JP2005245336A - Screening method for functional change of mutant protein and use thereof - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a screening method for functional modification of protein capable of screening the functional change of protein in an more shortened time than the conventional and more comprehensively and provide a kit for carrying out the screening. <P>SOLUTION: For the protein synthesis on the basis of gene mutation-introduced gene, wheat germ cell-free protein system is used. The PCR technique is used for introducing the mutation into a gene and for preparing a transcription template gene. In addition, increased throughput can be actualized by carrying out the mutation introduction and the preparation of transcription template DNA as one series process. <P>COPYRIGHT: (C)2005,JPO&NCIPI

Description

  The present invention relates to a screening method for the functional change of a mutant protein and its use. Specifically, in order to create a new function-acquisition protein, the functional change of the mutant protein can be performed at high throughput using a wheat germ cell-free protein synthesis system. The present invention relates to a screening method and a kit for performing the screening method.

  In recent years, due to remarkable progress in genetic engineering, functional modification of functional proteins has become possible, and many useful proteins with high utility value have been born. In addition, protein functional modification leads not only to the development of new functional materials, but also to improvement of vital functions and overcoming diseases caused by proteins.

  Conventionally, as a method of screening for functional modification of a protein, a mutation is introduced into a gene encoding a target protein, an expression vector incorporating the mutant gene is constructed, and the expression vector is then introduced into a host such as E. coli or cultured cells. A method of screening a function after introducing a mutant protein to express the mutant protein and purifying the mutant protein is used.

  For example, Non-Patent Document 1 uses a random mutagenesis method (evolutionary molecular engineering) by PCR to increase the efficiency of the phosphorylation reaction of pyrophosphate-nucleoside phosphotransferase, and conversely suppress the nucleotide degradation activity. An example of modification of a protein with a function added is described.

For example, Non-Patent Document 2 discloses yeast 3-deoxy-D-arabino-heptulosonate using a technique in which random mutations are introduced by PCR in the presence of 20 μM Mn ²⁺ ions and biological screening in yeast is combined. It describes an experimental example in which the feedback inhibitory activity of -7-phosphate synthase by phenylalanine is modified to receive feedback inhibition by tyrosine.
Y. Mihara, T. Utagawa, H. Yamada, and Y. Asano, Phosphorylation of nucleosides by the mutated acid phosphatase from Morganella morganii, Applied and Environmental Microbiology, 2000, Vol. 66 (7), 2811-2816 Hartmann M, Schneider TR, Pfeil A, Heinrich G, Lipscomb WN, Braus GH., Evolution of feedback-inhibited beta / alpha barrel isoenzymes by gene duplication and a single mutation., Proc Natl Acad Sci US A., 2003, Vol. 100 (3), 862-7

  However, in the above conventional screening method, mutation introduction is several days to one week, expression vector construction is several days to one week, protein expression by a host such as Escherichia coli is about two to three days, and protein purification is several days to Since it takes about one week, it is difficult to evaluate protein functional modification in a short period of time, and the number of samples that can be handled simultaneously is limited. Therefore, development of a so-called high-throughput screening method capable of comprehensively screening for functional changes of mutant proteins in a short time is expected. By realizing high-throughput screening of protein functional modification, it is possible to create industrially and medically useful proteins having various functions than ever before.

  The present invention has been made in view of the above problems, and an object of the present invention is to carry out a protein functional modification screening method and a screening method capable of comprehensively screening protein functional changes in a short time. It is to provide a kit for doing this.

  As a result of intensive studies in view of the above problems, the present inventors have used a wheat germ cell-free protein synthesis system capable of synthesizing a large number of proteins in a short time for the synthesis of mutant proteins, and introducing mutations into target genes. The ability to achieve high-throughput screening of protein functional modification by creating a transcription template DNA to synthesize mutant protein mRNA synthesized by the wheat germ cell-free protein synthesis system as a series of steps using the PCR method The headline and the present invention have been completed.

  That is, the protein functional modification screening method according to the present invention is a screening method for a protein having a mutation artificially introduced to modify the function, wherein at least one amino acid is present in the gene encoding the target protein. A mutagenesis step for introducing a mutation to be substituted, deleted, inserted and / or added, and a protein synthesis step for synthesizing the mutant protein using a wheat germ cell-free protein synthesis system based on the obtained mutant gene And a screening step for screening the function of the obtained protein.

  The protein synthesis process includes a transcription template DNA production process for producing a template DNA for synthesizing mRNA by in vitro transcription, and an mRNA synthesis process for synthesizing mRNA by in vitro transcription based on the obtained transcription template DNA. And a translation step of translating into protein using a wheat germ cell-free protein synthesis system based on the obtained mRNA.

  The PCR method is preferably used in the mutation introducing step, and the PCR method is also preferably used in the transcription template DNA preparation step of the protein synthesis step. Furthermore, it is particularly preferable to use the PCR method in both the mutation introduction step and the transcription template DNA production step of the protein synthesis step, and to perform both steps as a series of steps.

  When the PCR method is used in both of the mutation introduction step and the transcription template DNA preparation step of the protein synthesis step as described above and both steps are performed as a series of steps, the transcription of the mutation introduction step and the protein synthesis step is performed. In the template DNA production step, using a vector into which a gene encoding the target protein is inserted as a template, a sense strand mutation-introducing oligonucleotide based on the sequence of the portion into which the mutation of the gene encoding the target protein is to be introduced; The antisense primer comprising the antisense strand consisting of its complementary sequence is used as a primer, and the above-mentioned antisense primer and the above-mentioned anti-sense primer having a linker sequence bound to the 5 ′ end of the base sequence of the gene coding for the target protein. Combination with sense strand mutagenesis oligonucleotide PCR using a combination of the above-mentioned oligonucleotide for introducing a mutation in the sense strand and an antisense primer based on a vector sequence located downstream of the gene encoding the protein of interest, and mixing the above two sets of PCR products Then, a DNA fragment from the linker sequence to a vector sequence located downstream of the gene encoding the protein of interest is prepared by an extension reaction with a DNA synthase, and using the DNA fragment as a template, an in vitro transcription promoter sequence and MRNA used for synthesizing a mutant protein in a wheat germ cell-free protein synthesis system by performing PCR using a combination of a sense primer containing the linker sequence and an antisense primer based on the vector sequence contained in the template DNA fragment Together Methods for making transcription template DNA for can be suitably used.

  The sense primer containing the promoter sequence for in vitro transcription and the linker sequence preferably further contains a translation enhancing sequence at a position intermediate between the two sequences. Further, the promoter sequence for in vitro transcription, the translation enhancing sequence, and The sense primer including the linker sequence is a primer divided into an upstream primer and a downstream primer, and the 3 ′ end sequence of the upstream primer overlaps with the 5 ′ end sequence of the downstream primer. Particularly preferred.

  Here, “sense primer” means an oligonucleotide that defines the base sequence of the 5 ′ end of the fragment to be amplified by PCR, and “antisense primer” means the 3 ′ end of the fragment to be amplified by PCR. An oligonucleotide that defines the base sequence of

  The transcription template DNA production method according to the present invention is a method for producing a transcription template DNA for synthesizing mRNA used for synthesizing a mutant protein in a wheat germ cell-free protein synthesis system, which encodes a target protein. Mutation of an antisense strand consisting of an oligonucleotide for introduction of a sense strand and its complementary sequence based on the sequence of the portion into which the mutation of the gene encoding the target protein is to be introduced using a vector into which the gene to be inserted is used as a template A combination of a sense primer in which a linker sequence is linked to the 5 ′ end of the base sequence of the portion that starts translation of a gene encoding the target protein and the above-mentioned oligonucleotide for introducing a mutation in the antisense strand PCR and oligo for introduction of mutation in the sense strand PCR is performed with a combination of a nucleotide and an antisense primer based on a vector sequence located downstream of the gene encoding the protein of interest, the above two sets of PCR products are mixed and subjected to an extension reaction with a DNA synthase, and the linker sequence To a vector sequence located downstream of the gene encoding the protein of interest, using the DNA fragment as a template, a sense primer comprising an in vitro transcription promoter sequence and the linker sequence, and the template DNA fragment PCR is carried out by a combination with an antisense primer based on the vector sequence contained in.

  The sense primer containing the promoter sequence for in vitro transcription and the linker sequence preferably further contains a translation enhancing sequence at a position intermediate between the two sequences. Further, the promoter sequence for in vitro transcription, the translation enhancing sequence, and The sense primer including the linker sequence is a primer divided into an upstream primer and a downstream primer, and the 3 ′ end sequence of the upstream primer overlaps with the 5 ′ end sequence of the downstream primer. Particularly preferred.

  A protein functional modification screening kit according to the present invention is a kit for carrying out the protein functional modification screening method according to the present invention, wherein at least a vector for inserting a target gene, a promoter sequence for in vitro transcription, and Antisense based on two types of sense primers, including a translation enhancing sequence, divided into an upstream primer and a downstream primer, the 3 ′ end sequence of the upstream primer overlapping the 5 ′ end sequence of the downstream primer, and a vector sequence Primer, PCR reaction buffer, deoxyribonucleoside triphosphate mixed solution, thermostable DNA synthase, in vitro transcription buffer, RNA synthase, ribonucleoside triphosphate mixed solution, wheat germ cell-free protein synthetic solution, energy / Amino acid mixture, in vitro translation buffer, R It is characterized in that containing A protease inhibitor.

  A transcription template DNA production kit according to the present invention is a kit for carrying out the above-described method for producing a transcription template DNA according to the present invention, and includes at least a vector for inserting a target gene, a promoter sequence for in vitro transcription, and translation. Antisense primer based on two types of sense primers, including an enhancement sequence, divided into an upstream primer and a downstream primer, the 3 ′ end sequence of the upstream primer overlapping the 5 ′ end sequence of the downstream primer, and a vector sequence A buffer solution for PCR reaction, a deoxyribonucleoside triphosphate mixed solution, and a thermostable DNA synthase.

  The protein functional modification screening method according to the present invention makes it possible to exhaustively screen a large number of mutant proteins in a short time. That is, high throughput of functional modification screening of proteins can be realized. This produces an effect that an industrially useful protein having various functions than ever can be created.

  Specifically, the protein functional modification screening method according to the present invention uses a wheat germ cell-free protein synthesis system to synthesize a protein based on a mutant gene in which a mutation is introduced into a gene encoding the target protein. Therefore, protein synthesis can be performed in a short time. In addition, a large number of mutant proteins can be synthesized simultaneously. Further, depending on the type of protein to be synthesized, the synthesized solution after the synthesis reaction can be directly used for screening without purifying the synthesized protein. Therefore, it is possible to realize high throughput of protein functional modification screening, and to produce industrially useful proteins having various functions.

  In addition, shortening the time required by introducing PCR into the gene encoding the target protein and using the PCR method in the production of transcription template DNA for synthesizing the mRNA of the mutant protein synthesized by the wheat germ cell-free protein synthesis system Can do. Furthermore, by performing a series of steps from the introduction of mutations into genes to the transcription template DNA using the PCR method, a large number of transcription template DNAs can be prepared simultaneously in a short time. Therefore, protein functional modification screening can be further increased in throughput, and industrially useful proteins having various functions can be created.

  An embodiment of the present invention will be described as follows. Note that the present invention is not limited to this.

  The protein functional modification screening method according to the present invention (hereinafter abbreviated as “the screening method” where appropriate) is a screening method for a protein having a mutation artificially introduced to modify the function. A mutagenesis step for introducing a mutation so that an amino acid is substituted into a protein-encoding gene; a protein synthesis step for synthesizing a mutant protein using the obtained DNA as a template and a wheat germ cell-free protein synthesis system; Screening step for screening the function of the obtained protein. Here, protein functional modification screening means to evaluate a functional change of a mutant protein into which a mutation has been artificially introduced in order to create a protein having a new function, and to find a mutant protein modified to the target function. . The features of the screening method and kit for carrying out the screening method will be described in detail below.

1. Protein Function Modification Screening Method (1) Mutation Introduction Step The mutation introduction step in this screening method involves mutation so that at least one or more amino acids are substituted, deleted, inserted and / or added to the gene encoding the target protein. Is a step of introducing. Here, the gene may be any gene that encodes the protein of interest, and is preferably cDNA. Moreover, it is not limited to what encodes the full length of the target protein, You may code only a part of target protein. The target protein is not particularly limited as long as it is a protein that can be synthesized using a wheat germ cell-free protein synthesis system.

  The method used in the mutagenesis step in this screening method is not particularly limited as long as it can introduce a site-specific mutation at the gene (DNA) level, and a known method can be suitably used. One example of the method is the Kunkel method. In the Kunkel method, Escherichia coli CJ236 strain is used as a host strain to prepare single-stranded DNA of M13 phage into which a gene encoding a target protein for mutagenesis is cloned. CJ236 strain is F ', dut-, ung- E. coli and lacks dUTPase (Dut) and Uracil-DNA glycosylase (Ung). Therefore, DNA in which part of thymine (T) in the DNA is replaced with deoxyuracil (dU) is synthesized. Subsequently, this is hybridized with a synthetic oligonucleotide for introducing mutation, and a complementary strand is synthesized by polymerase reaction and ligase reaction. When this DNA is transfected into the ung + mutS strain, the DNA containing the original dU is degraded by Ung while suppressing the mismatch of the DNA, but the side of the complementary strand synthesized in vitro is Replicated without being disassembled. In this manner, DNA is selected and a mutation-introduced phage is obtained (Reference: Kunkel, TA (1985) Rapid and efficient site-specific mutagenesis without phenotypic selection. Proceedings of the National Academy of Science of the USA , 82: 488-492., Kunkel, TA, Bebenek, K. and McClary, J. (1991) Efficient site-directed mutagenesis using uracil-containing DNA. Methods in Enzymology, 204: 125-139.).

  Here, the synthetic oligonucleotide for mutagenesis is, for example, a 20 to 50 base oligonucleotide containing a sequence corresponding to the target amino acid when one amino acid is to be substituted, and the base sequence of the target amino acid. Is an oligonucleotide that has been changed to the base sequence of the amino acid to be substituted. The introduction of a restriction enzyme site at an appropriate position where the amino acid encoded by the gene does not change can be confirmed by the presence or absence of mutation introduction. By introducing a restriction enzyme site, the inserted gene part is amplified by PCR using the above-mentioned mutation-introduced phage as a template, cleaved with the restriction enzyme introduced into the synthetic oligonucleotide, and a cleavage pattern is obtained by electrophoresis. By confirming, it is possible to confirm whether or not the clone has a mutation introduced.

  As a method for site-directed mutagenesis at the gene (DNA) level other than the Kunkel method, a method using PCR can be mentioned. For example, using a vector in which a gene encoding the target protein for mutagenesis is inserted as a template and performing PCR using the same oligonucleotide as the synthetic oligonucleotide for mutagenesis used in the Kunkel method as a primer, mutation is performed. Can be introduced. In this case, it is also possible to confirm the presence or absence of mutagenesis by introducing a restriction enzyme site into the mutagenesis primer at an appropriate position where the amino acid encoded by the gene does not change. However, this step is not necessarily required.

  When mutagenesis is carried out using the Kunkel method, it usually takes about 3 days to 1 week, but when PCR is used, mutagenesis can be carried out in about half a day to 1 day. Therefore, a method using PCR is more preferable as the mutagenesis method used in the present screening method.

(2) Protein synthesis step The protein synthesis step in this screening method is a wheat germ cell-free protein synthesis system (hereinafter also referred to as “wheat germ cell-free system” as appropriate) based on the mutant gene obtained in the mutation introduction step. Is a step of synthesizing a mutant protein using In principle, this protein synthesis process consists of a transcription template DNA production process for producing a template DNA for synthesizing mRNA by in vitro transcription, and an mRNA synthesis process for synthesizing mRNA by in vitro transcription based on the obtained transcription template DNA. And a translation step of translating into protein based on the obtained mRNA. However, if the gene encoding the target protein is inserted into a vector having an RNA polymerase promoter sequence that can be used for in vitro transcription, the transcription template DNA preparation step is not necessary. In some cases, such as when using a wheat germ cell-free system where transcription template DNA, which serves as a template for in vitro transcription, is transcribed into mRNA in the reaction mixture and the protein is translated as is, etc. A process may not be necessary.

[Transcription template DNA preparation process]
The method for synthesizing mRNA added to the wheat germ cell-free system is not particularly limited, and a known in vitro transcription system can be suitably used. Therefore, the transcription template DNA is not particularly limited as long as mRNA can be synthesized by a known in vitro transcription system. For example, by inserting the mutant gene obtained in the above mutagenesis step into a vector having an RNA polymerase promoter sequence (eg, SP6 promoter, T7 promoter, T3 promoter, etc.) that can be used for in vitro transcription, transcription template DNA Can be produced. In addition, a primer is designed so as to amplify a part necessary for protein synthesis among the mutant genes obtained in the mutation introducing step, and a promoter sequence of RNA polymerase which can be used for in vitro transcription on the 5 ′ side of the sense primer and If an initiation codon (ATG) is added, transcription template DNA can be prepared by performing PCR using the primer. However, the production method of transcription template DNA is not limited to these.

  In addition, it has been known that protein synthesis efficiency is improved by adding a translation enhancing sequence upstream of mRNA encoding the target protein in a wheat germ cell-free system (reference: Sawasaki et al. (2002). Proc Natl Acad Sci USA 99, 14652-14657) Such translation enhancing sequences may include, but are not limited to, omega sequences derived from tobacco mosaic virus or sequences similar to omega sequences. Therefore, it is preferable to add a translation enhancing sequence between the promoter sequence and the mutated gene when preparing the transcription template DNA. By adding the translation enhancing sequence, the cap structure at the 5 'end and the poly A structure at the 3' end of the mRNA become unnecessary. In addition, the range of the indicated concentration of mRNA added to the wheat germ cell-free system is wider than the indicated concentration of mRNA having a cap structure and a poly A structure, and the handling becomes easy. For example, a transcription template for easily synthesizing an mRNA having a translation enhancing sequence can be obtained by constructing a vector in which a promoter and a translation enhancing sequence have been incorporated in advance and inserting the mutant gene obtained in the above mutagenesis step. DNA can be made. In addition, a primer is designed so as to amplify a part necessary for protein synthesis among the mutant genes obtained in the mutation introducing step, and a RNA polymerase promoter sequence that can be used for in vitro transcription on the 5 ′ side of the sense primer, If a translation enhancing sequence and an initiation codon (ATG) are added, a transcription template DNA for synthesizing mRNA having a translation enhancing sequence can be prepared by performing PCR using the primer. However, the method for producing a transcription template DNA having a translation enhancing sequence is not limited thereto.

  The method of Sawasaki et al. (Sawasaki et al. (2002) Proc Natl Acad Sci USA 99, 14652-14657) can be applied as a method for more easily preparing transcription template DNA using the PCR method. FIG. 1 shows the procedure. The method of Sawasaki et al. Will be described based on FIG.

  First, a vector in which the gene encoding the target protein has been cloned is used as a template for PCR. The 5 ′ end sequence (about 13 to about 30 bases) of the gene encoding the target protein and the linker sequence on the 5 ′ end side thereof. The first PCR is carried out with a combination of the added sense primer (indicated by 1 in the figure) and an antisense primer (indicated by 2 in the figure) set at an appropriate position on the vector. Here, when there is no start codon (ATG) at the 5 'end of the gene, such as when the protein to be synthesized (translated) is a protein lacking the N-terminus, the start codon (ATG) is added immediately after the linker sequence. Sense primer is used. Needless to say, a purified vector DNA can be used as a vector for the template, but it is also possible to directly use a culture solution such as host Escherichia coli transformed with the vector.

  Next, using the first PCR product as a template, 2 kinds of sense primers (indicated by 3 and 4 in the figure) and the antisense primer used in the first PCR (indicated by 2 in the figure) were combined to give 2 Perform the second round of PCR. One of the two types of sense primers has a sequence at the 5 'end (upstream side) of the final amplification product, and is designed to have a sequence at the 5' side of the promoter sequence (indicated by 3 in the figure). The other primer is designed in order from the 5 'side, including the 3' side of the promoter sequence, a translation enhancing sequence, and a linker sequence included in the primer used in the first PCR (indicated by 4 in the figure). The 3 ′ end of the upstream primer and the 5 ′ end of the downstream primer are designed so that the sequences partially overlap (about 10 bases) (such a primer is referred to as “Split primer”). By this second round of PCR, a DNA fragment consisting of a promoter, a translation enhancing sequence, a gene encoding the target protein, and a part of the vector sequence is amplified and can be suitably used as a transcription template DNA. In the present specification, the second PCR, that is, PCR using a split primer for adding a promoter and a translation enhancing sequence is referred to as “Split-PCR”.

  The cleavage sites of the two types of sense primers (Split primers) are not particularly limited, but it is particularly preferable to design so as to cleave the promoter sequence as described above. By designing in this way, only a DNA fragment amplified using both of the two types of sense primers can be a transcription template DNA having a full-length promoter sequence, but amplified only with either one of the sense primers. Since DNA fragments and nonspecifically amplified DNA fragments do not have a full-length promoter sequence, they cannot serve as transcription template DNA, and background noise during translation can be kept low.

[MRNA synthesis process]
As described above, the method for synthesizing mRNA added to the wheat germ cell-free system is not particularly limited, and a known in vitro transcription system can be suitably used. Therefore, for example, a transcription template DNA having an RNA polymerase promoter sequence that can be used for in vitro transcription prepared in the above transcription template DNA preparation step is added to a synthesis reaction solution containing an appropriate substrate and a promoter-specific RNA polymerase. By doing so, mRNA encoding the target mutant protein can be synthesized.

  After completion of the in vitro transcription reaction, transcription efficiency can be assayed by subjecting a part of the reaction solution to agarose gel electrophoresis. Alternatively, the amount of RNA can be calculated by purifying mRNA by ethanol precipitation and dissolving it in an appropriate amount of sterilized water (RNase free) and then measuring the absorbance at 260 nm.

[Translation process]
The translation step is a step of translating into a protein using a wheat germ cell-free protein synthesis system (see JP 2000-236896 A) based on the mRNA obtained in the mRNA synthesis step.

  The wheat germ cell-free protein synthesis system uses a dialysis membrane method in which a substrate is supplied through a dialysis membrane, and a multilayer method in which a substrate solution is overlaid on a translation solution to promote the reaction. Since the wheat germ cell-free protein synthesis system has high activity, if the reaction is carried out in a closed reaction system in which all are mixed, the substrate is consumed and the reaction is completed within a few hours. Therefore, the multilayer method is to extend the reaction time by slowly adding a new substrate here. By placing the highly viscous wheat germ extract on the lower layer and the less viscous substrate mixture on the upper layer, both solutions are gradually mixed by diffusion, during which necessary substances are supplied to the reaction solution and unnecessary substances are removed. By diluting, protein synthesis proceeds continuously. This reaction lasts for 16-24 hours, and high yields can be expected (Sawasaki, T., Hasegawa, Y., Tsuchimochi, M., Kamura, N., Ogasawara, T., Kuroita, T., Endo, Y. , FEBS Lett., 2002, Vol. 514, 102-105). The multi-layer method is suitable for screening a large number of samples with high throughput, and is particularly effective for an automation system using a dispensing robot.

  The dialysis method is a method in which protein synthesis proceeds continuously by supplying a substrate such as amino acids necessary for protein synthesis, ATP, GTP, etc. and diluting unnecessary substances by diffusion through the dialysis membrane (Spirin AS, Baranov, VI, Ryabova, LA, Ovodov, SY & Alakhov, YB, Science, 1988, Vol. 242, 1162-1164.). Dialysis is suitable for the purpose of synthesizing a large amount of protein.

(3) Method for performing a series of mutation introduction and transcription template DNA preparation The present inventors introduce a mutation into a gene encoding a target protein using PCR in order to perform a functional modification screening of the protein with higher throughput. In some cases, a method for producing transcription template DNA simply and quickly was devised by applying the method of Sawasaki et al. FIG. 2 shows the procedure. The procedure will be described with reference to FIGS.

  (A) A gene (DNA) encoding a protein to be introduced with a mutation is inserted into an appropriate cloning vector such as pBluescript SK + (Stratagene). The gene to be inserted is preferably cDNA. However, it may not be a full-length cDNA, but may be the full length of the open reading frame or a part of the open reading frame.

  Sense primer (indicated by 1 in the figure) to which a 5 'end sequence (about 13 to about 30 bases) of a gene encoding the target protein and a linker sequence (eg, CCTCTTCCAGGGCCCA, SEQ ID NO: 1) are added to the 5' end side Is designed and synthesized. Here, when there is no start codon (ATG) at the 5 'end of the gene, such as when the protein to be synthesized (translated) is a protein lacking the N-terminus, the start codon (ATG) is added immediately after the linker sequence. Design the sense primer. The linker sequence is not limited to the above sequence (SEQ ID NO: 1). In addition, two types of antisense primers (indicated by 4 and 5 in the figure) are designed and synthesized at different positions on the vector into which the gene encoding the target protein has been inserted. The antisense primer is preferably designed at a position on the vector such that the length of the 3 'untranslated region is about 1.0 to 1.5 kbp for the purpose of improving the stability of mRNA. However, it is not limited to this.

  Sense and antisense oligonucleotides (indicated by 2 (antisense) and 3 (sense) in the figure, hereinafter referred to as “mutation-introducing primers”) are synthesized at the positions where mutations are to be introduced. As described in the explanation of the Kunkel method, the mutagenesis primer is an oligonucleotide having 20 to 50 bases containing a sequence corresponding to a target amino acid, for example, when one amino acid is to be substituted. Any oligonucleotide may be used as long as the nucleotide sequence of the amino acid is changed to the amino acid sequence to be substituted. Therefore, one of the mutation-introducing primers can be the same as the mutation-introducing oligonucleotide used in the Kunkel method. At this time, it is possible to confirm the presence or absence of mutation introduction by introducing a restriction enzyme site at an appropriate position where the amino acid encoded by the gene does not change.

  (B) PCR is performed separately for the 5 'side region and the 3' side region so that the target gene overlaps with the primer region for mutagenesis. That is, PCR is carried out using a combination of primer 1 and primer 2 in the 5 'side region and a combination of primer 3 and primer 4 in the 3' side region. As a result, two types of DNA fragments in which the target gene overlaps with the mutation-introducing primer region can be obtained.

  Here, in order to avoid erroneous incorporation of bases by PCR and addition of adenine (A) to the 3 ′ end, the PCR cycle number is suppressed to 20 to 25 cycles, and the heat-resistant DNA polymerase used for PCR is highly amplified. It is preferable to use one having efficiency and high accuracy. As the thermostable DNA polymerase, for example, Pyrobest DNA polymerase (manufactured by Takara Bio Inc.), KOD DNA polymerase (TOYOBO), KOD Dash (TOYOBO), Pfu DNA polymerase (TOYOBO) and the like can be suitably used.

  (C) The two types of PCR reaction solutions obtained by PCR in (b) above are diluted to appropriate concentrations (for example, 20-fold dilution), mixed together, and subjected to an extension reaction with DNA polymerase in the absence of primers. Do. Thereby, the fragment | piece connected from the primer 1 to the primer 4 is synthesize | combined.

  (D) Split-PCR using the DNA fragment obtained in (c) above as a template, two types of split primers (SP6 and Ω in the figure) as sense primers, and the primer 5 as an antisense primer. Do. Although the SP6 promoter is used as the promoter in FIG. 2, the present invention is not limited to this, and other promoters such as a T7 promoter and a T3 promoter can be used. In addition, the sense primer is not limited to the split primer, and includes one kind of sense primer including in vitro transcription promoter sequence and the above linker sequence, or in vitro transcription promoter sequence, translation enhancing sequence, and linker sequence. One type of sense primer may be used. However, it is particularly preferable to use a split primer.

  (E) Through the above procedure, a DNA fragment containing a mutated gene that can be used as a transcription template DNA is synthesized, mRNA is synthesized using the DNA fragment as a transcription template using an in vitro transcription system, and wheat germ cell-free The target mutant protein can be synthesized using the system.

  By carrying out a series of mutation introduction and transcription template DNA production by the above procedures (a) to (e), transcription template DNA can be produced in a short time. Specifically, if a vector into which a gene encoding the protein to be mutated is inserted, a mutagenesis primer, and other necessary primers are prepared in advance, a transcription template DNA is produced in about one day. Compared to the conventional transformation of a host such as Escherichia coli that requires about 3 to 5 days after the introduction of mutation, the time required can be significantly shortened. In addition, when a large number of mutants of the target protein are prepared and their functional alterations are screened, if each of the primers for mutagenesis is designed, subsequent PCR can be performed using the same primer. If a PCR tube for a sample is used, transcription template DNAs for 96 types of mutant proteins can be prepared at one time.

  Applying the method for preparing transcription template DNA according to the above procedures (a) to (e) to this screening method, and combining and screening a large number of mutant proteins in a short time by combining with a wheat germ cell-free system. Is possible. That is, it is possible to realize a revolutionary high throughput of the protein functional modification screening method.

  In addition, the preparation method of the said transcription | transfer template DNA is also contained in this invention.

(4) Screening step The screening step in this screening method is a step of screening the function of the protein obtained in the protein synthesis step. Since this screening method uses a wheat germ cell-free protein synthesis system, any protein that can be synthesized using the protein synthesis system can be used as the target of this screening method. For example, various enzymes such as lipases, glycosidases, amino acid synthesizing enzymes, restriction enzymes and the like can be suitably targeted for this screening method.

  Furthermore, depending on the type of protein synthesized using the wheat germ cell-free protein synthesis system, it is possible to use for screening without purifying the protein in the reaction solution. That is, it is possible to carry out screening for various enzyme assays and the like simply by exchanging the reaction solution containing the synthesized protein as it is or with a buffer suitable for the screening method to be used.

  On the other hand, in the case of a protein that requires purification because functional analysis is difficult due to the mixture of wheat germ extract, a purification step may be provided before the screening step. The purification method is not particularly limited, and a known method suitable for purification of the synthesized protein can be appropriately selected and used. However, the purification method can be simply and quickly performed without hindering high throughput. It is preferable that it is possible. As an example of a simple purification method, a target protein in which a histag consisting of 6 histidine residues, glutathione-S-transferase (GST) protein or the like is previously synthesized at the amino terminal or carboxyl terminal of the target protein is synthesized. An example is a method in which a transcription template DNA is prepared and the synthesized protein is purified using an affinity carrier.

  The method used for the screening step in this screening method is not particularly limited, and a known method that can evaluate the target function may be selected and used. For example, when evaluating the biological activity of porcine interleukin 2 (rpoIL-2), the reaction solution after synthesis is diluted with the culture solution without being purified, and added to the culture medium of IL-2-dependent CTLL2 cells. A method for measuring proliferation can be used. Moreover, when evaluating the function of Calf Rhodanese, the enzymatic activity can be measured as it is according to a conventional method (Methods Enzymol, 77: 285-91, 1981) as it is after the synthesis. However, it is not limited to this.

2. Kit according to the present invention (1) Protein functional modification screening kit The protein functional modification screening kit according to the present invention (hereinafter abbreviated as “the present screening kit” as appropriate) is a protein functional modification screening method according to the present invention. It is a kit for carrying out. This screening kit contains at least a vector for inserting a target gene, an in vitro transcription promoter sequence and a translation enhancing sequence, and is divided into an upstream primer and a downstream primer, and the 3 ′ end sequence of the upstream primer is downstream. Two types of sense primers that overlap with the 5 'end sequence of the primer, antisense primers based on vector sequences, PCR reaction buffer, deoxyribonucleoside triphosphate mixture, heat-resistant DNA synthase, in vitro transcription buffer It preferably contains an RNA synthetase, a ribonucleoside triphosphate mixture, a wheat germ cell-free protein synthesis solution, an energy / amino acid mixture, an in vitro translation buffer, and an RNase inhibitor. The configuration of the kit is not limited to these, and various reagents and instruments may be added in consideration of user convenience. For example, tubes and plates for PCR, tubes and plates for mRNA synthesis, plates for protein synthesis, and the like can be mentioned. Furthermore, by specifying the function to be evaluated, it is possible to include reagents and instruments used in the screening step in the present screening method as a configuration of the kit. With such a configuration, the kit according to the present invention can be implemented as a large number of kits that specify the function to be evaluated.

  By using this screening kit, the protein functional modification screening method according to the present invention can be carried out simply and rapidly, and high-throughput protein functional modification screening can be more easily performed.

(2) Transcription template DNA preparation kit The transcription template DNA preparation kit according to the present invention is a kit for carrying out the method for preparing a transcription template DNA according to the present invention. This transcription template DNA preparation kit contains at least a vector for inserting a target gene, an in vitro transcription promoter sequence and a translation enhancing sequence, and is divided into an upstream primer and a downstream primer, and a sequence at the 3 ′ end of the upstream primer Contains two types of sense primers that overlap with the 5 ′ terminal sequence of the downstream primer, an antisense primer based on the vector sequence, a PCR reaction buffer, a deoxyribonucleoside triphosphate mixture, and a thermostable DNA synthase. preferable. The configuration of the kit is not limited to these, and various reagents and instruments may be added in consideration of user convenience. For example, PCR tubes and plates can be used.

  By using this transcription template DNA production kit, the transcription template DNA production method according to the present invention can be carried out simply and rapidly.

  The present invention is not limited to the above-described embodiments, and various modifications are possible within the scope shown in the claims, and embodiments obtained by appropriately combining technical means disclosed in different embodiments. Is also included in the technical scope of the present invention.

  Hereinafter, examples in which the protein functional modification screening method according to the present invention is applied to functional modification of the rice anthranilate synthase second isozyme α subunit will be described.

(1) Mutation introduction by PCR <Insertion of target gene into cloning vector>
Insert a gene (ACCESSION NO. AB022603) encoding rice anthranilate synthase second isozyme α subunit (hereinafter abbreviated as “OASA2”) into the EcoRI site of the cloning vector pBluescript SK + (Stratagene), pBS-OASA2 was constructed. The inserted gene is inserted in the direction from the restriction enzyme site KpnI of the multicloning site to SacI.

<Primer for mutagenesis>
i) Substitution of 367th tyrosine with alanine
A mutation introducing primer was designed so that the 367th tyrosine residue of OASA2 was substituted with an alanine residue and a restriction enzyme site (SnaBI: TACGTA) was introduced at a position where the encoded amino acid did not change. The base sequence of the mutation-introducing primer is as follows. The underline indicates the restriction enzyme site, and the lower case letter indicates the mutation introduction codon.
Y367A-F: 5'-GTGAACCCAAGTCCAgccATGGCA TACGTA CAGGCAAGAGGC-3 '(SEQ ID NO: 2)
Y367A-R: 5'-GCCTCTTGCCTG TACGTA TGCCATggcTGGACTTGGGTTCAC-3 '(SEQ ID NO: 3)
The 16th to 18th gcc (alanine, A) and 25th to 30th TACGTA (SnaBI site) of primer Y367A-F were designed from the TAC (tyrosine, Y) and TATGTA sequences of wild type OASA2, respectively. . By using TAC as GCC, the 367th tyrosine residue of wild-type OASA2 is replaced with an alanine residue. In addition, when TATGTA is changed to TACGTA, a restriction enzyme site (SnaBI: TACGTA) is introduced without amino acid substitution (both TAT and TAC are tyrosine), thereby facilitating selection after mutagenesis. Primer Y367A-R is the complementary strand of primer Y367A-F.

ii) Substitution of 367th tyrosine with isoleucine Similar to i) above, the 367th tyrosine residue of OASA2 is amino acid substituted with an alanine residue, and the restriction enzyme site (SnaBI: A mutagenesis primer was designed to introduce TACGTA). The base sequence of the mutation-introducing primer is as follows. The underline indicates the restriction enzyme site, and the lower case letter indicates the mutation introduction codon.
Y367I-F: 5'-GTGAACCCAAGTCCAatcATGGCA TACGTA CAGGCAAGAGGC-3 '(SEQ ID NO: 4)
Y367I-R: 5'-GCCTCTTGCCTG TACGTA TGCCATgatTGGACTTGGGTTCAC-3 '(SEQ ID NO: 5)
iii) Substitution of 367th tyrosine with phenylalanine As in i) above, the 367th tyrosine residue of OASA2 is amino acid substituted with a phenylalanine residue, and the restriction enzyme site (SnaBI: A mutagenesis primer was designed to introduce TACGTA). The base sequence of the mutation-introducing primer is as follows. The underline indicates the restriction enzyme site, and the lower case letter indicates the mutation introduction codon.
Y367F-F: 5'-GTGAACCCAAGTCCAttcATGGCA TACGTA CAGGCAAGAGGC-3 '(SEQ ID NO: 6)
Y367F-R: 5'-GCCTCTTGCCTG TACGTA TGCCATgaaTGGACTTGGGTTCAC-3 '(SEQ ID NO: 7)
iv) Substitution of 530th leucine with aspartic acid In the same manner as in i) above, the 530th leucine residue of OASA2 was substituted with an aspartic acid residue, and the restriction enzyme site ( NheI: GCTAGC) was designed to introduce a mutagenesis primer. The base sequence of the mutation-introducing primer is as follows. The underline indicates the restriction enzyme site, and the lower case letter indicates the mutation introduction codon.
L530D-F: 5'-ACGGAGACATGgacATCGC GCTAGC ACTCCGCACCATT-3 '(SEQ ID NO: 8)
L530D-R: 5'-AATGGTGCGGAGT GCTAGC GCGATgtcCATGTCTCCGT-3 '(SEQ ID NO: 9)
v) Substitution of 367th tyrosine with valine As in i) above, the 367th tyrosine residue of OASA2 is amino acid substituted with a valine residue, and the restriction amino acid site (SnaBI: A mutagenesis primer was designed to introduce TACGTA). The base sequence of the mutation-introducing primer is as follows. The underline indicates the restriction enzyme site, and the lower case letter indicates the mutation introduction codon.
Y367V-F: 5'-GTGAACCCAAGTCCAgtcATGGCA TACGTA CAGGCAAGAGGC-3 '(SEQ ID NO: 10)
Y367V-R: 5'-GCCTCTTGCCTG TACGTA TGCCATgacTGGACTTGGGTTCAC-3 '(SEQ ID NO: 11)
<Primers for Split-PCR>
OASA2 is a gene encoded in the rice nuclear genome, but it has been found that the synthesized protein moves to the chloroplast and functions in the chloroplast. The synthesized protein has a signal sequence for transferring to the chloroplast in the N-terminal region. When the sequence is removed, it becomes a mature enzyme and exhibits enzyme activity. Therefore, in order to synthesize OASA2 as a mature enzyme in a wheat germ cell-free synthesis system, primers were designed so that the 49-residue signal sequence present in the N-terminal region was removed. That is, an ATG initiation codon was placed downstream of a linker sequence enabling Split-PCR in a wheat germ cell-free synthesis system, and a 36-mer primer consisting of the 148th to 164th base sequences of the OASA2 gene was designed. In addition, two types of antisense primers for Split-PCR were set on the complementary strand side of the sense Split-PCR primer on a vector (pBluescript SK +) in which OASA2 was inserted. Antisense Split-PCR primer 1 and antisense Split-PCR primer 2 were used in order from the position of the inserted DNA. The base sequences of the primers for Split-PCR are as follows.
Sense Split-PCR primer: 5'- CCTCTTCCAGGGCCCA ATGTGCTCCGCGGGGAAGCC-3 '(SEQ ID NO: 12, underlined is linker sequence)
Antisense Split-PCR Primer 1: 5'-GGAGAAAGGCGGACAGGTAT-3 '(SEQ ID NO: 13)
Antisense Split-PCR Primer 2: 5'-GGGGAAACGCCTGGTATCTT-3 '(SEQ ID NO: 14)
<Preparation of DNA for mutation introduction by PCR>
PCR was performed separately on the 5 ′ side region and the 3 ′ side region so that the OASA2 gene overlapped with the primer region for mutagenesis. For example, when using a mutagenesis primer for substituting the 367th tyrosine described in i) above with alanine, the 5′-side region uses the pBS-OASA2 vector as a template, the sense Split-PCR primer and the primer Y367A. PCR was performed with a combination of -R, and the 3 'region was pBS-OASA2 vector as a template, and PCR was performed with a combination of primer Y367A-F and antisense Split-PCR primer 1. When using the mutation-introducing primers described in the above ii), iii), and iv), PCR was carried out using the same template and the same primer combination.

  When using the mutation-introducing primer described in v) above, plasmid DNA in which a mutation for amino acid substitution of the 530th leucine residue of OASA2 to an alanine residue by the Kunkel method described later is used as a template in the pBS-OASA2 vector. Was used. Therefore, by performing PCR using the mutation-introducing primers (Y367V-F and Y367V-R) described in v) above, the 367th tyrosine residue of OASA2 was amino acid-substituted, and the 530th amino acid was substituted. A mutant gene into which two mutations for amino acid substitution of leucine residues to alanine residues are introduced is obtained. The combination of primers is the same as described above.

  The composition of the PCR reaction solution was 1 × Pyrobest buffer II (TaKaRa), 0.2 mM dNTP, 0.5 μM sense and antisense primers, 0.025 units / μl Pyrobest DNA polymerase (TaKaRa), 10 ng template DNA (pBS-OASA2 vector) Using a PCR reaction device (TaKaRa PCR Thermal Cycler MP TP3000 type, manufactured by Takara Shuzo Co., Ltd.), hold at 95 ° C for 2 minutes, then react at 98 ° C for 20 seconds, 60 ° C for 35 seconds, and 72 ° C for 3 minutes. Was repeated for 25 cycles, held at 72 ° C. for 10 minutes, and then cooled to 4 ° C.

  Amplified PCR product (5 'region fragment and 3' region fragment) is diluted 20 times, and PCR reaction solution (1x EX Taq buffer (TaKaRa), 0.2 mM dNTP, 0.025 units / μl TaKaRa EX Taq (TaKaRa)) 1 μl at a time, using the above PCR reactor, hold at 95 ° C for 2 minutes, then repeat the reaction for 5 cycles of 98 ° C for 20 seconds, 60 ° C for 35 seconds, and 72 ° C for 3 minutes. Went. By this reaction, a DNA fragment ligated from the sense Split-PCR primer to the antisense Split-PCR primer 1 was synthesized.

  Immediately after the completion of the reaction, the sense split-PCR primer and the antisense split-PCR primer 1 were added so that the final concentration of each primer was 0.2 μM, and 2 ° C. at 95 ° C. using the PCR reaction apparatus. After holding for 20 minutes, the reaction of 98 ° C. for 20 seconds, 60 ° C. for 35 seconds and 72 ° C. for 3 minutes was repeated 20 cycles, held at 72 ° C. for 10 minutes, and then cooled to 4 ° C. As a result of the above reaction, a DNA fragment linked from the sense Split-PCR primer to the antisense Split-PCR primer 1 was amplified and used as a template for the next Split-PCR.

(2) Mutation introduction by Kunkel method
The Kunkel method was performed according to the method described in Reference Literature 1-3 below.

Reference 1: Kunkel, TA (1985) Rapid and efficient site-specific mutagenesis without phenotypic selection. Proceedings of the National Academy of Science of the USA, 82: 488-492.
Reference 2: Kunkel, TA, Bebenek, K. and McClary, J. (1991) Efficient site-directed mutagenesis using uracil-containing DNA. Methods in Enzymology, 204: 125-139.
Reference 3: “Molecular Cloning (Third Edition)” (J. Sambrook & DW Russell, Cold Spring Harbor Laboratory Press, 2001) Chapter 13
The mutagenesis primers used are the same as those used in the mutagenesis by the PCR method. Further, the following primers were used as mutation introduction primers not shown in SEQ ID NOs: 2 to 11. The underline indicates a restriction enzyme site (NheI: GCTAGC), and the lower case letter indicates a mutagenesis codon.
L530A-F: 5'-ACGGAGACATGgctATCGC GCTAGC ACTCCGCACCATT-3 '(SEQ ID NO: 15)
L530A-R: 5'-AATGGTGCGGAGT GCTAGC GCGATagcCATGTCTCCGT-3 '(SEQ ID NO: 16)
A gene encoding OASA2 into which mutation has been introduced by the Kunkel method is inserted into pBluescript SK +, PCR is performed using the above-described sense split-PCR primer and antisense split-PCR primer 1, and the amplified DNA fragment is This was used as a template for Split-PCR.

(3) Synthesis of transcription template DNA by Split-PCR method In order to use the fragment (Split-PCR template DNA) obtained by the above (1) PCR method or (2) Kunkel method as a transcription template DNA, It is necessary to add a promoter of SP6 RNA polymerase and a translation enhancement sequence (omega sequence) derived from tobacco mosaic virus (TMV) upstream of the 5 ′ end. Therefore, Split-PCR was performed according to the method of Sawasaki et al. (Sawasaki et al. (2002) Proc Natl Acad Sci USA 99, 14652-14657). Specifically, the Split-PCR template DNA obtained by the above (1) PCR method or (2) Kunkel method was diluted 50-fold, and PCR reaction solution [1 × EX Taq buffer (TaKaRa), 0.2 mM dNTP, 0.025 units / μl TaKaRa EX Taq (TaKaRa), 0.2 μM SP6 promoter primer, 1 nM TMV-Omega primer, 0.2 μM antisense Split-PCR primer 2] is added at 1 μl, and 2 times at 95 ° C. using the above PCR reaction apparatus. After holding for 30 minutes, the reaction of 98 ° C. for 20 seconds, 60 ° C. for 35 seconds, and 72 ° C. for 3 minutes was repeated 35 cycles, held at 72 ° C. for 10 minutes, and then cooled to 4 ° C. The base sequences of SP6 promoter primer and TMV-Omega primer are as follows. The underline indicates the SP6 promoter sequence, and the lowercase letter indicates the overlapping part of both primers.
SP6 promoter primer: 5'-GCGTAGC ATTTAggtgacact- 3 '(SEQ ID NO: 17)
TMV-Omega primer: 5'- ggtgacactATAGAA GTATTTTTACAACAATTACCAACAACAACAACAAACAACAACAACATTACATTTTACATTCTACAACTACCTCTTCCAGGGCCCAATG-3 '(SEQ ID NO: 18)
(4) Synthesis of mRNA for wheat germ cell-free system mRNA was synthesized (transcribed) using the PCR product obtained in (3) above directly as a template. That is, the PCR product obtained in (3) above was transcribed into a transcription reaction solution [80 mM HEPES-KOH (pH 7.8), 16 mM Mg (OAc) 2, 10 mM spermidine, 10 mM DTT, 3 mM NTP, 1 unit / μl RNasin RNase. 1/10 amount of inhibitor (Promega), 1 unit / μl SP6 RNA polymerase (Promega)]. After reaction at 37 ° C. for 2 hours, ethanol precipitation and 70% ethanol washing were performed, and the product was dissolved in an appropriate amount of sterile water. The amount of RNA was calculated by measuring the absorbance at 260 nm.

(5) Protein synthesis by wheat germ cell-free system
According to the method of Sawasaki et al. (Sawasaki et al. (2002) Proc Natl Acad Sci USA 99, 14652-14657), a protein was synthesized using the mRNA synthesized in the above (6) as a template. That is, the mRNA (about 30-35 μg) was added to a dialysis cup containing 50 μl of wheat germ cell-free protein synthesis solution, and the dialysis cup was immersed in a 24-well plate containing 1 ml of substrate solution per well. Incubated at 26 ° C for 24 hours.

(6) Activity measurement of OASA2 OASA2, which is the α subunit of rice anthranilate synthase, produces anthranilic acid from chorismate using ammonia derived from the amide group of glutamine supplied by the β subunit. In vivo, OASA2 exhibits anthranilic acid synthesizing activity (hereinafter abbreviated as “AS activity” where appropriate) using ammonia supplied by the β subunit, but ammonia such as NH ₄ Cl is added from the outside. It also shows enzyme activity.

  Since OASA2 activity is feedback-suppressed by tryptophan as is well known, it is essential to remove tryptophan from the protein synthesis reaction solution described in (5) above, and the environment of the expressed protein is used as a buffer for measuring AS activity. It is necessary to change into ingredients. Therefore, buffer A (50 mM Tris-HCl, pH7.6; 0.05 mM EDTA; 2 mM MgCl2; 0.05 mM DTT; 5% glycerol) using Microspin G-25 columns (manufactured by Amersham Biosciences) Replaced with

Enzyme activity was determined by adding 2.5 μl of a crude extract solution substituted with 90 μl of reaction solution (20 mM Tris-HCl, pH 8.3; 100 mM NH ₄ Cl, 0.5 mM chorismic acid; 10 mM MgCl ₂ ) at 32 ° C. Reacted for hours. The reaction was stopped by adding 10 μl of 1N HCl, and the synthesized anthranilic acid was extracted by adding 300 μl of ethyl acetate. The synthesis amount of anthranilic acid was measured using Wallac 1420 ARVOsx-FL (manufactured by Perkin Elmer Life Science Japan) at an excitation wavelength of 355 nm / fluorescence (emmision) of 460 nm. When analyzing the feedback inhibitory activity against tryptophan, tryptophan was added to the reaction system to a final concentration of 10 μM or 100 μM.

(7) Results The results are shown in FIG. As is apparent from FIG. 3, OASA2 into which the same mutation was introduced showed almost the same activity regardless of whether the mutation introduction method was the PCR method or the Kunkel method. The OASA2 mutant in which the 367th tyrosine residue of OASA2 is substituted with an alanine residue, isoleucine residue or phenylalanine residue is less active than OASA2 wild type but does not undergo feedback inhibition It turned out that. The OASA2 mutant in which the 367th 530th leucine residue of OASA2 was substituted with an aspartic acid residue was found to be a mutant that was subject to feedback inhibition but was more active than the OASA2 wild type. Furthermore, the OASA2 mutant in which the 367th tyrosine residue of OASA2 is amino acid substituted with a valine residue and the 530th leucine residue is amino acid substituted with an alanine residue is more active than a mutant having a mutation only at the 367th position. It was found that the mutant was not highly susceptible to feedback inhibition.

  The protein functional modification screening method according to the present invention can be applied to all proteins that can be synthesized using a wheat germ cell-free protein synthesis system. Therefore, it can be used for biological research and biological related industries in all fields. In particular, it is expected to contribute to the birth of a large number of useful proteins with high utility value through use in medical / pharmaceutical industries, agriculture, livestock industry, food industry, chemical industry, and the like.

It is a figure which shows the procedure of Split-PCR method of Sawasaki et al. (Sawasaki et al. (2002) Proc Natl Acad Sci USA 99, 14652-14657). In the protein functional modification screening method according to the present invention, it is a diagram showing a procedure of a method for performing a series of mutation introduction and transcription template DNA production. It is a graph which shows the result of having screened the functional modification | change of the rice anthranilate synthase 2nd isozyme alpha subunit using the screening method which concerns on this invention.

Claims (13)

A method for screening a protein having a mutation artificially introduced to modify its function,
A mutagenesis step of introducing a mutation so that at least one or more amino acids are substituted, deleted, inserted and / or added to a gene encoding the protein of interest;
A protein synthesis step of synthesizing a mutant protein using a wheat germ cell-free protein synthesis system based on the obtained mutant gene;
A protein functional modification screening method comprising a screening step for screening the function of the obtained protein. The protein synthesis step includes a transcription template DNA production step for producing a template DNA for synthesizing mRNA by in vitro transcription,
An mRNA synthesis step of synthesizing mRNA by in vitro transcription based on the obtained transcription template DNA;
The protein functional modification screening method according to claim 1, further comprising a translation step of translating into a protein using a wheat germ cell-free protein synthesis system based on the obtained mRNA.   The protein functional modification screening method according to claim 1 or 2, wherein a PCR method is used in the mutation introducing step.   4. The protein functional modification screening method according to claim 2 or 3, wherein a PCR method is used in the transcription template DNA preparation step of the protein synthesis step.   3. The protein functional modification screening method according to claim 2, wherein PCR is used in any of the mutation introduction step and the transcription template DNA preparation step of the protein synthesis step, and both steps are performed as a series of steps. . In the transcription template DNA preparation step of the mutation introduction step and protein synthesis step,
Using a vector into which a gene encoding the target protein is inserted as a template,
Using a sense strand mutagenesis oligonucleotide based on the sequence of the portion of the gene encoding the target protein to be introduced and an antisense strand mutagenesis oligonucleotide consisting of its complementary sequence as primers,
PCR using a combination of a sense primer in which a linker sequence is linked to the 5 ′ end of the base sequence of the portion that initiates translation of the gene encoding the target protein and the antisense strand mutagenesis oligonucleotide; Perform PCR by combining the oligonucleotide for mutagenesis and the antisense primer based on the vector sequence located downstream of the gene encoding the protein of interest,
A DNA fragment from the linker sequence to a vector sequence located downstream of the gene encoding the target protein is prepared by mixing the two sets of PCR products and extending with a DNA synthase,
By using the above DNA fragment as a template and performing PCR with a combination of a sense primer containing a promoter sequence for in vitro transcription and the above linker sequence and an antisense primer based on the vector sequence contained in the above template DNA fragment, wheat germ is eliminated. 6. The protein functional modification screening method according to claim 5, wherein a transcription template DNA for synthesizing mRNA used for synthesizing a mutant protein in a cellular protein synthesis system is prepared.   7. The protein functional modification screening method according to claim 6, wherein the sense primer comprising the in vitro transcription promoter sequence and the linker sequence further comprises a translation enhancing sequence at an intermediate position between the two sequences.   The sense primer containing an in vitro transcription promoter sequence, a translation enhancing sequence, and a linker sequence is a primer divided into an upstream primer and a downstream primer, and the sequence at the 3 ′ end of the upstream primer is 5 of the downstream primer. The method for screening for functional modification of a protein according to claim 7, wherein the primer is a primer overlapping with the sequence at the end. A method for preparing a transcription template DNA for synthesizing mRNA used for synthesizing a mutant protein in a wheat germ cell-free protein synthesis system,
Using a vector into which a gene encoding the target protein is inserted as a template,
Using a sense strand mutagenesis oligonucleotide based on the sequence of the portion of the gene encoding the target protein to be introduced and an antisense strand mutagenesis oligonucleotide consisting of its complementary sequence as primers,
PCR using a combination of a sense primer in which a linker sequence is linked to the 5 ′ end of the base sequence of the portion that initiates translation of the gene encoding the target protein and the antisense strand mutagenesis oligonucleotide; Perform PCR by combining the oligonucleotide for mutagenesis and the antisense primer based on the vector sequence located downstream of the gene encoding the protein of interest,
A DNA fragment from the linker sequence to a vector sequence located downstream of the gene encoding the target protein is prepared by mixing the two sets of PCR products and extending with a DNA synthase,
Transcription using the DNA fragment as a template and performing PCR by a combination of a sense primer containing a promoter sequence for in vitro transcription and the linker sequence and an antisense primer based on a vector sequence contained in the template DNA fragment A method for producing a template DNA.   The method for producing a transcription template DNA according to claim 9, wherein the sense primer comprising the in vitro transcription promoter sequence and the linker sequence further comprises a translation enhancing sequence at an intermediate position between the two sequences.   The sense primer containing an in vitro transcription promoter sequence, a translation enhancing sequence, and a linker sequence is a primer divided into an upstream primer and a downstream primer, and the sequence at the 3 ′ end of the upstream primer is 5 of the downstream primer. The method for producing a transcription template DNA according to claim 10, wherein the primer is a primer overlapping with a terminal sequence.   A kit for carrying out the protein functional modification screening method according to claim 8, comprising at least a vector for inserting a target gene, an in vitro transcription promoter sequence and a translation enhancing sequence, and an upstream primer and a downstream side 2 types of sense primers which are divided into primers and the 3 ′ end sequence of the upstream primer overlaps the 5 ′ end sequence of the downstream primer, an antisense primer based on the vector sequence, a PCR reaction buffer, deoxyribonucleoside 3 Phosphate mixed solution, thermostable DNA synthase, in vitro transcription buffer, RNA synthase, ribonucleoside triphosphate mixed solution, wheat germ cell-free protein synthesized solution, energy / amino acid mixed solution, in vitro translation buffer , A protein function characterized by containing an RNase inhibitor Strange screening kit. A kit for carrying out the method for producing a transcription template DNA according to claim 11, comprising at least a vector for inserting a target gene, an in vitro transcription promoter sequence and a translation enhancing sequence, an upstream primer and a downstream side 2 types of sense primers which are divided into primers and the 3 ′ end sequence of the upstream primer overlaps the 5 ′ end sequence of the downstream primer, an antisense primer based on the vector sequence, a PCR reaction buffer, deoxyribonucleoside 3 A transcription template DNA preparation kit comprising a phosphoric acid mixture and a heat-resistant DNA synthase.

Images