JP2005192478A - Set of pcr primer pair for arabidopsis thalina mapping, and method for mapping variant gene using the set - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a set of PCR primer pair for mapping designed over the whole domain of Arabidopsis thalina and capable of identifying Arabidopsis thalina lines. <P>SOLUTION: The set of PCR primer pair for mapping is capable of identifying the respective lines of Arabidopsis thalina on the basis of the difference between PCR products based on polymorphism between the respective lines. This set has a specific base sequence listed on the Tables(1-32)( not illustrated ) designed over the whole domain of the genomic DNA of Arabidopsis thalina. <P>COPYRIGHT: (C)2005,JPO&NCIPI

Description

  The present invention relates to a set of PCR primer pairs for mapping Arabidopsis thaliana, and a mutant gene mapping method using the same. The set of PCR primer pairs of the present invention is useful when cloning a causative gene of a novel mutant of Arabidopsis thaliana on a map basis, and enables a mapping operation to be performed mechanically easily.

  When identifying genes related to various phenomena in the target plant, it is generally found that the relevant gene is first identified using a mutant of Arabidopsis thaliana, and the gene of the target plant having the same function is obtained based on homology. Has been done. Therefore, it is important to identify the causative genes of Arabidopsis mutants on the chromosome (locus) as accurately as possible.

  In recent years, determination of the position of a gene on the chromosome (that is, mapping) has been performed by utilizing a polymorphism of a DNA sequence between two Arabidopsis strains (Non-Patent Document 1 (Experimental Protocol for Model Plants). Shujunsha), Non-Patent Document 2 (Plant Genome Research Protocol Shujunsha)). In this method, the polymorphism functions to provide information for identifying each strain of Arabidopsis and to provide positional information on the chromosome.

  However, conventionally, when mapping a causative gene of a mutant of Arabidopsis thaliana, a PCR primer for detecting a polymorphism has been designed each time. However, the PCR primer design performed here corresponds to individual genes, and if the gene to be identified changes, it is necessary to always start over from the PCR primer design.

Experimental protocol for model plants Shujunsha

Plant Genome Research Protocol Shujunsha

  In view of the above circumstances, an object of the present invention is to provide a set of mapping PCR primer pairs designed over the entire genome region of Arabidopsis thaliana and capable of distinguishing each Arabidopsis strain based on its polymorphism. To do. Another object of the present invention is to provide a rapid and simple method for mapping a mutated gene using the set of PCR primer pairs for mapping.

  In order to solve the above problems, the present invention provides means [1] to [8] described below.

[1] A complete set of mapping PCR primer pairs capable of distinguishing each strain of Arabidopsis thaliana by the difference in PCR products based on polymorphism between each strain,
33. A complete set of primer pairs of primer numbers 1 to 366 listed in Tables 1 to 32 designed over the entire region of Arabidopsis genomic DNA.
[2] A mapping PCR primer pair capable of distinguishing each strain of Arabidopsis thaliana by a difference in PCR product based on polymorphism between each strain,
Any one primer pair selected from the primer pairs of primer numbers 1 to 366 shown in Tables 1 to 32 designed over the entire region of the genomic DNA of Arabidopsis thaliana.
[3] A subset of mapping PCR primer pairs capable of distinguishing each strain of Arabidopsis by the difference in PCR products based on polymorphisms between each strain,
A subset of primer pairs composed of a plurality of primer pairs selected from the primer pairs of primer numbers 1 to 366 described in Tables 1 to 32 and designed at predetermined intervals over the entire region of Arabidopsis genomic DNA.

[4] A subset of mapping PCR primer pairs capable of distinguishing each strain of Arabidopsis thaliana by the difference in PCR products based on polymorphism between each strain,
A subset of primer pairs consisting of the following combinations:
A) Primers described in Tables 1 to 10 designed on the genomic DNA of the first chromosome by dividing the genomic DNA of the Arabidopsis first chromosome into a substantially equal region of a (a is an integer of 2 or more). A total of a primer pairs obtained by classifying the primer pairs of Nos. 1 to 109 into a groups corresponding to the regions and selecting one primer pair from each group;
B) Primers according to Tables 11 to 15 designed on the genomic DNA of the second chromosome by dividing the genomic DNA of the second chromosome of Arabidopsis into b (b is an integer of 2 or more) substantially equal regions. A total of b primer pairs obtained by classifying the primer pairs of numbers 110 to 168 into b groups corresponding to the regions and selecting one primer pair from each group;
C) Primers according to Table 16 to Table 20 designed on the genomic DNA of the third chromosome by dividing the genomic DNA of the third chromosome of Arabidopsis into c (c is an integer of 2 or more) substantially equal regions A total of c primer pairs obtained by classifying the primer pairs of numbers 169 to 228 into c groups corresponding to the region and selecting one primer pair from each group;
D) The primers shown in Tables 21 to 24 designed on the genomic DNA of the fourth chromosome by dividing the genomic DNA of the fourth chromosome of Arabidopsis thaliana into d almost equal regions (d is an integer of 2 or more). A total of d primer pairs obtained by classifying the primer pairs of numbers 229 to 274 into d groups corresponding to the region and selecting one primer pair from each group; and E) Arabidopsis fifth By dividing the genomic DNA of the chromosome into e (e is an integer of 2 or more) substantially equal regions, primer numbers 275 to 366 shown in Tables 25 to 32 designed on the genomic DNA of the fifth chromosome The primer pairs are classified into e groups corresponding to the regions, and a total of e primers obtained by selecting one primer pair from each group. Rimmer vs.
[5] A subset of mapping PCR primer pairs capable of distinguishing each strain of Arabidopsis by the difference in PCR products based on polymorphisms between each strain,
A subset of primer pairs consisting of the following combinations:
a) any one primer pair selected from the group consisting of the primer pairs of primer numbers 1 to 30 described in Tables 1 to 3 designed in the northern region of Arabidopsis first chromosome;
b) Any one primer pair selected from the group consisting of the primer pairs of primer numbers 31 to 60 described in Tables 3 to 5 designed in the central region of Arabidopsis first chromosome;
c) Any one primer pair selected from the group consisting of the primer pairs of primer numbers 61 to 109 described in Tables 6 to 10 designed in the southern region of the first chromosome of Arabidopsis thaliana;
d) Any one primer pair selected from the group consisting of the primer pairs of primer numbers 110 to 130 described in Tables 11 to 12 designed in the northern region of Arabidopsis second chromosome;
e) Any one primer pair selected from the group consisting of the primer pairs of primer numbers 131 to 150 described in Table 12 to Table 14 designed in the central region of Arabidopsis second chromosome;
f) Any one primer pair selected from the group consisting of the primer pairs of primer numbers 151 to 168 shown in Tables 14 to 15 designed in the southern region of Arabidopsis second chromosome;
g) Any one primer pair selected from the group consisting of the primer pairs of primer numbers 169 to 188 listed in Table 16 to Table 17 designed in the northern region of the third chromosome of Arabidopsis thaliana;
h) any one primer pair selected from the group consisting of the primer pairs of primer numbers 189 to 208 listed in Table 17 to Table 19 designed in the central region of Arabidopsis third chromosome;
i) any one primer pair selected from the group consisting of the primer pairs of primer numbers 209 to 228 described in Tables 19 to 20 designed in the southern region of the third chromosome of Arabidopsis thaliana;
j) Any one primer pair selected from the group consisting of the primer pairs of primer numbers 229 to 243 described in Tables 21 to 22 designed in the northern region of Arabidopsis fourth chromosome;
k) Any one primer pair selected from the group consisting of the primer pairs of primer numbers 244 to 259 described in Table 22 to Table 23 designed in the central region of Arabidopsis fourth chromosome;
l) Any one primer pair selected from the group consisting of the primer pairs of primer numbers 260 to 274 described in Table 23 to Table 24 designed in the southern region of Arabidopsis fourth chromosome;
m) any one primer pair selected from the group consisting of the primer pairs of primer numbers 275 to 305 described in Table 25 to Table 27 designed in the northern region of Arabidopsis chromosome 5;
n) any one primer pair selected from the group consisting of the primer pairs of primer numbers 306 to 336 listed in Table 27 to Table 30 designed in the central region of Arabidopsis chromosome 5; and o) Arabidopsis fifth chromosome Any one primer pair selected from the group consisting of primer pairs of primer numbers 337 to 366 described in Table 30 to Table 32 designed in the south region of

[6] A method for mapping a mutant gene of Arabidopsis,
(1) crossing an Arabidopsis mutant having a mutant gene with a wild-type Arabidopsis thaliana having a different strain from the mutant to obtain a first generation;
(2) self-pollinating the obtained first generation to obtain a plurality of second generations;
(3) (i) When the first generation shows the wild type phenotype (ie, when the mutant gene is a recessive gene), the phenotype of the mutant is selected from the obtained second generation. Selecting a plurality of second generations to be indicated, or (ii) if the first generation exhibits the mutant phenotype (ie, the mutant gene is a dominant gene), Selecting a plurality of second generations exhibiting the wild type phenotype from among them,
(4) The mapping PCR primer pair according to any one of the above means [3] to [5], using as a template genomic DNA of one individual of the plurality of second generations selected in the step (3) PCR was carried out using each primer pair of each of the subsets, and each portion of the genomic DNA amplified by each primer pair represents the difference in the size of the PCR product based on the polymorphism between the strains or the pattern of the cleavage fragment of the PCR product. A step of identifying whether the site is derived from the mutant strain or the wild-type strain according to the difference, wherein the PCR and identification are selected in the step (3). A step performed on each genomic DNA of each of the plurality of second generation individuals,
(5) (i) when the first generation exhibits the wild-type phenotype, a site of genomic DNA identified as being derived from the mutant strain in the largest number of the selected second generations Determining and determining that the mutant gene is present in the vicinity of the determined genomic DNA site, or (ii) if the first generation exhibits the mutant phenotype, Determining a site of genomic DNA identified as being derived from the wild-type strain in the largest number of two generations, and determining that a mutant gene is present in the vicinity of the site of genomic DNA determined here. Feature method.
[7] A method for mapping an Arabidopsis mutant gene according to the above means [6], which further comprises the following steps:
(6) A step of selecting a plurality of primer pairs designed in the vicinity of the genomic DNA site determined in step (5) from the primer pairs of primer numbers 1 to 366 described in Tables 1 to 32 When,
(7) PCR is performed using each primer pair selected in the step (6), using the genomic DNA of one individual of the plurality of second generations selected in the step (3) as a template, Whether each site of genomic DNA amplified by the primer pair is a site derived from the mutant strain due to the difference in the size of the PCR product based on the polymorphism between the strains or the pattern of the cleavage fragment of the PCR product Identifying whether each site is derived from the wild-type strain, wherein the PCR and identification are performed on each genomic DNA of the plurality of second generation individuals selected in the step (3). For each process,
(8) Based on the result identified in the step (7), from the chromosomes of the plurality of second generations, both the site derived from the mutant strain and the site derived from the wild type Selecting a plurality of chimeric chromosomes having,
(9) (i) When the first generation exhibits the wild type phenotype, from the result identified in the step (7), a chromosomal region derived from the wild type strain in each of the chimeric chromosomes (Ie, a region where no mutant gene is present), or (ii) when the first generation shows the mutant phenotype, from the result identified in the step (7), Determining the chromosomal region derived from the mutant strain (i.e., the region where the mutant gene does not exist),
(10) A step of determining that a mutant gene is present in a chromosomal region that does not correspond to any of the chromosomal regions determined in the step (9) in the plurality of chimeric chromosomes.
[8] A method for mapping a mutant gene of Arabidopsis as described in the above means [7], further comprising the following steps:
(11) A second generation having a chimeric chromosome that has undergone recombination within the chromosomal region determined in the step (10) is selected from the second generation prepared by the steps (1) and (2). Multiple selection from
(12) A primer pair designed to sandwich the chromosomal region determined in the step (10) from the primer pairs of primer numbers 1 to 366 described in Tables 1 to 32 and the step (10) A step of selecting a plurality of primer pairs designed in the chromosomal region determined in
(13) PCR is performed using each primer pair selected in the step (12), using as a template genomic DNA of one individual of the plurality of second generations selected in the step (11), Whether each site of genomic DNA amplified by the primer pair is a site derived from the mutant strain due to the difference in the size of the PCR product based on the polymorphism between the strains or the pattern of the cleavage fragment of the PCR product Identifying whether each site is derived from the wild-type strain, wherein the PCR and identification are performed on each genomic DNA of the plurality of second-generation individuals selected in the step (11). For each process,
(14) (i) When the first generation exhibits the wild type phenotype, a plurality of individuals exhibiting a mutant phenotype are selected from the plurality of second generations selected in the step (11). Or (ii) when the first generation exhibits the mutant phenotype, a plurality of individuals exhibiting a wild type phenotype are selected from the plurality of second generations selected in the step (11). A process of selecting,
(15) (i) When the first generation exhibits the wild-type phenotype, from the result identified in the step (13), in each of the individual chimeric chromosomes selected in the step (14), A step of determining a chromosomal region derived from the wild-type strain (ie, a region where no mutated gene is present), or (ii) when the first generation shows the mutant phenotype, the identification in the step (13) From the results obtained, in each of the individual chimeric chromosomes selected in the step (14), a step of determining a chromosomal region derived from the mutant strain (that is, a region where no mutated gene is present);
(16) A step of determining that a mutated gene is present in a chromosomal region that does not correspond to any of the chromosomal regions determined in the step (15) in the plurality of chimeric chromosomes.

  According to the mapping method of the present invention, a mutant strain and a wild strain of a different strain are crossed, the first generation obtained is self-pollinated, DNA is recovered from several tens of individuals of the second generation, Perform PCR using a part of the set of PCR primer pairs for mapping of the invention, identify the chromosome site derived from the mutant strain by the difference in the size of the PCR product or the pattern of the cleavage fragment of the PCR product, and the second generation In most cases, the approximate location of the mutated gene on the chromosome can be determined by determining the site identified as the chromosomal site from the mutant strain.

  Furthermore, after the approximate position of the mutant gene on the chromosome is determined, the position of the mutant gene can be further narrowed down using the mapping PCR primer pair of the present invention designed in the vicinity of this position.

  Thus, by using the PCR primer set for mapping of the present invention, the causative gene of a new mutant of Arabidopsis thaliana can be mapped within about 400 kb on the chromosome in a very short time. There is a high possibility that an average of 40 genes are present in the 400 kb range, and it becomes possible to identify the causative gene from these genes. Therefore, it is expected that functional analysis of other plant genes will be accelerated by identifying the causative genes of Arabidopsis thaliana using the mapping method of the present invention quickly and easily.

1. Set of PCR primer pairs for mapping Arabidopsis thaliana The set of PCR primer pairs for mapping Arabidopsis thaliana of the present invention was designed as described below.

  The complete genome sequence of Arabidopsis has already been determined. The Colombian line and the Lansburg line are frequently used for Arabidopsis research, and the complete genome sequence of the Colombian line is published by The Arabidopsis Information Research (TAIR) (http://www.arabidopsis.org) . In addition, the sequencing of the Lansburg system is also progressing, and the positions where polymorphisms are seen between the Colombia system and the Lansburg system have been extracted. Such polymorphic extraction was once done by Cereon Genomics and made available for academic research. Currently transferred to Monsant and published (http://www.arabidopsis.org/Cereon/index.html).

  In the present invention, based on this polymorphism information, a primer pair is designed so that polymorphism detection based on the PCR method can be performed. In the present invention, primer pairs are designed at almost regular intervals over the entire region of the genomic DNA to form a primer pair set. That is, the PCR primer pair for mapping according to the present invention is based on the difference in the PCR product obtained or the difference in the pattern of the cleaved fragment of the PCR product when PCR is performed using the primer pair as a template with different strains of Arabidopsis genomic DNA. It is possible to identify Arabidopsis strains.

  Specifically, the primer was positioned so that a region of about 200 to 1500 bp including a base showing a polymorphism could be amplified, and the primer was synthesized based on the genome sequence information of the Colombian strain. Using the synthesized primers, it was confirmed that PCR could actually be performed in the Colombian and Lansburg strains, and further, the difference in the PCR product chain length or the length of the PCR product when the PCR product was treated with a restriction enzyme. Due to the difference, it was confirmed that polymorphism could be detected between both strains.

  Furthermore, in the present invention, it was confirmed that the Ws strain of Arabidopsis thaliana often used in the study can detect polymorphism with the Colombian strain and with the Landsburg strain using the above primers.

  A set of 366 PCR primer pairs designed in this way is shown in Tables 1-32 below.

  Tables 1 to 10 show the primer pairs designed on the first chromosome in order from the northern region of the chromosome (5 'end of chromosomal DNA). Similarly, Tables 11 to 15 show primer pairs designed on the second chromosome in order from the northern region of the chromosome (5 ′ end of the chromosomal DNA), and Tables 16 to 20 show the primer pairs designed on the third chromosome. The primer pairs thus obtained are shown in order from the north region of the chromosome (5 ′ end of the chromosomal DNA), and Tables 21 to 24 show the primer pairs designed on the fourth chromosome in the north region of the chromosome (5 ′ end of the chromosomal DNA). Table 25 to Table 32 show primer pairs designed on the fifth chromosome in order from the northern region of the chromosome (5 ′ end of the chromosomal DNA).

  In these tables, “SSLP (Simple Sequence Length Polymorphism)” means that when PCR is performed using the corresponding primer pair and the genomic DNA of each of the Colombian and Lansburg strains as a template, It means that the length of the amplified fragment is different. That is, when a primer pair described as “SSLP” is used, the Arabidopsis thaliana lineage that determines the site on the chromosome where the primer pair can be amplified is determined depending on the length of each amplified fragment. be able to. In addition, “CAPS (Cleaved Amplified Polymorphic Sequence)” is a PCR performed using the corresponding primer pairs and the genomic DNAs of the Colombian line and the Lansburg line as templates, and the amplified fragments are subjected to predetermined restriction enzymes (described in the table). ) Means that the pattern (number and length of the cleaved fragments) of each cleaved fragment differs depending on the polymorphism between each strain. That is, if a primer pair described as “CAPS” is used, the Arabidopsis thaliana strain from which the site on the chromosome where the primer pair can be amplified is derived depends on the pattern of each cut fragment Can do. The restriction enzymes used here are described as “restriction enzymes” in the table.

  In the table, “Col” indicates the size (bp) of the amplified fragment when PCR was performed using the Colombian strain genomic DNA as a template in the case of SSLP, and in the case of CAPS, PCR was performed using the Colombian strain genomic DNA as a template. Shows the size (bp) of the cleaved fragment when the amplified fragment obtained by cleaving is cleaved with a predetermined restriction enzyme. Similarly, “Ler” in the table indicates the size (bp) of the amplified fragment when PCR was performed using the genomic DNA of the Lansburg strain as a template in the case of SSLP, and the genomic DNA of the Lansburg strain was represented in the case of CAPS. The size (bp) of the cleaved fragment when the amplified fragment obtained by performing PCR as a template is cleaved with a predetermined restriction enzyme is shown. Similarly, “WS” in the table indicates the size (bp) of the amplified fragment when PCR was performed using the genomic DNA of the Ws strain in the case of SSLP, and the genomic DNA of the Ws strain was used as the template in the case of CAPS. The size (bp) of the cleaved fragment when the amplified fragment obtained by PCR is cleaved with a predetermined restriction enzyme is shown.

  The fragment size (bp) described in the table represents the approximate chain length obtained by experiments. Here, the fragment size (bp) is not displayed to represent an accurate chain length, but is displayed for the purpose of showing that there is a difference in the fragment size pattern between each line.

  Each primer pair described in Tables 1 to 32 can be used only for PCR using the genomic DNA of each strain of Arabidopsis as a template, or after each PCR product can be treated with a restriction enzyme as necessary. It is possible to detect polymorphism between each system only by processing.

  In the present invention, an arbitrary primer pair may be selected from the total set of 366 primer pairs described in Tables 1 to 32, and a subset may be created. Such subsets are also included within the scope of the present invention.

  That is, the subset of the PCR primer pairs for mapping of the present invention is the entire set of primer pairs of primer numbers 1 to 366 shown in Tables 1 to 32, which are designed at predetermined intervals over the entire region of Arabidopsis genomic DNA. A plurality of primer pairs selected from. Here, the predetermined interval means that primer pairs are designed to be scattered all over the entire region of the genomic DNA. The predetermined interval does not necessarily mean that each primer pair is designed at a constant interval on the genomic DNA, but it is preferable that each primer pair is designed at a substantially constant interval.

  In the present invention, the primer pairs included in the subset can be, for example, 10 to 50 primer pairs. More specifically, the primer pairs included in the subset can be 2 to 10 primer pairs for each of the first to fifth chromosomes, for a total of 10 to 50 primer pairs. For example, a subset of primer pairs includes primer numbers 11, 43, 93, 111, 141, 168, 169, 202, 228, 232, 252, 268, 287, 328, 366 as a set. It is done.

More specifically, a subset of the mapping PCR primer pairs of the present invention can be composed of the following primer pairs of combinations A) to E):
A) Primers described in Tables 1 to 10 designed on the genomic DNA of the first chromosome by dividing the genomic DNA of the Arabidopsis first chromosome into a substantially equal region of a (a is an integer of 2 or more). A total of a primer pairs obtained by classifying the primer pairs of Nos. 1 to 109 into a groups corresponding to the regions and selecting one primer pair from each group;
B) Primers described in Tables 11 to 15 designed on the genomic DNA of the second chromosome by dividing the genomic DNA of the second chromosome of Arabidopsis into b substantially equal regions (b is an integer of 2 or more). A total of b primer pairs obtained by classifying the primer pairs of numbers 110 to 168 into b groups corresponding to the regions and selecting one primer pair from each group;
C) Primers according to Table 16 to Table 20 designed on the genomic DNA of the third chromosome by dividing the genomic DNA of the third chromosome of Arabidopsis into c (c is an integer of 2 or more) substantially equal regions A total of c primer pairs obtained by classifying the primer pairs of numbers 169 to 228 into c groups corresponding to the region and selecting one primer pair from each group;
D) The primers shown in Tables 21 to 24 designed on the genomic DNA of the fourth chromosome by dividing the genomic DNA of the fourth chromosome of Arabidopsis thaliana into d almost equal regions (d is an integer of 2 or more). A total of d primer pairs obtained by classifying the primer pairs of numbers 229 to 274 into d groups corresponding to the region and selecting one primer pair from each group; and E) Arabidopsis fifth By dividing the genomic DNA of the chromosome into e (e is an integer of 2 or more) substantially equal regions, primer numbers 275 to 366 shown in Tables 25 to 32 designed on the genomic DNA of the fifth chromosome The primer pairs are classified into e groups corresponding to the regions, and a total of e primers obtained by selecting one primer pair from each group. Rimmer vs.

  Here, each of the integers a to e is an integer of 2 or more, and is generally an integer of 2 to 10, and may be different or the same. For example, a = 4, b = 3, c = 3, d = 3, and e = 4. When a to e have such values, primer pairs A to Q selected from each region of each chromosome are schematically shown in FIG.

  As the integers a to e increase, the number of primer pairs increases accordingly, and when these primer pairs are used as a subset of the mapping PCR primer pairs, the mapping accuracy increases. However, since the number of primer pairs is large, the number of PCR reactions increases, and the labor of mapping operation increases. On the other hand, as the integers a to e become smaller, the number of primer pairs decreases accordingly, and when these primer pairs are used as a subset of mapping PCR primer pairs, the mapping accuracy is lowered, but the number of PCR reactions is reduced. The mapping operation becomes simple because it decreases.

  In the examples described later, a to e are 3 respectively, and each chromosomal DNA is divided into almost equal three regions (ie, the north region on the 5 ′ end side of the chromosomal DNA, the central region, and the south side on the 3 ′ end side of the chromosomal DNA). The primer pairs were selected one by one from each region.

That is, the subset of PCR primer pairs for mapping of the present invention can be composed of primer pairs of the following combinations a) to o):
a) any one primer pair selected from the group consisting of the primer pairs of primer numbers 1 to 30 described in Tables 1 to 3 designed in the northern region of Arabidopsis first chromosome;
b) Any one primer pair selected from the group consisting of the primer pairs of primer numbers 31 to 60 described in Tables 3 to 5 designed in the central region of Arabidopsis first chromosome;
c) Any one primer pair selected from the group consisting of the primer pairs of primer numbers 61 to 109 described in Tables 6 to 10 designed in the southern region of the first chromosome of Arabidopsis thaliana;
d) Any one primer pair selected from the group consisting of the primer pairs of primer numbers 110 to 130 described in Tables 11 to 12 designed in the northern region of Arabidopsis second chromosome;
e) any one primer pair selected from the group consisting of the primer pairs of primer numbers 131 to 150 described in Table 12 to Table 14 designed in the central region of Arabidopsis second chromosome;
f) Any one primer pair selected from the group consisting of the primer pairs of primer numbers 151 to 168 shown in Tables 14 to 15 designed in the southern region of Arabidopsis second chromosome;
g) Any one primer pair selected from the group consisting of the primer pairs of primer numbers 169 to 188 listed in Table 16 to Table 17 designed in the northern region of the third chromosome of Arabidopsis thaliana;
h) any one primer pair selected from the group consisting of the primer pairs of primer numbers 189 to 208 listed in Table 17 to Table 19 designed in the central region of Arabidopsis third chromosome;
i) Any one primer pair selected from the group consisting of the primer pairs of primer numbers 209 to 228 described in Table 19 to Table 20 designed in the southern region of the third chromosome of Arabidopsis thaliana;
j) Any one primer pair selected from the group consisting of the primer pairs of primer numbers 229 to 243 described in Tables 21 to 22 designed in the northern region of Arabidopsis fourth chromosome;
k) any one primer pair selected from the group consisting of the primer pairs of primer numbers 244 to 259 described in Table 22 to Table 23 designed in the central region of Arabidopsis fourth chromosome;
l) Any one primer pair selected from the group consisting of the primer pairs of primer numbers 260 to 274 listed in Table 23 to Table 24 designed in the southern region of Arabidopsis fourth chromosome;
m) any one primer pair selected from the group consisting of the primer pairs of primer numbers 275 to 305 described in Table 25 to Table 27 designed in the northern region of Arabidopsis chromosome 5;
n) any one primer pair selected from the group consisting of the primer pairs of primer numbers 306 to 336 listed in Table 27 to Table 30 designed in the central region of Arabidopsis fifth chromosome; and o) Arabidopsis fifth chromosome Any one primer pair selected from the group consisting of primer pairs of primer numbers 337 to 366 described in Table 30 to Table 32 designed in the south region of

  For example, as a subset of the primer pairs of the combinations a) to o), primer numbers 15, 60, 80, 120, 140, 160, 180, 200, 220, 240, 250, 270, 290, 325, 350 are included. One set is listed.

  As described above, one primer pair can be selected from each region of each chromosomal DNA divided into almost equal regions to form a subset. Here, when selecting primer pairs, it is desirable that the design positions on the chromosome of each primer pair are not close to each other. For example, when each chromosomal DNA is divided into almost equal three regions (north region on the 5 ′ end side of the chromosomal DNA, central region, south region on the 3 ′ end side of the chromosomal DNA), The primer pair designed in the region close to the 5 'end of the DNA is selected, the primer pair designed in the region close to the 3' end of the chromosomal DNA is selected from the south region, and the central region is selected from the central region. It is preferable to select a designed primer pair.

2. Method for Mapping Mutant Gene Using PCR Primer Set of the Present Invention The present invention further uses a subset of the above primer pair selected from the primer pairs of primer numbers 1 to 366 described in Tables 1 to 32 above. A method for determining the position of a mutated gene in Arabidopsis thaliana is provided.

The method for mapping the mutant gene of Arabidopsis thaliana of the present invention is as follows:
(1) crossing an Arabidopsis mutant having a mutant gene with a wild-type Arabidopsis thaliana having a different strain from the mutant to obtain a first generation;
(2) self-pollinating the obtained first generation to obtain a plurality of second generations;
(3) (i) When the first generation shows the wild type phenotype (ie, when the mutant gene is a recessive gene), the phenotype of the mutant is selected from the obtained second generation. Selecting a plurality of second generations to be indicated, or (ii) if the first generation exhibits the mutant phenotype (ie, the mutant gene is a dominant gene), Selecting a plurality of second generations exhibiting the wild type phenotype from among them,
(4) PCR is performed using each primer pair of a subset of the PCR primer pairs for mapping of the present invention using the genomic DNA of one of the plurality of second generations selected in the step (3) as a template. , Each site of genomic DNA amplified by each primer pair is a site derived from the mutant strain due to the difference in the size of the PCR product based on the polymorphism between the strains or the pattern of the cleavage fragment of the PCR product. Each of the genomes of each of the plurality of second generation individuals selected in the step (3), each of which is identified as a site derived from a wild-type strain. Steps performed on each of the DNAs;
(5) (i) when the first generation exhibits the wild-type phenotype, a site of genomic DNA identified as being derived from the mutant strain in the largest number of the selected second generations Determining and determining that the mutant gene is present in the vicinity of the determined genomic DNA site, or (ii) if the first generation exhibits the mutant phenotype, Determining a genomic DNA site identified as being derived from the wild-type strain in the largest number in two generations, and determining that a mutant gene is present in the vicinity of the genomic DNA site determined here.

  The method of the present invention can determine the position on the chromosome when the mutant gene is a recessive gene or when it is a dominant gene. Further, the method of the present invention can determine the position on the chromosome even when there are a plurality of mutant genes, but the method of the present invention can be used to determine the position of one mutant gene on the chromosome. Is preferably used.

2.1 Principle First, the principle of the method for mapping an Arabidopsis mutant gene of the present invention will be described with reference to FIGS. 2 and 3 schematically show only the chromosomes (ie, a set of homologous chromosomes) in which the mutated gene exists. In FIG. 2, the position where the mutated gene exists is displayed as “mutation”.

  In the mapping method of the present invention, an Arabidopsis mutant having a mutated gene and a wild type Arabidopsis of a strain different from the mutant are used. In FIG. 2, a Colombian strain (Col) Arabidopsis mutant having a recessive mutation and a Landsburg strain (Ler) wild-type Arabidopsis thaliana are used. Hereinafter, the case where these systems are used will be described as an example. The first generation (F1 generation) obtained by crossing these strains has two homologous chromosomes derived from the Col strain and the Ler strain one by one as shown in FIG. Then, when this F1 generation forms germ cells, meiosis occurs and recombination occurs between homologous chromosomes. Therefore, when the F1 generation is self-pollinated to obtain the second generation (F2 generation), there are individuals having a chimeric chromosome composed of a chromosomal region derived from the Col strain and a chromosomal region derived from the Ler strain in the F2 generation. included. For the F2 generation showing a mutant phenotype, the chromosomes (one set of homologous chromosomes) in which the mutated gene is present are schematically shown as an example of a chimeric chromosome as shown in FIG. That is, in the F2 generation showing a mutant phenotype, the chromosomal region in which the mutant gene exists is derived from the Col strain. Therefore, by creating a large number of F2 generations, selecting a large number of F2 generations exhibiting a mutant phenotype from them, and searching for a chromosomal region derived from the Col strain for the selected large number of F2 generations, Can be mapped. That is, it can be determined that the mutated gene is located in a chromosomal region identified to be derived from the Col strain in common to all F2 generations.

  Here, as a method for searching for a chromosomal region derived from the Col strain, the genetic polymorphism between the Col strain and the Ler strain is used, and each region is derived from the Col strain throughout the F2 generation genomic DNA. Or the region derived from the Ler strain. Specifically, as shown in FIG. 3, a technique using PCR, that is, a technique called CAPS (Cleaved Amplified Polymorphic Sequence) or SSLP (Simple Sequence Length Polymorphism) can be used. When the polymorphism between each strain is related to whether or not it is a recognition site for a restriction enzyme, a region containing that site is amplified by PCR and cleaved with a restriction enzyme, so that the amplified genomic DNA region becomes It can be determined from which line (CAPS). On the other hand, when the polymorphism between each strain is a difference in the length of the repetitive sequence, the region of the amplified genomic DNA is derived from which strain by amplifying the region containing the repetitive sequence by PCR. Can be determined (SSLP). In FIG. 3, primer pairs used in PCR are indicated by P-fw and P-rev. As shown in FIG. 3, when a certain chromosomal region is derived from the Col strain when two homologous chromosomes are derived from the Ler strain, one is derived from the Col strain and one is derived from the Ler strain. Can be distinguished by the difference in fragment size. As a specific example, FIG. 3 shows a case in which the Col strain contains a restriction enzyme cleavage site in the amplified DNA region and the Ler strain does not contain a restriction enzyme cleavage site, so that there is a difference in the electrophoresis band pattern ( CAPS). Further, FIG. 3 shows a case where a difference occurs in the band pattern of electrophoresis because the DNA region to be amplified contains a portion having a longer repetitive sequence in the Ler system than in the Col system (SSLP).

2.2 Explanation of each process Hereinafter, although each process (1)-(5) is demonstrated in detail, this invention is not limited.

[Process (1)]
Crossing is performed between a target mutant (for example, a Colombian line) to which a mutant gene is to be mapped and a wild type plant of a different line (for example, a Landsburg line) to obtain a first generation (F1 generation).

  Here, the target mutant to which the mutant gene is to be mapped may be a mutant obtained by natural mutation or a mutant obtained by mutagenesis. Mutagenesis can be performed as described below. In other words, among the next generation obtained by performing mutagen treatment on an Arabidopsis thaliana strain of a strain and self-pollinating the Arabidopsis thaliana plant body, compared to Arabidopsis thaliana (wild type), the phenotype was mutated. It can be prepared by selecting the resulting individual (individual having the mutant gene homozygous). Seeds, plants, calli and the like can be used as the wild type to be subjected to mutagen treatment. In the present invention, a known method can be used for mutagen treatment. As mutagens, chemical mutagens such as alkylating agents that alkylate DNA bases, electromagnetic waves that cause DNA damage such as ultraviolet rays and X-rays, Alternatively, a radioactive substance can be used. Alternatively, mutagen treatment is performed by a known Agrobacterium infection method, in which DNA in a region sandwiched between a pair of 25 base pair sequences at both ends of T-DNA is placed at random positions in wild-type genomic DNA. You may carry out by inserting. Preferably, the mutagen treatment is performed by immersing wild-type seeds in a solution containing a chemical mutagen (for example, ethyl methanesulfonic acid) at a concentration of 0.2 to 0.3% by weight for 12 to 16 hours.

  In the step (1), a mutant of a certain line and a wild type of a different line are crossed. Here, when the mutant strain is a Colombian strain, the Wildsburg strain can be used, and when the mutant strain is the Lansburg strain, the Colombian strain can be used as the wild type. Each line of Arabidopsis thaliana is available from LEHLE seed.

  The first generation (F1 generation) shows a wild type phenotype when the mutant gene to be mapped is a recessive gene. On the other hand, when the mutated gene to be mapped is a dominant gene, all phenotypes are mutated. Thus, by looking at the F1 generation phenotype, it is possible to determine whether the mutant gene to be mapped is a recessive gene or a dominant gene.

[Process (2)]
The first generation (F1 generation) obtained in the step (1) is self-pollinated to prepare a large number of second generations (F2 generation). For example, 100 to 200, preferably 500 to 1000 F2 generations are prepared.

  In the F1 generation, one homologous chromosome of both mutant and wild type strains is inherited. When this plant body (F1 generation) forms germ cells, recombination occurs between homologous chromosomes during meiosis. Therefore, some germ cells produced by the F1 generation include a chimeric chromosome composed of a chromosome derived from a mutant strain and a chromosome derived from a wild-type strain. Therefore, the F2 generation obtained by self-pollination includes individuals with both strains of chimeric chromosomes.

  When the target mutant gene is a recessive gene, all of the F2 generations showing the mutant phenotype have a chromosomal region in the vicinity of the mutant gene, and the two homologous chromosomes are both mutant strains (eg, Colombia). System). Therefore, the position of the mutant gene can be known by searching for a chromosomal region derived from a mutant strain (eg, the Colombian strain) in common for all the F2 generation mutants.

  On the other hand, when the target mutant gene is a dominant gene, all of the F2 generations that show a wild type phenotype have chromosomal regions in the vicinity of the mutant gene. For example, the Landsburg system). Therefore, the position of the mutated gene can be known by searching for a chromosomal region derived from a wild type strain (for example, the Lansburg strain) in common for all of the F2 generation mutants.

  Hereinafter, the case where the mutant gene to be mapped is a recessive gene will be described as an example throughout the detailed description of the present invention. In addition, the case where the mutant gene to be mapped is a dominant gene is also included in the scope of the present invention, and even when the mutant gene is a dominant gene, mapping can be similarly performed according to the following description. Hereinafter, a method for searching for a chromosomal region derived from a mutant strain in common among all the F2 generation mutants will be described in detail.

[Process (3)]
First, a plurality of second generations showing mutant phenotypes are selected from the second generations obtained by self-pollination of the first generation. As described above, since the mutant selected here has the target mutant gene in homozygosity, the chromosomal region in the vicinity of the mutant gene is derived from the mutant strain.

[Process (4)]
Next, the following PCR and identification are performed on all the individuals of the plurality of second generation selected in the step (3). That is, using the selected second-generation genomic DNA as a template, PCR was performed using each primer pair of the subset of the PCR primer pairs for mapping of the present invention, and each site of the genomic DNA amplified by each primer pair was Whether the site is derived from the mutant strain or the wild-type strain is identified.

  In order to examine which line the chromosomal region is derived from, as described above, the primer pair of the present invention that can detect polymorphism between lines can be used. As methods for detecting polymorphisms, the above-mentioned CAPS (Cleaved Amplified Polymorphic Sequence) and SSLP (Simple Sequence Length Polymorphism) are convenient, and both are methods using PCR. In any of the techniques, a genomic region containing a polymorphism is amplified by PCR using genomic DNA extracted from an F2 generation plant as a template. Next, in the case of CAPS, the PCR product is cleaved with a restriction enzyme, and the patterns of the cleaved fragments (number and length of the cleaved fragments) are compared to identify from which strain the region originates. In the case of SSLP, by comparing the lengths of PCR products, it is possible to identify which line the region is derived from.

  Such identification is performed for all the second generations selected in step (3). Since each second generation has two chromosomes as homologous chromosomes, identification here is performed for each chromosome.

  Thereby, it is determined whether each DNA site of the genome set of all selected second generations is derived from a mutant line or a wild type line. Specifically, when the number of second generation plant individuals selected is n individuals, each DNA site (each DNA site amplified by the primer pair of the present invention) of 2n genome sets is a mutant strain. Or from a wild-type strain (see Table 33 in Examples below).

  Therefore, in order to proceed with mapping by the mapping method of the present invention, if a large number of PCR markers (primer pairs) that can reliably detect polymorphisms between each strain are present on the genome, the loci are quickly narrowed down. can do. In other words, by amplifying genomic DNA using the PCR primer pair of the present invention as a PCR marker, it is possible to quickly determine to which strain the amplified genomic DNA region originates.

  Here, all the sets of PCR primer pairs of the present invention may be used as PCR markers, but in order to simplify the operation, some selected from all sets of PCR primer pairs of the present invention. These primer pairs are preferably used as PCR markers. That is, it is preferable to use a subset of the above-described PCR primer pairs of the present invention as a PCR marker. For example, as described in the examples below, each chromosome is divided into three regions: a north region (5 ′ end region of chromosomal DNA), a central region, and a south region (3 ′ end region of chromosomal DNA). One primer pair can be selected from each designed PCR primer pair, and a total of 15 PCR primer pairs can be used as PCR markers.

  In each PCR reaction using 15 PCR primer pairs, the second generation genomic DNA selected in step (3) was extracted, and the extracted genomic DNA solution was dispensed into 15 sample containers. This can be done in a container.

[Process (5)]
In step (4), it is determined whether each DNA site of the genome set of all the second generations is derived from the mutant strain or the wild-type strain. Determine the sites of genomic DNA identified as being derived from the mutant in two generations (sometimes almost all). It is determined that the mutated gene is present in the vicinity of the genomic DNA site determined here.

2.3 Preferred embodiment 2.3.1 Secondary mapping In the above step (5), after the approximate site where the mutated gene is present is determined, in order to further narrow down the position where the mutated gene is present, the following It is preferable to perform secondary mapping. Hereinafter, secondary mapping will be described by taking as an example the case where the mutant gene to be mapped is a recessive gene. In addition, the case where the mutant gene to be mapped is a dominant gene is also included in the scope of the present invention, and when the mutant gene is a dominant gene, secondary mapping can be similarly performed according to the following description.

[Process (6)]
First, the primer pair of the present invention designed in the vicinity of the site where the mutated gene is determined to exist in the above step (5) (the site of genomic DNA amplified by MAC12 of primer number 287 in the examples described later) A plurality of primer pairs are selected from the primer pairs described in Tables 1 to 32. In the examples described later, F7J8 with primer number 275, MAH20 with primer number 283, MAC12 with primer number 287, MRG7 with primer number 291 and K18P6 with primer number 300 were selected as such primer pairs.

  Here, “a primer pair designed in the vicinity of a site determined to have a mutated gene” means that the number of a primer pair that amplifies a site determined to have a mutated gene is n, for example, ( It means 3 to 10 primer pairs selected from the primer pair n-15) to the primer pair (n + 15).

[Process (7)]
Next, the following PCR and identification are performed on all of the plurality of second generation individuals selected in the step (3) using each primer pair selected in the step (6). That is, PCR is performed using each selected primer pair selected in step (6) using the selected second-generation genomic DNA as a template. Thereafter, each site of the genomic DNA amplified by each primer pair is identified by the CAPS method or the SSLP method as described above, whether it is derived from a mutant strain or a wild-type strain (Table of Examples described later). 34).

[Process (8)]
Based on the result identified in the above step (7), a chimeric chromosome having both a site derived from the mutant strain and a site derived from the wild type is selected from the plurality of second generations. A specific example of the chimeric chromosome selected here is schematically shown in FIG. In FIG. 4, PCR markers A to F indicate the primer pairs selected in the above step (6). The positions of the PCR markers A to F on the chimeric chromosome are indicated by the positions where the straight line indicating the PCR marker and the chimeric chromosome intersect.

[Process (9)]
From the result identified in the above step (7), in each chimeric chromosome, a chromosomal region derived from a wild-type strain (region filled in black in FIG. 4) is determined. Here, there is no mutated gene in the chromosomal region derived from the wild type strain. For example, in the chimeric chromosome 1 shown in FIG. 4, the DNA site of the chimeric chromosome amplified by the PCR marker A is derived from the wild type, and each DNA site of the chimeric chromosome amplified by the PCR markers B to F is mutated. It has been identified in step (7) above. From this result, in the chimeric chromosome 1, the region shaded in black in FIG. 4 (the region on the left side of the DNA site amplified by the PCR marker A) is determined to be a chromosomal region derived from a wild type strain. A region other than the region (open region) is determined to be a region derived from a mutant strain.

[Process (10)]
It is determined that the mutated gene is present in a chromosomal region (region between PCR markers C and D in FIG. 4) that does not correspond to any of the chromosomal regions determined to be derived from a wild type strain in a plurality of chimeric chromosomes. Thereby, it is possible to further narrow down the DNA region where the mutated gene is present.

  In this step, a large number of second generations are prepared, and if a large number of primers closely arranged in the vicinity of the site roughly determined that the mutant gene is present in the above step (5) is used, the mutant gene is more It is possible to map to a narrowed area. For example, if 250 to 1000 second generations are prepared, the mutated gene can be mapped in the region of about 80 kb.

2.3.2 Tertiary mapping As described above, after the location of the mutant gene is further narrowed down in the secondary mapping, the following tertiary mapping is performed to further narrow down the location of the mutant gene. It is preferable to carry out. Hereinafter, tertiary mapping will be described by taking as an example the case where the mutant gene to be mapped is a recessive gene. In addition, the case where the mutant gene to be mapped is a dominant gene is also included in the scope of the present invention, and even when the mutant gene is a dominant gene, the third mapping can be similarly performed according to the following description.

[Process (11)]
First, a second generation having a chimeric chromosome that has undergone recombination within the chromosomal region determined in the above step (10) is selected from the second generations prepared by the above steps (1) and (2). Select multiple. For this selection, the FIRE method (fast isolation of recombinants) is preferably used (Cell engineering separate volume Plant Cell Engineering Series 14 Plant Genome Research Protocol, p. 95-103). The FIRE method will be described below.

  In the FIRE method, two sets of PCR markers located at both ends of the region so as to sandwich the region determined to have a mutated gene by secondary mapping (the region between PCR markers C and D in FIG. 4). (PCR markers C and D in FIG. 4) are used. That is, in the FIRE method, a plurality of individuals having undergone recombination between two sets of PCR markers located at both ends of the chromosomal region determined in the above step (10) are selected.

  A large number of F2 seeds (before sprouting, phenotype is unknown, including both wild type and mutant phenotypes) are germinated, and DNA is extracted from each of all the seedlings. PCR is performed on the extracted DNA using the two sets of PCR markers (hereinafter also referred to as primer pairs C and D) sandwiching the mutated gene. For the two homologous chromosomes of each F2 generation, it is examined whether the DNA fragment amplified by each PCR marker is a wild type or a mutant type.

  The genotype in which the DNA fragment amplified by primer pair C is mutated in both of the two homologous chromosomes is referred to as “mutant genotype”, and one of the two homologous chromosomes is wild-type. A genotype in which the chromosome of the book is mutated is referred to as a “heterotype genotype”, and a genotype in which both homologous chromosomes are wild-type is referred to as a “wild-type genotype”. Similarly, the genotype in which the DNA fragment amplified by the primer pair D is mutated in both two homologous chromosomes is referred to as “mutant genotype, and one of the two homologous chromosomes is a wild type. A genotype in which one chromosome is mutated is called a “heterotype genotype”, and a genotype in which both two homologous chromosomes are wild-type is called a “wild-type genotype”.

Individuals (F2 generation) having different genotypes between the DNA fragment amplified by the primer pair C and the DNA fragment amplified by the primer pair D are selected. That is, individuals that have undergone recombination between two sets of PCR markers are selected. Here, the following 6 types are mentioned as individuals having different genotypes indicated by the respective PCR markers.
I) A type in which the DNA region amplified by primer pair C is “mutant genotype” and the DNA region amplified by primer pair D is “heterotype genotype”.
II) A type in which the DNA region amplified by primer pair C is “mutant genotype” and the DNA region amplified by primer pair D is “wild type genotype”.
III) A type in which the DNA region amplified by primer pair C is a “heterotype genotype” and the DNA region amplified by primer pair D is a “mutant genotype”.
IV) A type in which the DNA region amplified by primer pair C is “heterotype genotype” and the DNA region amplified by primer pair D is “wild type genotype”.
V) A type in which the DNA region amplified by primer pair C is “wild type genotype” and the DNA region amplified by primer pair D is “mutant genotype”.
VI) A type in which the DNA region amplified by primer pair C is “wild type genotype” and the DNA region amplified by primer pair D is “heterotype genotype”.

  Only the second generation individuals that have undergone recombination between the two sets of PCR markers selected in this way are grown until the phenotype is known.

[Process (12)]
PCR is performed on the selected second-generation individuals that have undergone recombination between the two sets of PCR markers, and the mutant gene is mapped. Here, as the primer pair used for PCR, among the primer pairs of the present invention described in Tables 1 to 32, the above two sets of PCR markers (primer pair C and D) and a primer pair designed between them ( In addition, for example, 3 to 10 primer pairs) are selected. That is, the primer pair of the present invention designed to sandwich the chromosomal region determined in the above step (10) and the primer pair of the present invention designed in the chromosomal region determined in the above step (10) select. In Examples described later, F7J8 of primer number 275 and MAH20 of primer number 283 are selected as the primer pair of the present invention designed to sandwich the chromosomal region determined in the above step (10), and the region As a primer pair of the present invention designed in the above, T7H20 of primer number 276, F15A17 of primer number 277, MED24 of primer number 279, MUK11 of primer number 280, and MJJ3s of primer number 281 were selected.

[Process (13)]
Using each primer pair selected in the above step (12), the following PCR and identification are performed on all individuals of the plurality of second generation selected in the above step (11). That is, PCR is performed using each selected primer pair selected in step (12) using the selected second generation genomic DNA as a template. Thereafter, each site of the genomic DNA amplified by each primer pair is identified by the CAPS method or the SSLP method as described above, whether it is derived from a mutant strain or a wild-type strain (Table of Examples described later). 35).

[Process (14)]
Based on the result identified in the above step (13), the position where the mutated gene is present can be determined on the chromosome. First, a second generation showing a mutant phenotype is further selected from a plurality of second generations selected in the above step (11), and attention is paid to chimeric chromosomes among homologous chromosomes possessed by the second generation. To do.

[Process (15)]
Next, from the result identified in the step (13), a chromosomal region derived from a wild-type strain (region in which no mutated gene is present) is determined in each of the chimeric chromosomes of interest in the step (14). Here, the region where the mutant gene does not exist is shown as a black region in FIG. For example, in the chimeric chromosome 2 shown in FIG. 4, each DNA site of the chimeric chromosome amplified by the PCR markers A and B is derived from the wild type, and each DNA site of the chimeric chromosome amplified by the PCR markers C to F is It has been identified in the above step (13) that it is derived from a mutant type. From this result, in the chimeric chromosome 2, it is determined that the blacked out region in FIG. 4 (the region on the left side of the DNA site amplified by the PCR marker B) is a chromosomal region derived from a wild type strain. A region other than the region (open region) is determined to be a region derived from a mutant strain.

[Process (16)]
In all the chimeric chromosomes focused on in the above step (14), it is determined that the mutated gene is present in the chromosomal region that was not determined to be derived from the wild type strain. Here, the region where the mutant gene is present is a region between PCR markers C and D in FIG.

  Thus, in the third mapping, a large number of second generations that have undergone recombination within the chromosomal region determined to have the mutant gene in the second mapping are prepared. Thereby, it is possible to further narrow down the DNA region where the mutated gene is present.

2.4 Extraction of Genomic DNA and PCR Conditions In the above-described steps, the second generation genomic DNA used as a PCR template can be extracted as described below. Moreover, PCR can be performed under the reaction conditions described below using the genomic DNA and the primer of the present invention.

(I) Extraction of genomic DNA Grind about one cotyledon leaf in a microtube. Add 200 ml of DNA extract (200 mM Tris-HCl (pH 7.5), 250 mM NaCl, 25 mM EDTA, 0.5% SDS) and stir. Add 400 ml of ethanol, stir, and centrifuge at 15000 rpm for 5 minutes. Dissolve the precipitate in 200 ml TE and subject 1 ml to PCR.

(Ii) PCR reaction solution The composition of the PCR reaction solution is per sample.
0.05μl TaKaRa Ex Taq (Takara Shuzo Co., Ltd.)
1μl dNTP Mixture (attached to TaKaRa Ex Taq)
1μl 10x Ex Taq Buffer (attached to TaKaRa Ex Taq)
0.25μl Marker primer (forward)
0.25μl Marker primer (reverse)
6.45μl H ₂ O
And 1 μl of the sample DNA solution.

(Iii) PCR reaction conditions The PCR reaction conditions vary slightly depending on the length of DNA to be amplified and the primers, but are basically the following conditions.
1st cycle 1st cycle
94 ° C 1 minute 2nd cycle 32 cycles
92 ° C 30 seconds
55 ° C 30 seconds
72 ° C 30 seconds 3rd cycle 1 cycle
72 ° C 1 minute

3. Examples An example of mapping of mutant genes using a subset of the primer pairs of the present invention is described below. In this example, the mutant gene SGR9 was mapped. FIG. 5 shows how the position on the chromosome where the mutant gene SRG9 exists is gradually narrowed down.

1) Primary mapping The strain of the sgr9-1 mutant (obtained from LEHLE seed) having the mutant gene SGR9 is Colombia. Therefore, first, seeds (F1 seeds) were obtained by crossing a wild strain (obtained from ABRC) of a Landsburg line different from the Colombian line with an sgr9-1 mutant. When F1 seeds were germinated and grown, all F1 generations showed a wild type phenotype. F2 seeds were obtained by self-pollination of the F1 generation. The sgr9-1 mutant shows an abnormal gravitropism in the flower stem, a recessive inheritance. Therefore, F2 seeds were sown, and 14 plants whose flower stems showed gravitropism abnormalities were selected. Here, since 14 plants have two chromosomes as homologous chromosomes, 28 chromosomes (that is, 28 genome sets) are investigated below. DNA was extracted from each selected plant and SGR9 gene mapping was performed using a subset of the primer pairs of the present invention described below.

  The primer pairs used are those that can detect polymorphisms between the Colombian line and the Lansburg line and are listed in Tables 1 to 32. As a subset of the primer pairs of the present invention, 15 primer pairs designed in the north, middle and south regions of each chromosome of Arabidopsis thaliana were used.

(A) Northern region of the first chromosome Primer name: F10K1 (primer pair described in primer number 11)
(B) Central region of the first chromosome Primer name: F28H19 (primer pair described in primer number 49)
(C) Southern region of the first chromosome Primer name: F17O7 (primer pair described in primer number 93)
(D) Northern region of the second chromosome Primer name: F2I9 (primer pair described in primer number 111)
(E) Central region of the second chromosome Primer name: T9J22 (primer pair described in primer number 141)
(F) Southern region of the second chromosome Primer name: T9J23 (primer pair described in primer number 168)
(G) Northern region of the third chromosome Primer name: T4P13 (primer pair described in primer number 169)
(H) Central region of the third chromosome Primer name: K17E12 (primer pair described in primer number 202)
(I) Southern region of the third chromosome Primer name: MAA21 (primer pair described in primer number 228)
(J) Northern region of chromosome 4 Primer name: T5J8 (primer pair described in primer number 232)
(K) Central region of chromosome 4 Primer name: FCA8 (primer pair described in primer number 252)
(L) Southern region of chromosome 4 Primer name: F3L17 (primer pair described in primer number 268)
(M) Northern region of chromosome 5 Primer name: MAC12 (primer pair described in primer number 287)
(N) Central region of chromosome 5 Primer name: K5J14 (primer pair described in primer number 328)
(O) Southern region of chromosome 5 Primer name: LA522 (primer pair described in primer number 366)

  Using the selected second-generation genomic DNA showing the mutant phenotype as a template, PCR is performed using each of the above primer pairs, and whether the obtained PCR product shows the mutant type (Colombia type) Each type was investigated to indicate whether it was a Landsburg type. The results are shown in the following table.

  When examining the second generation of 14 individuals (28 chromosomes), the PCR product amplified using the primer pair MAC12 designed on the north side of chromosome 5 shows that 27/28 is the mutant type (Colombia type). Indicated. That is, it was identified that the “region of genomic DNA amplified by primer pair MAC12” was derived from the mutant in the largest number (27) of the selected second generation chromosomes (28). This revealed that the SGR9 gene sits on the north side of chromosome 5.

2) Secondary mapping Furthermore, primer pairs designed in the vicinity: F7J8 (primer number 275), MAH20 (primer number 283), MAC12 (primer number 287), MRG7 (primer number 291), K18P6 (primer number 300) ) To confirm that the SGR9 gene is located between F7J8 and MAH20.

  That is, using the selected second generation (23 individuals including the above 14 individuals) genomic DNA showing the mutant phenotype as a template, PCR was performed using each of the above primer pairs, and the resulting PCR products were Whether it was a mutant type (Colombia type) or a wild type (Lansberg type) was examined. The results are shown in the following table.

  In Table 34, the second generation of Nos. 3, 4, 8, 11, 12, 14, 19, 20, 21 is a chimeric chromosome (both sites derived from mutant strains and sites derived from wild type strains). Having chromosomes). From the results shown in Table 34, in each of these second-generation chimeric chromosomes, the “region derived from the wild-type strain” was determined as a region where no mutant gene was present. Here, “regions derived from wild-type strains” are shown as black regions in FIG. It was determined that the mutant gene (SGR9 gene) is located in a region not corresponding to any of these regions (that is, a region between the PCR markers of F7J8 and MAH20).

3) Tertiary mapping Next, using the F7J8 (primer number 275) and MAH20 (primer number 283) PCR markers, the FIRE method was performed on 180 individuals of the second generation. 32 individuals who showed recombination were selected.

  For these 32 individuals, in addition to the two sets of PCR markers, PCR markers located between the two sets of PCR markers: T7H20 (primer number 276), F15A17 (primer number 277), MED24 (primer number 279), MUK11 (primer number) 280), MJJ3s (primer number 281), it was found that the SGR9 locus is between T7H20 and F15A17 (9 recombinants).

  Specifically, using the second generation (32 individuals) selected by the FIRE method as a template, PCR was performed using each of the above primer pairs, and the resulting PCR product was a mutant type (Colombia type). Or wild type (Lansberg type). The results are shown in Table 35 below. In Table 33 to Table 36, the same number is assigned to the same individual as the selected second generation individual number.

  From the results shown in Table 35, in each of the second generation chimera chromosomes (individual numbers 8, 20, 76, 102, 123, 126, 135, 155) showing a mutant phenotype, “derived from a wild type strain” The “region to do” was determined as the region where the mutant gene was not present. Here, “regions derived from wild-type strains” are shown as black regions in FIG. It was determined that the mutant gene (SGR9 gene) is located in a region not corresponding to any of these regions (that is, a region between T7H20 and F15A17).

  Here, the distance between T7H20 (primer number 276) and F15A17 (primer number 277) was about 350 kb. As described above, the primary mapping to the third mapping utilize the database of the PCR primer pair sets of the present invention.

In the third mapping of this example, the results of PCR using the second generation (individual numbers 8, 20, 76, 102, 123, 126, 135, 155) showing the mutant phenotype (Table) 35 and FIG. 7), the “region derived from the wild-type strain” is determined as the region where the mutant gene does not exist, and the locus of the mutant gene can be narrowed down to a region not corresponding to this region. It was.
However, when gene loci cannot be sufficiently narrowed down using only the results of the second generation showing the mutant phenotype, the second generation (individual number 138) showing the wild type of CH type and H- Paying attention also to the PCR results (Table 35) using the second generation (individual numbers 39, 51, 160, 171, 173, 174) showing the C type wild type, “regions derived from wild type strains” "May be determined as a region where the mutated gene exists, and the gene locus may be further narrowed down. Here, for convenience, the results shown in Table 35 are referred to as “C-H type wild type” in the order of C → H from the left, and “H-C” wild type in the order from the left. It is referred to as “HC type wild type”.

  However, when the gene loci still cannot be sufficiently narrowed down using the above results, the second generation (individual numbers 27, 40, 81, 94, 116, 143, 147, 183, 192) and the second generation (individual numbers 42, 92, 129, 149, 156, 159) showing HL type wild type, the loci of mutant genes may be narrowed down ( As described above, the wild type in which the results shown in Table 35 are L → H in order from the left is referred to as “L-H type wild type”, and the wild type in which H → L is in order from the left is “H- "L type wild type"). However, for the LH type wild type and the HL type wild type focused here, the position of the mutant gene cannot be narrowed down only from the PCR results (Table 35). Need to create. That is, the second generation (individual numbers 27, 40, 81, 94, 116, 143, 147, 183, 192) showing the wild type of the LH type and the second generation (individuals) showing the wild type of the HL type. By creating a third generation (F3 generation) for numbers 42, 92, 129, 149, 156, and 159) and examining their phenotypes, the loci can be narrowed down. If an individual showing a mutant phenotype is not obtained from the third generation, and all the third generations show a wild type phenotype, the mutant gene is identified as “wild type strain in the second generation chromosome. It is determined that the “region derived from” exists in a region that is homozygous. Alternatively, if a mutant phenotype appears in about 1/4 of the third generation created, the mutant gene is identified as “region derived from wild type strain” and “mutant strain” in the second generation chromosome. It is determined that the “region derived from” exists in a heterogeneous region.

4) Quaternary mapping In order to identify the locus in more detail, four sets of PCR markers (w, x, y, z) were inserted between T7H20 (primer number 276) and F15A17 (primer number 277). It was created independently, and it was finally found that SGR9 was contained in 24 genes in terms of the number of genes of about 70 kb in distance. In FIG. 5, four sets of PCR markers are indicated by w, x, y, and z, and each of the 24 genes is indicated by “→”.

Four sets of PCR markers w, x, y, and z are described below.
PCR marker w:
w-forward; GTGTGCATGAAGCACAGACC (SEQ ID NO: 733)
w-reverse; ACCAAGTGATCATGCAAGCC (SEQ ID NO: 734)
PCR marker x:
x-forward; AGAAGGCTACCAAGTTCCAGCC (SEQ ID NO: 735)
x-reverse; TGTTTGTTGTCGACATGTCATC (SEQ ID NO: 736)
PCR marker y:
y-forward; CTGCATTAGGTGTATCGTGTC (SEQ ID NO: 737)
y-reverse; TGGTAAAGTGACGGTGGTGG (SEQ ID NO: 738)
PCR marker z:
z-forward; GGTTTAAATCGAACGAGTCAC (SEQ ID NO: 739)
z-reverse; TAAATTTCTTTGTGGTTCCCTAC (SEQ ID NO: 740)

  The fourth-order mapping here was performed in the same manner as the third-order mapping. That is, among the 32 second generation individuals selected in the third mapping, individuals having undergone chromosome recombination between T7H20 and F15A17 (individual numbers 8, 39, 42, 51, 76, 92, 102.147). .167) were selected (see Table 35). Using the selected second-generation genomic DNA as a template, PCR was performed using T7H20 (primer number 276), F15A17 (primer number 277), and primer pairs of the above four sets of PCR markers. Whether it was a mutant type (Colombia type) or a wild type (Lansberg type) was examined. The results are shown in Table 36 below.

  From the result of individual number 8 shown in Table 36, it can be determined that the mutant gene is located between T7H20 and PCR marker y. From the result of individual number 167, the mutant gene is located between PCR marker x and F15A17. Then I was able to decide. Therefore, the mutated gene (SGR9 gene) was determined to be located between the PCR markers x and y.

  The 24 genes existing between the PCR markers x and y were examined in detail based on the information in the database, and the nucleotide sequence of the mutant and the wild strain were compared for a gene considered to be highly likely to be SGR9. The nucleotide sequences of 5 genes listed as candidates were confirmed, and mutations were found in the ORF of 1 gene.

  Whether this gene is definitely the SGR9 gene can be confirmed by a complementation test. That is, genomic DNA containing one gene determined as a mutated gene was cloned from a wild type plant and introduced into a sgr9-1 mutant having a mutated gene SGR9 to confirm that the phenotype could be restored to the wild type. To do.

The figure which showed typically the position on the chromosome of an example of the subset of the primer pair of this invention. The figure explaining the principle of mapping. The figure explaining the principle of mapping (continuation of FIG. 2). The figure which shows a mode that the area | region where a mutated gene exists is determined based on the area | region (black area) where the mutated gene does not exist in each chimeric chromosome. The figure which shows the process of determining the position of a variant gene (SGR9 gene) with the mapping method of this invention. The figure which shows the result of a secondary mapping. The figure which shows the result of a tertiary mapping.

Claims (8)

A complete set of PCR primer pairs for mapping that can distinguish each strain of Arabidopsis thaliana by the difference in PCR products based on polymorphisms between each strain,
33. A complete set of primer pairs of primer numbers 1 to 366 listed in Tables 1 to 32 designed over the entire region of Arabidopsis genomic DNA. A PCR primer pair for mapping capable of distinguishing each strain of Arabidopsis thaliana by a difference in PCR product based on polymorphism between each strain,
Any one primer pair selected from the primer pairs of primer numbers 1 to 366 shown in Tables 1 to 32 designed over the entire region of the genomic DNA of Arabidopsis thaliana. A subset of mapping PCR primer pairs capable of distinguishing each strain of Arabidopsis thaliana by the PCR product difference based on the polymorphism between each strain,
A subset of primer pairs composed of a plurality of primer pairs selected from the primer pairs of primer numbers 1 to 366 described in Tables 1 to 32 and designed at predetermined intervals over the entire region of Arabidopsis genomic DNA. A subset of mapping PCR primer pairs capable of distinguishing each strain of Arabidopsis thaliana by the PCR product difference based on the polymorphism between each strain,
A subset of primer pairs consisting of the following combinations:
A) Primers described in Tables 1 to 10 designed on the genomic DNA of the first chromosome by dividing the genomic DNA of the Arabidopsis first chromosome into a substantially equal region of a (a is an integer of 2 or more). A total of a primer pairs obtained by classifying the primer pairs of Nos. 1 to 109 into a groups corresponding to the regions and selecting one primer pair from each group;
B) Primers described in Tables 11 to 15 designed on the genomic DNA of the second chromosome by dividing the genomic DNA of the second chromosome of Arabidopsis into b substantially equal regions (b is an integer of 2 or more). A total of b primer pairs obtained by classifying the primer pairs of numbers 110 to 168 into b groups corresponding to the regions and selecting one primer pair from each group;
C) Primers according to Table 16 to Table 20 designed on the genomic DNA of the third chromosome by dividing the genomic DNA of the third chromosome of Arabidopsis into c (c is an integer of 2 or more) substantially equal regions A total of c primer pairs obtained by classifying the primer pairs of numbers 169 to 228 into c groups corresponding to the region and selecting one primer pair from each group;
D) The primers shown in Tables 21 to 24 designed on the genomic DNA of the fourth chromosome by dividing the genomic DNA of the fourth chromosome of Arabidopsis thaliana into d almost equal regions (d is an integer of 2 or more). A total of d primer pairs obtained by classifying the primer pairs of numbers 229 to 274 into d groups corresponding to the region and selecting one primer pair from each group; and E) Arabidopsis fifth By dividing the genomic DNA of the chromosome into e (e is an integer of 2 or more) substantially equal regions, primer numbers 275 to 366 shown in Tables 25 to 32 designed on the genomic DNA of the fifth chromosome The primer pairs are classified into e groups corresponding to the regions, and a total of e primers obtained by selecting one primer pair from each group. Rimmer vs. A subset of mapping PCR primer pairs capable of distinguishing each strain of Arabidopsis thaliana by the PCR product difference based on the polymorphism between each strain,
A subset of primer pairs consisting of the following combinations:
a) any one primer pair selected from the group consisting of the primer pairs of primer numbers 1 to 30 described in Tables 1 to 3 designed in the northern region of Arabidopsis first chromosome;
b) Any one primer pair selected from the group consisting of the primer pairs of primer numbers 31 to 60 described in Tables 3 to 5 designed in the central region of Arabidopsis first chromosome;
c) Any one primer pair selected from the group consisting of the primer pairs of primer numbers 61 to 109 described in Tables 6 to 10 designed in the southern region of the first chromosome of Arabidopsis thaliana;
d) Any one primer pair selected from the group consisting of the primer pairs of primer numbers 110 to 130 described in Tables 11 to 12 designed in the northern region of Arabidopsis second chromosome;
e) any one primer pair selected from the group consisting of the primer pairs of primer numbers 131 to 150 described in Table 12 to Table 14 designed in the central region of Arabidopsis second chromosome;
f) Any one primer pair selected from the group consisting of the primer pairs of primer numbers 151 to 168 shown in Tables 14 to 15 designed in the southern region of Arabidopsis second chromosome;
g) Any one primer pair selected from the group consisting of the primer pairs of primer numbers 169 to 188 listed in Table 16 to Table 17 designed in the northern region of the third chromosome of Arabidopsis thaliana;
h) any one primer pair selected from the group consisting of the primer pairs of primer numbers 189 to 208 listed in Table 17 to Table 19 designed in the central region of Arabidopsis third chromosome;
i) Any one primer pair selected from the group consisting of the primer pairs of primer numbers 209 to 228 described in Table 19 to Table 20 designed in the southern region of the third chromosome of Arabidopsis thaliana;
j) Any one primer pair selected from the group consisting of the primer pairs of primer numbers 229 to 243 described in Tables 21 to 22 designed in the northern region of Arabidopsis fourth chromosome;
k) any one primer pair selected from the group consisting of the primer pairs of primer numbers 244 to 259 described in Table 22 to Table 23 designed in the central region of Arabidopsis fourth chromosome;
l) Any one primer pair selected from the group consisting of the primer pairs of primer numbers 260 to 274 listed in Table 23 to Table 24 designed in the southern region of Arabidopsis fourth chromosome;
m) any one primer pair selected from the group consisting of the primer pairs of primer numbers 275 to 305 described in Table 25 to Table 27 designed in the northern region of Arabidopsis chromosome 5;
n) any one primer pair selected from the group consisting of the primer pairs of primer numbers 306 to 336 listed in Table 27 to Table 30 designed in the central region of Arabidopsis fifth chromosome; and o) Arabidopsis fifth chromosome Any one primer pair selected from the group consisting of primer pairs of primer numbers 337 to 366 described in Table 30 to Table 32 designed in the south region of A method for mapping a mutant gene of Arabidopsis,
(1) crossing an Arabidopsis mutant having a mutant gene with a wild-type Arabidopsis thaliana having a different strain from the mutant to obtain a first generation;
(2) self-pollinating the obtained first generation to obtain a plurality of second generations;
(3) (i) When the first generation shows the wild type phenotype (ie, when the mutant gene is a recessive gene), the phenotype of the mutant is selected from the obtained second generation. Selecting a plurality of second generations to be indicated, or (ii) if the first generation exhibits the mutant phenotype (ie, the mutant gene is a dominant gene), Selecting a plurality of second generations exhibiting the wild type phenotype from among them,
(4) A subset of the mapping PCR primer pair according to any one of claims 3 to 5, wherein the genomic DNA of one individual of the plurality of second generations selected in the step (3) is used as a template. PCR was performed using each primer pair, and each site of the genomic DNA amplified by each primer pair was caused by the difference in the size of the PCR product based on the polymorphism between each strain or the difference in the pattern of the cleavage fragment of the PCR product. A step of identifying whether the site is derived from the mutant strain or the wild-type strain, wherein the PCR and identification are selected in the step (3). The steps performed for each genomic DNA of all individuals of the second generation of
(5) (i) when the first generation exhibits the wild-type phenotype, a site of genomic DNA identified as being derived from the mutant strain in the largest number of the selected second generations Determining and determining that the mutant gene is present in the vicinity of the determined genomic DNA site, or (ii) if the first generation exhibits the mutant phenotype, Determining a site of genomic DNA identified as being derived from the wild-type strain in the largest number of two generations, and determining that a mutant gene is present in the vicinity of the site of genomic DNA determined here. Feature method. A method for mapping an Arabidopsis mutant gene according to claim 6, further comprising the following steps:
(6) A step of selecting a plurality of primer pairs designed in the vicinity of the genomic DNA site determined in step (5) from the primer pairs of primer numbers 1 to 366 described in Tables 1 to 32 When,
(7) PCR is performed using each primer pair selected in the step (6), using the genomic DNA of one individual of the plurality of second generations selected in the step (3) as a template, Whether each site of genomic DNA amplified by the primer pair is a site derived from the mutant strain due to the difference in the size of the PCR product based on the polymorphism between the strains or the pattern of the cleavage fragment of the PCR product Identifying whether each site is derived from the wild-type strain, wherein the PCR and identification are performed on each genomic DNA of the plurality of second generation individuals selected in the step (3). For each process,
(8) Based on the result identified in the step (7), from the chromosomes of the plurality of second generations, both the site derived from the mutant strain and the site derived from the wild type Selecting a plurality of chimeric chromosomes having,
(9) (i) When the first generation exhibits the wild type phenotype, from the result identified in the step (7), a chromosomal region derived from the wild type strain in each of the chimeric chromosomes (Ie, a region where no mutant gene is present), or (ii) when the first generation shows the mutant phenotype, from the result identified in the step (7), Determining the chromosomal region derived from the mutant strain (i.e., the region where the mutant gene does not exist),
(10) A step of determining that a mutant gene is present in a chromosomal region that does not correspond to any of the chromosomal regions determined in the step (9) in the plurality of chimeric chromosomes. A method for mapping the mutant gene of Arabidopsis thaliana according to claim 7, further comprising the following steps:
(11) A second generation having a chimeric chromosome that has undergone recombination within the chromosomal region determined in the step (10) is selected from the second generation prepared by the steps (1) and (2). Multiple selection from
(12) A primer pair designed to sandwich the chromosomal region determined in the step (10) from the primer pairs of primer numbers 1 to 366 described in Tables 1 to 32 and the step (10) A step of selecting a plurality of primer pairs designed in the chromosomal region determined in
(13) PCR is performed using each primer pair selected in the step (12), using as a template genomic DNA of one individual of the plurality of second generations selected in the step (11), Whether each site of genomic DNA amplified by the primer pair is a site derived from the mutant strain due to the difference in the size of the PCR product based on the polymorphism between the strains or the pattern of the cleavage fragment of the PCR product Identifying whether each site is derived from the wild-type strain, wherein the PCR and identification are performed on each genomic DNA of the plurality of second-generation individuals selected in the step (11). For each process,
(14) (i) When the first generation exhibits the wild type phenotype, a plurality of individuals exhibiting a mutant phenotype are selected from the plurality of second generations selected in the step (11). Or (ii) when the first generation exhibits the mutant phenotype, a plurality of individuals exhibiting a wild type phenotype are selected from the plurality of second generations selected in the step (11). A process of selecting,
(15) (i) When the first generation exhibits the wild-type phenotype, from the result identified in the step (13), in each of the individual chimeric chromosomes selected in the step (14), A step of determining a chromosomal region derived from the wild-type strain (ie, a region where no mutated gene is present), or (ii) if the first generation shows the phenotype of the variant, From the results obtained, in each of the individual chimeric chromosomes selected in the step (14), a step of determining a chromosomal region derived from the mutant strain (that is, a region where no mutated gene is present);
(16) A step of determining that a mutated gene is present in a chromosomal region that does not correspond to any of the chromosomal regions determined in the step (15) in the plurality of chimeric chromosomes.

Images