JP2005218349A - Gene encoding new r-isomer-specific alcohol dehydrogenase, and method for producing optically active alcohol by utilizing the same - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a gene encoding an R-isomer-specific alcohol dehydrogenase derived from Pichia ofunaensis; to obtain a transformant capable of producing the enzyme; and to provide a method for producing various kinds of optically active alcohols by using the transformant expressing the enzyme. <P>SOLUTION: The polynucleotide is the one encoding the R-isomer-specific alcohol dehydrogenase or a homolog thereof, and having the following characteristics: (1) action: reducing a ketone by using β-NADH as a coenzyme to provide the optically active alcohol, and oxidizing an alcohol by using β-NAD as a coenzyme to provide a corresponding ketone or aldehyde; and (2) substrate specificity: (i) utilizing the β-NADH as the coenzyme for the reduction reaction, and utilizing the β-NAD as the coenzyme for the oxidation reaction, and (ii) forming 4-hydroxy-2-butanone by oxidizing (R)-1,3-butanediol. <P>COPYRIGHT: (C)2005,JPO&NCIPI

Description

  The present invention relates to a gene encoding an R-form-specific alcohol dehydrogenase dependent on β-nicotinamide adenine dinucleotide (hereinafter abbreviated as NAD), a transformant containing the gene, and an optical activity using the transformant The present invention relates to a method for producing alcohol. Optically active alcohols such as (R) -1,3-butanediol, (S) -1,3-butanediol, ethyl (S) -4-chloro-3-hydroxybutyrate, (R) -2-pentanol , (S) -2-pentanol and the like are useful compounds as various pharmaceutical raw materials and perfumes.

  In the study on glycerol metabolism in Pichia ofunaensis (former name: Hansenula ofunaensis), which is a methanol-assimilating yeast, the present inventors have made several dihydroxyacetone reductions induced by methanol. It has been reported that there are active enzymes (I-1, I-2, II). (Non-Patent Document 1)

  Furthermore, among these enzymes, the dihydroxyacetone reductase of type I-2 has been purified and its properties have been reported. (Non-Patent Document 2)

As a result of examination on substrate specificity using purified enzyme, this enzyme has not only reducing activity against dihydroxyacetone, but also a wide range of reducing activity against various ketones, β-ketoesters, etc., and at the same time, various alcohols, β- It has been found that it has high activity and stereoselectivity for hydroxy esters, and that this enzyme is an R-form-specific alcohol dehydrogenase rather than dihydroxyacetone reductase.
Agri. Biol. Chem., 52, 1951-1956 (1988) J. Biosci. Bioeng., 88, 148-152 (1999)

  However, Pichia offnaensis has many enzymes that reduce various ketones with various stereoselectivities, and it has been difficult to synthesize optically active alcohols with high optical purity using these bacteria. . In addition, the ability of the present bacterium to produce the enzyme used in the present invention is low, and in order to use this enzyme industrially, it was necessary to develop a method for efficiently mass-producing this enzyme.

  That is, the present invention obtains a gene encoding an R-form-specific alcohol dehydrogenase derived from Pichia offnaensis, obtains a transformant capable of efficiently producing the enzyme, It is an object of the present invention to provide a production method capable of efficiently giving various optically active alcohols with high optical purity by using transformants that are expressed.

In order to efficiently produce an R-form-specific alcohol dehydrogenase and use it for the production of an optically active alcohol, the present inventors have cloned a gene encoding the enzyme.
First, Pichia offnaensis was cultured in a suitable medium containing methanol as a C source and collected to obtain bacterial cells. The cells were disrupted, and the enzyme that reduces dihydroxyacetone was purified from the obtained cell-free extract until it became a single band by electrophoresis. Using the purified enzyme thus obtained, the N-terminal amino acid sequence and a part of the internal sequence were analyzed after partial digestion with V8 protease.

Using the obtained amino acid sequence, a primer for PCR was synthesized, the core region was amplified by PCR using chromosomal DNA derived from Pichia offnaensis as a template, and the base sequence was analyzed to obtain the core sequence.
The nucleotide sequences of the 5′- and 3′-peripheral regions of the core sequence were analyzed by digesting chromosomal DNA with a restriction enzyme and using LA PCR in vitro Cloning Kit (manufactured by Takara Bio Inc.). The obtained sequence was assembled with the sequence of the core region, and the entire base sequence of R-form-specific alcohol dehydrogenase was determined. Based on the obtained sequence, a primer capable of specifically amplifying only the open reading frame (ORF) of the enzyme is synthesized and inserted into an expression vector pSE420D (Japanese Patent Laid-Open No. 2000-189170) in E. coli. An expression plasmid pSE-HOD1 for this enzyme gene was constructed. Escherichia coli containing this single expression plasmid was cultured in an appropriate medium, and induced by isopropylthiogalactopyranoside (IPTG) or lactose to efficiently express the enzyme.

  Further, this enzyme gene is a gene encoding an enzyme for regenerating coenzyme NADH in the reduction reaction, for example, pSE-MF26 (Japanese Patent Laid-Open No. 2003-199595) containing formate dehydrogenase gene or glucose dehydrogenase. The plasmids pSF-POD1 and pSG-HOD1 that can be co-expressed with these enzymes were constructed by introducing the gene into pSE-BSG1 (WO 01/061014). The resulting co-expression plasmid is introduced into Escherichia coli and expressed in an appropriate medium with isopropylthiogalactopyranoside (IPTG) or lactose, thereby simultaneously expressing the enzyme and the enzyme for regenerating NADH. I was able to. An optically active alcohol could be synthesized by reacting with a ketone body using the obtained transformant.

That is, the present invention relates to a polynucleotide encoding the following R-isomer-specific alcohol dehydrogenase, a method for producing an R-isomer-specific alcohol dehydrogenase, and a method for producing an optically active alcohol using the same.
[1] The polynucleotide according to any one of (a) to (e) below, which encodes the R-form-specific alcohol dehydrogenase according to (1) to (3) below;
(1) Action Using reduced β-nicotinamide adenine dinucleotide as a coenzyme, the ketone is reduced to produce an optically active alcohol. Alcohol is oxidized using oxidized β-nicotinamide adenine dinucleotide as a coenzyme to produce the corresponding ketone or aldehyde.
(2) Substrate specificity (i) A reduced β-nicotinamide adenine dinucleotide is used as a coenzyme for the reduction reaction, and a coenzyme for oxidation reaction and an oxidized β-nicotinamide adenine dinucleotide are used.
(Ii) (R) -1,3-butanediol is oxidized to produce 4-hydroxy-2-butanone.
(Iii) The activity against (R) -1,3-butanediol is 20 times higher than the activity against (S) -1,3-butanediol.
(3) Molecular weight Molecular weight determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis is about 38,000.
(A) a polynucleotide comprising the base sequence set forth in SEQ ID NO: 1,
(B) a polynucleotide encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 2;
(C) a polynucleotide encoding a protein consisting of an amino acid sequence in which one or more amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of SEQ ID NO: 2;
(D) a polynucleotide that hybridizes under stringent conditions with DNA comprising the base sequence set forth in SEQ ID NO: 1;
(E) a polynucleotide encoding an amino acid sequence having 70% or more homology with the amino acid sequence set forth in SEQ ID NO: 2.
[2] A transformant capable of expressing the recombinant vector inserted with the polynucleotide according to [1].
[3] A method for producing an R-form-specific alcohol dehydrogenase according to (1) to (3) below, comprising a step of culturing the transformant according to [2] and collecting an expression product.
(1) Action Using reduced β-nicotinamide adenine dinucleotide as a coenzyme, the ketone is reduced to produce an optically active alcohol. Alcohol is oxidized using oxidized β-nicotinamide adenine dinucleotide as a coenzyme to produce the corresponding ketone or aldehyde.
(2) Substrate specificity (i) A reduced β-nicotinamide adenine dinucleotide is used as a coenzyme for the reduction reaction, and a coenzyme for oxidation reaction and an oxidized β-nicotinamide adenine dinucleotide are used.
(Ii) (R) -1,3-butanediol is oxidized to produce 4-hydroxy-2-butanone.
(Iii) The activity against (R) -1,3-butanediol is 20 times higher than the activity against (S) -1,3-butanediol.
(3) Molecular weight Molecular weight determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis is about 38,000.
[4] A method for producing an optically active alcohol by allowing the transformant according to [2] or a treated product thereof to act on a ketone.
[5] The ketone according to [4], wherein the ketone according to [4] is 4-hydroxy-2-butanone, and the optically active alcohol produced is (R) -1,3-butanediol. Of producing an optically active alcohol.
[6] The ketone according to [4] is 4-chloroacetoacetic acid ethyl ester, and the optically active alcohol produced is ethyl (S) -4-chloro-3-hydroxybutyrate, [4] The manufacturing method of optically active alcohol as described in 1 ..
[7] A method for producing an optically active alcohol by allowing the transformant according to [2] or a processed product thereof to act on racemic alcohol.
[8] The racemic alcohol according to [7] is (RS) -1,3-butanediol, and the optically active alcohol to be generated is (S) -1,3-butanediol, [7] The method for producing an optically active alcohol according to [7].

<R-specific alcohol dehydrogenase>
The R-form-specific alcohol dehydrogenase used in the present invention is characterized by the following properties (1) to (3).

(1) Action Using reduced β-nicotinamide adenine dinucleotide as a coenzyme, the ketone is reduced to produce an optically active alcohol. Alcohol is oxidized using oxidized β-nicotinamide adenine dinucleotide as a coenzyme to produce the corresponding ketone or aldehyde.
(2) Substrate specificity (i) A reduced β-nicotinamide adenine dinucleotide is used as a coenzyme for the reduction reaction, and a coenzyme for oxidation reaction and an oxidized β-nicotinamide adenine dinucleotide are used.
(Ii) (R) -1,3-butanediol is oxidized to produce 4-hydroxy-2-butanone.
(Iii) The activity against (R) -1,3-butanediol is 20 times higher than the activity against (S) -1,3-butanediol.
(3) Molecular weight The molecular weight by sodium dodecyl sulfate-polyacrylamide gel electrophoresis is about 38,000.

In the present invention, the activity of the R-form-specific alcohol dehydrogenase can be confirmed, for example, as follows.
Reducing activity measurement method for dihydroxyacetone (activity measurement method-1):
The reaction is carried out at 25 ° C. in a reaction solution containing 167 mM potassium phosphate buffer (pH 6.0), 0.2 mM NADH, 100 mM dihydroxyacetone and an enzyme, and the decrease in absorbance at 340 nm accompanying the decrease in NADH is measured. 1 U was defined as the amount of enzyme that catalyzes the reduction of 1 μmol NADH per minute.

Reducing activity measurement method for dihydroxyacetone (activity measurement method-2):
The reaction is carried out at 30 ° C. in a reaction solution containing 100 mM potassium phosphate buffer (pH 6.5), 0.2 mM NADH, 100 mM dihydroxyacetone and an enzyme, and the decrease in absorbance at 340 nm accompanying the decrease in NADH is measured. 1 U was defined as the amount of enzyme that catalyzes the reduction of 1 μmol NADH per minute.

Dehydrogenation activity measurement method for (R) -1,3-butanediol (activity measurement method-3):
30 ° C. in a reaction solution containing 100 mM potassium phosphate buffer (pH 8.0), 50 mM (R) -1,3-butanediol, 2.5 mM oxidized nicotinamide adenine dinucleotide (hereinafter abbreviated as NAD +) and an enzyme And measure the decrease in absorbance at 340 nm with increasing NADH. 1 U was defined as the amount of enzyme that catalyzes the production of 1 μmol NADH per minute. The activity value measured using the activity measurement method-3 is about 4.2 times the value measured by the activity measurement method-2.
In addition, the molecular weight of the enzyme of the present invention can be measured by ordinary SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis). The measured value may vary slightly depending on the electrophoresis conditions, but can be confirmed in the range of 34,000 to 42,000.

  Examples of the R-form-specific alcohol dehydrogenase include enzymes derived from Pichia offnaensis, particularly Pichia offnaensis IFO 10709. This strain was originally isolated as a methanol-assimilating yeast and a new strain named Hansenula offnaensis was reclassified and changed to its current name.

  The microorganism is cultured in a general medium used for culturing yeast such as YM medium (glucose 10 g / L, peptone 5 g / L, yeast extract 3 g / L, malt extract 3 g / L, pH 6.0). Production of the enzyme of the present invention is induced by using methanol as a carbon source. For example, basic medium A (5 g / L ammonium chloride, 1 g / L dipotassium hydrogen phosphate, 1 g / L dipotassium hydrogen phosphate, 0.5 g / L magnesium sulfate heptahydrate, iron (III) chloride Hexahydrate 30 mg / L, Calcium chloride dihydrate 10 mg / L, Manganese (II) sulfate pentahydrate 10 mg / L, Zinc sulfate heptahydrate 10 mg / L, Thiamine hydrochloride 2 mg / L L and biotin (20 μg / L) are precultured in a medium supplemented with 1% glucose, and the main culture is performed in an induction medium containing 1% methanol in the basic medium, thereby increasing the production amount of the enzyme.

  After sufficiently growing, the cells are collected and crushed in a buffer solution containing a reducing agent such as 2-mercaptoethanol or phenylmethanesulfonyl fluoride or a protease inhibitor to obtain a cell-free extract.

  From cell-free extracts, fractionation by protein solubility (precipitation with organic solvents, salting out with ammonium sulfate, etc.), cation exchange, anion exchange, gel filtration, hydrophobic chromatography, chelates, dyes, antibodies, etc. It can be purified by appropriately combining affinity chromatography using For example, the cell-free extract is purified to a single band by electrophoresis through DEAE-cellulose anion exchange chromatography, 50% ammonium sulfate fraction, butyl-Toyopearl hydrophobic chromatography, Superdex G200 gel filtration chromatography, etc. can do.

  The R-form-specific alcohol dehydrogenase used in the present invention derived from such Pichia offnaensis is a protein having the physicochemical properties (1) to (3).

<Polynucleotide>
The present invention relates to a polynucleotide encoding an R-form-specific alcohol dehydrogenase and a homologue thereof.

  In the present invention, the polynucleotide may be an artificial molecule including an artificial nucleotide derivative in addition to a natural polynucleotide such as DNA or RNA. The polynucleotide of the present invention can also be a DNA-RNA chimeric molecule. The polynucleotide encoding the R-form-specific alcohol dehydrogenase of the present invention includes, for example, the base sequence shown in SEQ ID NO: 1. The base sequence shown in SEQ ID NO: 1 encodes a protein containing the amino acid sequence shown in SEQ ID NO: 2, and the protein containing this amino acid sequence represents a preferred embodiment of the R-form-specific alcohol dehydrogenase according to the present invention. Constitute.

  The homologue of the polynucleotide encoding the R-form specific alcohol dehydrogenase of the present invention is a deletion, substitution, insertion and deletion of one or more (preferably several) amino acids in the amino acid sequence of SEQ ID NO: 2. And / or a polynucleotide encoding a protein comprising the added amino acid sequence and having the physicochemical properties (1) to (3). Those skilled in the art will be able to introduce site-directed mutagenesis (Nucleic Acid Res., 10, pp. 6487 (1982), Methods in Enzymol., 100, pp. 448 (1983), Molecular Cloning 2nd Edt., Cold Spring Harbor Laboratory Press (1989), PCR A Practical Approach, IRL Press pp.200 (1991)), etc., to introduce substitutions, deletions, insertions, and / or addition mutations as appropriate. Thus, it is possible to obtain a homologue of the polynucleotide.

  The polynucleotide homologue in the present invention is a polynucleotide that can hybridize under stringent conditions with the polynucleotide comprising the nucleotide sequence represented by SEQ ID NO: 1, and the physicochemical properties (1)-( A polynucleotide encoding a protein having 3) is also included.

  The polynucleotide capable of hybridizing under stringent conditions is one or more selected from any at least 20, preferably at least 30, for example, 40, 60 or 100 consecutive sequences in SEQ ID NO: 1. The probe DNA is used as a probe DNA, for example, using ECL direct nucleic acid labeling and detection system (manufactured by Amersham Biosciences) under the conditions described in the manual (for example, wash: 42 ° C., primary wash buffer containing 0.5 × SSC), Refers to a hybridizing polynucleotide.

  More specific “stringent conditions” are, for example, usually 42 ° C., 2 × SSC, 0.1% SDS conditions, preferably 50 ° C., 2 × SSC, 0.1% SDS conditions, The conditions are preferably 65 ° C., 0.1 × SSC and 0.1% SDS, but are not particularly limited to these conditions. A plurality of factors such as temperature and salt concentration can be considered as factors affecting the stringency of hybridization, and those skilled in the art can realize optimum stringency by appropriately selecting these factors.

  Furthermore, the polynucleotide homologue in the present invention is a polynucleotide encoding a protein having at least 70%, preferably at least 80%, more preferably 90% or more homology with the amino acid sequence shown in SEQ ID NO: 2. And a polynucleotide encoding a protein having the physicochemical properties (1)-(3). Protein homology search, for example, databases related to amino acid sequences of proteins such as SWISS-PROT, PIR, DAD, databases related to DNA sequences such as DDBJ, EMBL, and Gene-Bank, databases related to predicted amino acid sequences based on DNA sequences, etc. For example, it can be performed through the Internet using programs such as BLAST and FASTA.

  As a result of homology search using the BLAST program for the DAD using the amino acid sequence described in SEQ ID NO: 2, the high homology was shown to be Streptococcus pyogenes MGAS8232 strain, SSI-1 strain , MGAS315 strain, predicted ORF derived from genome sequence of M1 GAS strain, zinc-containing alcohol dehydrogenase (Protein ID = AAL97696.1, BAC64067.1, AAM79379.1, AAK33988.1, respectively) 52%, 50% There was no functional analysis of proteins exceeding. Among the functionally analyzed proteins, the one with the highest homology was 49 of alcohol dehydrogenase (J. Bacteriol., 185, 7120-7128 (2003)) involved in propane metabolism derived from Gordonia sp. TY-5 strain. %Met. The homology of 70% or more of the present invention represents a value calculated using, for example, the BLAST program (J. Mol. Biol., 215, 403-410. (1990)).

The polynucleotide encoding the R-form-specific alcohol dehydrogenase of the present invention can be isolated, for example, by the following method.
The DNA of the present invention can be obtained by designing a primer for PCR based on the nucleotide sequence shown in SEQ ID NO: 1 and performing PCR using a chromosomal DNA of an enzyme production strain or a cDNA library as a template.

  Furthermore, using the obtained DNA fragment as a probe, restriction enzyme digests of chromosomal DNA of enzyme production strains are introduced into phages, plasmids, etc., and E. coli is transformed to obtain libraries and cDNA libraries. The polynucleotide of the present invention can be obtained by colony hybridization, plaque hybridization and the like.

In addition, the base sequence of the DNA fragment obtained by PCR is analyzed, and from the obtained sequence, a PCR primer for extending outside the known DNA is designed, and the chromosomal DNA of the enzyme production strain is expressed with an appropriate restriction enzyme. After digestion, reverse PCR is performed using DNA as a template by self-cyclization reaction (Genetics, 120, 621-623 (1988)). Also, RACE method (Rapid Amplification of cDNA End, “PCR Experiment Manual” p25-33 , HBJ Publishing Bureau), TAKARA LA PCR in vitro Cloning Kit (manufactured by Takara Bio Inc.), and the like.
The polynucleotide of the present invention includes genomic DNA cloned by the above method, or cDNA obtained by synthesis in addition to cDNA.

<Transformant>
An R-form-specific alcohol dehydrogenase expression vector is provided by inserting the isolated polynucleotide encoding the R-form-specific alcohol dehydrogenase according to the present invention into a known expression vector. .
Moreover, the R body specific alcohol dehydrogenase of this invention can be obtained from a recombinant by culture | cultivating the transformant transformed with this expression vector.

  In the present invention, in order to express R-form-specific alcohol dehydrogenase, a microorganism to be transformed is transformed with a recombinant vector containing a polynucleotide encoding a polypeptide having R-form-specific alcohol dehydrogenase. There is no particular limitation as long as it is an organism that is converted and can express R-form-specific alcohol dehydrogenase activity. Examples of the microorganisms that can be used include the following microorganisms.

-Escherichia genus-Bacillus genus-Pseudomonas genus-Serratia genus-Brevibacterium genus-Corynebacterium genus-Streptococcus genus-Lactobacillus Bacteria for which host vector systems such as (Lactobacillus) are developed ・ Rhodococcus genus ・ Streptomyces genus actinomycetes for which host vector systems are being developed ・ Saccharomyces genus Genus (Kluyveromyces) genus Schizosaccharomyces genus Zygosaccharomyces Yeast for which host vector systems such as genus have been developed La (Neurospora) genus, Aspergillus (Aspergillus) genus, Cephalosporium (Cephalosporium) genus, Trichoderma (Trichoderma) mold that has been developed host vector system such as the genus

  A procedure for producing a transformant and construction of a recombinant vector suitable for the host can be performed according to techniques commonly used in the fields of molecular biology, biotechnology, and genetic engineering (for example, Sambrook et al. , Molecular Cloning, Cold Spring Harbor Laboratories). In order to express the R-form-specific alcohol dehydrogenase gene using NADH of the present invention as an electron donor in microorganisms, this DNA is first introduced into a plasmid vector or a phage vector that is stably present in the microorganism. However, it is necessary to transcribe and translate the genetic information.

  For that purpose, a promoter corresponding to a unit controlling transcription / translation may be incorporated upstream of the 5′-side of the DNA strand of the present invention, more preferably a terminator downstream of the 3′-side. As the promoter and terminator, it is necessary to use a promoter and terminator known to function in a microorganism used as a host. “Microbiology Basic Course 8 Genetic Engineering / Kyoritsu Publishing” regarding vectors, promoters, terminators and the like that can be used in these various microorganisms, especially regarding yeast, Adv. Biochem. Eng., 43, 75-102 (1990), Yeast , 8, 423-488 (1992), and the like.

  For example, in the genus Escherichia, particularly Escherichia coli, pBR and pUC plasmids can be used as plasmid vectors, and lac (β-galactosidase), trp (tryptophan operon), tac, trc (lac, trp Fusion), promoters derived from λ phage PL, PR, etc. can be used. Moreover, as the terminator, a terminator derived from trpA, phage, or rrnB ribosomal RNA can be used. Among these, a co-expression vector pSE420D (described in JP-A-2000-189170) obtained by partially modifying a multicloning site of commercially available pSE420 (manufactured by Invitrogen) can be suitably used.

  In the genus Bacillus, pUB110 series plasmids, pC194 series plasmids and the like can be used as vectors, and can be integrated into chromosomes. Further, apr (alkaline protease), npr (neutral protease), amy (α-amylase) and the like can be used as promoters and terminators.

  In the genus Pseudomonas, host vector systems have been developed for Pseudomonas putida, Pseudomonas cepacia (currently Burkholderia cepacia), and the like. A broad host range vector (including genes necessary for autonomous replication derived from RSF1010) pKT240 based on the plasmid TOL plasmid, which is involved in the degradation of toluene compounds, can be used, and a lipase (specialized as a promoter or terminator) can be used. Kaihei 5-284973) Genes can be used.

  In the genus Brevibacterium, particularly in Brevibacterium lactofermentum, plasmid vectors such as pAJ43 (Gene, 39, 281 (1985)) can be used. As the promoter and terminator, promoters and terminators used in Escherichia coli can be used as they are.

  In the genus Corynebacterium, especially Corynebacterium glutamicum, plasmid vectors such as pCS11 (JP 57-183799) and pCB101 (Mol. Gen. Genet., 196, 175 (1984) are available. It is.

  In the genus Streptococcus, pHV1301 (FEMS Microbiol. Lett., 26, 239 (1985), pGK1 (Appl. Environ. Microbiol., 50, 94 (1985)), etc. can be used as a plasmid vector.

  In the genus Lactobacillus, pAMβ1 (J. Bacteriol., 137, 614 (1979)) developed for Streptococcus can be used, and those used in E. coli as promoters can be used. is there.

  In the genus Rhodococcus, plasmid vectors isolated from Rhodococcus rhodochrous can be used (J. Gen. Microbiol., 138, 1003 (1992)).

  In the genus Streptomyces, a plasmid can be constructed according to the method described in Hopwood et al., Genetic Manipulation of Streptomyces: A Laboratory Manual Cold Spring Harbor Laboratories (1985). In particular, in Streptomyces lividans, pIJ486 (Mol. Gen. Genet., 203, 468-478, 1986), pKC1064 (Gene, 103, 97-99 (1991)), pUWL-KS ( Gene, 165,149-150 (1995)) can be used. The same plasmid can also be used in Streptomyces virginiae (Actinomycetol. 11, 46-53 (1997)).

  In the genus Saccharomyces (especially Saccharomyces cerevisiae), YRp, YEp, YCp, and YIp plasmids can be used and use homologous recombination with ribosomal DNA present in multiple copies in the chromosome. Such integration vectors (such as EP 537456) are extremely useful because they can introduce genes in multiple copies and can stably hold genes. ADH (alcohol dehydrogenase), GAPDH (glyceraldehyde-3-phosphate dehydrogenase), PHO (acid phosphatase), GAL (β-galactosidase), PGK (phosphoglycerate kinase), ENO (enolase) Promoters and terminators such as can be used.

  In the genus Klyberomyces, especially Kluyveromyces lactis, a 2 μm-type plasmid derived from Saccharomyces cerevisiae, a pKD1-type plasmid (J. Bacteriol., 145, 382-390 (1981)) The pGKl1-derived plasmid involved, the autonomously proliferating gene KARS plasmid in the genus Kleberomyces, the vector plasmid (EP 537456 etc.) that can be integrated into the chromosome by homologous recombination with ribosomal DNA, etc. can be used. In addition, promoters and terminators derived from ADH, PGK and the like can be used.

  In the genus Schizosaccharomyces, plasmid vectors containing ARS (genes involved in autonomous replication) derived from Schizosaccharomyces pombe and selection markers that complement the auxotrophy derived from Saccharomyces cerevisiae are available ( Mol. Cell. Biol., 6, 80 (1986)). Moreover, the ADH promoter derived from Schizosaccharomyces pombe can be used (EMBO J., 6, 729 (1987)). In particular, pAUR224 is commercially available from Takara Shuzo and can be easily used.

  In the genus Zygosaccharomyces, plasmid vectors derived from pSB3 (Nucleic Acids Res., 13, 4267 (1985)) derived from Zygosaccharomyces rouxii can be used, and PHO5 derived from Saccharomyces cerevisiae A promoter, a promoter of GAP-Zr (glyceraldehyde-3-phosphate dehydrogenase) derived from Tigosaccharomyces rouxi (Agri. Biol. Chem., 54, 2521 (1990)), etc. can be used.

  In the genus Pichia, a host vector system has been developed in Pichia Angusta (formerly Hansenula polymorpha). As vectors, genes involved in autonomous replication derived from Pichia Angusta (HARS1, HARS2) can be used, but because they are relatively unstable, multicopy integration into the chromosome is effective (Yeast, 7, 431). -443 (1991)). In addition, AOX (alcohol oxidase) induced by methanol or the like, FDH (formate dehydrogenase) promoter, etc. can be used. In addition, host vector systems utilizing genes (PARS1, PARS2) involved in Pichia-derived autonomous replication have been developed in Pichia pastoris (Mol. Cell. Biol., 5, 3376 (1985) ), Strong promoters such as high concentration culture and methanol-inducible AOX can be used (Nucleic Acids Res, 15, 3859 (1987)).

  In the genus Candida, the host vector system in Candida maltosa, Candida albicans, Candida tropicalis, Candida utilis, etc. Has been developed. In Candida maltosa, ARS derived from Candida maltosa has been cloned (Agri. Biol. Chem., 51, 1587 (1987)), and vectors using this have been developed. In Candida utilis, a strong promoter has been developed for the chromosome integration type vector (Japanese Patent Laid-Open No. 08-173170).

  In the genus Aspergillus, Aspergillus niger and Aspergillus oryzae are the most studied among molds, and integration into plasmids and chromosomes is available. Promoters derived from external proteases or amylases are available (Trends in Biotechnology, 7, 283-287 (1989)).

  In the genus Trichoderma, a host vector system using Trichoderma reesei has been developed, and an extracellular cellulase gene-derived promoter or the like can be used (Biotechnology, 7, 596-603 (1989)).

  In addition to microorganisms, various host and vector systems have been developed in plants and animals, especially in insects using moths (Nature 315, 592-594 (1985)), rapeseed, corn, potatoes and other plants. A system for expressing a large amount of heterologous protein has been developed and can be suitably used.

<Optically active alcohol and its production method>
The present invention relates to a protein having an R-form-specific alcohol dehydrogenation activity of the present invention comprising a step of culturing a transformant transformed with a recombinant vector comprising the polynucleotide of the present invention and a step of recovering an expression product. It relates to a manufacturing method.
The present invention also relates to a method for producing optically active alcohols by reduction of ketones using the R-form-specific alcohol dehydrogenase, for example, preferably a method for producing optically active diols, optically active β-hydroxy esters, etc. Preferably, it relates to a method for producing (R) -1,3-butanediol and (S) -4-chloro-3-hydroxybutyrate ethyl.

  An optically active alcohol can be produced by bringing a transformant such as a microorganism that functionally expresses the enzyme into contact with a reaction solution to cause the target enzyme reaction.

The optical purity of the optically active alcohol obtained by the method of the present invention is preferably 80% ee or more, more preferably 90% ee or more, and particularly preferably 98% ee or more. The optical purity is a numerical value obtained by the following method.
Optical purity = (R−S / R + S) or (S−R / R + S) × 100 (%)
(R and S indicate the proportion of right and left enantiomers in the sample, respectively.)

  The contact form between the enzyme and the reaction solution is not limited to these specific examples. The microorganism used in the above method regenerates a heterologous transformant that functionally expresses the protein of SEQ ID NO: 2, for example, Escherichia coli transformed with pSE-HOD4, coenzyme NADH. Examples include enzymes such as pSG-HOD1 or pSF-HOD1 that co-express glucose dehydrogenase or formate dehydrogenase.

  Specifically, the processed product of the transformant containing the R-form-specific alcohol dehydrogenase in the present invention includes microorganisms whose cell membrane permeability has been changed by treatment with an organic solvent such as a surfactant or toluene, freeze-drying, Dry cells prepared by spray drying, etc., cell-free extracts obtained by crushing cells by glass beads or enzyme treatment, partially purified products, purified enzymes, immobilized enzymes with immobilized transformants and enzymes, Examples include immobilized microorganisms.

  The ketone body in the method for producing an optically active alcohol by an asymmetric reduction reaction of a ketone body according to the present invention is a lower alkyl ketone, β-ketoester, which may be substituted with a lower alkyl group, a halogen group, a nitro group or an alkoxy group. Examples include ketol and the like, and optically active lower alkyl alcohols, optically active β-hydroxy esters, optically active diols and the like corresponding to the respective substrates are produced. For example, acetol, 2-butanone, 2-pentanone, 3-methyl-2-butanone, 1-hydroxy-2-butanone, 3-hydroxy-2-butanone, 4-hydroxy-2-butanone, acetoacetic acid methyl ester, 4 -Chloroacetoacetic acid ethyl ester and the like, and corresponding (R) -1,2-propanediol, (R) -2-butanol, (R) -2-pentanol, (R) -3-methyl- 2-butanol, (R) -1,2-butanediol, (2R) -2,3-butanediol, (R) -1,3-butanediol, (R) -3-hydroxybutyric acid methyl ester, (S ) -4-chloro-3-hydroxybutyric acid ethyl ester can be synthesized.

  The regeneration of NAD + produced from NADH accompanying the above reduction reaction to NADH can be performed using the NAD + reducing ability of the microorganism (glycolytic system, methylotrophic C1 compound utilization pathway, etc.). These NAD + reducing ability can be enhanced by adding glucose, ethanol, or the like to the reaction system. Moreover, it can also carry out by adding the microorganisms which have the capability to produce | generate NADH from NAD +, its processed material, and an enzyme to a reaction system. For example, microorganisms including glucose dehydrogenase, alcohol dehydrogenase, formate dehydrogenase, amino acid dehydrogenase, organic acid dehydrogenase (malate dehydrogenase, etc.), processed products thereof, and partially purified or purified enzymes NADH can be regenerated using The components constituting the reaction necessary for NADH regeneration are added to the reaction system for the production of the optically active alcohol according to the present invention, the immobilized one is added, or through a membrane capable of exchanging NADH. Can be contacted.

  In this method, when a living cell of a microorganism transformed with a recombinant vector containing the polynucleotide of the present invention is used in the method for producing an optically active alcohol, an additional reaction system for NADH regeneration is used. It may be unnecessary. That is, by using a microorganism having high NADH regeneration activity as a host, an efficient reaction can be performed without adding an enzyme for NADH regeneration in a reduction reaction using a transformant.

  In addition, genes such as glucose dehydrogenase, alcohol dehydrogenase, formate dehydrogenase, amino acid dehydrogenase, organic acid dehydrogenase (malate dehydrogenase, etc.) that can be used for NADH regeneration are added to the NAD of the present invention. Performing more efficient expression and reduction of NADH-regenerating enzyme and NAD-dependent R-isomer-specific alcohol dehydrogenase by introducing it into the host simultaneously with DNA encoding dependent R-isomer-specific alcohol dehydrogenase Is also possible. In order to introduce these two or more genes into the host, a method of transforming the host with a recombinant vector in which genes are separately introduced into a plurality of vectors different from the origin of replication in order to avoid incompatibility, A method of introducing both genes into a single vector, a method of introducing both genes into a chromosome, or the like can be used.

  When introducing multiple genes into a single vector, methods such as linking promoter- and terminator-related regions related to expression control to each gene, or expressing as an operon containing multiple cistrons such as the lactose operon. Is possible.

  For example, glucose dehydrogenases derived from the genera Bacillus, Pseudomonas, Thermoplasma, etc. can be used as NADH regenerating enzymes. For example, pSG-HOD1, which is a recombinant vector into which a dehydrogenase and a glucose dehydrogenase gene derived from Bacillus subtilis are introduced, is preferably used. In addition, formate dehydrogenase derived from the genus Mycobacterium can be used as an enzyme for NADH regeneration. Specifically, R-form-specific alcohol dehydrogenase and formate dehydrogenase derived from Mycobacterium baccae are used. A recombinant vector into which a gene has been introduced, such as pSF-HOD1, is preferably used.

  In addition, since the R-form-specific alcohol dehydrogenase of the present invention has a high oxidation activity for low molecular alcohols such as 2-propanol and ethanol, these low molecular alcohols are used in a reaction solution for producing optically active alcohols by reduction of ketones. It is also possible to carry out an asymmetric reduction reaction and NADH regeneration reaction with a single enzyme.

  The present invention also provides an optically active alcohol, particularly (S) -1,3-butanediol, (S) -3-, which is obtained by stereoselective oxidation reaction of racemic alcohol using the R-form-specific alcohol dehydrogenase. The present invention relates to a method for producing methyl hydroxybutyrate.

  Examples of racemic alcohols include lower alkyl alcohols, diols, and β-hydroxy esters. For example, (S) -2-butanol can be produced by (R) -2-butanol oxidation using racemic 2-butanol as a raw material. Similarly, methyl (S) -3-hydroxybutyrate is used as a raw material from racemic β-hydroxybutyric acid methyl ester, and (S) -1,3-butanediol is used as a raw material from racemic 1,3-butanediol. (S) -1,2-propanediol can be produced using 1,2-propanediol as a raw material, and (S) -2-pentanol can be produced using racemic 2-pentanol as a raw material.

  In the racemic alcohol oxidation reaction, the R-form-specific dehydrogenase used in the present invention oxidizes the alcohol by dehydrogenation specifically with respect to the R-form alcohol as compared with the S-form. S-form alcohol can be selectively produced.

  By such an oxidation reaction, the coenzyme NAD + is reduced to produce NADH. The produced NADH can regenerate NAD + by the ability to regenerate NAD + from NADH contained in the microorganism. In addition, enzymes that have the activity to oxidize NADH to NAD + such as glutamate dehydrogenase, glucose dehydrogenase, NADH dehydrogenase, NADH oxidase, microorganisms containing these enzymes, or treatments thereof are added to the reaction system. By doing so, it is also possible to reproduce NAD +. In addition, by preparing a transformant that expresses an enzyme that generates NAD + from these NADH simultaneously with the R-form-specific alcohol dehydrogenase of the present invention, an NAD + regeneration reaction and a stereoselective oxidation reaction can be efficiently performed. It can also be done. In addition, by utilizing the substrate specificity of the enzyme of the present invention, an inexpensive substrate for the reduction reaction of the enzyme such as acetone or 2-butanone is allowed to coexist in the reaction system, thereby simultaneously regenerating NAD + with one enzyme. It can be carried out.

  The oxidation-reduction reaction using the enzyme of the present invention is an organic solvent such as ethyl acetate, butyl acetate, toluene, chloroform, n-hexane, methyl isobutyl ketone, methyl tertiary butyl ester which is difficult to dissolve in water or water. It can be carried out in a solvent or in a two-phase system with an aqueous medium or a mixed system with an organic solvent that dissolves in water, for example, methanol, ethanol, isopropyl alcohol, acetonitrile, acetone, dimethyl sulfoxide, and the like. The reaction of the present invention can also be performed using an immobilized enzyme, a membrane reactor, or the like.

  In the reaction of the present invention, the reaction temperature is 4-60 ° C, preferably 15-37 ° C, pH 3-11, preferably pH 5-9, substrate concentration 0.01-50%, preferably 0.1-20%, more preferably Can be carried out at 0.1-10%. If necessary, coenzyme NAD + or NADH can be added to the reaction system in an amount of 0.001-100 mM, preferably 0.01-10 mM. The substrate can be added all at once at the start of the reaction, but it is desirable to add it continuously or discontinuously so that the substrate concentration in the reaction solution does not become too high.

  For the regeneration of NADH, for example, glucose when using glucose dehydrogenase, ethanol or isopropanol when using alcohol dehydrogenase, and the like are added to the reaction system. These compounds can be added in a molar ratio of 0.1-20, preferably 1-5 times with respect to the substrate ketone. On the other hand, enzymes for NADH regeneration, such as glucose dehydrogenase and alcohol dehydrogenase, have an enzyme activity of 0.1 to 100 times that of the NAD-dependent R-isomer specific alcohol dehydrogenase of the present invention, preferably Can be added about 0.5-20 times.

  For purification of optically active alcohol produced by reduction of ketone or stereoselective oxidation reaction of racemic alcohol of the present invention, cell body, protein centrifugation, separation by membrane treatment, solvent extraction, distillation, crystallization, etc. are suitable. This can be done by combining them.

  For example, in (R) -1,3-butanediol, a reaction solution containing a transformant is centrifuged to remove microbial cells, and then cell residues and proteins are removed with an ultrafiltration membrane. Extract with optically active alcohol by extracting with butyl acetate, toluene, hexane, benzene, methyl isobutyl ketone, methyl tertiary butyl ether, butanol, etc., and concentrating under reduced pressure or by direct distillation. Can do. In order to further increase the purity of the reaction product, it can be further purified by performing precision distillation, silica gel column chromatography, or the like.

  EXAMPLES Hereinafter, although an Example demonstrates this invention in more detail, this invention is not limited to this.

[Example 1] Cultivation of Pichia offnaensis Pichia offnaensis IFO 10709 was inoculated into 5 mL of basic medium A containing 1% glucose, and cultured at 30 ° C until the mid-logarithm. The obtained fungus was inoculated into a basic medium A-5L containing 1% methanol and cultured at 30 ° C. until the late logarithm. The culture solution was centrifuged and used as a cell for enzyme purification.

[Example 2] Purification of R-form-specific alcohol dehydrogenase The cells prepared in Example 1 were treated with buffer A (10 mM potassium phosphate buffer (pH 7.0) and 1 mM dithiothreitol (hereinafter abbreviated as DTT). )) And crushed with Bead-Beater (manufactured by Biospec). The cell disruption solution was centrifuged, and a cell-free extract was obtained as the supernatant.
The cell-free extract was adsorbed on DEAE-cellulose (4.0 × 3.0 cm, manufactured by Wako Pure Chemical Industries) equilibrated with buffer A in advance, and buffer A: buffer B (100 mM potassium phosphate buffer (pH 7.0)). ) And 1 mM DTT) = 7: 3, 3: 7, and finally buffer B alone. This enzyme was eluted when buffer A: B was 3: 7. The obtained active fraction was collected and dialyzed against buffer A. In Pichia offnaensis, there are at least three kinds of proteins having dihydroxyacetone reducing activity, but two kinds of enzymes different from the enzyme of the present invention are a buffer A: B and a buffer B, respectively. Was eluted with a solution of 0.2M potassium chloride and separated from the enzyme of the present invention.

  Ammonium sulfate was added to the dialyzed enzyme solution until 50% saturation, and the produced precipitate was removed by centrifugation. Furthermore, the supernatant of centrifugation was dialyzed against 25% ammonium sulfate-saturated buffer A and adsorbed onto butyl-Toyopearl 650S (1.0 × 10 cm, manufactured by Tosoh Corporation) equilibrated with the same buffer. After the column was washed with the same buffer, gradient elution with 25-0% ammonium sulfate saturation was performed. The obtained active fraction was collected, concentrated, and dialyzed against buffer A containing 0.1 M sodium chloride.

It was applied to Superdex 200 (1.6 × 60 cm, manufactured by Amersham Biosciences) previously equilibrated with the same buffer, and eluted with the same buffer.
The obtained purified enzyme showed almost a single band in 12.5% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).
The specific activity of the purified enzyme was 30.0 U / mg (activity measurement method-1). A summary of the purification is shown in Table 1.

Measurement of molecular weight of R-form-specific alcohol dehydrogenase The molecular weight of the subunit of the enzyme obtained in Example 1 was determined to be about 38,000 by SDS-PAGE.

[Example 3] Partial amino acid sequence of R-form-specific alcohol dehydrogenase Using the enzyme obtained in Example 1, an N-terminal amino acid sequence was determined by a protein sequencer (476 protein sequencer, manufactured by Applied Biosystems). As a result of analysis, the amino acid sequence set forth in SEQ ID NO: 3 was obtained. In the amino acid sequence deduced from the DNA sequence described below, the 6-position Lys of SEQ ID NO: 3 was Cys.
MMKALKYLG (SEQ ID NO: 3)

Furthermore, the enzyme obtained in Example 1 was subjected to SDS-PAGE and partially digested with 1/20 amount of V8 protease in a stacking gel for 1 hour at room temperature. Partially digested products were separated by electrophoresis, blotted on PVDF (polyvinylidene difluoride) membrane, and analyzed for amino acid sequences. As a result, the sequences of SEQ ID NOs: 4 and 5 were obtained. In the amino acid sequence shown in SEQ ID NO: 5, 5th Leu, 10th Gly, 12th Lys, and 16th Lys are Ser, Lys, Asp, and Ile, respectively, as a result of analyzing the DNA sequence as described later. It was.
IPYADQSLYKAPENV (SEQ ID NO: 4)
VGVVLGNVKGGKTVAKVGL (SEQ ID NO: 5)

[Example 4] Purification of chromosomal DNA from Pichia offnaensis Pichia offnaensis IFO 10709 was cultured in basal medium A containing 1% methanol. Chromosomal DNA was purified by the method described in Meth. Cell Biol, 29, 39-44 (1975).

[Example 5] Cloning of core region of gene encoding R-form-specific alcohol dehydrogenase Based on the amino acid sequence obtained in Example 3, primer 1 (SEQ ID NO: 6) and primer 2 (SEQ ID NO: 7) was synthesized.
Primer 1 (SEQ ID NO: 6)
ATHCCCCNTAYGCNGAYCA
Primer 2 (SEQ ID NO: 7)
TCNCCYTTYTTNACRTT

  Using these primers, PCR was performed under the following conditions using the chromosomal DNA obtained in Example 4 as a template. Using 50 μL of a reaction solution containing 50 ng of chromosomal DNA, 25 pmol of each primer, 20 nmol each of dNTP, 1.25 U of ExTaq (manufactured by Takara Bio), and buffer for ExTaq, after heat treatment at 94 ° C. for 10 minutes, 94 ° C. for 1 minute, 56 ° C. 30 minutes at 72 ° C., and finally held at 72 ° C. for 10 minutes.

The PCR product was separated and purified by agarose electrophoresis and then inserted into pCR2.1-TOPO (manufactured by Invitrogen), and the base sequence of the inserted DNA fragment was analyzed. The obtained core region consisted of 129 bp, and the DNA sequence was shown in SEQ ID NO: 8.
Core region nucleotide sequence (SEQ ID NO: 8)
ATCCCGTATGCCGACCAGTCTTTGTATAAAGCACCTGAAAATGTTCCGATCGAGTCATTGTTGATGCTTAGCGACATTCTTCCAACGGCCTACGAGGTCGGAGTGGTTTCCGGTAACGTCAAGAAGGGT

[Example 6] Cloning of 5'-flanking region of gene core region encoding R-form-specific alcohol dehydrogenase 5 of gene core region encoding R-form-specific alcohol dehydrogenase obtained in Example 5 '-The flanking region was cloned using TAKARA LA PCR in vitro Cloning Kit (Takara Bio).

First, chromosomal DNA was digested with the restriction enzyme EcoRI and ligated with the EcoRI cassette attached to the kit. PCR was performed under the following conditions using the obtained DNA as a template and cassette primer C1 and primer S1 (SEQ ID NO: 9) attached to the kit. Ligated DNA 0.5 μg, each primer 25 pmol, dNTP 20 nmol each, LA Taq (manufactured by Takara Bio) 5 U, 50 μL reaction solution containing LA Taq buffer solution, 94 ° C. 30 seconds, 55 ° C. 30 seconds, 72 ° C. 4 cycles of 30 minutes were performed.
Primer S1 (SEQ ID NO: 9)
GCGGAGACAAGACCTGTTGAAATAG

Nested PCR was performed using the amplified DNA fragment of about 2000 bp as a template. As PCR primers, cassette primer C2 and primer S2 (SEQ ID NO: 10) attached to the kit were used, and PCR conditions were the same as those described above for LA Taq.
Primer S2 (SEQ ID NO: 10)
CGACCTCGTAGGCCGTTGGAA

  A DNA fragment of about 1700 bp was amplified, and the base sequence of the inserted DNA was analyzed.

[Example 7] Cloning of 3'-adjacent region of gene core region encoding R-form-specific alcohol dehydrogenase 3 of gene core region encoding R-form-specific alcohol dehydrogenase obtained in Example 5 The cloning of the '-adjacent region was performed using the TAKARA LA PCR in vitro Cloning Kit (manufactured by Takara Bio) in the same manner as the 5'-adjacent region.

First, chromosomal DNA was digested with the restriction enzyme XbaI and ligated with the XbaI cassette attached to the kit. PCR was performed under the following conditions using the obtained DNA as a template and cassette primer C1 and primer S3 (SEQ ID NO: 11) attached to the kit. Ligated DNA 0.5 μg, each primer 25 pmol, dNTP 20 nmol each, LA Taq (manufactured by Takara Bio) 5 U, 50 μL reaction solution containing LA Taq buffer solution, 94 ° C. 30 seconds, 55 ° C. 30 seconds, 72 ° C. 4 cycles of 30 minutes were performed.
Primer S3 (SEQ ID NO: 11)
GCACCTGAAAATGTTCCGATCGAGTCATTG

Nested PCR was performed using the amplified DNA fragment of about 2000 bp as a template. As PCR primers, cassette primer C2 and primer S2 (SEQ ID NO: 12) attached to the kit were used, and PCR conditions were the same as those described above for LA Taq.
Primer S4 (SEQ ID NO: 12)
ATTCTTCCAACGGCCTACGAGGTCGG

A DNA fragment of about 1900 bp was amplified, and the base sequence of the inserted DNA was analyzed.
As a result of assembling the base sequence obtained in Examples 6 and 7 and the base sequence of the core region obtained in Example 5, the entire open reading frame (ORF) of the R-form-specific alcohol dehydrogenase was revealed. .

The base sequence of the obtained ORF is shown in SEQ ID NO: 1. The ORF consisted of 1092 bp and encoded a 39006 Da protein consisting of 364 amino acids.
The amino acid sequence predicted from the obtained base sequence is shown in SEQ ID NO: 2.

[Example 8] Construction of expression plasmid of R-form-specific alcohol dehydrogenase gene Expression plasmid pSE-HOD4 in E. coli of R-form-specific alcohol dehydrogenase gene was constructed.
As PCR primers, HOD-ATGATG1 (SEQ ID NO: 13) and HOD-TAA1 (SEQ ID NO: 14) were synthesized, and PCR was performed under the following conditions. 30 cycles of 95 ° C. for 30 seconds, 50 ° C. for 1 minute, and 75 ° C. for 5 minutes using 50 ng of chromosomal DNA, 50 pmol of each primer, 10 nmol each of dNTP, 2 U of Pfu DNA polymerase (manufactured by Stratagene), and buffer for Pfu. went. The obtained amplified DNA fragment was double-digested with restriction enzymes BspHI and XbaI, and ligated with pSE420D double-digested with restriction enzymes NcoI and XbaI to construct pSE-HOD4. The process of plasmid construction is shown in FIG.
Primer HOD-ATGATG1 (SEQ ID NO: 13)
TGCTCATGATGAAGGCCTTGTGCTACCT
Primer HOD-TAA1 (SEQ ID NO: 14)
CAGTCTAGATCATTCGTCACAGGTGATCA

[Example 9] Construction of plasmid that co-expresses R-form-specific alcohol dehydrogenase and glucose dehydrogenase Plasmid that co-expresses R-form-specific alcohol dehydrogenase gene and glucose dehydrogenase gene derived from Bacillus subtilis pSG-HOD1 was constructed.
The amplified DNA fragment obtained in Example 8 was inserted between NcoI-XbaI of pSE-BSG1 (Japanese Patent Application No. 2000-374593) containing a glucose dehydrogenase gene derived from Bacillus subtilis to construct pSG-HOD1. The process of plasmid construction is shown in FIG.

[Example 10] Construction of a plasmid co-expressing an R-form-specific alcohol dehydrogenase gene and a formate dehydrogenase gene An R-form-specific alcohol dehydrogenase gene is defined as a formate dehydrogenase gene derived from Mycobacterium baccae. A co-expression plasmid pSF-HOD1 for co-expression was constructed.

As PCR primers, a combination of HOD-ATG2 (SEQ ID NO: 15) and HOD-XhoR (SEQ ID NO: 16), a combination of HOD-XhoF (SEQ ID NO: 17) and HOD-TAA2 (SEQ ID NO: 18), PCR was performed under the following conditions. Plasmid pSG-HOD1 100 ng, each primer 15 pmol, dNTP each 10 nmol, KOD plus DNA polymerase (manufactured by Toyobo) 2U, 50 μL of the reaction solution containing KOD plus DNA polymerase buffer, 94 ° C. for 15 seconds, 68 ° C. for 1 minute 30 cycles were performed.
Each of the obtained PCR amplification products was inserted into the HincII site of pUC118 at one end to confirm the base sequence, and then the DNA obtained from the primers HOD-ATG2 and HOD-XhoR was double digested with restriction enzymes EcoRI and XhoI. The DNA obtained from the primers HOD-XhoF and HOD-TAA2 was double-digested with restriction enzymes XhoI and HindIII, and ligated with digests of EcoRI and HindIII of pSE-MF26 (JP 2003-199595) to obtain pSF-HOD1 Built. The process of plasmid construction is shown in FIG.
Primer HOD-ATG2 (SEQ ID NO: 15)
GTCGAATTCTATCATGATGAAAGCATTATGTTACCTCGGATC
Primer HOD-XhoR (SEQ ID NO: 16)
GACCTCGAGACGAGAATCG
Primer HOD-XhoF (SEQ ID NO: 17)
CGTCTCGAGGTAGCACGTCGTCTCGGTGCGCACGAAACC
Primer HOD-TAA2 (SEQ ID NO: 18)
CTGAAGCTTCTAGATTATTCATCACAAGTGATCACCATC

[Example 11] Confirmation of activity of R-form-specific alcohol dehydrogenase by transformant
Escherichia coli HB101 strains containing pSE-HOD4, pSG-HOD1 and pSF-HOD1 were cultured in LB medium containing ampicillin, induced with 0.1 mM IPTG for 4 hours, and collected cells were obtained by centrifugation.

Each cell was suspended in a cell disruption solution (50 mM potassium phosphate buffer (pH 8.0), 0.02% 2-mercaptoethanol), and after disrupting the cell by ultrasound, it was obtained by centrifugation. The supernatant was used as a cell-free extract.
As a result of measuring dihydroxyacetone reduction activity (activity measurement method-2) using a cell-free extract derived from Escherichia coli containing pSG-HOD1, it was 0.570 U / mg and (R) -1,3-butanediol oxidation activity Was 2.38 U / mg. Similarly, (R) -1,3-butanediol oxidation activity of the cell-free extract derived from E. coli containing pSE-HOD4 and pSF-HOD1 was 1.41 U / mg and 1.06 U / mg, respectively. In addition, (R) -1,3-butanediol oxidation activity could not be detected only with the host.

  Furthermore, the glucose dehydrogenase activity of Escherichia coli HB101 strain containing pSG-HOD1 was measured and found to be 2.07 U / mg.

Glucose dehydrogenase activity was measured by the following method.
The reaction was carried out at 30 ° C. in a reaction solution containing 100 mM D-glucose, 2.5 mM NAD +, 100 mM potassium phosphate buffer (pH 6.5) and an enzyme, and the increase in absorbance at 340 nm accompanying the production of NADH was measured. 1 U was defined as the amount of enzyme that catalyzes the production of 1 μmol NADH per minute.
The formate dehydrogenase activity of Escherichia coli HB101 strain containing pSF-HOD1 was measured and found to be 0.192 U / mg.

The formate dehydrogenase activity was measured by the following method.
The reaction was carried out at 30 ° C. in a reaction solution containing 100 mM sodium formate, 2.5 mM NAD +, 100 mM potassium phosphate buffer (pH 7.0) and an enzyme, and the increase in absorbance at 340 nm accompanying the production of NADH was measured. 1 U was defined as the amount of enzyme that catalyzes the production of 1 μmol NADH per minute.

[Example 12] Substrate specificity and stereoselectivity of oxidation reaction of R-form-specific alcohol dehydrogenase Using a cell-free extract prepared from E. coli HB101 strain containing pSG-HOD1 obtained in Example 11, The substrate specificity of the oxidation reaction was examined.
The activity was measured by changing the substrate under the conditions of activity measurement method-3.

[Example 13] Substrate specificity of reduction reaction of R-form-specific alcohol dehydrogenase Using the cell-free extract prepared from E. coli HB101 strain containing pSG-HOD1 obtained in Example 11, reductive oxidation reaction was performed. Substrate specificity was examined.
The activity was measured by changing the substrate under the conditions of activity measurement method-2.

[Example 14] Production of (R) -2-pentanol by transformant
Escherichia coli HB101 strain containing pSE-HOD1 was cultured in 2 × YT medium, and the cells were collected by centrifugation, and dried cells were prepared by lyophilization. 20 mL of a reaction solution containing 100 mM 2-pentanone, 200 mM glucose, 100 mM potassium phosphate buffer (pH 7.0) and 300 mg of lyophilized cells was reacted at 30 ° C. in a 500 mL flask. After 2 hours of reaction,> 99% ee (R) -2-pentanol was produced in 88% yield.
Quantification of 2-pentanone, (R) -2-pentanol, and (S) -2-pentanol was performed by the following gas chromatography method.
Column: Chirasil-DEX CB (Chrompack, Middelburg, Netherlands)
Carrier gas: He
Injection temperature: 250 ℃
Detection temperature: 275 ° C
Column temperature: Initial 60 ° C for 3 minutes, then heated to 80 ° C at 1 ° C / min.
Under these conditions, 2-pentanone, (R) -2-pentanol, and (S) -2-pentanol elute at 2.2 minutes, 4.5 minutes, and 4.7 minutes, respectively.

[Example 15] Production of (S) -2-pentanol by transformant The freeze-dried cell of Escherichia coli HB101 containing pSE-HOD1 prepared in Example 14 was used as a biocatalyst. 20 mL of a reaction solution containing 100 mM racemic 2-pentanol, 100 mM potassium phosphate buffer (pH 7.0) and 300 mg of lyophilized cells was reacted at 30 ° C. in a 500 mL flask. Two hours after the reaction, 98% ee (S) -2-pentanol was produced in a yield of 44% with the racemate as 100%.

  The gene encoding the NAD-dependent R-form-specific alcohol dehydrogenase according to the present invention and the transformant transformed with a recombinant vector containing the gene are useful for the production of optically active alcohols. Furthermore, the method for producing an optically active alcohol according to the present invention provides various optically active alcohols that are efficient and have high optical purity using a transformant that highly expresses the enzyme.

The construction | assembly figure of the expression plasmid (pSE-HOD4) which introduce | transduced the R body specific alcohol dehydrogenase gene derived from Pichia offnaensis. In the plasmid map, P (trc) is the trc promoter, T (rrnB) is the rrnBT1T2 terminator, amp is the ampicillin-resistant β-lactase gene, ori is the plasmid origin of replication, and rop is the ROP-protein. LaqIq represents a lactose repressor, and RADH represents an R-form-specific alcohol dehydrogenase gene of the present invention. Construction diagram of a plasmid (pSG-HOD1) into which an R-form-specific alcohol dehydrogenase gene derived from Pichia offnaensis and a glucose dehydrogenase gene derived from Bacillus subtilis were introduced. In the plasmid map, P (trc) is the trc promoter, T (rrnB) is the rrnBT1T2 terminator, amp is the ampicillin-resistant β-lactase gene, ori is the plasmid origin of replication, and rop is the ROP-protein. LaqIq represents a lactose repressor, and BsGlcDH represents a glucose dehydrogenase gene derived from Bacillus subtilis. Construction diagram of a plasmid (pSF-HOD1) into which an R-form-specific alcohol dehydrogenase gene derived from Pichia offnaensis and a formate dehydrogenase gene derived from Mycobacterium baccae are introduced. In the plasmid map, P (trc) is the trc promoter, T (rrnB) is the rrnBT1T2 terminator, amp is the ampicillin-resistant β-lactase gene, ori is the plasmid origin of replication, and rop is the ROP-protein. LaqIq represents a lactose repressor, and McFDH represents a formate dehydrogenase gene derived from Mycobacterium baccae.

Claims (8)

The polynucleotide according to any one of (a) to (e) below, which encodes the R-form-specific alcohol dehydrogenase according to (1) to (3) below;
(1) Action Using reduced β-nicotinamide adenine dinucleotide as a coenzyme, the ketone is reduced to produce an optically active alcohol. Alcohol is oxidized using oxidized β-nicotinamide adenine dinucleotide as a coenzyme to produce the corresponding ketone or aldehyde.
(2) Substrate specificity (i) A reduced β-nicotinamide adenine dinucleotide is used as a coenzyme for the reduction reaction, and a coenzyme for oxidation reaction and an oxidized β-nicotinamide adenine dinucleotide are used.
(Ii) (R) -1,3-butanediol is oxidized to produce 4-hydroxy-2-butanone.
(Iii) The activity against (R) -1,3-butanediol is 20 times higher than the activity against (S) -1,3-butanediol.
(3) Molecular weight Molecular weight determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis is about 38,000.

(A) a polynucleotide comprising the base sequence set forth in SEQ ID NO: 1,
(B) a polynucleotide encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 2;
(C) a polynucleotide encoding a protein consisting of an amino acid sequence in which one or more amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of SEQ ID NO: 2;
(D) a polynucleotide that hybridizes under stringent conditions with DNA comprising the base sequence set forth in SEQ ID NO: 1;
(E) a polynucleotide encoding an amino acid sequence having 70% or more homology with the amino acid sequence set forth in SEQ ID NO: 2. A transformant that retains the recombinant vector into which the polynucleotide according to claim 1 is inserted so that it can be expressed. A method for producing an R-form-specific alcohol dehydrogenase according to any one of (1) to (3) below, comprising a step of culturing the transformant according to claim 2 and collecting an expression product.
(1) Action Using reduced β-nicotinamide adenine dinucleotide as a coenzyme, the ketone is reduced to produce an optically active alcohol. Alcohol is oxidized using oxidized β-nicotinamide adenine dinucleotide as a coenzyme to produce the corresponding ketone or aldehyde.
(2) Substrate specificity (i) A reduced β-nicotinamide adenine dinucleotide is used as a coenzyme for the reduction reaction, and a coenzyme for oxidation reaction and an oxidized β-nicotinamide adenine dinucleotide are used.
(Ii) (R) -1,3-butanediol is oxidized to produce 4-hydroxy-2-butanone.
(Iii) The activity against (R) -1,3-butanediol is 20 times higher than the activity against (S) -1,3-butanediol.
(3) Molecular weight Molecular weight determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis is about 38,000. A method for producing an optically active alcohol by allowing the transformant according to claim 2 or a treated product thereof to act on a ketone. The optical activity according to claim 4, wherein the ketone according to claim 4 is 4-hydroxy-2-butanone, and the optically active alcohol produced is (R) -1,3-butanediol. A method for producing alcohol. The ketone according to claim 4 is 4-chloroacetoacetic acid ethyl ester, and the optically active alcohol produced is ethyl (S) -4-chloro-3-hydroxybutyrate. A method for producing an optically active alcohol. A method for producing an optically active alcohol by allowing the transformant according to claim 2 or a processed product thereof to act on racemic alcohol. The racemic alcohol according to claim 7 is (RS) -1,3-butanediol, and the optically active alcohol to be produced is (S) -1,3-butanediol. The manufacturing method of optically active alcohol as described in any one of.

Images