JP2005201812A - Reference biomolecule array element - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a constitution of a reference biomolecule array element for efficiently implementing hybridization, based on a light emission action and utilizing light extinction action for the hybridization. <P>SOLUTION: The reference biomolecule array element, such as bio-chips, micro plates, micro beads overcomes the problem by arraying reference bio-molecules, comprising a chemical bonding group as a component having one or both of the light emission function and the light extinction function in a predetermined order. <P>COPYRIGHT: (C)2005,JPO&NCIPI

Description

  The present invention specifies the sequence relationship of biomolecules such as artificial nucleic acids such as DNA, RNA and PNA, proteins and peptides, and thus a reference for biochips or microplates or microbeads used for clarifying the types. The present invention relates to a biomolecule array element and further to a hybridization confirmation system using the reference biomolecule array element.

  The system for confirming hybridization of biomolecules is based on the arrangement of reference biomolecules according to a predetermined rule on a reference biomolecule array element such as a biochip or microplate or microbead having a predetermined shape. Then, the target biomolecule to be examined is administered in a state capable of emitting light by using a binding group having a light emitting function at the end as a constituent part, and as a result, the light emission of each target biomolecule Sequence of target biomolecules that can bind to the reference biomolecule based on the presence or absence of binding to the reference biomolecule, ie, the presence of complementary binding in the case of DNA, RNA, artificial nucleic acids, and affinity binding in the case of proteins The method of identifying and clarifying the type is adopted.

  The biochip is usually made of a flat plate material made of glass or plastic, but in recent years, a three-dimensional biochip formed by arranging hollow fibers in parallel has also been adopted.

  The microplate or microbead adopts a configuration in which a plurality of containers (wells) for performing a reaction with a biomolecule are arranged in a predetermined order on one plate or one bead. Polystyrene is often used as a material.

  In the optical method, as shown in FIG. 1, a biochip or a microplate using a laser beam as incident light through a beam splitter 12 having a reflection function and a transmission function, and an objective lens 11, Alternatively, in the microbead 2, by emitting a target biomolecule in which a binding group having a light emission function is bonded to the end portion in advance, light emission caused by being excited by complementary binding or affinity binding with the reference biomolecule Then, after passing through the objective lens 11 and the beam splitter 12 and passing through the filter 14 and further the detection lens 15, a confirmation operation with detection of the coupling is performed (in FIG. 1). Indicates the case of a biochip or a microplate as the reference biomolecule array element 2, But not shows the case of Robbie's.).

  In general, the number of target biomolecules tends to be larger than the number of reference biomolecules.

  Nevertheless, it is considerably troublesome to make a binding group having a light emission function bound to each end of the target biomolecule.

  In particular, when there is one reference biomolecule and the presence or absence of a target biomolecule that can bind to the reference biomolecule, the presence or absence of a target biomolecule that has a binding relationship with one reference biomolecule is simply examined. In order to do this, it is unavoidable to work on many target biomolecules so as to have a light-emitting effect.

  In recent years, a technology has been proposed in which a linking group having a light-dissipating function is used as a constituent part of a biomolecule. However, if there is no special work on the reference biomolecule side as in the prior art, the presence or absence of the target biomolecule having a binding relationship with the reference biomolecule cannot be examined.

  That is, it is not possible to make use of a bond by a bonding group having a light disappearance function as a hybridization confirmation system.

Japanese Patent Application Laid-Open No. 2000-235035.

JP 2002-330768 A.

Japanese translation of PCT publication No. 2002-52066.

Japanese translation of PCT publication No. 2002-544488.

  The present invention overcomes the problems of the prior art as described above, can efficiently perform hybridization based on the light emission action, and can also utilize the light extinction action for the hybridization. It is an object to provide a configuration of an array element.

  In order to solve the above-mentioned problems, the configuration of the present invention is arranged in a predetermined order with reference biomolecules having a chemical bonding group having either one or both of a light emission function and a light loss function as a constituent part. It consists of a reference biomolecule array element, such as a biochip or microplate based on, or microbeads.

  The array element of the reference biomolecule of the present invention can efficiently realize hybridization by the light emission action, and can also make use of the light loss action for the hybridization. In particular, both the light emission function and the light loss function In the presence of several reference biomolecules based on both trajectories.

  As is clear from the above configuration, the basic configuration of the present invention is that the reference biomolecule side has a linking group having one or both of a light emission function and a light loss function as a constituent part. Thus, the above-mentioned effect is exhibited.

  A peptide nucleic acid (Peptide Nucleic Acid: hereinafter abbreviated as “PNA”), as shown in FIG. 2, has a structure in which 2-aminoethyleneglycine is used as a skeleton and nucleobases are linked via trimethylenecarboxylic acid. A function of recognizing complementary DNA by binding to a part of the sequence constituting the DNA having a specific base sequence based on complementarity in the base sequence have.

PNA having such a recognition function has the following advantages compared to DNA and RNA.
a: Since it does not cause an orderly repulsion like a sugar phosphate skeleton such as DNA and RNA, it is difficult to be influenced by the pH value and salt concentration during hybridization.
b: has resistance to enzymes and has good preservation in cells,
c: Since melting temperature (Tm) is higher than that of DNA and RNA, even if a few non-complementary bases are present, the melting temperature is greatly lowered to exhibit excellent base specificity. Can do.

  In consideration of such characteristics of PNA, PNA corresponds to the most suitable reference biomolecule in the above-described configuration.

  A label by a sequence by PNA which is a reference biomolecule (PNA Molecular Beacon: hereinafter abbreviated as “PMB”) is arranged in the reference biomolecule array element 2, and the sequence based on each nucleic acid of the PMB is, for example, CAGTTCTAAGCATG In this case, as shown in FIG. 3, in the PMB, the constituent parts of the molecules that are complementary to each other are bonded by a so-called self-complementary relationship to be in a stable state (see FIG. 3). (Circle) and ● show the coupling | bonding state with the coupling group which has a light emission function or a light loss | disappearance function, respectively.

And in target DNA, RNA, or PNA,
(1) GTACAGATTCGTAC
When there is a complementary relationship with a one-to-one correspondence like
(2) AGATTCGT
If there is a complementary relationship with a part of the PMB sequence,
(3) ATGTCTTGTACAGAGTCGTACGCACCC
When the arrangement state includes the PMB configuration,
In both cases, the PMB has a light emission function or a light loss function by releasing the bond due to the self-complementary relationship and generating a complementary bond with the target DNA, RNA, PNA biomolecule. The presence of the complementary target biomolecule is detected by the action of the binding group present.

  When either one of the light emission function and the light disappearance function is exhibited as a reference biomolecule, it is usually bound to the end of the reference biomolecule sequence with a linking group having these functions as a constituent part. By doing so, it is possible to specify a sequence as a biomolecule other than the end and to perform the detection based on the sequence.

Even if each of the binding groups is bound at an intermediate site rather than at the end of the reference biomolecule, a plurality of sequence parts other than the intermediate site (for example, two when binding to one intermediate site) And the sequence part of the sequence part in the target biomolecule by specifying the sequence order in the target biomolecule. It is possible to detect the presence or absence of a sequence or sequence portion that is complementary or affinity to any of the above.
However, in order to identify which sequence portion of the plurality of sequence portions in the reference biomolecule is complementary or affinity, it has a binding group that maintains the light emission function and a light loss function. Both of the binding groups that are present, and in the reference biomolecule, the sequence part adjacent to one of the binding groups and the part of the sequence adjacent to both are specified, and then coexist with the target biomolecule. At this time, it may be specified which arrangement portion corresponds to either the appearance of a new light emission phenomenon, the appearance of a light disappearance phenomenon, or the appearance of both.

  In order to use a linking group having a light emission function or a light disappearance function as a constituent part, it has a light emission function as a functional molecule as in the method described in Japanese Patent Application No. 2002-121667. When PNA is synthesized after selecting a linking group, the functional molecule is bound to the same position as the nucleic acid by A, G, C, T as shown in FIG. 2, that is, according to the following general formula: The precursor represented by the peptide represented may be chemically bonded to the PNA component by binding of nucleic acid and trimethylene carboxylic acid.

（Ｒは、光放出性機能分子、又は光消失性機能分子であり、ｆは０〜１０の整数であり、ｘは１以上の整数である。）

(R is a light-emitting functional molecule or a light-disappearing functional molecule, f is an integer of 0 to 10, and x is an integer of 1 or more.)

As a specific production method, a PNA monomer unit having a linking group having a functional molecule based on a molecule of A, G, C, T and R protected by a protecting group as a constituent part is represented by Fmoc-ω. ^-Amino acid-After reacting with ^Boc PNA-OH to synthesize a PNA oligomer, the Fmoc-ω-amino acid site was deprotected by piperidine treatment to convert it to an ω-amino acid having a terminal amino group, and converted into the PNA oligomer. It is preferable to produce a light-emitting or light-disappearing PMB by introducing a functional molecule having a free carboxylic acid by condensation and further deprotecting the protecting group by super strong acid treatment.

  When the binding group of [Chemical Formula 1] is bound to the end of the reference biomolecule, the atom or atomic group that binds to the left nitrogen (N) atom and the right carbon (C) of [Chemical Formula 1] Is a hydrogen atom, an amino acid derivative, or a functional carboxylic acid derivative as in the case of a normal PNA configuration.

  Examples of the light-emitting functional molecule include FITC, Naphthalide, Flavin, FAM, Rhodamine, TAMRA, ROX, Pyrene, and Coumarin, and the like. Etc. correspond to a preferred embodiment.

  In the examples, a hybridization confirmation system using the reference biomolecular array element 2 of the present invention will be described.

  In Example 1, as a hybridization confirmation system, a target biomolecule arranged on the reference biomolecule array element 2 of the present invention having a binding group having a light emission function as a constituent part is used as a target. A biomolecule is administered, and the presence or absence of a biomolecule capable of complementary binding or affinity binding to the reference biomolecule is detected based on the presence or absence of light emission due to the binding between the reference biomolecule and the target biomolecule.

  In such a confirmation system, by setting the target reference biomolecule to a state having a light emission function, a binding group having a light emission function, in particular, to the target biomolecule, Even without such a work, it is possible to detect the presence or absence of a biomolecule that is complementary or affinity to the reference biomolecule.

  For example, when combining the presence or absence of a biomolecule that is complementary or affinity to one reference biomolecule, the single reference biomolecule may be in a state having a light emission function, Efficient hybridization can be realized.

  When ultraviolet rays are used as incident light for exciting a bonding group having a light emitting function, it is extremely advantageous because most of the bonding groups can be excited.

  In Example 2, as a hybridization confirmation system, a reference biomolecule arrayed on the reference biomolecule array element 2 of the present invention, which has a binding group having a light extinction function as a constituent part, is used as an optical system. A target biomolecule is administered by using a binding group having a release function as a constituent part at the end, and complemented with the reference biomolecule by the presence or absence of light loss due to the binding between the reference biomolecule and the target biomolecule The presence or absence of a biomolecule capable of binding or affinity binding is detected.

  That is, in the reference biomolecule array element 2 of the present invention, the presence or absence of a target biomolecule that can perform the binding can also be detected by using a light-extinguishing functional molecule as a binding moiety. Since the biomolecule array element 2 is not specially worked, it is clearly different from the prior art in which a binding group having a light loss function cannot be utilized for the detection.

  In Example 3, as a hybridization confirmation system, a light extinction function is provided for the reference biomolecule arranged on the reference biomolecule array element 2 of the present invention having a binding group having a light emission function as a constituent part. A target biomolecule is administered by having the binding group it has as a constituent part at the end, and complementary binding or affinity binding to the reference biomolecule depending on whether light is lost due to binding between the reference biomolecule and the target biomolecule The presence or absence of biomolecules that can be detected is detected.

  Example 3 is an opposite form of Example 2, and a binding group having a light emission function and a binding group having a light disappearance function are used as a reference biomolecule or a target biomolecule. In this respect, the state is reversed from the case of the second embodiment.

  And also in Example 3, unlike the case of a prior art, it has the characteristics in that the coupling group which has a light loss | disappearance function can be utilized for the said detection.

  The present invention can be used in the biology industry, such as elucidation of biomolecule sequences in vivo, particularly genes.

It is a basic principle figure regarding the confocal system employ | adopted as a prior art and embodiment of this invention. It is a chemical structural formula showing a situation where PNA recognizes a DNA sequence. It is a schematic diagram which shows the condition where PMB which is a reference | standard biomolecule is performing partial coupling | bonding by the self-complementary relationship.

Explanation of symbols

DESCRIPTION OF SYMBOLS 1 Detection apparatus 11 Objective lens 12 Beam splitter 13 Mirror 14 Filter 15 Detection lens 16 Detector 2 Reference | standard biomolecule arrangement | sequence elements, such as a biochip or a microplate, or a microbead

Claims (9)

  A biochip or microplate based on the arrangement of reference biomolecules having chemical bonding groups having either one or both of a light emission function and a light extinction function as a constituent part in a predetermined order, or microbeads, etc. Reference biomolecular array elements.   The reference biomolecule array device according to claim 1, wherein a binding group having one or both of a light emission function and a light disappearance function is arranged at an end of the bond.   The reference biomolecule array element according to claim 1, wherein peptide nucleic acid (PNA) is adopted as the reference biomolecule. 3. A reference biomolecular array element according to claim 2, wherein a peptide nucleic acid (PNA) having a binding group of a peptide precursor represented by the following general formula as a constituent part is adopted.

(R is a light-emitting functional molecule or a light-disappearing functional molecule, f is an integer of 0 to 10, and x is an integer of 1 or more.)   5. The light-emitting functional molecule is FITC, Naphthalide, Flavin, FAM, Rhodamine, TAMRA, ROX, Pyrene and Cumarine, and the light-disappearing functional molecule is Dabcyl, HABA, NDI, Azo. The reference biomolecular array element described.   The target biomolecule is administered to the reference biomolecule arranged on the reference biomolecule array element according to claim 1, wherein the reference biomolecule array element according to claim 1 has a binding group having a light emission function as a constituent part. A system for confirming hybridization in a biomolecule by detecting the presence or absence of a biomolecule capable of complementary binding or affinity binding with the reference biomolecule based on the presence or absence of light emission due to binding to the molecule.   The system for confirming hybridization in a biomolecule according to claim 6, wherein ultraviolet light or visible light is used as incident light for exciting a binding group having a light emission function.   2. The reference biomolecule arrayed on the reference biomolecule array device according to claim 1, wherein the bond group having a light-dissipating function is a constituent part. The presence or absence of a biomolecule capable of performing complementary binding or affinity binding with the reference biomolecule by administering the target biomolecule due to being a component in the above, and depending on whether light is lost due to the binding between the reference biomolecule and the target biomolecule A system for confirming hybridization in biomolecules by detection. The reference biomolecule arrayed on the reference biomolecule array device according to claim 1, wherein the bond group having a light emission function is a constituent part. By detecting the presence or absence of a biomolecule capable of complementary binding or affinity binding with the reference biomolecule according to the presence or absence of light loss due to the binding between the reference biomolecule and the target biomolecule. Hybridization confirmation system for biomolecules.

Images