JP2005168411A - Method for investigating dna having activity for inhibiting proteolytic enzyme - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method by which a DNA having high possibility of having inhibiting activities can be extracted from two or more candidate DNAs by one inhibition-examining test. <P>SOLUTION: The method for investigating the DNA having the activities for inhibiting a proteolytic enzyme comprises (1) mixing the proteolytic enzyme with a complex obtained by binding the DNA having affinity for the proteolytic enzyme with a substrate of the proteolytic enzyme to conjugate the proteolytic enzyme with the complex, (2) bringing the resultant conjugate of the proteolytic enzyme with the complex into a state in which the proteolytic enzyme can react with the substrate, (3) bringing the conjugate into a state in which the conjugate is dissociated, and (4) isolating the complex having the undecomposed substrate from the complex having the decomposed substrate. <P>COPYRIGHT: (C)2005,JPO&NCIPI

Description

  The present invention relates to a method for exploring DNA having an inhibitory action on proteolytic enzymes.

  Conventionally, DNA that is an inhibitor having an inhibitory action on a proteolytic enzyme has been (1) searching for DNA having an affinity for a proteolytic enzyme, and identifying a DNA having an inhibitory action on the proteolytic enzyme from the searched DNA. , (3) clone the identified DNA, (4) sequence the cloned DNA, (5) prepare DNA based on the obtained sequence data, and (6) verify inhibition using the obtained DNA This is done by conducting an experiment and verifying that it certainly has an inhibitory effect.

  In the above method, it is necessary to carry out inhibition verification experiments for the number of cloned DNAs, which has been a bottleneck for searching for inhibitors.

  Therefore, an object of the present invention is to provide a method capable of extracting DNA having a high possibility of having an inhibitory action in a single inhibition verification experiment from a plurality of candidate DNAs.

The present invention for solving the above problems is as follows.
[Claim 1] A method for exploring DNA having an inhibitory action on a proteolytic enzyme,
(1) Mixing a proteolytic enzyme, a complex in which a DNA having affinity for the proteolytic enzyme and a substrate of the proteolytic enzyme are linked, and binding the proteolytic enzyme and the complex;
The resulting proteolytic enzyme-complex conjugate is brought into a state where the protein component (2) and the substrate can react with each other,
(3) The method comprising bringing the conjugate into a dissociating state and (4) isolating the complex in which the substrate is undegraded from the complex in which the substrate is degraded.
[2] The method according to [1], wherein the complex is an assembly of a complex in which a plurality of DNAs having different base sequences and a substrate are linked.
[Claim 3] The method according to claim 1 or 2, wherein the DNA has been confirmed to have an affinity for the proteolytic enzyme in advance.
[4] The method according to any one of [1] to [3], wherein the DNA has a base number of 10 to 1,000.
[Claim 5] The conjugate according to any one of claims 1 to 4, wherein the conjugate is recovered after the degradation enzyme and the substrate can react with each other, and the collected conjugate is dissociated. the method of.
[Claim 6] The method according to claim 5, wherein gel beads are immobilized in advance on the proteolytic enzyme, and the conjugate is recovered using the gel beads.
[Claim 7] Biotin is immobilized on the complex in advance, and the undecomposed complex is isolated using the interaction between biotin and avidin or streptavidin. Or the method according to claim 1.
[8] The method according to any one of [1] to [7], wherein the proteolytic enzyme is trypsin, cathepsin, thrombin, plasmin, caspase, or matrix metalloproteinase (MMP).
[9] The method according to any one of [1] to [8], wherein the substrate is a peptide or a protein.
[10] The method according to any one of [1] to [9], wherein the complex is obtained by linking DNA and a substrate of a proteolytic enzyme via a linker.
[11] The method according to [10], wherein the linker of the complex is generated by a bivalent reagent used for linking DNA and a substrate of a proteolytic enzyme.
[Claim 12] The method according to any one of claims 1 to 11, further comprising sequencing DNA contained in a complex in which the isolated substrate is undegraded.
[13] The method according to [12], wherein the DNA sequence includes amplification and / or cloning of DNA contained in the complex.
[14] A base sequence of DNA contained in a complex in which the isolated substrate is undegraded, and a complex DNA obtained by linking a DNA having affinity for the proteolytic enzyme and a substrate of the proteolytic enzyme. The method according to any one of claims 1 to 13, wherein the steps (1) to (4) according to claim 1 are repeated using a complex formed of DNA having the same base sequence as.

  According to the present invention, a complex in which a peptide substrate of a proteolytic enzyme is linked to the end of each DNA chain in a DNA library having affinity for a proteolytic enzyme via a linker having an appropriate length and property. Prepare and bind and react with the proteolytic enzyme. A DNA library with higher inhibitory activity can be obtained by recovering the undegraded complex from the reaction product and, for example, amplifying the DNA portion by PCR. By repeating this cycle, a DNA library having higher inhibitory activity can be selected.

  The present invention is a method for exploring DNA having an inhibitory action on proteolytic enzymes. In the present invention, the target proteolytic enzyme is not particularly limited, and examples thereof include trypsin, cathepsin, thrombin, plasmin, caspase, or matrix metalloproteinase (MMP).

Step (1)
In the method of the present invention, first, a proteolytic enzyme, a complex in which DNA having affinity for the proteolytic enzyme and a substrate of the proteolytic enzyme are linked are mixed, and the proteolytic enzyme and the complex are mixed. Are combined.

  The complex to be bound to the proteolytic enzyme contains DNA having an affinity for the proteolytic enzyme. This DNA has been previously confirmed to have an affinity for a proteolytic enzyme.

  Furthermore, the complex is preferably an assembly (library) of complexes in which a plurality of DNAs having different base sequences and a substrate are linked. That is, the complex is preferably an aggregate of complexes obtained by linking a plurality of DNAs having different base sequences and substrates, which have been confirmed to have an affinity for a proteolytic enzyme. The types of DNA having different base sequences can be appropriately set according to the number of DNAs extracted as a result of an affinity test with a proteolytic enzyme. More specifically, the complex is, for example, an aggregate of complexes that are confirmed to have an affinity with a proteolytic enzyme and that are obtained by linking a DNA having a base sequence ranging from 2 to 1,000 and a substrate. It is preferable. However, it is not intended to be limited to this range.

The DNA constituting the complex is not limited in the number of bases.
From the viewpoint of the length required for binding to a protein, the length of a substantially effective single-stranded region, and the efficiency of binding to avidin beads required for single-strand formation, The range is appropriate. However, it does not preclude less than this range or exceeding this range.

  The DNA constituting the complex can be prepared, for example, using the method for preparing a nucleic acid library described in JP-A No. 2002-315577.

  DNA that has been confirmed to have an affinity for a proteolytic enzyme can be obtained by, for example, the following known methods.

(Preparation of library)
A DNA group (group A) consisting of DNA containing an invariant sequence region at one end and a variable sequence region at the 3 ′ end, and a DNA group having a sequence complementary to the constant region of the group A at one end and a variable sequence at the 5 ′ end (Group B) are hybridized and the variable sequence regions of each other are ligated with T4 RNA ligase. After amplifying the ligated DNA by PCR, using this as a material, two single-stranded DNA groups having an invariant sequence region containing a sequence complementary to the ligated variable region are prepared. A DNA library is prepared by a DNA block shuffling method using these operations as basic cycles.

Examples of DNA sequences used are shown below.
(Group A invariant sequence) 5'GGCTCGCGAATACTGCGAAGACCACCATG (SEQ ID NO: 1)
(Group B invariant sequence) 5'GATCTCACTCCTTCGCAGTATTCGCGAGCC (SEQ ID NO: 2)
(Variable sequence) 5'GGC, 5'ATT, 5'GAC, 5'AAA, 5'TCC, 5'TGC or 5'CCA

A DNA library having a variable sequence region length of 48 bases can be obtained by performing four basic cycles.
The method shown here is the method described in the following document.
Koichiro Kitamura et al., 843-853, Protein Engineering, Vol.15, No.10

(Acupuncture due to affinity)
Amplify the DNA library with a biotin-labeled primer, cleave the invariant sequence region on the non-biotin-labeled side with a restriction enzyme, and then use the biotin-avidin interaction to produce single-stranded DNA that does not contain a biotin label. to recover. This DNA is hybridized with a biotin-labeled DNA oligomer containing a sequence complementary to the invariant sequence region, and only the variable region is converted to a single-stranded DNA, which is then allowed to act on the enzyme immobilized on the gel beads. This bound product is washed with a washing solution (for example, 50 mM Tris-HCl (pH 7.2), 0.5 M NaCl), and then eluted with an eluent (for example, 50 mM Tris-HCl (pH 7.2), 1 M NaCl, 10 mM MgCl ₂ ). To do. The eluate removes the biotin-labeled DNA oligomer hybridized using biotin-avidin interaction, and then another DNA oligomer is linked to the recovered single-stranded DNA library with T4RNA ligase, and this can be changed by PCR. Amplify the sequence region. This basic cycle is repeated while increasing the stringency of the washing solution and the eluate, and DNA having affinity for the enzyme is selected.

  Furthermore, this complex is a complex in which DNA and a substrate of a proteolytic enzyme are linked. The substrate of the proteolytic enzyme can be appropriately selected according to the target proteolytic enzyme, and can be, for example, a peptide or a protein.

Ligation of the DNA and the substrate can be appropriately performed using a known method.
Known methods are, for example, the methods described in the following documents.
(1) ND Shinha et al., 2659-2669, Nucleic Acids Research, 1988, Vol.16, No.6,
(2) Jerzy Olejnik et al., 4626-4631, Nucleic Acids Research, 1999, Vol.27, No.23,
(3) Joseph G. Harrison et al., 3136-3145, Nucleic Acids Research, 1998, Vol.26, No.13,
(4) Nicholas J Ede et al., 373-378, Bioconjugate Chem. 1994, Vol.5

The complex may be one in which DNA and a substrate of a proteolytic enzyme are linked via a linker. Examples of the divalent reagent that can be used as the linker include the following.
Disuccinimidyl suberate (DSS)
N- [ε-Maleimidocaproyloxy] succinimide ester (EMCS)
N- [ε-Maleimidocaproyloxy] sulfosuccinimide ester (Sulfo-EMCS)
N- [γ-Maleimidobutyryloxy] succinimide ester (GMBS)
N- [γ-Maleimidobutyryloxy] sulfosuccinimide ester (Sulfo-GMBS)
N- [κ-Maleimidoundecanoyloxy] -sulfosuccinimide ester (Sulfo-KMUS)

  FIG. 1 shows a conceptual diagram of a complex in which DNA and a protease substrate are linked. In the figure, DNA indicates a single-stranded DNA having a structure including a variable sequence region corresponding to a library in the center adjacent to an invariable sequence region corresponding to the sequence of PCR primers at both ends. The complex in which the DNA and the substrate of the proteolytic enzyme are linked is, for example, a DNA functional group derived from a PCR primer labeled with a functional group such as a thiol group at the 5 ′ end and a terminal functional group of the substrate peptide, or For example, a functional group of an amino acid side chain such as lysine can be synthesized by, for example, bonding via a corresponding functional group selective divalent reagent. It shows that the peptide substrate contains a biotin label for selection on the side different from the DNA binding site with respect to the substrate cleavage site.

Step (2)
Next, the resulting conjugate of the proteolytic enzyme and the complex is brought into a state where the proteolytic enzyme and the substrate can react. More specifically, for example, as follows.
The complex and gel bead-immobilized cathepsin E are mixed at a molar ratio of (2: 1), and then incubated in a reaction buffer at 40 ° C. for 10 minutes. (Reaction buffer composition: 50 mM sodium acetate, 5 mM MgCl ₂ , 0.1 M NaCl) After 10 minutes, 5% trichloroacetic acid is added to stop the reaction.

  It is preferable to separate a conjugate obtained by allowing the proteolytic enzyme and the substrate to react with each other. In this separation, for example, gel beads are immobilized on a proteolytic enzyme in advance, and the conjugate can be separated by collecting the proteolytic enzyme using the gel beads.

Step (3)
The reaction is allowed to occur, and the recovered conjugate is then allowed to dissociate. The state in which the conjugate is dissociated includes, for example, an operation in which an equal amount of streptavidin magnetic beads is put into the solution after the reaction and incubated at room temperature for 1 hour with stirring. The composition of the suspension of streptavidin magnetic beads is 2M NaCl and high ionic strength, so that the conjugate is easily dissociated, but in some cases, it can be supplemented by a heating operation.

  As a result of the above dissociation operation, the conjugate of the proteolytic enzyme and the complex in which the substrate portion of the complex is undegraded, and the conjugate of the proteolytic enzyme and the complex in which the substrate portion of the complex is degraded are both Dissociates into proteolytic enzymes, undegraded complexes and degraded complexes (DNA and part of substrate and other part of substrate).

Step (4)
The complex in which the substrate portion is undegraded is then isolated from the degraded complex.

  The DNA constituting the complex has been previously confirmed to have affinity with a proteolytic enzyme as described above. However, it is unclear at this point which part of the proteolytic enzyme has affinity. Among DNAs that have an affinity for proteolytic enzymes, substances that have affinity at or near the proteolytic enzyme reaction site and as a result inhibit the enzymatic reaction of the proteolytic enzyme, the substrate constituting the complex is proteolytic There is a high probability that it will not be degraded by enzymes. On the other hand, in the case of a complex that has DNA having affinity at a site other than the proteolytic enzyme reaction site or its vicinity as a constituent component, depending on the DNA, the enzymatic reaction of the proteolytic enzyme is not inhibited and constitutes a complex. The substrate is likely to be degraded by proteolytic enzymes.

  Thus, when the complex is undegraded, it is considered that the DNA constituting the complex is highly likely to have affinity at or near the reaction site of the proteolytic enzyme. In the present invention, the substrate portion is undegraded. A complex is isolated.

  The length of the linker that constitutes the above-mentioned complex is, for example, a substrate that constitutes the complex in the case of a complex having DNA having affinity at a site other than the reaction site of the proteolytic enzyme or its vicinity as a constituent component. However, it is preferable to determine so as to increase the possibility of being degraded by a proteolytic enzyme. By doing so, when the complex is undegraded, there is a high possibility that the DNA constituting the complex has affinity at or near the reaction site of the proteolytic enzyme.

  As a more specific isolation method, for example, biotin, for example, is immobilized in advance on the complex. In particular, biotin is immobilized on the end of the complex substrate (on the opposite side to the DNA). By doing so, since the conjugate of the undegraded complex and the proteolytic enzyme has biotin, it can be isolated as one that binds to avidin or streptavidin. On the other hand, in the conjugate in which the substrate is degraded by the proteolytic enzyme, biotin is separated from the complex together with a part of the substrate, and thus has no binding property to these.

In this way, a complex in which the substrate portion is undegraded is isolated.
By isolating the isolated complex, a substance (DNA) that has affinity at or near the proteolytic enzyme reaction site and is likely to inhibit the enzymatic reaction of the proteolytic enzyme is obtained by sequencing the DNA portion. Can be identified. More specifically, the DNA contained in the complex is amplified, and then the DNA base sequence is determined. Amplification of DNA and determination of the base sequence of DNA can be performed by conventional methods.

In the method of the present invention, the DNA of a complex in which DNA having affinity for a proteolytic enzyme and the substrate of this proteolytic enzyme are linked is included in the complex in which the substrate isolated as described above is undegraded. The above steps (1) to (4) can be repeated again using a complex formed of DNA having the same base sequence as that of the DNA.
Thus, by repeating the above cycles (1) to (4), wrinkles due to affinity progress, and further improvement in inhibitory activity is expected.

The embodiment of the method of the present invention will be described more specifically with reference to the explanatory diagram of FIG.
(1) A 5 ′ terminal thiol-labeled single-stranded DNA library is prepared from a PCR product using a 5 ′ thiol-labeled primer and a 5 ′ biotin-labeled primer using biotin-avidin interaction.
(2) The 5 ′ terminal thiol-labeled single-stranded DNA library is reacted with a bivalent reagent such as EMCS.
(3) After purification of the EMCS-added DNA library, a DNA-peptide substrate is obtained by reacting with a peptide having lysine at the C-terminus and biotin at the N-terminus and a substrate sequence of proteolytic enzyme at the central portion. Create a complex.
(4) The DNA-peptide substrate complex binds to the proteolytic enzyme immobilized on the gel beads, and is incubated under conditions where the peptide substrate is degraded.
(5) The beads are washed to remove the unbound DNA-peptide substrate complex, and then the bound DNA-peptide substrate complex is recovered (including those that have been cleaved and unreacted).
(6) The uncleaved DNA-peptide substrate complex is recovered from the recovered DNA-peptide substrate complex using the biotin / avidin interaction.
(7) Using the recovered uncleaved DNA-peptide substrate complex as a template, PCR using a 5 ′ thiol labeled primer and a 5 ′ biotin labeled primer is performed.
(8) By repeating the operations from Step 1 to Step 7, a group of DNAs having a proteolytic enzyme inhibitory activity is selected. The selected DNA group is subjected to activity assay and sequencing after cloning according to conventional methods.

Screening of DNA library having affinity for cathepsin E Screening of DNA library having affinity for cathepsin E was performed according to the following protocol.

1) PCR amplification PCR amplification is carried out by the following method using an undisclosed DNA library as a template.

Taq polymerase (Greiner, Tokyo, Japan) 1U
10 x buffer 5 μl
[670 mM Tris-HCl, 166 mM (NH ₄ ) ₂ SO ₄ , 4.5% TritonX100, 2 mg / ml gelatin]
MgCl ₂ (25 mM) 5 μl
dNTP (2.5 mM) 4 μl
Template DNA library (1fmole or more)
Primer b-3 'stem primer (100pmol / μl) 0.5μl
5 'part primer (100pmol / μl) 0.5μl
H ₂ O up to 50μl
* Can be scaled up as needed.
program
90 ℃ 2min
90 ° C 30sec
45 ℃ 1min
72 ℃ 30sec
30 cycles of 90 ° C. for 30 sec, 45 ° C. for 1 min and 72 ° C. for 30 sec are performed, and the obtained amplification product is confirmed by electrophoresis and purified by ethanol precipitation.

2) Restriction enzyme treatment (Mbo II)
Reaction mixture:
Mbo II (Takara) 8U
10 x L Buffer 5μl
[100 mM Tris-HCl (pH 7.5), 100 mM MgCl2, 10 mM dithiothreitol]
DNA ~ 50pmol
H ₂ O up to 50μl
Incubate at 37 ° C for 1 hour.

3) Preparation of single-stranded DNA
a. Binding of DNA to streptavidin magnetic beads 50 μl of restriction enzyme digest
Streptavidin magnetic beads 50μl
[Dynabeads M-280 Streptavidin (Dynal, Oslo, Norway)]
Shake the suspension for 30 minutes.
Fix the beads to the bottom of the tube with a magnet and discard the supernatant.
b. Cleaning with 0.01% BSA aqueous solution
Add 100 μl of 0.01% BSA and mix well.
Fix the beads to the bottom of the tube with a magnet and discard the supernatant.
This operation is repeated twice.
c. Denaturation of double-stranded DNA and recovery of non-biotin-labeled single-stranded DNA Treated with 50 μl of 25% (w / v) ammonia water for 2 minutes at room temperature, fixed the beads to the bottom of the tube with a magnet, and then the supernatant Recover. (Non-biotin-labeled single-stranded DNA is present in the supernatant)
This operation is repeated twice.
The collected liquid is dried.

4) Primer b-3 'stem hybridization Dissolve the collected ssDNA in 95 µl of selection buffer (see below). Add 5 μl of b-3 ′ stem primer solution (10 pmol / μl).
DNA is hybridized by heat treatment at 94 ° C. (5 minutes) and 60 ° C. (15 minutes).

5) In vitro screening for DNA aptamers Materials:
1. Selection buffer:
50 mM sodium acetate (pH 4.5)
100 mM NaCl
5 mM MgCl ₂
2.Washing buffer 1:
50 mM sodium acetate (pH 4.5)
0.5 M NaCl
3.Washing buffer 2:
50 mM sodium acetate (pH 4.5)
1 M NaCl
4.Elution buffer 1:
50 mM sodium acetate (pH 4.5)
1 M NaCl
10 mM MgCl ₂
5.Elution buffer 2:
50 mM sodium acetate (pH 4.5)
2 M NaCl
10 mM MgCl ₂

operation:
Step 1. React the DNA in the selection buffer with the immobilized enzyme for 20-30 minutes.
DNA: 100 μl (selection buffer)
Enzyme: 5 μl (prepared by immobilization and activity assay)
DNA: enzyme molar ratio = 4: 1

Step 2. Washing with selection buffer Add 200 μl of selection buffer to the above reaction and gently tap the tube several times. After centrifuging for 30 seconds in a tabletop centrifuge, gently suck out and discard the supernatant.
Repeat this operation as described in Table 1 below.

Step 3. Wash with wash buffer 1 After the wash and centrifugation round 5 from step 2, add 200 μl wash buffer 1 and gently tap the tube several times. After centrifuging for 30 seconds in a tabletop centrifuge, gently suck out and discard the supernatant.
Repeat this operation as described in Table 1 below.

Step 4. Washing with wash buffer 2 This step involves two operations:
A) Add 200 μl wash buffer 2 and tap the tube gently several times. React for 5 minutes at room temperature with occasional tapping. After centrifuging for 30 seconds in a tabletop centrifuge, gently suck out and discard the supernatant.
Repeat this operation as described in Table 1 below.
B) Add 200 μl Wash Buffer 2 and tap the tube gently several times. After centrifugation at 15000 rpm for 1 minute, gently pipet off the supernatant and discard.
Repeat this operation as described in Table 1 below.

Step 5. Elution with elution buffer 1 First, prepare a thermostat at 37 ℃. Add 100 μl elution buffer 1 and gently tap the tube several times. Immerse the tube in a thermostat for 10 minutes. Tap gently at intervals of 2-5 minutes and return to the thermostat again. After centrifugation for 30 seconds in a tabletop centrifuge, the supernatant is gently aspirated and collected into a clean tube.
This operation is repeated twice.

Step 6. Elution with Elution Buffer 2 First, prepare a thermostatic bath at 95 ° C. Add 100 μl of elution buffer 2 and gently tap the tube several times. Immerse the tube in a thermostatic bath for 5 minutes. Tap gently at intervals of 2 minutes and return to the thermostat again. After centrifugation for 30 seconds in a tabletop centrifuge, the supernatant is gently aspirated and collected into a clean tube.
This operation is repeated twice.
DNA is purified from the collected supernatant by ethanol precipitation.
Note: If the salt concentration is high, wash the pellet a few times with 70% ethanol.

6) Preparation of single-stranded DNA (same as (3))
a. Binding of DNA to Streptavidin Magnetic Beads Add the following to the recovered DNA.
10 μl of water
Streptavidin magnetic beads 10μl
[Dynabeads M-280 Streptavidin (Dynal, Oslo, Norway)]
Shake the suspension for 30 minutes.
Fix the beads to the bottom of the tube with a magnet and discard the supernatant.
b. Cleaning with 0.01% BSA aqueous solution
Add 100 μl of 0.01% BSA and mix well.
Fix the beads to the bottom of the tube with a magnet and discard the supernatant.
This operation is repeated twice.
c. Denaturation of double-stranded DNA and recovery of non-biotin-labeled single-stranded DNA Treat with 50 μl of 25% (w / v) ammonia water for 2 minutes at room temperature, and fix the beads to the bottom of the tube with a magnet. Collect Qing. (Non-biotin-labeled single-stranded DNA is present in the supernatant)
This operation is repeated twice.
The collected liquid is dried.

7) Hybridization Dissolve the recovered single-stranded DNA in 2 μl of water. 1 μl primer b-5'stem solution (1 pmol / μl) and 5 μl 2 × TRL buffer [100 mM Tris-HCl (pH 8.0), 20 mM MgCl ₂ , 20 mg / l BSA, 2 mM hexaamine cobalt chloride (III), 50 % Polyethylene glycol 6000] is added.
DNA is hybridized by heat treatment at 94 ° C (5 minutes) and 60 ° C (15 minutes).

8) Y-ligation reaction
Add 1 μl of 1 mM ATP and 2 μl (50 U) of T4 RNA ligase (Takara) and react overnight (12 hours) at 25 ° C.
Repeat steps 1-8.

Preparation of Peptide / DNA Complex A peptide / DNA complex was prepared according to the following protocol.
(1) Using the 5 ′ biotin-labeled primer (b-3h-Stem: GGCTCGCGAATACTGCGAAGGAGTGAGATC) (SEQ ID NO: 3) and the 5 ′ thiol-labeled primer (SH-5sPartT7: CTGCGAAGACCACCATG) (SEQ ID NO: 4) Amplify by PCR (50 pmole, 50 μL of each PCR).
(2) Add 100 μL of streptavidin magnetic bead suspension (2 × B & W) and shake for 1 hour.
(3) The beads are extracted twice with 25 μL of aqueous ammonia (2 minutes) to recover the thiol group-labeled chain and then dried.
(4) Add 10 μl of bivalent reagent EMCS (N- [ε-maleimidocaproyloxy] succinimide ester, 1 mg / mL-acetonitrile) solution and stir at 37 ° C. for 1 hour.
(5) After evaporation of acetonitrile, dissolve in 20 μL of 0.1 M phosphate buffer (pH 7.0), and desalinate with a gel filtration desalting column (NAP5, Pharmacia).
(6) After drying the collected 1 mL modified DNA aqueous solution, 1 μL of 1M sodium bicarbonate solution, 2 μL of water and 6 μL of aqueous peptide solution (2 mg / mL) (N-terminal biotin-labeled Pro Pro Thr Ile Phe Phe Arg Leu Lys) And leave at 37 ° C. overnight.
(7) The reaction solution is desalted with a NAP5 column, and the recovered solution is dried.
(8) Dissolve in 100 μL of 0.1 M phosphate buffer (pH 7.0), add 100 μL of streptavidin magnetic bead suspension (2 × B & W), and shake for 1 hour.
(9) The beads are washed twice with 25 μL of aqueous ammonia (2 minutes) and then extracted twice with 25 μL of aqueous ammonia (65 ° C., 15 minutes) to recover peptide-bound DNA.

Sputum Test Method A sputum test was performed according to the following method.
(1) A peptide substrate / DNA complex and gel bead-fixed cathepsin E are mixed at a molar ratio of (2: 1), and then incubated in a reaction buffer at 40 ° C. for 10 minutes. (Reaction buffer composition: 50 mM sodium acetate (pH 4.5), 5 mM MgCl ₂ , 0.1 M NaCl)
(2) After 10 minutes, 5% trichloroacetic acid is added to stop the reaction.
(3) Add an equal amount of streptavidin magnetic bead suspension to the solution after the reaction, and incubate at room temperature for 1 hour with stirring.
(4) Fix the magnetic beads with a magnet and discard the supernatant. The remaining magnetic beads are washed twice with 200 μl of 0.01% BSA.
(5) Add 25 μl of 25% aqueous ammonia to magnetic beads and incubate at 60 ° C. for 15 minutes. Thereafter, the supernatant is collected. This operation is performed twice.
(6) After ammonia water is evaporated with a freeze dryer, PCR is carried out using a template dissolved in 10 μl of water (30 cycles of 94 ° C. for 30 seconds, 50 ° C. for 1 minute and 72 ° C. for 30 seconds).
PCR conditions
94 ° C 2 minutes
94 ℃ 30 seconds
50 ° C for 1 minute
72 ° C 30 seconds
72 ° C 5 minutes
(7) Create an SF link for the next cycle based on the PCR product and rotate the cocoon cycle.

Cathepsin E inhibitory activity assay method (1) Incubate selection buffer (50 mM sodium acetate (pH4.5), 5 mM MgCl ₂ , 0.1 M NaCl) 86 μl and cathepsin E solution (3.36 mM) 3 μl at room temperature for 5 minutes.
(2) Add 1 μl of a single-stranded library PCR product (non-biotin chain side, 10 pmol / μl) to this solution, and incubate at room temperature for 15 minutes. (Blank with 1 μl of water added at the same time)
(3) Add 10 μl of cathepsin E substrate (Peptide Research Institute Code: 3200-V) to this solution and react at 40 ° C. for 10 minutes.
(4) After 10 minutes, immediately transfer to ice and stop the reaction by adding 1 ml of 5% trichloroacetic acid.
(5) This solution is measured with a spectrofluorometer (328 nm Excitation, 396 nm Emission). Since the peak at 396 nm increases as the activity of cathepsin E increases, the inhibitory activity of the library can be determined by comparing the value with the blank.

FIG. 3 shows the results of assaying cathepsin E inhibitory activity of a DNA library that had been cleaved with an affinity for cathepsin E and a DNA library that had been cleaved with an inhibitory activity against cathepsin E using this method.
Af-Round3: DNA library after selection by affinity
SF-Round1: DNA library after drought due to inhibitory activity in this method As a result, the DNA library obtained by subjecting this method to one cycle of the DNA library drowned with affinity was found to have improved inhibitory activity. Furthermore, further improvement of the inhibitory activity is expected by repeating the same cycle.

The conceptual diagram of the composite_body | complex which connected DNA and the substrate of proteolytic enzyme. FIG. 10 is an explanatory diagram of one embodiment of the present invention. Test result of cathepsin E inhibitory activity. In the figure, Af-Round3 is a DNA library after acupuncture by affinity, and SF-Round1 is a DNA library after acupuncture by inhibitory activity in the method of the present invention.

Claims (14)

A method for exploring DNA having an inhibitory action on a proteolytic enzyme,
(1) Mixing a proteolytic enzyme, a complex in which a DNA having affinity for the proteolytic enzyme and a substrate of the proteolytic enzyme are linked, and binding the proteolytic enzyme and the complex;
The resulting proteolytic enzyme-complex conjugate is brought into a state where the protein component (2) and the substrate can react with each other,
(3) The method comprising bringing the conjugate into a dissociating state and (4) isolating the complex in which the substrate is undegraded from the complex in which the substrate is degraded. The method according to claim 1, wherein the complex is an aggregate of a complex in which a plurality of DNAs having different base sequences and a substrate are linked. The method according to claim 1 or 2, wherein the DNA has been confirmed to have an affinity for the proteolytic enzyme in advance. The method according to any one of claims 1 to 3, wherein the DNA has a base number of 10 to 1,000. The method according to any one of claims 1 to 4, wherein the conjugate is recovered after the degradation enzyme and the substrate can react with each other, and the recovered conjugate is dissociated. The method according to claim 5, wherein gel beads are immobilized in advance on the proteolytic enzyme, and the conjugate is recovered using the gel beads. The biotin is immobilized on the complex in advance, and the undegraded complex is isolated using the interaction between biotin and avidin or streptavidin. the method of. The method according to any one of claims 1 to 7, wherein the proteolytic enzyme is trypsin, cathepsin, thrombin, plasmin, caspase, or matrix metalloproteinase (MMP). The method according to any one of claims 1 to 8, wherein the substrate is a peptide or a protein. The method according to any one of claims 1 to 9, wherein the complex is obtained by linking DNA and a substrate of a proteolytic enzyme via a linker. The method according to claim 10, wherein the linker of the complex is generated by a divalent reagent used for linking DNA and a substrate of a proteolytic enzyme. The method according to any one of claims 1 to 11, further comprising sequencing DNA contained in a complex in which the isolated substrate is undegraded. The method according to claim 12, wherein the sequence of DNA comprises amplification and / or cloning of DNA contained in the complex. The base sequence identical to the base sequence of the DNA contained in the complex in which the isolated substrate is undegraded, the DNA of the complex in which the DNA having affinity for the proteolytic enzyme and the substrate of the proteolytic enzyme are linked The method according to any one of claims 1 to 13, wherein the steps (1) to (4) according to claim 1 are repeated using a complex having a DNA having the above.