JP2005229876A - Bag5 domain polypeptide and its application - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To accurately specify a mouse BAG5 domain to determine its three-dimensional structure to clarify the relationship between its structure and function. <P>SOLUTION: A polypeptide comprising a specific amino acid sequence forming the mouse BAG5 domain is provided. A polynucleotide encoding the polypeptide is provided. A method for producing the polypeptide is provided. A method for screening substances interacting with the polypeptide is also provided. <P>COPYRIGHT: (C)2005,JPO&NCIPI

Description

  The present invention relates to a polypeptide that forms a functional domain of the BAG protein family, a polynucleotide that encodes the same, a method for screening a compound using the same, and the like. More specifically, the present invention relates to a BAG domain polypeptide that is a conserved motif possessed by mouse BAG5 protein and its use.

  Apoptosis is a very important mechanism that occurs in the organism. In the process of development of organisms, many cells die to create complex forms of individuals. Such cell death occurs according to a genetically determined development schedule. Called death. On the other hand, apoptosis also occurs for the purpose of defense against external stress, cancer cells, and infected cells. If this mechanism fails to work properly for some reason, various diseases are caused. Examples of diseases caused by the absence of apoptosis include canceration triggered by DNA damage, and autoimmune diseases caused by incomplete self-reactive lymphocyte removal system. In addition, examples of symptoms that develop due to excessive apoptosis include neurodegenerative diseases caused by excessive apoptosis of nerve cells. In the future, it will be necessary to elucidate the molecular mechanism of apoptosis to elucidate the causes of various diseases caused by apoptosis and to develop therapeutic methods. Moreover, various diseases can be treated by adjusting apoptosis.

  Apoptosis is controlled by various signals generated by various gene products involved in the apoptosis mechanism. Those that stimulate the function of these gene products include both extracellular and intracellular signals. Examples of physiological stimuli that suppress apoptosis include various growth factors, extracellular matrix, CD40 ligand, viral gene products, neutral amino acids, estrogens and androgens. On the other hand, examples of the stimulus that promotes apoptosis include TNF, Fas, TGF-β, neurotransmitter, growth factor removal, loss of extracellular matrix, intracellular calcium, glucocorticoid, and the like. These various stimuli are led to the pathway of cell death through a complex mechanism involving intracellular protein and finally a common mechanism involving activation of a proteolytic enzyme called caspase and fragmentation of DNA.

  The BAG protein family is known as one protein of the signal transduction system involved in such an apoptosis mechanism. BAG1 protein was originally found as one of the Hsp70-binding protein family, and is a protein having a conserved C-terminal region called “BAG domain” (for example, Patent Document 1 and Non-Patent Document 1). (Refer to this report.) Although various studies have been conducted on various functions of the BAG1 protein, cell proliferation and anti-apoptotic activity are mainly mentioned. Hsc70 and Raf1 bind to BAG1 protein while competing, and when Raf1 dissociates from BAG1 and Hsc70 binds, DNA synthesis and cell growth are inhibited. It is thought that the growth pause at the time is being switched. On the other hand, it has been reported that Hsp70 / BAG1 heterocomplex induces conformational change of Bcl-2 and promotes anti-apoptotic activity (see, for example, Non-Patent Document 1).

  Advances in research on the BAG protein family having the BAG domain have revealed that there are six families in the human BAG protein family. A common domain (BAG domain) exists on the C-terminal side (BAG5 protein also exists on the N-terminal side), and binding to Hsc70 has been reported for this domain (for example, Non-patent document 1). Regarding BAG5 protein, not only its physiological function but also the roles of the N-terminal and C-terminal domains are unclear.

  By the way, in order to elucidate the role of the BAG protein family in extremely complicated mechanisms such as apoptosis and cell proliferation and to develop a drug that can regulate the signal transduction system by the BAG protein family, It is necessary to elucidate the three-dimensional structure and find out the binding mode with interacting proteins and compounds that inhibit these bindings. That is, when there is a common domain (BAG domain) as in the BAG protein family, in order to understand the characteristic functions of each protein, the three-dimensional structure of each BAG domain is clarified. It is important to clarify the relationship between these structures and functions.

  However, in order to express a domain suitable for structural analysis, information on the position of the domain boundary is necessary. In general, this domain boundary is predicted based on the homology of the amino acid sequence, but the domain that actually takes the structure (folds) even if the polypeptide is expressed based on the amino acid sequence of the predicted domain region. The probability of formation is very low, and this is one of the obstacles of protein tertiary structure analysis. At present, the BAG domains whose three-dimensional structure has been clarified in the BAG protein family are only BAG1 (PDB ID 116Z) and BAG4 (PDB ID IM62), and the BAG domain of the BAG5 protein is not yet known.

US Patent Application Publication No. 2003/0175958 Takayama and Reed, Nature Cell Biology 3, 237-241 (2001)

  The present invention has been made in the technical background as described above. The three-dimensional structure of the mouse BAG5 domain is accurately specified, the three-dimensional structure of the domain is determined, and the relationship between the structure and function is clarified. For the purpose.

  That is, the present invention provides the following polypeptide that forms a BAG5 domain, a polynucleotide encoding the same, a method for producing the polypeptide, a method for screening a substance that interacts with the polypeptide, and the like.

(1) A polypeptide comprising the amino acid sequence shown in any one of SEQ ID NOs: 2, 4, and 6, or a salt thereof.
(2) A polypeptide or a salt thereof, wherein one to five arbitrary amino acid residues are deleted from the N-terminus of the polypeptide in the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 4.
(3) A polypeptide comprising the amino acid sequence shown in SEQ ID NO: 2, wherein the amino acid sequence region forms a triple helix bundle or a salt thereof.
(4) The amino acid sequence of the polypeptide according to (1), (2) or (3), comprising an amino acid sequence in which one or several amino acids are deleted, substituted, or added, and substantially the same as a mouse BAG5 domain Polypeptides having the same apoptosis-inhibiting function or cell growth-inhibiting function, or salts thereof.
(5) A polynucleotide encoding any one of the polypeptides described in (1) to (4).
(6) The polynucleotide according to (5), comprising the base sequence shown in any one of SEQ ID NOs: 1, 3, and 5.
(7) An expression vector capable of producing the polypeptide according to any one of (1) to (4) in the host cell when introduced into the host cell, wherein the expression vector is the host An expression vector comprising the polynucleotide according to (5) or (6) operably linked to an expression control sequence in a cell.
(8) A transformed cell comprising the expression vector according to (7).
(9) An antibody against the polypeptide according to any one of (1) to (4).
(10) A method for producing the polypeptide or a salt thereof according to any one of (1) to (4), comprising a step of culturing the transformed cell according to (8) and expressing the polypeptide.
(11) The method for producing a polypeptide or a salt thereof according to any one of (1) to (4), wherein a cell-free protein synthesis system is used.
(12) A method for inhibiting cell proliferation, comprising a step of expressing a BAG5 domain in a host cell, wherein the BAG5 domain inhibits proliferation of the cell.
(13) The method according to (12), wherein the BAG domain is the polypeptide according to any one of (1) to (5).
(14) Using the information about the three-dimensional structure of the polypeptide according to any one of (1) to (4), comprising an amino acid sequence having 30% or more homology with the amino acid sequence shown in SEQ ID NO: 2. A method for estimating the three-dimensional structure of a polypeptide with an unknown structure by performing homology modeling of the polypeptide with an unknown structure.
(15) The method according to (14), wherein the polypeptide of unknown structure is a human BAG5 domain.
(16) The method includes a step of determining a ligand binding site of the polypeptide using information on the three-dimensional structure of the BAG5 domain polypeptide, and a step of specifying a compound that interacts with the binding site on a computer. A method for screening a compound that interacts with a BAG5 domain.
(17) The method according to (16), wherein the ligand is Hsc70, Hsp70, Raf1, or a homologue thereof.
(18) The BAG5 domain polypeptide is the polypeptide according to any one of (1) to (4), the human BAG5 domain estimated by the method according to (15), or a part thereof ( The method according to 16) or (17).
(19) A compound identified by the method according to (16), (17) or (18) is prepared as a candidate compound, and the polypeptide according to any one of (1) to (4) and the candidate A method for screening a compound that interacts with a BAG5 domain, comprising a step of contacting a compound and a step of confirming whether the polypeptide interacts with a candidate compound.
(20) A method for screening a compound that modulates apoptosis activity, wherein the method comprises preparing a compound identified by the method according to (16), (17) or (18) as a candidate compound, (1 ) To (4) the step of contacting the polypeptide with Hsc70 and the candidate compound, and whether or not the candidate compound inhibits the binding between the polypeptide and Hsc70. And a detecting method, wherein a substance that inhibits the binding between the polypeptide and Hsc70 regulates apoptosis activity.
(21) A method for screening for a compound that modulates cell proliferation activity, wherein the method comprises the transformation according to (8) in the presence or absence of a candidate compound under conditions suitable for the measurement of the cell proliferation activity. A method comprising culturing cells and measuring the proliferation activity of the transformed cells.
(22) The method according to (21), wherein the candidate compound is a compound obtained by the method according to any one of (16) to (19).

  The present invention is the first to clarify the structure of the mouse BAG5 domain. In particular, by determining the three-dimensional structure of the BAG5 domain, the relationship between the domain structure and the function is clarified, and the intracellular signal transduction function by the BAG5 protein. Will contribute to the development of drugs and the like (for example, development by rational drug design and virtual screening). In addition, the compound that interacts with the BAG5 domain obtained by the screening method of the present invention is used for the prevention and treatment of various diseases as a drug that regulates the apoptosis activity of cells and a growth inhibitor of cancer cells.

(Polypeptide of the present invention)
The polypeptide of the present invention is a polypeptide that forms a domain having a three-dimensional structure. More specifically, the present invention relates to the polypeptide described in any one of SEQ ID NOs: 2, 4, and 6, or any amino acid of 1 to 5 from the N-terminus of the amino acid sequence shown in SEQ ID NO: 4. It relates to polypeptides in which residues have been deleted (these may be referred to as “mouse BAG5 domain polypeptides”). The present invention also provides a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 2, wherein the amino acid sequence region forms a triple helix bundle, and each of the above polypeptides, It consists of an amino acid sequence in which one or several (1 to 9, preferably 1 to 5, more preferably 1 to 2) amino acids have been deleted, substituted or added, and is substantially identical to the mouse BAG5 domain. The present invention relates to a polypeptide having an apoptosis inhibitory function or a cell growth inhibitory function. In the present specification, the above polypeptides are collectively referred to as “polypeptides of the present invention”.
Hereinafter, the structure and function of the polypeptide of the present invention will be described.

  In the present invention, the “BAG domain” refers to a polypeptide consisting of about 80 to 100 amino acid residues having a high homology existing in common with BAG proteins. BAG proteins are well conserved in eukaryotes and have homology in vertebrates, insects, nematodes, yeasts and plants. The human BAG protein family includes BAG1, BAG2, BAG3 (Bis), BAG4 (SODD), BAG5 and BAG6. The BAG protein has various N-terminal regions, but contains a common domain (BAG domain) on the C-terminal side, and these BAG domains bind to the ATPase domain of Hsp70 / Hsc70 to regulate the action of these molecular chaperones. doing. These conserved BAG domains are required for binding to Hsp70 / Hsc70, but their size varies considerably depending on the BAG protein family, for example that of BAG4 protein is considerably smaller than that of BAG1 protein. It has been reported.

  In the present invention, the “triple helix bundle” is a three-dimensional structure in which three α-helices are bundled antiparallel and connected via two loops. FIG. 1 (a) schematically shows a three-dimensional structure of a mouse BAG5 domain main chain revealed by the present invention by a ribbon diagram. The three helices are not all the same length, and the length of the second helix is particularly short on the C-terminal side and is connected to the third helix by an extended loop. In this region, residues important for protein-protein interaction are conserved, and it is a structure commonly found in the BAG domain. However, the length of amino acid residues constituting each helix differs depending on each BAG protein, and the polypeptide of the present invention has a C-terminal side of the first helix and an N-terminal side of the second helix as compared to the mouse BAG1 domain. It is getting shorter. In addition, it is considered that the structure of the binding site with a ligand such as Hsc70 differs depending on the type of amino acid residue in the side chain constituting each BAG domain.

  In addition, examples of the function of the polypeptide of the present invention include an apoptosis suppressing function and a cell growth inhibiting function. The conserved C-terminal region (BAG domain) of the BAG protein family is known to bind to the ATPase domain of Hsc70 / Hsp70 and regulate its chaperone activity. Other domains of the BAG protein are involved in interactions with other proteins. For example, BAG1 interacts with Bcl2 and retinoic acid receptor, and interacts with Hsc70 / Hsp70 to induce conformational changes and regulate functions. On the other hand, BAG4 protein is presumed to cause Hsc70 to interact with tumor necrosis factor receptor 1 and death receptor 3. Therefore, it is suggested that various types of intracellular signal transduction functions are performed depending on the type of BAG protein.

  As shown in the Examples of the present specification, since the polypeptide of the present invention also suppresses apoptosis when expressed in cells, it is understood that it has an apoptosis regulating function like the BAG1 protein. Further, as a result of examining how the cell proliferation activity is affected by expressing the BAG5 domain in various cells, it was found that the cell proliferation function was significantly suppressed. Therefore, since the polypeptide of the present invention has an apoptosis-regulating function and a cell growth-inhibiting function, it plays an important role in regulating intracellular signal transduction mechanisms, and at least for screening for drugs that regulate these functions. It can be effectively used as an anticancer agent that inhibits the use of the above, optimization of drugs using the three-dimensional structure information, and induction of cell differentiation and cell proliferation function.

(Sequence of the polypeptide of the present invention)
Regarding the sequencing of the polypeptide of the present invention, after i) estimating a domain region having a target function based on known protein sequence information, ii) domain candidates having the amino acid sequence of the estimated domain region as a basic pattern A sequence pattern is prepared, iii) polypeptide expression is performed for each sequence pattern, and the structural stability of the polypeptide forming the obtained domain is evaluated as a target domain. Each polypeptide is defined by its amino acid sequence. That is, the polypeptide of the present invention is empirically selected to have a stable structure when expressed as a polypeptide that forms a domain by fragmenting a part of the full-length protein (having the desired function). In the domain region prediction stage, domain candidates existing in the order of several hundreds are narrowed down by various factors and actually selected carefully from the order of 10 to several tens. Therefore, by using the thus selected polypeptide for the three-dimensional structure analysis, it is possible to perform a highly accurate and reliable structural analysis.

(Domain region estimation)
As a method for estimating the domain region in the full-length protein, there are information science methods such as bioinformatics and computational science methods (see Japanese Patent Application No. 2001-309434), a combination of deleted DNA library and GFP (See JP-A-2002-262873), experimental methods such as limited degradation with protease are all available and are not particularly limited. By using a more accurate method, domain candidates can be used. The work efficiency of selecting the target domain from the group is improved.

(Creation of domain candidate sequence pattern)
The domain candidate sequence pattern is created by extending or shrinking the position of the domain boundary to the N-terminal side or the C-terminal side with reference to the domain region estimated as described above.

  For example, approximately several tens of residues are extended to the N-terminal side by several tens of residues from the position of the amino acid residue at the domain boundary on the N-terminal side of the putative domain region, or about several tens of residues are shortened to the C-terminal side. Dozens of types of boundaries are newly provided, and domain candidate sequence patterns having these boundaries as N-terminals are prepared. Similarly, several types of domain boundaries are selected at the domain boundary on the C-terminal side of the estimated domain region, and domain candidate sequence patterns having each boundary as the C-terminal are created.

(Stretching domain boundaries)
Examples of the method of expanding and contracting the domain boundary of the putative domain region include a method of individually synthesizing PCR primers capable of generating cDNA corresponding to the domain candidate sequence pattern and generating the PCR by PCR. The two-step PCR method disclosed in the 9880 publication is preferred.

(Extraction of target domain from domain candidate sequence pattern)
In order to select a target domain having an actually stable three-dimensional structure from such a domain candidate sequence pattern, first, protein synthesis is performed using the cDNA of the domain candidate sequence pattern prepared as described above.

  The expression system of this domain candidate sequence pattern is not particularly limited, and any conventionally known expression system can be used.

  Next, it is determined whether or not the obtained polypeptide actually has a stable three-dimensional structure, and a polypeptide that has been confirmed to have a three-dimensional structure is adopted as the polypeptide in the present invention.

  As an indicator of the stability of the three-dimensional structure of the polypeptide, for example, whether the synthesized domain polypeptide is detected as a soluble polypeptide by SDS gel electrophoresis or the like and is detected as a uniform band corresponding to an appropriate molecular weight. Examples include biochemical indicators, spectroscopic techniques such as fluorescence intensity of GFP fused to the C-terminal side, NMR spectrum, and CD spectrum.

  In the process of sequencing conventional polypeptides, for example, [1] In the above polypeptide synthesis, the polypeptide forming the target domain is not expressed, or [2] is expressed, but causes aggregation and low solubility. There was a problem such as. The present inventors have overcome such problems and have completed the present invention.

(Confirmation of having a stable three-dimensional structure)
The determination of the folding of the polypeptide forming the domain in the NMR spectrum is shown below.

  In the 1D spectrum, when the polypeptide forming the domain is not folded, a signal derived from methyl group protons such as Val, Leu, and Ile is observed around 0.8 ppm. However, when it is folded, the environment of the methyl group proton changes, and the signal shifts to the high magnetic field side (from 0.7 ppm to around -0.5 ppm).

The determination in ¹ H- ¹⁵ NHSQC includes visual evaluation of the degree of convergence of the cross peak and the uniformity of the signal intensity. That is, when the cross peaks are dense, the three-dimensional structure is not formed, and when the cross peaks are dispersed, the three-dimensional structure is evaluated as a stable three-dimensional structure.

(Polynucleotide of the present invention)
The present invention also relates to a polynucleotide encoding the polypeptide of the present invention. “Polynucleotide” generally refers to both polyribonucleotides or polydeoxyribonucleotides, which may be modified. Examples thereof include DNA, cDNA, genomic DNA, mRNA, unprocessed RNA and fragments thereof, and their length is not particularly limited. The “polynucleotide encoding the polypeptide of the present invention” can be selected from any base sequence based on the degeneracy of the genetic code as long as it can encode the polypeptide of the present invention. It may be double-stranded or single-stranded. DNA / RNA hybrids are also included. Once the base sequence of the polynucleotide is determined, this polynucleotide can be obtained by chemical synthesis thereafter. These polynucleotides are chemically synthesized by various methods known to those skilled in the art. Alternatively, a polynucleotide derived from a specific gene can be obtained by PCR using the 5 'and 3' terminal nucleotide sequences of the gene from which the polynucleotide is derived as primers and using all or part of cDNA or genomic DNA as a template. .

(vector)
The (recombinant) vector of the present invention can be obtained by ligating (inserting) the gene of the present invention into an appropriate vector. The vector for inserting the gene of the present invention is not particularly limited as long as it can be replicated in a host, and examples thereof include plasmid DNA and phage DNA.

  Plasmid DNA includes plasmids derived from E. coli (eg, pRSET, pBR322, pBR325, pUC118, pUC119, pUC18, pUC19, etc.), plasmids derived from Bacillus subtilis (eg, pUB110, pTP5, etc.), yeast-derived plasmids (eg, YEp13, YEp24, YCp50, etc.), and examples of phage DNA include λ phage (Charon 4A, Charon 21A, EMBL3, EMBL4, λgt10, λgt11, λZAP, etc.). Furthermore, animal viruses such as retrovirus or vaccinia virus, and insect virus vectors such as baculovirus can also be used.

  In order to insert the gene of the present invention into a vector, first, the purified DNA is cleaved with a suitable restriction enzyme, inserted into a restriction enzyme site or a multicloning site of a suitable vector DNA, and linked to the vector. Adopted.

  The gene of the present invention needs to be incorporated into a vector so that the function of the gene is exhibited. Therefore, the vector of the present invention contains, in addition to a promoter, the gene of the present invention, a cis element such as an enhancer, a splicing signal, a poly A addition signal, a selection marker, a ribosome binding sequence (SD sequence) and the like as desired. Can be linked. Examples of the selection marker include dihydrofolate reductase gene, ampicillin resistance gene, neomycin resistance gene and the like.

(Transformed cells)
The transformed cell of the present invention can be obtained by introducing the polynucleotide of the present invention into a host so that the target gene can be expressed. In many cases, transformation is performed using a vector because it is simple and efficient. Here, the host is not particularly limited as long as it can express the DNA of the present invention. For example, Escherichia such as Escherichia coli, Bacillus subtilis such as Bacillus subtilis, Pseudomonas putida such as Pseudomonas putida, Rhizobium meliloti and Rhizobium meliloti The bacteria to which it belongs. Examples thereof include yeasts such as Saccharomyces cerevisiae and Schizosaccharomyces pombe, and animal cells such as COS cells and CHO cells. Alternatively, insect cells such as Sf9 and Sf21 can also be used.

  When a bacterium such as Escherichia coli is used as a host, the recombinant vector introduced with the polynucleotide of the present invention can autonomously replicate in the bacterium, and at the same time, a promoter, a ribosome binding sequence, a gene of the present invention, a transcription termination sequence. It is preferable to be configured. Moreover, the gene which controls a promoter may be contained.

Examples of Escherichia coli include Escherichia coli K12 and DH1, and examples of Bacillus subtilis include Bacillus subtilis. Any promoter may be used as long as it can be expressed in a host such as Escherichia coli. For example trp promoter, lac promoter, P _L promoter, and P _R promoter may be used from Escherichia coli or phage. An artificially designed and modified promoter such as a tac promoter may be used. The method for introducing a recombinant vector into bacteria is not particularly limited as long as it is a method for introducing DNA into bacteria. Examples thereof include a method using calcium ions (Cohen, SN et al. (1972) Proc. Natl. Acad. Sci., USA 69, 2110-2114), electroporation method and the like.

  When yeast is used as a host, for example, Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pichia pastoris and the like are used. In this case, the promoter is not particularly limited as long as it can be expressed in yeast. For example, gal1 promoter, gal10 promoter, heat shock protein promoter, MFα1 promoter, PHO5 promoter, PGK promoter, GAP promoter, ADH promoter, AOX1 promoter, etc. Is mentioned. The method for introducing the recombinant vector into yeast is not particularly limited as long as it is a method for introducing DNA into yeast. For example, the electroporation method (Becker, DM et al. (1990) Methods. Enzymol., 194, 182-187 ), Spheroplast method (Hinnen, A. et al. (1978) Proc. Natl. Acad. Sci., USA 75, 1929-1933), lithium acetate method (Itoh, H. (1983) J. Bacteriol. 153,163 -168).

  When animal cells are used as hosts, monkey cells COS-7, Vero, Chinese hamster ovary cells (CHO cells), mouse L cells, rat GH3, human FL cells and the like are used. As the promoter, SRα promoter, SV40 promoter, LTR promoter, CMV promoter and the like may be used, and human cytomegalovirus early gene promoter and the like may be used. Examples of methods for introducing a recombinant vector into animal cells include an electroporation method, a calcium phosphate method, and a lipofection method.

  When insect cells are used as hosts, Sf9 cells, Sf21 cells and the like are used. As a method for introducing a recombinant vector into insect cells, for example, calcium phosphate method, lipofection method, electroporation method and the like are used.

(antibody)
An antibody against the antigen can be prepared using the protein of the present invention as an antigen.
[Preparation of polyclonal antibody against the polypeptide of the present invention]
Animals are immunized with the antigens described above. In the case of rabbits, the dose of antigen per animal is, for example, 100 to 500 μg using an adjuvant. Examples of adjuvants include Freund's complete adjuvant (FCA), Freund's incomplete adjuvant (FIA), and aluminum hydroxide adjuvant.

  Immunization is performed by administering to mammals (for example, non-human mammals such as rats, mice and rabbits). The site of administration is intravenous, subcutaneous or intraperitoneal. Further, the immunization interval is not particularly limited, and immunization is performed 1 to 10 times, preferably 2 to 3 times at intervals of several days to several weeks, preferably at intervals of 2-3 weeks. Then, the antibody titer is measured 6 to 60 days after the final immunization day, and blood is collected on the day when the maximum antibody titer is shown to obtain antiserum. The antibody titer can be measured by enzyme immunoassay (ELISA), radioimmunoassay (RIA), or the like.

When purification of antibody from antiserum is required, it should be purified by selecting a known method such as ammonium sulfate salting-out method, ion exchange chromatography, gel filtration, affinity chromatography, or a combination thereof. Can do.
[Production of monoclonal antibodies against proteins]
Animals are immunized with the antigen. If necessary, in order to effectively immunize, an adjuvant (commercially available Freund's complete adjuvant, Freund's incomplete adjuvant, etc.) may be mixed as described above.

  Immunization is performed by administering to a mammal (eg, rat, mouse, rabbit, etc.). One dose of antigen is 50 μg per mouse in the case of mice. The administration site is mainly intravenous, subcutaneous and intraperitoneal. The interval between immunizations is not particularly limited, and is performed at least 2 to 3 times at intervals of several days to several weeks, preferably 2 to 3 weeks. Then, antibody-producing cells are collected after the final immunization. Examples of antibody-producing cells include spleen cells, lymph node cells, and peripheral blood cells, with spleen cells being preferred.

[Cell fusion]
In order to obtain a hybridoma, cell fusion between antibody-producing cells and myeloma cells is performed. As myeloma cells to be fused with antibody-producing cells, cell lines derived from animals such as mice and generally available can be used. As a cell line to be used, it has drug selectivity and cannot survive in a HAT selection medium (including hypoxanthine, aminopterin and thymidine) in an unfused state, but can survive only in a state fused with antibody-producing cells. What has is preferable. For example, specific examples of myeloma cells include P3X63-Ag. 8). Examples include mouse myeloma cell lines such as U1 (P3U1), P3 / NSI / 1-Ag4-1, Sp2 / 0-Ag14. Next, the myeloma cell and the antibody-producing cell are fused. In cell fusion, antibody-producing cells and myeloma cells are mixed at a ratio of 15: 1 to 25: 1 in animal cell culture media such as serum-free DMEM and RPMI-1640 media, and cells such as polyethylene glycol are used. The fusion reaction is performed in the presence of a fusion promoter or by electric pulse treatment (for example, electroporation).

[Selection and cloning of hybridomas]
The target hybridoma is selected from the cells after cell fusion treatment. For example, cells can be cultured using a medium containing hypoxanthine, aminopterin and thymidine, and the growing cells can be obtained as hybridomas. Next, it is screened whether the target antibody exists in the culture supernatant of the grown hybridoma. Hybridoma screening is not particularly limited, and may be performed according to ordinary methods. For example, a part of the culture supernatant contained in a well grown as a hybridoma can be collected and screened by enzyme-linked immunosorbent assay (ELISA), RIA (radioimmuno assay), or the like. Cloning of the fused cells is performed by a limiting dilution method or the like, and finally a hybridoma that is a monoclonal antibody-producing cell is established.

[Collecting monoclonal antibodies]
As a method for collecting a monoclonal antibody from the established hybridoma, a normal cell culture method or the like can be employed. In the cell culture method, the hybridoma is cultured in an animal cell culture medium such as RPMI-1640 medium or MEM medium containing 10% fetal bovine serum under normal culture conditions (for example, 37 ° C., 5% CO ₂ concentration) for 3 to 10 days. Then, an antibody is obtained from the culture supernatant. In the above antibody collection method, when purification of the antibody is required, a known method such as ammonium sulfate fractionation, ion exchange chromatography, affinity chromatography, gel chromatography or the like is appropriately selected, or these It can be purified by a combination of methods.

(Production of polypeptide of the present invention)
The polypeptide of the present invention can be obtained, for example, by culturing a transformant and collecting it from the culture. “Culture” means any of cultured cells, cultured cells, or disrupted cells or cells in addition to the culture supernatant. The “method for culturing the transformant of the present invention” is carried out according to a usual method applied to host culture.

  As a medium for culturing transformants obtained using microorganisms such as Escherichia coli and yeast as a host, the medium contains a carbon source, nitrogen source, inorganic salts, etc. that can be assimilated by the microorganisms. As long as the medium can be used, either a natural medium or a synthetic medium may be used. As the carbon source, carbohydrates such as glucose, fructose, sucrose and starch, organic acids such as acetic acid and propionic acid, and alcohols such as ethanol and propanol are used. As the nitrogen source, ammonium salts of inorganic acids or organic acids such as ammonia, ammonium chloride, ammonium sulfate, ammonium acetate and ammonium phosphate, or other nitrogen-containing compounds, peptone, meat extract, corn steep liquor and the like are used. As the inorganic substance, monopotassium phosphate, dipotassium phosphate, magnesium phosphate, magnesium sulfate, sodium chloride, ferrous sulfate, manganese sulfate, copper sulfate, calcium carbonate and the like are used.

  The culture is preferably performed at 37 ° C. for 6 to 24 hours under aerobic conditions such as shaking culture or aeration and agitation culture. During the culture period, the pH is maintained at 7.0 to 7.5. The pH is preferably adjusted using an inorganic or organic acid, an alkaline solution, or the like. During culture, an antibiotic such as ampicillin or tetracycline may be added to the medium as necessary.

  When culturing a microorganism transformed with an expression vector using an inducible promoter as a promoter, an inducer may be added to the medium as necessary. For example, when cultivating a microorganism transformed with an expression vector using the Lac promoter, a microorganism transformed with isopropyl-β-D-thiogalactopyranoside (IPTG) or the like with an expression vector using the trp promoter is cultured. Sometimes indoleacrylic acid (IAA) or the like may be added to the medium.

As a medium for cultivating a transformant obtained using animal cells as a host, a generally used RPMI 1640 medium, DMEM medium, a medium obtained by adding fetal calf serum or the like to these mediums, or the like is used. The culture is usually performed at 37 ° C. for 1 to 30 days in the presence of 5% CO ₂ . During culture, antibiotics such as kanamycin and penicillin may be added to the medium as necessary.

  When the polypeptide is produced in the microbial cells or cells after culturing, the polypeptide is extracted by disrupting the microbial cells or cells. When the polypeptide of the present invention is produced outside the cells or cells, the culture solution is used as it is, or the cells or cells are removed by centrifugation or the like. Thereafter, by using a general biochemical method used for isolation and purification of the polypeptide, such as ammonium sulfate precipitation, gel chromatography, ion exchange chromatography, affinity chromatography, etc. alone or in appropriate combination, the culture The protein of the present invention can be isolated and purified from the inside. During or after this purification step, the tag sequence used for purification can be removed by protease treatment.

(Method for producing the polypeptide of the present invention using a cell-free protein synthesis system)
In a preferred embodiment, the polypeptides of the present invention can be produced using a cell-free protein synthesis system. The cell-free protein synthesis system is a system that synthesizes a protein in a test tube using a cell extract. The “cell-free protein synthesis system” includes both a cell-free translation system that reads mRNA information and synthesizes proteins on ribosomes, and a cell-free transcription system and cell-free translation system that synthesize RNA using DNA as a template. The cell-free protein synthesis system has the advantage that it is easy to construct an expression system suitable for the target protein because the system can be easily modified. Details of the cell-free protein synthesis system are described in Japanese Patent Publication No. 2000-175695.

[Cell extract]
The crude cell extract has high protein synthesis activity such as bacteria (eg, E. coli), fungi (eg, budding yeast), wheat germ, rabbit reticulocyte, mouse L-cell, Ehrlich ascites tumor cell, HeLa cell, CHO cell, etc. Extracts from eukaryotic and prokaryotic cells in the same state (Clemens, MJ, Transcription and translation-apractical approach, (1984), pp.231-270, Henes, BD and Higgins, SJ, IRLPress, Oxford) .

  The crude cell extract preferably contains components necessary for protein synthesis such as ribosome and tRNA. For the preparation of the crude extract, for example, the method described in Pratt, J.M., et al., Transcription and translation-apractical approach, (1984), pp.179-209, Henes, B.D. and Higgins, S.J., IRLPress, Oxford can be used. Specifically, it can be performed by crushing with French press (Pratt et al., Supra) or crushing using glass beads. A preferred cell extract is the E. coli S30 cell extract. The S30 cell extract can be prepared from E. coli BL21 Codon Plus strain according to a known method, for example, the method of Pratt et al. (Supra), or commercially available from Promega or Novagen. As the cell extract, those derived from Escherichia coli, wheat embryo, rabbit reticulocyte are mainly used.

[Dialyzer]
It is possible to use a dialysis apparatus that can shake or stir and contains the internal liquid and the external liquid separately through a dialysis membrane. Examples of the small-scale reaction apparatus include Dispo Dialyzer (registered trademark) (manufactured by Spectrum) and Slidealyzer (registered trademark) (manufactured by Pierce). An example of a large-scale reaction apparatus is a Spectra / Por (registered trademark) dialysis tube (manufactured by Spectrum).

[Dialysis fluid]
In the cell-free protein synthesis system, the dialysis internal solution (that is, protein synthesis reaction solution) includes DNA or RNA (such as mRNA) encoding target protein, ATP (adenosine 5), in addition to concentrated cell extracts such as E. coli S30. '-Triphosphate), GTP (guanosine 5'-triphosphate), CTP (cytidine 5'-triphosphate), UTP (uridine 5'-triphosphate), buffer, salts, amino acids, RNase inhibition Agents, antibacterial agents, RNA polymerase (when DNA is used as a template) and tRNA, if necessary.
In addition, a combination of phosphoenolpyruvate and pyruvate kinase or a combination of creatine phosphate and creatine kinase as an ATP regeneration system, polyethylene glycol (eg, # 8000), 3 ′, 5′-cAMP, folic acid, RNase inhibitor , Reducing agents (eg, dithiothreitol), and the like. On the other hand, the dialysis external solution (that is, the protein synthesis substrate solution) can be obtained by removing the cell extract, RNase inhibitor, DNA or RNA, and RNA polymerase from the dialysis internal solution composition. For example, a buffer solution, ATP, GTP, CTP, UTP, salts, amino acids, antibacterial agents and the like can be included. The concentration of the additive component can be arbitrarily selected.

[Buffer]
As the buffer, for example, a buffer such as Hepes-KOH or Tris-OAc can be used. Examples of salts are acetates (for example, ammonium salts, magnesium salts, etc.), glutamates, etc., and examples of antibacterial agents are sodium azide, ampicillin, and the like. Amino acids are the 20 amino acids that make up proteins. Further, when DNA is used as a template, RNA polymerase is added to the reaction system. For example, a commercially available enzyme such as T7 RNA polymerase can be used.

  Shaking or stirring (rotating stirring, etc.) a closed system that allows the substance to move through the membrane according to the molecular weight limit of the membrane, with the above dialysate inside the dialysis membrane and outside dialysis outside And the produced target protein can be recovered from the dialysis internal solution or the external solution. Arbitrary conditions can be used for reaction conditions, such as temperature and stirring speed, according to the kind of protein. In the case of protein synthesis, the temperature is usually about 25 to about 50 ° C., preferably 37 ° C., but may be higher than 50 ° C. in a cell-free protein synthesis system using a cell extract derived from highly thermophilic bacteria.

The shaking speed or stirring speed can be low, for example, 100 to 200 rpm. While monitoring the production of the target protein, the reaction time can be appropriately selected.
It is preferable to replace the dialysis outer solution of the cell-free protein synthesis system with a fresh one when the reaction rate is lowered. In addition, when the molecular weight limit of the dialysis membrane exceeds 10,000 daltons, preferably about 50,000 daltons or more, the protein production can be further increased.

[Polypeptide purification]
Purification of the resulting polypeptide can be performed relatively easily because the amount and type of contaminants that are present are much smaller than those isolated from living cells. As the purification method, conventionally known methods can be used alone or in appropriate combination depending on the properties of the protein. Examples thereof include conventional techniques such as ammonium sulfate or acetone precipitation, acid extraction, anion or cation exchange chromatography, hydrophobic interaction chromatography, affinity chromatography, gel filtration chromatography, HPLC, electrophoresis, and chromatofocusing. During or after this purification step, the tag sequence used for purification can be removed by protease treatment. Identification and quantification of the produced protein can be carried out by comparing with a standard sample as required by activity measurement, immunological measurement, spectroscopic measurement, amino acid analysis, and the like.

(3D structure analysis)
The three-dimensional structure of a polypeptide can be analyzed by structural analysis by NMR, X-ray structural analysis, or the like.

(NMR)
The sample used for NMR is not particularly limited, but preferably a sample obtained by stably isotopic labeling ¹² C or ¹⁴ N in a polypeptide with ¹³ C or ¹⁵ N nuclei (multinuclear multidimensional NMR). Measurement). Techniques for labeling proteins with stable isotopes are conventional techniques and are described, for example, in documents such as Clore, GM & Gronenborn, AM, Science, 252, p. 1390-1399, 1991. In particular, analysis using a protein sample labeled with a main chain ¹⁵ N homogeneous stable isotope is easy and preferable. Alternatively, a protein backbone skeleton labeled with at least two kinds of isotopes among ¹³ C, ¹⁵ N and ² H may be used (Special Table 2001-514239).

Preferably, the ¹⁵ N- ¹ H spin coupling constant is measured by observing an IPAP-HSQC spectrum or the like. “IPAP-HSQC spectrum” means that two HSQC spectra of quasi-phase and anti-phase are observed at the same time, and the spectrum of both is added to prevent signal overlap, and effectively ¹⁵ N- ¹ This is a measurement method for reading the H spin coupling constant.

Chemical shift assignments are made by two or more NMR methods. For example, 2D NMR includes 2D, DOQ-COSY, TOCSY, NOESY, HSQC, etc., and multidimensional NMR includes HNCO, HCACO, HNCA, HCA (CO) N, HN (CO) CA, HNHB, CBCANH, H ( CA) NH, HBHA (CO) NH, HCCH-COSY, HCANH, HCCH-TOCSY, HCACON, 15 N-NOESY-HSQC, 13 , etc. C-NOESY-HSQC is known as prior art. General methods of NMR are well known, for example, “NMR of proteins” (Kyoritsu Shuppan, 1996, Yoji Arata); “Basic Biochemical Experiments, Volume 3, Protein I. Detection and Structural Analysis” edited by the Japanese Biochemical Society Chapter 18: Three-dimensional structure analysis by NMR (Tokyo Kagaku Doujin, February 2001); Takashi Ito et al., Journal of Agricultural Chemical Society of Japan 21, p.450-459, 1996; Toshiyuki Tanaka, Chemistry and Industry Vol. 49, No. 2, p. 155-158, 1996 and the like.

When NMR is used for the three-dimensional structure analysis, a method is generally used in which the distance between each proton is estimated from the magnitude of the nuclear overhauser effect between the protons of the polypeptide, and the three-dimensional structure is determined based on the distance information. It is also possible to refine the steric structure by adding information such as chemical shift values, scalar coupling values, residual dipole coupling values, and hydrogen bonds.
Many programs for performing structural analysis from NMR data are well known. Preferably, structural analysis is performed using NMR Pipe, PIPP, Capp, Felix, NMR View, XEASY, and three-dimensional structure calculation software such as X-PLOR, CNS, DYANA, and DYNAMO as chemical shift assignments.

(X-ray crystal structure analysis)
When X-ray crystal structure analysis is used for the three-dimensional structure analysis, an electron density diagram is calculated based on an X-ray diffraction image of the crystallized protein to determine the three-dimensional structure. That is, the protein is crystallized, the monochromatic X-ray is applied to the crystal, and the three-dimensional structure of the protein is clarified based on the obtained X-ray diffraction image (Blundell, TL). And Johnson, LN, PROTEIN CRYSTALLOGRAPHY, 1-565, (1976) Academic Press, New York).

(3D structure prediction by homology modeling)
In general, it is considered that the three-dimensional structure of a protein is more evolutionarily conserved than the primary structure (amino acid sequence). If the homology of the amino acid sequences of two proteins is 30% or more, the three-dimensional structures are likely to be similar. Therefore, the three-dimensional structure of polypeptides having similar amino acid sequences can be predicted using the three-dimensional structure information of the polypeptide of the present invention. “Homology” means the percent similarity between two polypeptide parts. Percent sequence identity is determined by aligning the sequences, counting the exact number of matches between the two aligned sequences, dividing by the length of the shorter sequence and multiplying the result by 100, The sequence information between two molecules can be determined by direct comparison. Computer programs for supporting such analysis are readily available, and examples include ALIGN (Dayhoff, MO et al), FASTA, BLAST, and the like. For example, the amino acid sequence of the polypeptide of the present invention and the polypeptide of unknown structure such as human BAG3 and BAG5 domains are aligned, and all atoms of the polypeptide of unknown structure are modeled using the polypeptide of the present invention as a template structure. The template structure is used as much as possible for the coordinates of the main chain atoms, and a new main chain structure of the inserted sequence is created. Subsequently, the three-dimensional structure of a polypeptide whose structure is unknown can be estimated by performing molecular modeling of side chain atoms.

(Screening method based on 3D structure information)
Next, the present invention uses the information relating to the three-dimensional structure of the polypeptide of the present invention to determine a binding site with the ligand of the polypeptide and to search for a compound that interacts with the binding site on a computer. And a method for screening for a compound that interacts with a BAG5 domain polypeptide.

  Examples of the ligand of the polypeptide of the present invention include the Hsp70 family involved in protein folding reactions as so-called molecular chaperones. The Hsp70 family constitutively present in the mammalian cytoplasm is Hsc70 (heat shock cognate protein 70, heat shock-related protein 70) (Hsc73). On the other hand, inductive Hsp70 (Hsp72) also exists in some tissues, organs, cultured cells and the like. There are members in each compartment (cytoplasm, endoplasmic reticulum, mitochondria) in the cell. Each of these members may be referred to as a homolog (homologue). The Hsp70 family plays a role in binding to and shielding the hydrophobic regions of unstable proteins so that they do not aggregate with each other. The Hsp70 family has ATPase activity, and promotes the formation of the original three-dimensional structure while repeatedly binding and dissociating with a target protein in a cochaperone-dependent manner such as Hsp40. It is involved in aspects such as protein folding, protein transport to organelles, complex association, dissociation, denatured protein repair, and degradation. In addition, it interacts with Raf1, Bcl2, and the like to regulate signal transduction systems such as cell proliferation and apoptosis.

(In silico screening)
There are many reviews on drug design based on the three-dimensional structure of molecules, so-called molecular simulation, including drug development / Volume 7 “Molecular Design” (Yodogawa Shoten). Specifically, first, a ligand binding site of a target protein or polypeptide is discovered. Since the shape of the ligand generally tends to be three-dimensionally complementary to the shape of the ligand binding site of the protein, search for a site with a geometrical feature (groove, recess) where the ligand binds. Is effective for finding candidate ligand binding sites. Alternatively, it can be inferred from homology with a similar protein whose structure has been determined as a complex with a ligand. Various programs for comparing the three-dimensional structures of proteins are known (for example, FSSP, http://www2.ebi.ac.uk/dali/fssp/, DALI, http://www2.ebi.ac. uk / dali /, MATRAS, http://spock.genes.nig.ac.jp/~takawaba/Matras.html, etc.).

  Next, using a flexible ligand docking simulation software such as GOLD or FlexX, a library of low-molecular compounds (molecular weight of 500 or less) stored in a relational database such as Oracle (for example, about 1000000 species) is screened with a computer. The chemical substances in this library can be created by creating a three-dimensional structure using a program such as CORINA and selecting substances that can be inserted into the binding sites. From the selected substances, use a molecular simulation program such as Sybyl or MOE to analyze the binding state in more detail and narrow down the compounds. The computer software used in the process is as follows (GOLD: Cambridge Crystallographic Data Centre; FlexX: Tripos Inc .; CORINA: Molecular Networks GmbH; Oracle: Oracle Corp .; Sybyl: Tripos Inc. MOE: Chemical Computing Group Inc.).

  Another method is computer design of candidate compounds including unknown substances. In this method, there are known a method of arranging chemical groups such as methyl and ethyl in the ligand binding site to search for a suitable one, and a method of arranging atoms in the ligand binding site using a computer program.

(Wet screening)
In order to select a potential candidate for a candidate compound that interacts with the polypeptide of the present invention, the candidate compound obtained by in silico screening is brought into contact with the polypeptide of the present invention, and the molecular function or physiological activity of the polypeptide of the present invention is brought into contact. taking measurement. The candidate compound is modified based on the three-dimensional structure data of the candidate compound and the polypeptide of the present invention to obtain a more desirable structure.

  The narrowed compound is synthesized, actually reacted with the polypeptide, and screened. The compound in which the activity of the polypeptide is changed is further tested for in vivo activity, pharmacokinetics, toxicity and the like by animal experiments.

(In vitro screening method)
The in vitro screening method includes contacting the polypeptide of the present invention or a salt thereof with a candidate substance, and confirming whether the polypeptide and the candidate substance interact with each other, Examples thereof include screening methods for compounds having an interaction. Here, “having an interaction” means that a compound and a polypeptide bind to each other and suppress or enhance the molecular function and / or physiological activity of the polypeptide. In this screening method, the polypeptide and a candidate substance are brought into contact with each other, and whether or not the molecular function or physiological activity of the polypeptide is changed is measured.

  For example, specific methods include searching for interacting substances using NMR, pull-down analysis and affinity chromatography for examining binding to ligands immobilized on beads, etc., and surface plasmon resonance (SPR). ) To analyze the interaction in real time.

When NMR is used for searching for an interacting substance, the presence or absence of an interaction can be determined based on the presence or absence of a change in protein signal before and after the addition of the candidate substance. That is, when an interaction candidate substance interacts with a protein, changes in the chemical shift value, line width, number, etc. of the NMR signal originating from the vicinity of the protein interaction site are expected. By detecting this, the presence or absence of interaction can be determined. In particular, a protein labeled with ¹⁵ N is relatively easy to prepare, and the ¹⁵ N-HSQC spectrum obtained therefrom is relatively high in resolution and sensitivity and is not easily influenced by the NMR signal derived from the added interaction candidate substance. Therefore, its usefulness is high.

  BIACORE (registered trademark) is a device that uses SPR as a measurement principle and can monitor the interaction between biomolecules in real time without labeling. In order to screen for a molecule that interacts with the BAG5 domain of the present invention using BIACORE, one of the target biomolecules is immobilized on a surface called a sensor chip, and a sample containing the molecule that acts on the surface is microchanneled. The solution is sent at a constant flow rate through the system. A minute mass change on the surface of the sensor chip accompanying the binding or dissociation between two molecules is detected as an SPR signal, and the change with time of this signal is displayed as a graph called a sensorgram. Furthermore, regarding the interaction between biomolecules, not only the affinity (dissociation constant Kd or affinity constant Ka) between two molecules in an equilibrium state, but also information on the speed of binding and dissociation reactions, ie, the binding rate constant ka and the dissociation The speed constant kd can be obtained. Since the BAG5 domain interacts with Hsc70, these interactions can be analyzed by immobilizing either the BAG5 domain or the Hsc70 protein of the present invention on a sensor chip. First, after binding the BAG5 domain of the present invention and Hsc70 on the sensor chip and switching to only the running buffer, various candidate compounds are added to observe whether these promote the dissociation of the BAG5 domain and Hsc70. Thus, a compound that inhibits the interaction between the BAG5 domain and Hsc70 can be screened.

(Medicine containing interacting substances)
A substance having an interaction with the polypeptide of the present invention can be used as a prophylactic and / or therapeutic agent for a disease involving the polypeptide. Such medicaments can be administered systemically or locally orally or parenterally.

  When the medicament of the present invention is orally administered, it may be any of tablets, capsules, granules, powders, pills, troches, liquids for internal use, suspensions, emulsions, syrups, etc. It may be a dry product that is redissolved when used. When the pharmaceutical agent of the present invention is administered parenterally, it can be selected from pharmaceutical forms such as intravenous injection (including infusion), intramuscular injection, intraperitoneal injection, subcutaneous injection, suppository, etc. In the case of unit dose ampoules or multi-dose containers.

  These various preparations include excipients, extenders, binders, wetting agents, disintegrants, lubricants, surfactants, dispersants, buffers, preservatives, solubilizers, preservatives, A flavoring agent, a soothing agent, a stabilizer, a tonicity agent, and the like can be appropriately selected and produced by a conventional method.

  The above various preparations may contain a pharmaceutically acceptable carrier or additive. Examples of such carriers and additives include water, pharmaceutically acceptable organic solvents, collagen, polyvinyl alcohol, polyvinyl pyrrolidone, carboxyvinyl polymer, sodium alginate, water-soluble dextran, sodium carboxymethyl starch, pectin, xanthan gum, Examples include gum arabic, casein, gelatin, agar, glycerin, propylene glycol, polyethylene glycol, petrolatum, paraffin, stearyl alcohol, stearic acid, human serum albumin, mannitol, sorbitol, and lactose. The additive to be used is selected appropriately or in combination from the above according to the dosage form of the present invention.

  The dosage of the pharmaceutical agent of the present invention varies depending on the age of administration subject, administration route, and number of administrations, and can be varied over a wide range. In this case, the effective amount administered as a combination of an effective amount of the polypeptide of the present invention and an appropriate diluent and a pharmacologically usable carrier is in the range of 0.01 mg to 1000 mg per kg body weight at a time. The dose can be selected, and is preferably administered once a day or several times a day or more.

(Description of array)
The SEQ ID NOs in the present specification indicate the following sequences.
[SEQ ID NO: 1]
The DNA sequence encoding the BAG5 domain polypeptide (7-86 of mouse BAG5 protein) is shown.
[SEQ ID NO: 2]
The amino acid sequence of BAG5 domain polypeptide (7-86 of mouse BAG5 protein) is shown.
[SEQ ID NO: 3]
The DNA sequence encoding the BAG5 domain polypeptide (1-86 of mouse BAG5 protein) is shown.
[SEQ ID NO: 4]
1 shows the amino acid sequence of a BAG5 domain polypeptide (1 to 86 of mouse BAG5 protein).
[SEQ ID NO: 5]
2 shows a DNA sequence encoding a BAG5 domain polypeptide (polypeptide with amino acid residues GSSGSSG and SGPSSG added to the N-terminus and C-terminus of the amino acid sequence shown in SEQ ID NO: 4, respectively).
[SEQ ID NO: 6]
The amino acid sequence of BAG5 domain polypeptide (polypeptide which added the amino acid residue GSSGSSG and SGPSSG to the N terminal and C terminal of the amino acid sequence shown by sequence number 4, respectively) is shown.
[SEQ ID NO: 7]
The base sequence of cDNA encoding the full length mouse BAG5 protein is shown.
[SEQ ID NO: 8]
The amino acid sequence of the entire mouse BAG5 protein is shown.
[SEQ ID NO: 9]
The base sequence of the primer used by the primary PCR of Example 3 is shown.
[SEQ ID NO: 10]
The base sequence of the primer used by the primary PCR of Example 3 is shown.
[SEQ ID NO: 11]
The base sequence of the primer used by secondary PCR of Example 3 is shown.
[SEQ ID NO: 12]
The base sequence of the primer used by secondary PCR of Example 3 is shown.
[SEQ ID NO: 13]
The base sequence of the primer used by secondary PCR of Example 3 is shown.

  EXAMPLES The present invention will be described in more detail with reference to the following examples, but these do not limit the scope of the present invention.

[Experimental example 1] Domain estimation and evaluation by Bioinformatics (1) Estimation of domain region The domain region was estimated by the following procedure.
First, 1) <SCOP method> When a region having a homology with a sequence contained in the protein database SCOP (Version 1.55) was detected, the region was predicted as a domain. The homology detection method utilized BLASTP, and it was judged that there was homology when there was a hit with an E-value of 0.1 or less.
2) <PFAM method> When a region having a sequence homology with the sequence profile contained in the protein motif database PFAM (version 7.1) was detected, the region was predicted as a domain. The homology detection method used HMMER, and it was judged that there was homology when there was a hit with an E-value of 0.1 or less.
3) <ProDom method> If a region with homology to any of the consensus sequences contained in the protein motif database ProDom (version obtained from the Web in March 2001) is detected, the query sequence As a domain. The homology detection method utilized BLASTP, and it was judged that there was homology when there was a hit with an E-value of 0.1 or less.
4) <NR method> BLASTP homology search is performed on the protein sequence data set (NCBI-nr) for the query sequence, and if there is a hit with an E-value of 0.1 or less, the homology region is Grouped as a group and predicted as a domain.
5) <PASS method> The query sequence was subjected to homology search by BLASTP against the protein sequence data set (NCBI-nr), and the frequency at which homology was detected was calculated. A high frequency part is displayed as a mountain, a low part is displayed as a valley, and a single mountain is predicted as a domain so that a valley is a domain boundary.
6) <No Hit Method> A region (residual region) that was not detected as a domain by using any of the methods from 1) to 5) was predicted as a domain.
7) <Difference Domain Boundary Setting Method> With regard to the above six domain predictions, the priority order when the hit areas overlap is 1) as the highest priority, and the following 2), 3), 4), 5), 6) If the hit regions overlap, but the domain boundary shift is 30 residues or more, and the definition with lower priority is longer on the N-terminal side or C-terminal side, the difference The sequence was predicted as a separate domain.

  Of the domain regions estimated by any of the above methods, those having one or more Low-Complexity regions (low-complexity sequence regions) and those having a total length of less than 30 residues were excluded.

  Regarding the full-length amino acid sequence of the mouse BAG5 protein shown in SEQ ID NO: 8, 9-86 was estimated as a domain by the PFAM method. Since it does not have a low-complexity region (a low-complexity sequence region) and has a total length of 30 residues or more, this region was finally used as a result of domain estimation by Bioinformatics.

(2) Expression of putative domain The mouse BAG5 protein domain (referred to herein as the putative domain) estimated by Bioinformatics was subjected to a protein synthesis reaction using a cell-free protein synthesis system described later. Thereafter, SDS gel electrophoresis was performed on the obtained samples according to a conventional method, and the expression state of the protein was examined. As a result, none of the target proteins could be expressed from the amino acid sequence information of the deduced domain.

[Example 2] Production of construct Therefore, with respect to the amino acid sequence of the mouse BAG5 protein based on the amino acid sequence of the putative domain, the position of the domain boundary of the putative domain is several residues at each of the N-terminal and C-terminal. Systematically created a stretched or shrunk construct.

That is, as shown in Table 1 below, the NAG terminal is extended to the 9th amino acid residue of the BAG5 protein, and 10, 20 to the C-terminal side of the 86th amino acid residue of the BAG5 protein is used as a reference. Alternatively, a pattern extended by 30 residues was prepared. These constructs were used to amplify a template DNA by PCR according to the same method as in Examples described later, and each protein synthesis was attempted in a cell-free protein synthesis system. As a result, as shown in Table 1, only the constructs of amino acid residues 1 to 86 and 1-116 were observed in the BAG5 protein. It can be seen that the construct estimated in Example 1 was not expressed. When expression was evaluated structural stability by one-dimensional NMR and ¹ H- ¹⁵ N HSQC spectra measured using the protein were observed, the high magnetic field side of the methyl regions of Both proteins 1D NMR spectrum (0.7Ppm～ A signal shifted by a high magnetic field was observed at around 0.5 ppm, and a signal of amide protons separated over 7 ppm to 9 ppm was observed in the ¹ H- ¹⁵ N HSQC spectrum. From these results, it was found that the structure was stable.

[Example 3]
In this example, the results of studies on polypeptides (1-86): (SEQ ID NO: 4) having a BAG5 domain suitable for use in three-dimensional structure analysis among the constructs prepared as described above will be described.
(1) Construction of expression vector
[1] Primary PCR
BAG5 domain FW primer: 5'-CCAGCGGCTCCTCGGGAATGGATATGGGAAACCAAC-3 '(SEQ ID NO :) using a recombinant E. coli culture medium containing a plasmid in which a cDNA encoding mouse BAG5 protein (FANTOM2 Clone ID: 4930405J06) was cloned into plasmid pBluescriptII SK + 9) PCR was performed using BAG5 domain RV primer: 5′-CCTGACGAGGGCCCCGAGGCATTCTGCTCCAACT-3 ′ (SEQ ID NO: 10). The composition of the PCR reaction solution was as shown in Table 2, and the program followed a normal PCR protocol.

[2] Second PCR
Next, a first primary PCR products obtained by reacting, T7P-DM5-KH6 primers with a His tag sequence to the downstream of the T7 promoter sequence: 5'-GCTCTTGTCATTGTGCTTCGCATGATTACG AATTCAGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGAAAGGCAGCAGCCATCATCATCATCATCACGATTACGATATCCCAACGACCGAAAACCTGTATTTTCAGGGATCCAGCGGCTCCTCGGG-3 '(SEQ ID NO: 11) and T7 terminator T7T-DM3-Term primer with sequence: 5'-CGGGGCCCTCGTCAGGATAATAATTGATTGATGCTGAGTTGGCTGC TGCCACCGCTGCTCATATGAGCCTCTATGACTGTTTTCTGAAATC Next PCR was performed. The PCR reaction solution composition was as shown in Table 3, and the program was the same as in the first PCR.

  As a result, a linear double-stranded DNA fragment capable of expressing a fusion protein of the His tag sequence and the BAG5 domain polypeptide (1-86) could be amplified under the control of the T7 promoter.

[3] Cloning The DNA fragment obtained by the second PCR reaction is cloned into the vector pPCR2.1 (Invitrogen) using TOPO TA-cloning kit (Invitrogen). Thus, an expression vector pPCR2.1 was constructed.

(2) Expression of BAG5 domain polypeptide (1-86)
[1] Synthesis of ¹⁵ N-labeled BAG5 domain by cell-free protein synthesis using dialysis method E. coli S30 extract was prepared according to the method of Zubay et al. (Annu. Rev. Geneti. 7, 267-287, 1973). Prepared from the codon plus strain.

  The protein synthesis reaction was carried out overnight while maintaining the liquid temperature at 30 ° C. on a scale of 3 ml of the reaction liquid having the reaction liquid composition shown in Table 4 and 30 ml of the external dialysis liquid having the composition of external dialysis shown in Table 4.

[2] Determination of expression state by SDS gel electrophoresis After completion of the synthesis reaction, SDS gel electrophoresis was performed according to a conventional method to determine the expression state of the obtained protein. As a result, a band having a molecular weight of about 10,000 was detected, and it was confirmed that the target BAG5 domain was expressed.

[Example 4] Structure determination of BAG5 domain derived from mouse by NMR (1) Purification of ¹³ C ¹⁵ N-labeled domain SEQ ID NO: All carbon nuclei and nitrogen nuclei were substituted with carbon 13 and nitrogen 15 as stable isotopes, respectively The polypeptide described in 6 was produced by the cell-free protein expression system described above. The polypeptide described in SEQ ID NO: 6 is obtained by adding an amino acid residue represented by GSSGSSG to the N-terminus of the polypeptide described in SEQ ID NO: 4 and SGPSSG to the C-terminus. It does not affect the structure. Therefore, by analyzing the three-dimensional structure of the polypeptide described in SEQ ID NO: 6, information relating to the three-dimensional structure of the polypeptide of the present invention described in SEQ ID NO: 4 can be obtained.

  The obtained high-purity sample was concentrated using a protein concentrator with an ultrafiltration membrane for a high-speed centrifuge until the concentration of the sample was approximately 0.7 mM. Thereafter, the concentrated solution was diluted 10-fold with a standard buffer for NMR analysis. This concentration and dilution operation was repeated three times, and the sample purification buffer was completely replaced with the NMR analysis sample buffer. The composition of the sample buffer for NMR analysis used was 20 mM sodium phosphate buffer (pH 7.5), 200 mM sodium chloride, and 0.4 mM sodium azide. The final standard concentration of the standard completely replaced with the standard buffer for NMR analysis was approximately 0.7 mM. The obtained sample was injected into a Shigemi sample tube for NMR measurement having an outer diameter of 5 mm, degassed, and used for measurement.

(2) NMR measurement Unity INOVA600 and Unity INOVA800 manufactured by Varian, USA were used for NMR experiments. All measurements were performed under a temperature environment of 25 ° C. As an NMR experiment for the purpose of assignment of the main chain signal, the two-dimensional spectrum is ¹ H- ¹⁵ N HSQC, the three-dimensional spectrum is HNCO, HN (CO) CA, (HCA) CO (CA) NH, CBCA (CO) NH. , HNCACB was measured. As an NMR experiment for the purpose of assigning side chain signals, the two-dimensional spectrum is ¹ H- ¹³ C HSQC, the aromatic side-chain HCCH-TOCSY, and the three-dimensional spectrum is HBHA (CBCACO) NH, HBHANH, C ( CCCO) NH, CCH-TOCSY for aliphatic side chain, and HCCH-TOCSY were measured. Three-dimensional ¹⁵ N-edited NOESY and three-dimensional ¹³ C-edited NOESY were measured as NMR experiments aimed at collecting distance limit information.

(3) Measurement data analysis Measurement data is subjected to Fourier transform calculation using workstations Octane 2 and Origin 3800 manufactured by Silicon Graphics, USA, and 2D and 3D spectra are obtained. It was. Based on the obtained spectral data, the main chain signals in amino acid residues are Cα and Cβ as carbon nuclei at the α-position and β-position, C ′ as the carbon nucleus of the carbonyl group, HN as the hydrogen nucleus of the amide group, N, which is the nitrogen nucleus of the amide group, was assigned in a chain manner. This technique first searches HNCCAB for a signal that matches the chemical shift value of the Cα signal of the adjacent residue on HN (CO) CA, and reveals the linkage of the Cα signal of the residue adjacent to itself. By repeating this operation, all the Cα signals can be assigned in a chain manner except for a proline residue and an amide proton signal that cannot be observed for some reason. By performing the same operation, the Cβ signal can be assigned by CBCA (CO) NH and HNCACB, and further the C ′ signal can be assigned by HNCO and (HCA) CO (CA) NH. Furthermore, using the obtained main chain attribution information and spectral data measured for side chain attribution, carbon nuclei, nitrogen nuclei, and hydrogen nuclei at the γ, δ, ε, ζ, and η positions are assigned. By the above operation, signal assignment data for almost all amino acid residues was obtained. In addition, distance limit data was obtained from 871 signals from ¹⁵ N-edited NOESY and 2139 signals from ¹³ C-edited NOESY. Based on the attribution data and distance restriction data of these signals, the domain structure was calculated using CANA, which is a protein tertiary structure calculation software. Based on the obtained three-dimensional structure, optimization was performed while comparatively examining NOE groups that did not satisfy the provided distance restriction. By repeating this, the calculation was finally performed using 2804 distance restrictions, and the top 20 three-dimensional structures that were stable in terms of energy were obtained. In these structures, the convergence of the amino acid residue part forming the secondary structure is 0.41% with respect to the main chain atomic group and 0.94% with respect to all atomic groups other than hydrogen atoms including the side chain. there were.

(4) Three-dimensional structure coordinates The obtained structure coordinates are shown below. The coordinate notation shows only the first one of the 20 structures obtained for simplification. This structure is the most stable three-dimensional structure in terms of energy among the 20 structures, and the remaining 19 structures overlap each other with the accuracy of the convergence.

The following three-dimensional structure coordinate data is described according to the format of the protein data bank (PDB). ATOM in the first column indicates that this row is a row of atomic coordinates, the second column shows the order of the atoms, the third column shows the distinction of atoms in amino acid residues, etc., and the fourth column shows the amino acid residues. The fifth column is the amino acid number corresponding to SEQ ID NO: 6, the sixth, seventh and eighth columns are the coordinates of the atoms (in the order of the a-axis, b-axis, and c-axis, in Å units), 9 The column shows the occupation ratio of the atoms (all 1.00 in the present invention), and the column 10 shows the temperature factor of the atoms. The last line indicates the last line of this table.

BAG5 three-dimensional structure coordinate table 1

ATOM 1 N GLY A 1 -9.657 -5.046 -15.587 1.00 0.00 N
ATOM 2 CA GLY A 1 -10.838 -4.200 -15.622 1.00 0.00 C
ATOM 3 C GLY A 1 -11.631 -4.312 -14.318 1.00 0.00 C
ATOM 4 O GLY A 1 -11.779 -3.331 -13.591 1.00 0.00 O
ATOM 5 H GLY A 1 -9.301 -5.312 -16.482 1.00 0.00 H
ATOM 6 1HA GLY A 1 -10.543 -3.164 -15.784 1.00 0.00 H
ATOM 7 2HA GLY A 1 -11.470 -4.487 -16.462 1.00 0.00 H
ATOM 8 N SER A 2 -12.121 -5.517 -14.062 1.00 0.00 N
ATOM 9 CA SER A 2 -12.895 -5.770 -12.859 1.00 0.00 C
ATOM 10 C SER A 2 -12.827 -7.254 -12.495 1.00 0.00 C
ATOM 11 O SER A 2 -13.543 -8.071 -13.071 1.00 0.00 O
ATOM 12 CB SER A 2 -14.350 -5.334 -13.039 1.00 0.00 C
ATOM 13 OG SER A 2 -14.931 -4.894 -11.814 1.00 0.00 O
ATOM 14 H SER A 2 -11.995 -6.309 -14.658 1.00 0.00 H
ATOM 15 HA SER A 2 -12.428 -5.163 -12.082 1.00 0.00 H
ATOM 16 1HB SER A 2 -14.400 -4.529 -13.773 1.00 0.00 H
ATOM 17 2HB SER A 2 -14.931 -6.165 -13.438 1.00 0.00 H
ATOM 18 HG SER A 2 -14.963 -3.895 -11.790 1.00 0.00 H
ATOM 19 N SER A 3 -11.958 -7.557 -11.541 1.00 0.00 N
ATOM 20 CA SER A 3 -11.787 -8.929 -11.094 1.00 0.00 C
ATOM 21 C SER A 3 -12.815 -9.258 -10.009 1.00 0.00 C
ATOM 22 O SER A 3 -12.622 -8.918 -8.843 1.00 0.00 O
ATOM 23 CB SER A 3 -10.369 -9.165 -10.570 1.00 0.00 C
ATOM 24 OG SER A 3 -9.381 -8.878 -11.557 1.00 0.00 O
ATOM 25 H SER A 3 -11.379 -6.886 -11.078 1.00 0.00 H
ATOM 26 HA SER A 3 -11.954 -9.544 -11.978 1.00 0.00 H
ATOM 27 1HB SER A 3 -10.198 -8.540 -9.693 1.00 0.00 H
ATOM 28 2HB SER A 3 -10.269 -10.201 -10.248 1.00 0.00 H
ATOM 29 HG SER A 3 -8.954 -9.726 -11.870 1.00 0.00 H
ATOM 30 N GLY A 4 -13.885 -9.915 -10.431 1.00 0.00 N
ATOM 31 CA GLY A 4 -14.943 -10.293 -9.510 1.00 0.00 C
ATOM 32 C GLY A 4 -15.609 -11.600 -9.947 1.00 0.00 C
ATOM 33 O GLY A 4 -16.741 -11.593 -10.429 1.00 0.00 O
ATOM 34 H GLY A 4 -14.034 -10.188 -11.382 1.00 0.00 H
ATOM 35 1HA GLY A 4 -14.533 -10.408 -8.507 1.00 0.00 H
ATOM 36 2HA GLY A 4 -15.688 -9.500 -9.462 1.00 0.00 H
ATOM 37 N SER A 5 -14.878 -12.690 -9.764 1.00 0.00 N
ATOM 38 CA SER A 5 -15.384 -14.001 -10.133 1.00 0.00 C
ATOM 39 C SER A 5 -14.402 -15.085 -9.684 1.00 0.00 C
ATOM 40 O SER A 5 -13.576 -15.544 -10.471 1.00 0.00 O
ATOM 41 CB SER A 5 -15.625 -14.094 -11.641 1.00 0.00 C
ATOM 42 OG SER A 5 -16.070 -15.390 -12.031 1.00 0.00 O
ATOM 43 H SER A 5 -13.958 -12.687 -9.371 1.00 0.00 H
ATOM 44 HA SER A 5 -16.333 -14.103 -9.607 1.00 0.00 H
ATOM 45 1HB SER A 5 -16.367 -13.352 -11.936 1.00 0.00 H
ATOM 46 2HB SER A 5 -14.704 -13.852 -12.171 1.00 0.00 H
ATOM 47 HG SER A 5 -17.046 -15.367 -12.245 1.00 0.00 H
ATOM 48 N SER A 6 -14.526 -15.465 -8.421 1.00 0.00 N
ATOM 49 CA SER A 6 -13.660 -16.487 -7.858 1.00 0.00 C
ATOM 50 C SER A 6 -14.261 -17.024 -6.558 1.00 0.00 C
ATOM 51 O SER A 6 -14.868 -16.275 -5.794 1.00 0.00 O
ATOM 52 CB SER A 6 -12.254 -15.941 -7.607 1.00 0.00 C
ATOM 53 OG SER A 6 -11.259 -16.956 -7.714 1.00 0.00 O
ATOM 54 H SER A 6 -15.201 -15.088 -7.787 1.00 0.00 H
ATOM 55 HA SER A 6 -13.615 -17.273 -8.612 1.00 0.00 H
ATOM 56 1HB SER A 6 -12.040 -15.147 -8.323 1.00 0.00 H
ATOM 57 2HB SER A 6 -12.210 -15.494 -6.614 1.00 0.00 H
ATOM 58 HG SER A 6 -11.146 -17.418 -6.835 1.00 0.00 H
ATOM 59 N GLY A 7 -14.071 -18.318 -6.345 1.00 0.00 N
ATOM 60 CA GLY A 7 -14.587 -18.964 -5.150 1.00 0.00 C
ATOM 61 C GLY A 7 -13.524 -19.010 -4.050 1.00 0.00 C
ATOM 62 O GLY A 7 -12.389 -18.585 -4.260 1.00 0.00 O
ATOM 63 H GLY A 7 -13.576 -18.921 -6.971 1.00 0.00 H
ATOM 64 1HA GLY A 7 -15.464 -18.426 -4.791 1.00 0.00 H
ATOM 65 2HA GLY A 7 -14.910 -19.977 -5.390 1.00 0.00 H
ATOM 66 N MET A 8 -13.930 -19.529 -2.901 1.00 0.00 N
ATOM 67 CA MET A 8 -13.028 -19.637 -1.767 1.00 0.00 C
ATOM 68 C MET A 8 -13.617 -20.537 -0.680 1.00 0.00 C
ATOM 69 O MET A 8 -14.528 -20.131 0.041 1.00 0.00 O
ATOM 70 CB MET A 8 -12.764 -18.244 -1.191 1.00 0.00 C
ATOM 71 CG MET A 8 -11.265 -17.945 -1.144 1.00 0.00 C
ATOM 72 SD MET A 8 -10.924 -16.733 0.122 1.00 0.00 S
ATOM 73 CE MET A 8 -9.141 -16.688 0.036 1.00 0.00 C
ATOM 74 H MET A 8 -14.855 -19.873 -2.738 1.00 0.00 H
ATOM 75 HA MET A 8 -12.114 -20.082 -2.162 1.00 0.00 H
ATOM 76 1HB MET A 8 -13.270 -17.493 -1.798 1.00 0.00 H
ATOM 77 2HB MET A 8 -13.184 -18.177 -0.187 1.00 0.00 H
ATOM 78 1HG MET A 8 -10.709 -18.860 -0.941 1.00 0.00 H
ATOM 79 2HG MET A 8 -10.928 -17.575 -2.112 1.00 0.00 H
ATOM 80 1HE MET A 8 -8.827 -16.695 -1.008 1.00 0.00 H
ATOM 81 2HE MET A 8 -8.777 -15.782 0.519 1.00 0.00 H
ATOM 82 3HE MET A 8 -8.731 -17.561 0.544 1.00 0.00 H
ATOM 83 N ASP A 9 -13.074 -21.742 -0.595 1.00 0.00 N
ATOM 84 CA ASP A 9 -13.535 -22.703 0.393 1.00 0.00 C
ATOM 85 C ASP A 9 -12.358 -23.572 0.840 1.00 0.00 C
ATOM 86 O ASP A 9 -11.865 -24.398 0.074 1.00 0.00 O
ATOM 87 CB ASP A 9 -14.607 -23.624 -0.193 1.00 0.00 C
ATOM 88 CG ASP A 9 -15.859 -23.789 0.670 1.00 0.00 C
ATOM 89 OD1 ASP A 9 -16.547 -22.766 0.874 1.00 0.00 O
ATOM 90 OD2 ASP A 9 -16.101 -24.936 1.106 1.00 0.00 O
ATOM 91 H ASP A 9 -12.334 -22.064 -1.185 1.00 0.00 H
ATOM 92 HA ASP A 9 -13.944 -22.104 1.206 1.00 0.00 H
ATOM 93 1HB ASP A 9 -14.904 -23.236 -1.168 1.00 0.00 H
ATOM 94 2HB ASP A 9 -14.168 -24.607 -0.362 1.00 0.00 H
ATOM 95 N MET A 10 -11.942 -23.357 2.080 1.00 0.00 N
ATOM 96 CA MET A 10 -10.833 -24.110 2.638 1.00 0.00 C
ATOM 97 C MET A 10 -10.521 -23.652 4.064 1.00 0.00 C
ATOM 98 O MET A 10 -10.610 -22.464 4.372 1.00 0.00 O
ATOM 99 CB MET A 10 -9.594 -23.923 1.760 1.00 0.00 C
ATOM 100 CG MET A 10 -9.087 -25.267 1.233 1.00 0.00 C
ATOM 101 SD MET A 10 -7.556 -25.701 2.041 1.00 0.00 S
ATOM 102 CE MET A 10 -7.434 -27.419 1.573 1.00 0.00 C
ATOM 103 H MET A 10 -12.349 -22.683 2.697 1.00 0.00 H
ATOM 104 HA MET A 10 -11.160 -25.150 2.647 1.00 0.00 H
ATOM 105 1HB MET A 10 -9.834 -23.267 0.922 1.00 0.00 H
ATOM 106 2HB MET A 10 -8.808 -23.433 2.333 1.00 0.00 H
ATOM 107 1HG MET A 10 -9.833 -26.041 1.410 1.00 0.00 H
ATOM 108 2HG MET A 10 -8.936 -25.211 0.155 1.00 0.00 H
ATOM 109 1HE MET A 10 -7.849 -28.042 2.366 1.00 0.00 H
ATOM 110 2HE MET A 10 -7.992 -27.585 0.652 1.00 0.00 H
ATOM 111 3HE MET A 10 -6.388 -27.680 1.417 1.00 0.00 H
ATOM 112 N GLY A 11 -10.163 -24.618 4.897 1.00 0.00 N
ATOM 113 CA GLY A 11 -9.838 -24.328 6.284 1.00 0.00 C
ATOM 114 C GLY A 11 -8.347 -24.021 6.445 1.00 0.00 C
ATOM 115 O GLY A 11 -7.571 -24.887 6.845 1.00 0.00 O
ATOM 116 H GLY A 11 -10.093 -25.581 4.639 1.00 0.00 H
ATOM 117 1HA GLY A 11 -10.427 -23.479 6.629 1.00 0.00 H
ATOM 118 2HA GLY A 11 -10.107 -25.179 6.909 1.00 0.00 H
ATOM 119 N ASN A 12 -7.993 -22.785 6.125 1.00 0.00 N
ATOM 120 CA ASN A 12 -6.610 -22.352 6.229 1.00 0.00 C
ATOM 121 C ASN A 12 -6.463 -20.970 5.590 1.00 0.00 C
ATOM 122 O ASN A 12 -6.736 -20.798 4.404 1.00 0.00 O
ATOM 123 CB ASN A 12 -5.675 -23.315 5.494 1.00 0.00 C
ATOM 124 CG ASN A 12 -4.955 -24.239 6.478 1.00 0.00 C
ATOM 125 OD1 ASN A 12 -4.837 -23.959 7.660 1.00 0.00 O
ATOM 126 ND2 ASN A 12 -4.482 -25.353 5.926 1.00 0.00 N
ATOM 127 H ASN A 12 -8.631 -22.086 5.801 1.00 0.00 H
ATOM 128 HA ASN A 12 -6.392 -22.344 7.297 1.00 0.00 H
ATOM 129 1HB ASN A 12 -6.247 -23.910 4.782 1.00 0.00 H
ATOM 130 2HB ASN A 12 -4.942 -22.748 4.919 1.00 0.00 H
ATOM 131 1HD2 ASN A 12 -4.612 -25.522 4.950 1.00 0.00 H
ATOM 132 2HD2 ASN A 12 -3.995 -26.021 6.489 1.00 0.00 H
ATOM 133 N GLN A 13 -6.031 -20.019 6.406 1.00 0.00 N
ATOM 134 CA GLN A 13 -5.844 -18.657 5.936 1.00 0.00 C
ATOM 135 C GLN A 13 -4.391 -18.437 5.510 1.00 0.00 C
ATOM 136 O GLN A 13 -3.509 -18.290 6.354 1.00 0.00 O
ATOM 137 CB GLN A 13 -6.261 -17.646 7.005 1.00 0.00 C
ATOM 138 CG GLN A 13 -6.378 -16.239 6.414 1.00 0.00 C
ATOM 139 CD GLN A 13 -7.301 -15.363 7.263 1.00 0.00 C
ATOM 140 OE1 GLN A 13 -7.848 -15.784 8.268 1.00 0.00 O
ATOM 141 NE2 GLN A 13 -7.442 -14.123 6.804 1.00 0.00 N
ATOM 142 H GLN A 13 -5.811 -20.167 7.370 1.00 0.00 H
ATOM 143 HA GLN A 13 -6.502 -18.556 5.073 1.00 0.00 H
ATOM 144 1HB GLN A 13 -7.216 -17.942 7.439 1.00 0.00 H
ATOM 145 2HB GLN A 13 -5.530 -17.644 7.814 1.00 0.00 H
ATOM 146 1HG GLN A 13 -5.390 -15.783 6.355 1.00 0.00 H
ATOM 147 2HG GLN A 13 -6.763 -16.300 5.396 1.00 0.00 H
ATOM 148 1HE2 GLN A 13 -6.964 -13.840 5.972 1.00 0.00 H
ATOM 149 2HE2 GLN A 13 -8.026 -13.473 7.290 1.00 0.00 H
ATOM 150 N HIS A 14 -4.188 -18.423 4.200 1.00 0.00 N
ATOM 151 CA HIS A 14 -2.857 -18.224 3.652 1.00 0.00 C
ATOM 152 C HIS A 14 -2.151 -17.101 4.415 1.00 0.00 C
ATOM 153 O HIS A 14 -2.773 -16.103 4.776 1.00 0.00 O
ATOM 154 CB HIS A 14 -2.923 -17.966 2.145 1.00 0.00 C
ATOM 155 CG HIS A 14 -1.674 -18.368 1.398 1.00 0.00 C
ATOM 156 ND1 HIS A 14 -0.611 -17.505 1.197 1.00 0.00 N
ATOM 157 CD2 HIS A 14 -1.329 -19.548 0.808 1.00 0.00 C
ATOM 158 CE1 HIS A 14 0.326 -18.147 0.514 1.00 0.00 C
ATOM 159 NE2 HIS A 14 -0.121 -19.413 0.274 1.00 0.00 N
ATOM 160 H HIS A 14 -4.911 -18.544 3.521 1.00 0.00 H
ATOM 161 HA HIS A 14 -2.312 -19.155 3.807 1.00 0.00 H
ATOM 162 1HB HIS A 14 -3.772 -18.510 1.731 1.00 0.00 H
ATOM 163 2HB HIS A 14 -3.111 -16.906 1.976 1.00 0.00 H
ATOM 164 HD2 HIS A 14 -1.941 -20.450 0.781 1.00 0.00 H
ATOM 165 HE1 HIS A 14 1.285 -17.735 0.199 1.00 0.00 H
ATOM 166 HE2 HIS A 14 0.401 -20.139 -0.173 1.00 0.00 H
ATOM 167 N PRO A 15 -0.826 -17.307 4.643 1.00 0.00 N
ATOM 168 CA PRO A 15 -0.028 -16.324 5.356 1.00 0.00 C
ATOM 169 C PRO A 15 0.278 -15.116 4.467 1.00 0.00 C
ATOM 170 O PRO A 15 0.855 -14.132 4.928 1.00 0.00 O
ATOM 171 CB PRO A 15 1.222 -17.072 5.791 1.00 0.00 C
ATOM 172 CG PRO A 15 1.293 -18.311 4.913 1.00 0.00 C
ATOM 173 CD PRO A 15 -0.055 -18.476 4.230 1.00 0.00 C
ATOM 174 HA PRO A 15 -0.537 -15.965 6.139 1.00 0.00 H
ATOM 175 1HB PRO A 15 2.110 -16.454 5.667 1.00 0.00 H
ATOM 176 2HB PRO A 15 1.167 -17.344 6.846 1.00 0.00 H
ATOM 177 1HG PRO A 15 2.086 -18.208 4.172 1.00 0.00 H
ATOM 178 2HG PRO A 15 1.528 -19.191 5.512 1.00 0.00 H
ATOM 179 1HD PRO A 15 0.052 -18.517 3.146 1.00 0.00 H
ATOM 180 2HD PRO A 15 -0.544 -19.401 4.537 1.00 0.00 H
ATOM 181 N SER A 16 -0.123 -15.231 3.210 1.00 0.00 N
ATOM 182 CA SER A 16 0.100 -14.161 2.252 1.00 0.00 C
ATOM 183 C SER A 16 -1.172 -13.327 2.093 1.00 0.00 C
ATOM 184 O SER A 16 -1.103 -12.116 1.888 1.00 0.00 O
ATOM 185 CB SER A 16 0.543 -14.718 0.898 1.00 0.00 C
ATOM 186 OG SER A 16 1.743 -15.480 1.000 1.00 0.00 O
ATOM 187 H SER A 16 -0.592 -16.035 2.843 1.00 0.00 H
ATOM 188 HA SER A 16 0.903 -13.558 2.676 1.00 0.00 H
ATOM 189 1HB SER A 16 -0.249 -15.343 0.486 1.00 0.00 H
ATOM 190 2HB SER A 16 0.694 -13.895 0.200 1.00 0.00 H
ATOM 191 HG SER A 16 2.140 -15.371 1.911 1.00 0.00 H
ATOM 192 N ILE A 17 -2.304 -14.008 2.194 1.00 0.00 N
ATOM 193 CA ILE A 17 -3.591 -13.345 2.064 1.00 0.00 C
ATOM 194 C ILE A 17 -3.811 -12.428 3.268 1.00 0.00 C
ATOM 195 O ILE A 17 -4.060 -11.234 3.107 1.00 0.00 O
ATOM 196 CB ILE A 17 -4.706 -14.373 1.861 1.00 0.00 C
ATOM 197 CG1 ILE A 17 -4.617 -15.012 0.474 1.00 0.00 C
ATOM 198 CG2 ILE A 17 -6.079 -13.750 2.119 1.00 0.00 C
ATOM 199 CD1 ILE A 17 -5.029 -14.019 -0.614 1.00 0.00 C
ATOM 200 H ILE A 17 -2.352 -14.993 2.361 1.00 0.00 H
ATOM 201 HA ILE A 17 -3.552 -12.730 1.164 1.00 0.00 H
ATOM 202 HB ILE A 17 -4.572 -15.170 2.592 1.00 0.00 H
ATOM 203 1HG1 ILE A 17 -3.598 -15.354 0.292 1.00 0.00 H
ATOM 204 2HG1 ILE A 17 -5.261 -15.891 0.433 1.00 0.00 H
ATOM 205 1HG2 ILE A 17 -6.365 -13.918 3.157 1.00 0.00 H
ATOM 206 2HG2 ILE A 17 -6.035 -12.679 1.923 1.00 0.00 H
ATOM 207 3HG2 ILE A 17 -6.816 -14.210 1.460 1.00 0.00 H
ATOM 208 1HD1 ILE A 17 -5.704 -13.275 -0.191 1.00 0.00 H
ATOM 209 2HD1 ILE A 17 -4.142 -13.523 -1.009 1.00 0.00 H
ATOM 210 3HD1 ILE A 17 -5.536 -14.552 -1.419 1.00 0.00 H
ATOM 211 N SER A 18 -3.711 -13.021 4.449 1.00 0.00 N
ATOM 212 CA SER A 18 -3.897 -12.272 5.681 1.00 0.00 C
ATOM 213 C SER A 18 -2.982 -11.045 5.690 1.00 0.00 C
ATOM 214 O SER A 18 -3.405 -9.955 6.070 1.00 0.00 O
ATOM 215 CB SER A 18 -3.622 -13.148 6.904 1.00 0.00 C
ATOM 216 OG SER A 18 -3.884 -12.459 8.124 1.00 0.00 O
ATOM 217 H SER A 18 -3.508 -13.992 4.572 1.00 0.00 H
ATOM 218 HA SER A 18 -4.944 -11.969 5.679 1.00 0.00 H
ATOM 219 1HB SER A 18 -4.239 -14.045 6.855 1.00 0.00 H
ATOM 220 2HB SER A 18 -2.582 -13.476 6.890 1.00 0.00 H
ATOM 221 HG SER A 18 -3.903 -11.472 7.962 1.00 0.00 H
ATOM 222 N ARG A 19 -1.746 -11.265 5.266 1.00 0.00 N
ATOM 223 CA ARG A 19 -0.769 -10.191 5.221 1.00 0.00 C
ATOM 224 C ARG A 19 -1.293 -9.032 4.370 1.00 0.00 C
ATOM 225 O ARG A 19 -1.480 -7.924 4.872 1.00 0.00 O
ATOM 226 CB ARG A 19 0.560 -10.679 4.641 1.00 0.00 C
ATOM 227 CG ARG A 19 1.679 -10.585 5.681 1.00 0.00 C
ATOM 228 CD ARG A 19 1.338 -11.401 6.929 1.00 0.00 C
ATOM 229 NE ARG A 19 2.580 -11.809 7.622 1.00 0.00 N
ATOM 230 CZ ARG A 19 3.340 -12.849 7.253 1.00 0.00 C
ATOM 231 NH1 ARG A 19 2.988 -13.594 6.196 1.00 0.00 N
ATOM 232 NH2 ARG A 19 4.451 -13.145 7.942 1.00 0.00 N
ATOM 233 H ARG A 19 -1.411 -12.155 4.958 1.00 0.00 H
ATOM 234 HA ARG A 19 -0.640 -9.887 6.260 1.00 0.00 H
ATOM 235 1HB ARG A 19 0.457 -11.711 4.305 1.00 0.00 H
ATOM 236 2HB ARG A 19 0.820 -10.084 3.766 1.00 0.00 H
ATOM 237 1HG ARG A 19 2.612 -10.947 5.249 1.00 0.00 H
ATOM 238 2HG ARG A 19 1.838 -9.542 5.956 1.00 0.00 H
ATOM 239 1HD ARG A 19 0.714 -10.811 7.600 1.00 0.00 H
ATOM 240 2HD ARG A 19 0.761 -12.283 6.651 1.00 0.00 H
ATOM 241 HE ARG A 19 2.871 -11.274 8.416 1.00 0.00 H
ATOM 242 1HH1 ARG A 19 2.159 -13.373 5.682 1.00 0.00 H
ATOM 243 2HH1 ARG A 19 3.555 -14.370 5.921 1.00 0.00 H
ATOM 244 1HH2 ARG A 19 4.713 -12.590 8.731 1.00 0.00 H
ATOM 245 2HH2 ARG A 19 5.017 -13.922 7.666 1.00 0.00 H
ATOM 246 N LEU A 20 -1.514 -9.327 3.098 1.00 0.00 N
ATOM 247 CA LEU A 20 -2.013 -8.323 2.173 1.00 0.00 C
ATOM 248 C LEU A 20 -3.244 -7.645 2.778 1.00 0.00 C
ATOM 249 O LEU A 20 -3.444 -6.444 2.602 1.00 0.00 O
ATOM 250 CB LEU A 20 -2.266 -8.941 0.796 1.00 0.00 C
ATOM 251 CG LEU A 20 -1.022 -9.250 -0.039 1.00 0.00 C
ATOM 252 CD1 LEU A 20 -1.336 -10.271 -1.134 1.00 0.00 C
ATOM 253 CD2 LEU A 20 -0.412 -7.967 -0.609 1.00 0.00 C
ATOM 254 H LEU A 20 -1.359 -10.230 2.698 1.00 0.00 H
ATOM 255 HA LEU A 20 -1.231 -7.574 2.051 1.00 0.00 H
ATOM 256 1HB LEU A 20 -2.826 -9.867 0.933 1.00 0.00 H
ATOM 257 2HB LEU A 20 -2.903 -8.264 0.227 1.00 0.00 H
ATOM 258 HG LEU A 20 -0.274 -9.699 0.614 1.00 0.00 H
ATOM 259 1HD1 LEU A 20 -1.436 -9.758 -2.091 1.00 0.00 H
ATOM 260 2HD1 LEU A 20 -0.527 -10.999 -1.195 1.00 0.00 H
ATOM 261 3HD1 LEU A 20 -2.269 -10.783 -0.897 1.00 0.00 H
ATOM 262 1HD2 LEU A 20 0.540 -8.199 -1.086 1.00 0.00 H
ATOM 263 2HD2 LEU A 20 -1.092 -7.538 -1.345 1.00 0.00 H
ATOM 264 3HD2 LEU A 20 -0.251 -7.252 0.198 1.00 0.00 H
ATOM 265 N GLN A 21 -4.036 -8.444 3.477 1.00 0.00 N
ATOM 266 CA GLN A 21 -5.242 -7.936 4.109 1.00 0.00 C
ATOM 267 C GLN A 21 -4.882 -7.050 5.304 1.00 0.00 C
ATOM 268 O GLN A 21 -5.663 -6.184 5.696 1.00 0.00 O
ATOM 269 CB GLN A 21 -6.163 -9.081 4.534 1.00 0.00 C
ATOM 270 CG GLN A 21 -7.218 -9.362 3.462 1.00 0.00 C
ATOM 271 CD GLN A 21 -8.553 -9.759 4.097 1.00 0.00 C
ATOM 272 OE1 GLN A 21 -9.310 -8.933 4.578 1.00 0.00 O
ATOM 273 NE2 GLN A 21 -8.797 -11.066 4.071 1.00 0.00 N
ATOM 274 H GLN A 21 -3.866 -9.419 3.615 1.00 0.00 H
ATOM 275 HA GLN A 21 -5.741 -7.341 3.344 1.00 0.00 H
ATOM 276 1HB GLN A 21 -5.573 -9.980 4.712 1.00 0.00 H
ATOM 277 2HB GLN A 21 -6.653 -8.829 5.474 1.00 0.00 H
ATOM 278 1HG GLN A 21 -7.356 -8.477 2.841 1.00 0.00 H
ATOM 279 2HG GLN A 21 -6.872 -10.161 2.806 1.00 0.00 H
ATOM 280 1HE2 GLN A 21 -8.132 -11.691 3.660 1.00 0.00 H
ATOM 281 2HE2 GLN A 21 -9.644 -11.424 4.462 1.00 0.00 H
ATOM 282 N GLU A 22 -3.700 -7.297 5.849 1.00 0.00 N
ATOM 283 CA GLU A 22 -3.228 -6.533 6.990 1.00 0.00 C
ATOM 284 C GLU A 22 -2.392 -5.340 6.522 1.00 0.00 C
ATOM 285 O GLU A 22 -2.140 -4.414 7.291 1.00 0.00 O
ATOM 286 CB GLU A 22 -2.430 -7.418 7.950 1.00 0.00 C
ATOM 287 CG GLU A 22 -3.353 -8.108 8.956 1.00 0.00 C
ATOM 288 CD GLU A 22 -2.655 -8.293 10.305 1.00 0.00 C
ATOM 289 OE1 GLU A 22 -1.688 -9.085 10.339 1.00 0.00 O
ATOM 290 OE2 GLU A 22 -3.103 -7.638 11.270 1.00 0.00 O
ATOM 291 H GLU A 22 -3.071 -8.003 5.523 1.00 0.00 H
ATOM 292 HA GLU A 22 -4.127 -6.180 7.495 1.00 0.00 H
ATOM 293 1HB GLU A 22 -1.877 -8.168 7.384 1.00 0.00 H
ATOM 294 2HB GLU A 22 -1.694 -6.813 8.481 1.00 0.00 H
ATOM 295 1HG GLU A 22 -4.259 -7.516 9.089 1.00 0.00 H
ATOM 296 2HG GLU A 22 -3.661 -9.078 8.566 1.00 0.00 H
ATOM 297 N ILE A 23 -1.987 -5.401 5.262 1.00 0.00 N
ATOM 298 CA ILE A 23 -1.186 -4.337 4.681 1.00 0.00 C
ATOM 299 C ILE A 23 -2.080 -3.442 3.820 1.00 0.00 C
ATOM 300 O ILE A 23 -1.823 -2.247 3.686 1.00 0.00 O
ATOM 301 CB ILE A 23 0.011 -4.919 3.927 1.00 0.00 C
ATOM 302 CG1 ILE A 23 1.103 -5.373 4.897 1.00 0.00 C
ATOM 303 CG2 ILE A 23 0.542 -3.925 2.891 1.00 0.00 C
ATOM 304 CD1 ILE A 23 1.505 -6.825 4.629 1.00 0.00 C
ATOM 305 H ILE A 23 -2.197 -6.157 4.642 1.00 0.00 H
ATOM 306 HA ILE A 23 -0.789 -3.741 5.503 1.00 0.00 H
ATOM 307 HB ILE A 23 -0.324 -5.802 3.383 1.00 0.00 H
ATOM 308 1HG1 ILE A 23 1.975 -4.726 4.798 1.00 0.00 H
ATOM 309 2HG1 ILE A 23 0.748 -5.274 5.923 1.00 0.00 H
ATOM 310 1HG2 ILE A 23 1.624 -4.032 2.807 1.00 0.00 H
ATOM 311 2HG2 ILE A 23 0.081 -4.127 1.924 1.00 0.00 H
ATOM 312 3HG2 ILE A 23 0.301 -2.910 3.205 1.00 0.00 H
ATOM 313 1HD1 ILE A 23 2.433 -7.048 5.157 1.00 0.00 H
ATOM 314 2HD1 ILE A 23 0.718 -7.491 4.982 1.00 0.00 H
ATOM 315 3HD1 ILE A 23 1.652 -6.970 3.559 1.00 0.00 H
ATOM 316 N GLN A 24 -3.111 -4.056 3.259 1.00 0.00 N
ATOM 317 CA GLN A 24 -4.045 -3.330 2.415 1.00 0.00 C
ATOM 318 C GLN A 24 -4.865 -2.347 3.253 1.00 0.00 C
ATOM 319 O GLN A 24 -4.929 -1.160 2.938 1.00 0.00 O
ATOM 320 CB GLN A 24 -4.957 -4.293 1.652 1.00 0.00 C
ATOM 321 CG GLN A 24 -4.263 -4.826 0.396 1.00 0.00 C
ATOM 322 CD GLN A 24 -5.125 -4.594 -0.847 1.00 0.00 C
ATOM 323 OE1 GLN A 24 -5.719 -3.546 -1.035 1.00 0.00 O
ATOM 324 NE2 GLN A 24 -5.159 -5.629 -1.681 1.00 0.00 N
ATOM 325 H GLN A 24 -3.313 -5.028 3.374 1.00 0.00 H
ATOM 326 HA GLN A 24 -3.427 -2.783 1.703 1.00 0.00 H
ATOM 327 1HB GLN A 24 -5.236 -5.125 2.298 1.00 0.00 H
ATOM 328 2HB GLN A 24 -5.879 -3.782 1.373 1.00 0.00 H
ATOM 329 1HG GLN A 24 -3.299 -4.332 0.272 1.00 0.00 H
ATOM 330 2HG GLN A 24 -4.063 -5.891 0.512 1.00 0.00 H
ATOM 331 1HE2 GLN A 24 -4.647 -6.462 -1.467 1.00 0.00 H
ATOM 332 2HE2 GLN A 24 -5.696 -5.575 -2.523 1.00 0.00 H
ATOM 333 N ARG A 25 -5.471 -2.878 4.305 1.00 0.00 N
ATOM 334 CA ARG A 25 -6.284 -2.062 5.191 1.00 0.00 C
ATOM 335 C ARG A 25 -5.474 -0.874 5.711 1.00 0.00 C
ATOM 336 O ARG A 25 -6.042 0.131 6.137 1.00 0.00 O
ATOM 337 CB ARG A 25 -6.796 -2.881 6.378 1.00 0.00 C
ATOM 338 CG ARG A 25 -5.639 -3.544 7.126 1.00 0.00 C
ATOM 339 CD ARG A 25 -6.152 -4.379 8.301 1.00 0.00 C
ATOM 340 NE ARG A 25 -5.577 -3.876 9.569 1.00 0.00 N
ATOM 341 CZ ARG A 25 -6.088 -4.136 10.780 1.00 0.00 C
ATOM 342 NH1 ARG A 25 -7.186 -4.894 10.896 1.00 0.00 N
ATOM 343 NH2 ARG A 25 -5.499 -3.636 11.876 1.00 0.00 N
ATOM 344 H ARG A 25 -5.414 -3.844 4.555 1.00 0.00 H
ATOM 345 HA ARG A 25 -7.119 -1.728 4.574 1.00 0.00 H
ATOM 346 1HB ARG A 25 -7.351 -2.234 7.058 1.00 0.00 H
ATOM 347 2HB ARG A 25 -7.491 -3.643 6.026 1.00 0.00 H
ATOM 348 1HG ARG A 25 -5.076 -4.180 6.443 1.00 0.00 H
ATOM 349 2HG ARG A 25 -4.951 -2.781 7.491 1.00 0.00 H
ATOM 350 1HD ARG A 25 -7.240 -4.333 8.342 1.00 0.00 H
ATOM 351 2HD ARG A 25 -5.882 -5.425 8.160 1.00 0.00 H
ATOM 352 HE ARG A 25 -4.757 -3.306 9.518 1.00 0.00 H
ATOM 353 1HH1 ARG A 25 -7.625 -5.267 10.079 1.00 0.00 H
ATOM 354 2HH1 ARG A 25 -7.567 -5.088 11.801 1.00 0.00 H
ATOM 355 1HH2 ARG A 25 -4.680 -3.070 11.790 1.00 0.00 H
ATOM 356 2HH2 ARG A 25 -5.880 -3.830 12.780 1.00 0.00 H
ATOM 357 N GLU A 26 -4.159 -1.027 5.660 1.00 0.00 N
ATOM 358 CA GLU A 26 -3.264 0.021 6.121 1.00 0.00 C
ATOM 359 C GLU A 26 -3.187 1.145 5.087 1.00 0.00 C
ATOM 360 O GLU A 26 -3.482 2.299 5.395 1.00 0.00 O
ATOM 361 CB GLU A 26 -1.874 -0.540 6.426 1.00 0.00 C
ATOM 362 CG GLU A 26 -1.861 -1.272 7.770 1.00 0.00 C
ATOM 363 CD GLU A 26 -1.083 -0.477 8.820 1.00 0.00 C
ATOM 364 OE1 GLU A 26 -1.696 0.444 9.403 1.00 0.00 O
ATOM 365 OE2 GLU A 26 0.106 -0.807 9.017 1.00 0.00 O
ATOM 366 H GLU A 26 -3.705 -1.848 5.312 1.00 0.00 H
ATOM 367 HA GLU A 26 -3.708 0.396 7.043 1.00 0.00 H
ATOM 368 1HB GLU A 26 -1.571 -1.223 5.633 1.00 0.00 H
ATOM 369 2HB GLU A 26 -1.146 0.271 6.443 1.00 0.00 H
ATOM 370 1HG GLU A 26 -2.884 -1.431 8.112 1.00 0.00 H
ATOM 371 2HG GLU A 26 -1.410 -2.257 7.647 1.00 0.00 H
ATOM 372 N VAL A 27 -2.788 0.770 3.880 1.00 0.00 N
ATOM 373 CA VAL A 27 -2.668 1.733 2.799 1.00 0.00 C
ATOM 374 C VAL A 27 -4.034 2.371 2.535 1.00 0.00 C
ATOM 375 O VAL A 27 -4.114 3.530 2.132 1.00 0.00 O
ATOM 376 CB VAL A 27 -2.075 1.058 1.560 1.00 0.00 C
ATOM 377 CG1 VAL A 27 -0.739 0.387 1.889 1.00 0.00 C
ATOM 378 CG2 VAL A 27 -3.060 0.053 0.959 1.00 0.00 C
ATOM 379 H VAL A 27 -2.550 -0.170 3.637 1.00 0.00 H
ATOM 380 HA VAL A 27 -1.975 2.509 3.124 1.00 0.00 H
ATOM 381 HB VAL A 27 -1.887 1.830 0.815 1.00 0.00 H
ATOM 382 1HG1 VAL A 27 -0.312 -0.036 0.979 1.00 0.00 H
ATOM 383 2HG1 VAL A 27 -0.053 1.127 2.302 1.00 0.00 H
ATOM 384 3HG1 VAL A 27 -0.901 -0.407 2.618 1.00 0.00 H
ATOM 385 1HG2 VAL A 27 -4.039 0.521 0.858 1.00 0.00 H
ATOM 386 2HG2 VAL A 27 -2.704 -0.261 -0.022 1.00 0.00 H
ATOM 387 3HG2 VAL A 27 -3.137 -0.815 1.613 1.00 0.00 H
ATOM 388 N LYS A 28 -5.074 1.585 2.774 1.00 0.00 N
ATOM 389 CA LYS A 28 -6.432 2.059 2.568 1.00 0.00 C
ATOM 390 C LYS A 28 -6.843 2.946 3.745 1.00 0.00 C
ATOM 391 O LYS A 28 -7.474 3.984 3.554 1.00 0.00 O
ATOM 392 CB LYS A 28 -7.379 0.882 2.326 1.00 0.00 C
ATOM 393 CG LYS A 28 -8.674 1.348 1.659 1.00 0.00 C
ATOM 394 CD LYS A 28 -9.041 0.445 0.480 1.00 0.00 C
ATOM 395 CE LYS A 28 -9.102 1.243 -0.824 1.00 0.00 C
ATOM 396 NZ LYS A 28 -9.910 0.524 -1.834 1.00 0.00 N
ATOM 397 H LYS A 28 -5.000 0.644 3.103 1.00 0.00 H
ATOM 398 HA LYS A 28 -6.433 2.665 1.662 1.00 0.00 H
ATOM 399 1HB LYS A 28 -6.888 0.139 1.696 1.00 0.00 H
ATOM 400 2HB LYS A 28 -7.608 0.393 3.273 1.00 0.00 H
ATOM 401 1HG LYS A 28 -9.484 1.346 2.389 1.00 0.00 H
ATOM 402 2HG LYS A 28 -8.560 2.376 1.313 1.00 0.00 H
ATOM 403 1HD LYS A 28 -8.305 -0.354 0.387 1.00 0.00 H
ATOM 404 2HD LYS A 28 -10.004 -0.029 0.666 1.00 0.00 H
ATOM 405 1HE LYS A 28 -9.535 2.226 -0.636 1.00 0.00 H
ATOM 406 2HE LYS A 28 -8.094 1.407 -1.205 1.00 0.00 H
ATOM 407 1HZ LYS A 28 -9.647 -0.441 -1.846 1.00 0.00 H
ATOM 408 2HZ LYS A 28 -10.879 0.602 -1.603 1.00 0.00 H
ATOM 409 3HZ LYS A 28 -9.748 0.924 -2.736 1.00 0.00 H
ATOM 410 N ALA A 29 -6.467 2.504 4.937 1.00 0.00 N
ATOM 411 CA ALA A 29 -6.789 3.245 6.145 1.00 0.00 C
ATOM 412 C ALA A 29 -5.961 4.531 6.184 1.00 0.00 C
ATOM 413 O ALA A 29 -6.236 5.426 6.983 1.00 0.00 O
ATOM 414 CB ALA A 29 -6.546 2.358 7.368 1.00 0.00 C
ATOM 415 H ALA A 29 -5.954 1.658 5.084 1.00 0.00 H
ATOM 416 HA ALA A 29 -7.847 3.504 6.104 1.00 0.00 H
ATOM 417 1HB ALA A 29 -6.649 2.953 8.275 1.00 0.00 H
ATOM 418 2HB ALA A 29 -7.276 1.548 7.380 1.00 0.00 H
ATOM 419 3HB ALA A 29 -5.540 1.940 7.320 1.00 0.00 H
ATOM 420 N ILE A 30 -4.965 4.583 5.312 1.00 0.00 N
ATOM 421 CA ILE A 30 -4.096 5.745 5.238 1.00 0.00 C
ATOM 422 C ILE A 30 -4.275 6.424 3.878 1.00 0.00 C
ATOM 423 O ILE A 30 -3.715 7.491 3.635 1.00 0.00 O
ATOM 424 CB ILE A 30 -2.649 5.353 5.544 1.00 0.00 C
ATOM 425 CG1 ILE A 30 -2.077 4.463 4.438 1.00 0.00 C
ATOM 426 CG2 ILE A 30 -2.538 4.697 6.922 1.00 0.00 C
ATOM 427 CD1 ILE A 30 -1.078 5.236 3.574 1.00 0.00 C
ATOM 428 H ILE A 30 -4.748 3.851 4.666 1.00 0.00 H
ATOM 429 HA ILE A 30 -4.413 6.441 6.015 1.00 0.00 H
ATOM 430 HB ILE A 30 -2.047 6.261 5.570 1.00 0.00 H
ATOM 431 1HG1 ILE A 30 -1.586 3.597 4.881 1.00 0.00 H
ATOM 432 2HG1 ILE A 30 -2.887 4.086 3.814 1.00 0.00 H
ATOM 433 1HG2 ILE A 30 -3.528 4.386 7.256 1.00 0.00 H
ATOM 434 2HG2 ILE A 30 -1.886 3.826 6.858 1.00 0.00 H
ATOM 435 3HG2 ILE A 30 -2.123 5.412 7.632 1.00 0.00 H
ATOM 436 1HD1 ILE A 30 -0.797 4.631 2.713 1.00 0.00 H
ATOM 437 2HD1 ILE A 30 -1.536 6.165 3.232 1.00 0.00 H
ATOM 438 3HD1 ILE A 30 -0.189 5.465 4.163 1.00 0.00 H
ATOM 439 N GLU A 31 -5.057 5.776 3.028 1.00 0.00 N
ATOM 440 CA GLU A 31 -5.317 6.304 1.699 1.00 0.00 C
ATOM 441 C GLU A 31 -5.804 7.751 1.788 1.00 0.00 C
ATOM 442 O GLU A 31 -5.341 8.613 1.042 1.00 0.00 O
ATOM 443 CB GLU A 31 -6.326 5.431 0.950 1.00 0.00 C
ATOM 444 CG GLU A 31 -7.028 6.227 -0.152 1.00 0.00 C
ATOM 445 CD GLU A 31 -8.109 5.385 -0.833 1.00 0.00 C
ATOM 446 OE1 GLU A 31 -9.229 5.343 -0.279 1.00 0.00 O
ATOM 447 OE2 GLU A 31 -7.792 4.803 -1.892 1.00 0.00 O
ATOM 448 H GLU A 31 -5.509 4.908 3.233 1.00 0.00 H
ATOM 449 HA GLU A 31 -4.359 6.266 1.180 1.00 0.00 H
ATOM 450 1HB GLU A 31 -5.817 4.571 0.514 1.00 0.00 H
ATOM 451 2HB GLU A 31 -7.066 5.042 1.650 1.00 0.00 H
ATOM 452 1HG GLU A 31 -7.475 7.126 0.272 1.00 0.00 H
ATOM 453 2HG GLU A 31 -6.297 6.553 -0.892 1.00 0.00 H
ATOM 454 N PRO A 32 -6.755 7.980 2.732 1.00 0.00 N
ATOM 455 CA PRO A 32 -7.310 9.309 2.929 1.00 0.00 C
ATOM 456 C PRO A 32 -6.317 10.215 3.660 1.00 0.00 C
ATOM 457 O PRO A 32 -6.290 11.423 3.433 1.00 0.00 O
ATOM 458 CB PRO A 32 -8.596 9.087 3.708 1.00 0.00 C
ATOM 459 CG PRO A 32 -8.480 7.700 4.319 1.00 0.00 C
ATOM 460 CD PRO A 32 -7.327 6.985 3.634 1.00 0.00 C
ATOM 461 HA PRO A 32 -7.482 9.748 2.047 1.00 0.00 H
ATOM 462 1HB PRO A 32 -8.721 9.846 4.480 1.00 0.00 H
ATOM 463 2HB PRO A 32 -9.465 9.154 3.053 1.00 0.00 H
ATOM 464 1HG PRO A 32 -8.302 7.770 5.392 1.00 0.00 H
ATOM 465 2HG PRO A 32 -9.408 7.145 4.185 1.00 0.00 H
ATOM 466 1HD PRO A 32 -6.590 6.637 4.358 1.00 0.00 H
ATOM 467 2HD PRO A 32 -7.674 6.108 3.087 1.00 0.00 H
ATOM 468 N GLN A 33 -5.526 9.596 4.524 1.00 0.00 N
ATOM 469 CA GLN A 33 -4.534 10.331 5.290 1.00 0.00 C
ATOM 470 C GLN A 33 -3.579 11.071 4.351 1.00 0.00 C
ATOM 471 O GLN A 33 -2.972 12.068 4.737 1.00 0.00 O
ATOM 472 CB GLN A 33 -3.766 9.399 6.229 1.00 0.00 C
ATOM 473 CG GLN A 33 -4.605 9.046 7.459 1.00 0.00 C
ATOM 474 CD GLN A 33 -3.715 8.791 8.677 1.00 0.00 C
ATOM 475 OE1 GLN A 33 -3.914 9.337 9.749 1.00 0.00 O
ATOM 476 NE2 GLN A 33 -2.723 7.934 8.452 1.00 0.00 N
ATOM 477 H GLN A 33 -5.554 8.612 4.703 1.00 0.00 H
ATOM 478 HA GLN A 33 -5.100 11.049 5.883 1.00 0.00 H
ATOM 479 1HB GLN A 33 -3.490 8.488 5.699 1.00 0.00 H
ATOM 480 2HB GLN A 33 -2.838 9.878 6.544 1.00 0.00 H
ATOM 481 1HG GLN A 33 -5.299 9.858 7.675 1.00 0.00 H
ATOM 482 2HG GLN A 33 -5.206 8.160 7.251 1.00 0.00 H
ATOM 483 1HE2 GLN A 33 -2.615 7.521 7.547 1.00 0.00 H
ATOM 484 2HE2 GLN A 33 -2.086 7.702 9.187 1.00 0.00 H
ATOM 485 N VAL A 34 -3.477 10.554 3.135 1.00 0.00 N
ATOM 486 CA VAL A 34 -2.607 11.153 2.138 1.00 0.00 C
ATOM 487 C VAL A 34 -3.419 12.121 1.274 1.00 0.00 C
ATOM 488 O VAL A 34 -3.016 13.265 1.072 1.00 0.00 O
ATOM 489 CB VAL A 34 -1.915 10.059 1.322 1.00 0.00 C
ATOM 490 CG1 VAL A 34 -1.043 10.666 0.221 1.00 0.00 C
ATOM 491 CG2 VAL A 34 -1.095 9.137 2.226 1.00 0.00 C
ATOM 492 H VAL A 34 -3.975 9.743 2.829 1.00 0.00 H
ATOM 493 HA VAL A 34 -1.838 11.716 2.667 1.00 0.00 H
ATOM 494 HB VAL A 34 -2.688 9.458 0.843 1.00 0.00 H
ATOM 495 1HG1 VAL A 34 -0.298 11.325 0.668 1.00 0.00 H
ATOM 496 2HG1 VAL A 34 -0.540 9.868 -0.326 1.00 0.00 H
ATOM 497 3HG1 VAL A 34 -1.668 11.237 -0.465 1.00 0.00 H
ATOM 498 1HG2 VAL A 34 -0.796 8.251 1.665 1.00 0.00 H
ATOM 499 2HG2 VAL A 34 -0.206 9.664 2.572 1.00 0.00 H
ATOM 500 3HG2 VAL A 34 -1.698 8.839 3.083 1.00 0.00 H
ATOM 501 N VAL A 35 -4.547 11.625 0.787 1.00 0.00 N
ATOM 502 CA VAL A 35 -5.419 12.431 -0.050 1.00 0.00 C
ATOM 503 C VAL A 35 -5.866 13.669 0.730 1.00 0.00 C
ATOM 504 O VAL A 35 -6.052 14.738 0.150 1.00 0.00 O
ATOM 505 CB VAL A 35 -6.591 11.585 -0.552 1.00 0.00 C
ATOM 506 CG1 VAL A 35 -7.534 12.417 -1.423 1.00 0.00 C
ATOM 507 CG2 VAL A 35 -6.093 10.351 -1.307 1.00 0.00 C
ATOM 508 H VAL A 35 -4.867 10.693 0.957 1.00 0.00 H
ATOM 509 HA VAL A 35 -4.839 12.752 -0.916 1.00 0.00 H
ATOM 510 HB VAL A 35 -7.153 11.242 0.317 1.00 0.00 H
ATOM 511 1HG1 VAL A 35 -7.065 12.605 -2.389 1.00 0.00 H
ATOM 512 2HG1 VAL A 35 -8.467 11.873 -1.572 1.00 0.00 H
ATOM 513 3HG1 VAL A 35 -7.742 13.366 -0.930 1.00 0.00 H
ATOM 514 1HG2 VAL A 35 -5.735 10.648 -2.292 1.00 0.00 H
ATOM 515 2HG2 VAL A 35 -5.279 9.888 -0.749 1.00 0.00 H
ATOM 516 3HG2 VAL A 35 -6.910 9.638 -1.416 1.00 0.00 H
ATOM 517 N GLY A 36 -6.026 13.483 2.032 1.00 0.00 N
ATOM 518 CA GLY A 36 -6.447 14.572 2.897 1.00 0.00 C
ATOM 519 C GLY A 36 -5.250 15.193 3.619 1.00 0.00 C
ATOM 520 O GLY A 36 -5.416 15.872 4.632 1.00 0.00 O
ATOM 521 H GLY A 36 -5.872 12.610 2.495 1.00 0.00 H
ATOM 522 1HA GLY A 36 -6.956 15.334 2.307 1.00 0.00 H
ATOM 523 2HA GLY A 36 -7.166 14.202 3.628 1.00 0.00 H
ATOM 524 N PHE A 37 -4.072 14.939 3.071 1.00 0.00 N
ATOM 525 CA PHE A 37 -2.847 15.465 3.650 1.00 0.00 C
ATOM 526 C PHE A 37 -2.718 16.967 3.388 1.00 0.00 C
ATOM 527 O PHE A 37 -3.469 17.529 2.593 1.00 0.00 O
ATOM 528 CB PHE A 37 -1.684 14.739 2.972 1.00 0.00 C
ATOM 529 CG PHE A 37 -0.303 15.211 3.433 1.00 0.00 C
ATOM 530 CD1 PHE A 37 0.033 15.148 4.749 1.00 0.00 C
ATOM 531 CD2 PHE A 37 0.588 15.693 2.525 1.00 0.00 C
ATOM 532 CE1 PHE A 37 1.315 15.587 5.176 1.00 0.00 C
ATOM 533 CE2 PHE A 37 1.870 16.131 2.953 1.00 0.00 C
ATOM 534 CZ PHE A 37 2.206 16.069 4.269 1.00 0.00 C
ATOM 535 H PHE A 37 -3.946 14.386 2.247 1.00 0.00 H
ATOM 536 HA PHE A 37 -2.896 15.289 4.725 1.00 0.00 H
ATOM 537 1HB PHE A 37 -1.774 13.670 3.166 1.00 0.00 H
ATOM 538 2HB PHE A 37 -1.762 14.875 1.894 1.00 0.00 H
ATOM 539 HD1 PHE A 37 -0.681 14.762 5.476 1.00 0.00 H
ATOM 540 HD2 PHE A 37 0.319 15.743 1.471 1.00 0.00 H
ATOM 541 HE1 PHE A 37 1.584 15.537 6.231 1.00 0.00 H
ATOM 542 HE2 PHE A 37 2.584 16.517 2.225 1.00 0.00 H
ATOM 543 HZ PHE A 37 3.189 16.405 4.597 1.00 0.00 H
ATOM 544 N SER A 38 -1.758 17.574 4.071 1.00 0.00 N
ATOM 545 CA SER A 38 -1.520 19.000 3.922 1.00 0.00 C
ATOM 546 C SER A 38 -0.161 19.369 4.519 1.00 0.00 C
ATOM 547 O SER A 38 -0.081 19.800 5.668 1.00 0.00 O
ATOM 548 CB SER A 38 -2.631 19.816 4.586 1.00 0.00 C
ATOM 549 OG SER A 38 -3.598 20.268 3.642 1.00 0.00 O
ATOM 550 H SER A 38 -1.151 17.109 4.716 1.00 0.00 H
ATOM 551 HA SER A 38 -1.529 19.183 2.847 1.00 0.00 H
ATOM 552 1HB SER A 38 -3.123 19.208 5.346 1.00 0.00 H
ATOM 553 2HB SER A 38 -2.195 20.673 5.097 1.00 0.00 H
ATOM 554 HG SER A 38 -3.816 21.230 3.809 1.00 0.00 H
ATOM 555 N GLY A 39 0.873 19.186 3.712 1.00 0.00 N
ATOM 556 CA GLY A 39 2.225 19.494 4.146 1.00 0.00 C
ATOM 557 C GLY A 39 3.198 19.478 2.965 1.00 0.00 C
ATOM 558 O GLY A 39 3.066 18.657 2.059 1.00 0.00 O
ATOM 559 H GLY A 39 0.799 18.835 2.779 1.00 0.00 H
ATOM 560 1HA GLY A 39 2.243 20.474 4.623 1.00 0.00 H
ATOM 561 2HA GLY A 39 2.545 18.770 4.895 1.00 0.00 H
ATOM 562 N LEU A 40 4.153 20.394 3.014 1.00 0.00 N
ATOM 563 CA LEU A 40 5.148 20.495 1.960 1.00 0.00 C
ATOM 564 C LEU A 40 5.890 19.163 1.835 1.00 0.00 C
ATOM 565 O LEU A 40 5.818 18.322 2.729 1.00 0.00 O
ATOM 566 CB LEU A 40 6.070 21.692 2.205 1.00 0.00 C
ATOM 567 CG LEU A 40 5.709 22.980 1.463 1.00 0.00 C
ATOM 568 CD1 LEU A 40 6.261 22.964 0.037 1.00 0.00 C
ATOM 569 CD2 LEU A 40 4.198 23.223 1.490 1.00 0.00 C
ATOM 570 H LEU A 40 4.254 21.058 3.755 1.00 0.00 H
ATOM 571 HA LEU A 40 4.617 20.684 1.027 1.00 0.00 H
ATOM 572 1HB LEU A 40 6.081 21.902 3.275 1.00 0.00 H
ATOM 573 2HB LEU A 40 7.084 21.407 1.926 1.00 0.00 H
ATOM 574 HG LEU A 40 6.179 23.816 1.982 1.00 0.00 H
ATOM 575 1HD1 LEU A 40 5.709 22.238 -0.559 1.00 0.00 H
ATOM 576 2HD1 LEU A 40 6.152 23.955 -0.406 1.00 0.00 H
ATOM 577 3HD1 LEU A 40 7.316 22.690 0.059 1.00 0.00 H
ATOM 578 1HD2 LEU A 40 3.710 22.418 2.039 1.00 0.00 H
ATOM 579 2HD2 LEU A 40 3.992 24.174 1.981 1.00 0.00 H
ATOM 580 3HD2 LEU A 40 3.817 23.251 0.470 1.00 0.00 H
ATOM 581 N SER A 41 6.585 19.012 0.717 1.00 0.00 N
ATOM 582 CA SER A 41 7.339 17.796 0.463 1.00 0.00 C
ATOM 583 C SER A 41 8.424 17.621 1.528 1.00 0.00 C
ATOM 584 O SER A 41 9.509 18.188 1.413 1.00 0.00 O
ATOM 585 CB SER A 41 7.965 17.817 -0.933 1.00 0.00 C
ATOM 586 OG SER A 41 9.163 18.588 -0.969 1.00 0.00 O
ATOM 587 H SER A 41 6.638 19.701 -0.006 1.00 0.00 H
ATOM 588 HA SER A 41 6.611 16.987 0.522 1.00 0.00 H
ATOM 589 1HB SER A 41 8.181 16.797 -1.249 1.00 0.00 H
ATOM 590 2HB SER A 41 7.249 18.226 -1.645 1.00 0.00 H
ATOM 591 HG SER A 41 9.868 18.151 -0.411 1.00 0.00 H
ATOM 592 N ASP A 42 8.092 16.834 2.541 1.00 0.00 N
ATOM 593 CA ASP A 42 9.024 16.578 3.626 1.00 0.00 C
ATOM 594 C ASP A 42 9.004 17.758 4.600 1.00 0.00 C
ATOM 595 O ASP A 42 9.920 18.579 4.604 1.00 0.00 O
ATOM 596 CB ASP A 42 10.452 16.422 3.100 1.00 0.00 C
ATOM 597 CG ASP A 42 10.573 15.688 1.763 1.00 0.00 C
ATOM 598 OD1 ASP A 42 9.747 14.777 1.540 1.00 0.00 O
ATOM 599 OD2 ASP A 42 11.488 16.056 0.995 1.00 0.00 O
ATOM 600 H ASP A 42 7.207 16.377 2.628 1.00 0.00 H
ATOM 601 HA ASP A 42 8.680 15.651 4.086 1.00 0.00 H
ATOM 602 1HB ASP A 42 10.894 17.413 2.995 1.00 0.00 H
ATOM 603 2HB ASP A 42 11.042 15.888 3.845 1.00 0.00 H
ATOM 604 N ASP A 43 7.951 17.805 5.401 1.00 0.00 N
ATOM 605 CA ASP A 43 7.800 18.871 6.377 1.00 0.00 C
ATOM 606 C ASP A 43 8.089 18.321 7.776 1.00 0.00 C
ATOM 607 O ASP A 43 8.993 18.798 8.459 1.00 0.00 O
ATOM 608 CB ASP A 43 6.373 19.424 6.372 1.00 0.00 C
ATOM 609 CG ASP A 43 5.273 18.373 6.213 1.00 0.00 C
ATOM 610 OD1 ASP A 43 4.667 18.025 7.250 1.00 0.00 O
ATOM 611 OD2 ASP A 43 5.062 17.942 5.059 1.00 0.00 O
ATOM 612 H ASP A 43 7.210 17.133 5.392 1.00 0.00 H
ATOM 613 HA ASP A 43 8.512 19.638 6.075 1.00 0.00 H
ATOM 614 1HB ASP A 43 6.206 19.965 7.304 1.00 0.00 H
ATOM 615 2HB ASP A 43 6.283 20.148 5.563 1.00 0.00 H
ATOM 616 N LYS A 44 7.304 17.325 8.159 1.00 0.00 N
ATOM 617 CA LYS A 44 7.464 16.705 9.463 1.00 0.00 C
ATOM 618 C LYS A 44 6.504 15.519 9.581 1.00 0.00 C
ATOM 619 O LYS A 44 6.863 14.478 10.129 1.00 0.00 O
ATOM 620 CB LYS A 44 7.298 17.744 10.574 1.00 0.00 C
ATOM 621 CG LYS A 44 8.038 17.314 11.842 1.00 0.00 C
ATOM 622 CD LYS A 44 8.964 18.426 12.341 1.00 0.00 C
ATOM 623 CE LYS A 44 9.754 17.972 13.570 1.00 0.00 C
ATOM 624 NZ LYS A 44 10.824 18.944 13.886 1.00 0.00 N
ATOM 625 H LYS A 44 6.570 16.943 7.597 1.00 0.00 H
ATOM 626 HA LYS A 44 8.486 16.330 9.523 1.00 0.00 H
ATOM 627 1HB LYS A 44 7.678 18.708 10.236 1.00 0.00 H
ATOM 628 2HB LYS A 44 6.239 17.879 10.795 1.00 0.00 H
ATOM 629 1HG LYS A 44 7.318 17.060 12.620 1.00 0.00 H
ATOM 630 2HG LYS A 44 8.620 16.415 11.641 1.00 0.00 H
ATOM 631 1HD LYS A 44 9.653 18.713 11.547 1.00 0.00 H
ATOM 632 2HD LYS A 44 8.376 19.310 12.587 1.00 0.00 H
ATOM 633 1HE LYS A 44 9.083 17.870 14.423 1.00 0.00 H
ATOM 634 2HE LYS A 44 10.189 16.989 13.387 1.00 0.00 H
ATOM 635 1HZ LYS A 44 11.387 19.095 13.074 1.00 0.00 H
ATOM 636 2HZ LYS A 44 10.414 19.810 14.173 1.00 0.00 H
ATOM 637 3HZ LYS A 44 11.394 18.584 14.625 1.00 0.00 H
ATOM 638 N ASN A 45 5.303 15.717 9.059 1.00 0.00 N
ATOM 639 CA ASN A 45 4.289 14.677 9.099 1.00 0.00 C
ATOM 640 C ASN A 45 4.300 13.910 7.776 1.00 0.00 C
ATOM 641 O ASN A 45 3.760 12.808 7.689 1.00 0.00 O
ATOM 642 CB ASN A 45 2.894 15.276 9.287 1.00 0.00 C
ATOM 643 CG ASN A 45 1.924 14.237 9.854 1.00 0.00 C
ATOM 644 OD1 ASN A 45 1.687 13.190 9.275 1.00 0.00 O
ATOM 645 ND2 ASN A 45 1.378 14.585 11.016 1.00 0.00 N
ATOM 646 H ASN A 45 5.019 16.568 8.616 1.00 0.00 H
ATOM 647 HA ASN A 45 4.557 14.049 9.948 1.00 0.00 H
ATOM 648 1HB ASN A 45 2.949 16.132 9.959 1.00 0.00 H
ATOM 649 2HB ASN A 45 2.520 15.644 8.332 1.00 0.00 H
ATOM 650 1HD2 ASN A 45 1.615 15.460 11.438 1.00 0.00 H
ATOM 651 2HD2 ASN A 45 0.730 13.972 11.468 1.00 0.00 H
ATOM 652 N TYR A 46 4.920 14.522 6.778 1.00 0.00 N
ATOM 653 CA TYR A 46 5.008 13.910 5.463 1.00 0.00 C
ATOM 654 C TYR A 46 5.815 12.611 5.516 1.00 0.00 C
ATOM 655 O TYR A 46 5.582 11.699 4.724 1.00 0.00 O
ATOM 656 CB TYR A 46 5.743 14.917 4.577 1.00 0.00 C
ATOM 657 CG TYR A 46 6.140 14.367 3.206 1.00 0.00 C
ATOM 658 CD1 TYR A 46 7.208 13.499 3.094 1.00 0.00 C
ATOM 659 CD2 TYR A 46 5.431 14.737 2.082 1.00 0.00 C
ATOM 660 CE1 TYR A 46 7.582 12.981 1.803 1.00 0.00 C
ATOM 661 CE2 TYR A 46 5.805 14.219 0.791 1.00 0.00 C
ATOM 662 CZ TYR A 46 6.862 13.367 0.716 1.00 0.00 C
ATOM 663 OH TYR A 46 7.215 12.877 -0.503 1.00 0.00 O
ATOM 664 H TYR A 46 5.356 15.418 6.857 1.00 0.00 H
ATOM 665 HA TYR A 46 3.995 13.686 5.128 1.00 0.00 H
ATOM 666 1HB TYR A 46 5.109 15.793 4.436 1.00 0.00 H
ATOM 667 2HB TYR A 46 6.641 15.255 5.096 1.00 0.00 H
ATOM 668 HD1 TYR A 46 7.768 13.207 3.982 1.00 0.00 H
ATOM 669 HD2 TYR A 46 4.588 15.422 2.171 1.00 0.00 H
ATOM 670 HE1 TYR A 46 8.423 12.296 1.700 1.00 0.00 H
ATOM 671 HE2 TYR A 46 5.253 14.504 -0.105 1.00 0.00 H
ATOM 672 HH TYR A 46 7.235 13.617 -1.176 1.00 0.00 H
ATOM 673 N LYS A 47 6.747 12.569 6.457 1.00 0.00 N
ATOM 674 CA LYS A 47 7.590 11.397 6.623 1.00 0.00 C
ATOM 675 C LYS A 47 6.724 10.207 7.041 1.00 0.00 C
ATOM 676 O LYS A 47 6.685 9.190 6.349 1.00 0.00 O
ATOM 677 CB LYS A 47 8.735 11.694 7.593 1.00 0.00 C
ATOM 678 CG LYS A 47 9.505 12.946 7.166 1.00 0.00 C
ATOM 679 CD LYS A 47 10.103 12.771 5.769 1.00 0.00 C
ATOM 680 CE LYS A 47 11.517 13.351 5.702 1.00 0.00 C
ATOM 681 NZ LYS A 47 11.535 14.736 6.224 1.00 0.00 N
ATOM 682 H LYS A 47 6.930 13.315 7.097 1.00 0.00 H
ATOM 683 HA LYS A 47 8.037 11.176 5.654 1.00 0.00 H
ATOM 684 1HB LYS A 47 8.339 11.832 8.599 1.00 0.00 H
ATOM 685 2HB LYS A 47 9.413 10.842 7.633 1.00 0.00 H
ATOM 686 1HG LYS A 47 8.837 13.808 7.175 1.00 0.00 H
ATOM 687 2HG LYS A 47 10.299 13.151 7.883 1.00 0.00 H
ATOM 688 1HD LYS A 47 10.127 11.713 5.509 1.00 0.00 H
ATOM 689 2HD LYS A 47 9.468 13.266 5.033 1.00 0.00 H
ATOM 690 1HE LYS A 47 12.199 12.728 6.281 1.00 0.00 H
ATOM 691 2HE LYS A 47 11.873 13.339 4.672 1.00 0.00 H
ATOM 692 1HZ LYS A 47 12.331 15.219 5.859 1.00 0.00 H
ATOM 693 2HZ LYS A 47 10.701 15.209 5.942 1.00 0.00 H
ATOM 694 3HZ LYS A 47 11.586 14.715 7.222 1.00 0.00 H
ATOM 695 N ARG A 48 6.050 10.372 8.170 1.00 0.00 N
ATOM 696 CA ARG A 48 5.187 9.324 8.687 1.00 0.00 C
ATOM 697 C ARG A 48 4.365 8.706 7.555 1.00 0.00 C
ATOM 698 O ARG A 48 4.491 7.516 7.269 1.00 0.00 O
ATOM 699 CB ARG A 48 4.240 9.869 9.757 1.00 0.00 C
ATOM 700 CG ARG A 48 3.980 8.824 10.844 1.00 0.00 C
ATOM 701 CD ARG A 48 3.708 9.491 12.193 1.00 0.00 C
ATOM 702 NE ARG A 48 4.968 10.027 12.756 1.00 0.00 N
ATOM 703 CZ ARG A 48 5.037 10.767 13.871 1.00 0.00 C
ATOM 704 NH1 ARG A 48 3.921 11.063 14.550 1.00 0.00 N
ATOM 705 NH2 ARG A 48 6.224 11.211 14.308 1.00 0.00 N
ATOM 706 H ARG A 48 6.087 11.202 8.726 1.00 0.00 H
ATOM 707 HA ARG A 48 5.868 8.592 9.122 1.00 0.00 H
ATOM 708 1HB ARG A 48 4.668 10.766 10.205 1.00 0.00 H
ATOM 709 2HB ARG A 48 3.296 10.163 9.298 1.00 0.00 H
ATOM 710 1HG ARG A 48 3.128 8.205 10.562 1.00 0.00 H
ATOM 711 2HG ARG A 48 4.842 8.161 10.929 1.00 0.00 H
ATOM 712 1HD ARG A 48 2.983 10.296 12.071 1.00 0.00 H
ATOM 713 2HD ARG A 48 3.270 8.770 12.883 1.00 0.00 H
ATOM 714 HE ARG A 48 5.820 9.825 12.274 1.00 0.00 H
ATOM 715 1HH1 ARG A 48 3.035 10.732 14.224 1.00 0.00 H
ATOM 716 2HH1 ARG A 48 3.973 11.616 15.382 1.00 0.00 H
ATOM 717 1HH2 ARG A 48 7.058 10.990 13.801 1.00 0.00 H
ATOM 718 2HH2 ARG A 48 6.276 11.763 15.140 1.00 0.00 H
ATOM 719 N LEU A 49 3.541 9.542 6.940 1.00 0.00 N
ATOM 720 CA LEU A 49 2.698 9.093 5.845 1.00 0.00 C
ATOM 721 C LEU A 49 3.519 8.206 4.907 1.00 0.00 C
ATOM 722 O LEU A 49 3.260 7.008 4.795 1.00 0.00 O
ATOM 723 CB LEU A 49 2.044 10.287 5.147 1.00 0.00 C
ATOM 724 CG LEU A 49 0.931 10.992 5.925 1.00 0.00 C
ATOM 725 CD1 LEU A 49 0.118 11.909 5.010 1.00 0.00 C
ATOM 726 CD2 LEU A 49 0.046 9.979 6.655 1.00 0.00 C
ATOM 727 H LEU A 49 3.445 10.509 7.179 1.00 0.00 H
ATOM 728 HA LEU A 49 1.896 8.493 6.275 1.00 0.00 H
ATOM 729 1HB LEU A 49 2.820 11.018 4.919 1.00 0.00 H
ATOM 730 2HB LEU A 49 1.636 9.948 4.195 1.00 0.00 H
ATOM 731 HG LEU A 49 1.392 11.623 6.686 1.00 0.00 H
ATOM 732 1HD1 LEU A 49 -0.882 12.040 5.422 1.00 0.00 H
ATOM 733 2HD1 LEU A 49 0.611 12.879 4.937 1.00 0.00 H
ATOM 734 3HD1 LEU A 49 0.048 11.462 4.018 1.00 0.00 H
ATOM 735 1HD2 LEU A 49 -0.875 10.466 6.975 1.00 0.00 H
ATOM 736 2HD2 LEU A 49 -0.193 9.156 5.982 1.00 0.00 H
ATOM 737 3HD2 LEU A 49 0.576 9.594 7.526 1.00 0.00 H
ATOM 738 N GLU A 50 4.491 8.828 4.256 1.00 0.00 N
ATOM 739 CA GLU A 50 5.351 8.110 3.330 1.00 0.00 C
ATOM 740 C GLU A 50 5.876 6.828 3.980 1.00 0.00 C
ATOM 741 O GLU A 50 5.734 5.741 3.421 1.00 0.00 O
ATOM 742 CB GLU A 50 6.504 8.995 2.854 1.00 0.00 C
ATOM 743 CG GLU A 50 7.472 8.206 1.971 1.00 0.00 C
ATOM 744 CD GLU A 50 7.861 9.009 0.728 1.00 0.00 C
ATOM 745 OE1 GLU A 50 9.014 8.836 0.279 1.00 0.00 O
ATOM 746 OE2 GLU A 50 6.996 9.778 0.256 1.00 0.00 O
ATOM 747 H GLU A 50 4.694 9.802 4.352 1.00 0.00 H
ATOM 748 HA GLU A 50 4.716 7.860 2.480 1.00 0.00 H
ATOM 749 1HB GLU A 50 6.108 9.844 2.296 1.00 0.00 H
ATOM 750 2HB GLU A 50 7.037 9.399 3.714 1.00 0.00 H
ATOM 751 1HG GLU A 50 8.367 7.955 2.541 1.00 0.00 H
ATOM 752 2HG GLU A 50 7.012 7.265 1.671 1.00 0.00 H
ATOM 753 N ARG A 51 6.471 6.997 5.151 1.00 0.00 N
ATOM 754 CA ARG A 51 7.019 5.867 5.883 1.00 0.00 C
ATOM 755 C ARG A 51 6.025 4.704 5.884 1.00 0.00 C
ATOM 756 O ARG A 51 6.392 3.569 5.582 1.00 0.00 O
ATOM 757 CB ARG A 51 7.344 6.252 7.327 1.00 0.00 C
ATOM 758 CG ARG A 51 8.841 6.105 7.610 1.00 0.00 C
ATOM 759 CD ARG A 51 9.411 7.383 8.227 1.00 0.00 C
ATOM 760 NE ARG A 51 10.651 7.076 8.973 1.00 0.00 N
ATOM 761 CZ ARG A 51 11.508 8.004 9.421 1.00 0.00 C
ATOM 762 NH1 ARG A 51 11.265 9.303 9.200 1.00 0.00 N
ATOM 763 NH2 ARG A 51 12.609 7.633 10.089 1.00 0.00 N
ATOM 764 H ARG A 51 6.583 7.884 5.599 1.00 0.00 H
ATOM 765 HA ARG A 51 7.931 5.604 5.347 1.00 0.00 H
ATOM 766 1HB ARG A 51 7.035 7.281 7.512 1.00 0.00 H
ATOM 767 2HB ARG A 51 6.777 5.621 8.012 1.00 0.00 H
ATOM 768 1HG ARG A 51 9.006 5.266 8.286 1.00 0.00 H
ATOM 769 2HG ARG A 51 9.369 5.877 6.684 1.00 0.00 H
ATOM 770 1HD ARG A 51 9.618 8.113 7.445 1.00 0.00 H
ATOM 771 2HD ARG A 51 8.676 7.833 8.896 1.00 0.00 H
ATOM 772 HE ARG A 51 10.863 6.116 9.155 1.00 0.00 H
ATOM 773 1HH1 ARG A 51 10.443 9.580 8.702 1.00 0.00 H
ATOM 774 2HH1 ARG A 51 11.904 9.995 9.534 1.00 0.00 H
ATOM 775 1HH2 ARG A 51 12.791 6.663 10.253 1.00 0.00 H
ATOM 776 2HH2 ARG A 51 13.249 8.325 10.423 1.00 0.00 H
ATOM 777 N ILE A 52 4.786 5.026 6.226 1.00 0.00 N
ATOM 778 CA ILE A 52 3.737 4.022 6.271 1.00 0.00 C
ATOM 779 C ILE A 52 3.720 3.249 4.950 1.00 0.00 C
ATOM 780 O ILE A 52 3.995 2.051 4.924 1.00 0.00 O
ATOM 781 CB ILE A 52 2.394 4.665 6.624 1.00 0.00 C
ATOM 782 CG1 ILE A 52 2.473 5.395 7.966 1.00 0.00 C
ATOM 783 CG2 ILE A 52 1.268 3.630 6.599 1.00 0.00 C
ATOM 784 CD1 ILE A 52 1.493 6.569 8.009 1.00 0.00 C
ATOM 785 H ILE A 52 4.496 5.951 6.470 1.00 0.00 H
ATOM 786 HA ILE A 52 3.983 3.327 7.074 1.00 0.00 H
ATOM 787 HB ILE A 52 2.163 5.411 5.864 1.00 0.00 H
ATOM 788 1HG1 ILE A 52 2.250 4.701 8.776 1.00 0.00 H
ATOM 789 2HG1 ILE A 52 3.488 5.758 8.128 1.00 0.00 H
ATOM 790 1HG2 ILE A 52 1.601 2.743 6.061 1.00 0.00 H
ATOM 791 2HG2 ILE A 52 1.003 3.357 7.621 1.00 0.00 H
ATOM 792 3HG2 ILE A 52 0.397 4.053 6.099 1.00 0.00 H
ATOM 793 1HD1 ILE A 52 1.116 6.766 7.005 1.00 0.00 H
ATOM 794 2HD1 ILE A 52 0.659 6.323 8.667 1.00 0.00 H
ATOM 795 3HD1 ILE A 52 2.003 7.456 8.385 1.00 0.00 H
ATOM 796 N LEU A 53 3.396 3.968 3.885 1.00 0.00 N
ATOM 797 CA LEU A 53 3.339 3.365 2.564 1.00 0.00 C
ATOM 798 C LEU A 53 4.644 2.612 2.296 1.00 0.00 C
ATOM 799 O LEU A 53 4.624 1.438 1.929 1.00 0.00 O
ATOM 800 CB LEU A 53 3.010 4.421 1.507 1.00 0.00 C
ATOM 801 CG LEU A 53 1.567 4.929 1.493 1.00 0.00 C
ATOM 802 CD1 LEU A 53 1.461 6.259 0.744 1.00 0.00 C
ATOM 803 CD2 LEU A 53 0.619 3.872 0.922 1.00 0.00 C
ATOM 804 H LEU A 53 3.174 4.942 3.915 1.00 0.00 H
ATOM 805 HA LEU A 53 2.520 2.646 2.568 1.00 0.00 H
ATOM 806 1HB LEU A 53 3.673 5.273 1.655 1.00 0.00 H
ATOM 807 2HB LEU A 53 3.238 4.006 0.525 1.00 0.00 H
ATOM 808 HG LEU A 53 1.260 5.114 2.523 1.00 0.00 H
ATOM 809 1HD1 LEU A 53 0.831 6.945 1.311 1.00 0.00 H
ATOM 810 2HD1 LEU A 53 2.455 6.690 0.628 1.00 0.00 H
ATOM 811 3HD1 LEU A 53 1.021 6.089 -0.238 1.00 0.00 H
ATOM 812 1HD2 LEU A 53 0.998 3.527 -0.040 1.00 0.00 H
ATOM 813 2HD2 LEU A 53 0.556 3.030 1.611 1.00 0.00 H
ATOM 814 3HD2 LEU A 53 -0.371 4.307 0.788 1.00 0.00 H
ATOM 815 N THR A 54 5.748 3.319 2.489 1.00 0.00 N
ATOM 816 CA THR A 54 7.060 2.732 2.273 1.00 0.00 C
ATOM 817 C THR A 54 7.204 1.437 3.074 1.00 0.00 C
ATOM 818 O THR A 54 7.791 0.468 2.595 1.00 0.00 O
ATOM 819 CB THR A 54 8.113 3.785 2.625 1.00 0.00 C
ATOM 820 OG1 THR A 54 9.028 3.740 1.534 1.00 0.00 O
ATOM 821 CG2 THR A 54 8.957 3.386 3.837 1.00 0.00 C
ATOM 822 H THR A 54 5.756 4.273 2.788 1.00 0.00 H
ATOM 823 HA THR A 54 7.148 2.468 1.219 1.00 0.00 H
ATOM 824 HB THR A 54 7.652 4.761 2.776 1.00 0.00 H
ATOM 825 HG1 THR A 54 9.357 4.660 1.325 1.00 0.00 H
ATOM 826 1HG2 THR A 54 9.527 4.248 4.183 1.00 0.00 H
ATOM 827 2HG2 THR A 54 8.303 3.039 4.637 1.00 0.00 H
ATOM 828 3HG2 THR A 54 9.642 2.587 3.555 1.00 0.00 H
ATOM 829 N LYS A 55 6.657 1.462 4.281 1.00 0.00 N
ATOM 830 CA LYS A 55 6.718 0.302 5.154 1.00 0.00 C
ATOM 831 C LYS A 55 5.769 -0.777 4.627 1.00 0.00 C
ATOM 832 O LYS A 55 6.172 -1.922 4.433 1.00 0.00 O
ATOM 833 CB LYS A 55 6.444 0.707 6.604 1.00 0.00 C
ATOM 834 CG LYS A 55 7.741 0.755 7.414 1.00 0.00 C
ATOM 835 CD LYS A 55 8.048 2.182 7.873 1.00 0.00 C
ATOM 836 CE LYS A 55 8.492 2.203 9.337 1.00 0.00 C
ATOM 837 NZ LYS A 55 8.296 3.550 9.919 1.00 0.00 N
ATOM 838 H LYS A 55 6.182 2.254 4.664 1.00 0.00 H
ATOM 839 HA LYS A 55 7.736 -0.084 5.114 1.00 0.00 H
ATOM 840 1HB LYS A 55 5.960 1.684 6.628 1.00 0.00 H
ATOM 841 2HB LYS A 55 5.752 -0.002 7.059 1.00 0.00 H
ATOM 842 1HG LYS A 55 7.657 0.100 8.281 1.00 0.00 H
ATOM 843 2HG LYS A 55 8.566 0.379 6.809 1.00 0.00 H
ATOM 844 1HD LYS A 55 8.830 2.609 7.246 1.00 0.00 H
ATOM 845 2HD LYS A 55 7.163 2.806 7.749 1.00 0.00 H
ATOM 846 1HE LYS A 55 7.923 1.468 9.906 1.00 0.00 H
ATOM 847 2HE LYS A 55 9.541 1.919 9.409 1.00 0.00 H
ATOM 848 1HZ LYS A 55 7.729 4.099 9.304 1.00 0.00 H
ATOM 849 2HZ LYS A 55 7.841 3.467 10.806 1.00 0.00 H
ATOM 850 3HZ LYS A 55 9.184 3.993 10.040 1.00 0.00 H
ATOM 851 N GLN A 56 4.526 -0.372 4.411 1.00 0.00 N
ATOM 852 CA GLN A 56 3.516 -1.289 3.911 1.00 0.00 C
ATOM 853 C GLN A 56 3.982 -1.927 2.601 1.00 0.00 C
ATOM 854 O GLN A 56 3.887 -3.142 2.430 1.00 0.00 O
ATOM 855 CB GLN A 56 2.173 -0.580 3.729 1.00 0.00 C
ATOM 856 CG GLN A 56 1.646 -0.053 5.065 1.00 0.00 C
ATOM 857 CD GLN A 56 1.675 -1.145 6.136 1.00 0.00 C
ATOM 858 OE1 GLN A 56 2.437 -1.096 7.088 1.00 0.00 O
ATOM 859 NE2 GLN A 56 0.806 -2.130 5.928 1.00 0.00 N
ATOM 860 H GLN A 56 4.206 0.562 4.572 1.00 0.00 H
ATOM 861 HA GLN A 56 3.414 -2.055 4.680 1.00 0.00 H
ATOM 862 1HB GLN A 56 2.286 0.246 3.027 1.00 0.00 H
ATOM 863 2HB GLN A 56 1.449 -1.270 3.295 1.00 0.00 H
ATOM 864 1HG GLN A 56 2.249 0.796 5.388 1.00 0.00 H
ATOM 865 2HG GLN A 56 0.626 0.311 4.939 1.00 0.00 H
ATOM 866 1HE2 GLN A 56 0.210 -2.109 5.126 1.00 0.00 H
ATOM 867 2HE2 GLN A 56 0.750 -2.892 6.574 1.00 0.00 H
ATOM 868 N LEU A 57 4.474 -1.080 1.709 1.00 0.00 N
ATOM 869 CA LEU A 57 4.954 -1.546 0.419 1.00 0.00 C
ATOM 870 C LEU A 57 6.009 -2.632 0.635 1.00 0.00 C
ATOM 871 O LEU A 57 5.861 -3.752 0.147 1.00 0.00 O
ATOM 872 CB LEU A 57 5.446 -0.369 -0.426 1.00 0.00 C
ATOM 873 CG LEU A 57 6.191 -0.733 -1.712 1.00 0.00 C
ATOM 874 CD1 LEU A 57 7.659 -1.054 -1.424 1.00 0.00 C
ATOM 875 CD2 LEU A 57 5.489 -1.875 -2.448 1.00 0.00 C
ATOM 876 H LEU A 57 4.547 -0.094 1.856 1.00 0.00 H
ATOM 877 HA LEU A 57 4.106 -1.987 -0.105 1.00 0.00 H
ATOM 878 1HB LEU A 57 4.587 0.248 -0.689 1.00 0.00 H
ATOM 879 2HB LEU A 57 6.103 0.245 0.190 1.00 0.00 H
ATOM 880 HG LEU A 57 6.175 0.134 -2.373 1.00 0.00 H
ATOM 881 1HD1 LEU A 57 7.905 -0.748 -0.407 1.00 0.00 H
ATOM 882 2HD1 LEU A 57 7.824 -2.126 -1.531 1.00 0.00 H
ATOM 883 3HD1 LEU A 57 8.294 -0.516 -2.128 1.00 0.00 H
ATOM 884 1HD2 LEU A 57 5.106 -2.594 -1.723 1.00 0.00 H
ATOM 885 2HD2 LEU A 57 4.662 -1.475 -3.035 1.00 0.00 H
ATOM 886 3HD2 LEU A 57 6.198 -2.371 -3.111 1.00 0.00 H
ATOM 887 N PHE A 58 7.051 -2.264 1.366 1.00 0.00 N
ATOM 888 CA PHE A 58 8.131 -3.193 1.652 1.00 0.00 C
ATOM 889 C PHE A 58 7.583 -4.543 2.121 1.00 0.00 C
ATOM 890 O PHE A 58 8.220 -5.577 1.928 1.00 0.00 O
ATOM 891 CB PHE A 58 8.965 -2.577 2.777 1.00 0.00 C
ATOM 892 CG PHE A 58 10.469 -2.819 2.640 1.00 0.00 C
ATOM 893 CD1 PHE A 58 10.943 -4.084 2.482 1.00 0.00 C
ATOM 894 CD2 PHE A 58 11.333 -1.769 2.676 1.00 0.00 C
ATOM 895 CE1 PHE A 58 12.339 -4.309 2.355 1.00 0.00 C
ATOM 896 CE2 PHE A 58 12.730 -1.994 2.549 1.00 0.00 C
ATOM 897 CZ PHE A 58 13.203 -3.259 2.391 1.00 0.00 C
ATOM 898 H PHE A 58 7.163 -1.351 1.759 1.00 0.00 H
ATOM 899 HA PHE A 58 8.691 -3.332 0.728 1.00 0.00 H
ATOM 900 1HB PHE A 58 8.781 -1.503 2.805 1.00 0.00 H
ATOM 901 2HB PHE A 58 8.627 -2.983 3.731 1.00 0.00 H
ATOM 902 HD1 PHE A 58 10.250 -4.925 2.453 1.00 0.00 H
ATOM 903 HD2 PHE A 58 10.954 -0.755 2.803 1.00 0.00 H
ATOM 904 HE1 PHE A 58 12.719 -5.323 2.229 1.00 0.00 H
ATOM 905 HE2 PHE A 58 13.422 -1.153 2.578 1.00 0.00 H
ATOM 906 HZ PHE A 58 14.275 -3.432 2.294 1.00 0.00 H
ATOM 907 N GLU A 59 6.406 -4.489 2.728 1.00 0.00 N
ATOM 908 CA GLU A 59 5.765 -5.694 3.226 1.00 0.00 C
ATOM 909 C GLU A 59 5.105 -6.458 2.076 1.00 0.00 C
ATOM 910 O GLU A 59 5.035 -7.686 2.101 1.00 0.00 O
ATOM 911 CB GLU A 59 4.748 -5.363 4.319 1.00 0.00 C
ATOM 912 CG GLU A 59 5.378 -5.483 5.709 1.00 0.00 C
ATOM 913 CD GLU A 59 5.306 -6.924 6.220 1.00 0.00 C
ATOM 914 OE1 GLU A 59 4.234 -7.284 6.754 1.00 0.00 O
ATOM 915 OE2 GLU A 59 6.324 -7.632 6.066 1.00 0.00 O
ATOM 916 H GLU A 59 5.894 -3.644 2.881 1.00 0.00 H
ATOM 917 HA GLU A 59 6.568 -6.294 3.655 1.00 0.00 H
ATOM 918 1HB GLU A 59 4.369 -4.351 4.174 1.00 0.00 H
ATOM 919 2HB GLU A 59 3.894 -6.036 4.243 1.00 0.00 H
ATOM 920 1HG GLU A 59 6.417 -5.159 5.670 1.00 0.00 H
ATOM 921 2HG GLU A 59 4.862 -4.821 6.404 1.00 0.00 H
ATOM 922 N ILE A 60 4.637 -5.699 1.095 1.00 0.00 N
ATOM 923 CA ILE A 60 3.985 -6.289 -0.061 1.00 0.00 C
ATOM 924 C ILE A 60 4.981 -7.184 -0.801 1.00 0.00 C
ATOM 925 O ILE A 60 4.670 -8.330 -1.124 1.00 0.00 O
ATOM 926 CB ILE A 60 3.366 -5.200 -0.940 1.00 0.00 C
ATOM 927 CG1 ILE A 60 2.334 -4.386 -0.158 1.00 0.00 C
ATOM 928 CG2 ILE A 60 2.775 -5.798 -2.219 1.00 0.00 C
ATOM 929 CD1 ILE A 60 1.655 -3.351 -1.059 1.00 0.00 C
ATOM 930 H ILE A 60 4.698 -4.701 1.083 1.00 0.00 H
ATOM 931 HA ILE A 60 3.168 -6.910 0.306 1.00 0.00 H
ATOM 932 HB ILE A 60 4.157 -4.514 -1.242 1.00 0.00 H
ATOM 933 1HG1 ILE A 60 1.583 -5.053 0.264 1.00 0.00 H
ATOM 934 2HG1 ILE A 60 2.819 -3.883 0.678 1.00 0.00 H
ATOM 935 1HG2 ILE A 60 3.399 -6.627 -2.554 1.00 0.00 H
ATOM 936 2HG2 ILE A 60 1.767 -6.160 -2.019 1.00 0.00 H
ATOM 937 3HG2 ILE A 60 2.740 -5.033 -2.995 1.00 0.00 H
ATOM 938 1HD1 ILE A 60 0.692 -3.073 -0.631 1.00 0.00 H
ATOM 939 2HD1 ILE A 60 2.288 -2.467 -1.136 1.00 0.00 H
ATOM 940 3HD1 ILE A 60 1.503 -3.777 -2.050 1.00 0.00 H
ATOM 941 N ASP A 61 6.158 -6.628 -1.049 1.00 0.00 N
ATOM 942 CA ASP A 61 7.201 -7.362 -1.745 1.00 0.00 C
ATOM 943 C ASP A 61 7.638 -8.553 -0.890 1.00 0.00 C
ATOM 944 O ASP A 61 8.137 -9.548 -1.413 1.00 0.00 O
ATOM 945 CB ASP A 61 8.427 -6.479 -1.988 1.00 0.00 C
ATOM 946 CG ASP A 61 9.354 -6.954 -3.108 1.00 0.00 C
ATOM 947 OD1 ASP A 61 9.251 -6.378 -4.212 1.00 0.00 O
ATOM 948 OD2 ASP A 61 10.144 -7.884 -2.835 1.00 0.00 O
ATOM 949 H ASP A 61 6.403 -5.696 -0.783 1.00 0.00 H
ATOM 950 HA ASP A 61 6.753 -7.669 -2.690 1.00 0.00 H
ATOM 951 1HB ASP A 61 8.089 -5.470 -2.220 1.00 0.00 H
ATOM 952 2HB ASP A 61 9.001 -6.418 -1.063 1.00 0.00 H
ATOM 953 N SER A 62 7.434 -8.413 0.412 1.00 0.00 N
ATOM 954 CA SER A 62 7.800 -9.465 1.345 1.00 0.00 C
ATOM 955 C SER A 62 6.780 -10.603 1.277 1.00 0.00 C
ATOM 956 O SER A 62 7.095 -11.745 1.607 1.00 0.00 O
ATOM 957 CB SER A 62 7.900 -8.925 2.773 1.00 0.00 C
ATOM 958 OG SER A 62 9.067 -9.396 3.441 1.00 0.00 O
ATOM 959 H SER A 62 7.027 -7.601 0.830 1.00 0.00 H
ATOM 960 HA SER A 62 8.781 -9.811 1.018 1.00 0.00 H
ATOM 961 1HB SER A 62 7.911 -7.835 2.748 1.00 0.00 H
ATOM 962 2HB SER A 62 7.015 -9.222 3.335 1.00 0.00 H
ATOM 963 HG SER A 62 9.588 -8.624 3.804 1.00 0.00 H
ATOM 964 N VAL A 63 5.576 -10.251 0.848 1.00 0.00 N
ATOM 965 CA VAL A 63 4.508 -11.229 0.733 1.00 0.00 C
ATOM 966 C VAL A 63 4.805 -12.169 -0.436 1.00 0.00 C
ATOM 967 O VAL A 63 4.833 -11.742 -1.589 1.00 0.00 O
ATOM 968 CB VAL A 63 3.160 -10.517 0.600 1.00 0.00 C
ATOM 969 CG1 VAL A 63 2.092 -11.464 0.048 1.00 0.00 C
ATOM 970 CG2 VAL A 63 2.722 -9.916 1.937 1.00 0.00 C
ATOM 971 H VAL A 63 5.328 -9.320 0.582 1.00 0.00 H
ATOM 972 HA VAL A 63 4.492 -11.809 1.656 1.00 0.00 H
ATOM 973 HB VAL A 63 3.282 -9.699 -0.111 1.00 0.00 H
ATOM 974 1HG1 VAL A 63 1.177 -10.905 -0.148 1.00 0.00 H
ATOM 975 2HG1 VAL A 63 2.449 -11.913 -0.879 1.00 0.00 H
ATOM 976 3HG1 VAL A 63 1.890 -12.248 0.777 1.00 0.00 H
ATOM 977 1HG2 VAL A 63 3.023 -10.579 2.749 1.00 0.00 H
ATOM 978 2HG2 VAL A 63 3.193 -8.942 2.069 1.00 0.00 H
ATOM 979 3HG2 VAL A 63 1.638 -9.800 1.946 1.00 0.00 H
ATOM 980 N ASP A 64 5.021 -13.432 -0.098 1.00 0.00 N
ATOM 981 CA ASP A 64 5.316 -14.436 -1.106 1.00 0.00 C
ATOM 982 C ASP A 64 4.017 -14.857 -1.796 1.00 0.00 C
ATOM 983 O ASP A 64 2.944 -14.801 -1.196 1.00 0.00 O
ATOM 984 CB ASP A 64 5.941 -15.682 -0.475 1.00 0.00 C
ATOM 985 CG ASP A 64 6.670 -16.606 -1.453 1.00 0.00 C
ATOM 986 OD1 ASP A 64 6.524 -17.836 -1.287 1.00 0.00 O
ATOM 987 OD2 ASP A 64 7.356 -16.061 -2.344 1.00 0.00 O
ATOM 988 H ASP A 64 4.997 -13.771 0.842 1.00 0.00 H
ATOM 989 HA ASP A 64 6.016 -13.958 -1.790 1.00 0.00 H
ATOM 990 1HB ASP A 64 6.644 -15.367 0.297 1.00 0.00 H
ATOM 991 2HB ASP A 64 5.156 -16.252 0.023 1.00 0.00 H
ATOM 992 N THR A 65 4.156 -15.269 -3.048 1.00 0.00 N
ATOM 993 CA THR A 65 3.007 -15.698 -3.826 1.00 0.00 C
ATOM 994 C THR A 65 3.058 -17.209 -4.064 1.00 0.00 C
ATOM 995 O THR A 65 2.084 -17.915 -3.811 1.00 0.00 O
ATOM 996 CB THR A 65 2.978 -14.880 -5.118 1.00 0.00 C
ATOM 997 OG1 THR A 65 4.204 -15.210 -5.765 1.00 0.00 O
ATOM 998 CG2 THR A 65 3.086 -13.375 -4.861 1.00 0.00 C
ATOM 999 H THR A 65 5.032 -15.311 -3.528 1.00 0.00 H
ATOM 1000 HA THR A 65 2.105 -15.497 -3.247 1.00 0.00 H
ATOM 1001 HB THR A 65 2.090 -15.112 -5.706 1.00 0.00 H
ATOM 1002 HG1 THR A 65 4.377 -14.572 -6.516 1.00 0.00 H
ATOM 1003 1HG2 THR A 65 2.500 -12.837 -5.605 1.00 0.00 H
ATOM 1004 2HG2 THR A 65 2.705 -13.149 -3.865 1.00 0.00 H
ATOM 1005 3HG2 THR A 65 4.130 -13.069 -4.929 1.00 0.00 H
ATOM 1006 N GLU A 66 4.206 -17.660 -4.549 1.00 0.00 N
ATOM 1007 CA GLU A 66 4.398 -19.074 -4.824 1.00 0.00 C
ATOM 1008 C GLU A 66 3.595 -19.488 -6.059 1.00 0.00 C
ATOM 1009 O GLU A 66 3.306 -20.668 -6.249 1.00 0.00 O
ATOM 1010 CB GLU A 66 4.017 -19.925 -3.612 1.00 0.00 C
ATOM 1011 CG GLU A 66 5.171 -20.842 -3.201 1.00 0.00 C
ATOM 1012 CD GLU A 66 4.662 -22.242 -2.852 1.00 0.00 C
ATOM 1013 OE1 GLU A 66 3.667 -22.312 -2.099 1.00 0.00 O
ATOM 1014 OE2 GLU A 66 5.279 -23.210 -3.347 1.00 0.00 O
ATOM 1015 H GLU A 66 4.994 -17.079 -4.752 1.00 0.00 H
ATOM 1016 HA GLU A 66 5.464 -19.188 -5.021 1.00 0.00 H
ATOM 1017 1HB GLU A 66 3.748 -19.277 -2.778 1.00 0.00 H
ATOM 1018 2HB GLU A 66 3.137 -20.525 -3.846 1.00 0.00 H
ATOM 1019 1HG GLU A 66 5.896 -20.906 -4.013 1.00 0.00 H
ATOM 1020 2HG GLU A 66 5.691 -20.416 -2.343 1.00 0.00 H
ATOM 1021 N GLY A 67 3.257 -18.493 -6.867 1.00 0.00 N
ATOM 1022 CA GLY A 67 2.493 -18.739 -8.078 1.00 0.00 C
ATOM 1023 C GLY A 67 1.013 -18.956 -7.758 1.00 0.00 C
ATOM 1024 O GLY A 67 0.430 -19.965 -8.153 1.00 0.00 O
ATOM 1025 H GLY A 67 3.496 -17.535 -6.705 1.00 0.00 H
ATOM 1026 1HA GLY A 67 2.601 -17.894 -8.758 1.00 0.00 H
ATOM 1027 2HA GLY A 67 2.890 -19.615 -8.591 1.00 0.00 H
ATOM 1028 N LYS A 68 0.447 -17.994 -7.045 1.00 0.00 N
ATOM 1029 CA LYS A 68 -0.954 -18.067 -6.667 1.00 0.00 C
ATOM 1030 C LYS A 68 -1.664 -16.784 -7.105 1.00 0.00 C
ATOM 1031 O LYS A 68 -1.689 -15.802 -6.366 1.00 0.00 O
ATOM 1032 CB LYS A 68 -1.091 -18.367 -5.173 1.00 0.00 C
ATOM 1033 CG LYS A 68 -0.409 -19.688 -4.814 1.00 0.00 C
ATOM 1034 CD LYS A 68 -0.670 -20.061 -3.353 1.00 0.00 C
ATOM 1035 CE LYS A 68 0.075 -21.342 -2.973 1.00 0.00 C
ATOM 1036 NZ LYS A 68 -0.818 -22.516 -3.092 1.00 0.00 N
ATOM 1037 H LYS A 68 0.928 -17.176 -6.728 1.00 0.00 H
ATOM 1038 HA LYS A 68 -1.394 -18.906 -7.206 1.00 0.00 H
ATOM 1039 1HB LYS A 68 -0.650 -17.556 -4.594 1.00 0.00 H
ATOM 1040 2HB LYS A 68 -2.146 -18.413 -4.903 1.00 0.00 H
ATOM 1041 1HG LYS A 68 -0.777 -20.480 -5.466 1.00 0.00 H
ATOM 1042 2HG LYS A 68 0.664 -19.606 -4.987 1.00 0.00 H
ATOM 1043 1HD LYS A 68 -0.352 -19.244 -2.704 1.00 0.00 H
ATOM 1044 2HD LYS A 68 -1.739 -20.197 -3.194 1.00 0.00 H
ATOM 1045 1HE LYS A 68 0.943 -21.470 -3.619 1.00 0.00 H
ATOM 1046 2HE LYS A 68 0.448 -21.263 -1.951 1.00 0.00 H
ATOM 1047 1HZ LYS A 68 -1.467 -22.366 -3.838 1.00 0.00 H
ATOM 1048 2HZ LYS A 68 -0.272 -23.331 -3.283 1.00 0.00 H
ATOM 1049 3HZ LYS A 68 -1.318 -22.642 -2.235 1.00 0.00 H
ATOM 1050 N GLY A 69 -2.223 -16.835 -8.305 1.00 0.00 N
ATOM 1051 CA GLY A 69 -2.931 -15.689 -8.850 1.00 0.00 C
ATOM 1052 C GLY A 69 -3.704 -14.951 -7.755 1.00 0.00 C
ATOM 1053 O GLY A 69 -3.482 -13.762 -7.528 1.00 0.00 O
ATOM 1054 H GLY A 69 -2.198 -17.638 -8.900 1.00 0.00 H
ATOM 1055 1HA GLY A 69 -2.222 -15.009 -9.321 1.00 0.00 H
ATOM 1056 2HA GLY A 69 -3.621 -16.019 -9.627 1.00 0.00 H
ATOM 1057 N ASP A 70 -4.594 -15.686 -7.105 1.00 0.00 N
ATOM 1058 CA ASP A 70 -5.400 -15.115 -6.039 1.00 0.00 C
ATOM 1059 C ASP A 70 -4.540 -14.160 -5.210 1.00 0.00 C
ATOM 1060 O ASP A 70 -4.978 -13.062 -4.868 1.00 0.00 O
ATOM 1061 CB ASP A 70 -5.930 -16.205 -5.106 1.00 0.00 C
ATOM 1062 CG ASP A 70 -6.458 -17.458 -5.808 1.00 0.00 C
ATOM 1063 OD1 ASP A 70 -7.090 -17.287 -6.873 1.00 0.00 O
ATOM 1064 OD2 ASP A 70 -6.217 -18.557 -5.264 1.00 0.00 O
ATOM 1065 H ASP A 70 -4.768 -16.652 -7.295 1.00 0.00 H
ATOM 1066 HA ASP A 70 -6.222 -14.606 -6.543 1.00 0.00 H
ATOM 1067 1HB ASP A 70 -5.132 -16.498 -4.424 1.00 0.00 H
ATOM 1068 2HB ASP A 70 -6.730 -15.784 -4.497 1.00 0.00 H
ATOM 1069 N ILE A 71 -3.331 -14.612 -4.911 1.00 0.00 N
ATOM 1070 CA ILE A 71 -2.405 -13.811 -4.129 1.00 0.00 C
ATOM 1071 C ILE A 71 -1.655 -12.853 -5.057 1.00 0.00 C
ATOM 1072 O ILE A 71 -1.704 -11.638 -4.872 1.00 0.00 O
ATOM 1073 CB ILE A 71 -1.485 -14.710 -3.301 1.00 0.00 C
ATOM 1074 CG1 ILE A 71 -2.272 -15.451 -2.218 1.00 0.00 C
ATOM 1075 CG2 ILE A 71 -0.317 -13.912 -2.717 1.00 0.00 C
ATOM 1076 CD1 ILE A 71 -1.406 -16.515 -1.541 1.00 0.00 C
ATOM 1077 H ILE A 71 -2.982 -15.505 -5.193 1.00 0.00 H
ATOM 1078 HA ILE A 71 -2.995 -13.221 -3.427 1.00 0.00 H
ATOM 1079 HB ILE A 71 -1.060 -15.465 -3.962 1.00 0.00 H
ATOM 1080 1HG1 ILE A 71 -2.629 -14.740 -1.472 1.00 0.00 H
ATOM 1081 2HG1 ILE A 71 -3.152 -15.919 -2.658 1.00 0.00 H
ATOM 1082 1HG2 ILE A 71 0.110 -13.275 -3.491 1.00 0.00 H
ATOM 1083 2HG2 ILE A 71 -0.676 -13.293 -1.894 1.00 0.00 H
ATOM 1084 3HG2 ILE A 71 0.445 -14.600 -2.349 1.00 0.00 H
ATOM 1085 1HD1 ILE A 71 -0.413 -16.107 -1.349 1.00 0.00 H
ATOM 1086 2HD1 ILE A 71 -1.865 -16.813 -0.599 1.00 0.00 H
ATOM 1087 3HD1 ILE A 71 -1.321 -17.384 -2.194 1.00 0.00 H
ATOM 1088 N GLN A 72 -0.979 -13.436 -6.035 1.00 0.00 N
ATOM 1089 CA GLN A 72 -0.220 -12.649 -6.993 1.00 0.00 C
ATOM 1090 C GLN A 72 -0.997 -11.390 -7.380 1.00 0.00 C
ATOM 1091 O GLN A 72 -0.453 -10.287 -7.352 1.00 0.00 O
ATOM 1092 CB GLN A 72 0.130 -13.479 -8.230 1.00 0.00 C
ATOM 1093 CG GLN A 72 1.634 -13.441 -8.508 1.00 0.00 C
ATOM 1094 CD GLN A 72 1.916 -12.951 -9.930 1.00 0.00 C
ATOM 1095 OE1 GLN A 72 1.237 -13.301 -10.881 1.00 0.00 O
ATOM 1096 NE2 GLN A 72 2.953 -12.123 -10.021 1.00 0.00 N
ATOM 1097 H GLN A 72 -0.944 -14.425 -6.179 1.00 0.00 H
ATOM 1098 HA GLN A 72 0.700 -12.373 -6.477 1.00 0.00 H
ATOM 1099 1HB GLN A 72 -0.190 -14.511 -8.082 1.00 0.00 H
ATOM 1100 2HB GLN A 72 -0.414 -13.097 -9.094 1.00 0.00 H
ATOM 1101 1HG GLN A 72 2.124 -12.785 -7.789 1.00 0.00 H
ATOM 1102 2HG GLN A 72 2.058 -14.436 -8.372 1.00 0.00 H
ATOM 1103 1HE2 GLN A 72 3.468 -11.876 -9.201 1.00 0.00 H
ATOM 1104 2HE2 GLN A 72 3.217 -11.748 -10.910 1.00 0.00 H
ATOM 1105 N GLN A 73 -2.258 -11.596 -7.731 1.00 0.00 N
ATOM 1106 CA GLN A 73 -3.116 -10.490 -8.122 1.00 0.00 C
ATOM 1107 C GLN A 73 -3.159 -9.434 -7.016 1.00 0.00 C
ATOM 1108 O GLN A 73 -2.762 -8.290 -7.230 1.00 0.00 O
ATOM 1109 CB GLN A 73 -4.523 -10.983 -8.465 1.00 0.00 C
ATOM 1110 CG GLN A 73 -4.769 -10.935 -9.975 1.00 0.00 C
ATOM 1111 CD GLN A 73 -5.287 -12.279 -10.489 1.00 0.00 C
ATOM 1112 OE1 GLN A 73 -5.879 -13.063 -9.766 1.00 0.00 O
ATOM 1113 NE2 GLN A 73 -5.032 -12.501 -11.776 1.00 0.00 N
ATOM 1114 H GLN A 73 -2.693 -12.496 -7.750 1.00 0.00 H
ATOM 1115 HA GLN A 73 -2.657 -10.070 -9.018 1.00 0.00 H
ATOM 1116 1HB GLN A 73 -4.653 -12.003 -8.105 1.00 0.00 H
ATOM 1117 2HB GLN A 73 -5.263 -10.368 -7.953 1.00 0.00 H
ATOM 1118 1HG GLN A 73 -5.490 -10.151 -10.204 1.00 0.00 H
ATOM 1119 2HG GLN A 73 -3.843 -10.677 -10.489 1.00 0.00 H
ATOM 1120 1HE2 GLN A 73 -4.541 -11.815 -12.313 1.00 0.00 H
ATOM 1121 2HE2 GLN A 73 -5.331 -13.353 -12.205 1.00 0.00 H
ATOM 1122 N ALA A 74 -3.644 -9.856 -5.858 1.00 0.00 N
ATOM 1123 CA ALA A 74 -3.745 -8.960 -4.718 1.00 0.00 C
ATOM 1124 C ALA A 74 -2.411 -8.236 -4.525 1.00 0.00 C
ATOM 1125 O ALA A 74 -2.349 -7.010 -4.611 1.00 0.00 O
ATOM 1126 CB ALA A 74 -4.160 -9.756 -3.479 1.00 0.00 C
ATOM 1127 H ALA A 74 -3.965 -10.788 -5.692 1.00 0.00 H
ATOM 1128 HA ALA A 74 -4.519 -8.226 -4.940 1.00 0.00 H
ATOM 1129 1HB ALA A 74 -4.436 -10.769 -3.773 1.00 0.00 H
ATOM 1130 2HB ALA A 74 -3.327 -9.796 -2.776 1.00 0.00 H
ATOM 1131 3HB ALA A 74 -5.013 -9.270 -3.004 1.00 0.00 H
ATOM 1132 N ARG A 75 -1.377 -9.024 -4.269 1.00 0.00 N
ATOM 1133 CA ARG A 75 -0.049 -8.472 -4.064 1.00 0.00 C
ATOM 1134 C ARG A 75 0.233 -7.371 -5.088 1.00 0.00 C
ATOM 1135 O ARG A 75 0.314 -6.196 -4.735 1.00 0.00 O
ATOM 1136 CB ARG A 75 1.023 -9.558 -4.184 1.00 0.00 C
ATOM 1137 CG ARG A 75 2.224 -9.244 -3.290 1.00 0.00 C
ATOM 1138 CD ARG A 75 3.529 -9.705 -3.942 1.00 0.00 C
ATOM 1139 NE ARG A 75 4.424 -8.547 -4.157 1.00 0.00 N
ATOM 1140 CZ ARG A 75 4.379 -7.753 -5.235 1.00 0.00 C
ATOM 1141 NH1 ARG A 75 3.482 -7.987 -6.203 1.00 0.00 N
ATOM 1142 NH2 ARG A 75 5.231 -6.724 -5.346 1.00 0.00 N
ATOM 1143 H ARG A 75 -1.437 -10.020 -4.201 1.00 0.00 H
ATOM 1144 HA ARG A 75 -0.067 -8.070 -3.051 1.00 0.00 H
ATOM 1145 1HB ARG A 75 0.600 -10.523 -3.906 1.00 0.00 H
ATOM 1146 2HB ARG A 75 1.348 -9.639 -5.221 1.00 0.00 H
ATOM 1147 1HG ARG A 75 2.268 -8.173 -3.097 1.00 0.00 H
ATOM 1148 2HG ARG A 75 2.102 -9.737 -2.325 1.00 0.00 H
ATOM 1149 1HD ARG A 75 4.021 -10.443 -3.309 1.00 0.00 H
ATOM 1150 2HD ARG A 75 3.317 -10.193 -4.894 1.00 0.00 H
ATOM 1151 HE ARG A 75 5.105 -8.344 -3.454 1.00 0.00 H
ATOM 1152 1HH1 ARG A 75 2.847 -8.755 -6.121 1.00 0.00 H
ATOM 1153 2HH1 ARG A 75 3.449 -7.394 -7.008 1.00 0.00 H
ATOM 1154 1HH2 ARG A 75 5.900 -6.549 -4.624 1.00 0.00 H
ATOM 1155 2HH2 ARG A 75 5.197 -6.131 -6.151 1.00 0.00 H
ATOM 1156 N LYS A 76 0.375 -7.791 -6.337 1.00 0.00 N
ATOM 1157 CA LYS A 76 0.647 -6.855 -7.415 1.00 0.00 C
ATOM 1158 C LYS A 76 -0.371 -5.714 -7.361 1.00 0.00 C
ATOM 1159 O LYS A 76 -0.037 -4.566 -7.653 1.00 0.00 O
ATOM 1160 CB LYS A 76 0.683 -7.584 -8.760 1.00 0.00 C
ATOM 1161 CG LYS A 76 -0.731 -7.879 -9.262 1.00 0.00 C
ATOM 1162 CD LYS A 76 -0.719 -8.254 -10.746 1.00 0.00 C
ATOM 1163 CE LYS A 76 -0.015 -9.594 -10.967 1.00 0.00 C
ATOM 1164 NZ LYS A 76 0.655 -9.616 -12.286 1.00 0.00 N
ATOM 1165 H LYS A 76 0.308 -8.749 -6.616 1.00 0.00 H
ATOM 1166 HA LYS A 76 1.640 -6.441 -7.245 1.00 0.00 H
ATOM 1167 1HB LYS A 76 1.214 -6.976 -9.493 1.00 0.00 H
ATOM 1168 2HB LYS A 76 1.239 -8.516 -8.658 1.00 0.00 H
ATOM 1169 1HG LYS A 76 -1.165 -8.693 -8.681 1.00 0.00 H
ATOM 1170 2HG LYS A 76 -1.365 -7.005 -9.109 1.00 0.00 H
ATOM 1171 1HD LYS A 76 -1.742 -8.310 -11.119 1.00 0.00 H
ATOM 1172 2HD LYS A 76 -0.214 -7.475 -11.317 1.00 0.00 H
ATOM 1173 1HE LYS A 76 0.717 -9.761 -10.177 1.00 0.00 H
ATOM 1174 2HE LYS A 76 -0.740 -10.406 -10.907 1.00 0.00 H
ATOM 1175 1HZ LYS A 76 0.192 -10.270 -12.884 1.00 0.00 H
ATOM 1176 2HZ LYS A 76 0.616 -8.705 -12.695 1.00 0.00 H
ATOM 1177 3HZ LYS A 76 1.610 -9.889 -12.170 1.00 0.00 H
ATOM 1178 N ARG A 77 -1.591 -6.068 -6.986 1.00 0.00 N
ATOM 1179 CA ARG A 77 -2.659 -5.088 -6.890 1.00 0.00 C
ATOM 1180 C ARG A 77 -2.405 -4.139 -5.716 1.00 0.00 C
ATOM 1181 O ARG A 77 -2.904 -3.015 -5.703 1.00 0.00 O
ATOM 1182 CB ARG A 77 -4.016 -5.768 -6.703 1.00 0.00 C
ATOM 1183 CG ARG A 77 -4.667 -6.074 -8.053 1.00 0.00 C
ATOM 1184 CD ARG A 77 -6.193 -6.015 -7.952 1.00 0.00 C
ATOM 1185 NE ARG A 77 -6.743 -7.381 -7.805 1.00 0.00 N
ATOM 1186 CZ ARG A 77 -7.945 -7.654 -7.280 1.00 0.00 C
ATOM 1187 NH1 ARG A 77 -8.730 -6.657 -6.848 1.00 0.00 N
ATOM 1188 NH2 ARG A 77 -8.363 -8.924 -7.186 1.00 0.00 N
ATOM 1189 H ARG A 77 -1.854 -7.004 -6.750 1.00 0.00 H
ATOM 1190 HA ARG A 77 -2.632 -4.553 -7.839 1.00 0.00 H
ATOM 1191 1HB ARG A 77 -3.889 -6.692 -6.139 1.00 0.00 H
ATOM 1192 2HB ARG A 77 -4.672 -5.124 -6.116 1.00 0.00 H
ATOM 1193 1HG ARG A 77 -4.321 -5.357 -8.798 1.00 0.00 H
ATOM 1194 2HG ARG A 77 -4.360 -7.062 -8.394 1.00 0.00 H
ATOM 1195 1HD ARG A 77 -6.486 -5.402 -7.100 1.00 0.00 H
ATOM 1196 2HD ARG A 77 -6.607 -5.541 -8.842 1.00 0.00 H
ATOM 1197 HE ARG A 77 -6.183 -8.148 -8.117 1.00 0.00 H
ATOM 1198 1HH1 ARG A 77 -8.419 -5.710 -6.918 1.00 0.00 H
ATOM 1199 2HH1 ARG A 77 -9.627 -6.861 -6.456 1.00 0.00 H
ATOM 1200 1HH2 ARG A 77 -7.777 -9.668 -7.508 1.00 0.00 H
ATOM 1201 2HH2 ARG A 77 -9.260 -9.128 -6.794 1.00 0.00 H
ATOM 1202 N ALA A 78 -1.630 -4.628 -4.759 1.00 0.00 N
ATOM 1203 CA ALA A 78 -1.304 -3.838 -3.584 1.00 0.00 C
ATOM 1204 C ALA A 78 0.017 -3.103 -3.819 1.00 0.00 C
ATOM 1205 O ALA A 78 0.246 -2.034 -3.255 1.00 0.00 O
ATOM 1206 CB ALA A 78 -1.255 -4.747 -2.355 1.00 0.00 C
ATOM 1207 H ALA A 78 -1.229 -5.543 -4.778 1.00 0.00 H
ATOM 1208 HA ALA A 78 -2.099 -3.104 -3.446 1.00 0.00 H
ATOM 1209 1HB ALA A 78 -2.208 -4.699 -1.828 1.00 0.00 H
ATOM 1210 2HB ALA A 78 -1.066 -5.774 -2.670 1.00 0.00 H
ATOM 1211 3HB ALA A 78 -0.456 -4.418 -1.691 1.00 0.00 H
ATOM 1212 N ALA A 79 0.852 -3.705 -4.653 1.00 0.00 N
ATOM 1213 CA ALA A 79 2.145 -3.122 -4.969 1.00 0.00 C
ATOM 1214 C ALA A 79 1.935 -1.801 -5.713 1.00 0.00 C
ATOM 1215 O ALA A 79 2.690 -0.850 -5.522 1.00 0.00 O
ATOM 1216 CB ALA A 79 2.972 -4.122 -5.779 1.00 0.00 C
ATOM 1217 H ALA A 79 0.658 -4.575 -5.107 1.00 0.00 H
ATOM 1218 HA ALA A 79 2.658 -2.921 -4.029 1.00 0.00 H
ATOM 1219 1HB ALA A 79 2.720 -5.136 -5.470 1.00 0.00 H
ATOM 1220 2HB ALA A 79 2.753 -4.000 -6.840 1.00 0.00 H
ATOM 1221 3HB ALA A 79 4.033 -3.942 -5.604 1.00 0.00 H
ATOM 1222 N GLN A 80 0.904 -1.786 -6.547 1.00 0.00 N
ATOM 1223 CA GLN A 80 0.586 -0.598 -7.320 1.00 0.00 C
ATOM 1224 C GLN A 80 -0.251 0.372 -6.483 1.00 0.00 C
ATOM 1225 O GLN A 80 -0.050 1.584 -6.546 1.00 0.00 O
ATOM 1226 CB GLN A 80 -0.137 -0.966 -8.618 1.00 0.00 C
ATOM 1227 CG GLN A 80 0.799 -1.710 -9.574 1.00 0.00 C
ATOM 1228 CD GLN A 80 0.104 -2.000 -10.906 1.00 0.00 C
ATOM 1229 OE1 GLN A 80 -0.862 -2.741 -10.983 1.00 0.00 O
ATOM 1230 NE2 GLN A 80 0.647 -1.376 -11.947 1.00 0.00 N
ATOM 1231 H GLN A 80 0.295 -2.564 -6.697 1.00 0.00 H
ATOM 1232 HA GLN A 80 1.546 -0.144 -7.563 1.00 0.00 H
ATOM 1233 1HB GLN A 80 -1.002 -1.590 -8.392 1.00 0.00 H
ATOM 1234 2HB GLN A 80 -0.511 -0.063 -9.099 1.00 0.00 H
ATOM 1235 1HG GLN A 80 1.694 -1.113 -9.749 1.00 0.00 H
ATOM 1236 2HG GLN A 80 1.123 -2.645 -9.117 1.00 0.00 H
ATOM 1237 1HE2 GLN A 80 1.440 -0.781 -11.815 1.00 0.00 H
ATOM 1238 2HE2 GLN A 80 0.263 -1.502 -12.862 1.00 0.00 H
ATOM 1239 N GLU A 81 -1.172 -0.198 -5.720 1.00 0.00 N
ATOM 1240 CA GLU A 81 -2.040 0.601 -4.871 1.00 0.00 C
ATOM 1241 C GLU A 81 -1.206 1.446 -3.906 1.00 0.00 C
ATOM 1242 O GLU A 81 -1.359 2.666 -3.853 1.00 0.00 O
ATOM 1243 CB GLU A 81 -3.029 -0.285 -4.111 1.00 0.00 C
ATOM 1244 CG GLU A 81 -4.450 -0.105 -4.648 1.00 0.00 C
ATOM 1245 CD GLU A 81 -4.580 -0.680 -6.060 1.00 0.00 C
ATOM 1246 OE1 GLU A 81 -4.069 -0.021 -6.990 1.00 0.00 O
ATOM 1247 OE2 GLU A 81 -5.187 -1.767 -6.176 1.00 0.00 O
ATOM 1248 H GLU A 81 -1.328 -1.185 -5.675 1.00 0.00 H
ATOM 1249 HA GLU A 81 -2.591 1.250 -5.551 1.00 0.00 H
ATOM 1250 1HB GLU A 81 -2.732 -1.329 -4.201 1.00 0.00 H
ATOM 1251 2HB GLU A 81 -3.003 -0.036 -3.050 1.00 0.00 H
ATOM 1252 1HG GLU A 81 -5.159 -0.599 -3.984 1.00 0.00 H
ATOM 1253 2HG GLU A 81 -4.708 0.954 -4.658 1.00 0.00 H
ATOM 1254 N THR A 82 -0.343 0.765 -3.167 1.00 0.00 N
ATOM 1255 CA THR A 82 0.514 1.438 -2.206 1.00 0.00 C
ATOM 1256 C THR A 82 1.242 2.609 -2.870 1.00 0.00 C
ATOM 1257 O THR A 82 1.073 3.759 -2.468 1.00 0.00 O
ATOM 1258 CB THR A 82 1.460 0.397 -1.605 1.00 0.00 C
ATOM 1259 OG1 THR A 82 0.591 -0.528 -0.957 1.00 0.00 O
ATOM 1260 CG2 THR A 82 2.312 0.966 -0.469 1.00 0.00 C
ATOM 1261 H THR A 82 -0.226 -0.227 -3.216 1.00 0.00 H
ATOM 1262 HA THR A 82 -0.114 1.857 -1.420 1.00 0.00 H
ATOM 1263 HB THR A 82 2.087 -0.050 -2.376 1.00 0.00 H
ATOM 1264 HG1 THR A 82 0.397 -1.299 -1.565 1.00 0.00 H
ATOM 1265 1HG2 THR A 82 2.745 0.147 0.106 1.00 0.00 H
ATOM 1266 2HG2 THR A 82 3.110 1.580 -0.885 1.00 0.00 H
ATOM 1267 3HG2 THR A 82 1.687 1.576 0.183 1.00 0.00 H
ATOM 1268 N GLU A 83 2.038 2.275 -3.876 1.00 0.00 N
ATOM 1269 CA GLU A 83 2.792 3.284 -4.599 1.00 0.00 C
ATOM 1270 C GLU A 83 1.875 4.435 -5.018 1.00 0.00 C
ATOM 1271 O GLU A 83 2.229 5.603 -4.866 1.00 0.00 O
ATOM 1272 CB GLU A 83 3.497 2.676 -5.814 1.00 0.00 C
ATOM 1273 CG GLU A 83 4.450 1.556 -5.390 1.00 0.00 C
ATOM 1274 CD GLU A 83 5.895 2.056 -5.339 1.00 0.00 C
ATOM 1275 OE1 GLU A 83 6.398 2.222 -4.207 1.00 0.00 O
ATOM 1276 OE2 GLU A 83 6.464 2.261 -6.433 1.00 0.00 O
ATOM 1277 H GLU A 83 2.170 1.338 -4.197 1.00 0.00 H
ATOM 1278 HA GLU A 83 3.542 3.646 -3.895 1.00 0.00 H
ATOM 1279 1HB GLU A 83 2.756 2.284 -6.510 1.00 0.00 H
ATOM 1280 2HB GLU A 83 4.053 3.451 -6.342 1.00 0.00 H
ATOM 1281 1HG GLU A 83 4.158 1.176 -4.411 1.00 0.00 H
ATOM 1282 2HG GLU A 83 4.373 0.725 -6.091 1.00 0.00 H
ATOM 1283 N ARG A 84 0.713 4.065 -5.536 1.00 0.00 N
ATOM 1284 CA ARG A 84 -0.258 5.052 -5.977 1.00 0.00 C
ATOM 1285 C ARG A 84 -0.373 6.180 -4.949 1.00 0.00 C
ATOM 1286 O ARG A 84 -0.071 7.333 -5.252 1.00 0.00 O
ATOM 1287 CB ARG A 84 -1.635 4.416 -6.182 1.00 0.00 C
ATOM 1288 CG ARG A 84 -2.196 4.758 -7.564 1.00 0.00 C
ATOM 1289 CD ARG A 84 -3.231 3.722 -8.007 1.00 0.00 C
ATOM 1290 NE ARG A 84 -3.192 3.565 -9.478 1.00 0.00 N
ATOM 1291 CZ ARG A 84 -2.137 3.093 -10.156 1.00 0.00 C
ATOM 1292 NH1 ARG A 84 -1.027 2.730 -9.499 1.00 0.00 N
ATOM 1293 NH2 ARG A 84 -2.192 2.985 -11.491 1.00 0.00 N
ATOM 1294 H ARG A 84 0.432 3.113 -5.655 1.00 0.00 H
ATOM 1295 HA ARG A 84 0.132 5.422 -6.924 1.00 0.00 H
ATOM 1296 1HB ARG A 84 -1.560 3.334 -6.073 1.00 0.00 H
ATOM 1297 2HB ARG A 84 -2.320 4.767 -5.411 1.00 0.00 H
ATOM 1298 1HG ARG A 84 -2.653 5.747 -7.541 1.00 0.00 H
ATOM 1299 2HG ARG A 84 -1.384 4.799 -8.290 1.00 0.00 H
ATOM 1300 1HD ARG A 84 -3.029 2.765 -7.526 1.00 0.00 H
ATOM 1301 2HD ARG A 84 -4.227 4.033 -7.692 1.00 0.00 H
ATOM 1302 HE ARG A 84 -4.005 3.827 -9.999 1.00 0.00 H
ATOM 1303 1HH1 ARG A 84 -0.986 2.811 -8.504 1.00 0.00 H
ATOM 1304 2HH1 ARG A 84 -0.239 2.378 -10.005 1.00 0.00 H
ATOM 1305 1HH2 ARG A 84 -3.020 3.256 -11.981 1.00 0.00 H
ATOM 1306 2HH2 ARG A 84 -1.404 2.634 -11.997 1.00 0.00 H
ATOM 1307 N LEU A 85 -0.810 5.807 -3.755 1.00 0.00 N
ATOM 1308 CA LEU A 85 -0.969 6.773 -2.682 1.00 0.00 C
ATOM 1309 C LEU A 85 0.327 7.572 -2.525 1.00 0.00 C
ATOM 1310 O LEU A 85 0.306 8.802 -2.524 1.00 0.00 O
ATOM 1311 CB LEU A 85 -1.421 6.077 -1.397 1.00 0.00 C
ATOM 1312 CG LEU A 85 -2.931 6.044 -1.148 1.00 0.00 C
ATOM 1313 CD1 LEU A 85 -3.445 7.419 -0.717 1.00 0.00 C
ATOM 1314 CD2 LEU A 85 -3.677 5.510 -2.372 1.00 0.00 C
ATOM 1315 H LEU A 85 -1.054 4.867 -3.517 1.00 0.00 H
ATOM 1316 HA LEU A 85 -1.764 7.459 -2.974 1.00 0.00 H
ATOM 1317 1HB LEU A 85 -1.054 5.051 -1.414 1.00 0.00 H
ATOM 1318 2HB LEU A 85 -0.944 6.572 -0.551 1.00 0.00 H
ATOM 1319 HG LEU A 85 -3.126 5.355 -0.326 1.00 0.00 H
ATOM 1320 1HD1 LEU A 85 -4.531 7.445 -0.810 1.00 0.00 H
ATOM 1321 2HD1 LEU A 85 -3.165 7.603 0.320 1.00 0.00 H
ATOM 1322 3HD1 LEU A 85 -3.007 8.187 -1.354 1.00 0.00 H
ATOM 1323 1HD2 LEU A 85 -3.650 6.256 -3.167 1.00 0.00 H
ATOM 1324 2HD2 LEU A 85 -3.200 4.593 -2.718 1.00 0.00 H
ATOM 1325 3HD2 LEU A 85 -4.713 5.302 -2.104 1.00 0.00 H
ATOM 1326 N LEU A 86 1.424 6.840 -2.395 1.00 0.00 N
ATOM 1327 CA LEU A 86 2.726 7.464 -2.238 1.00 0.00 C
ATOM 1328 C LEU A 86 2.839 8.648 -3.201 1.00 0.00 C
ATOM 1329 O LEU A 86 3.195 9.753 -2.793 1.00 0.00 O
ATOM 1330 CB LEU A 86 3.840 6.429 -2.403 1.00 0.00 C
ATOM 1331 CG LEU A 86 4.726 6.196 -1.177 1.00 0.00 C
ATOM 1332 CD1 LEU A 86 5.600 4.953 -1.361 1.00 0.00 C
ATOM 1333 CD2 LEU A 86 5.558 7.439 -0.857 1.00 0.00 C
ATOM 1334 H LEU A 86 1.432 5.840 -2.397 1.00 0.00 H
ATOM 1335 HA LEU A 86 2.786 7.842 -1.217 1.00 0.00 H
ATOM 1336 1HB LEU A 86 3.387 5.479 -2.685 1.00 0.00 H
ATOM 1337 2HB LEU A 86 4.476 6.738 -3.232 1.00 0.00 H
ATOM 1338 HG LEU A 86 4.080 6.011 -0.319 1.00 0.00 H
ATOM 1339 1HD1 LEU A 86 4.985 4.127 -1.718 1.00 0.00 H
ATOM 1340 2HD1 LEU A 86 6.384 5.164 -2.087 1.00 0.00 H
ATOM 1341 3HD1 LEU A 86 6.052 4.683 -0.406 1.00 0.00 H
ATOM 1342 1HD2 LEU A 86 4.988 8.100 -0.204 1.00 0.00 H
ATOM 1343 2HD2 LEU A 86 6.480 7.141 -0.358 1.00 0.00 H
ATOM 1344 3HD2 LEU A 86 5.799 7.963 -1.782 1.00 0.00 H
ATOM 1345 N LYS A 87 2.530 8.377 -4.460 1.00 0.00 N
ATOM 1346 CA LYS A 87 2.592 9.405 -5.484 1.00 0.00 C
ATOM 1347 C LYS A 87 1.708 10.584 -5.071 1.00 0.00 C
ATOM 1348 O LYS A 87 2.159 11.729 -5.061 1.00 0.00 O
ATOM 1349 CB LYS A 87 2.237 8.821 -6.853 1.00 0.00 C
ATOM 1350 CG LYS A 87 3.280 7.793 -7.297 1.00 0.00 C
ATOM 1351 CD LYS A 87 4.499 8.480 -7.915 1.00 0.00 C
ATOM 1352 CE LYS A 87 4.268 8.775 -9.399 1.00 0.00 C
ATOM 1353 NZ LYS A 87 4.421 7.542 -10.202 1.00 0.00 N
ATOM 1354 H LYS A 87 2.241 7.475 -4.783 1.00 0.00 H
ATOM 1355 HA LYS A 87 3.624 9.750 -5.539 1.00 0.00 H
ATOM 1356 1HB LYS A 87 1.254 8.352 -6.809 1.00 0.00 H
ATOM 1357 2HB LYS A 87 2.175 9.622 -7.589 1.00 0.00 H
ATOM 1358 1HG LYS A 87 3.591 7.193 -6.442 1.00 0.00 H
ATOM 1359 2HG LYS A 87 2.836 7.110 -8.022 1.00 0.00 H
ATOM 1360 1HD LYS A 87 4.706 9.409 -7.384 1.00 0.00 H
ATOM 1361 2HD LYS A 87 5.377 7.844 -7.800 1.00 0.00 H
ATOM 1362 1HE LYS A 87 3.270 9.189 -9.542 1.00 0.00 H
ATOM 1363 2HE LYS A 87 4.978 9.529 -9.740 1.00 0.00 H
ATOM 1364 1HZ LYS A 87 5.383 7.269 -10.215 1.00 0.00 H
ATOM 1365 2HZ LYS A 87 3.872 6.810 -9.798 1.00 0.00 H
ATOM 1366 3HZ LYS A 87 4.110 7.713 -11.138 1.00 0.00 H
ATOM 1367 N GLU A 88 0.466 10.264 -4.740 1.00 0.00 N
ATOM 1368 CA GLU A 88 -0.485 11.282 -4.328 1.00 0.00 C
ATOM 1369 C GLU A 88 0.159 12.229 -3.312 1.00 0.00 C
ATOM 1370 O GLU A 88 0.171 13.443 -3.511 1.00 0.00 O
ATOM 1371 CB GLU A 88 -1.755 10.648 -3.757 1.00 0.00 C
ATOM 1372 CG GLU A 88 -2.432 9.750 -4.795 1.00 0.00 C
ATOM 1373 CD GLU A 88 -3.576 10.488 -5.494 1.00 0.00 C
ATOM 1374 OE1 GLU A 88 -4.740 10.135 -5.205 1.00 0.00 O
ATOM 1375 OE2 GLU A 88 -3.260 11.387 -6.303 1.00 0.00 O
ATOM 1376 H GLU A 88 0.107 9.331 -4.751 1.00 0.00 H
ATOM 1377 HA GLU A 88 -0.736 11.829 -5.236 1.00 0.00 H
ATOM 1378 1HB GLU A 88 -1.507 10.063 -2.871 1.00 0.00 H
ATOM 1379 2HB GLU A 88 -2.445 11.429 -3.441 1.00 0.00 H
ATOM 1380 1HG GLU A 88 -1.700 9.424 -5.533 1.00 0.00 H
ATOM 1381 2HG GLU A 88 -2.817 8.853 -4.309 1.00 0.00 H
ATOM 1382 N LEU A 89 0.678 11.638 -2.247 1.00 0.00 N
ATOM 1383 CA LEU A 89 1.322 12.413 -1.200 1.00 0.00 C
ATOM 1384 C LEU A 89 2.138 13.541 -1.835 1.00 0.00 C
ATOM 1385 O LEU A 89 1.836 14.717 -1.639 1.00 0.00 O
ATOM 1386 CB LEU A 89 2.142 11.501 -0.285 1.00 0.00 C
ATOM 1387 CG LEU A 89 2.772 12.170 0.939 1.00 0.00 C
ATOM 1388 CD1 LEU A 89 1.703 12.560 1.961 1.00 0.00 C
ATOM 1389 CD2 LEU A 89 3.855 11.281 1.553 1.00 0.00 C
ATOM 1390 H LEU A 89 0.665 10.650 -2.093 1.00 0.00 H
ATOM 1391 HA LEU A 89 0.535 12.857 -0.591 1.00 0.00 H
ATOM 1392 1HB LEU A 89 1.498 10.692 0.059 1.00 0.00 H
ATOM 1393 2HB LEU A 89 2.937 11.047 -0.876 1.00 0.00 H
ATOM 1394 HG LEU A 89 3.257 13.090 0.613 1.00 0.00 H
ATOM 1395 1HD1 LEU A 89 0.862 13.027 1.448 1.00 0.00 H
ATOM 1396 2HD1 LEU A 89 1.359 11.669 2.486 1.00 0.00 H
ATOM 1397 3HD1 LEU A 89 2.126 13.263 2.679 1.00 0.00 H
ATOM 1398 1HD2 LEU A 89 4.801 11.454 1.039 1.00 0.00 H
ATOM 1399 2HD2 LEU A 89 3.967 11.522 2.610 1.00 0.00 H
ATOM 1400 3HD2 LEU A 89 3.570 10.234 1.446 1.00 0.00 H
ATOM 1401 N GLU A 90 3.156 13.143 -2.583 1.00 0.00 N
ATOM 1402 CA GLU A 90 4.018 14.105 -3.249 1.00 0.00 C
ATOM 1403 C GLU A 90 3.192 15.281 -3.776 1.00 0.00 C
ATOM 1404 O GLU A 90 3.605 16.434 -3.662 1.00 0.00 O
ATOM 1405 CB GLU A 90 4.811 13.443 -4.376 1.00 0.00 C
ATOM 1406 CG GLU A 90 6.305 13.406 -4.047 1.00 0.00 C
ATOM 1407 CD GLU A 90 7.145 13.308 -5.322 1.00 0.00 C
ATOM 1408 OE1 GLU A 90 6.993 12.285 -6.025 1.00 0.00 O
ATOM 1409 OE2 GLU A 90 7.920 14.258 -5.566 1.00 0.00 O
ATOM 1410 H GLU A 90 3.395 12.184 -2.738 1.00 0.00 H
ATOM 1411 HA GLU A 90 4.709 14.453 -2.482 1.00 0.00 H
ATOM 1412 1HB GLU A 90 4.446 12.429 -4.537 1.00 0.00 H
ATOM 1413 2HB GLU A 90 4.654 13.989 -5.306 1.00 0.00 H
ATOM 1414 1HG GLU A 90 6.581 14.304 -3.494 1.00 0.00 H
ATOM 1415 2HG GLU A 90 6.518 12.555 -3.401 1.00 0.00 H
ATOM 1416 N GLN A 91 2.041 14.948 -4.342 1.00 0.00 N
ATOM 1417 CA GLN A 91 1.154 15.961 -4.887 1.00 0.00 C
ATOM 1418 C GLN A 91 0.363 16.634 -3.763 1.00 0.00 C
ATOM 1419 O GLN A 91 0.470 17.843 -3.562 1.00 0.00 O
ATOM 1420 CB GLN A 91 0.216 15.362 -5.936 1.00 0.00 C
ATOM 1421 CG GLN A 91 0.454 15.993 -7.309 1.00 0.00 C
ATOM 1422 CD GLN A 91 -0.836 16.018 -8.132 1.00 0.00 C
ATOM 1423 OE1 GLN A 91 -1.310 15.006 -8.622 1.00 0.00 O
ATOM 1424 NE2 GLN A 91 -1.375 17.227 -8.256 1.00 0.00 N
ATOM 1425 H GLN A 91 1.713 14.007 -4.431 1.00 0.00 H
ATOM 1426 HA GLN A 91 1.808 16.690 -5.367 1.00 0.00 H
ATOM 1427 1HB GLN A 91 0.371 14.285 -5.995 1.00 0.00 H
ATOM 1428 2HB GLN A 91 -0.820 15.519 -5.634 1.00 0.00 H
ATOM 1429 1HG GLN A 91 0.831 17.008 -7.186 1.00 0.00 H
ATOM 1430 2HG GLN A 91 1.220 15.431 -7.844 1.00 0.00 H
ATOM 1431 1HE2 GLN A 91 -0.935 18.017 -7.829 1.00 0.00 H
ATOM 1432 2HE2 GLN A 91 -2.220 17.347 -8.777 1.00 0.00 H
ATOM 1433 N ASN A 92 -0.413 15.822 -3.061 1.00 0.00 N
ATOM 1434 CA ASN A 92 -1.222 16.323 -1.964 1.00 0.00 C
ATOM 1435 C ASN A 92 -0.381 17.273 -1.108 1.00 0.00 C
ATOM 1436 O ASN A 92 -0.895 18.257 -0.579 1.00 0.00 O
ATOM 1437 CB ASN A 92 -1.703 15.180 -1.067 1.00 0.00 C
ATOM 1438 CG ASN A 92 -3.016 14.591 -1.587 1.00 0.00 C
ATOM 1439 OD1 ASN A 92 -4.071 15.198 -1.514 1.00 0.00 O
ATOM 1440 ND2 ASN A 92 -2.891 13.376 -2.116 1.00 0.00 N
ATOM 1441 H ASN A 92 -0.494 14.840 -3.232 1.00 0.00 H
ATOM 1442 HA ASN A 92 -2.067 16.825 -2.436 1.00 0.00 H
ATOM 1443 1HB ASN A 92 -0.942 14.402 -1.025 1.00 0.00 H
ATOM 1444 2HB ASN A 92 -1.843 15.546 -0.050 1.00 0.00 H
ATOM 1445 1HD2 ASN A 92 -1.995 12.934 -2.145 1.00 0.00 H
ATOM 1446 2HD2 ASN A 92 -3.694 12.906 -2.484 1.00 0.00 H
ATOM 1447 N ALA A 93 0.898 16.944 -0.999 1.00 0.00 N
ATOM 1448 CA ALA A 93 1.815 17.756 -0.217 1.00 0.00 C
ATOM 1449 C ALA A 93 1.569 19.234 -0.523 1.00 0.00 C
ATOM 1450 O ALA A 93 0.975 19.949 0.283 1.00 0.00 O
ATOM 1451 CB ALA A 93 3.254 17.330 -0.515 1.00 0.00 C
ATOM 1452 H ALA A 93 1.308 16.142 -1.432 1.00 0.00 H
ATOM 1453 HA ALA A 93 1.605 17.572 0.837 1.00 0.00 H
ATOM 1454 1HB ALA A 93 3.374 17.179 -1.587 1.00 0.00 H
ATOM 1455 2HB ALA A 93 3.940 18.108 -0.179 1.00 0.00 H
ATOM 1456 3HB ALA A 93 3.474 16.401 0.010 1.00 0.00 H
ATOM 1457 N SER A 94 2.038 19.650 -1.691 1.00 0.00 N
ATOM 1458 CA SER A 94 1.877 21.031 -2.113 1.00 0.00 C
ATOM 1459 C SER A 94 2.498 21.231 -3.497 1.00 0.00 C
ATOM 1460 O SER A 94 1.958 21.963 -4.324 1.00 0.00 O
ATOM 1461 CB SER A 94 2.506 21.993 -1.104 1.00 0.00 C
ATOM 1462 OG SER A 94 1.808 23.234 -1.042 1.00 0.00 O
ATOM 1463 H SER A 94 2.520 19.063 -2.341 1.00 0.00 H
ATOM 1464 HA SER A 94 0.800 21.197 -2.150 1.00 0.00 H
ATOM 1465 1HB SER A 94 2.512 21.530 -0.117 1.00 0.00 H
ATOM 1466 2HB SER A 94 3.546 22.175 -1.377 1.00 0.00 H
ATOM 1467 HG SER A 94 2.458 23.987 -0.945 1.00 0.00 H
ATOM 1468 N GLY A 95 3.626 20.566 -3.706 1.00 0.00 N
ATOM 1469 CA GLY A 95 4.327 20.661 -4.975 1.00 0.00 C
ATOM 1470 C GLY A 95 3.705 19.728 -6.016 1.00 0.00 C
ATOM 1471 O GLY A 95 3.009 18.777 -5.665 1.00 0.00 O
ATOM 1472 H GLY A 95 4.058 19.972 -3.027 1.00 0.00 H
ATOM 1473 1HA GLY A 95 4.293 21.689 -5.336 1.00 0.00 H
ATOM 1474 2HA GLY A 95 5.377 20.407 -4.834 1.00 0.00 H
ATOM 1475 N PRO A 96 3.987 20.042 -7.309 1.00 0.00 N
ATOM 1476 CA PRO A 96 3.463 19.242 -8.404 1.00 0.00 C
ATOM 1477 C PRO A 96 4.218 17.917 -8.524 1.00 0.00 C
ATOM 1478 O PRO A 96 5.344 17.794 -8.045 1.00 0.00 O
ATOM 1479 CB PRO A 96 3.605 20.121 -9.636 1.00 0.00 C
ATOM 1480 CG PRO A 96 4.622 21.190 -9.270 1.00 0.00 C
ATOM 1481 CD PRO A 96 4.807 21.161 -7.762 1.00 0.00 C
ATOM 1482 HA PRO A 96 2.509 18.998 -8.230 1.00 0.00 H
ATOM 1483 1HB PRO A 96 3.942 19.539 -10.494 1.00 0.00 H
ATOM 1484 2HB PRO A 96 2.650 20.568 -9.909 1.00 0.00 H
ATOM 1485 1HG PRO A 96 5.571 21.003 -9.775 1.00 0.00 H
ATOM 1486 2HG PRO A 96 4.277 22.172 -9.594 1.00 0.00 H
ATOM 1487 1HD PRO A 96 5.854 21.018 -7.494 1.00 0.00 H
ATOM 1488 2HD PRO A 96 4.486 22.097 -7.306 1.00 0.00 H
ATOM 1489 N SER A 97 3.568 16.958 -9.168 1.00 0.00 N
ATOM 1490 CA SER A 97 4.163 15.647 -9.358 1.00 0.00 C
ATOM 1491 C SER A 97 5.490 15.778 -10.109 1.00 0.00 C
ATOM 1492 O SER A 97 6.534 15.364 -9.608 1.00 0.00 O
ATOM 1493 CB SER A 97 3.215 14.715 -10.115 1.00 0.00 C
ATOM 1494 OG SER A 97 3.791 13.431 -10.336 1.00 0.00 O
ATOM 1495 H SER A 97 2.652 17.067 -9.555 1.00 0.00 H
ATOM 1496 HA SER A 97 4.329 15.257 -8.353 1.00 0.00 H
ATOM 1497 1HB SER A 97 2.288 14.605 -9.551 1.00 0.00 H
ATOM 1498 2HB SER A 97 2.953 15.165 -11.073 1.00 0.00 H
ATOM 1499 HG SER A 97 4.534 13.500 -11.002 1.00 0.00 H
ATOM 1500 N SER A 98 5.405 16.357 -11.298 1.00 0.00 N
ATOM 1501 CA SER A 98 6.586 16.548 -12.122 1.00 0.00 C
ATOM 1502 C SER A 98 6.452 17.835 -12.938 1.00 0.00 C
ATOM 1503 O SER A 98 7.329 18.696 -12.894 1.00 0.00 O
ATOM 1504 CB SER A 98 6.809 15.352 -13.051 1.00 0.00 C
ATOM 1505 OG SER A 98 5.643 15.039 -13.808 1.00 0.00 O
ATOM 1506 H SER A 98 4.552 16.691 -11.697 1.00 0.00 H
ATOM 1507 HA SER A 98 7.418 16.624 -11.422 1.00 0.00 H
ATOM 1508 1HB SER A 98 7.634 15.569 -13.729 1.00 0.00 H
ATOM 1509 2HB SER A 98 7.101 14.484 -12.460 1.00 0.00 H
ATOM 1510 HG SER A 98 5.108 14.336 -13.338 1.00 0.00 H
ATOM 1511 N GLY A 99 5.346 17.926 -13.663 1.00 0.00 N
ATOM 1512 CA GLY A 99 5.086 19.094 -14.488 1.00 0.00 C
ATOM 1513 C GLY A 99 5.014 18.715 -15.968 1.00 0.00 C
ATOM 1514 O GLY A 99 6.038 18.650 -16.647 1.00 0.00 O
ATOM 1515 H GLY A 99 4.638 17.221 -13.693 1.00 0.00 H
ATOM 1516 1HA GLY A 99 4.149 19.558 -14.181 1.00 0.00 H
ATOM 1517 2HA GLY A 99 5.872 19.833 -14.336 1.00 0.00 H
TER 1518 GLY A 99
ENDMDL
END

  The obtained atomic coordinates are scheduled to be registered in the Protein Data Bank (Protein Data Bank (PDB), operated by Research Collaboratory for Structural Bioinformatics (RCSB)) as the acceptance code PDB ID: 1UGO, which is incorporated herein. Is done.

In this way, a component (domain) having a protein structure / function is predicted by a computer from the full length of the protein, and various types of constructs that are extended or cut from the predicted region to the N-end and C-end are created. These proteins were expressed, and the expression of the actually obtained domain proteins was confirmed by SDS-PAGE. Further, whether or not it has a structure was confirmed for all individual domains by performing an HSQC measurement using NMR. Therefore, it was confirmed that the position of the actually structured (folded) domain on the protein sequence could be determined accurately. In addition, it was confirmed that a three-dimensional structure analysis can be easily performed by using a domain protein having such a small molecular weight.

[Example 5] In silico screening of compounds interacting with BAG5 domain In silico screening was performed based on the above three-dimensional structure analysis results to search for ligand candidates and to search for a pharmacophore of the BAG5 domain.

(1) Database optimization The low molecular compound catalog database provided by SPECS was used as a control database for the low molecular compound database. Those containing multiple molecules in one entry were divided into molecules, and the library excluding duplicates was used as the screening population. This contains 152323 molecules.

Based on Lipinski's Rule of 5, target-independent optimization was performed for the low molecular weight compound database. The narrowing conditions used here are as follows.
1. Molecular weight 100 or more and 500 or less2. Calculated LogP value (o / w) 5 or less (using XLOGP-1 algorithm)
3. 3. Number of hydrogen bond acceptor atoms (number of N and O contained in low molecular weight compound) 10 or less Number of hydrogen bond donor atoms (number of NH and OH contained in low molecular weight compound) 5 or less In addition, the following molecules were excluded in order to perform docking calculation appropriately.
1. 1. Number of end couplings that can rotate is 21 or more. 2. containing radicals The number of molecules of candidate compounds after narrowing down those containing atoms other than H, C, N, O, F, S, P, Cl, Br, and I was 103773.

(2) Binding site prediction
[1] Three-dimensional similarity search Non-redundat PDB published by NCBI using distance matrix comparison [Holm L., Sander C., J. Mol. Biol. (1993), 233: 123-138] Three-dimensional structure similarity search was performed for chain sets whose redundancy level is non-identical. The three-dimensional structure coordinate table 1 was used for the three-dimensional structure similarity search.
[2] Binding site prediction
FIG. 1B shows a superposition of the target BAG5 domain (red) and BAG1 of BAG1 (blue) / Hsc70 (green) (PDB: 1HX1) obtained as a complex structure. Superposition is based on the sequence alignment of the BAG5 domain and BAG1. Next, the predicted binding site is shown in yellow in Fig. 1 (c). Among the spheres generated by SPHGEN, Arg258, Arg261, Arg262, Thr265, Glu283, Ser286, Asp292 and Tyr294 (of the Hsc70 side residues involved in the interaction of BAG1 / Hsc70 (Science 291, 1553-1557 (2001)) Those having a center-to-center distance within 4.5 angstroms from the included atoms were selected as binding sites.

(3) Screening
[1] Primary screening
Dock4.0 was used to dock the entire low molecular weight compound library that was previously optimized for binding sites. The low molecular weight compounds were ranked based on the Dock's energy score.
[2] Secondary screening Detailed docking was performed on the top 10,000 molecules obtained as a result of the primary screening using AutoDock 3.0.5. After the completion of AutoDock, the compounds used in the docking were narrowed down to compounds within 4 angstroms, and the molecules for which calculation was abnormally completed were removed. As a result, docking structures were finally obtained for 9949 molecules.

(4) Search for important residues in the pharmacophore definition By selecting from the structure coordinate information of the target BAG5 domain within 4 angstroms for each ligand, important amino acids (stereostructure coordinates in the pharmacophore definition) Ser41, Asp42, Tyr46, Lys47, Glu50, Arg51, Thr54, Leu57, Phe58, Glu83, Leu86, Lys87, Glu90) shown in Table 1 were determined.

[Example 6] Measurement of cell proliferation (1) Cell culture
[1] HeLa cells 10% fetal bovine serum (FBS) for cell culture manufactured by ICN, 2 mM L-glutamine manufactured by Sigma, 100 U / ml penicillin, and HeLa in a humid environment of 37 ° C. containing 5% carbon dioxide using Sigma Dulbecco's modified medium (DMEM) containing 100 μg / ml of Sigma streptomycin Cells were cultured.
[2] 293 cells 10% fetal bovine serum (FBS) for ICN cell culture, 2 mM Sigma L-glutamine, 0.1 mM Sigma non-essential amino acid (Non-essential amino acids) Sigma Dulbecco MEM medium containing 1 mM sodium pyruvate, 100 U / ml penicillin, and 100 μg / ml streptomycin from Sigma (Dulbecco's modified essential medium (DMEM) medium) was used, and 293 cells were cultured in a humid environment of 37 ° C. containing 5% carbon dioxide.

(2) Gene transfer of the polypeptide of the present invention into cultured cells The mouse BAG5 domain cDNA consisting of the amino acid sequence shown in SEQ ID NO: 4 (SEQ ID NO: 3) was obtained from the expression vector of Example 3 using restriction enzymes BamHI and XhoI. This was excised, introduced into the BamHI / XhoI multicloning site of Invitrogen's entry vector (gateway system), and subcloned. Thereafter, the cDNA portion was introduced into pDEST26 (Invitrogen Corporation's pDEST26 (FLAG-tag and IRES-DsRed sequences were introduced and modified, hereinafter simply referred to as pDEST26)), which is an expression vector for animal cultured cells, by gateway LR reaction. The above 293 cells and HeLa cells were seeded in each well of a 96-well culture plate at 7500 and 5000 cells, respectively, and cultured in the presence of 37 ° C. and 5% CO ₂ for about 24 hours. Thereafter, the plasmid DNA into which each of the cDNAs had been introduced was transiently introduced into the cells using LipoFectamine 2000 (Invitrogen), which is a gene introduction reagent, according to a known protocol. At that time, as a control, cells into which only pDEST26 was introduced were prepared and cultured at 37 ° C. in the presence of 5% CO ₂ .

(3) Measurement of cell proliferation In order to measure cell proliferation, the following control experiment was conducted. 48 hours after gene introduction, SF (Cell Count Reagent SF) (manufactured by Nacalai Tesque) was added to each well so as to be 10% of the medium volume. Color reaction was performed for 1 to 4 hours in a carbon dioxide incubator, and the absorbance at 450 nm (reference wavelength: 600 nm) was measured using a microplate reader. Since the amount of the produced water-soluble formazan (WST-8 formazan) is proportional to the number of living cells, the number of living cells can be easily measured by measuring the above absorbance. The measurement was performed on 6 independent wells, and the average value and standard deviation (SE) were obtained. The result is shown in FIG. From FIG. 2, it can be seen that in both the 293 cell and the HeLa cell, the number of viable cells is reduced in the case where the cDNA expressing the BAG5 domain is introduced compared to the case where the cDNA is not introduced. From the above, it can be seen that, when the polypeptide of the present invention is expressed in cultured animal cells, the cells are controlled for growth inhibition.

[Example 7] Measurement of anti-apoptotic activity 2 × 10 ⁵ HeLa cells were seeded on a 1-well chamber slide (manufactured by Nunc). Thereafter, after culturing for about 24 hours, the plasmid DNA prepared in Example 6 was transiently transferred to cells according to a known protocol using LipoFectamine 2000 of Invitrogen, which is a gene introduction reagent. Introduced. At that time, as a control, cells into which only pDEST26 was introduced were prepared and cultured for 24 hours at 37 ° C. in the presence of 5% CO ₂ .

  Induction of apoptosis was performed by treating cells with 1.0 μg / ml anti-Fas antibody (CH11, manufactured by MBL) for 3 hours. The cells were fixed with 4% Para formaldehyde at room temperature for 1 hour after washing with PBS. After washing with PBS again, apoptotic cells were fluorescently stained using the In Situ Cell Death Detection Kit Fluorescein (Roche) according to the attached manual. The prepared specimens were evaluated for apoptosis by measuring fluorescence intensity with a Laser Scanning Cytometer (manufactured by Olympus). The results are shown in Table 6 below and FIG.

  As shown in FIG. 3, the cells to which the control vector was added were stained with the anti-Fas antibody, indicating that apoptosis was induced. In contrast, it was found that the induction of apoptosis was significantly suppressed in the system to which the vector containing the BAG5 domain was added.

[Example 8] Binding experiment with Hsc70 In order to confirm in vitro that the polypeptide of the present invention binds to Hsc70, the following experiment was performed using BIACORE-3000 (Biacore) as a surface plasmon resonance sensor. . Concentration of BAG5 domain prepared in the same manner as in Example 3 by immobilizing the full length (FL: 1-646 amino acid residue) and ATPase domain (1-386 amino acid residue) of mouse Hsc70 on a Biacore sensor chip. And measured.

  FIG. 4A shows an analysis example of the interaction between Hsc70FL and the BAG5 domain, and FIG. 4B shows an analysis example of the interaction between the Hsc70ATPase domain and the BAG5 domain. The concentration of the BAG5 domain that flowed was 250, 500 nM, 1, 2, 4 μM, and 6 μM from the bottom, and the respective sensorgrams were superimposed and displayed. As shown in FIG. 4, the dissociation rate was so fast that kinetic analysis was impossible. Therefore, when the affinity analysis in the equilibrium state was performed, the following results were obtained.

  As shown in Table 7, the BAG5 domain was found to bind with moderate strength to the Hsc70 and Hsc70 ATPase domains.

It is a figure showing the three-dimensional structure of a BAG5 domain. It is a graph showing the cell growth inhibitory activity of a BAG5 domain. It is a graph showing the anti-apoptotic activity of a BAG5 domain. It is a sensorgram which analyzed the interaction of BAG5 domain and Hsc70.

Claims (22)

  A polypeptide comprising the amino acid sequence shown in any one of SEQ ID NOs: 2, 4, and 6, or a salt thereof.   A polypeptide comprising the amino acid sequence shown in SEQ ID NO: 4, wherein 1 to 5 arbitrary amino acid residues are deleted from the N-terminus of the polypeptide, or a salt thereof.   A polypeptide comprising the amino acid sequence shown in SEQ ID NO: 2, wherein the amino acid sequence region forms a triple helix bundle or a salt thereof.   The amino acid sequence of the polypeptide according to any one of claims 1 to 3, comprising an amino acid sequence in which one or several amino acids are deleted, substituted, or added, and is substantially identical to the mouse BAG5 domain. A polypeptide having a function of inhibiting apoptosis or a function of inhibiting cell growth, or a salt thereof.   A polynucleotide encoding the polypeptide according to any one of claims 1 to 4.   The polynucleotide according to claim 5, comprising the base sequence shown in any one of SEQ ID NOs: 1, 3, and 5.   An expression vector capable of producing the polypeptide according to any one of claims 1 to 4 in the host cell when introduced into the host cell, wherein the expression vector controls expression in the host cell. An expression vector comprising the polynucleotide of claim 5 or 6 operably linked to a sequence.   A transformed cell comprising the expression vector according to claim 7.   The antibody with respect to the polypeptide as described in any one of Claims 1-4.   The manufacturing method of polypeptide or those salts as described in any one of Claims 1-4 including the process which culture | cultivates the transformed cell of Claim 8, and expresses polypeptide.   A method for producing a polypeptide or a salt thereof according to any one of claims 1 to 4, wherein a cell-free protein synthesis system is used.   A method for inhibiting cell proliferation, comprising a step of expressing a BAG5 domain in a host cell, wherein the BAG5 domain inhibits proliferation of the cell.   The method according to claim 12, wherein the BAG5 domain is the polypeptide according to any one of claims 1 to 4.   A polypeptide of unknown structure consisting of an amino acid sequence having 30% or more homology with the amino acid sequence shown in SEQ ID NO: 2 using information on the three-dimensional structure of the polypeptide according to any one of claims 1 to 4 A method for estimating the three-dimensional structure of a polypeptide having an unknown structure by performing homology modeling.   The method according to claim 14, wherein the polypeptide of unknown structure is a human BAG5 domain.   Characterized in that it comprises the steps of determining a ligand binding site of the polypeptide using information relating to the three-dimensional structure of the BAG5 domain polypeptide and identifying a compound that interacts with the binding site on a computer. A screening method for a compound that interacts with a BAG5 domain.   The method according to claim 16, wherein the ligand is Hsc70, Hsp70, Raf1 or a homologue thereof.   The polypeptide according to any one of claims 1 to 4, the BAG5 domain polypeptide is a human BAG5 domain estimated by the method according to claim 15, or a part thereof. The method described.   The compound specified by the method as described in any one of Claims 16-18 is prepared as a candidate compound, The process of contacting the polypeptide as described in any one of Claims 1-4, and the said candidate compound. And a step of confirming whether or not the polypeptide and the candidate compound interact with each other, and a method for screening a compound that interacts with a BAG5 domain. A method of screening for compounds that modulate apoptotic activity, the method comprising:
A compound identified by the method according to any one of claims 16 to 18 is prepared as a candidate compound, the polypeptide according to any one of claims 1 to 4, Hsc70, and the candidate compound, A step of contacting
Detecting whether the candidate compound inhibits the binding between the polypeptide and Hsc70,
A screening method, wherein a substance that inhibits the binding between the polypeptide and Hsc70 regulates apoptosis activity. A method of screening for a compound that modulates cell proliferation activity, the method comprising:
Culturing the transformed cell according to claim 8 in the presence or absence of a candidate compound under conditions suitable for the measurement of the cell proliferation activity,
A method comprising measuring the proliferation activity of the transformed cell.   The method according to claim 21, wherein the candidate compound is a compound obtained by the method according to any one of claims 16 to 19.

Images