JP2005119998A - Condensed benzene ring compound and its use - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To obtain a PPAR (Peroxisome Proliferator Activated Receptor) agonist useful as a prophylactic and/or therapeutic agent against sugar/lipid metabolic disorder, etc. <P>SOLUTION: The PPAR agonist comprises a compound represented by formula (I) (ring A is a cyclic group which may contain a substituent group; ring S is a spacer composed of a ring; Y is a direct bond or a spacer in which a main chain has 1-8 atoms; Z is an acidic group; X is an oxygen atom or the like; W is a spacer in which a main chain has 1-8 atoms; V is an alkyl group which may contain a substituent group, a cyclic group which may contain a substituent group or the like). The compound represented by general formula (I) is useful as a prophylactic and/or a therapeutic agent against sugar/lipid metabolic disorder, etc., by having PPAR agonist action. <P>COPYRIGHT: (C)2005,JPO&NCIPI

Description

  The present invention relates to a fused benzene ring compound useful for the treatment of diseases such as abnormal sugar / lipid metabolism, and uses thereof.

Recently, in the study of transcription factors involved in induction of the expression of adipocyte differentiation marker genes, peroxisome proliferator activated receptor is a nuclear receptor (P eroxisome P roliferator A ctivated R eceptor; hereinafter abbreviated as PPAR) attention Has been. PPAR has been cloned from various animal species and several isoform genes have been found. In mammals, three types of α, δ, and γ are known (J. Steroid Biochem. Molec. Biol., 51 , 157 (1994); Gene Expression., 4 , 281 (1995); Biochem Biophys. Res. Commun. ., 224 , 431 (1996); Mol. Endocrinology., 6 , 1634 (1992)). Furthermore, γ type is mainly expressed in adipose tissue, immune cells, adrenal gland, spleen, and small intestine, α type is mainly expressed in adipose tissue, liver, and retina, and δ type is universally found to have no tissue specificity. It is known that it is expressed (see Endocrinology., 137 , 354 (1996)).

  Thiazolidine derivatives such as pioglitazone, ciglitazone, rosiglitazone, and troglitazone are known as therapeutic agents for non-insulin dependent diabetes mellitus (NIDDM), and are hypoglycemic agents used to correct hyperglycemia in diabetic patients. In addition, this compound is effective in correcting or improving hyperinsulinemia, improving glucose tolerance, and lowering serum lipids, and is considered a very promising drug for improving insulin resistance.

One of the intracellular target proteins of these thiazolidine derivatives is PPARγ, which has been found to increase the transcriptional activity of PPARγ (Endocrinology., 137 , 4189 (1996); Cell., 83 , 803 (1995). Cell., 83 , 813 (1995); J. Biol. Chem., 270 , 12953 (1995)). Therefore, PPARγ activators (agonists) that increase the transcriptional activity of PPARγ are considered promising as hypoglycemic agents and / or lipid lowering agents. Moreover, since it is known that PPARγ agonists enhance the expression of PPARγ protein itself (Genes & Development., 10 , 974 (1996)), not only PPARγ is activated but also the expression of PPARγ protein itself is increased. The drugs to be used are also considered clinically useful.

The nuclear receptor PPARγ is involved in adipocyte differentiation (see J. Biol. Chem., 272 , 5637 (1997) and Cell., 83 , 803 (1995)), and thiazolidine derivatives that can activate this are adipocytes It is known to promote differentiation. Recently, it has been reported that thiazolidine derivatives increase body fat and cause weight gain and obesity in humans (see Lancet, 349 , 952 (1997)). Because of these, PPARγ agonists (agonists) and PPARγ protein expression promoters that can increase the expression of the protein itself have a blood glucose-lowering action and a lipid-lowering action. (For example, diabetes, hyperlipidemia (hypercholesterolemia, low HDL (high density lipoprotein) blood, high LDL (low density lipoprotein) blood, high TG (triglyceride)), arteriosclerosis It is expected to be useful as a preventive and / or therapeutic agent for cardiovascular diseases, obesity, metabolic syndrome, etc.), hypertension, circulatory diseases and the like.

In addition, fibrates, such as clofibrate, are known as lipid lowering agents, but it has also been found that one of the intracellular target proteins of fibrates is PPARα (Nature., 347 , 645 (1990). ); J. Steroid Biochem. Molec. Biol., 51 , 157 (1994); Biochemistry., 32 , 5598 (1993)). From these facts, the PPARα agonist is considered to have a lipid lowering action and is expected to be useful as a preventive and / or therapeutic agent for hyperlipidemia and the like.

In addition to this, it was reported that PPARα has an anti-obesity action as a biological activity involved (WO9736579). In addition, a PPARα agonist has been reported to promote the metabolism of lipids (cholesterol, HDL, LDL, triglyceride, etc.) (J. Lipid Res., 39 , 17 (1998)). That is, it has been reported that it has a high density lipoprotein (HDL) cholesterol increasing action, a low density lipoprotein (LDL) cholesterol, a very low density lipoprotein (VLDL) cholesterol, and a triglycedide reducing action. One of the fibrate compounds, bezafibrate, has been reported to improve blood fatty acid composition, hypertension, and insulin resistance (Diabetes., 46 , 348 (1997)). Therefore, an agonist that activates PPARα and a PPARα protein expression promoter that enhances the expression of the PPARα protein itself have a lipid-lowering action, and thus, for example, disorders of lipid metabolism (eg, hyperlipidemia (high cholesterol) ), Arteriosclerosis, cardiovascular disease, obesity, metabolic syndrome, etc.), hypertension, circulatory disease, etc. It is expected to be useful as

  On the other hand, there are few reports of biological activities involving ligands or PPARδ significantly activated by PPARδ. PPARδ is sometimes referred to as PPARβ or, in the case of humans, NUC1. So far, it has been shown that the biological activity of PPARδ is that hNUC1B (PPAR subtype different from human NUC1 by one amino acid) can suppress the transcriptional activity of human PPARα and thyroid hormone receptor (WO 9601430). In addition, recently, compounds (agonists) having high affinity for PPARδ protein and significantly activating PPARδ have been found, and these compounds have HDL (high density lipoprotein) cholesterol raising action. (WO9728149). Therefore, since an agonist capable of activating PPARδ has, for example, an HDL cholesterol raising action and a lipid lowering action, for example, a lipid metabolism disorder (eg, hyperlipidemia (eg, hypercholesterolemia, low HDL blood) It is useful as a prophylactic and / or therapeutic agent for arteriosclerosis, cardiovascular disease, obesity, metabolic syndrome, etc.), hypertension, cardiovascular disease, etc. Be expected.

In addition, it has been found that foaming occurs due to the action of macrophage oxidized LDL uptake, which deposits on the vascular endothelium and causes lipid metabolism disorders (Proceedings of the National Academy of Sciences of the United States of America, 98 (9) , 5306, (2001)), LDL lowering action due to PPARδ agonist action reduces foam cells, and lipid metabolism disorders (eg, hyperlipidemia (hypercholesterolemia, hypoHDLemia, hyperlipidemia) It is expected to be useful as a preventive and / or therapeutic agent for arteriosclerosis, cardiovascular disease, obesity, metabolic syndrome, etc.), hypertension, circulatory system disease, etc.

  On the other hand, the general formula (A)

(Wherein X ^A is a single bond, ^C 1-4 alkylene group; Y ^A is an —O— group, —S— group; ZA is a ^C 1-4 alkylene group; A ^A is an —O— group, —S— group. R ^1A is (1) a COOR ^5A group, etc .; R ^5A is a hydrogen atom, a C1-8 alkyl group; R ^2A and R ^3A are a hydrogen atom, a C1-8 alkyl group, etc .; R ^4A is a hydrogen atom, a C1-8 alkyl group; D represents a ^{D 1A, D 2A} or ^{D 3A,, D 1A} is ^(R _6A) ring1 ^a group substituted with _mA ^{group; D 2A} is RING2 ^a group substituted with ^(R _{6A) mA} group; ring1 ^A is a C3-10 monocyclic or bicyclic carbocyclic aryl which may be partially or fully saturated; ring2 ^A is 1-4 heteroatoms selected from an oxygen atom, a nitrogen atom or a sulfur atom Or some or all of them may be saturated. 0-membered monocyclic or bicyclic heterocyclic ^{aryl; D 3A} is C1-8 alkyl ^{group; R 6A} is hydrogen atom, C1-8 alkyl group or the like;. MA of the compound represented by representing 1-3) is PPAR It is known to be useful as a receptor control agent (see Patent Document 1).

International Publication No. 02/51820 Pamphlet

  The development of PPAR agonists useful as preventive and / or therapeutic agents for diseases such as abnormal sugar / lipid metabolism is eagerly desired.

In view of the said subject, as a result of earnest examination, the present inventors discovered that the compound shown by general formula (I) achieved the objective, and completed this invention.
That is, the present invention
(1) General formula (I)

(In the formula, ring A represents a cyclic group which may have a substituent, and ring S is a ring formed of 3 to 20 atoms selected from a carbon atom, an oxygen atom, a sulfur atom and a nitrogen atom. The ring S may have a substituent, and V has an alkyl group that may have a substituent, an alkenyl group that may have a substituent, and a substituent. Represents an optionally substituted alkynyl group or an optionally substituted cyclic group, W represents a main chain spacer having 1 to 8 atoms, X represents an oxygen atom, and an optionally oxidized sulfur atom Or represents an —NR ² — group, R ² represents a hydrogen atom or an optionally substituted alkyl group, Y represents a bond, or a spacer having 1 to 8 atoms in the main chain, Z represents an optionally protected acidic group, provided that Spacer represented by the S is

(In the group, a left-pointing arrow is bonded to X and a right-pointing arrow is bonded to Y). A PPAR agonist comprising a compound represented by the following formula: a salt thereof, an N-oxide thereof, a solvate thereof, or a prodrug thereof;
(2) The spacer represented by ring S is

(In each group, the left arrow is bonded to X, the right arrow is bonded to Y, and ring B and ring C are each independently a C5-10 monocyclic optionally having substituent (s). Represents a monocyclic heterocyclic ring having 5-10 members which may have a carbocycle or a substituent, and ring D represents a monocyclic carbocycle or substituent of C5-10 which may have a substituent. Represents a 6-10 membered monocyclic heterocyclic ring which may have, R ¹ represents a hydrogen atom or a substituent, m represents an integer of 1-4,

Represents a single bond or a double bond. The agent according to the preceding item (1),
(3) The agent according to item (1), wherein PPAR is PPARα and / or γ,
(4) The agent according to the above item (1), which is a preventive and / or therapeutic agent for PPAR-mediated diseases,
(5) The agent according to the above item (4), wherein the PPAR-mediated disease is a disease of abnormal sugar / lipid metabolism,
(6) The agent according to item (1), wherein V is a cyclic group which may have a substituent,
(7) The agent according to the above item (1), wherein Y is a bond.
(8) The agent according to item (1), wherein ring A is a 5- to 7-membered monocyclic heterocyclic ring which may have a substituent,
(9) The agent according to the above item (8), wherein the 5- to 7-membered monocyclic heterocycle is 1,3-oxazole or 1,3-thiazole ring,
(10) General formula (IA)

(Wherein all symbols have the same meanings as described in (1 and 2) above), the agent described in (1) above,
(11) A pharmaceutical composition comprising a combination of the PPAR agonist described in (1) above and one or more selected from anti-obesity agents, diabetes therapeutic agents and lipid improving agents,
(12) PPAR-mediated in mammals, characterized by administering an effective amount of the compound, salt, N-oxide, solvate, or prodrug thereof described in (1) above to the mammal A method for preventing and / or treating a disease,
(13) Use of the compound according to the above item (1), a salt thereof, an N-oxide thereof, a solvate thereof, or a prodrug thereof for producing a prophylactic and / or therapeutic agent for a PPAR-mediated disease, and 14) General formula (IA)

(In the formula, ring A represents an optionally substituted cyclic group, and ring B has an optionally substituted C5-10 monocyclic carbocycle or substituent. Represents a 5- to 10-membered monocyclic heterocycle, and V represents an alkyl group which may have a substituent, an alkenyl group which may have a substituent, or an optionally substituted group. An alkynyl group or an optionally substituted cyclic group, W represents a main chain spacer having 1 to 8 atoms, X represents an oxygen atom, an optionally oxidized sulfur atom, or —NR ² represents a group, R ² represents a hydrogen atom or an optionally substituted alkyl group, Y represents a bond, or a spacer having 1 to 8 atoms in the main chain, and Z represents a protected group. An acidic group that may be present)), a salt thereof, an N-oxy thereof Body, a solvate thereof, or prodrugs thereof.

  Examples of the cyclic group in the “cyclic group optionally having substituent (s)” represented by ring A include carbocycle and heterocycle.

  The carbocycle includes, for example, a C3-15 monocyclic, bicyclic or tricyclic aromatic carbocyclic ring, a carbocyclic ring partially or wholly saturated, a spiro-bonded bicyclic carbocyclic ring, and Examples thereof include a bridged bicyclic carbocycle. Examples of the C3-15 monocyclic, bicyclic or tricyclic aromatic carbocyclic ring, and a carbocyclic ring partially or completely saturated include cyclopropane, cyclobutane, cyclopentane, cyclohexane, cycloheptane, cyclo Octane, cyclononane, cyclodecane, cycloundecane, cyclododecane, cyclotridodecane, cyclotetradecane, cyclopentadecane, cyclopentene, cyclohexene, cycloheptene, cyclooctene, cyclopentadiene, cyclohexadiene, cycloheptadiene, cyclooctadiene, benzene, pentalene, par Hydropentalene, azulene, perhydroazulene, indene, perhydroindene, indane, naphthalene, dihydronaphthalene, tetrahydronaphthalene, perhydronaphthalene, hepta Emissions, perhydro hept, biphenylene, as-indacene, s- indacene, acenaphthylene, acenaphthene, fluorene, phenalene, phenanthrene, anthracene ring, and the like. Examples of the spiro-bonded bicyclic carbocycle and the bridged bicyclic carbocycle include, for example, spiro [4.4] nonane, spiro [4.5] decane, spiro [5.5] undecane, and bicyclo [2. 2.1] heptane, bicyclo [2.2.1] hept-2-ene, bicyclo [3.1.1] heptane, bicyclo [3.1.1] hept-2-ene, bicyclo [2.2. 2] Octane, bicyclo [2.2.2] oct-2-ene, adamantane, noradamantane ring and the like.

  The heterocycle includes, for example, a 3-15 membered monocyclic or bicyclic ring containing 1 to 5 heteroatoms selected from an oxygen atom, a nitrogen atom and a sulfur atom, which may be partially or fully saturated. Alternatively, a tricyclic aromatic heterocycle, a spiro-bonded bicyclic heterocycle, a bridged bicyclic heterocycle, and the like can be given. A 3-15 membered monocyclic, bicyclic or tricyclic aromatic group containing 1-5 heteroatoms selected from the oxygen atom, nitrogen atom and sulfur atom, which may be partially or fully saturated Examples of the heterocyclic ring and the spiro-linked bicyclic heterocyclic ring and the bridged bicyclic heterocyclic ring include pyrrole, imidazole, triazole, tetrazole, pyrazole, pyridine, pyrazine, pyrimidine, pyridazine, azepine, diazepine, furan, Pyran, oxepin, thiophene, thiopyran, thiepine, oxazole, isoxazole, thiazole, isothiazole, furazane, oxadiazole, oxazine, oxadiazine, oxazepine, oxadiazepine, thiadiazole, thiazine, thiadiazine, thiazepine, thiadiazepine, indole, isoin , Indolizine, benzofuran, isobenzofuran, benzothiophene, isobenzothiophene, dithianaphthalene, indazole, quinoline, isoquinoline, quinolidine, purine, phthalazine, pteridine, naphthyridine, quinoxaline, quinazoline, cinnoline, pyrrolopyridine, benzoxazole, Benzothiazole, thieno [3,2-c] pyridine, benzimidazole, chromene, benzoxepin, benzoxazepine, benzoxiazepine, benzothiepine, benzothiazepine, benzothiazepine, benzoazepine, benzodiazepine, benzofurazan, benzothiadiazole , Benzotriazole, carbazole, β-carboline, acridine, phenazine, dibenzofuran, xanthene, dibenzothiophene Phenothiazine, phenoxazine, phenoxathiin, thianthrene, phenanthridine, phenanthroline, perimidine, pyridonaphthyridine, pyrazoloisoquinoline, pyrazolonaphthyridine, pyrimidoindole, aziridine, azetidine, pyrroline, pyrrolidine, imidazoline, imidazolidine, Triazoline, triazolidine, tetrazoline, tetrazolidine, pyrazoline, pyrazolidine, dihydropyridine, tetrahydropyridine, piperidine, dihydropyrazine, tetrahydropyrazine, piperazine, dihydropyrimidine, tetrahydropyrimidine, perhydropyrimidine, dihydropyridazine, tetrahydropyridazine, perhydropyridazine, dihydroazepine, Tetrahydroazepine, perhydroazepine, dihydro Azepine, tetrahydrodiazepine, perhydrodiazepine, oxirane, oxetane, dihydrofuran, tetrahydrofuran, dihydropyran, tetrahydropyran, dihydrooxepin, tetrahydrooxepin, perhydrooxepin, thiirane, thietane, dihydrothiophene, tetrahydro Thiophene, dihydrothiopyran, tetrahydrothiopyran, dihydrothiepine, tetrahydrothiepine, perhydrothiepine, dihydrooxazole, tetrahydrooxazole (oxazolidine), dihydroisoxazole, tetrahydroisoxazole (isoxazolidine), dihydrothiazole, tetrahydrothiazole ( Thiazolidine), dihydroisothiazole, tetrahydroisothiazole (isothiazolidine), di Drofurazan, Tetrahydrofurazan, Dihydrooxadiazole, Tetrahydrooxadiazole (oxadiazolidine), Dihydrooxazine, Tetrahydrooxazine, Dihydrooxadiazine, Tetrahydrooxadiazine, Dihydrooxazepine, Tetrahydrooxazepine, Perhydrooxase Pin, dihydrooxadiazepine, tetrahydrooxadiazepine, perhydrooxadiazepine, dihydrothiadiazole, tetrahydrothiadiazole (thiadiazolidine), dihydrothiazine, tetrahydrothiazine, dihydrothiadiazine, tetrahydrothiadiazine, dihydrothiazepine , Tetrahydrothiazepine, perhydrothiazepine, dihydrothiadiazepine, tetrahydrothiadiazepine, perhydrothiazepine , Morpholine, thiomorpholine, oxathiane, indoline, isoindoline, dihydrobenzofuran, perhydrobenzofuran, dihydroisobenzofuran, perhydroisobenzofuran, dihydrobenzothiophene, perhydrobenzothiophene, dihydroisobenzothiophene, perhydroisobenzothiophene, Dihydroindazole, Perhydroindazole, Dihydroquinoline, Tetrahydroquinoline, Octahydroquinoline, Perhydroquinoline, Dihydroisoquinoline, Tetrahydroisoquinoline, Octahydroisoquinoline, Perhydroisoquinoline, Dihydrophthalazine, Tetrahydrophthalazine, Perhydrophthalazine, Dihydronaphthyridine , Tetrahydronaphthyridine, perhydronaphthyridine, dihydroquino Sarin, tetrahydroquinoxaline, perhydroquinoxaline, dihydroquinazoline, tetrahydroquinazoline, perhydroquinazoline, tetrahydropyrrolopyridine, dihydrocinnoline, tetrahydrocinnoline, perhydrocinnoline, benzooxathiane, dihydrobenzoxazine, dihydrobenzothiazine, pyra Dinomorpholine, dihydrobenzoxazole, perhydrobenzoxazole, dihydrobenzothiazole, perhydrobenzothiazole, 4,5,6,7-tetrahydrothieno [3,2-c] pyridine, dihydrobenzimidazole, perhydrobenzimidazole, dihydro Benzoazepine, tetrahydrobenzoazepine, dihydrobenzodiazepine, tetrahydrobenzodiazepine, benzodioxepane, Hydrobenzoxazepine, tetrahydrobenzoxazepine, dihydrocarbazole, tetrahydrocarbazole, perhydrocarbazole, dihydroacridine, tetrahydroacridine, perhydroacridine, dihydrodibenzofuran, dihydrodibenzothiophene, tetrahydrodibenzofuran, tetrahydrodibenzothiophene, perhydrodibenzofuran, Perhydrodibenzothiophene, tetrapyridonaphthyridine, tetrahydro-β-carboline, dihydroazepinoindole, hexahydroazepinoindole, tetrahydropyrazoloisoquinoline, tetrahydropyrazolonaphthyridine, dihydroazepinoindazole, hexahydroazepinoindazole, dihydropyra Zolopyridazepine, hexahydropyrazolopi Adoazepine, tetrahydropyrimidoindole, dihydrothiazinoindole, tetrahydrothiazinoindole, dihydrooxazinoindole, tetrahydrooxazinoindole, 2,3-dihydro-1H-benzo [de] isoquinoline, dioxolane, dioxane, dithiolane, dithiane, benzo Dioxol (eg, 1,3-benzodioxole, etc.), benzodioxane, chroman, benzodithiolane, benzodithiane, azaspiro [4.4] nonane, oxazaspiro [4.4] nonane, oxaazaspiro [2.5] octane , Dioxaspiro [4.4] nonane, azaspiro [4.5] decane, thiaspiro [4.5] decane, dithiaspiro [4.5] decane, dioxaspiro [4.5] decane, oxazaspiro [4.5] decane, azaspiro B [5.5] undecane, oxaspiro [5.5] undecane, dioxaspiro [5.5] undecane, 1,4-dioxa-8-azaspiro [4.5] decane, 1,3,8-triazaspiro [4. 5] Decane, azabicyclo [2.2.1] heptane, oxabicyclo [2.2.1] heptane, azabicyclo [3.1.1] heptane, azabicyclo [3.2.1] octane, oxabicyclo [3. 2.1] octane, azabicyclo [2.2.2] octane, diazabicyclo [2.2.2] octane, 2,5-diazabicyclo [2.2.1] heptane ring and the like.

In this specification, examples of the substituent in the “optionally substituted cyclic group” represented by ring A include (1) an optionally substituted alkyl group, and (2) a substituent. An alkenyl group optionally having (3) an alkynyl group optionally having a substituent, (4) a carbocyclic group optionally having a substituent, and (5) a substituent. An optionally substituted heterocyclic group, (6) a hydroxyl group optionally having a protecting group, (7) a mercapto group optionally having a protecting group, and (8) an amino group optionally having a protecting group. (9) an optionally substituted carbamoyl group, (10) an optionally substituted sulfamoyl group, (11) a carboxyl group, (12) an alkoxycarbonyl group (for example, methoxycarbonyl, ethoxy C1-6 alkyl such as carbonyl, tert-butoxycarbonyl and the like Alkoxycarbonyl group, etc.), (13) a sulfo group _(-SO 3 H), (14) sulfino group, (15) phosphono group, (16) a nitro group, (17) cyano group, (18) amidino group, (19 ) Imino group, (20) -B (OH) ₂ group, (21) halogen atom (for example, fluorine, chlorine, bromine, iodine, etc.), (22) alkylsulfinyl group (for example, C1 such as methylsulfinyl, ethylsulfinyl, etc.) -6 alkylsulfinyl groups, etc.), (23) aromatic sulfinyl groups (eg, C6-10 aromatic ring sulfinyl groups such as phenylsulfinyl), (24) alkylsulfonyl groups (eg, C1- 6 alkylsulfonyl group, etc.), (25) aromatic ring sulfonyl group (for example, C6-10 aromatic ring sulfo group such as phenylsulfonyl) Nyl group etc.), (26) oxo group, (27) thioxo group, (28) (C1-6 alkoxyimino) methyl group (eg (methoxyimino) methyl group etc.), (29) acyl group, (30) formyl A group, (31) an alkyl group substituted with a hydroxyl group optionally having a protecting group, (32) an alkyl group substituted with a mercapto group optionally having a protecting group, and (33) having a protecting group. And an alkyl group substituted with an amino group which may optionally be substituted, (34) (alkyl which may have a substituent) oxycarbonyl group and the like. Or 5 may be substituted.

  Examples of the alkyl group in “(1) an optionally substituted alkyl group” as a substituent include, for example, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl. And linear or branched C1-6 alkyl groups such as pentyl and hexyl groups. Here, examples of the substituent of the alkyl group include a hydroxyl group, a mercapto group, an amino group, a carboxyl group, a nitro group, a cyano group, a mono- or di-C1-6 alkylamino group (for example, methylamino, ethylamino, propylamino, Dimethylamino, diethylamino, etc.), N-aromatic ring amino group (eg, N-phenylamino group), N-aromatic ring-N-alkylamino group (eg, N-phenyl-N-methylamino group, N-phenyl-N) -Ethylamino group, N-phenyl-N-propylamino group, N-phenyl-N-butylamino group, N-phenyl-N-pentylamino group, N-phenyl-N-hexylamino group, etc.), acylamino group, N-acyl-N-alkylamino group, C1-6 alkoxy group (for example, methoxy, ethoxy, propoxy, isopropoxy Hexyloxy etc.), C3-7 cycloalkyl-C1-6 alkoxy group (eg cyclohexylmethyloxy group, cyclopentylethyloxy group etc.), C3-7 cycloalkyloxy group (eg cyclohexyloxy group etc.), C7-15 aralkyloxy. Groups (for example, benzyloxy, phenethyloxy, phenylpropyloxy, naphthylmethyloxy, naphthylethyloxy, etc.), phenoxy groups, C1-6 alkoxycarbonyl groups (for example, methoxycarbonyl, ethoxycarbonyl, tert-butoxycarbonyl, etc.), C1- 6 alkylcarbonyloxy groups (eg acetoxy, ethylcarbonyloxy etc.), C 1-6 alkylthio groups (eg methylthio, ethylthio, propylthio, butylthio etc.), halogen atoms (eg fluorine , Chlorine, bromine, iodine, etc.), alkylsulfonyl groups (eg, C1-4 alkylsulfonyl groups such as methylsulfonyl, ethylsulfonyl, etc.), aromatic ring sulfonyl groups (eg, C6-10 aromatic ring sulfonyl groups such as phenylsulfonyl, etc.) ), An optionally substituted carbamoyl group (for example, unsubstituted carbamoyl group, N-mono-C 1-6 alkylcarbamoyl (for example, N-methylcarbamoyl, N-ethylcarbamoyl, N-propylcarbamoyl, N- Isopropylcarbamoyl, N-butylcarbamoyl, etc.), N, N-diC1-6 alkylcarbamoyl (for example, N, N-dimethylcarbamoyl, N, N-diethylcarbamoyl, N, N-dipropylcarbamoyl, N, N-dibuty) Rucarbamoyl, etc.), piperidin-1-ylcarbonyl Group), an acyl group, a carbocyclic group which may have a substituent, a heterocyclic group which may have a substituent, and the like. 1 to 4 may be substituted. Here, as the alkyl group in the N-acyl-N-alkylamino group, for example, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl, hexyl groups, etc. Examples thereof include a linear or branched C1-6 alkyl group. The acyl group in the acylamino group and the N-acyl-N-alkylamino group has the same meaning as “(29) acyl group” as a substituent described later. Further, the carbocyclic group which may have a substituent and the heterocyclic group which may have a substituent are described later in “(4) carbocyclic group which may have a substituent”, And “(5) heterocyclic group optionally having substituent (s)”.

  Examples of the alkenyl group in the “(2) optionally substituted alkenyl group” as a substituent include linear or branched C 2-6 alkenyl such as ethenyl, propenyl, butenyl, pentenyl, hexenyl and the like. Groups and the like. Here, the substituent of the alkenyl group has the same meaning as the substituent in “(1) an alkyl group which may have a substituent” as the substituent.

  Examples of the alkynyl group in the “(3) optionally substituted alkynyl group” as a substituent include linear or branched C 2-6 alkynyl such as ethynyl, propynyl, butynyl, pentynyl, hexynyl and the like. Groups and the like. Here, the substituent of the alkynyl group has the same meaning as the substituent in “(1) an alkyl group which may have a substituent” as the substituent.

  The carbocyclic group in “(4) optionally substituted carbocyclic group” as the substituent is the “cyclic group” in the “optionally substituted cyclic group” represented by ring A above. The same meaning as the carbocyclic ring in Here, as the substituent of the carbocyclic group, for example, a linear or branched C1-6 alkyl group optionally substituted with a hydroxyl group (for example, methyl, ethyl, n-propyl, isopropyl, n-butyl, Isobutyl, sec-butyl, tert-butyl, pentyl, hexyl group, etc.), linear or branched C2-6 alkenyl group (eg ethenyl, propenyl, butenyl, pentenyl, hexenyl, etc.), linear or branched chain C2-6 alkynyl group (for example, ethynyl, propynyl, butynyl, pentynyl, hexynyl, etc.), hydroxyl group, linear or branched C1-6 alkoxy group (for example, methoxy, ethoxy, propoxy, isopropoxy, butoxy, Isobutyloxy, tert-butoxy, pentyloxy, hexyloxy, etc.), mercapto A linear or branched C1-6 alkylthio group (for example, methylthio, ethylthio, propylthio, isopropylthio, butylthio, isobutylthio, tert-butylthio, pentylthio, hexylthio, etc.), amino group, mono- or di-C1 -6 alkylamino groups (eg methylamino, ethylamino, propylamino, isopropylamino, butylamino, isobutylamino, tert-butylamino, pentylamino, hexylamino, dimethylamino, diethylamino, dipropylamino, N-methyl-N -Ethylamino etc.), halogen atom (eg fluorine, chlorine, bromine, iodine etc.), cyano group, nitro group, carboxyl group, linear or branched C1-6 alkoxycarbonyl group (eg methoxycarbonyl, ethoxy) Carbonyl, tert-butoxycarbonyl etc.), trihalomethyl group (eg trifluoromethyl etc.), trihalomethoxy group (eg trifluoromethoxy etc.), trihalomethylthio group (eg trifluoromethylthio etc.), dihalomethylthio group (eg difluoromethylthio) Etc.), a cyano group, a nitro group, an oxo group, a carbocyclic ring (which has the same meaning as the carbocyclic ring in the “cyclic group” in the “cyclic group optionally having substituents” represented by the ring A), A heterocyclic ring (having the same meaning as the heterocyclic ring in the “cyclic group” in the “cyclic group optionally having substituents” represented by the ring A), etc., and these optional substituents are substituted 1 to 4 may be substituted at possible positions.

  The heterocyclic group in “(5) optionally substituted heterocyclic group” as a substituent is the “cyclic group” in the “optionally substituted cyclic group” represented by ring A above. The same meaning as the heterocyclic ring in Here, the substituent of the heterocyclic group has the same meaning as the substituent in the “(4) optionally substituted carbocyclic group”.

  “(6) hydroxyl group optionally having protecting group”, “(7) mercapto group optionally having protecting group” and “(8) protecting group as a substituent” Examples of the protecting group in the “amino group” include an alkyl group which may have a substituent (having the same meaning as the above-mentioned “(1) alkyl group which may have a substituent”), a substituent. An alkenyl group which may have (which has the same meaning as the above-mentioned “(2) alkenyl group which may have a substituent”), an alkynyl group which may have a substituent (the above “(3 ) Represents the same meaning as “optionally substituted alkynyl group”), optionally substituted carbocyclic group (the above-mentioned “(4) optionally substituted carbocyclic ring”). The same meaning as “group”), a heterocyclic group optionally having a substituent (the above-mentioned “(5) substitution”). And a heterocyclic group optionally having an alkyl group), an alkylsulfonyl group (for example, a C1-4 alkylsulfonyl group such as methylsulfonyl or ethylsulfonyl), an aromatic ring sulfonyl group (for example, phenylsulfonyl). C6-10 aromatic ring sulfonyl group and the like), acyl group (which has the same meaning as “(29) acyl group” described later), and (optionally substituted alkyl) oxycarbonyl group (described later). “(34) (which may have a substituent, an alkyl) oxycarbonyl group” has the same meaning).

  Examples of the “(9) optionally substituted carbamoyl group” as a substituent include an unsubstituted carbamoyl group, N-mono-C 1-6 alkylcarbamoyl (eg, N-methylcarbamoyl, N-ethyl). Carbamoyl, N-propylcarbamoyl, N-isopropylcarbamoyl, N-butylcarbamoyl, etc.), N, N-diC1-6 alkylcarbamoyl (for example, N, N-dimethylcarbamoyl, N, N-diethylcarbamoyl, N, N- Dipropylcarbamoyl, N, N-dibutylcarbamoyl, etc.), piperidin-1-ylcarbonyl group and the like.

  Examples of the “(10) optionally substituted sulfamoyl group” as the substituent include an unsubstituted sulfamoyl group, N-mono-C 1-6 alkylsulfamoyl (for example, N-methylsulfamoyl). N-ethylsulfamoyl, N-propylsulfamoyl, N-isopropylsulfamoyl, N-butylsulfamoyl, etc.), N, N-diC1-6 alkylsulfamoyl (for example, N, N- Dimethylsulfamoyl, N, N-diethylsulfamoyl, N, N-dipropylsulfamoyl, N, N-dibutylsulfamoyl, etc.).

  As the “(29) acyl group” as a substituent, for example, an alkylcarbonyl group which may have a substituent (in the group, an alkyl which may have a substituent represents the above-mentioned “(1) substituent”. The same meaning as “optionally substituted alkyl group” represents an alkenylcarbonyl group which may have a substituent (in the group, the alkenyl which may have a substituent is the above-mentioned “(2) substitution”). The same meaning as “optionally substituted alkenyl group” and an optionally substituted alkynylcarbonyl group (in which the optionally substituted alkynyl is the above-mentioned “(3 ) Represents an alkynyl group optionally having substituent (s)), and a carbocyclic carbonyl group optionally having substituent (s). “(4) optionally substituted carbocyclic group” and A heterocyclic carbonyl group which may have a substituent (in the group, the heterocyclic ring which may have a substituent may have the above-mentioned (5) substituent). And the same meaning as “heterocyclic group”.

  The hydroxyl group optionally having a protecting group in the “(31) alkyl group substituted with a hydroxyl group optionally having a protecting group” as a substituent has the above-mentioned “(6) protecting group”. The mercapto group optionally having a protecting group in “(32) an alkyl group substituted with a mercapto group optionally having a protecting group” has the same meaning as “may be a hydroxyl group”. ) Represents a mercapto group optionally having a protecting group ", and may have a protecting group in" (33) an alkyl group substituted with an amino group optionally having a protecting group ". A good amino group has the same meaning as the above “(8) amino group optionally having a protecting group”. Further, “(31) an alkyl group substituted with a hydroxyl group optionally having a protecting group”, “(32) an alkyl group substituted with a mercapto group optionally having a protecting group” and “(33 Examples of the alkyl group in “) an alkyl group substituted with an amino group optionally having a protecting group” include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, Examples thereof include linear or branched C1-6 alkyl groups such as pentyl and hexyl groups.

  The alkyl which may have a substituent in “(34) (alkyl which may have a substituent) oxycarbonyl group” as a substituent may have the above-mentioned “(1) substituent”. It represents the same meaning as “good alkyl group”.

  Examples of the C5-10 monocyclic carbocycle in the “optionally substituted C5-10 monocyclic carbocycle” represented by ring B include, for example, C5-10 monocyclic aromatic carbon Examples thereof include a ring and a carbocyclic ring in which part or all of the ring is saturated. Examples of the C5-10 monocyclic aromatic carbocyclic ring and a carbocyclic ring in which part or all thereof are saturated include, for example, cyclopentane, cyclohexane, cycloheptane, cyclooctane, cyclononane, cyclodecane, cyclopentene, cyclohexene, Examples include cycloheptene, cyclooctene, cyclopentadiene, cyclohexadiene, cycloheptadiene, cyclooctadiene, and benzene.

  The “spacer comprising a ring formed of 3-20 atoms selected from carbon atom, oxygen atom, sulfur atom and nitrogen atom” represented by ring S is, for example, a position where X and Y are as shown below The ring concerned is preferred.

  Examples of the “spacer consisting of a ring formed of 3-20 atoms selected from carbon atom, oxygen atom, sulfur atom and nitrogen atom” represented by ring S include:

(Wherein all symbols have the same meanings as described above).

  Examples of the C5-10 monocyclic carbocycle in the "optionally substituted C5-10 monocyclic carbocycle" represented by ring B include, for example, C5-10 monocyclic aromatic carbon Examples thereof include a ring and a carbocyclic ring in which part or all of the ring is saturated. Examples of the C5-10 monocyclic aromatic carbocyclic ring and a carbocyclic ring that is partially or fully saturated include, for example, cyclopentane, cyclohexane, cycloheptane, cyclooctane, cyclononane, cyclodecane, cyclopentene, cyclohexene, Examples include cycloheptene, cyclooctene, cyclopentadiene, cyclohexadiene, cycloheptadiene, cyclooctadiene, and benzene.

  The substituent in the “optionally substituted C 5-10 monocyclic carbocycle” represented by ring B is the same as the “optionally substituted cyclic group” represented by ring A above. It represents the same meaning as the substituent, and these optional substituents may be substituted 1-3 at substitutable positions.

  Examples of the 5- to 10-membered monocyclic heterocycle in the “optionally substituted 5- to 10-membered monocyclic heterocycle” represented by ring B include an oxygen atom, a nitrogen atom, and a sulfur atom. Examples thereof include 5 to 10-membered monocyclic aromatic heterocycles containing 1 to 3 selected heteroatoms, which may be partially or fully saturated. Examples of the 5- to 10-membered monocyclic aromatic heterocycle containing 1 to 3 heteroatoms selected from the oxygen, nitrogen and sulfur atoms, which may be partially or fully saturated, For example, pyrrole, pyrazole, pyridine, pyrimidine, pyridazine, azepine, diazepine, furan, pyran, oxepin, thiophene, thiopyran, thiepine, isoxazole, isothiazole, oxazine, oxadiazine, oxazepine, oxadiazepine, thiazine, thiazepine, pyrroline, pyrrolidine, pyrazoline , Pyrazolidine, dihydropyridine, tetrahydropyridine, dihydropyrimidine, tetrahydropyrimidine, perhydropyrimidine, dihydropyridazine, tetrahydropyridazine, perhydropyridazine, dihydroazepine, tetrahydro Zepin, Perhydroazepine, Dihydrodiazepine, Tetrahydrodiazepine, Perhydrodiazepine, Dihydrofuran, Tetrahydrofuran, Dihydropyran, Tetrahydropyran, Dihydrooxepin, Tetrahydrooxepin, Perhydrooxepin, Dihydrothiophene, Tetrahydro Thiophene, dihydrothiopyran, tetrahydrothiopyran, dihydrothiepine, tetrahydrothiepine, perhydrothiepin, dihydroisoxazole, tetrahydroisoxazole (isoxazolidine), dihydroisothiazole, tetrahydroisothiazole (isothiazolidine), dihydrooxazine, Tetrahydrooxazine, dihydrooxazepine, tetrahydrooxazepine, perhydrooxazepine, dihydrothiazine, Tiger hydro thiazine, dihydrothienyl azepine, tetrahydrothienyl azepine, perhydro thiazepine and the like.

  The substituent in the “optionally substituted 5-10-membered monocyclic heterocycle” represented by ring B is the “optionally substituted cyclic group” represented by ring A above. It represents the same meaning as the substituent in, and these optional substituents may be substituted by 1 to 3 at substitutable positions.

  The “optionally substituted C5-10 monocyclic carbocycle” represented by ring C is the C5-10 monocyclic carbocycle optionally substituted by the aforementioned ring B. Means the same as

  Examples of the 5- to 10-membered monocyclic heterocycle in the “optionally substituted 5- to 10-membered monocyclic heterocycle” represented by ring C include an oxygen atom, a nitrogen atom and a sulfur atom. Examples thereof include 5 to 10-membered monocyclic aromatic heterocycles containing 1 to 3 selected heteroatoms, which may be partially or fully saturated. Examples of the 5- to 10-membered monocyclic aromatic heterocycle containing 1 to 3 heteroatoms selected from the oxygen, nitrogen and sulfur atoms, which may be partially or fully saturated, For example, pyrrole, imidazole, triazole, pyrazole, pyridine, pyrazine, pyrimidine, pyridazine, azepine, diazepine, furan, pyran, oxepin, thiophene, thiopyran, thiepine, oxazole, isoxazole, thiazole, isothiazole, furazane, oxazine, oxazepine, oxadiazepine , Thiazine, thiazepine, thiadiazepine, pyrroline, pyrrolidine, imidazoline, imidazolidine, triazoline, triazolidine, pyrazoline, pyrazolidine, dihydropyridine, tetrahydropyridine, piperidine, dihydropyrazine Tetrahydropyrazine, piperazine, dihydropyrimidine, tetrahydropyrimidine, perhydropyrimidine, dihydropyridazine, tetrahydropyridazine, perhydropyridazine, dihydroazepine, tetrahydroazepine, perhydroazepine, dihydrodiazepine, tetrahydrodiazepine, perhydrodiazepine, dihydrofuran , Tetrahydrofuran, dihydropyran, tetrahydropyran, dihydrooxepin, tetrahydrooxepin, perhydrooxepin, dihydrothiophene, tetrahydrothiophene, dihydrothiopyran, tetrahydrothiopyran, dihydrothiepine, tetrahydrothiepine, perhydrothie Pin, dihydrooxazole, tetrahydrooxazole (oxazolidine), dihydroisoxazo , Tetrahydroisoxazole (isoxazolidine), dihydrothiazole, tetrahydrothiazole (thiazolidine), dihydroisothiazole, tetrahydroisothiazole (isothiazolidine), dihydrofurazan, tetrahydrofurazan, dihydrooxazine, tetrahydrooxazine, dihydrooxazepine, tetrahydro Oxazepine, perhydrooxazepine, dihydrooxadiazepine, tetrahydrooxadiazepine, perhydrooxadiazepine, dihydrothiazine, tetrahydrothiazine, dihydrothiazepine, tetrahydrothiazepine, perhydrothiazepine, dihydrothiadi Azepine, tetrahydrothiadiazepine, perhydrothiadiazepine, morpholine, thiomorpholine, oxathiane, dioxolane , Dioxane, dithiolane, dithiane and the like.

  The substituent in the “optionally substituted 5-10-membered monocyclic heterocycle” represented by ring C is the “optionally substituted cyclic group” represented by ring A above. It represents the same meaning as the substituent in, and these optional substituents may be substituted by 1 to 3 at substitutable positions.

  The “optionally substituted C5-10 monocyclic carbocycle” represented by ring D is the C5-10 monocyclic carbocycle optionally substituted by the aforementioned ring B. Means the same as

  Examples of the 6-10 membered monocyclic heterocycle in the “optionally substituted 6-10 membered monocyclic heterocycle” represented by ring D include, for example, an oxygen atom, a nitrogen atom and a sulfur atom. Examples thereof include 6-10 membered monocyclic aromatic heterocycles, which may be partially or fully saturated, and include 1-2 heteroatoms selected. Examples of the 6-10 membered monocyclic aromatic heterocycle containing 1-2 heteroatoms selected from the oxygen atom, nitrogen atom and sulfur atom, which may be partially or fully saturated, For example, pyridine, azepine, pyran, oxepin, thiopyran, thiepine, dihydropyridine, tetrahydropyridine, piperidine, dihydroazepine, tetrahydroazepine, perhydroazepine, dihydropyran, tetrahydropyran, dihydrooxepin, tetrahydrooxepin, perhydrooxe Pin, dihydrothiopyran, tetrahydrothiopyran, dihydrothiepine, tetrahydrothiepine, perhydrothiepin and the like can be mentioned.

  The substituent in the “optionally substituted 6-10-membered monocyclic heterocycle” represented by ring D is the “optionally substituted cyclic group” represented by ring A above. It represents the same meaning as the substituent in, and these optional substituents may be substituted by 1 to 3 at substitutable positions.

The “spacer having 1 to 8 atoms in the main chain” represented by Y means an interval formed by 1 to 8 consecutive atoms. Here, the “number of main chain atoms” is counted so that the main chain atoms are minimized. Examples of the “spacer having 1 to 8 atoms in the main chain” represented by Y include an optionally substituted C 1-8 alkylene group (for example, methylene, ethylene, propylene, butylene, pentylene, hexylene, heptylene). , Octylene, etc.), an optionally substituted C2-8 alkenylene group (eg, ethenylene, propenylene, butenylene, butadienylene, pentenylene, pentadienylene, hexenylene, hexadienylene, heptenylene, heptadienylene, octenylene, octadiylene, etc.) A C2-8 alkynylene group (for example, ethynylene, propynylene, butynylene, butadiynylene, pentynylene, pentadiinylene, hexynylene, hexadiinylene, heptynylene, heptadinylene, octyne Ylene, include Okutajiiniren etc.) and the like. Here, the carbon atom of the C1-8 alkylene group, C2-8 alkenylene group, and C2-8 alkynylene group is an oxygen atom (—O—) or an optionally oxidized sulfur atom (for example, —S—, —SO—). , —SO ₂ — and the like), a carbonyl group (—CO—) or a nitrogen atom (—NH—) optionally having a substituent (the substituent includes, for example, the above-mentioned “(1) substituent. And an alkyl group that may be substituted. ”May be substituted with 1-3 groups selected from. Here, the “C1-8 alkylene group which may have a substituent”, “C2-8 alkenylene group which may have a substituent” and “C2-8 which may have a substituent”. The substituent in the “alkynylene group” has the same meaning as the substituent in the “cyclic group optionally having substituent (s)” represented by the ring A, and these optional substituents can be substituted at the substitutable positions. Three may be substituted.

The “optionally protected acidic group” represented by Z means an acidic group that may be protected by a protective group. Examples of the acidic group in the “acidic group optionally protected by a protecting group” include a carboxy group (—COOH), a hydroxamic acid group (—CONHOH), an acyl cyanamide group (—CONHCN), and a sulfo group (—SO ₃ H), a sulfonamide group (—SO ₂ NH ₂ or —NR ¹⁰⁰ SO ₃ H (R ¹⁰⁰ includes, for example, a hydrogen atom, an alkyl group which may have a substituent (the above-mentioned “(1) The same meaning as the “optionally substituted alkyl group”), and the same alkenyl group that may have a substituent (the same as “(2) the alkenyl group that may have a substituent”). ), Or an alkynyl group which may have a substituent (the same meaning as the above-mentioned “(3) alkynyl group which may have a substituent”) and the like. Ruhonamide group (—CONHSO ₂ R ¹⁰⁰ or —SO ₂ NHCOR ¹⁰⁰ (R ¹⁰⁰ represents the same meaning as described above)), phosphono group (—P (═O) (OH) ₂ ), phosphinico group (═P ( ═O) OH), amino (hydroxy) phosphoryl group (—P (═O) (OH) (NH ₂ )), phenol group (—C ₆ H ₄ OH) or a heterocycle containing a hydrogen atom that can be deprotonated Examples include various Bronsted acids such as residues, etc. “Bronsted acid” means a substance that gives a hydrogen ion to other substances. “Heterocyclic residue having a hydrogen atom that can be deprotonated” For example, 5-oxo-4,5-dihydro-1,2,4-oxadiazol-3-yl group, 5-oxo-4,5-dihydro-1,3,4-oxadiazole- 2- Yl group, 3-oxo-2,3-dihydro-1,2,4-oxadiazol-5-yl group, 3-methyl-5-oxo-1,5-dihydro-4H-1,2,4- Triazol-4-yl group, 5-oxo-4,5-dihydro-1,2,4-thiadiazol-3-yl group, 5-thioxo-4,5-dihydro-1,2,4-oxadiazole- 3-yl group, 2-oxide-3H-1,2,3,5-oxathiadiazol-4-yl group, 1H-tetrazol-5-yl group, 4H-1,2,4-triazol-3-ylthio group 4H-1,2,4-triazol-3-ylsulfinyl group, 4H-1,2,4-triazol-3-ylsulfonyl group, 3-hydroxyisoxazol-5-yl group, 3-hydroxyisothiazole- 5-yl group, 4-hydro Ci-1,2,5-thiadiazol-3-yl group, 5-hydroxy-4-oxo-4H-pyran-3-yl group, 2,4-dioxo-1,3-thiazolidin-5-yl group, 2 , 4-Dioxo-1,3-oxazolidin-5-yl group, 3,5-dioxoisoxazolidin-4-yl group, 3,5-dioxo-1,2,4-oxadiazolidin-2-yl group Etc.

  As the protecting group in the “acidic group optionally protected by a protecting group”, for example, an alkyl group which may have a substituent (the above-mentioned “(1) alkyl group which may have a substituent”) Represents the same meaning), an alkenyl group which may have a substituent (has the same meaning as the above-mentioned “(2) alkenyl group which may have a substituent”), and has a substituent. An alkynyl group (which has the same meaning as the above-mentioned “(3) alkynyl group optionally having substituents)”, a linear or branched C 1-6 alkyl group (for example, methyl, ethyl , N-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl, hexyl group, etc.), an amino group optionally having a protecting group (the above-mentioned “(8) having a protecting group”) And an amino group that may be Flip meaning.), A 1-piperidinyl group or a 4-morpholinyl group. The “optionally protected acidic group” represented by Z includes, for example, an ester group such as methoxycarbonyl and ethoxycarbonyl, and an amide group such as carbamoyl.

Examples of the sulfur atom which may be oxidized represented by X include —S—, —SO— and —SO ₂ — groups.

The substituent represented by R ¹ has the same meaning as the substituent in the “cyclic group optionally having substituent (s)” represented by the ring A.

The alkyl group which may have a substituent represented by R ² represents the same meaning as the above “(1) alkyl group which may have a substituent”.

  The “spacer having 1 to 8 atoms in the main chain” represented by W means an interval formed by 1 to 8 consecutive atoms. Here, the “number of main chain atoms” is counted so that the main chain atoms are minimized. Examples of the “spacer having 1 to 8 atoms in the main chain” represented by Y include an optionally substituted C 1-8 alkylene group (for example, methylene, ethylene, propylene, butylene, pentylene, hexylene, heptylene). , Octylene, etc.), an optionally substituted C2-8 alkenylene group (eg, ethenylene, propenylene, butenylene, butadienylene, pentenylene, pentadienylene, hexenylene, hexadienylene, heptenylene, heptadienylene, octenylene, octadiylene, etc.) A C2-8 alkynylene group (for example, ethynylene, propynylene, butynylene, butadiynylene, pentynylene, pentadiinylene, hexynylene, hexadiinylene, heptynylene, heptadinylene, octyne Ylene, include Okutajiiniren etc.) and the like. The “optionally substituted C 1-8 alkylene group”, “optionally substituted C 2-8 alkenylene group” and “optionally substituted C 2-8 alkynylene group” The substituent in "represents the same meaning as the substituent in the" cyclic group optionally having substituent (s) "represented by ring A, and 1-3 of these optional substituents are located at substitutable positions. May be substituted.

  The alkyl group which may have a substituent represented by V represents the same meaning as the “(1) alkyl group which may have a substituent”.

  The alkenyl group which may have a substituent represented by V represents the same meaning as the “(2) alkenyl group which may have a substituent”.

  The alkynyl group which may have a substituent represented by V represents the same meaning as the “(3) alkynyl group which may have a substituent”.

  The cyclic group which may have a substituent represented by V has the same meaning as the “cyclic group which may have a substituent” represented by the ring A.

  In the present invention, the compound represented by the general formula (I) does not include a compound which cannot exist in organic chemistry.

  In the present invention, all isomers are included unless otherwise specified. For example, an alkyl group, an alkenyl group, an alkynyl group, an alkoxy group, an alkylthio group, an alkylene group, an alkenylene group, and an alkynylene group include straight-chain and branched-chain groups. Furthermore, isomers (E, Z, cis, trans isomers) in double bonds, rings, condensed rings, isomers due to the presence of asymmetric carbon, etc. (R, S isomers, α, β configuration, enantiomers, diastereomers) , Optically active substances having optical activity (D, L, d, l form), polar bodies (high polar bodies, low polar bodies) by chromatographic separation, equilibrium compounds, rotamers, mixtures of these in any proportions, All racemic mixtures are included in the present invention.

  In this specification, unless otherwise specified, symbols are apparent as will be apparent to those skilled in the art.

Represents binding to the other side of the page (ie α-configuration),

Represents binding to the near side of the page (ie β-configuration),

Represents α-configuration, β-configuration or a mixture thereof,

Represents a mixture of α-configuration and β-configuration.

  Salts of the compounds represented by the general formula (I) include all pharmacologically acceptable salts. The pharmacologically acceptable salt is preferably non-toxic and water-soluble. Suitable salts include, for example, salts of alkali metals (potassium, sodium, lithium, etc.), salts of alkaline earth metals (calcium, magnesium, etc.), ammonium salts (tetramethylammonium salt, tetrabutylammonium salt, etc.), organic amines (Triethylamine, methylamine, dimethylamine, cyclopentylamine, benzylamine, phenethylamine, piperidine, monoethanolamine, diethanolamine, tris (hydroxymethyl) methylamine, lysine, arginine, N-methyl-D-glucamine, etc.) salt, acid Adduct salts (inorganic acid salts (hydrochloride, hydrobromide, hydroiodide, sulfate, phosphate, nitrate, etc.), organic acid salts (acetate, trifluoroacetate, lactate, tartaric acid) Salt, oxalate, fumarate, maleate, benzoate Citrate, methanesulfonate, ethanesulfonate, benzenesulfonate, toluenesulfonate, isethionate, glucuronate, gluconate, etc.), etc.). The salt of the compound of the present invention includes a solvate or a solvate of an alkali (earth) metal salt, ammonium salt, organic amine salt or acid adduct salt of the compound of the present invention. The solvate is preferably non-toxic and water-soluble. Suitable solvates include, for example, solvates such as water and alcohol solvents (ethanol etc.). The compound of the present invention is converted into a pharmacologically acceptable salt by a known method.

Further, the salt includes a quaternary ammonium salt. The quaternary ammonium salts, nitrogen atoms of the compound represented by formula (I), R ⁰ group (R ⁰ group represents a C1-8 alkyl group substituted C1-8 alkyl group, by a phenyl group. ) Represents a quaternized product.

  The salt also includes an N-oxide form. The compound of the present invention can be converted to N-oxide by any method. The N-oxide form represents a compound in which the nitrogen atom of the compound represented by the general formula (I) is oxidized.

The prodrug of the compound represented by the general formula (I) refers to a compound that is converted into a compound represented by the general formula (I) by a reaction with an enzyme, gastric acid or the like in a living body. As a prodrug of the compound represented by the general formula (I), for example, when the compound represented by the general formula (I) has an amino group, the compound in which the amino group is acylated, alkylated or phosphorylated (for example, The amino group of the compound represented by the general formula (I) is eicosanoylated, alanylated, pentylaminocarbonylated, (5-methyl-2-oxo-1,3-dioxolen-4-yl) methoxycarbonylated, tetrahydrofuranylated. , Pyrrolidylmethylated, pivaloyloxymethylated, acetoxymethylated, tert-butylated compounds, etc.); when the compound represented by the general formula (I) has a hydroxyl group, the hydroxyl group is acylated or alkylated , Phosphorylated and borated compounds (for example, the hydroxyl group of the compound represented by the general formula (I) is acetylated, palmitoylated, Ropanoylated, pivaloylated, succinylated, fumarylated, alanylated, dimethylaminomethylcarbonylated compounds, etc.); when the compound represented by the general formula (I) has a carboxy group, the carboxy group is esterified, amide (For example, the carboxy group of the compound represented by the general formula (I) is converted into ethyl ester, phenyl ester, carboxymethyl ester, dimethylaminomethyl ester, pivaloyloxymethyl ester, ethoxycarbonyloxy Ethyl esterification, phthalidyl esterification, (5-methyl-2-oxo-1,3-dioxolen-4-yl) methyl esterification, cyclohexyloxycarbonylethyl esterification, methylamidated compounds, and the like). . These compounds can be produced by a method known per se. The prodrug of the compound represented by the general formula (I) may be either a hydrate or a non-hydrate. In addition, the prodrug of the compound represented by the general formula (I) has a general formula under physiological conditions as described in Yodogawa Shoten 1990, “Drug Development”, Vol. 7, “Molecular Design”, pages 163-198. It may be changed to the compound represented by (I). Furthermore, the compound represented by the general formula (I) may be labeled with an isotope (for example, ³ H, ¹⁴ C, ³⁵ S, ¹²⁵ I and the like).

  The PPAR agonist / antagonists of the present invention include all modes of action, ie PPARα, γ, δ, α + γ, α + δ, γ + δ and α + γ + δ agonists / antagonists. The preferred mode of action of the present invention is a PPARα agonist, PPARγ agonist or PPARα + γ agonist.

In the compound represented by the general formula (I) of the present invention, each definition represented by ring A, ring B, ring C, ring D, V, W, X, Y, Z and R ¹ is preferable. Preferred groups and preferred rings are listed below, but all symbols used herein have the same meaning as described above.

  The carbocycle represented by ring A is preferably a C3-10 monocyclic or bicyclic aromatic carbocyclic ring and a carbocyclic ring in which a part or all thereof is saturated, and more preferably a C5-7 single carbocyclic ring. A cyclic aromatic carbocyclic ring and a carbocyclic ring in which a part or all thereof is saturated, more preferably a benzene ring.

  The heterocyclic ring represented by ring A is preferably a 3- to 10-membered single atom which may be partially or fully saturated, containing 1-3 heteroatoms selected from an oxygen atom, a nitrogen atom and a sulfur atom. A ring or a bicyclic aromatic heterocyclic ring, more preferably a part or all of which may contain 1 to 2 heteroatoms selected from an oxygen atom, a nitrogen atom and a sulfur atom, and may be saturated 5 It is a -7-membered monocyclic aromatic heterocycle, and more preferably an oxazole, thiazole or pyridine ring.

  As ring A which may have a substituent,

(In the group, R ¹⁰¹ represents the same meaning as R ^1, and n represents an integer of 1-4).

  The spacer represented by ring S is preferably

(In the group, the left arrow is bonded to X and the right arrow is bonded to Y).

  V is preferably an alkyl group which may have a substituent, or a cyclic group which may have a substituent, and more preferably a cyclic group which may have a substituent. The cyclic group which may have a substituent is preferably a C3-10 monocyclic or bicyclic aromatic carbocyclic ring and a carbocyclic ring in which a part or all thereof is saturated, an oxygen atom, nitrogen A 3- to 10-membered monocyclic or bicyclic aromatic heterocyclic ring, which may be partially or fully saturated, containing 1-3 heteroatoms selected from atoms and sulfur atoms, and more preferably Includes a C5-7 monocyclic aromatic carbocyclic ring and a carbocyclic ring in which part or all thereof is saturated, or 1-2 heteroatoms selected from an oxygen atom, a nitrogen atom and a sulfur atom, 5-7 membered monocyclic aromatic heterocyclic ring which may be partially or fully saturated, more preferably benzene, pyridine, tetrahydropyridine, piperidine, piperazine, thiomorpholine, morpholine, pyra Lumpur, pyrazine, 1,3-benzodioxole ring.

W is preferably a C1-5 alkylene group which may have a substituent, or a C2-5 alkynylene group which may have a substituent, more preferably a C1-5 alkylene group, preferably, a methylene group is (-CH ₂ -) or ethylene group _{(- - (CH 2) 2} ).

  X is preferably an oxygen atom, an optionally oxidized sulfur atom, or a —NH— group, and more preferably an oxygen atom (—O—) or a sulfur atom (—S—).

Y is preferably a bond. Further, the spacer having 1 to 8 atoms in the main chain represented by Y is preferably a spacer having 1 to 5 atoms in the main chain, and more preferably a C1-5 alkylene group which may have a substituent. , An optionally substituted C2-5 alkenylene group, or an optionally substituted C2-5 alkynylene group, more preferably a C1-5 alkylene group, and particularly preferably methylene. It is a group (—CH ₂ —) or an ethylene group (— (CH ₂ ) ₂ —).

  Z is preferably a carboxy group (—COOH group), an alkoxycarbonyl group (for example, C1-8 alkoxycarbonyl group such as methoxycarbonyl, ethoxycarbonyl, tert-butoxycarbonyl, etc.), 1H-tetrazol-5-yl group, or A 2,4-dioxo-1,3-thiazolidin-5-yl group, more preferably a carboxy group.

  In the present invention, the compounds of the general formula (I) containing the preferred groups and preferred ring combinations listed above are preferred.

Specific preferred compounds of the present invention include, for example, the following compounds 1) -91), the compounds described in the examples, salts thereof, N-oxides thereof, solvates thereof, Drug etc. are mentioned.
1) (3Z) -3- [5- [2- (5-Methyl-2-phenyl-1,3-oxazol-4-yl) ethoxy] -3,4-dihydronaphthalene-1 (2H) -ylidene] Propanoic acid, 2) (3Z) -3- [5- {2- [2- (4-fluorophenyl) -5-methyl-1,3-oxazol-4-yl] ethoxy} -3,4-dihydronaphthalene -1 (2H) -ylidene] propanoic acid, 3) (3Z) -3- [5- {2- [2- (4-ethylphenyl) -5-methyl-1,3-oxazol-4-yl] ethoxy } -3,4-dihydronaphthalene-1 (2H) -ylidene] propanoic acid, 4) (3Z) -3- [5- (2- {5-methyl-2- [4- (methylsulfanyl) phenyl]- 1,3-oxazol-4-yl} ethoxy) -3,4-dihi Lonaphthalene-1 (2H) -ylidene] propanoic acid, 5) (3Z) -3- [5- {2- [2- (1,3-benzodioxol-5-yl) -5-methyl-1 , 3-Oxazol-4-yl] ethoxy} -3,4-dihydronaphthalene-1 (2H) -ylidene] propanoic acid, 6) (3Z) -3- [5- {2- [2- (4-isopropyl) Phenyl) -5-methyl-1,3-oxazol-4-yl] ethoxy} -3,4-dihydronaphthalene-1 (2H) -ylidene] propanoic acid, 7) (3Z) -3- [5- (2 -{5-methyl-2- [4- (trifluoromethyl) phenyl] -1,3-oxazol-4-yl} ethoxy) -3,4-dihydronaphthalene-1 (2H) -ylidene] propanoic acid, 8 ) (3Z) -3- [5- {2- [2- (4- ert-butylphenyl) -5-methyl-1,3-oxazol-4-yl] ethoxy} -3,4-dihydronaphthalene-1 (2H) -ylidene] propanoic acid, 9) (3Z) -3- [5 -(2- {2- [4- (dimethylamino) phenyl] -5-methyl-1,3-oxazol-4-yl} ethoxy) -3,4-dihydronaphthalene-1 (2H) -ylidene] propanoic acid 10) (3Z) -3- [5- (2- {2- [6- (Dimethylamino) pyridin-3-yl] -5-methyl-1,3-oxazol-4-yl} ethoxy) -3 , 4-Dihydronaphthalene-1 (2H) -ylidene] propanoic acid, 11) (3Z) -3- [5- (2- {2- [6- (diethylamino) pyridin-3-yl] -5-methyl- 1,3-oxazol-4-yl} Toxi) -3,4-dihydronaphthalene-1 (2H) -ylidene] propanoic acid, 12) (3Z) -3- [5- {2- [5-methyl-2- (6-morpholin-4-ylpyridine-] 3-yl) -1,3-oxazol-4-yl] ethoxy} -3,4-dihydronaphthalene-1 (2H) -ylidene] propanoic acid, 13) (3Z) -3- [5- {2- [ 5-methyl-2- (6-piperidin-1-ylpyridin-3-yl) -1,3-oxazol-4-yl] ethoxy} -3,4-dihydronaphthalene-1 (2H) -ylidene] propanoic acid, 14) (3Z) -3- [5- {2- [2- (6-Azepan-1-ylpyridin-3-yl) -5-methyl-1,3-oxazol-4-yl] ethoxy} -3, 4-Dihydronaphthalene-1 (2H) -ylide ] Propanoic acid, 15) (3Z) -3- [5- {2- [2- (4-cyclohexylphenyl) -5-methyl-1,3-oxazol-4-yl] ethoxy} -3,4-dihydro Naphthalene-1 (2H) -ylidene] propanoic acid, 16) (3Z) -3- [5- [2- (5-methyl-2-piperidin-1-yl-1,3-thiazol-4-yl) ethoxy ] -3,4-dihydronaphthalene-1 (2H) -ylidene] propanoic acid, 17) (3Z) -3- [2-methyl-5- [2- (5-methyl-2-phenyl-1,3- Oxazol-4-yl) ethoxy] -3,4-dihydronaphthalene-1 (2H) -ylidene] propanoic acid, 18) (3Z) -3- [2-methyl-5- {2- [5-methyl-2 -(4-Methylphenyl) -1,3-oxazole- -Yl] ethoxy} -3,4-dihydronaphthalene-1 (2H) -ylidene] propanoic acid, 19) (3Z) -3- [5- {2- [2- (4-fluorophenyl) -5-methyl -1,3-oxazol-4-yl] ethoxy} -2-methyl-3,4-dihydronaphthalene-1 (2H) -ylidene] propanoic acid, 20) (3Z) -3- [5- {2- [ 2- (4-Ethylphenyl) -5-methyl-1,3-oxazol-4-yl] ethoxy} -2-methyl-3,4-dihydronaphthalene-1 (2H) -ylidene] propanoic acid, 21) ( 3Z) -3- [2-Methyl-5- (2- {5-methyl-2- [4- (methylsulfanyl) phenyl] -1,3-oxazol-4-yl} ethoxy) -3,4-dihydro Naphthalene-1 (2H) -ylidene] Lopanic acid, 22) (3Z) -3- [5- {2- [2- (1,3-benzodioxol-5-yl) -5-methyl-1,3-oxazol-4-yl] ethoxy } -2-Methyl-3,4-dihydronaphthalene-1 (2H) -ylidene] propanoic acid, 23) (3Z) -3- [5- {2- [2- (4-isopropylphenyl) -5-methyl -1,3-oxazol-4-yl] ethoxy} -2-methyl-3,4-dihydronaphthalene-1 (2H) -ylidene] propanoic acid, 24) (3Z) -3- [2-methyl-5 (2- {5-Methyl-2- [4- (trifluoromethyl) phenyl] -1,3-oxazol-4-yl} ethoxy) -3,4-dihydronaphthalene-1 (2H) -ylidene] propanoic acid 25) (3Z) -3- [5- {2- [2- ( -Tert-butylphenyl) -5-methyl-1,3-oxazol-4-yl] ethoxy} -2-methyl-3,4-dihydronaphthalene-1 (2H) -ylidene] propanoic acid, 26) (3Z) -3- [5- (2- {2- [4- (dimethylamino) phenyl] -5-methyl-1,3-oxazol-4-yl} ethoxy) -2-methyl-3,4-dihydronaphthalene- 1 (2H) -ylidene] propanoic acid, 27) (3Z) -3- [5- (2- {2- [6- (dimethylamino) pyridin-3-yl] -5-methyl-1,3-oxazole -4-yl} ethoxy) -2-methyl-3,4-dihydronaphthalene-1 (2H) -ylidene] propanoic acid, 28) (3Z) -3- [5- (2- {2- [6- ( Diethylamino) pyridin-3-yl] -5 Methyl-1,3-oxazol-4-yl} ethoxy) -2-methyl-3,4-dihydronaphthalene-1 (2H) -ylidene] propanoic acid, 29) (3Z) -3- [2-methyl-5 -{2- [5-Methyl-2- (6-morpholin-4-ylpyridin-3-yl) -1,3-oxazol-4-yl] ethoxy} -3,4-dihydronaphthalene-1 (2H)- Iridene] propanoic acid, 30) (3Z) -3- [2-methyl-5- {2- [5-methyl-2- (6-piperidin-1-ylpyridin-3-yl) -1,3-oxazole- 4-yl] ethoxy} -3,4-dihydronaphthalene-1 (2H) -ylidene] propanoic acid, 31) (3Z) -3- [5- {2- [2- (6-azepan-1-ylpyridine-] 3-yl) -5-methyl-1,3-oxy Sazol-4-yl] ethoxy} -2-methyl-3,4-dihydronaphthalene-1 (2H) -ylidene] propanoic acid, 32) (3Z) -3- [5- {2- [2- (4- (Cyclohexylphenyl) -5-methyl-1,3-oxazol-4-yl] ethoxy} -2-methyl-3,4-dihydronaphthalene-1 (2H) -ylidene] propanoic acid, 33) (3Z) -3- [2-Methyl-5- [2- (5-methyl-2-piperidin-1-yl-1,3-thiazol-4-yl) ethoxy] -3,4-dihydronaphthalene-1 (2H) -ylidene] Propanoic acid, 34) (3Z) -3- [2,2-dimethyl-5- [2- (5-methyl-2-phenyl-1,3-oxazol-4-yl) ethoxy] -3,4-dihydro Naphthalene-1 (2H) -ylidene] Lopanic acid, 35) (3Z) -3- [2,2-dimethyl-5- {2- [5-methyl-2- (4-methylphenyl) -1,3-oxazol-4-yl] ethoxy}- 3,4-dihydronaphthalene-1 (2H) -ylidene] propanoic acid, 36) (3Z) -3- [5- {2- [2- (4-fluorophenyl) -5-methyl-1,3-oxazole -4-yl] ethoxy} -2,2-dimethyl-3,4-dihydronaphthalene-1 (2H) -ylidene] propanoic acid, 37) (3Z) -3- [5- {2- [2- (4 -Ethylphenyl) -5-methyl-1,3-oxazol-4-yl] ethoxy} -2,2-dimethyl-3,4-dihydronaphthalene-1 (2H) -ylidene] propanoic acid, 38) (3Z) -3- [2,2-dimethyl-5- (2- {5-mes Ru-2- [4- (methylsulfanyl) phenyl] -1,3-oxazol-4-yl} ethoxy) -3,4-dihydronaphthalene-1 (2H) -ylidene] propanoic acid, 39) (3Z)- 3- [5- {2- [2- (1,3-benzodioxol-5-yl) -5-methyl-1,3-oxazol-4-yl] ethoxy} -2,2-dimethyl-3 , 4-Dihydronaphthalene-1 (2H) -ylidene] propanoic acid, 40) (3Z) -3- [5- {2- [2- (4-isopropylphenyl) -5-methyl-1,3-oxazole- 4-yl] ethoxy} -2,2-dimethyl-3,4-dihydronaphthalene-1 (2H) -ylidene] propanoic acid, 41) (3Z) -3- [2,2-dimethyl-5- (2- {5-Methyl-2- [4- (trifluoromethyl L) phenyl] -1,3-oxazol-4-yl} ethoxy) -3,4-dihydronaphthalene-1 (2H) -ylidene] propanoic acid, 42) (3Z) -3- [5- {2- [ 2- (4-tert-Butylphenyl) -5-methyl-1,3-oxazol-4-yl] ethoxy} -2,2-dimethyl-3,4-dihydronaphthalene-1 (2H) -ylidene] propanoic acid 43) (3Z) -3- [5- (2- {2- [4- (dimethylamino) phenyl] -5-methyl-1,3-oxazol-4-yl} ethoxy) -2,2-dimethyl -3,4-dihydronaphthalene-1 (2H) -ylidene] propanoic acid, 44) (3Z) -3- [5- (2- {2- [6- (dimethylamino) pyridin-3-yl] -5 -Methyl-1,3-oxazol-4-yl Ethoxy) -2,2-dimethyl-3,4-dihydronaphthalene-1 (2H) -ylidene] propanoic acid, 45) (3Z) -3- [5- (2- {2- [6- (diethylamino) pyridine] -3-yl] -5-methyl-1,3-oxazol-4-yl} ethoxy) -2,2-dimethyl-3,4-dihydronaphthalen-1 (2H) -ylidene] propanoic acid, 46) (3Z ) -3- [2,2-Dimethyl-5- {2- [5-methyl-2- (6-morpholin-4-ylpyridin-3-yl) -1,3-oxazol-4-yl] ethoxy}- 3,4-dihydronaphthalene-1 (2H) -ylidene] propanoic acid, 47) 3- {5- [2- (5-methyl-2-phenyl-1,3-oxazol-4-yl) ethoxy] -1 -Naphthyl} propanoic acid, 48) 3- 5- {2- [5-methyl-2- (4-methylphenyl) -1,3-oxazol-4-yl] ethoxy} -1-naphthyl) propanoic acid, 49) 3- (5- {2- [ 2- (4-Fluorophenyl) -5-methyl-1,3-oxazol-4-yl] ethoxy} -1-naphthyl) propanoic acid, 50) 3- (5- {2- [2- (4-ethyl) Phenyl) -5-methyl-1,3-oxazol-4-yl] ethoxy} -1-naphthyl) propanoic acid, 51) 3- [5- (2- {5-methyl-2- [4- (methylsulfanyl)] ) Phenyl] -1,3-oxazol-4-yl} ethoxy) -1-naphthyl] propanoic acid, 52) 3- (5- {2- [2- (1,3-benzodioxol-5-yl) ) -5-Methyl-1,3-oxazol-4-yl] ethoxy} -1-naphthyl) propanoic acid, 53) 3- (5- {2- [2- (4-isopropylphenyl) -5-methyl-1,3-oxazol-4-yl] ethoxy} -1-naphthyl) propane Acid, 54) 3- [5- (2- {5-methyl-2- [4- (trifluoromethyl) phenyl] -1,3-oxazol-4-yl} ethoxy) -1-naphthyl] propanoic acid, 55) 3- (5- {2- [2- (4-tert-butylphenyl) -5-methyl-1,3-oxazol-4-yl] ethoxy} -1-naphthyl) propanoic acid, 56) (2E ) -3- {5- [2- (5-Methyl-2-phenyl-1,3-oxazol-4-yl) ethoxy] -1-naphthyl} acrylic acid, 57) (2E) -3- (5- {2- [5-Methyl-2- (4-methylphenyl)- , 3-Oxazol-4-yl] ethoxy} -1-naphthyl) acrylic acid, 58) (2E) -3- (5- {2- [2- (4-fluorophenyl) -5-methyl-1,3 -Oxazol-4-yl] ethoxy} -1-naphthyl) acrylic acid, 59) (2E) -3- (5- {2- [2- (4-ethylphenyl) -5-methyl-1,3-oxazole -4-yl] ethoxy} -1-naphthyl) acrylic acid, 60) (2E) -3- [5- (2- {5-methyl-2- [4- (methylsulfanyl) phenyl] -1,3- Oxazol-4-yl} ethoxy) -1-naphthyl] acrylic acid, 61) (2E) -3- (5- {2- [2- (1,3-benzodioxol-5-yl) -5- Methyl-1,3-oxazol-4-yl] ethoxy} -1-naphthy ) Acrylic acid, 62) (2E) -3- (5- {2- [2- (4-Isopropylphenyl) -5-methyl-1,3-oxazol-4-yl] ethoxy} -1-naphthyl) acrylic Acid, 63) (2E) -3- [5- (2- {5-methyl-2- [4- (trifluoromethyl) phenyl] -1,3-oxazol-4-yl} ethoxy) -1-naphthyl Acrylic acid, 64) (2E) -3- (5- {2- [2- (4-tert-butylphenyl) -5-methyl-1,3-oxazol-4-yl] ethoxy} -1-naphthyl ) Acrylic acid, 65) 6- [2- (5-Methyl-2-phenyl-1,3-oxazol-4-yl) ethoxy] -2-naphthoic acid, 66) 6- {2- [5-methyl- 2- (4-Methylphenyl) -1,3-oxazole-4- Yl] ethoxy} -2-naphthoic acid, 67) 6- {2- [2- (4-fluorophenyl) -5-methyl-1,3-oxazol-4-yl] ethoxy} -2-naphthoic acid, 68 ) 6- {2- [2- (4-Ethylphenyl) -5-methyl-1,3-oxazol-4-yl] ethoxy} -2-naphthoic acid, 69) 6- (2- {5-methyl- 2- [4- (methylsulfanyl) phenyl] -1,3-oxazol-4-yl} ethoxy) -2-naphthoic acid, 70) 6- [2- (5-methyl-2-phenyl-1,3- Oxazol-4-yl) ethoxy] -1,2,3,4-tetrahydronaphthalene-2-carboxylic acid, 71) 6- {2- [5-methyl-2- (4-methylphenyl) -1,3- Oxazol-4-yl] ethoxy} -1,2,3,4 Tetrahydronaphthalene-2-carboxylic acid, 72) 6- {2- [2- (4-fluorophenyl) -5-methyl-1,3-oxazol-4-yl] ethoxy} -1,2,3,4 Tetrahydronaphthalene-2-carboxylic acid, 73) 6- {2- [2- (4-ethylphenyl) -5-methyl-1,3-oxazol-4-yl] ethoxy} -1,2,3,4 Tetrahydronaphthalene-2-carboxylic acid, 74) 6- (2- {5-methyl-2- [4- (methylsulfanyl) phenyl] -1,3-oxazol-4-yl} ethoxy) -1,2,3 , 4-tetrahydronaphthalene-2-carboxylic acid, 75) 6- [2- (5-methyl-2-phenyl-1,3-oxazol-4-yl) ethoxy] quinoline-2-carboxylic acid, 76) 6- {2- [5 Methyl-2- (4-methylphenyl) -1,3-oxazol-4-yl] ethoxy} quinoline-2-carboxylic acid, 77) 6- {2- [2- (4-fluorophenyl) -5-methyl -1,3-oxazol-4-yl] ethoxy} quinoline-2-carboxylic acid, 78) 6- {2- [2- (4-ethylphenyl) -5-methyl-1,3-oxazol-4-yl ] Ethoxy} quinoline-2-carboxylic acid, 79) 6- (2- {5-methyl-2- [4- (methylsulfanyl) phenyl] -1,3-oxazol-4-yl} ethoxy) quinoline-2- Carboxylic acid, 80) 6- [2- (5-Methyl-2-phenyl-1,3-oxazol-4-yl) ethoxy] -1,2,3,4-tetrahydroquinoline-2-carboxylic acid, 81) 6- {2- [5-Me Tyl-2- (4-methylphenyl) -1,3-oxazol-4-yl] ethoxy} -1,2,3,4-tetrahydroquinoline-2-carboxylic acid, 82) 6- {2- [2- (4-Fluorophenyl) -5-methyl-1,3-oxazol-4-yl] ethoxy} -1,2,3,4-tetrahydroquinoline-2-carboxylic acid, 83) 6- {2- [2- (4-Ethylphenyl) -5-methyl-1,3-oxazol-4-yl] ethoxy} -1,2,3,4-tetrahydroquinoline-2-carboxylic acid, 84) 6- (2- {5- Methyl-2- [4- (methylsulfanyl) phenyl] -1,3-oxazol-4-yl} ethoxy) -1,2,3,4-tetrahydroquinoline-2-carboxylic acid, 85) 3- {8- [2- (5-Methyl-2-phenyl 1,3-oxazol-4-yl) ethoxy] quinolin-4-yl} propanoic acid, 86) 3- (8- {2- [5-methyl-2- (4-methylphenyl) -1,3-oxazole -4-yl] ethoxy} quinolin-4-yl) propanoic acid, 87) 3- (8- {2- [2- (4-fluorophenyl) -5-methyl-1,3-oxazol-4-yl] Ethoxy} quinolin-4-yl) propanoic acid, 88) 3- (8- {2- [2- (4-ethylphenyl) -5-methyl-1,3-oxazol-4-yl] ethoxy} quinoline-4 -Yl) propanoic acid, 89) 3- [8- (2- {5-methyl-2- [4- (methylsulfanyl) phenyl] -1,3-oxazol-4-yl} ethoxy) quinolin-4-yl ] Propanoic acid, 90) (3Z) -2, -Dimethyl-3- [5- [2- (5-methyl-2-phenyl-1,3-oxazol-4-yl) ethoxy] -3,4-dihydronaphthalene-1 (2H) -ylidene] propanoic acid, 91) 1-{(Z)-[5- [2- (5-Methyl-2-phenyl-1,3-oxazol-4-yl) ethoxy] -3,4-dihydronaphthalene-1 (2H) -ylidene ] Methyl} cyclopropanecarboxylic acid.
[Method for producing compound of the present invention]
The compounds of the present invention represented by the general formula (I) can be prepared by known methods, for example, the methods described below, the methods described in the Examples, or Comprehensive Organic Transformations: A Guide to Functional Group Preparations, 2nd Edition (Richard C. Larock , John Wiley & Sons Inc, 1999) can be used in combination. In each of the following production methods, the raw material compound may be used as a salt. As such a salt, those described as the salt of the general formula (I) are used.
(1) Among the compounds of the present invention represented by the general formula (I), a compound in which X represents an oxygen atom and Z represents a carboxy group or a C1-8 alkoxycarbonyl group, that is, the general formula (IA)

The compound represented by the formula (wherein Z ¹ represents a carboxy group or a C 1-8 alkoxycarbonyl group, and other symbols have the same meanings as described above) can be produced, for example, by the method shown below.

  The compound of the present invention represented by the general formula (IA) is represented by the general formula (II)

(Wherein all symbols have the same meaning as described above) and the general formula (III)

(In the formula, Z ² represents a C 1-8 alkoxycarbonyl group or a protected carboxyl group, and other symbols have the same meaning as described above.) It can be produced by subjecting the protecting group to a deprotection reaction.

  This Mitsunobu reaction is publicly known. For example, in an organic solvent (eg, dichloromethane, diethyl ether, tetrahydrofuran, acetonitrile, benzene, toluene, etc.), an azo compound (diethyl azodicarboxylate (DEAD), diisopropyl azodicarboxylate, 1,1 '-(Azodicarbonyl) dipiperidine (ADDP), 1,1'-azobis (N, N-dimethylformamide), etc.) and phosphine compounds (for example, triphenylphosphine, tributylphosphine, trimethylphosphine, polymer supported triphenylphosphine, etc. ) In the presence of a corresponding alcohol compound at 0-60 ° C.

  Examples of the protective group for the carboxyl group include a methyl group, an ethyl group, an allyl group, a t-butyl group, a trichloroethyl group, a benzyl (Bn) group, a phenacyl group, a p-methoxybenzyl group, a trityl group, and a 2-chlorotrityl group. Or the solid-phase support | carrier etc. which those structures couple | bonded are mentioned. The protecting group for the carboxyl group is not particularly limited as long as it is a group that can be easily and selectively eliminated other than those described above. For example, those described in Protective Groups in Organic Synthesis (T. W. Greene, John Wiley & Sons Inc, 1999) are used.

  The deprotection reaction of the carboxyl group is known, for example, (1) alkaline hydrolysis, (2) deprotection reaction under acidic conditions, (3) deprotection reaction by hydrogenolysis, (4) silyl group deprotection Reaction, (5) deprotection reaction using metal, (6) deprotection reaction using metal complex, and the like.

To explain these methods in detail,
(1) The deprotection reaction by alkali hydrolysis is performed by, for example, an alkali metal hydroxide (eg, sodium hydroxide, potassium hydroxide, lithium hydroxide) in an organic solvent (eg, methanol, tetrahydrofuran, dioxane, etc.). , Alkaline earth metal hydroxides (for example, barium hydroxide, calcium hydroxide, etc.) or carbonates (for example, sodium carbonate, potassium carbonate, etc.), aqueous solutions thereof or mixtures thereof, Performed at temperature.
(2) The deprotection reaction under acid conditions is carried out by using, for example, an organic acid (for example, acetic acid, trifluoroacetic acid, methanesulfonic acid, p) -Tosylic acid etc.), or an inorganic acid (eg hydrochloric acid, sulfuric acid etc.) or a mixture thereof (eg hydrogen bromide / acetic acid etc.) at a temperature of 0-100 ° C.
(3) Deprotection reaction by hydrogenolysis may be carried out, for example, with a solvent (eg, ether type (tetrahydrofuran, dioxane, dimethoxyethane, diethyl ether, etc.), alcohol type (methanol, ethanol, etc.), benzene type (benzene, toluene, etc.) , Ketone system (acetone, methyl ethyl ketone, etc.), nitrile system (acetonitrile, etc.), amide system (dimethylformamide, etc.), water, ethyl acetate, acetic acid or a mixed solvent of two or more thereof, catalyst (for example, palladium-carbon , Palladium black, palladium hydroxide, platinum oxide, Raney nickel, etc.), in a hydrogen atmosphere under normal pressure or under pressure, or in the presence of ammonium formate, at a temperature of 0 to 200 ° C.
(4) The deprotection reaction of the silyl group is performed at a temperature of 0-40 ° C. using tetrabutylammonium fluoride in an organic solvent miscible with water (for example, tetrahydrofuran, acetonitrile, etc.).
(5) The deprotection reaction using a metal is carried out, for example, in an acidic solvent (acetic acid, a buffer solution of pH 4.2-7.2 or a mixture thereof with an organic solvent such as tetrahydrofuran) in the presence of powdered zinc, If necessary, it is performed at a temperature of 0 to 40 ° C. while applying ultrasonic waves.
(6) The deprotection reaction using a metal complex is carried out, for example, by using a trap reagent (for example, an organic solvent (for example, dichloromethane, dimethylformamide, tetrahydrofuran, ethyl acetate, acetonitrile, dioxane, ethanol, etc.), water or a mixed solvent thereof. , Tributyltin hydride, triethylsilane, dimedone, morpholine, diethylamine, pyrrolidine etc.), organic acids (eg acetic acid, formic acid, 2-ethylhexanoic acid etc.) and / or organic acid salts (eg sodium 2-ethylhexanoate, Metal complexes (for example, tetrakistriphenylphosphine palladium (0), bis (trichloride)) in the presence or absence of phosphine reagents (for example, triphenylphosphine, etc.) in the presence of potassium 2-ethylhexanoate, etc. Phenylphosphine) palladium (II), palladium (II), with tris (triphenylphosphine) rhodium (I) etc.), at a temperature of 0-40 ° C..

  In addition to the above, the deprotection reaction can be performed by the method described in, for example, T. W. Greene, Protective Groups in Organic Synthesis, Wiley, New York, 1999. As can be easily understood by those skilled in the art, the desired compound of the present invention can be easily produced by properly using these deprotection reactions.

  The compounds represented by the general formulas (II) to (III) used as other starting materials or reagents are known per se or known methods such as Comprehensive Organic Transformations: A Guide to Functional Group Preparations, 2nd Edition. (Richard C. Larock, John Wiley & Sons Inc, 1999).

  Among the compounds of the present invention represented by the general formula (I), compounds other than those shown above can be used in the examples described in the present specification or known methods such as “Comprehensive Organic Transformations: A Guide to Functional”. Group Preparations, 2nd Edition (Richard C. Larock, John Wiley & Sons Inc, 1999) "can be used in combination.

In each reaction in the present specification, the reaction product is obtained by a conventional purification means such as distillation under normal pressure or reduced pressure, high performance liquid chromatography using silica gel or magnesium silicate, thin layer chromatography, ion exchange resin, It can be purified by scavenger resin, column chromatography, washing or recrystallization. Purification may be performed for each reaction or after completion of several reactions.
[Pharmacological activity]
Examples of pharmacological tests other than those described in the Examples, particularly in vivo experiments using animals, include the following methods. The blood glucose and blood lipid lowering action of the compound of the present invention can be measured by the method described below.
Blood glucose and blood lipid lowering action (1):
The body weight and blood glucose level of KKAy / Ta Jcl mice are measured and divided into groups based on the blood glucose level as an index. From the next day, the animals are fed with a feed containing the compound of the present invention or a powdered feed for 6 days. After repeated administration, body weight and food intake are measured, and the dose is converted from the average food intake. In addition to blood glucose level and plasma TG level, blood insulin / free fatty acid (NEFA) and GOT / GPT are measured.

Decreased blood glucose, blood insulin, NEFA level or plasma TG level during satiety in KKAy / Ta mice suggests a potential preventive and / or therapeutic agent for diabetes, hyperlipidemia, arteriosclerosis, etc. Is. This action is derived from the activation of PPARγ in the living body. On the other hand, it is suggested that the increase in the liver weight and the increase in the expression level of the hepatic double enzyme reflect the activation of PPARα in the living body.
Blood glucose and blood lipid lowering action (2):
Measure body weight, blood glucose, NEFA, TG, and HbA1c concentrations in Zucker fa / fa rats (strain name Crj- [ZUC] -fa / fa) and normal control animal lean rats (strain name Crj- [ZUC] -lean) To do. Among them, the HbA1c value and body weight are used as an index, and the compound of the present invention is repeatedly orally administered from the next day. For the control group, the vehicle is administered.

  After the start of repeated administration, the average food intake is calculated, and blood glucose / NEFA / TG and HbA1c concentrations are measured. In addition, oral glucose tolerance test (OGTT) will be conducted to evaluate the glucose tolerance improving action. OGTT is fasted from the previous day, and the next day after loading with glucose solution 2 g / 5 mL / kg, blood glucose level 60 minutes and 120 minutes later, blood insulin, NEFA, TG, GOT, GPT, and liver wet weight Measure.

Reduced blood glucose, blood insulin, NEFA, HbA1c or plasma TG levels during satiety in Zucker fa / fa rats as a prophylactic and / or therapeutic agent for diabetes, hyperlipidemia and arteriosclerosis It suggests. Moreover, the reduction of fasting blood glucose level and the improvement of glucose tolerance in OGTT suggest the possibility as a preventive and / or therapeutic agent for diabetes. These actions are derived from the activation of PPARγ in the living body. On the other hand, it is suggested that the increase in liver weight reflects the activation of PPARα in the living body.
Blood glucose and blood lipid lowering action (3):
Further quarantine and acclimatize cynomolgus monkeys at the study site. The animals are weighed, divided into groups, and a medium or a medicinal solution containing 3 to 100 mg / kg / day of the compound of the present invention is administered intranasally repeatedly once a day using a nutrition catheter and syringe. After administration, blood is collected and the above hematological tests (red blood cell count, hematocrit, hemoglobin content, platelet count, white blood cell count) and blood chemistry tests (GOT, GPT, alkaline phosphatase, total protein, urinary nitrogen, creatinine)・ Measure creatinine kinase, total bilirubin, blood glucose, TC, HDL, LDL, and TG). Blood was collected before administration of the compound of the present invention, 1, 2, 4 hours after administration on the 14th day after administration, and 1, 2, 3 hours after feeding (1 hour intake time).・ Measure HDL, LDL, and TG.

The fasting plasma TG value, TC value, and LDL value lowering effect in normal cynomolgus monkeys suggest the possibility as a preventive and / or therapeutic agent for hyperlipidemia, arteriosclerosis and the like. Similarly, this is confirmed also in the point which suppresses the TG raise after a diet load.
[toxicity]
The toxicity of the compound of the present invention represented by the general formula (I) is very low, and is sufficiently safe for use as a medicine.
[Application to pharmaceutical products]
The compound of the present invention represented by the general formula (I), a salt thereof, an N-oxide thereof, a solvate thereof, or a prodrug thereof has, for example, a PPARγ agonistic action, and thus has a blood glucose lowering action, a lipid lowering action, etc. For example, diseases of abnormal sugar / lipid metabolism (for example, diabetes, hyperlipidemia (hypercholesterolemia, low HDL (high density lipoprotein)), high LDL (low density lipoprotein), TG (triglyceride) blood, etc.), arteriosclerosis, cardiovascular disease, obesity, metabolic syndrome, etc.), hypertension, circulatory disease and the like are useful. In addition, since it has a PPARα agonistic action, it has a lipid lowering action and the like, for example, a lipid metabolism disorder (for example, hyperlipidemia (hyperlipidemia (hypercholesterolemia, hypoHDLemia, hyperlipidemia), hypertriglyceride blood) Etc.), arteriosclerosis, cardiovascular disease, obesity, metabolic syndrome, etc.), hypertension, circulatory disease and the like.

  The compound of the present invention represented by the general formula (I) is 1) complementation and / or enhancement of the preventive and / or therapeutic effect of the compound, 2) improvement of kinetics / absorption of the compound, reduction of dosage, and / or 3) In order to reduce the side effects of the compound, it may be administered in combination with other drugs as a concomitant drug.

  The combined use of the compound of the present invention represented by the general formula (I) and other drugs may be administered in the form of a combination preparation in which both components are combined in one preparation, or in the form of separate preparations. You may take When administered as separate preparations, simultaneous administration and administration by time difference are included. In addition, administration with a time difference may be such that the compound of the present invention represented by the general formula (I) is administered first, and another drug may be administered later, or the other drug is administered first, and the general formula (I) The compound of the present invention represented by the above may be administered later, and each administration method may be the same or different.

  The other drug may be a low molecular weight compound, and may be a high molecular protein, polypeptide, polynucleotide (DNA, RNA, gene), antisense, decoy, antibody, or vaccine. Also good. The dosage of other drugs can be appropriately selected based on the clinically used dose. In addition, the compounding ratio of the compound of the present invention and other drugs can be appropriately selected depending on the age and weight of the administration subject, administration method, administration time, target disease, symptom, combination and the like. For example, 0.01 to 100 parts by weight of another drug may be used with respect to 1 part by weight of the compound of the present invention. Other drugs may be administered by combining one or two or more from the same group and different groups shown below in an appropriate ratio.

  The disease that exerts a preventive and / or therapeutic effect by the above combination is not particularly limited as long as it is a disease that complements and / or enhances the preventive and / or therapeutic effect of the compound of the present invention represented by the general formula (I). .

For example, as other drugs for complementing and / or enhancing the lipid lowering action of the compound of the present invention represented by the general formula (I), that is, as lipid improving agents, for example, MTP (Microsomal Triglyceride Transfer Protein) inhibitors, HMG -CoA reductase inhibitor, squalene synthetase inhibitor, fibrate preparation (fibric acid derivative), ACAT (acyl CoA: cholesterol O-acyltransferase) inhibitor, 5-lipoxygenase inhibitor, cholesterol absorption inhibitor, bile acid absorption inhibitors, ileal Na ⁺ / bile acid cotransporter ^{(ileal Na + / bile acid transporter} ; IBAT) inhibitor, LDL receptor activator, expression enhancer, a pancreatic lipase inhibitor, probucol formulation, nicotine acid formulation, other Anti-hypercholesterolemia therapeutic agents and the like.

  Examples of the MTP inhibitor include BMS-201038, BMS-212122, BMS-200150, GW-328713, R-103757, and the like. Examples of HMG-CoA reductase inhibitors include atorvastatin, fluvastatin, lovastatin, pitavastatin, pravastatin, rosuvastatin, simvastatin and the like. Examples of the ACAT inhibitor include F-12511, F-1394, CI-1011, melinamide and the like. Examples of the squalene synthetase inhibitor include TAK-475. Examples of fibrate preparations include gemfibrozil, clofibrate, bezafibrate, fenofibrate and the like. Examples of the ACAT inhibitor include Cl-1011, FCE27677, RP73163, and the like. Examples of cholesterol absorption inhibitors include ezetimibe. Examples of bile acid absorption inhibitors include cholestyramine and colesevelam. Examples of the LDL receptor activator / expression enhancer include MD-700, LY295427, and the like. Examples of pancreatic lipase inhibitors include orlistat. When used in combination with fibrates and HMG-CoA reductase inhibitors, it is sometimes known that rhabdomyolysis is accompanied, and is contraindicated in patients with renal failure and those with impaired renal function. . Among the above combinations, there is a possibility that abnormal lipid metabolism can be corrected without causing rhabdomyolysis. Preferred combination agents are HMG-CoA reductase inhibitors, cholesterol absorption inhibitors, bile acid absorption inhibitors, pancreatic lipase inhibitors.

  Other drugs for supplementing and / or enhancing the hypoglycemic action of the compound represented by the general formula (I) and enhancing the effect of treating diabetic complications, ie, diabetic therapeutic agents include, for example, sulfonylurea hypoglycemic agents. , Biguanide preparations, α-glucosidase inhibitors, rapid-acting insulin secretagogues, insulin preparations, DP (dipeptidyl peptidase) 4 inhibitors, β3 adrenergic receptor agonists, other antidiabetics, diabetic complications, etc. Is mentioned.

  Examples of the sulfonylurea hypoglycemic agent include acetohexamide, glibenclamide, gliclazide, glyclopyramide, chlorpropamide, tolazamide, tolbutamide, glimepiride and the like. Examples of biguanide preparations include buformin hydrochloride and metformin hydrochloride. Examples of the α-glucosidase inhibitor include acarbose and voglibose. Examples of fast-acting insulin secretagogues include nateglinide and repaglinide. Examples of the DPP4 inhibitor include NVP-DPP728A. Examples of the β3 adrenergic receptor agonist include AJ-9679, BMS-210285, CP-331679, KUL-1248, LY-362684, L-750335, CP-331648 and the like. Examples of the therapeutic agent for diabetic complications include epalrestat.

  Other agents for complementing and / or enhancing the anti-obesity effect of the compound represented by the general formula (I) include anti-obesity agents such as appetite suppressants, pancreatic lipase inhibitors, β3 adrenergic receptor agonists. It may be used in combination with other agents such as serotonin, norepinephrine, dopamine reuptake inhibitors. Appetite suppressants include leptin, mazindol, amphetamine, methamphetamine and the like. Examples of pancreatic lipase inhibitors include orlistat. Examples of the β3 adrenergic receptor agonist include AJ-9679, BMS-210285, CP-331679, KUL-1248, LY-362684, L-750335, CP-331648 and the like. Examples of serotonin / norepinephrine / dopamine reuptake inhibitors include sibutramine.

  The weight ratio of the compound represented by the general formula (I) and other drugs is not particularly limited.

  In addition, other drugs that complement and / or enhance the preventive and / or therapeutic effects of the compound represented by the general formula (I) include not only those found so far based on the above-described mechanism. This includes those found in the future.

  In order to use the compound of the present invention represented by the general formula (I) or the combination of the compound represented by the general formula (I) and another drug for the above-mentioned purpose, it is usually systemically or locally, orally or non- It is administered in the oral form.

  The dose varies depending on age, body weight, symptoms, therapeutic effect, administration method, treatment time, etc., but is usually orally administered once to several times a day in the range of 1 mg to 1000 mg per adult. Or it is administered parenterally once or several times a day in the range of 1 mg to 100 mg per adult, or continuously intravenously in the range of 1 hour to 24 hours per day. .

  Of course, as described above, since the dosage varies depending on various conditions, an amount smaller than the above dosage may be sufficient, or administration may be necessary beyond the range.

  When administering the compound of the present invention represented by the general formula (I) or a combination of the compound represented by the general formula (I) and another drug, a solid preparation for internal use for oral administration, a liquid preparation for internal use and It is used as an injection for parenteral administration, an external preparation, a suppository, an eye drop, an inhalant and the like.

  Examples of the solid preparation for internal use for oral administration include tablets, pills, capsules, powders, granules and the like. Capsules include hard capsules and soft capsules.

  In such solid preparations for internal use, one or more active substances are left as they are, or excipients (lactose, mannitol, glucose, microcrystalline cellulose, starch, etc.), binders (hydroxypropylcellulose, polyvinylpyrrolidone, Mixed with magnesium metasilicate aluminate, etc.), disintegrating agents (such as calcium calcium glycolate), lubricants (such as magnesium stearate), stabilizers, solubilizing agents (such as glutamic acid, aspartic acid), etc. Used by formulating. If necessary, it may be coated with a coating agent (sucrose, gelatin, hydroxypropylcellulose, hydroxypropylmethylcellulose phthalate, etc.), or may be coated with two or more layers. Also included are capsules of absorbable substances such as gelatin.

  Liquid preparations for internal use for oral administration include pharmaceutically acceptable solutions, suspensions / emulsions, syrups, elixirs and the like. In such a solution, one or more active substances are dissolved, suspended or emulsified in a commonly used diluent (purified water, ethanol or a mixture thereof). Furthermore, this liquid agent may contain a wetting agent, a suspending agent, an emulsifier, a sweetening agent, a flavoring agent, a fragrance, a preservative, a buffering agent and the like.

  Among parenteral administration, external dosage forms include, for example, ointments, gels, creams, poultices, patches, liniments, sprays, inhalants, sprays, eye drops, and nasal drops. Agents and the like. These contain one or more active substances and are produced and prepared by known methods or commonly used formulations.

The ointment is produced by a known or commonly used formulation. For example, it is manufactured and prepared by grinding or melting one or more active substances in a base. The ointment base is selected from known or commonly used ones. For example,
Higher fatty acids or higher fatty acid esters (adipic acid, myristic acid, palmitic acid, stearic acid, oleic acid, adipic acid ester, myristic acid ester, palmitic acid ester, stearic acid ester, oleic acid ester, etc.), waxes (honey bees, whales) Waxes, ceresins, etc.), surfactants (polyoxyethylene alkyl ether phosphates, etc.), higher alcohols (cetanol, stearyl alcohol, cetostearyl alcohol, etc.), silicone oils (dimethylpolysiloxane, etc.), hydrocarbons (hydrophilic petrolatum) , White petrolatum, purified lanolin, liquid paraffin, etc.), glycols (ethylene glycol, diethylene glycol, propylene glycol, polyethylene glycol, macrogol, etc.), vegetable oils (castor oil, olive oil, sesame) , Turpentine oil, etc.), animal oils (mink oil, yolk oil, squalane, squalene, etc.), water, absorption accelerator, used alone or in combination of two or more kinds chosen from irritation inhibitor. Furthermore, a humectant, a preservative, a stabilizer, an antioxidant, a flavoring agent and the like may be included.

  The gel is produced by a known or commonly used formulation. For example, it is produced and prepared by melting one or more active substances in a base. The gel base is selected from known or commonly used ones. For example, lower alcohols (ethanol, isopropyl alcohol, etc.), gelling agents (carboxymethyl cellulose, hydroxyethyl cellulose, hydroxypropyl cellulose, ethyl cellulose, etc.), neutralizing agents (triethanolamine, diisopropanolamine, etc.), surfactants (monostearin) Acid polyethylene glycol, etc.), gums, water, absorption promoters, anti-rash agents, or a mixture of two or more. Furthermore, a preservative, an antioxidant, a flavoring agent and the like may be included.

  The cream is produced by a known or commonly used formulation. For example, it is produced and prepared by melting or emulsifying one or more active substances in a base. The cream base is selected from known or commonly used ones. For example, higher fatty acid esters, lower alcohols, hydrocarbons, polyhydric alcohols (propylene glycol, 1,3-butylene glycol, etc.), higher alcohols (2-hexyldecanol, cetanol, etc.), emulsifiers (polyoxyethylene alkyl ethers, fatty acids) Esters etc.), water, absorption promoters, anti-rash agents, or a mixture of two or more of them may be used. Furthermore, a preservative, an antioxidant, a flavoring agent and the like may be included.

  The poultice is produced by a known or commonly used formulation. For example, it is produced by melting one or more active substances in a base material, and applying it as a kneaded product on a support. The poultice base is selected from known or commonly used ones. For example, thickeners (polyacrylic acid, polyvinylpyrrolidone, gum arabic, starch, gelatin, methylcellulose, etc.), wetting agents (urea, glycerin, propylene glycol, etc.), fillers (kaolin, zinc oxide, talc, calcium, magnesium, etc.) ), Water, a solubilizing agent, a tackifier, and a rash prevention agent, or a mixture of two or more thereof. Furthermore, a preservative, an antioxidant, a flavoring agent and the like may be included.

  The patch is produced by a known or commonly used formulation. For example, it is produced by melting one or more active substances in a base and spreading and coating them on a support. The base for patch is selected from known or commonly used ones. For example, those selected from a polymer base, fats and oils, higher fatty acids, tackifiers and anti-rash agents may be used alone or in admixture of two or more. Furthermore, a preservative, an antioxidant, a flavoring agent and the like may be included.

  The liniment is produced by a known or commonly used formulation. For example, one or more actives may be dissolved, suspended or used alone or in combination of two or more selected from water, alcohol (ethanol, polyethylene glycol, etc.), higher fatty acids, glycerin, soap, emulsifier, suspending agent, etc. Produced and prepared by emulsification. Furthermore, a preservative, an antioxidant, a flavoring agent and the like may be included.

  Sprays, inhalants, and sprays are buffers that provide isotonicity with stabilizers such as sodium bisulfite in addition to commonly used diluents, such as sodium chloride, sodium citrate or citric acid. An isotonic agent such as A method for producing a spray is described in detail in, for example, US Pat. Nos. 2,868,691 and 3,095,355. Moreover, it does not matter as an aerosol agent.

  Examples of the injection for parenteral administration include solutions, suspensions, emulsions, and solid injections used by dissolving or suspending in a solvent at the time of use. An injection is used by dissolving, suspending or emulsifying one or more active substances in a solvent. As the solvent, for example, distilled water for injection, physiological saline, vegetable oil, propylene glycol, polyethylene glycol, alcohols such as ethanol, and combinations thereof are used. Further, this injection may contain a stabilizer, a solubilizing agent (such as glutamic acid, aspartic acid, polysorbate 80 (registered trademark)), a suspending agent, an emulsifier, a soothing agent, a buffering agent, a preservative and the like. . These are sterilized in the final process or manufactured and prepared by aseptic manipulation. In addition, an aseptic solid preparation, for example, a lyophilized product, can be produced and used by dissolving in sterilized or aseptic distilled water for injection or other solvent before use.

  Inhalants for parenteral administration include aerosols, powders for inhalation, or liquids for inhalation, and the liquids for inhalation are used by dissolving or suspending in water or other suitable medium at the time of use. It may be.

  These inhalants are produced according to known methods.

  For example, in the case of inhalation solutions, preservatives (benzalkonium chloride, parabens, etc.), coloring agents, buffering agents (sodium phosphate, sodium acetate, etc.), isotonic agents (sodium chloride, concentrated glycerin, etc.) , Thickeners (carboxyvinyl polymer, etc.), absorption accelerators and the like are appropriately selected as necessary.

  In the case of powders for inhalation, lubricants (stearic acid and its salts), binders (starch, dextrin, etc.), excipients (lactose, cellulose, etc.), colorants, preservatives (benzalkonium chloride) , Parabens, etc.), absorption promoters and the like are appropriately selected as necessary.

  A nebulizer (atomizer or nebulizer) is usually used when administering an inhalation solution, and an inhalation administration device for powder drug is usually used when administering an inhalation powder.

  Other compositions for parenteral administration include suppositories for rectal administration and pessaries for intravaginal administration, which contain one or more active substances and are prescribed by conventional methods.

  The compound of the present invention represented by the general formula (I) has a PPARα and / or γ agonistic action, and includes, for example, diseases of abnormal sugar / lipid metabolism (for example, diabetes, hyperlipidemia (for example, hypercholesterolemia) It is very useful as a prophylactic and / or therapeutic agent for HDL, hypo HDL, hyper LDL, hyper TG, etc.).

  Hereinafter, although an example explains the present invention in detail, the present invention is not limited to these. The location of separation by chromatography, the solvent in parentheses shown in TLC indicates the elution solvent or developing solvent used, and the ratio indicates the volume ratio. The solvent in parentheses shown at the NMR site indicates the solvent used for the measurement.

The nomenclature of the compound of the present invention is shown below. The nomenclature used herein is a method in accordance with IUPAC rules or a computerized system that generally generates IUPAC rule nomenclature, ACD / Name ^™ (version 6.00, manufactured by Advanced Chemistry Development Inc.) ).

NMR is a measured value of ¹ HNMR, and the solvent in parentheses shown in the NMR part indicates the solvent used for the measurement.
Example 1
5-{[tert-Butyl (dimethyl) silyl] oxy} -3,4-dihydronaphthalen-1 (2H) -one dimethyl tert-butylchlorodimethylsilane (7.82 g) and imidazole (3.53 g) under argon atmosphere 5-hydroxy-3,4-dihydronaphthalen-1 (2H) -one (7.00 g) was added to a formamide (30 mL) solution, and the mixture was stirred at room temperature for 20 hours. The reaction mixture was diluted with ethyl acetate (90 mL) and added to cold 1N hydrochloric acid (90 mL). The organic layer was washed successively with water (50 mL x 3) and saturated brine (30 mL), dried over anhydrous magnesium sulfate, and concentrated. The residue was recrystallized from cold tert-butyl methyl ether to give the title compound (8.95 g) having the following physical data.
TLC: Rf 0.64 (hexane: ethyl acetate = 4: 1);
¹ H NMR (400 MHz, CDCl ₃ ): δ 7.67, 7.17, 6.97, 2.88, 2.62, 2.10, 1.03, 0.24.
Example 2
Ethyl (2Z)-[5-{[tert-butyl (dimethyl) silyl] oxy} -3,4-dihydronaphthalene-1 (2H) -ylidene] acetate Ethyl ethynyl ether (15 g, ca.40 under argon stream) (wt% hexane solution) in diethyl ether (85 mL) was cooled to 0 ° C. or lower, and ethylmagnesium bromide (25 mL, 3M diethyl ether solution) was added dropwise, followed by stirring for 20 minutes. Next, a solution of the compound (8.8 g) produced in Example 1 in anhydrous tetrahydrofuran (120 mL) was added dropwise to the reaction solution, and the mixture was stirred at 0 ° C. or lower for 10 minutes and at room temperature for 3.5 hours. A saturated aqueous ammonium chloride solution was added to the reaction mixture, and the mixture was extracted with diethyl ether. The organic layer was washed with saturated brine, dried over anhydrous magnesium sulfate, and concentrated. The obtained oil was dissolved in ethanol (160 mL) under an argon atmosphere and cooled to 0 ° C. or lower. Camphorsulfonic acid (186 mg) was added to the above solution and stirred at 0 ° C. or lower for 50 minutes. The reaction mixture was concentrated and further azeotroped with toluene. The residue was purified by silica gel column chromatography (hexane: ethyl acetate = 50: 1) to give the title compound (4.54 g) having the following physical data.
TLC: Rf 0.68 (hexane: ethyl acetate = 10: 1);
¹ H NMR (400 MHz, CDCl ₃ ): δ 7.18, 6.99, 6.75, 5.76, 4.16, 2.76, 2.43, 1.98, 1.24, 1.01, 0.23.
Example 3
Ethyl (3Z) -3- [5-{[tert-butyl (dimethyl) silyl] oxy} -3,4-dihydronaphthalene-1 (2H) -ylidene] propanoate Prepared in Example 2 under argon atmosphere. A solution of the compound (3.60 g) and dibromomethane (1.6 mL) in anhydrous tetrahydrofuran (21 mL) was cooled to −78 ° C., and then cooled to −70 ° C. in a lithium tetramethylpiperidide solution (2 in tetrahydrofuran (25 mL)). , 2,6,6-tetramethylpiperidine (4.2 mL) and n-butyllithium (14.5 mL, 1.6 M hexane solution) were added at 0 ° C.) and stirred for 15 minutes. The reaction mixture was cooled to −70 ° C. from lithium hexamethyldisilazide solution (hexamethyldisilazane (4.4 mL) and n-butyllithium (13.0 mL, 1.6 M hexane solution) in tetrahydrofuran (16 mL) at 0 ° C.). The mixture was heated to -40 ° C and stirred for 10 minutes. Next, the reaction mixture was cooled to −78 ° C., sec-butyllithium (42 mL, 0.99 M cyclohexane / hexane solution) was added, and the mixture was stirred at −60 ° C. or lower for 20 minutes and heated to 10 ° C. N-Butyllithium (13.0 mL, 1.6 M hexane solution) was added to the reaction mixture at 10 ° C., and the mixture was stirred for 1 hour. The reaction mixture was cooled to −78 ° C., and an acidic ethanol solution prepared from acetyl chloride (11 mL) and ethanol (55 mL) was added at 0 ° C. or lower. The reaction mixture was diluted with ethyl acetate (350 mL) and cold water (300 mL) was added. The organic layer was washed successively with saturated aqueous sodium hydrogen carbonate solution (300 mL) and saturated brine (200 mL), dried over anhydrous magnesium sulfate and concentrated to give the title compound (4.14 g) having the following physical properties. The obtained compound was used in the next reaction without further purification.
TLC: Rf 0.72 (hexane: ethyl acetate = 10: 1);
¹ H NMR (400 MHz, CDCl ₃ ): δ 7.04, 6.92, 6.70, 5.62, 4.17, 3.37, 2.72, 2.41, 1.93, 1.27, 1.01, 0.23.
Example 4
Ethyl (3Z) -3- (5-hydroxy-3,4-dihydronaphthalene-1 (2H) -ylidene) propanoate A solution of the compound prepared in Example 3 (4.14 g) in anhydrous tetrahydrofuran (10 mL) under an argon atmosphere. Was added tetra-n-butylammonium fluoride (11.5 mL, 1 M tetrahydrofuran solution) in an ice bath and stirred for 45 minutes. Ethyl acetate (60 mL) and saturated aqueous ammonium chloride solution (60 mL) were added to the reaction mixture. The organic layer was washed successively with water (50 mL) and saturated brine (50 mL), dried over anhydrous magnesium sulfate and concentrated. The residue was purified by silica gel column chromatography (hexane: ethyl acetate = 10: 1) to give the title compound (1.71 g) having the following physical data.
TLC: Rf 0.51 (hexane: ethyl acetate = 4: 1);
¹ H NMR (400 MHz, CDCl ₃ ): δ 7.06, 6.92, 6.71, 5.65, 4.80, 4.17, 3.38, 2.72, 2.43, 1.98, 1.27.
Example 5
Ethyl (3Z) -3- [5- {2- [5-methyl-2- (4-methylphenyl) -1,3-oxazol-4-yl] ethoxy} -3,4-dihydronaphthalene-1 (2H ) -Ilidene] propanoate Under argon atmosphere, the compound prepared in Example 4 (1.68 g) and 2- [5-methyl-2- (4-methylphenyl) -1,3-oxazol-4-yl] ethanol ( Triphenylphosphine (4.49 g) and 1,1 ′-(azodicarbonyl) dipiperidine (4.32 g) were sequentially added to a solution of 2.23 g of a compound described in WO02 / 51820 (methylene chloride) (24 mL) at room temperature. Stir overnight. The reaction mixture was diluted with isopropyl ether (48 mL), the precipitate was filtered off, and the filtrate was concentrated. To the residue was added a mixed solvent of hexane and ethyl acetate (16: 3), and the insoluble material was filtered off. The filtrate was concentrated, and the residue was purified by silica gel column chromatography (hexane: ethyl acetate = 20: 1 → 10: 1) to obtain the title compound (2.36 g) having the following physical property values.
TLC: Rf 0.53 (hexane: ethyl acetate = 3: 1);
¹ H NMR (400 MHz, CDCl ₃ ): δ 7.86, 7.22, 7.11, 6.92, 6.78, 5.62, 4.24, 4.16, 3.36, 2.98, 2.70, 2.38, 2.37, 2.36, 1.91, 1.26.
Example 6
(3Z) -3- [5- {2- [5-Methyl-2- (4-methylphenyl) -1,3-oxazol-4-yl] ethoxy} -3,4-dihydronaphthalene-1 (2H) -Ilidene] propanoic acid

In an argon atmosphere, the compound prepared in Example 5 (1.68 g), dimethoxyethane (7.5 mL) and ethanol (7.5 mL) were cooled in an ice bath, 1N aqueous lithium hydroxide solution (9.1 mL) was added, and the mixture was stirred for 6 hours. did. The reaction mixture was diluted with ethanol (7.5 mL), water (130 mL) and saturated brine (20 mL), and extracted with tert-butyl methyl ether (150 mL x 2). The aqueous layer was acidified with 1N hydrochloric acid and then stirred at room temperature for 30 minutes and in an ice bath for 1 hour. The precipitate was filtered off, washed with water, and dried in vacuo at 40 ° C. overnight to give the title compound (1.06 g) having the following physical data.
TLC: Rf 0.44 (hexane: ethyl acetate = 1: 1);
¹ H NMR (400 MHz, DMSO-d ₆ ): δ 12.23, 7.77, 7.27, 7.11, 6.88, 5.55, 4.18, 3.21, 2.90, 2.57, 2.32, 2.31, 2.25, 1.78.
Examples 7 (1) -7 (3)
Instead of the compound prepared in Example 4, ethyl (3E) -3- (5-hydroxy-3,4-dihydronaphthalene-1 (2H) -ylidene) propanoate, methyl 6-hydroxy-2-naphthoate, and methyl By using 3- (5-hydroxy-1-naphthyl) propanoate in the same manner as in Example 5 → Example 6, the following compound was obtained.
Example 7 (1)
(3E) -3- [5- {2- [5-Methyl-2- (4-methylphenyl) -1,3-oxazol-4-yl] ethoxy} -3,4-dihydronaphthalene-1 (2H) -Ilidene] propanoic acid
TLC: Rf 0.14 (hexane: ethyl acetate = 2: 1);
¹ HNMR (400 MHz, DMSO-D ₆ ): δ 1.67, 2.33, 2.33, 2.33-2.36, 2.56, 2.91, 3.15, 4.17, 6.09, 6.82, 7.08, 7.15, 7.28 7.78.
Example 7 (2)
6- {2- [5-Methyl-2- (4-methylphenyl) -1,3-oxazol-4-yl] ethoxy} -2-naphthoic acid
TLC: Rf 0.63 (chloroform: methanol: acetic acid = 9: 1: 0.5);
¹ HNMR (300 MHz, DMSO-d ₆ ): δ 8.49, 7.99, 7.91, 7.85, 7.79, 7.44, 7.29, 7. 21, 4.36, 3.00, 2.36, 2.33.
Example 7 (3)
3- (5- {2- [5-Methyl-2- (4-methylphenyl) -1,3-oxazol-4-yl] ethoxy} -1-naphthyl) propanoic acid
TLC: Rf 0.37 (chloroform: methanol = 10: 1);
¹ HNMR (400 MHz, DMSO-D ₆ ): δ 2.33, 2.39, 2.59, 3.06, 3.24, 4.37, 7.01, 7.29, 7.35-7.39, 7.44, 7.58, 7.80, 8.02-8.05.
[Biological Example]
It was proved by the following experiment that the compound of the present invention represented by the general formula (I) has PPAR agonist activity.
Measurement of PPAR agonist activity (1) Preparation of material for luciferase assay using human PPAR The measurement method of the present invention is to add the improvement of measurement accuracy and measurement sensitivity in order to evaluate the compound of the present invention as follows. is there.

That is, for the purpose of creating a vector in which the luciferase gene is expressed under the control of the thymidine kinase (TK) promoter, the luciferase structural gene is excised from PicaGene Basic Vector 2 (trade name, Toyo Ink, Catalog No. 309-04821), and TK From pTKβ having a promoter (Clontech, catalog No. 6179-1), a luciferase gene expression vector pTK-Luc. Under the control of the TK promoter (−105 / + 51) was prepared as the minimum necessary promoter activity. Upstream of the TK promoter was inserted a response element of Gal4 protein which is a basic transcription factor of yeast, an enhancer sequence in which UAS was repeated four times, and 4xUAS-TK-Luc. Was constructed as a reporter gene. The enhancer sequence (SEQ ID NO: 1) used is shown below.
SEQ ID NO: 1: Enhancer sequence with repeated Gal4 protein response sequence
5'-T (CGACGGAGTACTGTCCTCCG) x4 AGCT-3 '
A vector for expressing a chimeric receptor protein, in which the ligand binding region of the nuclear receptor human PPARα, γ or δ was fused to the carboxyl terminus of the DNA binding region of the yeast Gal4 protein, was prepared as follows. That is, PicaGene Basic Vector 2 (trade name, Toyo Ink, Catalog No. 309-04821) was used as a basic expression vector, and the structural gene was exchanged for that of a chimeric receptor protein with the promoter / enhancer region intact.

  The DNA binding region of the Gal4 protein, the DNA encoding the ligand binding region of human PPARα, γ or δ is fused downstream of the DNA encoding the amino acid sequence from the 1st to the 147th to match the frame, and PicaGene Basic It was inserted downstream of the promoter / enhancer region of Vector 2. At this time, in order to localize the expressed chimeric protein in the nucleus, a nuclear translocation signal derived from SV40 T-antigen, Ala Pro Lys Lys Lys Arg Lys Val is present at the amino terminal of the ligand binding region of human PPARα, γ or δ. On the other hand, the carboxy terminus has a DNA sequence in which an influenza hemagglutinin epitope, Tyr Pro Tyr Asp Val Pro Asp Tyr Ala, and a translation stop codon are arranged in order as an epitope tag sequence for detection of the expressed protein. .

The structural gene portion used as the ligand binding region of human PPARα, γ or δ is R. Mukherjee et al. (See J. Steroid Biochem. Molec. Biol., 51 , 157 (1994)), ME Green et al. (Gene Expression., 4 , 281 (1995)), A. Elbrecht et al. (See Biochem Biophys. Res. Commun., 224 , 431 (1996) or A. Schmidt et al. (See Mol. Endocrinology., 6 , 1634 (1992)). From the structural comparison of human PPAR,
Human PPARα ligand binding region: Ser ¹⁶⁷ -Tyr ⁴⁶⁸
Human PPARγ ligand binding region: Ser ¹⁷⁶ -Tyr ⁴⁷⁸
Human PPARδ ligand binding region: Ser ¹³⁹ -Tyr ⁴⁴¹
DNA encoding human PPARγ1 and human PPARγ2 corresponds to Ser ²⁰⁴ -Tyr ^{506 and} has the same nucleotide sequence. In order to monitor the influence on the basic transcription, an expression vector having a DNA binding region of the Gal4 protein lacking the PPAR ligand binding region and a DNA encoding only the first to 147th amino acid sequences was also prepared.
(2) Luciferase assay using human PPARα, γ or δ CV-1 cells used as host cells were cultured according to a conventional method. That is, fetal bovine serum (GIBCO BRL, catalog No. 26140-061) was added to Dulbecco's modified Eagle medium (DMEM) to a final concentration of 10%, and penicillin G with a final concentration of 50 U / ml and 50 μg / ml. Was cultured at 37 ° C. in 5% carbon dioxide gas in a medium supplemented with streptomycin sulfate.

Before transfection to introduce both the reporter gene and Gal4-PPAR expression vector DNA into host cells, cells are seeded in 2 x 10 ⁶ cells in a 10 cm dish and washed once with medium without serum. After that, 10 ml of the same medium was added. 10 μg of the reporter gene, 0.5 μg of Gal4-PPAR expression vector and 50 μl of LipofectAMINE (trade name, GIBCO BRL, catalog No. 18324-012) were mixed well and added to the culture dish. The culture was continued at 37 ° C. for 5-6 hours, and a medium containing 10% of dialyzed fetal calf serum (GIBCO BRL, catalog No. 26300-061) 20% was added. After overnight culture at 37 ° C., the cells were dispersed by trypsin treatment, replated in a 96-well plate at a cell density of 8000 cells / 100 μl DMEM-10% dialyzed serum / well, and cultured for several hours to attach the cells. At this time, 100 μl of a DMEM-10% dialyzed serum solution of the compound of the present invention containing twice the concentration of the assay was added. After culturing at 37 ° C. for 42 hours, the cells were lysed, and luciferase activity was measured according to a conventional method.

As a result, the compound of the present invention showed excellent agonist activity against PPARα and γ.
[Formulation example]
Formulation examples that can be used in the practice of the present invention are shown below.
Formulation Example 1
The following components were mixed by a conventional method and then tableted to obtain 10,000 tablets each containing 10 mg of the active ingredient.
(3Z) -3- [5- {2- [5-Methyl-2- (4-methylphenyl) -1,3-oxazol-4-yl] ethoxy} -3,4-dihydronaphthalene-1 (2H ) -Ylidene] propanoic acid (100 g);
Carboxymethylcellulose calcium (disintegrant) (20 g);
Magnesium stearate (lubricant) (10 g);
-Microcrystalline cellulose (870 g).
Formulation Example 2
The following components were mixed by a conventional method, filtered through a dust removal filter, filled in 5 ml aliquots, and sterilized by heating in an autoclave to obtain 10,000 ampoules containing 20 mg of active ingredient per ampoule.
(3Z) -3- [5- {2- [5-Methyl-2- (4-methylphenyl) -1,3-oxazol-4-yl] ethoxy} -3,4-dihydronaphthalene-1 (2H ) -Ylidene] propanoic acid (200 g);
・ Mannitol (2 kg);
-Distilled water (50 L).

Since the compound of the present invention represented by the general formula (I), a salt thereof, an N-oxide thereof, a solvate thereof, or a prodrug thereof has a PPAR agonist (eg, PPARα and / or γ) action, -It is useful as a preventive and / or therapeutic agent for dyslipidemia.

Claims (14)

Formula (I)

(In the formula, ring A represents a cyclic group which may have a substituent, and ring S is a ring formed of 3 to 20 atoms selected from a carbon atom, an oxygen atom, a sulfur atom and a nitrogen atom. The ring S may have a substituent, and V has an alkyl group that may have a substituent, an alkenyl group that may have a substituent, and a substituent. Represents an optionally substituted alkynyl group or an optionally substituted cyclic group, W represents a main chain spacer having 1 to 8 atoms, X represents an oxygen atom, and an optionally oxidized sulfur atom Or represents an —NR ² — group, R ² represents a hydrogen atom or an optionally substituted alkyl group, Y represents a bond, or a spacer having 1 to 8 atoms in the main chain, Z represents an optionally protected acidic group, provided that Spacer represented by the S is

(In the group, a left-pointing arrow is bonded to X and a right-pointing arrow is bonded to Y). A PPAR agonist comprising the compound represented by formula (II), a salt thereof, an N-oxide thereof, a solvate thereof or a prodrug thereof. The spacer indicated by ring S is

(In each group, the left arrow is bonded to X, the right arrow is bonded to Y, and ring B and ring C are each independently a C5-10 monocyclic optionally having substituent (s). Represents a monocyclic heterocyclic ring having 5-10 members which may have a carbocycle or a substituent, and ring D represents a monocyclic carbocycle or substituent of C5-10 which may have a substituent. Represents a 6-10 membered monocyclic heterocyclic ring which may have, R ¹ represents a hydrogen atom or a substituent, m represents an integer of 1-4,

Represents a single bond or a double bond. The agent according to claim 1, wherein The agent according to claim 1, wherein the PPAR is PPARα and / or γ. The agent according to claim 1, which is a prophylactic and / or therapeutic agent for PPAR-mediated diseases. The agent according to claim 4, wherein the PPAR-mediated disease is a disease of abnormal sugar / lipid metabolism. The agent according to claim 1, wherein V is a cyclic group which may have a substituent. The agent according to claim 1, wherein Y is a bond. The agent according to claim 1, wherein ring A is a 5- to 7-membered monocyclic heterocyclic ring which may have a substituent. The agent according to claim 8, wherein the 5- to 7-membered monocyclic heterocycle is a 1,3-oxazole or 1,3-thiazole ring. Formula (IA)

(Wherein all symbols have the same meaning as described in claims 1 and 2). A pharmaceutical composition comprising a combination of the PPAR agonist according to claim 1 and one or more selected from anti-obesity agents, diabetes therapeutic agents and lipid improving agents. The prevention of PPAR-mediated diseases in mammals, comprising administering to the mammal an effective amount of the compound according to claim 1, its salt, its N-oxide, its solvate, or its prodrug. / Or treatment method. Use of the compound according to claim 1, a salt thereof, an N-oxide thereof, a solvate thereof, or a prodrug thereof for the manufacture of a prophylactic and / or therapeutic agent for PPAR-mediated diseases. Formula (IA)

(In the formula, ring A represents an optionally substituted cyclic group, and ring B has an optionally substituted C5-10 monocyclic carbocycle or substituent. Represents a 5- to 10-membered monocyclic heterocycle, and V represents an alkyl group which may have a substituent, an alkenyl group which may have a substituent, or an optionally substituted group. An alkynyl group or an optionally substituted cyclic group, W represents a main chain spacer having 1 to 8 atoms, X represents an oxygen atom, an optionally oxidized sulfur atom, or —NR ² represents a group, R ² represents a hydrogen atom or an optionally substituted alkyl group, Y represents a bond, or a spacer having 1 to 8 atoms in the main chain, and Z represents a protected group. An acidic group that may be present)), a salt thereof, an N-oxy thereof Body, a solvate thereof, or a prodrug thereof.