresponding to
-Full length 5'NTR of transcript B (B)
-4 nucleotide sequence corresponding to the contiguous fragment of the 5 'NTR of transcript B (B2, B3, B4)
-Full length 5'NTR of transcript C (C)
-4 nucleotide sequence corresponding to consecutive fragments (C2, C3, C4) of 5'NTR of transcript C
-Full length 5'NTR of transcript A (A)

  The nucleotide sequence to be verified was a contiguous sequence derived from mRNA and subcloned into a bicistronic vector according to the same procedure described in Example 1. The bicistronic vector incorporates a nucleotide sequence to be verified between two luciferase genes, encoding two luciferases, Renilla luciferase (LucR, first cistron) and firefly luciferase (LucF, second cistron). It is. This is to quantify the ability of the nucleotide sequences to be verified to generate translation initiation by IRES by measuring LucF activity. The LucF activity value is related to the LucR activity value which is itself proportional to the amount of mRNA. In order to show the IRES activity value in arbitrary units (AUs), the ratio of LucF / LucR is related to the value of the negative control (bicistron vector without IRES) representing the degree of “leakage”. For human adenocarcinoma (SK-Hep-1) cell extracts, LucR and LucF luciferase activities were measured 48 hours after transfection.

  The results are shown in FIGS. 8A and 8B.

  IRES FGF-1A: As shown in FIG. 8A, 5′NTR A of FGF-1 mRNA (nucleotides 1 to 435) enables IRES with an efficiency of about 14 AU. Therefore, the result of Example 1 is confirmed. Based on this mapping, it can be concluded that analysis of each part of this 5'NTR does not require IRES activity from 1 to 270, 387 to 435 nucleotides. Based on this mapping, the minimum IRES for FGF-1A is 269 to 366. It may be concluded that (construct A18). IRES activity is optimized by the presence of nucleotides located on either side, such as 214-269 or 366-435 (construct A5). Important but not necessarily sufficient elements are located at 270-304.

  IRES FGF-B: FIG. 8B shows that 5′NTR B (nucleotides 1 to 147) of FGF-1 mRNA has a relatively low activity of 3 AU. Therefore, the result of Example 1 is confirmed. Deletion of nucleotides 0 to 39 completely inactivates IRES (Figure 8B, constructs B3 and B4).

  Other examples show that the IRES of FGF-1B has higher activity in other cell types.

  IRES FGF-1C: FIG. 8B shows that 5′NTRC (149 nucleotides) of FGF-1 mRNA has a highly efficient activity of 6 AU. Interestingly, deletion of nucleotides 103 to 149 (corresponding to a region common to the four NTRs of the FGF-1 mRNA) causes an increase in IRES activity (4 AU). It can therefore be concluded that the minimal IRES of FGF-1C consists of nucleotides 1 to 103. Furthermore, the deletion of the first 59 nucleotides deactivates IRES activity.

  IRES FGF-ID: FIG. 8B shows that the 5 ′ NTR D of FGF-1 mRNA does not have IRES activity in SK-Hep-1 cells. However, other examples show that this fragment has IRES activity in other cell types, especially C2 / 7 myoblasts.

Example 2B: Characterization in 911 cells (human embryo retinoblasts) and C2 / 7 cells (mouse myoblasts) Example 2A is repeated with fragments A2, A6, A7 and A9.

  Embryo retinoblasts and myoblasts were plated in 24-well plates 1-2 days before transfection. Total transfection of retinoblasts and neuroblasts was performed at 3 μl / μl plasmid DNA concentration per well using Lipofectamine reagent according to the life technologies protocol. Forty-eight hours after transfection, cells were lysed with 100 μl lysis buffer (dual luciferase, Promega). After adding 50 μl of reagent (dual luciferase, Promega), luciferase activity (Renilla and firefly) was measured for 10 minutes with 20 μl of cell lysate (mediator PhL, luminometer).

  The results are shown in FIGS. 9A and 9B. A hairpin is a reference sequence with a stem-loop structure and does not have an IRES.

  As FIG. 9A shows, the 5 ′ NTR of translation product A and fragments A2, A6, A7 and A9 have sufficient IRES activity. The same is true for the 5′NTR of translation products B, C, and D in myoblasts, but in human adenocarcinoma cells (SK-Hep-1) these same sequences showed lower activity ( See Example 2A).

Example 2C: Characterization in C2 / 7 myoblasts that later differentiate into myotubes Example 2A is repeated using transcripts A, A9, B, C and D, and this activity is compared to that of EMCV.

  Myoblasts are plated in 12-well plates 1-2 days prior to transfection. For fragments containing hairpins, EMCV, A, A9, B, C or D, transfections were performed as described above in duplicate. Cells were lysed 24 hours after transfection (Figure 9C, diagonal lines) or 9 days (Figure 9C, stippled). During the 9 day incubation, myoblasts differentiate into myotubes in DMEM medium supplemented with 5% bovine serum.

  As FIG. 9C shows, the IRES activity of FGF-1 transcript A, fragment A9 and FGF-1 transcript B is higher in myotubes than myoblasts. FGF-1 transcripts C and D have similar activity in myoblasts and myotubes.

  Interestingly, the IRES activity of FGF-1 transcript A (ratio = 8.47), fragment A9 (ratio = 11.63) and FGF-1 transcript B (ratio = 18.27) in myotubes for myoblasts is Much higher than that of EMCV (ratio = 6.44).

Example 2D: Characterization of mutant transcripts in 911 cells (human embryonic retinoblasts)
Example 2A is repeated using various transcripts with specific sequences added between the IRES and AUG codons of the firefly luciferase gene.

The obtained fragments are as follows.
A26: SEQ ID NO: 26 (nucleotides 269 to 435 of the sequence of SEQ ID NO: 8 + 20 nucleotides)
A21: SEQ ID NO: 21 (nucleotides 269 to 435 of the sequence of SEQ ID NO: 8 + 40 nucleotides)
A22: SEQ ID NO: 22 (nucleotides 269 to 435 of the sequence of SEQ ID NO: 8 + 70 nucleotides)
A25: SEQ ID NO: 25 (nucleotides 269 to 435 of the sequence of SEQ ID NO: 8 + 135 nucleotides)
A23: SEQ ID NO: 23 (nucleotides 269 to 390 in the sequence of SEQ ID NO: 9 + 70 nucleotides)
A24: SEQ ID NO: 24 (nucleotides 269 to 390 of the sequence of SEQ ID NO: 9 + 135 nucleotides)
B10: SEQ ID NO: 34 (nucleotides 1 to 147 of the sequence of SEQ ID NO: 30 + 40 nucleotides)
B11: SEQ ID NO: 35 (nucleotides 1 to 147 of the sequence of SEQ ID NO: 30 + 70 nucleotides)
C10: SEQ ID NO: 40 (nucleotides 1 to 149 of the sequence of SEQ ID NO: 36 + 40 nucleotides)
C11: SEQ ID NO: 41 (nucleotides 1 to 149 of the sequence of SEQ ID NO: 36 + 70 nucleotides)

  The results are shown in FIGS. 8C and 8D.

  The IRES efficiency of FGF1A (FIG. 8C) increases for A26 and A21 and decreases for A22 and A25. However, the portion contained between nucleotides 390 to 435 is required for IRES efficiency (variants A23 and A24). The IRES efficiency of FGF1B and FGF1C is increased by 4 to 6 AU compared to the wild type IRES (FIG. 8D). Furthermore, the reversibility of fragments A, B and C is fully observed.

Example 2E: Characterization of mutant transcripts in 911 cells (human embryonic retinoblasts)
Example 2A is repeated using various transcripts of fragment A8 with a different 40 nucleotide sequence added between the IRES and AUG codons of the firefly luciferase gene.

The obtained fragments are as follows.
A27: SEQ ID NO: 27 (nucleotides 269 to 435 of the sequence of SEQ ID NO: 8 + 40 nucleotides)
A28: SEQ ID NO: 28 (nucleotides 269 to 435 of the sequence of SEQ ID NO: 8 + 40 nucleotides)
A29: SEQ ID NO: 29 (nucleotides 269 to 435 of the sequence of SEQ ID NO: 8 + 40 nucleotides).

  In three cases sufficient IRES activity is obtained, which again shows sufficient reversibility of fragment A. After about 100 strains have been tested, it is observed that at least 80% of them have the same or higher efficiency as transcript A.

In vivo activity of 5 'NTR of human FGF-1 transcripts A, B, C and D The experiment is performed according to the following protocol.

  The animals used are weaned female mice of about 6 weeks of age and the strain is Balb / C (IFFA CREDO). Mice are anesthetized with a mixture of ketamine (100 mg / kg) and xylazine (10 mg / kg). Anesthesia lasts 20 minutes.

  DNA was amplified and purified with endotoxin-free maxi preparation (Endofree, Qiagen). After precipitation, DNA was prepared at a concentration of about 50 μg and 30 μl with 150 mM NaCl solution (Sigma).

  DNA is injected into the left anterior tibia using a Hamilton syringe. Coat pre-haired limb with conductive gel. Two electrodes are placed on one limb to induce electrotransfer. Normally, 20 electrical pulses of 20 milliseconds are sent at a frequency of 2 Hz. The voltage is 200V / cm. These experiments were performed in groups of 3 animals / plasmid.

  One week later, the animals are killed by intraperitoneal injection of 0.1 ml of 6% pentobarbital and cervical dislocation. The anterior tibia is removed and frozen with liquid nitrogen. Place the muscle in 500 μl of lysis buffer supplemented with protein inhibitor cacte to a concentration of 16.7 μl / ml. Dissolve the muscle lysate at 37 ° C for 5 minutes and vortex, then centrifuge at 15000G for 5 minutes at 4 ° C. For 20 μl of muscle lysate, luciferase activity (Renilla and firefly) was measured (mediators PhL, luminometer) 10 seconds after adding 50 μl of reagent (Dual Luciferase, Promega)

  Control muscles are muscles injected with 30 μl of 150 mM NaCl and electroporated, or untreated.

Example 3A: Comparison of IRES activity of transcript A of human FGF-1 with respect to known IRES This example shows the IRES activity of transcript A of human FGF-1 in vivo, ie mouse muscle, EMCV, VEGF, FGF2 It is intended to be compared with other IRES such as BIPS and PDGF IRES.

  As FIG. 10 shows, the IRES activity of FGF-1A is comparable to that of EMCV, and is higher than the IRES of VEGF, FGF-2, Bip and PDGF.

Example 3B: Comparison of the IRES of EMCV IRES with the IRES of Human FGF-1 Transcript A and its Subfragments A, A2, A6, A7 and A9 in Vivo as shown in FIG. The 1A and modified A2, A6, and A7 IRESs are as active as the EMCV IRES, but the minimal IRES of FGF-1A (construct A9) has a slightly higher activity.

  Example 3C: Regarding IRES of EMCV, IRES of human FGF-1 transcript A, IRES of its subfragments A and A11, IRES of human FGF-1 transcript B, IRES of its subfragments B2 and B3, human Comparison of IRES of FGF-1 transcript C and its fragments C2 and C3

  As FIG. 12 shows, the IRES of FGF-1B and FGF-1C has the same activity as the IRES of EMCV. The minimal IRES of FGF-1B (fragment B3) and the minimal IRES of FGF-1C (fragment C2) have a much higher activity than the IRES of EMCV.

  Fragment A11 has no activity. This confirms that the minimum IRES of FGF-1A is A9 (Example 3B).

[References]

Fibroblast growth factor 1 gene: A diagram showing the composition of the human FGF-1 gene, where exons 1, 2 and 3 constitute three coding exons: non-coding exons 1A, 1B, 1C and exon 1 1D splicing produces A, B, C and D mRNAs, respectively. The starting point for transcription of transcript A is preceded by the canonical sequences CCAAT and TATA. Figure 4 shows four transcripts A, B, C and D encoding FGF-1: Transcripts A and B are the main transcripts and are expressed in the kidney, brain and retina. Transcripts C and D are minor transcripts and are expressed in fibroblasts and vascular smooth muscle cells (VSMCs) after induction with serum or PMA. They are also expressed on cells derived from prostate cancer (PC3) or lung cancer, or cells derived from glioblastoma. IRES test method: diagram illustrating the principle of bicistronic vectors: the first cistron of the bicistron mRNA provides a cap-dependent translation level, the second cistron is an internal entry in the FGF-1 5'NTRs Expressed in proportion to the activity of The calculation of the protein Y / protein X ratio defines the IRES activity of the sequence located between the two cistrons. FIG. 5 shows Western blotting after transfection of Cos-7 cells with the vector CAT-I-NuCAT: the intensity of the band corresponding to CAT provides a cap-dependent translation level. The intensity of the NuCAT band corresponds to the IRES activity of the 5 ′ NTR under investigation. N. T .: extracted from non-transfected cells; FIG. 5 shows a vector containing FGF-2 5′NTR. A, B, C, D: Vectors containing A, B, C, D 5'NTRs of human FGF-1, respectively; Arrow 1: Start codon from alternative translation start in FGF-2 5'NTR High molecular weight isoform induced by CUG. FIG. 2 is a diagram showing comparison of IRES activity of bicistron LucR-I-LucF mRNAs and human FGF-1 5′NTRs in various cell types. It is a figure which shows LucR -I- LucF bicistronic mRNA. The stem-loop structure was placed at the 3 ′ position of LucR to limit the phenomenon of non-specific translation reinitiation in the LucF second stron. It is a figure which shows the IRES activity of 5'NTRs of human FGF-1 in various cell types. The value on the Y axis is obtained by calculating the activity ratio of LucF / LucR and is expressed in arbitrary units. It is a figure which shows a mouse | mouth FGF-1 gene and a transcript. It is a figure which shows a mouse | mouth FGF-1 gene structure. Exons 1, 2 and 3 constitute three coding exons; splicing of non-coding exons -1A and -1B in exon 1 generates FGF-1 A and B mRNAs. FIG. 2 shows mouse FGF-1 transcripts A and B. The transcripts usually have a reading frame and a 3 ′ NTR region, differing in their 5 ′ NTR end potency. It is a figure which shows the comparison between human 5'NTR and mouse | mouth 5'NTR of FGF-1. It is a figure which shows the arrangement | sequence arrangement | sequence of 5'NTR class A of mouse | mouth FGF-1 (mFGF-1) and human FGF-1 (hFGF-1). It is a figure which shows the IRES activity of 5'NTR class A and B of human FGF-1 (h FGF-1) and mouse FGF-1 (m FGF-1) in various cell types. The value on the Y axis is obtained by calculating the activity ratio of LucF / LucR and is expressed in arbitrary units. It is a figure which shows the IRES activity of various human FGF-1 5'NTR subfragments in SK-Hep-1 human adenocarcinoma cells. The value on the Y axis is obtained by calculating the activity ratio of LucF / LucR and is expressed in arbitrary units. Of 20 nucleotide sequences of fragment A (A, A2, A3, A4, A5, A6, A7, A8, A9, A10, A11, A12, A13, A14, A15, A16, A17, A18, A19, A20) It is a figure which shows IRES activity. FIG. 4 shows the IRES activity of the nucleotide sequences of fragments B and C, each of four nucleotide sequences (B, B2, B3, B4) and (C, C2, C3, C4) and fragment D. It is a figure which shows the IRES activity of six variant fragments A (A26, A21, A22, A23, A24, A25) in the 911 system (embryonic retinoblast). It is a figure which shows the IRES activity of two variant fragments B (B10, B11) and two variant fragments C (C10, C11) in the 911 system (fetal retinoblast). It is a figure which shows the IRES activity of three variant fragments A27, A28, and A29 in 911 system | strain (embryo retinoblast). IRES activity of various human FGF-1 5'NTR subfragments in 911 system (fetal retinoblast (Fig. 9A)), myoblast (Fig. 9B) and myotube differentiated myoblast (Fig. 9C) FIG. The value on the Y axis is obtained by calculating the activity ratio of LucF / LucR and is expressed in arbitrary units. 5 nucleotide sequences of fragment A (A, A2, A6, A7, A9), nucleotide sequence of fragment B including the nucleotide sequence of fragment B2 with respect to FIG.9A, nucleotide sequence of fragment C including the nucleotide sequence of fragment C2 with respect to FIG.9A , And the nucleotide sequence of fragment D was also tested. FIG. 6 shows a comparison of IRES activity of human FGF-1 (intramuscular injection of mice) transcript A in vivo for EMCV, VEGF, FGF2, Bip and PDGF. FIG. 6 shows a comparison of the IRES activity of human FGF-1 transcript A and subfragments A2, A6, A7 and A9 in vivo for EMCV IRES. Human FGF-1 transcript A and all its subfragments for EMCV IRES, human FGF-1 transcript B and its subfragments B2 and B3, human FGF-1 transcript C and its fragments C2 and C3 It is a figure which shows the comparison of IRES activity.

Claims (12)

  Regarding IRES activity, it is identical to transcripts A, B, C and D of FGF1 corresponding to SEQ ID NO: 1 (A), SEQ ID NO: 30 (B), SEQ ID NO: 36 (C) and SEQ ID NO: 42 (D), respectively. Or the use of isolated nucleic acids containing homologous sequences.   The nucleic acid is SEQ ID NO: 2 (A2), SEQ ID NO: 3 (A3), SEQ ID NO: 4 (A4), SEQ ID NO: 5 (A5), SEQ ID NO: 6 (A6), SEQ ID NO: 7 (A7), SEQ ID NO: 8 ( A8), SEQ ID NO: 9 (A9), SEQ ID NO: 12 (A12), SEQ ID NO: 16 (A16), SEQ ID NO: 17 (A17), SEQ ID NO: 18 (A18), SEQ ID NO: 19 (A19), SEQ ID NO: 20 (A20 ), SEQ ID NO: 26 (A26), SEQ ID NO: 21 (A21), SEQ ID NO: 27 (A27), SEQ ID NO: 28 (A28) and SEQ ID NO: 29 (A29). Use according to claim 1, characterized in that it contains a typical sequence.   Use according to claim 1, characterized in that the nucleic acid contains a sequence identical or homologous to a sequence selected from the group comprising SEQ ID NO 31 (B2) and SEQ ID NO 34 (B10).   The nucleic acid contains a sequence identical or homologous to a sequence selected from the group comprising SEQ ID NO: 36 (C2), SEQ ID NO: 40 (C10) and SEQ ID NO: 41 (C11). Use of the isolated nucleic acid according to Item 1.   A cassette expressing at least one gene of interest in a eukaryotic cell, characterized in that it contains at least one nucleic acid as defined in claims 1 to 4.   6. Expression cassette according to claim 5, characterized in that it contains at least two genes of interest.   A recombinant expression vector comprising an expression cassette which is the subject of claim 5.   8. The expression vector according to claim 7, which is a plasmid vector or a viral vector selected from the group comprising retroviruses, lentiviruses and adenoviruses.   A pharmaceutical composition comprising an expression cassette which is the subject of claim 5 or a recombinant vector which is the subject of claim 7.   A recombinant host cell comprising an expression cassette which is the subject of claim 5 or a recombinant vector which is the subject of claim 7.   A transformed animal comprising an expression cassette which is the subject of claim 5 or a recombinant vector which is the subject of claim 7.   SEQ ID NO: 1 (A), SEQ ID NO: 30 (B), SEQ ID NO: 36 (C), SEQ ID NO: 42 (D), SEQ ID NO: 2 (A2), SEQ ID NO: 3 (A3), SEQ ID NO: 4 (A4), SEQ ID NO: No. 5 (A5), SEQ ID NO: 6 (A6), SEQ ID NO: 7 (A7), SEQ ID NO: 8 (A8), SEQ ID NO: 9 (A9), SEQ ID NO: 12 (A12), SEQ ID NO: 16 (A16), SEQ ID NO: 17 (A17), SEQ ID NO: 18 (A18), SEQ ID NO: 19 (A19), SEQ ID NO: 20 (A20), SEQ ID NO: 26 (A26), SEQ ID NO: 21 (A21), SEQ ID NO: 27 (A27), SEQ ID NO: 28 (A28), SEQ ID NO: 29 (A29), SEQ ID NO: 31 (B2), SEQ ID NO: 34 (B10), SEQ ID NO: 36 (C2), SEQ ID NO: 40 (C10), SEQ ID NO: 41 (C11) and SEQ ID NO: 42 ( An isolated nucleic acid having IRES activity consisting of a sequence showing at least 60% identity with a sequence selected from the group of D).

Images