JP2005278405A - Gene related to acid resistance of lactic acid bacterium and acid induction promoter - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To obtain a new acid-resistant gene directly related to acid resistance of microorganism and a new acid stress induction promoter strongly inducing expression of a combined gene by acid stress. <P>SOLUTION: The new acid-resistant gene and the new acid stress induction promoter are found by exhaustively analyzing an acid stress gene response in a short time in the acid adaptation of a strongly acid-resistant Lactobacillus gasseri OLL2716 strain (Lactobacillus gasseri LG21) by a DNA array method and confirming the phenotype of the found new gene. <P>COPYRIGHT: (C)2006,JPO&NCIPI

Description

  The present invention relates to the evaluation and enhancement of acid resistance of food microorganisms such as lactic acid bacteria involved in fermented dairy production and probiotics, microorganisms producing useful substances such as lactic acid, amino acids and nucleic acids, and microorganisms involved in environmental purification. More specifically, the present invention relates to the application of genes that are present in the genome of Lactobacillus gasseri and are involved in the expression of the acid resistance mechanism of this bacterium. The present invention also relates to an acid stress-inducible promoter controlling the transcription of the acid resistance gene and its application.

  Since there are acidic environments in various places on the earth, resistance to acid environments (acid resistance) is an important trait when microorganisms are applied industrially. Microorganisms that grow in an acidic environment need to maintain an intracellular pH at a constant value in the vicinity of neutrality in order to survive or survive the external low pH stress. In particular, useful microorganisms such as lactic acid bacteria, acetic acid bacteria, and propionic acid bacteria need to have a strong defense mechanism against the acid because the acid is generated as a metabolite during growth and the acidification of the environment proceeds. In addition, since the stomachs of humans and domestic animals are acidic, acid tolerance is an important factor for probiotic bacteria to survive in the digestive tract.

Therefore, in bacteria that produce various acids, studies have been made on genes and proteins involved in acid resistance. For example, with respect to acetic acid bacteria, the acetic acid resistance gene and a method for improving the acetic acid resistance of microorganisms to obtain a high concentration of acetic acid using the gene have already been reported. (For example, Patent Document 1)
In addition, some genes related to acid resistance have been reported in lactic acid bacteria, and several acid resistance mechanisms of lactic acid bacteria have been reported. (For example, Non-Patent Document 1)

  Many of the previous reports have inactivated genes by random mutations and found the mutants that have weakened acid resistance to elucidate the genes, or “acid adaptation” phenomenon ( In other words, a protein that is involved in acid resistance is examined by utilizing the phenomenon that acid resistance mechanism is induced by placing cells in logarithmic growth phase under relatively mild acidity that is not lethal and acid resistance mechanism of bacteria increases. Met.

  The problem in these cases is that the random mutation method is limited in the number of microorganisms that can be applied and is not efficient, and in the protein analysis method (proteome analysis) using two-dimensional electrophoresis, Despite the fact that “acid adaptation” is a phenomenon that takes place within a few minutes, analysis has been carried out using proteins that require time for expression as indicators. Therefore, it cannot be said that the genes reported so far accurately reflect the original acid resistance gene whose expression level increases in a short time during "acid adaptation".

    Further, not only the examination of the acid-resistant gene body but also the mechanism for increasing the gene expression level during “acid adaptation”, that is, the gene expression promoter induced by acid stress is being studied.

For example, Patent Document 2 describes the Lactobacillus acidophilus F ₁ F ₀ -ATPase promoter. The purpose of this study was to increase the expression level of the target gene by using the promoter induced under acidic conditions, aiming to obtain useful microorganisms by improving mass production of specific proteins and specific traits Is. In order to make the medium acidic, lactic acid, acetic acid, citric acid or the like may be added, or these acids which are naturally produced by microorganisms may be used. Therefore, this method can be said to be suitable for food production. However, according to the report described in Patent Document 2, an increase in gene expression level under acidic conditions is at most about twice, and an acid stress-inducible promoter capable of further increasing the expression level of a gene product was desired.

JP2003-289868 US 6,242,194 Rallu F, Gruss A, Ehrlich SD, Maguin E, Molecular Microbiology 2000 35 (3) 517-528

  Thus, an object of the present invention is to search for a more effective acid resistance gene from microorganisms such as lactic acid bacteria involved in the production of acidic foods, and to apply, enhance, or detect acid resistance to useful microorganisms by applying the mechanism. Is to apply the. Another object is to provide a strong gene expression inducing promoter capable of reliably increasing the expression level of a gene encoding a useful protein by acidifying the medium.

The present inventors have solved Lactobcillus, which is known to have strong acid resistance among lactic acid bacteria, in solving the above two problems.
The study began with a focus on gasseri OLL2716 strain (hereinafter LG21 strain; deposit number FERM BP-6999). The strong acid resistance of the LG21 strain is that the final pH of the culture solution is about 3.8 in the LG21 strain, which is low compared to, for example, about 4.5 of the cheese-producing lactic acid bacterium Lactococcus lactis, and the survivability using artificial gastric juice From the examination results, it is clear that LG21 strain has a higher survival rate than other lactic acid strains.

  That is, the present invention is aimed at finding a useful gene related to an acid resistance mechanism that has not been known so far and predicting its application, assuming that the LG21 strain has a strong acid resistance mechanism. Therefore, when the behavior of the LG21 strain to acid was first examined, the number of surviving bacteria did not decrease even at pH 2.5 in cells at stationary phase, but the number of surviving bacteria at pH 2.5 in cells at logarithmic growth phase. Was gradually reduced (FIG. 1).

  Therefore, in addition to using LG21 strain cells in the logarithmic growth phase with high acid sensitivity, DNA microarray technology that can detect the original acid-resistant genes whose expression levels increase in a short time by “acid adaptation” We planned to comprehensively analyze the acid resistance gene of LG21 strain. By using this method, it is possible to analyze changes in the transcription amount of a gene that cannot be detected by conventional methods such as proteome analysis.

  In other words, by using the LG21 strain that has a high possibility of having a novel acid-resistant gene as a strain, and by using DNA microarray technology that can grasp the transcription status of genes that could not be detected by conventional methods as a detection method It aims to find both new and useful acid resistance genes and gene expression promoters induced by acid stress. And, it is considered that the gene that promotes or represses transcription during acid adaptation of LG21 strain is comprehensively analyzed on a genome scale, and as a result, is involved in the acid tolerance expression of lactic acid bacteria induced during "acid adaptation" We succeeded in finding a new gene (hereinafter # 474).

Moreover, from the results of array analysis, it was confirmed that the amount of # 474 gene transcription during "acid adaptation" increased more than 10 times that of the untreated group, and the transcriptional regulatory mechanism of # 474 was very strongly induced by acid stress. It has been found. Therefore, if a base sequence related to transcriptional regulation upstream of # 474 is used, a large amount of a specific gene can be expressed in a large amount by a simple method of acid addition to a medium, and a so-called useful gene large amount and an inducible expression system can be constructed. You can expect.

As a result of comparing the amino acid sequence of the acid resistance gene # 474 thus obtained (SEQ ID NO: 1) and the amino acid sequence of the protein deduced therefrom with a database, several proteins homologous to the protein were found.
High homology in BLASTP homology search is that of putative receptor protein (score = 157, accession) of Escherichia coli K12 strain.
number AE000325-6), 168 strains of Bacillus subtilis YWKB protein (score = 76, accession number Z99122-189), Lactobacillus lactic acid bacteria
plantarumWCFS1 strain transport protein (score = 53, accession number AL935262-14). However, the function of these proteins is not clear and there is no evidence of an association with acid tolerance. Therefore, it has been found that the gene # 474 derived from the LG21 strain found in the present invention has an unknown function and has never been suggested to be associated with industrial utility such as acid resistance.

  Furthermore, a strain in which this gene # 474 was knocked out (hereinafter referred to as Δ474 strain) was prepared, and the properties of the obtained strain were compared with the wild strain (LG21 strain) in various tests. As a result, the Δ474 strain did not show a difference in growth from the wild strain under normal culture conditions, whereas the acidic medium showed a difference in the survival of both strains. For example, when comparing survival in MRS medium adjusted to pH 2.5, Δ474 strain was 1/30 of the wild strain when treated with “acid adaptation”, and 1/8 of the strain when adaptation was not occurring. It was clear that the acid tolerance of the Δ474 strain was reduced when judging only the survival rate and other evidence. Therefore, it was concluded that gene # 474 is involved in acid resistance of this bacterium.

  When a large amount of the novel gene # 474 involved in acid resistance is expressed in large quantities, it is considered that the acid resistance of a microorganism having the gene (or a transformant into which the gene has been introduced) is improved. Therefore, it may be possible to estimate the acid resistance of a microorganism by measuring the presence or absence of gene # 474, the amount of transcription thereof, or the amount of protein as a final product. Presence / absence of gene # 474, the amount of transcription, and the amount of the protein can be easily measured by known methods. For example, the presence or absence of gene # 474 is the PCR method, the transcription amount is the northern blotting method based on the base sequence of gene # 474, the quantitative PCR method, etc. The protein amount is, for example, the Western blotting method, etc. It can be quantified by a known method. By using at least one of these methods to measure at least one of the presence / absence, transcription level, and expression level of gene # 474 in the microorganism to be measured, it can be usefully used in fields such as food production and probiotics. It is considered that it is possible to screen for a microbial strain having high acid resistance.

The present invention has been completed based on the above findings. That is, the present invention comprises the following (1) to (7).
(1) A gene having the base sequence set forth in SEQ ID NO: 1.
(2) A microorganism transformant produced by introducing the gene according to (1) and having improved acid resistance.
(3) A microorganism strain in which the gene shown in (1) is inactivated.
(4) The microorganism strain according to (2) to (3), wherein the microorganism is a lactic acid bacterium.
(5) A method for screening a microorganism having high acid resistance using the base sequence shown in (1).
(6) An acid stress-inducible promoter region that controls transcription of the gene according to (1) and is present within 600 base pairs of SEQ ID NO: 2 upstream of the gene.
(7) A gene inducible expression system comprising the acid stress inducible promoter region according to (6).

The present invention also relates to a gene having a base sequence in which one or several bases of SEQ ID NO: 1 of (1) have been deleted, substituted and / or added. It goes without saying that if the function is a gene involved in acid resistance, it is included. Furthermore, even if the promoter region has a base sequence in which one or several bases of the base sequence shown in SEQ ID NO: 2 in (6) are deleted, substituted and / or added, the function thereof is acid. It goes without saying that any gene involved in stress-induced gene expression is included.

  The gene discovered this time is a novel gene that has not been known to be related to acid resistance, and is an acid resistance gene that is strongly induced in a short time. It can be expected to impart or enhance acid resistance to microorganisms used in food production and probiotics.

In addition, by measuring the presence / absence and expression level of gene # 474, it is considered possible to screen a highly acid-resistant microorganism that can be usefully used in fields such as food production and probiotics.

  Second, since acid tolerance is extremely important for survival, cells are thought to have multiple acid tolerance mechanisms. It is essential to elucidate the resistance mechanism other than the known mechanism. In that case, it can be expected that a novel acid resistance mechanism and related genes can be newly discovered by creating a deletion strain of the gene of the present invention in addition to a gene related to a known acid resistance mechanism.

  Furthermore, since the gene of the present invention rapidly increases the amount of transcription by a simple method of lowering the medium pH (weak acid treatment), if the transcription control mechanism of this gene is used, useful proteins that can be induced by addition of acid There is a possibility that an expression system can be constructed.

The # 474 gene described in SEQ ID NO: 1 of the present invention is isolated from the LG21 strain and consists of 1182 base pairs.
Further, the present invention provides a gene having a base sequence in which one or several bases of the base sequence shown in SEQ ID NO: 1 have been deleted, substituted and / or added, and the function thereof is acid resistant. It goes without saying that genes involved in the gene are included.
In order to express the gene, the gene described in SEQ ID NO: 1 may be introduced into an expression vector. As the vector, the gene of the present invention can be used for plasmids, phages, cosmids and the like derived from genetically engineered host cells having a known expression system.

A transformant may be prepared by a conventional method. At this time, any host cell that can maintain, proliferate, and express a gene inserted into the host can be used. Examples of the host include Escherichia coli, Lactococcus bacteria, Lactobacillus lactic acid bacteria, Bifidobacterium bacteria, Bacillus subtilis, and animal cells.
In order to produce a microorganism in which the # 474 gene has been inactivated, conventional methods such as point mutation and homologous recombination may be used.
In order to screen a microorganism having high acid resistance using the base sequence described in SEQ ID NO: 1, a gene hybridizing to the gene described in SEQ ID NO: 1 is screened, and a primer prepared from a part of the sequence described in SEQ ID NO: 1 is used. And cloning.

The base sequence described in SEQ ID NO: 2 of the present invention is isolated from the LG21 strain and consists of 600 base pairs present in the promoter region located upstream of the # 474 gene.
Furthermore, even in a promoter region having a base sequence in which one or several bases of the base sequence shown in SEQ ID NO: 2 have been deleted, substituted and / or added, its function is induced by acid stress. It goes without saying that any gene involved in gene expression is included.

  EXAMPLES Hereinafter, although this invention is demonstrated concretely based on an Example, this invention is not limited to these Examples.

[Example 1] Induction of acid stress tolerance of LG21 strain (acid adaptation)
The acid adaptation of LG21 strain was examined by the following. “Acid adaptation” refers to a phenomenon in which acid tolerance mechanism is induced by placing cells in logarithmic growth phase under relatively mild acid conditions that are not lethal (weak acid treatment), thereby increasing acid tolerance.
First, in order to examine the optimum pH for the weak acid treatment in this bacterium, lactic acid was added to the MRS medium to prepare weakly acidic media having various initial pHs (pH 5.8, 5.3, 4.8, 4.3, 3.8). The LG21 strain cells in the logarithmic growth phase were suspended in each of these media, treated at 37 ° C. for 30 minutes (weak acid treatment), and then treated with a strongly acidic (pH 2.5) MRS medium for 2.5 hours to determine the number of surviving bacteria. . As a control, after suspending in a medium having an initial pH of 6.5 and treating for 30 minutes, the number of surviving bacteria when treated with a strongly acidic medium (pH 2.5) for 2.5 hours was also measured. In order to compare the effects at each pH, the number of surviving bacteria (CFU) in the case of weak acid treatment (treated section)
: Colony Forming Unit) divided by the number of surviving bacteria in the control (untreated section) for comparison. (Fig. 2) As a result, the weak treatment at pH 4.8 had the highest acid adaptation effect, and the survival increased by a factor of 100 or more compared to the untreated group.
Next, the time for the weak acid treatment was also examined. As a result of examination from 15 minutes to 3 hours in a medium of pH 4.8, the longer the weak acid treatment, the higher the survival in the strong acid treatment. However, the survival rate increased by several tens of times even in the 15-minute treatment compared to the untreated section, and therefore the weak acid treatment time was set to 30 minutes in the subsequent experiments. When the weak acid treatment was performed in the MRS medium at pH 4.8, the survival rate of the LG21 strain was 10 2 to 5 times higher than that of the untreated group. (Figure 3)

[Example 2] Preparation of DNA array carrying genes of LG21 strain and examination of analysis conditions
In order to analyze the genes involved in acid adaptation of the LG21 strain, a DNA array carrying the genes present in the genome of this strain was prepared. Since there was no report on the array analysis of lactic acid bacteria at the start of the study, the conditions of this strain were examined.
A) Preparation of DNA array
The size of the LG21 strain genome is estimated to be about 2.1 Mb, but about 90% of the base sequence has been determined so far. The average GC content was about 35%, and there were about 2900 ORFs (gene candidates) of 200 bp or more. The functions of each ORF were estimated using ordinary analysis programs (BLASTP and COG). Based on the obtained function estimation results, 1597 ORFs containing unknown function genes were selected to prepare a DNA microarray (hereinafter referred to as an array) for the LG21 strain.
Primers were designed with the design software primer3 in order to amplify the DNA to be placed on the array by PCR. A 500 bp to 800 bp sequence inside each ORF was amplified by PCR to obtain a DNA fragment of each ORF. Human
A control gene DNA such as TFR was added to prepare a so-called Stanford type microarray consisting of a total of 3456 spots as duplicates. Spotting of DNA fragments on slide glass was requested from Takara Shuzo.
B) Sample preparation and analysis conditions analysis Array analysis was performed according to the following procedures 1) to 6). 1) collection of bacterial cell samples, 2) preparation of RNA, 3) preparation of cDNA from RNA by reverse transcriptase and fluorescent labeling, 4) hybridization of the obtained fluorescently labeled cDNA with DNA spots on the array, 5 )
Measurement of each spot fluorescence intensity, 6) Signal analysis.
First, the overall conditions were examined. As a standard for studying the experimental conditions, the cDNA reverse-transcribed from the same RNA was labeled with fluorescent dyes Cy5 and Cy3 (both Amersham Pharmacia Biotech) and global normalization was performed, and then the ratio of the fluorescence intensity of about 1600 genes derived from the LG21 strain That is, the condition in which Cy5 / Cy3 is closest to 1.0 was determined as the optimum. First, as a result of examining the amount of RNA used for hybridization, it was found that 100 μg or more was appropriate. Also, random as a primer
As a result of comparing the primer with the specific primer, the former had a high background due to the reaction with ribosomal RNA and the like, and a good image could not be obtained. In contrast to this
When primer was used, good images were obtained with a low background. Therefore, the primer has a specific 3 'end sequence (22-24mer) specific for each of about 1600 genes.
Primer (mixture) was used.

Hereinafter, the result of having examined about the concrete conditions of each process is shown.
<Bacteria sampling>
It is important to sample quickly because the half-life of bacterial mRNA is short. In order to inactivate RNase instantly, a culture solution containing bacterial cells 10
Stop the degradation of mRNA by quickly adding and mixing 1.25 ml of stop solution (ethanol plus 5% DEPC water-saturated phenol) in ml. This is room temperature, 10,000
After centrifugation at rpm for 1 minute, the supernatant was discarded, and the cells were frozen using liquid nitrogen. This treatment was performed within a few minutes in total, and the frozen cell samples were stored at minus 80 ° C.
<RNA preparation, cDNA conversion, fluorescent labeling and hybridization>
The experimental procedure after the cell sampling is basically the following literature on Bacillus subtilis array experiment methods except for some reagent manufacturers {Yoshida, K., et al., Nucleic Acids Res., (2001), 29 (3), 683-692. Ogura, M.,
et al., Nucleic Acids Res., (2001), 29 (18), 3804-3813}.
The array scanner used was Affymetrix428 (Affymetrix), and the signal analysis software used was ImaGene (BioDiscovery).
Using the above method, the same RNA prepared from logarithmic growth phase or stationary phase cells of the LG21 strain was labeled with Cy5 and Cy3, respectively. As a result, the signal ratio of Cy5 / Cy3 was almost 1,600 genes. It was about 1.0. (FIG. 4) Moreover, since this result was reproducible, it was concluded that the array analysis in this strain can be advanced with this method with high accuracy.

[Example 3] Acid stress response analysis of LG21 strain by DNA array.
Using the method established in Example 2, the transcriptional changes of about 1,600 genes occurring during acid adaptation of the LG21 strain were analyzed in an array.
MRS medium (MRS +) adjusted to pH 6.5 by adding 200 mM of MOPS (3-morpholinopropanesulfonic acid, Wako Pure Chemicals), a pH buffer, to the LG21 strain precultured in MRS medium at 37 ° C for 15 hours MOPS pH6.5) 2% inoculated into 800 ml, and further statically cultured for 2 hours. The culture solution in which the turbidity (OD ₆₆₀ ) of the culture solution became about 0.4 was divided into 2 minutes, and each was centrifuged (6000 rpm, 1 minute, room temperature). In the test group, MRS medium 400 in which the precipitate (LG21 cell) was adjusted to pH 4.8 with lactic acid.
Suspended in ml and treated with weak acid at 37 ° C. 10 ml each of the bacterial suspension was collected 3 minutes, 8 minutes and 30 minutes after the start of the weak acid treatment, RNA was prepared by the method shown in Example 2, and the obtained cDNA was labeled with the fluorescent dye Cy5. The control sample was centrifuged as described above, but the precipitate was resuspended using the supernatant and cultured at 37 ° C. Samples were prepared by collecting 10 ml of bacterial suspension at the same time as above, and the obtained cDNA was labeled with the fluorescent dye Cy3.

To confirm that acid adaptation occurred, the culture solution for 30 minutes after the start of mild acid treatment (or no treatment) was centrifuged (6000 rpm, 1 minute, room temperature), and the precipitated cells were placed in MRS medium at pH 2.5. The survival rate was measured after suspending. As a result, the survival in the treated area was almost as high as that of Example 1 compared to the control, so it was confirmed that acid adaptation occurred in this experimental sample.
As a result of analyzing the fluorescence intensity ratio (ie, Cy5 / Cy3 ratio) by array analysis of the labeled sample obtained as described above, a dynamic transcription change has already occurred in the microbial cells after 3 minutes of weak acid treatment. It was speculated. That is, it was estimated that about 60 genes out of about 1600 genes promoted transcription more than 3 times, and these included important genes related to acid resistance. On the other hand, about 40 genes had transcription suppressed to one third or less. (Fig. 5)

It is thought that genes whose transcription amount increases with weak acid treatment are mainly involved in the expression of acid tolerance, but some of the 60 genes that have been shown to promote transcription include arginine, ornithine, antiporter, and ornithine desensitization. There were genes that have been reported or estimated to be associated with acid resistance, such as carbonic acid enzymes, cations transport-related genes, and sugar transport-related genes.
At the same time, there were genes whose functions were unknown among the genes whose transcription amount was increased. Among them, the present inventors newly discovered the gene # 474 shown in the bold line portion of FIG. 5 as an unknown gene whose transcription amount is remarkable even in a short time and high transcription continues after 30 minutes. Gene # 474 showed a transcriptional acceleration of 10 times or more that of the control over 3 to 30 minutes after the weak acid treatment in the pH 4.8 medium. Moreover, the pH at which acid adaptation is hardly observed
Compared to the case of weak acid treatment in the medium of 5.3, the transcription of gene # 474 was promoted 3 times or more by treatment with pH 4.8. Therefore, it was considered that gene # 474, which shows a high transcription amount from the beginning of the weak acid treatment, may be one of the important genes related to the acid resistance of the LG21 strain.

[Example 4] Homology search of gene # 474 estimated to be associated with acid resistance From the results shown in Example 3, gene # 474 was selected and its function was examined.
First, as a result of comparing the amino acid sequence of the acid resistance gene # 474 thus obtained (SEQ ID NO: 1) and the amino acid sequence of the protein deduced therefrom with a database, several proteins homologous to the protein were found. . It was putative of E. coli K12 that showed high homology in BLASTP homology search.
receptor protein (score = 157, accession number AE000325-6), YWKB of Bacillus subtilis 168 strain
protein (score = 76, accession number Z99122-189), Lactobacillus plantarum WCFS1 strain transport protein (score = 53, accession
number AL935262-14). However, the function of these proteins is not clear and there is no evidence of an association with acid tolerance. Therefore, it has been found that the gene # 474 derived from the LG21 strain found in the present invention has an unknown function and has never been suggested to be associated with industrial utility such as acid resistance. Moreover, none of the homologous previous genes have a clear function, and thus there is no evidence of any association with acid resistance.
In addition, in E. coli, there was a report (Tucker, DL, et al., J. Bacteriol., 2002, 184 (23) 6551-6558.) That analyzed acid resistance using an array in the same manner as the present invention. Many genes that are thought to be related are shown, but ywkB and yfdV that are homologous to gene # 474 are not included. Therefore, in E. coli, ywkB and yfdV may not be involved in acid resistance.
As described above, the results of homology searches based on the nucleotide sequence and amino acid sequence indicate that the gene # 474 of Gasseri strain LG21 strain has not been estimated so far, and is related to industrial utility such as acid resistance. It became clear that it never happened.

[Example 5] Preparation of gene # 474 knockout strain Next, in order to examine the function of gene # 474, a strain lacking this gene (gene # 474 knockout strain) was prepared by double crossover by homologous recombination. did.
First, a DNA fragment from which the internal sequence 705 bp of gene # 474 was deleted was amplified by a PCR reaction using LG21 strain genomic DNA as a template by a conventional method. This fragment was transformed into a temperature sensitive replication vector pSG ⁺ E2 (Y.
Sasaki et al,, Appl. Environ. Microbiol., 2004, 70 (3),
The plasmid pTERM4745 (FIG. 6) was constructed by inserting into the integration vector derived from 1858-1864. That is, in order to delete the central part of gene # 474 on the genome of the LG21 strain (FIG. 6, bold straight arrow: 1179 base pairs), a 472 bp DNA fragment (# 474_A) containing the upstream sequence of gene # 474, A 370 bp DNA fragment (# 474_C) containing the downstream sequence of gene # 474 was amplified by PCR. PTERM4745 was assembled after combining these two fragments in the same direction. In this plasmid, two DNA fragments (namely, # 474_A and # 474_C) are homologous to the LG21 strain genome, but the internal sequence of gene # 474, 705 bp (B deletion site in FIG. 6) is deleted. Yes.

This plasmid was used to transform the L. LG21 strain by electroporation. A transformant cultured at a low temperature (32 ° C.) and selected for resistance to erythromycin (Em) was cultured at a high temperature (42 ° C.) in the presence of Em to obtain a strain in which the plasmid was integrated into the chromosome (integrated strain). .
Next, this integrated strain was cultured at a low temperature (32 ° C.) using an Em-free medium, and then 100 single colonies were isolated and examined. As a result, 25 sensitive colonies that lost Em resistance were obtained, and these sensitive colonies were subjected to PCR to estimate the structure of gene # 474 on each genome. First, in 18 out of 25 colonies, the primer that sandwiches gene # 474 (primer
1296L: AGCCTTCGTAGTCACCTTGAGC and primer ysk244: GCCCATCCTTACACTTCTTG), a DNA fragment of about 2.2 kb was obtained. These were considered to have returned to the same genetic structure as the original upon double crossover.
However, in the remaining 7 strains, a DNA fragment of about 1.5 kb was obtained. That is, it was estimated that about 0.7 kb of the internal sequence of gene # 474 was deleted in these seven strains. Furthermore, it was confirmed that there is an FbaI restriction site in the internal sequence 705 bp of gene # 474, which is scheduled to be deleted, but the FbaI restriction site was not found in the approximately 1.5 kb DNA fragment amplified in the above seven strains. It was. Therefore, it was confirmed that about 0.7 kb of the internal sequence of gene # 474 was deleted in these seven colonies, and it was concluded that it was a “gene # 474 knockout strain”.

[Example 6] Examination of resistance to acid stress of gene # 474 knockout strain The phenotype of gene # 474 knockout strain obtained in Example 5 (hereinafter referred to as Δ474 strain) was compared with the LG21 strain (wild strain). did.
First, the growth of Δ474 strain and LG21 strain was cultured in a normal MRS medium, and the turbidity of the cultures was compared. As a result, the Δ474 strain showed almost the same growth curve as the wild-type LG21 (results omitted), and the final pH reached was about 3.8 for both strains. Therefore, as long as the Δ474 strain was judged by the growth curve in the MRS medium and the final pH of the culture solution, it could not be said that the acid tolerance was clearly reduced compared to the LG21 strain.
Therefore, the acid resistance was compared in more detail by the following two methods.
The first is a comparison of “survival” in an acidic medium, and the second is a comparison of “growth” in an acidic medium. From these results, the following differences in traits related to acid resistance were observed between the Δ474 strain and the LG21 strain. Specific results are shown below.

First, in the same manner as in Example 3, LG21 strain and Δ474 strain cells cultured for 2 hours in MRS + MOPS pH6.5 medium were directly (untreated) or MRS
Cells that had been acid-adapted by culturing in pH 4.8 medium for another 30 minutes (weak acid treatment group) were suspended in strongly acidic (pH 2.5) MRS medium and compared for survival. As a result, in both strains, the survival rate in the MRS medium at pH 2.5 was increased by the weak acid treatment compared to the untreated group, and it was confirmed that acid adaptation occurred. However, the CFU of the Δ474 strain was lower than that of the LG21 strain, which was 1/30 under acid adaptation conditions and 1/8 under conditions where adaptation did not occur. (Fig. 7)
Thus, when the survival rate in the acidic medium was compared, the survival rate of the Δ474 strain was lower than that of the LG21 strain, so it was found that gene # 474 is a gene involved in acid resistance.
Next, the growth of both strains was compared in an MRS medium adjusted to acidic pH.
Since the LG21 strain hardly grows in MRS medium having a pH of 4.0 or less, the growth was compared in a medium that was adjusted to pH 4.25, 4.5, 4.75, 5.00 with hydrochloric acid and filtered aseptically with a filter. Note that the medium is a liquid medium obtained by diluting MRS with sterile water in half (hereinafter 1/2).
(Referred to as MRS medium), but a 1/2 MRS medium with no special pH adjustment was also used as a control.
First, LG21 strain and Δ474 strain cultured at 37 ° C. for 15 hours in 1/2 MRS medium without pH adjustment were inoculated to the medium prepared at each pH as described above to examine the growth. Growth was compared by the turbidity of the culture (OD ₆₆₀ ), but no clear difference was observed between the two strains in this experiment.
Therefore, the pre-culture medium was changed so that the pH after pre-culture was around neutral. That is, 200 mM MOPS was added to adjust the pH to 7.5, and as a result of adding the same examination as described above using 1/2 MRS medium sterilized by filtration with a filter, the pH was adjusted.
It was found that the growth of the Δ474 strain was slower than that of the LG21 strain in the media of 4.25 and 4.5. (Fig. 8)
Since no difference was observed in the growth of both strains in the medium without pH adjustment and pH 5.0, it was concluded that the difference in growth between pH 4.25 and 4.5 was due to the pH of the medium.
From the above, it became clear that the Δ474 strain was inferior in survival and viability at low pH compared to the LG21 strain. Therefore, it was concluded that gene # 474 is involved in acid resistance of this bacterium.

  However, this difference is clearly reproduced when the pre-culture is carried out in the vicinity of neutrality as described above, and the difference is observed under the condition that the medium is cultured overnight in a normal medium and the pH of the medium is around 4. It was not clear. This is interpreted that it was difficult to detect the difference because a plurality of other acid resistance mechanisms present in the knockout strain (Δ474 strain) operated under acidic conditions and complemented the deletion of gene # 474. As a result of actual analysis by array analysis, it was found that a plurality of genes estimated to be involved in acid tolerance by weak acid treatment were transcribed several times more in the Δ474 strain than in the LG21 strain. (Data not shown) In other words, the effect of only one resistance mechanism (in this case, the acid resistance mechanism by gene # 474) can be achieved under conditions where the acid resistance mechanism is not fully functioning when cultured in a neutral medium. It is estimated that it was detected.

  The novel gene of the present invention contributes deeply to the acid resistance of microorganisms, and enables creation and screening of microorganisms with excellent acid resistance, which are important properties in food production using microorganisms, probiotics, etc. be able to. Moreover, the acid stress-inducible promoter involved in the expression of this gene can induce 10-fold or more gene expression, and can increase the expression of the target useful gene by simple acid stimulation by linking to the useful gene. Can do.

Comparison of acid resistance performance in the logarithmic growth phase and stationary phase of LG21 strain. Comparison of the survival rate of LG21 strain when treated with weak acid at each pH. Comparison of survival rate after strong acid treatment with and without acid adaptation. Signal distribution when Cy5 and Cy3 are labeled on the same sample (shows measurement reliability). Changes in the amount of gene transcription that was observed to promote or repress transcription during acid adaptation of the LG21 strain. Temperature sensitive integration plasmid pTERM4745. (For gene # 474 knockout) Comparison of LG21 strain and Δ474 acid resistance with and without acid adaptation. Comparison of growth at low pH between Δ474 and LG21 strains.

Claims (7)

  A gene having the base sequence set forth in SEQ ID NO: 1.   A transformant of a microorganism produced by introducing the gene according to claim 1 and having improved acid resistance.   A microorganism strain in which the gene shown in claim 1 is inactivated.   The microorganism strain according to any one of claims 2 to 3, wherein the microorganism is a lactic acid bacterium. A method for screening a microorganism having a high acid resistance using the base sequence shown in claim 1.   An acid stress-inducible promoter region that controls transcription of the gene according to claim 1 and is present within 600 base pairs of SEQ ID NO: 2 upstream of the gene. A gene-inducible expression system comprising the acid stress-inducible promoter region according to claim 6.

Images