JP2005160433A - Method for producing protein by using cell-free protein synthesis system - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a new cell-free protein synthesis system capable of synthesizing a rightly folded protein. <P>SOLUTION: An objective protein is synthesized in a cell-free protein synthesis system in the presence of one or more specifically bonding molecules selected from (a) an antibody to the objective protein, (b) a ligand for the objective protein when the protein is a receptor, (c) a receptor when the objective protein is a ligand, (d) other molecule when the objective protein forms a complex with other molecule in the case of exhibiting the activity of the protein and (e) a molecule recognizing a structure temporarily existing in a process to form the right folding of the objective protein and bonding with the structure. The right folding of the objective protein is promoted by the bonding of the specifically bonding molecule to the objective protein in the course of synthesis. <P>COPYRIGHT: (C)2005,JPO&NCIPI

Description

  The present invention relates to a method for producing a protein using a cell-free protein synthesis system.

  In the post-genome era, where the elucidation of the base sequence of the human genome, rice genome, etc. is advancing rapidly, the elucidation of the structure and function of the protein that is the expression product of the gene contained in the genome is in progress. In particular, there is great interest in the analysis of functional proteins (various enzymes, antibodies, etc.) that exhibit specific functions by adopting a predetermined conformation or by undergoing post-translational modification. In order to proceed with the analysis of such a protein, the target protein must be produced in large quantities to the extent that it can be used for the analysis. Moreover, it is desirable to prepare a protein in a high quality state. However, with regard to protein synthesis, there is still no method equivalent to the PCR method that enables high-quality and rapid production of nucleic acids (genes).

  Conventionally, as a method for synthesizing proteins, expression systems (live cell systems) using live cells such as Escherichia coli, yeast, and cultured cells have been widely used. However, when eukaryotic proteins are expressed in an expression system using bacteria (for example, E. coli), inclusion bodies are likely to be produced, and proteins that retain the activity of the native type (native) may not be obtained. Many. On the other hand, although expression systems using eukaryotes such as yeast are also used, there are problems in terms of efficiency and operability, so there are short cases such as when analyzing multiple types of proteins simultaneously. It is not a suitable method for synthesizing many proteins in time. In addition, since living cells have a strong tendency to exclude foreign proteins in order to maintain their own cell functions, many proteins are difficult to express.

  As a method that can solve the above problems of living cell systems, a cell-free protein synthesis method called a cell-free protein synthesis system (hereinafter also referred to as “cell-free system”) or an in vitro translation system has been developed. It has attracted particular attention in recent years. The cell-free system does not need to maintain living cells, so it has excellent operability and a high degree of freedom. It can also produce proteins that are toxic to cells. It can be synthesized in a short time. Can be synthesized simultaneously and rapidly (high throughput), and non-natural proteins can be synthesized. The cell-free system having many excellent features as described above is a promising technique that can solve the problems of living cell systems, and has been expected to be used for the synthesis of various proteins. However, it has been reported that even in a cell-free system, the synthesized protein is not properly folded, so that it cannot take a natural conformation and insolubilization or aggregation often occurs. Aggregation competes with normal folding and association, resulting in a decrease or loss of the activity of the protein. The reason why aggregation occurs is that unraveled polypeptide chains expose the side chains of hydrophobic amino acids on the surface and tend to associate with each other between molecules and within molecules, resulting in incorrect intermolecular interactions, This is because the protein is prevented from becoming a natural state. When a heterogeneous aggregate is finally formed, the polypeptide chain of the protein does not recover and loses its activity. Such aggregation can be suppressed to some extent by adjusting physicochemical parameters such as protein concentration, solvent conditions, temperature, and ionic strength during synthesis (Non-Patent Documents 1 to 3, etc.).

As another approach for suppressing aggregation, a method using a molecular chaperone has been proposed (Patent Document 1). Molecular chaperones are molecules that control protein folding in the synthesis of proteins in cells, and are classified into several groups such as the HSP60 family and the HSP70 family.
As an example of using a molecular chaperone for a cell-free protein synthesis system, it has been reported that the yield and activity of a synthesized protein can be increased by co-expressing the molecular chaperone during translation reaction (Patent Document 2). .

Japanese National Patent Publication No. 8-508651 JP 2002-335959 A Jaenicke R, Rudolph R .: Methods Enzymol. 1986,131,218-250 Kiefhaber T, Rudolph R, Kohler HH, Buchner: J. Biotechnology (N Y) .1991 Sep; 9 (9): 825-829. Jaenicke R, Seckler R .: Adv Protein Chem. 1997; 50: 1-59

As described above, molecular chaperones are used in cell-free protein synthesis systems. However, considering that specific molecular chaperones are involved in the folding of specific proteins in cells, appropriate molecules for each target protein are used. It is necessary to select a chaperone. In addition, since molecular chaperones often act in cooperation with other molecules, it is not easy to create a favorable reaction environment. Furthermore, the types of molecular chaperones that have been found so far are limited, and there is no guarantee that molecular chaperones that can effectively control the folding of the target protein can always be used. In particular, when synthesizing a non-natural protein, it is sufficiently assumed that a molecular chaperone that acts effectively cannot be prepared. This means that one of the great advantages of using a cell-free system that non-natural proteins (especially proteins that are toxic to cultured cells) can be synthesized is impaired.
On the other hand, it is difficult to prepare a high-quality molecular chaperone at the current technical level, and it takes a lot of time and money to prepare a sufficient amount.

In view of the above background, the present inventors sought a new method for promoting preferred folding of a protein to be synthesized in consideration of the mechanism of an in vivo expression system and the technology of a conventional cell-free protein synthesis system. As a result, a protein having a favorable conformation was successfully synthesized by advancing a synthesis reaction in the presence of a molecule that specifically binds to the protein to be synthesized, and the following present invention was completed. It came to.
One embodiment of the present invention includes (a) an antibody against a target protein, (b) a ligand for the target protein when it is a receptor, (c) a receptor for the target protein when it is a ligand, (d) a target protein Recognize the other molecule when it forms a complex with another molecule when it exhibits its activity, and (e) the structure that temporarily exists in the process of the target protein forming the correct folding A method for producing a protein comprising synthesizing a target protein in a cell-free protein synthesis system in the presence of one or more specific binding molecules selected from the group consisting of molecules to be bound.
In one embodiment of the present invention, a molecule prepared using a phage display method is used as the specific binding molecule.
In one embodiment of the present invention, a molecule that specifically binds to a target protein in a native state is used as the specific binding molecule.
On the other hand, in one embodiment of the present invention, the target protein is an enzyme, and a molecule that binds to the target protein without inhibiting the enzyme activity of the target protein is used as the specific binding molecule.
In one embodiment of the present invention, an in vitro transcription / translation system is used as the cell-free protein synthesis system.
In one embodiment of the present invention, an antibody is used as the specific binding molecule. As the antibody herein, an antibody fragment selected from the group consisting of Fab, Fab ′, F (ab ′) ₂ , scFv, and dsFv may be used. Moreover, it is preferable to use a monovalent antibody as the antibody.
Other embodiments of the present invention include: i) (a) an antibody against the target protein, (b) a ligand for the target protein when it is a receptor, (c) a receptor for that when the target protein is a ligand, (d ) Recognizing the other molecules that form complexes with other molecules when the target protein exerts its activity, and (e) the structure that temporarily exists in the process of forming the correct folding of the target protein. Synthesizing a target protein in a cell-free protein synthesis system in the presence of one or more specific binding molecules selected from the group consisting of
ii) separating the target protein synthesized in step i) by binding or adsorbing the specific binding molecule to another substance;
And a method for producing a protein.
Still another embodiment of the present invention provides: i) preparing an antibody against a target protein using a phage display method;
ii) synthesizing the target protein in a cell-free protein synthesis system in the presence of the antibody prepared in step i);
And a method for producing a protein.
As another aspect, the present invention relates to a protein produced by any one of the production methods described above.

In the present invention, a target protein is synthesized using a cell-free protein synthesis system in the presence of other molecules that specifically bind to the cell-free protein synthesis system. This coexisting molecule binds to a peptide or protein in the middle of synthesis, suppresses its aggregation or unfavorable association, and promotes correct folding. Therefore, in the synthesis in the absence of a specific binding molecule, the protein that has been aggregated and fractionated into an insoluble fraction can be recovered as a soluble fraction.
If a molecule that specifically binds to a native protein, or a molecule that recognizes and temporarily binds to the target protein in the process of forming the correct folding, coexists with this molecule It is considered that a peptide or protein in the middle of synthesis folds so as to adopt a native state conformation, and a protein having an original activity can be synthesized. In addition, when the target protein is an enzyme, the use of a molecule that specifically binds to the protein without inhibiting the enzyme activity enables expression of an active enzyme that has been extremely difficult until now.
When an antibody is used as a specific binding molecule, irregularities in the normal (active) structure of the target protein in the binding pocket of the antibody, or irregularities in the structure that temporarily exist in the process of the target protein forming the correct folding If it is memorized, it is considered that a peptide or protein in the course of synthesis is guided by the unevenness to induce a normal structure, and an excellent folding assisting (controlling) action is expected. The high binding specificity that is characteristic of antibodies is also expected to be advantageous in exerting the folding assisting (controlling) action. When antibodies are used as specific binding molecules, specific binding molecules can also be easily prepared using genetic engineering techniques such as immunological techniques or phage display methods, enabling the synthesis of a wide variety of proteins. The present invention can be applied.

In the method for producing a protein of the present invention, a protein is synthesized in a cell-free protein synthesis system in the presence of a molecule that specifically binds to a target protein (specific binding molecule).
The term “target protein” in the present invention refers to a protein intended to be produced by the production method of the present invention. The type of target protein is not particularly limited. Modified proteins such as phosphorylated protein, dephosphorylated protein, acetylated protein, and deacetylated protein, proteins that are generally difficult to produce in an in vivo expression system, such as restriction enzymes and coenzymes, and difficult to use with conventional expression methods The present invention can also be applied to proteins derived from eukaryotes.

  In the present invention, the specific binding molecule coexisting during protein synthesis includes (a) an antibody against the target protein, (b) a ligand for the target protein when it is a receptor, and (c) a case where the target protein is a ligand. A receptor for it, (d) the other protein in the case where it forms a complex with another molecule when the target protein exerts its activity, and (e) a process in which the target protein forms the correct folding temporarily. A molecule that recognizes and binds to an existing structure is selected. Two or more specific binding molecules can be used in combination. For example, different categories of molecules may be combined, such as using an antibody against the target protein and a ligand for the target protein. In this case, two or more types of molecules in the same category may be used. On the other hand, specific binding molecules included in the same category may be combined, for example, using two types of antibodies against the target protein.

In one embodiment of the present invention, an antibody against a target protein is used as a specific binding molecule. In such an embodiment, an excellent folding assisting (controlling) action can be expected due to the high binding specificity that is characteristic of antibodies. Further, in such an embodiment, a specific binding molecule (in this case, an antibody) that can be used in the present invention can be prepared in principle by an immunological technique or genetic technique using the target protein as an antigen. is there. Therefore, a production method that can be applied to the synthesis of a wide variety of proteins, that is, a wide variety of proteins, is provided. Furthermore, when an antibody is used as a specific binding molecule, separation and purification of the target protein can be easily performed using the binding between the antibody and protein A or protein G having binding properties. -Also advantageous in terms of purification operation.
Here, the “antibody against the target protein” refers to an antibody that specifically recognizes and binds to the target protein. As long as it has such characteristics, its type and origin are not particularly limited. Any of a polyclonal antibody, an oligoclonal antibody (mixture of several to several tens of antibodies), and a monoclonal antibody may be used. As a polyclonal antibody or an oligoclonal antibody, an anti-serum-derived IgG fraction obtained by animal immunization, or an affinity-purified antibody using an antigen can be used. A monoclonal antibody can be prepared by a conventional method such as a hybridoma method.

Antibody fragments such as Fab, Fab ′, F (ab ′) ₂ , scFv, and dsFv antibodies may be used as specific binding molecules.
Fab is a molecular weight of about 50,000 comprising an L chain and an H chain variable region obtained by digesting IgG with papain in the presence of cysteine, and an H chain fragment comprising a C _H 1 domain and a part of the hinge part. Is a fragment of For example, Fab can be prepared by digesting papain with an antibody obtained by immunization using a target protein as an antigen. Fabs can also be prepared using genetic engineering techniques such as phage display.

Fab ′ is a fragment having a molecular weight of about 50,000 obtained by cleaving a disulfide bond between the H chains of F (ab ′) ₂ described later. For example, an antibody that specifically recognizes a target protein is obtained by immunization, and then digested with pepsin, and then a disulfide bond is cleaved using a reducing agent. It can also be prepared by genetic engineering as in the case of Fab.

F (ab ′) ₂ is a fragment composed of an L chain and an H chain variable region obtained by digesting IgG with pepsin, and an H chain fragment comprising a C _H 1 domain and a part of the hinge part ( Fab ′) is a fragment having a molecular weight of about 100,000 bonded by a disulfide bond. For example, an antibody that specifically recognizes a target protein can be obtained by immunization and then digested with pepsin. It can also be prepared by genetic engineering as in the case of Fab.

scFv is an antibody fragment in which an Fv comprising an H chain variable region and an L chain variable region is made into a single chain by linking the C terminus of one chain and the other N terminus with an appropriate peptide linker. As the peptide linker, for example, (GGGGS) ₃ having high flexibility can be used. For example, it can be prepared by genetic engineering like Fab.

  dsFv is an Fv fragment in which a Cys residue is introduced at an appropriate position in the H chain variable region and the L chain variable region, and the H chain variable region and the L chain variable region are stabilized by disulfide bonds. The position of Cys residue introduction in each chain can be determined based on the three-dimensional structure predicted by molecular modeling. For example, it can be prepared by genetic engineering like Fab.

  In a preferred embodiment of the present invention, a monovalent antibody is used as the specific binding substance. A monovalent antibody refers to an antibody having one antigen-binding portion. For example, Fab, Fab 'and scFv correspond to monovalent antibodies. As another form of monovalent antibody, the variable region of a camelid H chain single antibody can be used, and if sufficient binding force can be obtained, use only the Fab H chain or the variable region. You can also. By using a monovalent antibody, immunoprecipitation due to cross-linking of the antibody can be suppressed.

  If the target protein functions as a receptor, its ligand can be used as a specific binding molecule. On the contrary, if the target protein functions as a ligand, its receptor can be used as a specific binding molecule. On the other hand, when it is necessary to form a complex with another molecule when the target protein exhibits activity, the other molecule can be used as a specific binding molecule. Examples of other molecules herein include peptides, proteins, and metals.

  As the specific binding molecule in the present invention, a molecule that specifically binds to a target protein in a native state is preferably used. If such a specific binding molecule is used, it can be expected that the specific binding molecule actively assists (controls) that the target protein folds into the native state, and the target protein in the native state can be prepared. It is done.

In one embodiment of the present invention, a molecule that recognizes and binds to a structure temporarily present in the process of forming a correct folding of the target protein is used as the specific binding molecule. Here, “correct folding” means folding into a structure found in the target protein in the native state. On the other hand, the “temporarily existing structure” here refers to a structure that is hidden inside the molecule or lost by conversion to the final structure in the target protein in the native state. If the target protein is synthesized in the presence of an antibody that recognizes such a structure that exists only in the folding process, the structure is retained by the action of the antibody, and as a result, the progression to the correct folding is promoted. Conceivable. In addition, by coexisting with an antibody, it can be expected that a peptide or protein being synthesized is guided to take such a temporary structure.
The molecule (specific binding molecule) used in this embodiment is, for example, a peptide or protein, and preferably an antibody (including an antibody fragment).

  When the target protein is an enzyme, a molecule that specifically binds to the target protein without inhibiting the enzyme activity is preferably employed as the specific binding molecule in the present invention. Such a synthesis system enables the expression (ie synthesis) of the active enzyme. Since the expression of the active enzyme has been extremely difficult in conventional protein synthesis systems, the production method of the present invention has great significance in this respect.

Pre-labeled specific binding molecules may be used. In such an embodiment, since the target protein to which the labeling substance is bound via the specific binding molecule can be obtained, the target protein is confirmed or detected using the labeling substance as an index, or the synthesis amount of the target protein is measured. It becomes possible. Examples of labeling substances that can be used for labeling specific binding molecules include fluorescent dyes such as fluorescein, rhodamine, Texas red, and Oregon green, horseradish peroxidase, microperoxidase, alkaline phosphatase, and β-D-galactosidase. Mention may be made of chemical or bioluminescent compounds such as enzymes, luminol, acridine dyes, radioisotopes such as ³² P, ¹³¹ I, ¹²⁵ I and biotin.
A specific binding molecule to which a label capable of binding to a specific substance (for example, a histidine tag) is bound may be used. In such an embodiment, the conjugate of the target protein and the specific binding molecule can be easily separated and purified using a label. Therefore, the target protein can be prepared by a simpler operation. In addition, it becomes easy to prepare a target protein of high purity.

The specific binding molecule in the present invention can be prepared by immunization, genetic engineering, chemical synthesis, or the like depending on the type and properties.
When the desired specific binding molecule is a peptide or protein (including antibodies and fragment antibodies), the specific binding molecule can be prepared using chemical synthesis, phage display, ribosome display, etc. . For example, chemical synthesis of peptides can be performed by a known method (solid phase method or liquid phase method using Boc method, Fmoc method or the like). On the other hand, the phage display method is a system for expressing a foreign gene as a fusion protein with a coding protein (cp3, cp8) of a filamentous phage such as M13. In the phage display method, a phage library of about 10 ⁶ to 10 ¹² is constructed by assembling genes of a mixture of different proteins or peptides into phage DNA. Selection of a target protein (peptide) from the phage library is performed by an operation called panning. Panning typically involves reacting (contacting) a molecule having binding properties with a target protein with a phage library, removing unbound phage (washing), elution of bound phage, and recovering the recovered phage into E. coli. It consists of a series of steps of infection (phage propagation). Panning enriches the phage displaying the target protein. Panning is repeated until sufficient enrichment of phage displaying the target protein is confirmed. By infecting appropriate host cells with the thus selected and concentrated phage, the target protein (peptide) displayed by the phage can be expressed as a soluble molecule. Alternatively, a foreign protein is excised from the selected and concentrated phage, the recovered foreign gene is incorporated into an appropriate expression vector, and the target gene (peptide) is expressed by expressing the foreign gene using an appropriate expression system. It may be obtained soluble. The target protein obtained as described above can be used as a specific binding molecule in the present invention. The expression product can be collected by appropriately combining methods such as centrifugation, ammonium sulfate fractionation, salting out, ultrafiltration, affinity chromatography, ion exchange chromatography, and gel filtration chromatography.
On the other hand, a target protein (peptide) in a state displayed on a phage may be used as a specific binding molecule in the present invention.
By using the phage display method, it is possible to prepare specific binding molecules for a wide variety of target proteins.

  The ribosome display method uses a protein / mRNA / ribosome complex (ARM) obtained in this way by mutating the stop codon to bind the template DNA transcript and translation product to the ribosome. For example, it refers to a method for screening a target. Examples of applying ribosome display to the production of antibody libraries are disclosed in US Pat. Nos. 5,643,768 and 5,658,754.

  When preparing an antibody as a specific binding molecule using genetic engineering techniques such as the phage display method or ribosome display method, for example, after immunizing an animal with the target protein as an antigen, mRNA and DNA are obtained from immune system cells. An antibody gene containing an antigen binding domain is obtained by gene amplification such as PCR and RT-PCR, and a phage display library and the like are constructed using this. Next, a clone having a specific binding property to the target protein is selected from the library thus constructed. As long as a clone having (or expressing) a specific binding molecule is included, it may be in any state of a polyclone, an oligoclone, and a monoclone. Once the target clone is selected, the antibody it displays is obtained as a soluble molecule by the above procedure (may be used as it is displayed) and used for the production method of the present invention.

Non-natural antibodies can also be prepared by using genetic engineering techniques, and in the present invention, such non-natural antibodies may be used as specific binding molecules. For example, an artificial antibody constructed by introducing a random sequence or a sequence derived from another animal species into a complementary chain determining region (CDR) of an antibody can be used.
A library in which peptides having a random sequence are presented may be constructed, and peptides isolated from the library may be used as the specific binding molecule of the present invention.

  If the specific binding molecule is an antibody, the specific binding molecule can also be prepared using classical immunological techniques. Specifically, for example, a monoclonal antibody can be prepared according to the following procedure. First, an animal such as a mouse is immunized with a protein (target protein) intended to be produced in the present invention as an antigen. Immunization is repeated as necessary, and antibody-producing cells are removed from the immunized animal when the antibody titer sufficiently increases. Next, the obtained antibody-producing cells and myeloma cells are fused to obtain a hybridoma. Subsequently, after this hybridoma is monoclonalized, a clone that produces an antibody having high specificity for the target protein is selected.

  The term “cell-free protein synthesis” in the present invention is not a living cell but a template using a ribosome derived from a living cell (or obtained by a genetic engineering technique) or a transcription / translation factor. This refers to in vitro synthesis of the protein encoded by DNA or mRNA. In a cell-free protein synthesis system, a cell extract obtained by purifying a cell disruption solution as needed is generally used. Cell extracts generally contain ribosomes necessary for protein synthesis, various factors such as initiation factors, and various enzymes such as tRNA. When protein is synthesized, other substances necessary for protein synthesis such as various amino acids, energy sources such as ATP and GTP, and creatine phosphate are added to the cell extract. Of course, a ribosome, various factors, and / or various enzymes prepared separately may be supplemented as necessary during protein synthesis.

  Development of a protein synthesis system in which each molecule (factor) necessary for protein synthesis is reconstituted has been reported (Shimizu, Y. et al .: Nature Biotech., 19, 751-755, 2001). In this synthesis system, three types of initiation factors constituting bacterial protein synthesis system, three types of elongation factors, four types of factors involved in termination, 20 types of aminoacyl-tRNA synthetases that bind each amino acid to tRNA, and Genes of 31 types of factors consisting of methionyl tRNA formyltransferase are amplified from the Escherichia coli genome, and the protein synthesis system is reconstructed in vitro using these genes. In the present invention, such a reconstructed synthesis system may be used.

  The term “cell-free protein synthesis system” is used interchangeably with in vitro translation system or in vitro transcription / translation system. In an in vitro translation system, RNA is used as a template to synthesize proteins. As the template DNA, total RNA, mRNA, in vitro transcript and the like can be used. The other in vitro transcription / translation system uses DNA as a template. As the template DNA, a vector constructed by inserting a gene encoding the target protein into a position downstream of the transcription promoter and the translation initiation point, or a product of PCR or RT-PCR can be used. The template DNA should contain a ribosome binding region and preferably contain an appropriate terminator sequence. When a vector that requires amplification in vivo in advance is used, the vector should have a replication origin and a selection marker corresponding to the host so that self-replication and selection in the host are possible. In order to facilitate genetic engineering operations, vectors are usually provided with a plurality of restriction enzyme recognition sites. In the in vitro transcription / translation system, conditions to which factors necessary for each reaction are added are set so that the transcription reaction and the translation reaction proceed continuously.

The cell-free protein synthesis system has the following advantages. First, since there is no need to maintain live cells, operability is good and the degree of freedom of the system is high. Therefore, it is possible to design a synthetic system with various modifications and modifications according to the properties of the target protein. Next, in the synthesis of cell systems, it is basically impossible to synthesize proteins that are toxic to the cells used, but in the cell-free system, even such toxic proteins can be produced. In addition, high throughput can be easily achieved because many types of proteins can be synthesized simultaneously and rapidly. It also has the advantage that the produced protein can be easily separated and purified, which is advantageous for high throughput. In addition, it also has the advantage that non-natural proteins can be synthesized by incorporating non-natural amino acids.
The following cell-free systems are currently widely used. That is, an E. coli S30 fraction extract system (prokaryotic cell system), a wheat germ extract system (eukaryotic cell system), and a rabbit reticulocyte lysate system (eukaryotic cell system). These systems are also commercially available as kits and can be used easily.

Historically, the development of the E. coli S30 fraction extract system has been the oldest, and attempts have been made to synthesize various proteins using this system. The E. coli 30S fraction is prepared through steps of E. coli collection, cell disruption, and purification. The preparation of the 30S fraction of E. coli and the cell-free transcription / translation coupling reaction were performed by the method of Pratt et al. (Pratt, JM: Chapter 7, in “Transcription and Translation: A practical approach”, ed. By BD Hames & SJ Higgins, pp. 179-209, IRL Press, New York (1984)) and the method of Ellman et al. (Ellman, J. et al .: Methods Enzymol., 202, 301-336 (1991)).
The wheat germ extract system has the advantage of being able to efficiently synthesize high-quality eukaryotic proteins, and can be used to synthesize eukaryotic proteins that are difficult to synthesize using the E. coli S30 fraction extract system. Often used. Recently, it has been reported that a high-efficiency and stable synthetic system is constructed by preparing an extract from germs from which seed endosperm components have been washed away (Madin, K. et al .: Proc. Natl. Acad. Sci. USA, 97: 559-564, 2000). After that, technical developments such as mRNA untranslated sequence with high translation promoting ability, protein synthesis method for multi-item function analysis using PCR, construction of dedicated high expression vector, etc. were carried out (Sawasaki, T. et al .: Proc Natl. Acad. Sci. USA, 99: 14652-14657, 2002), which is expected to be applied in various fields.
The wheat germ extract can be obtained by grinding and centrifuging wheat germ and then separating the supernatant by gel filtration. Regarding the translation reaction, the method of Anderson et al. (Anderson, CW et al .: Methods Enzymol., 101, 638-644 (1983)) can be referred to. Improved methods have also been reported. For example, Kawarazaki et al. (Kawarasaki, Y. et al .: Biotechnol. Prog., 16, 517-521 (2000)) and Madin et al. (Madin, K. et al. : Proc. Natl. Acad. Sci. USA, 97: 559-564, 2000).
The rabbit reticulocyte lysate system is suitable for globulin production. Rabbit reticulocyte lysate is made anemic by injecting phenylhydrazine intravenously into rabbits for several days, blood is collected after a predetermined period (for example, day 8), and then subjected to ultracentrifugation from the hemolyzed solution. can get. The method for preparing a rabbit reticulocyte lysate can be performed with reference to the method of Jackson and Hunt (Jackson, RJ and Hunt, T .: Methods Enzymol., 96, 50-74 (1983)).
The cell-free system that can be used in the practice of the present invention is not limited to those described above. For example, a system constructed on the basis of an extract of bacteria other than E. coli or plants other than wheat or genome information may be used. Good.

The protein synthesis reaction in the cell-free system is carried out batchwise or continuously. Here, the “batch type” typically refers to a method in which all components necessary for the reaction are mixed and the reaction is performed, and the product is recovered after a predetermined time has elapsed. Taking the case of performing a plurality of synthesis reactions in one container as an example, the reaction solution used in the previous synthesis reaction is discarded in the next synthesis reaction, and a new reaction solution is prepared in the container. It will be. Rather than mixing all components at the beginning of the reaction, add specific components after a certain time (for example, preincubate to form a ribosome complex and then add a template), or during the synthesis reaction A case where a synthetic reaction is allowed to proceed by appropriately adding substances such as ATP and GTP is also referred to as a batch system. In addition, the case where the synthetic reaction is performed only once using a disposable container is also a typical example of a batch type.
On the other hand, “continuous” means that solvents, nucleic acid templates, synthetic substrates, energy sources (ATP and GTP), etc. are continuously supplied or exchanged during the synthesis reaction so that proteins can be synthesized over a long period of time. A method for protein synthesis. Supply or exchange as described above may be performed only during a predetermined period, and such a case is also referred to as a continuous type. A continuous cell-free protein synthesis system was first reported by spring et al. (Spring, AS et al: Science, 242: 1162-1164, 1998, etc.). There are CFCF system and CECF system in the continuous type. In the former, a reaction vessel provided with an ultrafiltration membrane in a part (for example, the bottom) is used, and a liquid containing all components necessary for protein synthesis such as amino acids, ATP, and GTP is continuously supplied thereto. The reaction solution is separated by an ultrafiltration membrane. The synthesized protein is contained in the filtrate and separated and recovered from other components by a fraction collector or the like. Thus, in the CFCF system, the supply of the reaction solution and the extraction of the target protein and unwanted substances by ultrafiltration are performed simultaneously. In the other CECF system, circulating fluid containing necessary low molecules such as amino acids and ATP is circulated in the reaction solution across the dialysis membrane, and the necessary low molecules such as amino acids and ATP are utilized using the dialysis principle. And the removal of unnecessary substances at the same time so that the synthesized protein stays in the reaction solution. One of the advantages of this system is that the reaction liquid and the circulating liquid are independent, so that various corrections can be easily made to the circulating liquid. Moreover, since the area of the dialysis membrane with respect to the amount of the reaction solution can be increased, there is also an advantage that efficient substance exchange can be performed through the dialysis membrane. In addition, a multilayer method has been developed in which two layers called a reaction mix layer and a buffer mix layer are formed, and these two layers are gradually mixed to replenish low molecular weight substances such as amino acids and ATP. (PROTEIOS? Kit, TOYOBO). In such a method, the protein synthesis efficiency is 5 to 10 times that of a simple batch method, and the target protein can be efficiently synthesized with high throughput.

  In the method for producing a protein of the present invention, a protein is synthesized using a cell-free system as described above in the presence of a specific binding molecule for the target protein. Therefore, a specific binding molecule necessary for the reaction solution is typically added prior to synthesis. In the production method of the present invention, it is sufficient that a specific binding molecule is present during the protein synthesis reaction. For example, the specific binding molecule is added immediately before the synthesis reaction, at the early stage of the synthesis reaction, at the middle of the synthesis reaction, or at the later stage of the synthesis reaction. May be. Preferably, a specific binding molecule is added before the start of the synthesis reaction so that a good folding assisting (controlling) action by the specific binding molecule is exhibited.

The amount (concentration) of the specific binding molecule is not particularly limited, but it should be set appropriately in consideration of the expected total amount of protein synthesis, the protein concentration in the reaction solution, the binding constant of the specific binding molecule, etc. Can do. It is preferable to set the addition amount of the specific binding molecule so as to be larger than the assumed total amount of protein synthesis. This is so that a sufficient folding assisting (controlling) action is exhibited. The “assumed total protein synthesis amount” here can be estimated based on the amount of protein obtained when synthesized under the same conditions except that no specific binding molecule is added (typically The amount of protein obtained when synthesized under the above conditions is the assumed total amount of protein synthesis).
When setting the amount of specific binding molecule added, it is preferable to consider its dissociation constant (Kd). For example, if a specific binding molecule is added so as to have the same concentration as the value of Kd, it is theoretically generated. Since a specific binding molecule acts on half of the synthetic molecules, a sufficient effect can be expected. However, this addition amount is used in order to obtain a sufficient effect because when the antibody is used as a specific binding molecule, if the antibody is polyclonal or oligoclonal, it is expected that only a part of the antibody will be effective. In this case, it is preferable to set the addition amount to be larger than the above addition amount.
It is preferable to use a specific binding molecule with high binding specificity. This is because the amount of specific binding molecules added can be reduced, and the occurrence of undesirable effects such as unnecessarily inhibiting the protein synthesis reaction can be suppressed.

  The protein synthesis reaction is performed under a temperature condition of about 30 ° C., for example, so that the reaction proceeds well. For example, in a Roche kit RTS using Escherichia coli lysate, a temperature condition of 30 ° C. is optimal, but a protein that easily aggregates is performed under a temperature condition of 30 ° C. or less. In addition, in the kit PROTEIOS of Toyobo Co., Ltd. using wheat germ extract, the temperature condition of 26 ° C. is optimal, but the temperature condition of 23 ° C. may be optimal depending on the protein. It is preferable to optimize the working temperature depending on the target protein.

  Unless otherwise specified, genetic engineering procedures in this specification are, for example, Molecular Cloning (Third Edition, Cold Spring Harbor Laboratory Press, New York) or Current protocols in molecular biology (edited by Frederick M. Ausubel et al., 1987). ).

  Prior to each of the following experiments (1. to 4.), in vivo synthesis of vSrc (avian rous sarcoma virus gene v-src gene product) and cSrc (oncogene c-src gene product) was performed. Note that vSrc and cSrc have the following characteristics. (1) Both have tyrosine kinase activity. (2) Both are myristoylated (post-translational fatty acid modification). (3) When both are compared, in addition to substitution of several amino acid residues, a large change at the C-terminus is observed. (4) vSrc always exists as an active form. (5) cSrc possesses two autophosphorylation sites, one for inhibition and one for activation. From this, it is expected that vSrc is easier to prepare the active form.

When recombinant vSrc and cSrc were synthesized in vivo (data not shown), the following phenomenon was observed.
1) When vSrc and cSrc were each expressed in vivo alone, large-scale expression was successful, but both were insolubilized.
2) In order to perform myristoylation, a gene for myristoyltransferase was further introduced into the expression system prepared in 1) to obtain a co-expression system. Although vSrc was co-expressed, the product was insolubilized. For cSrc, the E. coli used as an expression host was lethal.
3) In order to solve the problem of insolubilization, the chaperonin (GroESL) gene was further introduced into the vSrc system prepared in 2), but the host cell died. The death of the host cell was considered to mean that the transgene was expressed in a functional form (solubilized).
The co-expression system in 2) was constructed as follows.

A. Construction of co-expression system of vSrc or cSrc and myristoyltransferase using E. coli as host
A-1. Preparation of pETvSrc and pETcSrc (see Fig. 1)
vSrc (Rous sarcoma virus src gene, complete cds., GenBank Accession Number M11753) and cSrc (Chicken c-src gene, complete cds, GenBank Accession Number J00844) incorporated between the restriction enzyme sites SmaI and EcoRI of the pBluescript vector cDNA was a gift from Professor Michinari Hamaguchi of Nagoya University School of Medicine.
Prepare 1 μg of this vector, 1 unit of restriction enzyme NcoI (TAKARA), and 0.01% BSA (TAKARA), and prepare a reaction system so that the salt and others have the composition of K buffer (TAKARA) (total amount 30 μL), The vector was treated with a restriction enzyme by incubating at 37 ° C. for 2 hours. This was electrophoresed using a 1% agarose gel gel, and the target DNA fragment cleaved with NcoI was purified by cutting out the band. Prepare the reaction system so that it has a composition of H buffer (TAKARA) containing 1 unit each of the obtained product and XhoI (TAKARA) (salt, etc.) (total volume 30 μL) and incubate at 37 ° C for 2 hours Then, the restriction enzyme treatment of the vector was performed. This was electrophoresed using a 1% agarose gel, and the target DNA fragment was purified by cutting out the band (insert fragment). pET14b (Novagen) was similarly treated to obtain a vector fragment.
Mix the vector fragment and the insert fragment so that the molar ratio is 1:10, add the same volume of DNA ligase solution (TOYOBO Ligation Kit Version 2) and mix (total volume 10 μL), and continue at 16 ° C for 14 hours. Keep warm. Using this half amount (5 μL), Escherichia coli JM109 strain (TOYOBO) was transformed, and a plasmid was extracted from 10 transformants obtained. Using 1% agarose gel electrophoresis, select a larger size than pET14b that has not undergone insert introduction treatment, and determine the base sequence of the DNA fragment incorporated therein using a DNA primer that has the same sequence as the T7 promoter did. Those in which v-src and c-src were incorporated into pET14b were designated as pETvSrc and pETcSrc, respectively.

A-2. Construction of co-expression system of N-myristoyl transferase (NMT) and vSrc and cSrc (see Fig. 1)
PBB131 vector incorporating NMT cDNA ((Duronio, RJ, Jackson-Machelski, E., Heuckeroth, RO, Olines, PO, Devine, CS, Yonemoto, W., Slice, LW, Taylor, SS, and Gordon, JI (1990) Proc. Natl. Acad. Sci. USA 87, 1506-1510.)) Was kindly provided by Dr. JIGordon.
Using pBB131, Escherichia coli BL21 (DE3) strain (Novagen) was transformed, and those having the target gene introduced due to kanamycin resistance were selected. The obtained transformant was further transformed with pETvSrc (or pETcSrc), and kanamycin and ampicillin were simultaneously used to select those in which both the NMT gene and the vSrc gene (or cSrc gene) were introduced. A co-expression system was constructed as described above. FIG. 1 schematically shows a co-expression system of myristoyltransferase and recombinant vSrc.

Based on the above results, the following experiments were conducted with the aim of obtaining myristoylated vSrc.
1． Production of antiserum-derived rabbit Fab (production of anti-Src antibody to investigate chaperone-like activity)
As described above, vSrc expressed in large amounts in E. coli becomes insoluble, and thus purification was performed as follows. Cultivate 3 liters, induce expression with 0.4 mM IPTG, and incubate for 6 hours.The cells are collected and suspended in CelLyticTM B II Bacterial Cell Lysis Extraction Reagent (SIGMA B 3678) and centrifuged. After removing the soluble fraction, the precipitate was solubilized in Buffer 1 and dialyzed to gradually and continuously change to the composition of Buffer 2 (linear concentration gradient change).
Buffer 1: 20 mM Tris-HCl (pH 8), 120 mM NaCl, 6 M guanidine hydrochloride, 1 M L-arginine, 20 mM DTT
Buffer 2: 20 mM Tris-HCl (pH 8), 120 mM NaCl, 2 M guanidine hydrochloride, 1 M L-arginine, 1 mM DTT
This soluble fraction was subjected to HiPrep 26/60 Sephacryl S-200 HR gel filtration column chromatography (Amersham 17-1195-01) to obtain 4 ml (4.5 mg / ml) of purified protein.
Rabbit immunization and IgG purification were performed by conventional methods. That is, a mixture of adjuvant and immunized vSrc antigen was immunized 6 times every other week until the antibody titer increased to obtain 53 ml of antiserum. According to the attached manual, IgG fraction 5 mg (2.7 mg / ml 1.85 ml) was prepared using Protein-A Sepharose (Pharmacia). When an antibody is added to a protein synthesis system, an antigen may aggregate and precipitate if it is a bivalent antibody. To prevent this, papain is allowed to act on the prepared IgG fraction according to the following procedure. Antibody (Fab). In addition, in order to omit the operation of removing papain, immobilized papain (Immobilized papain, PIERCE, 20341) was used. This is one in which papain is immobilized on agarose beads.
1) The IgG purified from the antiserum by Protein-G Sepharose is dissolved in PBS. Accordingly, 5 mg of IgG (2.7 mg / ml was 1.85 ml) was dialyzed into the following buffer, and then concentrated to 10 mg / ml (500 μl) with Amicon Ultra 100 (Millipore, UFC801096).
buffer: 20mM sodium phosphate, 10mM ETDA (pH7.0)
2) After 0.2 ml of immobilized papain was transferred to a 2 ml Eppendorf tube and washed twice with the digestion buffer shown below, 0.4 ml of digestion buffer was added, and the IgG prepared in 1) was added. The mass ratio of enzyme (papain) to substrate (IgG) was adjusted to 1: 100.
Digestion buffer: 20mM sodium phosphate, 20mM cystein ・ HCl, 10mM ETDA (pH7.0)
3) Incubated at 37 ° C for 5 hours.
4) 1.2 ml of 10 mM Tris-HCl (pH 7.5) was added and centrifuged, and the supernatant was recovered as Fab (including Fc). When the amount of protein was measured, it was a 5 mg / 2.1 ml solution in terms of IgG, and the Fab concentration was 1.59 mg / ml.

2． Measurement of chaperone-like activity of antibodies
2-1. Src synthesis in the cell-free protein synthesis system using wheat germ extract in the presence and absence of rabbit anti-vSrc antibody (Fab) To investigate the chaperone-like activity of antibodies, Ehime University, Endo The highly efficient cell-free protein synthesis system PROTEIOS ™ Wheat germ cell-free protein synthesis kit (TOYOBO CPS-601) developed by the professors and others was used. First, vectors (pEUvSrc and pEUcSrc) used for expression of recombinant vSrc and recombinant cSrc were prepared by the following procedure.

2-1-1. Construction of expression vectors (pEUvSrc (see Fig. 8) and pEUcSrc (see Fig. 9))
vSrc (Rous sarcoma virus src gene, complete cds., GenBank Accession Number M11753) and cSrc (Chicken c-src gene, complete cds, GenBank Accession Number J00844) incorporated between the restriction enzyme sites SmaI and EcoRI of the pBluescript vector cDNA was a gift from Professor Michinari Hamaguchi of Nagoya University School of Medicine. The cDNA sequence of the v-Src gene (SEQ ID NO: 62) is shown in FIGS. 2 and 3, and the amino acid sequence encoded by it (SEQ ID NO: 63) is shown in FIG. Similarly, the cDNA sequence of the c-Src gene (SEQ ID NO: 64) is shown in FIGS. 5 and 6, and the amino acid sequence encoded by it (SEQ ID NO: 65) is shown in FIG.
Prepare a reaction system containing 1 μg of this vector and 1 unit of the restriction enzyme SpeI (TAKARA), salt and others in the composition of M buffer (TAKARA) (total amount 30 μL), and incubate at 37 ° C for 2 hours. Then, the restriction enzyme treatment of the vector was performed. This was electrophoresed using a 1% agarose gel gel, and the target DNA fragment cleaved with SpeI was purified by cutting out the band. Prepare the reaction system so that it has the composition of the obtained product and SalI (TAKARA) each, salt and others H buffer (TAKARA) (total amount 30 μL), and keep it at 37 ° C for 2 hours. The vector was subjected to restriction enzyme treatment. This was electrophoresed using a 1% agarose gel gel, and the target DNA fragment was purified by cutting out the band (insert fragment). pEU3-NII (TOYOBO) was treated in the same manner to obtain a vector fragment.
Mix the vector fragment and the insert fragment so that the molar ratio is 1:10, add the same volume of DNA ligase solution (TOYOBO Ligation Kit Version 2) and mix (total volume 10 μL), and continue at 16 ° C for 14 hours. Keep warm. Using this half amount (5 μL), Escherichia coli JM109 strain (TOYOBO) was transformed, and a plasmid was extracted from 10 transformants obtained. Use 1% agarose gel electrophoresis to select a larger size than pEU3-NII, which has not undergone insert introduction treatment, and use the DNA primer that has the same sequence as the T7 promoter for the base sequence of the incorporated DNA fragment. Decided.
Next, the reaction system contains 1 μg of the expression vector obtained here, 1 unit of restriction enzyme NcoI (TAKARA), and 0.01% BSA (TAKARA), and the other components such as salt and K buffer (TAKARA). Was prepared (total amount 30 μL) and incubated at 37 ° C. for 2 hours to carry out a restriction enzyme treatment of the vector. Since there are three NcoI sites, two on the insert fragment and one on the pEU, three fragments with different lengths can be obtained. Electrophoresis using 1% agarose gel gel, and cut out the longest DNA fragment (expression vector body) and the next long DNA fragment (fragment containing v-src gene or c-src gene) (Insert fragment).
These were mixed so that the molar ratio was 1 (vector body): 10 (fragment containing v-src gene or c-src gene), and the same volume of DNA ligase solution (TOYOBO Ligation Kit Version 2) was added thereto. In addition, the mixture was mixed (total amount: 10 μL) and incubated at 16 ° C. for 14 hours. Using this half amount (5 μL), Escherichia coli JM109 strain (TOYOBO) was transformed, and a plasmid was extracted from 10 transformants obtained. Use 1% agarose gel electrophoresis to select a larger size than pEU3-NII, which has not undergone insert introduction treatment, and use the DNA primer that has the same sequence as the T7 promoter for the base sequence of the incorporated DNA fragment. Thus, those having the target gene integrated in the correct orientation were selected. Those in which v-src and c-src were incorporated into pEU3-NII were designated pEUvSrc and pEUcSrc, respectively (see FIGS. 8 and 9).

2-1-2. In vitro synthesis of recombinant protein Protein synthesis was performed according to the following procedure.
1) XL-1Blue was transformed with pEUvSrc (or pEUcSrc), and the plasmid was purified with Geno Pure Plasmid Maxi Kit (Roshe 3 143 422).
2) The plasmid purified in 1) was cleaved at the HindIII site derived from the vector pBluescript-KS multicloning site where Src was cloned to make linear.
3) mRNA was synthesized using the plasmid prepared in 2) as follows.
pEUvSrc: pEUcSrc
miliQ water 60.1μL: 64.73μL
10 × T7 RNA polymerase buffer 10μL: 10μL
25mM NTP 10μL: 10μL
RNase inhibitor (TOYOBO SIN-101) 2μL ： 2μL
Plasmid DNA (10μg) 11.9μL ： 7.27μL
T7 RNA polymerase (TOYOBO TRL-201) 6μL ： 6μL
Total 100μL: 100μL

The above reaction solution was placed in a 500 μL Eppendorf tube and incubated at 37 ° C. for 4 hours on a thermal cycler. MRNA was purified with MicroSpin G-25 columns (Amersham 27-5325-01), and the concentration of synthesized mRNA was quantified by measuring absorbance at 260 nm. The mRNA for vSrc was 1.272 mg / mL and the mRNA for cSrc was 1.32 mg / mL. The prepared mRNA was stored at −20 ° C. until use.
4) As shown below, protein synthesis was performed in the presence and absence of the Fab prepared in 1.
vSrc (cSrc): vSrc (cSrc) + Fab
buffer # 2 1μL ： 1μL
buffer mix 10.59μL ： 4.59μL
Fab (0.934 mg / mL) −: 6 μL
Creatine kinase (TOYOBO CPS-6012) 0.85μL: 0.85μL
RNase inhibitor 0.5μL: 0.5μL
Wheat germ extract 5μL ： 5μL
mRNA (1mg / mL) 7.06μL: 7.06μL
Total 25μL: 25μL

After mixing the reaction solution under the above conditions, it was gently layered under a 125 μL buffer mix dispensed in advance into a 500 μL Eppendorf tube. This was incubated in a thermal cycler at 26 ° C. for 20 hours to synthesize Src in vitro.
Composition of Buffer mix
Buffer # 1 107μL
Buffer # 2 125μL
miliQ water 768μL
Total 1000μL

2-2. Detection of solubilization of Src synthesized in the presence and absence of rabbit anti-vSrc antibody (Fab)
The distribution of soluble and insoluble fractions of each Src synthesized in 2-1-2 was examined by Western immunoblotting. The total fraction, soluble fraction (sup), and insoluble fraction (ppt.) were each subjected to acrylamide gel electrophoresis for 5 μL, and Western immunoblotting was performed using anti-cSrc monoclonal antibody GD11 (UBI). The results are shown in FIG. In order from the left lane, Lane 1: cSrc total, Lane 2: cSrc sup., Lane 3: cSrc ppt., Lane 4: cSrc total + Fab, Lane 5: cSrc sup. + Fab, Lane 6: cSrc ppt. + Fab, lane 7: negative control, lane 8: positive control (recombinant Src).
As shown in FIG. 10, the band at cSrc position (arrow position) is much deeper in lane 5 than in lane 2, and the proportion of soluble fraction of protein is increased in cSrc by performing synthesis in the presence of Fab. It can be seen that there has been a significant increase.

2-3. Activity measurement of Src synthesized in the presence and absence of rabbit anti-vSrc antibody (Fab)
The activity of each Src synthesized in 2-1-2. Was measured using Src Assay Kit (UBI 17-131). After sampling 50 μL of the protein synthesis solution as a total fraction, it was separated into a supernatant (soluble fraction) and a precipitate (insoluble fraction) by centrifugation, and the activity was measured by the following procedure using the soluble fraction. The reaction was carried out in a 96-well 1/2 microtiter plate (Costar 3695).
1) 12.5 μL of src solution (2-1-2. Soluble fraction) was added. Further, as a positive control showing that the Src activity measurement was possible, 1 μL (5U 0.0115 μg) of commercially available cSrc (Src, active UBI 14-236) was diluted with 11.5 μL of miliQ water.
2) [γ- ³² P] ATP was diluted with Manganese / ATP cocktail (75 mM manganese chloride, 500 μM ATP) and 12.5 μl was added to 1). The added [γ- ³² P] ATP is 2.5 μCi.
3) Substrate peptide (KVEKIGEGTYGVVYK) was diluted with Src Kinase Reaction Buffer (SrcRB) to 0.5 mg / mL, and 25 μL was added (final concentration 125 μM) to start the reaction.
4) 10 μL each was sampled 5 minutes, 10 minutes, 30 minutes, and 60 minutes after the start of the reaction, and 20 μL of 40% trichloroacetic acid prepared in advance was added to stop the reaction.
5) 25 μL of 4) was added to P81 Phosphocellulose paper, washed 3 times with 0.75% phosphoric acid, and then washed once with acetone. After air drying, it was put into a glass vial containing 5 ml of liquid scintillator, and the amount of phosphoric acid incorporated into the peptide was measured with a scintillation counter. The measurement results are shown in FIG. cSrc showed an increase in Src activity in the presence of Fab. In addition, when the same experiment was performed by adding the same concentration of Fab to the synthesized vSrc and cSrc, no activity was observed (FIG. 12). That is, it was found that the presence of antibody (Fab) at the time of activity measurement does not affect Src activity. As a result, it was confirmed that the increase in the activity of cSrc synthesized in the presence of Fab was due to the generation of active cSrc by the action of Fab during synthesis.
As described above, it has been clarified that an antibody can exert an action for a chaperone during protein synthesis.

3. Rabbit antibody phage display library construction
3-1. Preparation of Phagemid Vector An expression vector was constructed according to the following procedure (see FIG. 13). scNcopFCAH9-E8VHdVLd vector (see WO 01/96401. The nucleotide sequence (SEQ ID NO: 66) and amino acid sequence (SEQ ID NO: 67) of the vector are shown in FIGS. 14 to 16) 1 μg (1 μL), Rev primer (5′-AGGAAACAGCTATGACCATG -3 ′ (20mer): SEQ ID NO: 71) (100 pmol / mL) 1 μL, SfiR primer (5′-CGGCTGGGCCGCGAGTAA-3 ′ (18mer): SEQ ID NO: 72) (100 pmol / mL) 1 μL, 10 × LA PCR buffer 10 μL, 25 mM MgCl ₂ 10 μL, 2.5 mM dNTP mix 16 μL, sterile distilled water 60 μL, TaKaRa LA Taq Polymerase (5 U / μL Takara Shuzo) 1 μL are mixed, 2 drops of mineral oil are added, and the mixture is incubated at 95 ° C. for 2 minutes, then 94 ° C. The reaction of 1 minute, 58 ° C. for 2 minutes, and 72 ° C. for 1 minute was repeated 16 cycles. The obtained PCR product was confirmed by agarose gel electrophoresis, then excised, phenol treated, EtOH precipitated and concentrated to 10 μL (A fragment). Similarly, scNcopFCAH9-E8VHdVLd 1 μg (1 μL), SfiF primer (5′-TTACTCGCGGCCCAGCCGGCCCCTGACATCTGAGGACACT-3 ′ (40mer): SEQ ID NO: 73) (100 pmol / mL) 1 μL, BstR primer (5′-CCACCGCCGCTCGAGACGGTGACC-3 ′ : SEQ ID NO: 74) (100 pmol / mL) 1 μL, 10 × LA PCR buffer 10 μL, 25 mM MgCl ₂ 10 μL, 2.5 mM dNTP mix 16 μL, sterile distilled water 60 μL, TaKaRa LA Taq Polymerase (5 U / μL Takara Shuzo) 1 μL, After adding 2 drops of mineral oil and incubating at 95 ° C. for 2 minutes, the reaction of 94 ° C. for 1 minute, 58 ° C. for 2 minutes and 72 ° C. for 1 minute was repeated 16 cycles. The obtained PCR product was confirmed by agarose gel electrophoresis, then excised, phenol-treated, EtOH precipitated and concentrated to 10 μl (B fragment). Furthermore, scNcopFCAH9-E8VHdVLd 1 μg (1 μl), BstF primer (5′-GGTCACCGTCTCGAGCGGCGGTGG-3 ′ (24mer): SEQ ID NO: 75) (100 pmol / mL), cp3R primer (5′-GCCAGCATTGACAGGAGGTTG-3 ′ (21mer): SEQ ID NO: 76) (100 pmol / mL) 1 μL, 10 × LA PCR buffer 10 μL, 25 mM MgCl ₂ 10 μL, 2.5 mM dNTP mix 16 μL, sterile distilled water 60 μL, TaKaRa LA Taq Polymerase (5 U / μL Takara Shuzo) 1 μL are mixed, and mineral oil is added. Two drops were added, and the mixture was incubated at 95 ° C for 2 minutes, and then the reaction of 94 ° C for 1 minute, 58 ° C for 2 minutes, and 72 ° C for 1 minute was repeated 16 cycles. The obtained PCR product was confirmed by agarose gel electrophoresis, then excised, phenol treated, EtOH precipitated and concentrated to 10 μL (C fragment). A fragment 5 μL, B fragment 5 μL, Rev primer (100 pmol / mL) 1 μL, BstR primer (100 pmol / mL) 1 μL, 10 × LA PCR buffer 10 μL, 25 mM MgCl ₂ 10 μL, 2.5 mM dNTP mix 16 μL, sterile distilled water 51 μL, TaKaRa LA Taq Polymerase (5U / μL Takara Shuzo) Mix 1μL, add 2 drops of mineral oil, incubate at 95 ℃ for 1 minute, and then react at 94 ℃ for 1 minute, 58 ℃ for 4 minutes, 72 ℃ for 2 minutes for 17 cycles Repeated. The obtained PCR product was confirmed by agarose gel electrophoresis, then excised, phenol treated, EtOH precipitated and concentrated to 20 μL (D fragment). C fragment 5 μL, D fragment 5 μL, Rev primer (100 pmol / mL) 1 μL, cp3R primer (100 pmol / mL) 1 μL, 10 × LA PCR buffer 10 μL, 25 mM MgCl ₂ 10 μL, 2.5 mM dNTP mix 16 μL, sterile distilled water 51 μL, TaKaRa LA Taq Polymerase (5U / μL Takara Shuzo) Mix 1μL, add 2 drops of mineral oil, incubate at 95 ℃ for 1 minute, and then react at 94 ℃ for 1 minute, 58 ℃ for 4 minutes, 72 ℃ for 2 minutes for 17 cycles Repeated. The obtained PCR product was confirmed by agarose gel electrophoresis, then cut out, phenol-treated, EtOH precipitated and concentrated to 20 μL. Among these, 7 μL, 10 × M buffer 10 μL, sterile distilled water 78 μL, and HindIII (10 U / μL Takara Shuzo) 5 μL were mixed and reacted at 37 ° C. for 2 hours. To this, 1 μL of 5M NaCl and 5 μL of BstPI (5 U / μL Takara Shuzo) were added, and further reacted at 37 ° C. for 2 hours. This was confirmed by agarose gel electrophoresis, then excised, phenol treated, EtOH precipitated and concentrated to 15 μL (insert fragment). Similarly, scNcopFCAH9-E8VHdVLd 1 μg (1 μL), 10 × M buffer 10 μL, sterilized distilled water 86 μL, and HindIII (10 U / μL Takara Shuzo) were mixed and reacted at 37 ° C. for 2 hours. To this, 1 μL of 5M NaCl and 3 μL of BstPI (5U / μL Takara Shuzo) were added, and further reacted at 37 ° C. for 2 hours. This was confirmed by agarose gel electrophoresis, then excised, phenol treated, EtOH precipitated and concentrated to 15 μL (vector fragment). Insert fragment 2 μL, vector fragment 1 μL, 10 × ligation buffer 1.5 μL, 10 mM ATP 1.5 μL, DW 8 μL, and T4 DNA ligase (350 units / μL Takara Shuzo) were added and mixed, and incubated at 16 ° C. for 3 hours. Ethanol was precipitated and dissolved in 3 μL of 1 / 5TE, and a half thereof was used to transform DH12S. Plasmids were extracted from each of the 24 transformants obtained, and subjected to agarose gel electrophoresis, and the nucleotide sequence of the clone containing the insert was confirmed. A clone containing the expected substitution was selected and used as pSCCA4-E8d (base sequence (SEQ ID NO: 68) and amino acid sequence (SEQ ID NO: 69) are shown in FIGS. 17 to 19).

  Furthermore, since the ligation efficiency was low at the XhoI site, PCR was performed using the 5 'primer (sequence 58 XhoI, NotI site is underlined) and the 3' primer (sequence 59 NcoI site is underlined). The reaction was performed and converted so that the heavy chain could be inserted at the NotI site. In the base sequence of the insert of this vector pSCCA5-E8d, the amino acid sequence (SEQ ID NO: 70) encoded by the restriction enzyme site and the base sequence is shown in FIGS.

  An actual antibody protein expression vector is completed by inserting heavy chain and light chain genes into predetermined positions of this vector. The shape of the antibody expressed by the completed vector is scFv type. The heavy chain and light chain are linked by the linker -GRGGS (GGGGS) 2MA-. The light chain gene is linked to the aforementioned cp3 gene, and as a result, the expressed protein is in the form of scFv-cp3.

3-2. Preparation of rabbit antibody library
3-2-1. Isolation of Rabbit Antibody Genes Rabbits were immunized in the same manner as in 1-1. To prepare a rabbit-derived antibody library.

3-2-2. Preparation of RNA RNA was prepared from the spleen of an immunized rabbit according to a conventional method using an RNA Extraction Kit (Amersham-Pharmacia 27-9270-01). 1.04 mg of RNA was obtained from one spleen.

3-2-3. Synthesis of cDNA
Using Super Script II Rnase H-Reverse Transcriptase (Gibco 18064-071), the heavy chain gene, light chain gene κ gene and λ gene cDNA were synthesized from 30 μg RNA. Primers were mixed with equimolar amounts of 3 'primer for obtaining heavy chain gene (sequence 46-48), mixed with equimolar amount of 3' primer for obtaining light chain kappa gene (sequence 49-56), PCR was carried out for each of these using the 3 ′ primer for obtaining the light chain λ gene (sequence 57). The template RNA was degraded using Ribonuclease H (Gibco 18021-71).

3-2-4. Amplification of antibody gene Using the obtained cDNA as a template, PCR was performed using 5 'primer (sequence 1-13) and 3' primer (sequence 14-16) for heavy chain gene acquisition. went. PCR was performed using a 5 ′ primer (sequence 17-35) and a 3 ′ primer (sequence 37-44) for obtaining the κ gene. Further, PCR was performed using a 5 ′ primer (sequence 36) and a 3 ′ primer (sequence 45) for obtaining the λ gene to prepare a DNA fragment. PCR reaction conditions are shown below.
200pmol / μL VH (Vk, VL) primer mix 10μL
200pmol / μL JH (Jk, JL) primer mix 10μL
cDNA 10μL
10 × LA Taq Polymerase buffer (attached to Taq) 100 μL
25 mM MgCl ₂ 100 μL
2.5mM dNTP 80μL
LA Taq Polymerase (TAKARA 5U / μL) 10μL
Sterile miliQ water 680μL
total 1000μL
94 ° C, 3 minutes → 94 ° C, 1 minute; 65 ° C, 2 minutes; 72 ° C, 1 minute

Preliminary experiments were conducted in advance to determine an appropriate number of cycles (around 20 cycles) that did not produce non-specific reaction products.
The PCR product is treated with phenol, ethanol-precipitated, suspended in 90 μL of TE buffer, added with 10 μL of 10 × sample loading buffer, electrophoresed on 0.8% agarose gel, and then cut out the target band around 450 bp. And purified with QIAQuick Gel Extraction Kit (QIAGEN 28704). In the nucleotide sequence of the primer for obtaining a heavy chain gene, the VH underline indicates the SfiI site, and the JH underline indicates the NotI site. In the base sequence of the light chain gene acquisition primer, the underlined portion of Vk (VL) indicates the NcoI site, and the underlined portion of Jk (JL) indicates the AscI site.

The primers used are shown below.
Rabbit VH PCR primer
[1] (rabV1a1)
5'-ACTTACTCGCGGCCCAGCCGGCCATGGCCCAGTCGGTGGAGGAGTCCGG (G / C) GG-3 '(SEQ ID NO: 1)
[2] (rabV1a2)
5'-ACTTACTCGCGGCCCAGCCGGCCATGGCCCAGTCGGTGGAGGAGTCCGGGGA-3 '(SEQ ID NO: 2)
[3] (rabV1a3)
5'-ACTTACTCGCGGCCCAGCCGGCCATGGCCCAGTCGCTGG (A / T) GGAGTCCGGGGG-3 '(SEQ ID NO: 3)
[4] (rabV1a4)
5'-ACTTACTCGCGGCCCAGCCGGCCATGGCCCAGTCGGTGGAGGAGTCCAGGGG-3 '(SEQ ID NO: 4)
[5] (rabV1a5)
5'-ACTTACTCGCGGCCCAGCCGGCCATGGCCCAGTC (G / A) GTGAAGGAGTCCGAGGG-3 '(SEQ ID NO: 5)
[6] (rabV2)
5'-ACTTACTCGCGGCCCAGCCGGCCATGGCCCAGTCGTTGGAGGAGTCCGGGGG-3 '(SEQ ID NO: 6)
[7] (rabV3a1)
5'-ACTTACTCGCGGCCCAGCCGGCCATGGCCCAGCAGCTGGAGGAGTCCGGGGG-3 '(SEQ ID NO: 7)
[8] (rabV3a2)
5'-ACTTACTCGCGGCCCAGCCGGCCATGGCCCAGCAGCTGGAGCA (C / G) TCCGCAGG -3 '(SEQ ID NO: 8)
[9] (rabV4a1)
5'-ACTTACTCGCGGCCCAGCCGGCCATGGCCCAG (C / G) AGCAGCTGATGGAGTCCGG-3 '(SEQ ID NO: 9)
[10] (rabV4a2)
5'-ACTTACTCGCGGCCCAGCCGGCCATGGCCCAGCAGCTGGTGGAGTCCGGGGG-3 '(SEQ ID NO: 10)
[11] (rabV4a3)
5'-ACTTACTCGCGGCCCAGCCGGCCATGGCCGAGCAGCTGGAGGAGTCCGGGGG-3 '(SEQ ID NO: 11)
[12] (rabV4a4)
5'-ACTTACTCGCGGCCCAGCCGGCCATGGCCGAGCAGCTGGTGGAGT (C / A) CGGGGG-3 '(SEQ ID NO: 12)
[13] (rabV4a5)
5'-ACTTACTCGCGGCCCAGCCGGCCATGGCCGAGCAGCTGAAGGAGTCCGG (G / A) GG-3 '(SEQ ID NO: 13)

JH PCR primers
[14] rabJH2Not
5'-AGAACCACCGCGGCCGCTCGAGACGGTGACCAGGGTGCCTGGG-3 '(SEQ ID NO: 14)
[15] rabJH5Not
5'-AGAACCACCGCGGCCGCTCGAGAC (G / A) GTGACCAGGGTGCCCTGG-3 '(SEQ ID NO: 15)
[16] rabJH6Not
5'-AGAACCACCGCGGCCGCTCGAGACGGTGACGAGGGTCCCTGGG-3 '(SEQ ID NO: 16)

Vk PCR primers
[17] Rabvk1
5'-GCCCAGCCGGCCATGGCCGC (C / G) CTTGTGATGACCCAGACTCC-3 '(SEQ ID NO: 17)
[18] Rabvk2
5'-GCCCAGCCGGCCATGGCCGCAGCCGTGCTGACCCAGACACC-3 '(SEQ ID NO: 18)
[19] Rabvk3
5'-GCCCAGCCGGCCATGGCCGACCCT (G / A) TGCTGACCCAGACTGC-3 '(SEQ ID NO: 19)
[20] Rabvk4
5'-GCCCAGCCGGCCATGGCCGACCCTGTGCTGACCCAGACACC-3 '(SEQ ID NO: 20)
[21] Rabvk5
5'-GCCCAGCCGGCCATGGCCGCAGCCGTGATGACCCAGACTCC-3 '(SEQ ID NO: 21)
[22] Rabvk6
5'-GCCCAGCCGGCCATGGCCGATGTCGTGATGACCCAGACT (C / G) C-3 '(SEQ ID NO: 22)
[23] Rabvk7
5'-GCCCAGCCGGCCATGGCCGACATTGTGCTGACCCAGACTGC-3 '(SEQ ID NO: 23)
[24] Rabvk8
5'-GCCCAGCCGGCCATGGCCTATGTCATGATGACCCAGACTCC-3 '(SEQ ID NO: 24)
[25] Rabvk9
5'-GCCCAGCCGGCCATGGCCGCTCAAGTGCTGACCCAGACTGA-3 '(SEQ ID NO: 25)
[26] Rabvk10
5'-GCCCAGCCGGCCATGGCCGCCCAAGGGCCAACCCAGACTCC-3 '(SEQ ID NO: 26)
[27] Rabvk11
5'-GCCCAGCCGGCCATGGCCGACCCTGTGATGACCCAGACTCC-3 '(SEQ ID NO: 27)
[28] Rabvk12
5'-GCCCAGCCGGCCATGGCCGCCATCGATATGACCCAGACTCC-3 '(SEQ ID NO: 28)
[29] Rabvk13
5'-GCCCAGCCGGCCATGGCCGATGGCGTGATGACCCAGACTCC-3 '(SEQ ID NO: 29)
[30] Rabvk14
5'-GCCCAGCCGGCCATGGCCGATGTTGTGATGACCCAGACTCC-3 '(SEQ ID NO: 30)
[31] Rabvk15
5'-GCCCAGCCGGCCATGGCCGCCATCAAAATGACCCAGACTCC-3 '(SEQ ID NO: 31)
[32] Rabvk16
5'-GCCCAGCCGGCCATGGCCGACCCT (A / G) TGCTGACCCAGACTCC-3 '(SEQ ID NO: 32)
[33] Rabvk17
5'-GCCCAGCCGGCCATGGCCGCCCAAGTG (A / C) TGACCCAGACTCC-3 '(SEQ ID NO: 33)
[34] Rabvk18
5'-GCCCAGCCGGCCATGGCCGCCGTCGTGCTGACCCAGACTGC-3 '(SEQ ID NO: 34)
[35] Rabvk19
5'-GCCCAGCCGGCCATGGCCGCCCT (G / T) GTGATGACCCAGACTCC-3 '(SEQ ID NO: 35)
VL PCR primer
[36] rabVL
5'-GCCCAGCCGGCCATGGCCCAGCCTGTGCTGACTCAGTCGCC-3 '(SEQ ID NO: 36)
Jk PCR primers
[37] rab4K1J2Asc
5'-GGAGTCGACTGGCGCGCCGAACCTTTGACCACCACCTCGGT-3 '(SEQ ID NO: 37)
[38] rab4vK1J2Asc
5'-GGAGTCGACTGGCGCGCCGAACCTTTGACGACCACCTCGGT-3 '(SEQ ID NO: 38)
[39] rab5K1J2Asc
5'-GGAGTCGACTGGCGCGCCGAAACTTCGACGACCACCTTGGT-3 '(SEQ ID NO: 39)
[40] rab9K1J2Asc
5'-GGAGTCGACTGGCGCGCCGAACATAGGATCTCCAGCTCGGT-3 '(SEQ ID NO: 40)
[41] rab95K1J2Asc
5'-GGAGTCGACTGGCGCGCCGAAACTTTGACCACCACCTCGGT-3 '(SEQ ID NO: 41)
[42] rab4K2J1Asc
5'-GGAGTCGACTGGCGCGCCGAACGTTTGATTTCCACCTTGGT-3 '(SEQ ID NO: 42)
[43] rab4K2J2Asc
5'-GGAGTCGACTGGCGCGCCGAACGTTTGATCTCCACCTTGGT-3 '(SEQ ID NO: 43)
[44] rab4K2J3Asc
5'-GGAGTCGACTGGCGCGCCGAACGTTTGATCTCCAGCTTGGT-3 '(SEQ ID NO: 44)

JL PCR primers
[45] rabLJAsc
5'-GGAGTCGACTGGCGCGCCGAACCTGTGACGGTCAGCTGGGT-3 '(SEQ ID NO: 45)

Primer for JH cDNA
[46] rabJH2R
5′-TGAGGAGACGGTGACCAGGGTGCC-3 ′ (SEQ ID NO: 46)
[47] rabJH5R
5'-TGAAGAGAC (G / A) GTGACCAGGGTGCC-3 '(SEQ ID NO: 47)
[48] rabJH6R
5'-TGAAGAGACGGTGACGAGGGTCCC-3 '(SEQ ID NO: 48)
Primer for Jk cDNA
[49] rab4K1J2
5'-ACCTTTGACCACCACCTCGGTCCC-3 '(SEQ ID NO: 49)
[50] rab4vK1J2
5'-ACCTTTGACGACCACCTCGGTCCC-3 '(SEQ ID NO: 50)
[51] rab5K1J2
5'-AACTTCGACGACCACCTTGGTCCC-3 '(SEQ ID NO: 51)
[52] rab9K1J2
5'-ACATAGGATCTCCAGCTCGGTCCC-3 '(SEQ ID NO: 52)
[53] rab95K1J2
5'-AACTTTGACCACCACCTCGGTCCC-3 '(SEQ ID NO: 53)
[54] rab4K2J1
5'-ACGTTTGATTTCCACCTTGGTGCC-3 '(SEQ ID NO: 54)
[55] rab4K2J2
5'-ACGTTTGATCTCCACCTTGGTCCC-3 '(SEQ ID NO: 55)
[56] rab4K2J3
5'-ACGTTTGATCTCCAGCTTGGTTCC-3 '(SEQ ID NO: 56)

Primer for JL cDNA
[57] rabLJR
5'-ACCTGTGACGGTCAGCTGGGTCCC-3 '(SEQ ID NO: 57)

[58] XNSCN1B2
5'-CCACGGTCACCGTCTCGAGCGGCCGCGGTGGTTCTGGTGGTGGCGGTTCTGG-3 '(SEQ ID NO: 58)
[59] XNSCN1F
3'-AAGACCACCACCGCCAAGACCGCCACCACCAAGGTACCGGCTG-5 '(SEQ ID NO: 59)

3-2-5. Preparation of light chain library 1) 6 μg of pSCCA5-E8d was digested with NcoI and dephosphorylated with Alkaline Phosphatase (E. coli C75). The conditions are shown below.
PSCCA5-E8d 6μg
NcoI (TAKARA 10U / ul) 6μL
10 × K buffer 10μL
0.1% BSA 10μL
The solution was adjusted to 100 μL with sterile milliQ water and reacted at 37 ° C. for 2 hours. 10 μL of 1M Tris-HCl (pH 8) and 1 μL of Alkaline Phosphatase (E. coli C75) (TAKARA 0.45 U / μl) were added and reacted at 37 ° C. for 30 minutes. This vector DNA was treated with phenol and chloroform, and then purified by QIAquick PCR Purification Kit (QIAGEN) to obtain 60 μL of DNA solution.

2) The κ gene DNA fragment or λ gene DNA fragment prepared by PCR was digested with NcoI under the following conditions.
PCR product DNA fragment 10 μg
10 × K buffer (attached to NcoI) 10 μL
0.1% BSA 10μL
NcoI (TAKARA 10U / μL) 6μL
The solution was adjusted to 100 μL with sterilized miliQ water, reacted at 37 ° C. for 2 hours, and purified with QIAquick PCR Purification Kit (QIAGEN) to obtain 60 μL of DNA solution.

2) 2) and 1) were ligated under the following conditions.
PSCCA5-E8d / NcoI-BAP 60μL
PCR product DNA / NcoI 60μL
10 × T4 DNA ligation buffer (attached with T4 DNA ligase) 20μL
T4 DNA ligase (TAKARA 350U / μL) 10μL
The solution was adjusted to 200 μL with sterile milliQ water and reacted at 16 ° C. for 3 hours. This was treated with phenol chloroform and purified with QIAquick PCR Purification Kit (QIAGEN) to obtain 120 μL of DNA solution.

4) 3) was digested with AscI and self-ligated. The conditions are shown below.
DNA solution 120μL
10 × NEB4 (attached to AscI) 20μL
AscI (NEW ENGLAND Biolabs Inc. 10 U / μL) 6μL
The solution was adjusted to 200 μL with sterile milliQ water and reacted at 37 ° C. for 2 hours. This is treated with phenol, ethanol precipitated, suspended in 90 μL of TE buffer, added with 10 μL of 10 × sample loading buffer, electrophoresed on 0.8% agarose gel, and then cut out the target band near 4,850 bp. Purified with QIAQuick Gel Extraction Kit (QIAGEN 28704). 120 μL of DNA solution was obtained. Self ligation was done.
DNA solution 120μL
10 × T4 DNA ligation buffer (attached with T4 DNA ligase) 80μL
T4 DNA ligase (TAKARA 350U / μL) 10μL
The solution was adjusted to 800 μL with sterilized miliQ water and reacted at 16 ° C. for 3 hours. This was treated with phenol chloroform, concentrated with butanol, and ethanol precipitated.

5) Introduction of phagemid into Escherichia coli The obtained ligated DNA was used to transform Escherichia coli DH12S as follows. That is, the ligated DNA was once ethanol precipitated and dissolved in 5 μL of 1/5 TE (TE diluted 5 times with sterilized MilliQ). 5 μL was suspended in 110 μL of competent cells ElectroMax DH12S Cells (manufactured by GIBCO BRL), 20 μL each was dispensed into 6 microelectro chambers, and electroporation was performed under the following conditions.
Electroporator
BRL Cell-Porator (Cat.series 1600)
Setting condition: voltage booster 4kΩ
capacitance 330μF
DC volts LowΩ
charge rate Fast
The transformed E. coli was suspended in 10 mL of 2 × YT, added to a medium having the following composition that had been kept warm at 37 ° C., and cultured at 37 ° C. for 1 hour.
2 x YT 380mL
40% Glucose 10mL (final 1%)
Sample 15 μL after incubation at 37 ° C for 1 hour and dilute as follows to LB plate (LBGA plate) containing 0.2% glucose, 100ug / mL ampiciliin for use in counting the number of transformed E. coli. It was. The culture solution was added with 100 mg / mL ampicillin (final 100 μg / mL) and cultured at 30 ° C. overnight. Plasmid DNA was recovered from E. coli.
Cell culture solution 15μL
↓ ← 2 × YT medium 135μL was added
150μL → 100μL was dispensed (10mL of 400mL culture solution)
↓
15μL
↓ ← 2 × YT medium 135μL was added
150μL → 100μL was dispensed (1μL for 400mL culture solution)
↓
15μL
↓ ← 2 × YT medium 135μL was added
150μL → 100μL was dispensed (0.1ml of 400ml culture)
The number of E. coli transformed (transformation efficiency)
It was 4.32 × 10 ⁷ and 8.56 × 10 ⁷ for the λ chain library.

6) The plasmid DNAs of the κ chain library and the λ chain library obtained in 5) were mixed at a ratio of 9: 1 to obtain a light chain library pSCCA5-rSrcKL.

3-2-6. Incorporation of heavy chain gene DNA fragment into light chain library 7) 6 μg of light chain library pSCCA5-rSrcKL obtained in 6) was digested with NotI, and Alkaline Phosphatase (E. coli C75) ( (TAKARA). The conditions are shown below.
pSCCA5-rSrcKL 6μg
NotI (TAKARA 10U / μL) 6μL
10 x H buffer (NotI attached) 10μL
0.1% BSA 10μL
0.1% tritonX-100 10μL
The solution was adjusted to 100 μL with sterile milliQ water and reacted at 37 ° C. for 2 hours. 10 μL of 1M Tris-HCl (pH 8) and 1 μL of Alkaline Phosphatase (E. coli C75) (TAKARA 0.45 U / μL) were added and reacted at 37 ° C. for 30 minutes. This vector DNA was treated with phenol and then purified with QIAquick PCR Purification Kit (QIAGEN) to obtain 60 μL of DNA solution.

8) The heavy chain gene DNA fragment prepared by PCR was digested with NotI under the following conditions.
PCR product DNA fragment 10 μg
NotI (TAKARA 10U / ul) 6μL
10 x H buffer (NotI attached) 10μL
0.1% BSA 10μL
0.1% tritonX-100 10μL
The solution was adjusted to 100 μL with sterilized miliQ water, reacted at 37 ° C. for 2 hours, and purified with QIAquick PCR Purification Kit (QIAGEN) to obtain 60 μL of DNA solution.

9) 7) and 8) were ligated under the following conditions.
pSCCA5-rSrcKL / NotI-BAP 60μL
PCR product DNA / NotI 60μL
10 × T4 DNA ligation buffer (attached with T4 DNA ligase) 20μL
T4 DNA ligase (TAKARA 350U / μL) 10μL
The solution was adjusted to 200 μL with sterile milliQ water and reacted at 16 ° C. for 3 hours. This was treated with phenol and purified with QIAquick PCR Purification Kit (QIAGEN) to obtain 120 μL of DNA solution.

10) 9) was digested with SfiI and self-ligated. The conditions are shown below.
DNA solution 120μL
10 x NEB2 (attached to SfiI) 16μL
0.1% BSA 16μL
SfiI (NEW ENGLAND Biolabs Inc. 20U / μL) 6μL
The solution was adjusted to 160 μL with sterile milliQ water and reacted at 50 ° C. for 2 hours. This is treated with phenol, ethanol precipitated, suspended in 90 μl of TE buffer, 10 μL of 10 × sample loading buffer is added, and after electrophoresis on 0.8% agarose gel, the target band around 5,000 bp is excised. Purified with QIAQuick Gel Extraction Kit (QIAGEN 28704). 120 μL of DNA solution was obtained. Self ligation was done.
DNA solution 120μL
10 × T4 DNA ligation buffer (attached with T4 DNA ligase) 80μL
T4 DNA ligase (TAKARA 350U / μl) 10μL
The solution was adjusted to 800 μL with sterilized miliQ water and reacted at 16 ° C. for 3 hours. This was treated with phenol, concentrated with butanol, and ethanol precipitated.

3-2-7. Introduction of phagemid into E. coli and preparation of phage library
Using the ligated DNA obtained in 3-2-6, E. coli DH12S was transformed and cultured in the same manner as 3-2-5 5), and a portion was sampled and plated.
The culture was added at 100 mg / mL ampicillin (final 100 μg / mL) and cultured at 37 ° C. The turbidity (OD600nm) of the medium was measured over time, and when it reached 0.7, 100mL of the culture solution was transferred to another flask and cultured overnight at 30 ° C. Plasmid DNA was recovered from E. coli, and the library pSCCA5 -rSrcKLH. The remaining 300 mL was cultured at 37 ° C., and when turbidity reached 1.6, E. coli was recovered by centrifugation. The cells were suspended in 2 × YT medium to make 5 mL, and 4 mL was used as a glycerol stock. The remaining 1 mL was added to a medium having the following composition and cultured at 37 ° C. for 1 hour.
2 x YT medium 195mL
100mg / ml ampicillin 0.2mL
M13KO7 4mL
Total 199mL
After culturing at 37 ° C. for 1 hour, a medium having the following composition was added (finally 800 mL) and cultured at 37 ° C. overnight (16 hours), and then a phage antibody was prepared.
2 x YT medium 599mL
100mg / ml ampicillin 0.6mL
70mg / ml kanamycin 0.8mL
Total 600mL
The number of E. coli transformed (transformation efficiency) was 0.92 × 10 ⁸ .

3-2-8. Preparation of Phage Antibody The cells were centrifuged at 4 ° C. and 8000 rpm for 10 minutes, and the supernatant was collected. To the supernatant, 20% polyethylene glycol / 2.5M NaCl (500 mL) was added and gently stirred for about 20 minutes. After centrifugation at 4 ° C. and 8000 rpm for 20 minutes, the precipitate was dissolved in 100 mL of PBS, and 20% polyethylene glycol / 2.5M. After adding 20 mL of NaCl and stirring gently for about 20 minutes, the mixture was centrifuged at 4 ° C. and 8000 rpm for 20 minutes. The supernatant was discarded and the precipitate was further collected by centrifugation at 4 ° C. and 8000 rpm for 3 minutes. The precipitate was dissolved in 4 ml of PBS to which 0.05% NaN ₃ was added, centrifuged at 1000 rpm for 15 minutes at 4 ° C., and the supernatant was collected. After further centrifugation at 8000 rpm for 3 minutes at 4 ° C., the supernatant was collected.
The titer of the recovered phage solution was checked as follows. That is, the phage solution was diluted 10 ⁶ , 10 ⁷ , 10 ⁸ with PBS, 10 μL thereof was infected with 990 μL of DH12S, and cultured at 37 ° C. for 1 hour. 100 μL of this was plated on an LBGA plate and cultured at 30 ° C. for 18 hours. The titer of the undiluted stock solution was calculated by counting the number of colonies. The stock solution of the phage solution was suspended at 2 × 10 ¹⁴ / ml in PBS containing 2% skim milk and 0.05% NaN ₃ .
2 × YT medium: The following components were added to 900 mL of purified water and shaken. After complete dissolution, the pH was adjusted to 7.0 with 5N NaOH, and purified water was added to 1000 mL. Sterilized in an autoclave for 20 minutes before use.
bacto-tryptone 16g
bacto-yeast extract 10g
NaCl 5g

Other reagents were purchased from the following.
Manufacturer Name Product Name Sigma Ampicillin Sodium Wako Pure Chemicals Phenolic Sigma BSA
DIFCO 2 × YT medium Wako Pure Chemicals Kanamycin sulfate Nacalai Tesque polyethylene glycol 6000
Nacalai Tesque Tween20
Katayama Chemical NaCl
Wako Pure Chemicals IPTG
Wako Pure Chemicals Skim Milk Wako Pure Chemicals Sodium Azide Wako Pure Chemicals Triethylamine Wako Pure Chemicals Hydrogen Peroxide Wako Pure Chemicals OPD Tablets Wako Pure Chemicals Ethanol

4. Selection of phages that specifically bind to a specific antigen from a phage library The operation of selecting phages that specifically bind to a specific antigen from a phage library is referred to herein as screening. The antibody library was screened using vSrc purified in 1. as an antigen.

4-1. Preparation of screening microcups Antigen (vSrc) is dialyzed from Buffer 2 shown in 1 to Buffer 3 shown below to remove the denaturant to 500 μg / mL, and then 50 μg in Buffer 4 shown below. / mL. 100 μL of this was added to each microcup 2 well (Nunc Maxisorp) and incubated at 4 ° C. for 18 hours to adsorb the antigen to the inner surface of the microcup. After adsorption, the antigen solution was discarded, 200 μL of 2% BSA-containing PBS solution was added and reacted at 37 ° C. for 1 hour, and blocking was performed to prevent the phage antibody from binding non-specifically to the microcup.
Buffer3; 20 mM Tris-HCl (pH 8), 120 mM NaCl, 1 mM DTT, 10% glycerin, 0.01% NP-40
Buffer4; 20mM Tris-HCl (pH 8), 120mM NaCl, 1mM DTT

4-2. Screening procedure In the prepared antigen-adsorbed microcup, the phage library pSCCA5-rSrcKLH is dissolved in 1% BSA-containing PBS to prepare 1 × 10 ¹³ CFU / 100 μL. 50 μL each was added to the well and reacted at 37 ° C. for 2 hours, followed by washing 5 times with PBS.
Subsequently, the phage bound to the antigen-binding microcup cup was recovered as follows. That is, 100 μL of 0.1 M HCl-glycine (pH 2.2) was added per well of a microcup cup, reacted at room temperature for 10 minutes to be separated, then neutralized by adding 6 μL of 2M Tris, and this solution was recovered.

4-3. Amplification of recovered phage The recovered liquid was treated (infection of phage to E. coli) (infection of helper phage) (recovery of phage), and the contained phage was purified and amplified.
1) Infection of Escherichia coli with phage Escherichia coli (DH12S) is cultured in 20 ml of SB (super broth) medium, grown so that the absorbance at a wavelength of 600 nm is 0.5, and the recovered phage solution is added for 1 hour at 37 ° C. Cultured with shaking.
SB medium 10g MOPS
30g tryptone
20g yeast extract
The pH was adjusted to 7 with NaOH, 1 liter with deionized water, and sterilized.

2) Infection of helper phage To the culture medium of 1), 60 mL of SB medium and 40 μL of 100 μg / mL ampicillin (final 50 μg / mL) were added and incubated at 37 ° C. for 2 hours, and then SB medium added with 460 μL of 100 mg / mL ampicillin. 420 mL (ampicillin final 100 μg / mL) was added, 10 ¹³ cfu of helper phage M13K07 was added thereto, and cultured with shaking at 37 ° C. for 1 hour. Thereafter, 500 μL of 50 mg / mL kanamycin was added (final 50 μg / mL), and cultured at 37 ° C. overnight.

3) Phage recovery The culture solution of 2) is centrifuged at 7000 rpm for 10 minutes at 4 ° C, 1/5 amount of 20% polyethylene glycol added with 2.5 M sodium chloride is added to the supernatant, and the mixture is allowed to stand at room temperature for 20 minutes. After that, the precipitate was recovered by centrifugation at 8000 rpm for 15 minutes at 4 ° C, and 1/10 volume of sterile PBS of the culture solution was added and dissolved, and 20% polyethylene glycol with 2.5 M sodium chloride added again was added to 1 / 5 volume was added and centrifuged at 10,000 rpm for 20 minutes at 4 ° C., and the supernatant was discarded. Spin down and centrifuged at 4 ° C. for 10,000 minutes for 2 minutes. PBS with 0.05% NaN ₃ added thereto was added with 3.2 mL of the culture solution, the precipitate was dissolved to recover the phages, and 0.8 mL of 5% BSA was added.

4-4. Re-screening with amplified phage Screening was repeated using the amplified phage in the same manner as in 4-2. Washing in the screening was 10 times in the second screening and 15 times in the third and subsequent screenings. The microcup used was 1 well from the second time onwards.

4-5. Evaluation method of phage screening technique
When the screening is repeated by the method of 4-4., (Total number of phages loaded into antigen-adsorbed microcups) / (total number of phages recovered from antigen-adsorbed microcups) is clearly smaller than the previous screening. For example, it can be presumed that the phage displaying the target antibody is being concentrated. The number of phage contained in the solution was calculated as follows.
1) A dilution series of phage was prepared as follows.
[1] 1 × 10 ^-2 dilution: phage solution 10μL + PBS990μL
[2] 1 x 10 ^-4 dilution: [1] dilution 10 μL + PBS 990 μL
[3] 1 × 10 ^-6 dilution: 10 μL of [2] dilution + 990 μL of PBS
[4] 1 × 10 ^-8 dilution: 10 μL of [3] dilution + 990 μL of PBS
[5] 1 × 10 ^-9 dilution: [4] dilution 100 μL + PBS 900 μL
[6] 1 × 10 ⁻¹⁰ dilution: [5] dilution 100 μL + PBS 900 μL
Make 10 μL of dilution series [4], [5], and [6] plus 990 μL of DH12S, infect at 37 ° C. for 1 hour, spread this on LBGA plate at 100 μL and incubate at 30 ° C. for 18-24 hours The colonies were counted. Of the above dilution series, the plate [4] usually produces 50 or more colonies. The number of phage per mL is calculated as follows based on the number of colonies in the plate [4].
Number of phages in stock solution = (number of colonies / plate) x (1 x 10 ⁸ ) x 10 ³ cfu / mL

  In addition, the number of recovered phages was calculated in the same manner, and the number of phages displaying an antibody against this antigen was determined for each screening.

4-6. Measurement of antigen-binding activity (affinity) of antibody obtained by screening Antigen-binding activity (affinity) of the antibody selected by the above screening was measured. For affinity measurement, scFv-cp3 type antibody was used as a sample instead of phage type antibody. The measurement method was an ELISA method using a 96-well microtiter plate. The method of inducing scFv-cp3-type antibody expression is described in 4-7.
First, an ELISA plate was prepared as follows. 50 μg of antigen was added to each well of a 96-well microtiter plate (Nunc Maxisorp) and allowed to bind at 4 ° C. for 18 hours, and then 200 μL of 5% BSA (blocking solution) was added to each well. Blocked for 1 hour at ° C. After discarding the blocking solution, it was washed once with PBS and used for affinity measurement. 100 μL of the culture supernatant collected in the procedure of 4-7 was added to each well and reacted at 25 ° C. for 1 hour. After the reaction, the plate was washed 8 times with PBS, 100 μL of anti-cp3 mouse monoclonal antibody (3H11) 5 μg / mL (manufactured by Medical and Biological Laboratories) was added, and the mixture was reacted at 37 ° C. for 1 hour. Wash again 8 times with PBS and add 100 μL of anti-mouse IgG (H + L) goat antibody Fab′-HRP-labeled (330) (manufactured by Medical and Biological Laboratories) diluted 1000-fold for 1 hour at 37 ° C. Reacted. After washing again with PBS 8 times, 100 μL of a solution of orthophenylenediamine and hydrogen peroxide was added to react for a while, then 100 μL of 1.5N phosphoric acid was added to stop the reaction, and the absorbance at a wavelength of 492 nm was measured. As a result, activity was confirmed in 83 clones out of 95 clones (FIG. 23).

4-7. Induction of scFv-cp3 antibody expression After culturing phage-infected E. coli in 2xYT supplemented with 1% glucose and 100 µg / mL ampicillin at 30 ° C for 18 hours, 0.1% glucose and 100 µg / mL 5 μL of the above culture solution was added to 2 × YT 1.5 mL to which ampicillin had been added, and cultured at 30 ° C. for 4 hours. The concentration of Escherichia coli at this time was about 0.5 when measuring absorbance at a wavelength of 600 nm.
After adding IPTG (isopropyl-1-thio-β-D-galactoside) to 1 mM and further culturing at 30 ° C. for 18 hours, 1.5 mL of the culture solution was put into an Eppendorf tube, and 10,000 rpm at 4 ° C. for 5 minutes. The culture supernatant was taken in mind, and sodium azide was added to a concentration of 0.1% to prepare a sample.
Whether or not the scFv-cp3 type antibody was expressed was confirmed by the ELISA method shown in 4-8. All clones that were positive in 4-6 (clones with antigen-binding activity) were found to be expressed.

4-8. Confirmation of scFv-cp3 antibody expression
After adding 100 μL of the culture supernatant expressing the scFv-cp3 type antibody in 4-7 to each well of a 96-well microtiter plate (Nunc Maxisorp) and binding at 37 ° C. for 1 hour, 5% BSA 200 μL of the blocking solution was added to each well and blocked at 37 ° C. for 1 hour. After discarding the blocking solution, it was washed once with PBS and used for affinity measurement. 100 μL of anti-cp3 mouse monoclonal antibody (3H11) 5 μg / mL (manufactured by Medical and Biological Laboratories) was added and reacted at 37 ° C. for 1 hour. Wash again 8 times with PBS and add 100 μL of anti-mouse IgG (H + L) goat antibody Fab′-HRP labeled (330) (manufactured by Medical and Biological Laboratories) diluted 1000 times for 1 hour at 37 ° C. Reacted. After washing again with PBS 8 times, 100 μL of a solution of orthophenylenediamine and hydrogen peroxide was added to react for a while, then 100 μL of 1.5N phosphoric acid was added to stop the reaction, and the absorbance at a wavelength of 492 nm was measured.

4-9. Monoclonalization and purification of phagemid
4-5. E. coli clones were selected from the single colony plate obtained in the section “Evaluation of phage screening techniques” and cultured in LBGA at 30 ° C. for 18 hours. Phagemid was purified using File No.50.
4-10. Identification of Monoclonal Antibody The sequence of the gene of the anti-vSrc antibody selected by screening from the antibody library of the present invention was confirmed. The sequences were determined by the dideoxy method using CEQ ^™ DTCS-Quick Start-KIT (Beckman Coulter) and CEQ2000XL DNA Analysis system manufactured by Beckman Coulter using the following primers for the heavy chain and light chain. As a result of the nucleotide sequence determination, 21 types of antibodies were obtained from the combination of H chain and L chain.
Primer for heavy chain sequencing (SDSEQ primer): 5'-TTCTATTTCAAGGAGACAGTC-3 '(SEQ ID NO: 60)
Primer for light chain sequencing (CP3RGGG primer): 5'-GCCGCCGCCAGCATTGACA-3 '(SEQ ID NO: 61)

4-11. Collection of polyclonal scFv-pp antibody for chaperone activity measurement
4-11-1. Conversion of polyclonal antibody scFv-cp3 type antibody to scFv-pp type antibody
For the purpose of obtaining reproducibility of the chaperone-like activity of the antibody obtained in 2. with the antibody of the library, a polyclonal antibody for 4th screening was prepared. For convenience of purification, it was converted to an scFv-pp type antibody. The vector is constructed such that cp3 is excised and converted to a pp-type antibody when digested with SalI and self-ligated (FIGS. 20-22), but analysis of the DNA sequence examined in 4-10. As a result, rabbit antibodies having a SalI site in the FW3 part of the H chain were included in 21 out of 21 clones in a ratio of 1/3, so this method could not be used. Therefore, an antibody gene was excised at the SfiI-AscI site and inserted into a vector that had already been converted to pp type.

1) A 4th polyclonal antibody was prepared. Including the number of phages collected from 4th panning glycerol stock 3.6 × 10 ⁶ by 4th panning (4-5. Reference) More than the number of cells and containing 1% glucose and 100 μg / mL ampicillin 2 X Plasmid was prepared by culturing overnight at 30 ° C in 150 mL of YT medium.

2) The plasmid DNA obtained in 1) was treated with phenol, ethanol precipitated, and then digested at the SfiI-AscI site under the following conditions.
Plasmid DNA 28μg
SfiI (20U / μL) 7μL
10 × NEB (New England Biolabs) Buffer2 20μL
0.1% BSA 20μL
After making it 200 μL with sterilized miliQ water and reacting at 50 ° C. for 2 hours, phenol treatment and ethanol precipitation, AscI digestion was performed under the following conditions.
Plasmid DNA
AscI (10U / μL) 14μL
10 × NEB Buffer 4 20μL
Make 200 μL with sterile miliQ water, react at 37 ° C. for 2 hours, phenol treatment, ethanol precipitation, suspend in 90 μL TE, add 10 μL sample loading buffer, perform electrophoresis on 0.8% agarose gel, around 700 bp Were cut out and purified with QIAquick Gel Extraction Kit (manufactured by QIAGEN). 120 μL of DNA solution (corresponding to 2 μg) was obtained.

3) For clone 4007 that does not contain SalI site in H chain and L chain, prepare plasmid DNA using PI-50 plasmid extractor (manufactured by Kurabo), add TE 40μL to 20μL (20ng), phenol-treat, ethanol precipitation Thereafter, SalI digestion and self-ligation were carried out under the following conditions to prepare a pp-type converted antibody plasmid DNA.
Plasmid DNA
10 x H buffer (SalI attached) 2μL
SalI (15U / μL TAKARA) 0.3μL
Make 20 μL with sterile MiliQ water, react for 2 hours at 37 ° C., and confirm that 2 μL of the approximately 600 bp band corresponding to cp3 was cut out by 0.8% agarose gel electrophoresis, followed by phenol treatment and ethanol precipitation. Self-ligation was performed under the following conditions.
Plasmid DNA
T4 DNA ligase (TAKARA 350U / μL) 1μL
10 × T4 DNA ligase buffer (attached with T4 DNA ligase) 6μL
The volume was adjusted to 60 μL with sterilized MiliQ water, and reacted at 16 ° C. for 3 hours. Add 3 μL of 20 mg / ml glycogen (Roshe), perform ethanol precipitation, suspend in 5 μL of 1/10 TE, transform with 20 μL of DH12S competent cell with 2 μL, dilute with 1 ml of 2 × YT, 20 μL was plated on an LBGA plate and cultured at 30 ° C. overnight. The next day, 4 colonies were picked and cultured in 2 x YT medium containing 2 ml of 1% glucose and 100 µg / mL ampicillin at 30 ° C overnight. Plasmid DNA was recovered from the culture solution using a PI-50 plasmid extractor. . This plasmid DNA was digested with AscI under the following conditions, and it was confirmed that a band was detected at the desired size in the vicinity of 4,300 bp. It was confirmed that all 4 clones were converted to pp type antibodies.
Plasmid DNA 3μL (60ng)
AscI (10U / μL) 0.15μL
10 × NEB Buffer 4 0.8μL
The volume was adjusted to 8 μL with sterile MiliQ water, reacted at 37 ° C. for 2 hours, and the entire amount was electrophoresed.
20 μL of DH12S competent cells were transformed with 1 μL of the converted plasmid DNA, and cultured at 30 ° C. overnight in 150 ml of 2 × YT medium containing 1% glucose and 100 μg / mL ampicillin to prepare plasmid DNA from the cells. .

4) The pp-type conversion plasmid DNA obtained in 3) was excised from the antibody gene sequence at SfiI-AscI site and dephosphorylated with Alkaline phosphatase (E. coli C75). The conditions are shown below.
Plasmid DNA 20μg
SfiI (20U / μL) 5μL
10 × NEB Buffer2 20μL
0.1% BSA 20μL
It was made 200 μL with sterilized MiliQ water and reacted at 37 ° C. for 2 hours, followed by phenol treatment and ethanol precipitation. Next, the following reaction was performed.
Plasmid DNA
AscI (10U / μL) 10μL
10 × NEB Buffer4 20μL
200 μL with sterile MiliQ water, react at 50 ° C. for 2 hours, add 20 μL of 1M Tris-HCl (pH 8) and 2 μL of Alkaline phosphatase (E. coli C75), react at 37 ° C. for 30 minutes, phenol treatment, ethanol Precipitation was performed. Suspend in 90 μL of TE, add 10 μL of 10 × sample loading buffer, perform electrophoresis on 0.8% agarose gel, cut out a band around 3,800 bp corresponding to the vector part of stuffer, and use QIAquick Gel Extraction Kit. Purified. 120 μL of DNA solution corresponding to 17 μg was obtained.

5) The ligation reaction was performed on the DNA obtained in 2) and 4) under the following conditions.
Vector DNA 2) 1μg
Insert DNA 4) 2μg
T4 DNA ligase (TAKARA 350U / μL) 1μL
10 × T4 DNA ligase buffer (attached with T4 DNA ligase) 2μL
The volume was adjusted to 20 μL with sterile MiliQ water, and reacted at 16 ° C. for 3 hours. Perform ethanol precipitation, suspend in 4 μL of 1/10 TE, transform 20 μL of DH12S (Gibco) with 2 μL, suspend with 10 mL of 2 × YT, dilute 10 μL with 2 × YT 100 times, and add 100 μL. It rolled to the LBGA plate and it culture | cultivated at 30 degreeC overnight. The remaining cell suspension was cultured in 500 ml of 2 × YT medium containing 1% glucose and 100 μg / mL ampicillin to prepare plasmid DNA. On the next day, 94 colonies were picked from the plate and cultured overnight at 30 ° C. in 2 × YT medium (YTA) containing 2 ml of 1% glucose and 100 μg / mL ampicillin, and then cultured at 30 ° C. for 3 hours at 0.1% glucose YTA. After that, 1M IPTG was added and cultured at 30 ° C. for 20 hours. The supernatant was obtained by centrifugation at 10,000 rpm for 5 minutes. A culture supernatant containing this scFv-pp type antibody was obtained, and pp expression was confirmed by the method described in 6). As a result, 84 clones out of 94 clones expressed pp.

6) Confirmation of pp expression
After adding 100 μL of the culture supernatant expressing scFv-pp type antibody in 4-7 to each well of a 96-well microtiter plate (Nunc Maxisorp) and binding at 37 ° C. for 1 hour, 5% BSA 200 μL of the blocking solution was added to each well and blocked at 37 ° C. for 1 hour. After discarding the blocking solution, it was washed once with PBS and used for affinity measurement. 100 μL of 1000-fold diluted Fc-HRP label (Rockland) was added and reacted at 37 ° C. for 1 hour.
After washing 8 times with PBS, 100 μL of a solution of orthophenylenediamine and hydrogen peroxide was added and allowed to react for a while, then 100 μL of 1.5N phosphoric acid was added to stop the reaction, and the absorbance at a wavelength of 492 nm was measured.

The antibody protein thus obtained can be used as a specific binding molecule during Src synthesis in a cell-free protein synthesis system.

  The production method of the present invention can be used for the synthesis of various proteins. Application fields include protein structure and function analysis, gene function analysis, mutant gene rapid screening, protein rapid screening, protein / protein, protein / DNA or protein / RNA interaction analysis, gene mutation The present invention can be used for detection and analysis, analysis of post-translational modifications, development of various drugs including antiviral agents, and the like.

The present invention is not limited to the description of the embodiments and examples of the invention described above. Various modifications may be included in the present invention as long as those skilled in the art can easily conceive without departing from the description of the scope of claims.
The contents of papers, published patent gazettes, patent gazettes, and the like specified in this specification are incorporated by reference in their entirety.

FIG. 1 is a conceptual diagram of an in vivo synthesis system of recombinant vSrc. E. coli BL21 (DE3) strain was used as a host. pBB131 is JIGordon (Duronio, RJ, Jackson-Machelski, E., Heuckeroth, RO, Olines, PO, Devine, CS, Yonemoto, W., Slice, LW, Taylor, SS, and Gordon, JI (1990) Proc. (Acquired from Natl. Acad. Sci. USA 87, 1506-1510.) pETvSrc was constructed based on the pET14 expression vector (Novagen Co.). FIG. 2 is a diagram showing a cDNA sequence (part) of the v-src gene. FIG. 3 shows the cDNA sequence of the v-src gene (continuation of FIG. 2). FIG. 4 is a diagram showing an amino acid sequence encoded by the v-src gene. FIG. 5 is a diagram showing a cDNA sequence (part) of the c-src gene. FIG. 6 is a diagram showing the cDNA sequence of the c-src gene (continuation of FIG. 5). FIG. 7 shows the amino acid sequence encoded by the c-src gene. FIG. 8 is a schematic diagram showing the structure of the vector pEU-vSrc. Constructed from pEU3-NII expression vector (TOYOBO). The cDNA was transferred from Dr. Hamaguchi (Nagoya Univ.). The Ω sequence represents a plant specific translation enhanced sequence. FIG. 9 is a schematic diagram showing the structure of the vector pEU-cSrc. It is constructed in the same way as the vector pEU-vSrc. FIG. 10 shows the results of examining the distribution of the total fraction, soluble fraction, and insoluble fraction obtained by cell-free protein synthesis using the vector pEU-cSrc by Western immunoblotting. Anti-cSrc monoclonal antibody GD11 (UBI) was used for detection. In order from the left lane, Lane 1: cSrc total (5 μl), Lane 2: cSrc sup. (5 μl), Lane 3: cSrc ppt. (5 μl), Lane 4: cSrc total + Fab (5 μl), Lane 5: cSrc sup. + Fab (5 μl), lane 6: cSrc ppt. + Fab (5 μl), lane 7: negative control, lane 8: positive control (recombinant Src). FIG. 11 is a graph showing the results of measuring the activity of Src synthesized in the presence and absence of rabbit anti-vSrc antibody (Fab). The results of two independent tests are shown together. vSrc1 and vSrc1 ′ are vSrc synthesized in the absence of antibody, (vSrc + Fab) 1 and (vSrc + Fab) 1 ′ are vSrc, cSrc1 and cSrc1 ′ synthesized in the presence of antibody (Fab) CSrc, (cSrc + Fab) 1 and (cSrc + Fab) 1 ′ synthesized in the coexistence are cSrc and NC, which are synthesized in the presence of antibody (Fab), and negative controls (wheat germ extract, wheat germ extract + Fab , Or QW (miliQ water)), PC represents a positive control (recombinant Src), respectively. FIG. 12 is a graph showing the results of measuring each Src activity when cSrc and vSrc were synthesized in the absence of an antibody and the antibody was added after the synthesis. The results of two independent tests are shown together. NC is negative control (wheat germ extract, wheat germ extract + Fab or QW (miliQ water)), PC is positive control (recombinant Src), vSrc1 + Fab and vSrc2 + Fab are antibodies (Fab ), CSrc1 + Fab and cSrc2 + Fab represent samples to which an antibody (Fab) was added after cSrc synthesis, respectively. FIG. 13 is a diagram for explaining the preparation process of a phagemid vector used for the production of a rabbit antibody phage display library. FIG. 14 shows the base sequence (part) and the encoded amino acid sequence (part) of the scNcopFCAH9-E8VHdVLd vector used for the construction of the rabbit antibody phage display library vector. FIG. 15 shows the base sequence (continuation of FIG. 14) and the encoded amino acid sequence (continuation of FIG. 14) of the scNcopFCAH9-E8VHdVLd vector used for the construction of the rabbit antibody phage display library vector. FIG. 16 shows the base sequence (continuation of FIG. 15) and the encoded amino acid sequence (continuation of FIG. 15) of the scNcopFCAH9-E8VHdVLd vector used for the construction of the vector for the rabbit antibody phage display library. FIG. 17 is a diagram showing the base sequence (part) of the rabbit antibody phage display library vector pSCCA4-E8d and the encoded amino acid sequence (part). FIG. 18 is a diagram showing the base sequence of the rabbit antibody phage display library vector pSCCA4-E8d (continuation of FIG. 17) and the encoded amino acid sequence (continuation of FIG. 17). FIG. 19 shows the base sequence (continuation of FIG. 18) and the encoded amino acid sequence (continuation of FIG. 18) of the vector pSCCA4-E8d for rabbit antibody phage display library. FIG. 20 is a diagram showing (in part) the amino acid sequence encoded by the restriction enzyme site and the nucleotide sequence in the nucleotide sequence of the insert of the vector pSCCA5-E8d. FIG. 21 shows the amino acid sequence (continuation of FIG. 20) encoded by the restriction enzyme site and the base sequence in the base sequence of the insert of vector pSCCA5-E8d. FIG. 20 is a diagram showing an amino acid sequence (continuation of FIG. 21) encoded by a restriction enzyme site and a base sequence in the base sequence of the insert of vector pSCCA5-E8d. FIG. 23 is a graph summarizing the results of measuring the antigen-binding activity of a sample obtained by screening from an antibody phage display library.

Claims (11)

  (a) an antibody against the target protein, (b) a ligand for the target protein when it is a receptor, (c) a receptor for the target protein when it is a ligand, (d) when the target protein exerts its activity The other molecule in the case of forming a complex with another molecule, and (e) a molecule that recognizes and binds to a structure temporarily existing in the process in which the target protein forms the correct folding A method for producing a protein, comprising synthesizing a target protein in a cell-free protein synthesis system in the presence of one or more specific binding molecules selected.   The production method according to claim 1, wherein the specific binding molecule is a molecule prepared using a phage display method.   The production method according to claim 1, wherein the specific binding molecule is a molecule that specifically binds to a target protein in a native state. The production according to any one of claims 1 to 3, wherein the target protein is an enzyme, and the specific binding molecule is a molecule that binds to the target protein without inhibiting the enzyme activity of the target protein. Method.   The production method according to claim 1, wherein the cell-free protein synthesis system is an in vitro transcription / translation system.   The production method according to claim 1, wherein the specific binding molecule is an antibody. The production method according to claim 6, wherein the antibody is an antibody fragment selected from the group consisting of Fab, Fab ′, F (ab ′) ₂ , scFv, and dsFv.   The production method according to claim 6, wherein the antibody is a monovalent antibody. i) (a) an antibody against the target protein, (b) a ligand for the target protein when it is a receptor, (c) a receptor for when the target protein is a ligand, (d) the target protein exerts its activity Other molecules when forming a complex with other molecules, and (e) a molecule that recognizes and binds to a structure that temporarily exists in the process of the target protein forming the correct folding Synthesizing a target protein in a cell-free protein synthesis system in the presence of one or more specific binding molecules selected from the group consisting of:
ii) separating the target protein synthesized in step i) by binding or adsorbing the specific binding molecule to another substance;
A method for producing a protein, comprising: i) preparing an antibody against the protein of interest using a phage display method;
ii) synthesizing the target protein in a cell-free protein synthesis system in the presence of the antibody prepared in step i);
A method for producing a protein, comprising:   A protein produced by the production method according to claim 1.