JP2005065694A - Immobilization of dna, synthetic method for protein, method for preparing protein chip and kit - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide an economical and efficient method for immobilizing DNA applicable to DNA including arbitrary gene, a method and a kit for synthesizing a protein, a method for preparing a protein chip and a kit. <P>SOLUTION: The method for immobilizing DNA comprises (1) a process for preparing an immobilized adaptor DNA wherein the adaptor DNA has a biotinyl group on a terminal and a functional terminal capable of reacting with a nucleic acid on the other terminal and the DNA is immobilized by a bond composed of the biotinyl group and an avidin on a substrate on which the avidin is arranged, (2) a process for separately preparing a target DNA containing the target gene and having a terminal capable of bonding to the functional terminal of the adaptor DNA, (3) a process for preparing the DNA immobilized on the substrate by bonding the immobilized adaptor DNA with the DNA containing the target gene. <P>COPYRIGHT: (C)2005,JPO&NCIPI

Description

  The present invention relates to a cell-free protein synthesis technology and a protein chip production technology.

  Conventionally, in genome research, many DNA chips have been developed using microarray technology for arranging a large number of DNAs on a substrate at high density. In recent proteome research, it has become possible to create protein chips using DNA chip microarray technology. Currently, protein chips are developed which are arranged and fixed at high density by spotting proteins on a substrate such as a glass slide or a membrane.

  On the other hand, as a protein synthesis method, a method for synthesizing a protein in a cell-free translation system is known as described in JP-B-7-110236.

  Furthermore, as a method for immobilizing DNA on a base material, a method is known in which DNA obtained by PCR amplification of a target gene using DNA labeled with biotin is immobilized on the base material.

Japanese Patent Publication No.7-110236

  Since proteins have a very unstable structure in which polypeptides are entangled with each other, advanced techniques are required to spot and immobilize them on a substrate. In addition, protein is denatured by a slight change in the surrounding environment, and its reactivity changes, so that conventional protein chips are extremely difficult to store.

  Therefore, an object of the present invention is to provide a method for easily synthesizing a protein when using a protein and a method for easily preparing a protein chip when using a protein chip. Another object of the present invention is to provide a kit for simply synthesizing a protein when using a protein and a kit for easily preparing a protein chip when using a protein chip.

  Furthermore, in the conventional method for immobilizing DNA on a substrate, it is necessary to prepare biotin-labeled DNA for each target gene, which is expensive.

  Thus, in addition to the above-described object, an object of the present invention is an immobilization method that can be applied to DNA containing an arbitrary gene by a kind of biotin-labeled DNA without creating a biotin-labeled DNA for each target gene. Another object of the present invention is to provide a protein synthesis method and a protein chip production method using the same. Another object of the present invention is to provide a protein synthesis kit and a protein chip preparation kit that can be adapted to DNA containing an arbitrary gene by a kind of biotin-labeled DNA.

The present invention includes the following inventions <1> to <16>.
The inventions <1> to <6> below are directed to DNA immobilization methods.

<1>
(1) An adapter DNA portion having a biotinyl group at one end and an end capable of nucleic acid ligation reaction at the other end is formed on the substrate on which avidin is arranged on the surface, and the biotinyl group and the avidin Preparing an immobilized adapter DNA immobilized by binding with
(2) separately, preparing a target DNA containing a target gene and having an end that can be linked to one end of the adapter DNA part and capable of being linked to the end of the adapter DNA portion;
(3) A method for immobilizing DNA, comprising the step of ligating the immobilized adapter DNA with DNA containing the target gene to obtain DNA immobilized on the substrate.

The following <2> and <3> describe an example of preparing the immobilized adapter DNA in <1> above.
<2>
In the step (1), the end capable of the ligation reaction is a restriction enzyme digestion end,
An adapter DNA precursor portion having a biotinyl group at one end and having a restriction enzyme recognition sequence is immobilized by binding of the biotinyl group and the avidin on a substrate on which avidin is arranged on the surface. Prepare an immobilized adapter DNA precursor,
The method for immobilizing DNA according to <1>, wherein the immobilized adapter DNA is prepared by treating the immobilized adapter DNA precursor with a restriction enzyme that cleaves the recognition sequence.
<3>
The immobilized adapter DNA precursor,
Preparing an adapter DNA precursor having a biotinyl group at one end and a restriction enzyme recognition sequence;
<2> The protein synthesis method according to <2>, wherein the adapter DNA precursor is immobilized by binding of the biotinyl group and the avidin on a substrate on which avidin is arranged.

The following <4> to <6> describe other examples of obtaining the immobilized adapter DNA in <1> above.
<4>
In the step (1),
Preparing an adapter DNA having a biotinyl group at one end and an end capable of nucleic acid ligation at the other end;
Preparing the immobilized adapter DNA by immobilizing the adapter DNA by binding the biotinyl group and the avidin on a substrate on which avidin is arranged on the surface; Synthesis method.
<5>
The end capable of the ligation reaction is a restriction enzyme digestion end,
The adapter DNA is
Preparing an adapter DNA precursor having a biotinyl group at one end and a restriction enzyme recognition sequence;
<4> The protein synthesis method according to <4>, obtained by treating the adapter DNA precursor with a restriction enzyme that cleaves the recognition sequence.
<6>
The DNA immobilization method according to <4>, wherein the adapter DNA is prepared by nucleic acid synthesis and / or complementary strand bonding so as to have an end capable of ligating the nucleic acid.

The inventions <7> to <11> below are directed to a cell-free protein synthesis method using the above DNA immobilization method.
<7>
(1) An adapter DNA portion having a biotinyl group at one end and an end capable of nucleic acid ligation reaction at the other end is formed on the substrate on which avidin is arranged on the surface, and the biotinyl group and the avidin Preparing an immobilized adapter DNA immobilized by binding with
(2) separately, preparing a target DNA containing a target gene and having an end that can be linked to one end of the adapter DNA part and capable of being linked to the end of the adapter DNA portion;
(3) obtaining the template DNA immobilized on the substrate by linking the immobilized adapter DNA and the DNA containing the target gene;
(4) a transcription system in which a transcription step for synthesizing RNA by transcribing the immobilized template DNA and a cell-free protein synthesis system in which a synthesis step for synthesizing a protein with the synthesized RNA is performed; And a method for synthesizing the protein.
<8>
<7> The protein synthesis method according to <7>, wherein the substrate is removed from the transcription system after the transfer step, or the substrate is removed from the cell-free protein synthesis system after the synthesis step.
<9>
The method for synthesizing a protein according to <7> or <8>, wherein the cell-free protein synthesis system comprises at least a reagent selected from ribosome, RNA, substrate amino acid, ATP and GTP in an aqueous buffer solution.
<10>
The method for synthesizing a protein according to any one of <7> to <9>, wherein the substrate is selected from glass, quartz, metal, resin, fiber, a substance constituting a living organism, and a semipermeable membrane.
<11>
The protein according to <10>, wherein the semipermeable membrane is selected from a dialysis membrane, a semipermeable membrane, an ultrafiltration membrane, an ultrafiltration barrier, and a membrane that can capture a target substance chemically or biologically. How to synthesize.

The inventions <12> and <13> below are directed to a protein synthesis kit.
<12>
The protein according to any one of <7> to <11>, comprising at least one item selected from the immobilized adapter DNA or a base material for preparing the immobilized adapter DNA, DNA, and a restriction enzyme A protein synthesis kit for carrying out the method for synthesizing.
<13>
The protein synthesis kit according to <12>, wherein the item further includes at least one selected from a reagent for performing cell-free protein synthesis and an aqueous buffer solution.

The invention <14> below is directed to a protein chip production method.
<14>
<7>-The method of producing a protein chip using the method of synthesize | combining the protein in any one of <11>.

The inventions <15> and <16> below are directed to a protein chip preparation kit.
<15>
The protein according to any one of <7> to <11>, comprising at least one item selected from the immobilized adapter DNA or a base material for preparing the immobilized adapter DNA, DNA, and a restriction enzyme Protein chip creation kit for creating protein chips using the method of synthesizing
<16>
The protein chip preparation kit according to <15>, wherein the item further includes at least one selected from a reagent for performing cell-free protein synthesis and an aqueous buffer solution.

  According to the present invention, it is possible to provide a method for easily synthesizing a protein when using a protein and a method for easily preparing a protein chip when using a protein chip. Further, according to the present invention, it is possible to provide a kit for easily synthesizing a protein when using a protein and a kit for easily preparing a protein chip when using a protein chip. The protein synthesized by the present invention and the protein chip prepared by the present invention can be used in a state in which the activity of the protein is high.

  Furthermore, according to the present invention, an immobilization method that can be applied to a DNA containing an arbitrary gene with a kind of biotin-labeled DNA without using a biotin-labeled DNA for each gene of interest, and using the same A protein synthesis method and a protein chip production method can be provided. In addition, according to the present invention, a protein synthesis kit and a protein chip preparation kit that can be adapted to DNA containing an arbitrary gene by a kind of biotin-labeled DNA can be provided. By using the method and kit of the present invention, it is not necessary to prepare biotin-labeled DNA for each target gene, so that the cost of protein synthesis and protein chip preparation can be reduced.

In this specification, protein is used in the meaning including oligopeptide and polypeptide.
In the present specification, the protein chip refers to a protein having a high density arranged on a substrate. Such a protein chip can be used for detecting substances such as proteins and nucleic acids that interact with the arranged proteins. The base material in this specification refers to a thin piece (chip, well), thin surface (sheet), or the like made of a material described later. Furthermore, in this specification, “arrangement” on the base material is used in the meaning including both the state of being simply placed on the base material and the state of being fixed to the base material. . Note that this does not necessarily mean that the arrangement is in an orderly manner.

  Furthermore, in this specification, DNA is used in the meaning including oligonucleotide and polynucleotide. In addition, single-stranded DNA and double-stranded DNA are included, but unless otherwise specified, double-stranded DNA is used.

First, the present invention is a method for immobilizing DNA.
In the DNA immobilization method of the present invention, DNA immobilized on a substrate is used as an adapter. Then, the immobilized DNA is obtained by linking the DNA containing the target gene to this adapter.
Specifically, the DNA immobilization method of the present invention includes the following steps (1) to (3).

(1) Prepare immobilized adapter DNA.
Here, “immobilized adapter DNA” is a state in which “adapter DNA” constituting a part thereof is immobilized on a substrate. The adapter DNA portion is DNA having a biotinyl group at one end and an end capable of nucleic acid ligation at the other end. And the avidin is arrange | positioned on the surface at the base material, The adapter DNA part is fix | immobilized on the base material by the coupling | bonding of the biotinyl group which self has, and the avidin on a base material.

(2) Prepare the target DNA separately.
In the present invention, the “target DNA” is a DNA containing a target gene and having an end capable of nucleic acid ligation at one end. This end of the target DNA can be linked to the end of the adapter DNA in (1) and is preferably in a form compatible with the end of the adapter DNA.

(3) Ligating the fixed adapter DNA and the target DNA.
The ends of both DNAs capable of ligation are ligated. Thus, DNA immobilized on the substrate is obtained. That is, the immobilized DNA obtained by the method of the present invention includes the base sequences of the adapter DNA and the target DNA, and the biotinyl group and the base material on the end on the side to which the adapter DNA is linked. It is immobilized on the substrate by binding with avidin.

  FIG. 1 is a schematic diagram showing an example of DNA immobilization by the method of the present invention. In the example of FIG. 1, the immobilized adapter DNA and the target DNA containing the GFP gene as the target gene are ligated at the restriction enzyme digestion ends with Hind III to immobilize the DNA.

  Hereinafter, the step (1) will be further described.

  The immobilized adapter DNA is not particularly limited except that it has a biotinyl group bonded to avidin on the substrate and a terminal capable of ligating nucleic acid as described above. For example, the DNA portion has a relatively long chain length. It can be a short oligonucleotide. Such an immobilized adapter DNA can be prepared by the method described later. In the present specification, “avidin” is a generic term for biotinyl group-binding proteins such as avidin and streptavidin. In addition, the terminal capable of ligating nucleic acids is not particularly limited as long as it is prepared as a terminal capable of linking nucleic acids by a covalent bond. For example, an end obtained by cleaving with a restriction enzyme (restriction enzyme digestion end) or an end artificially prepared by a method other than restriction enzyme treatment so as to have the same sequence as the desired restriction enzyme digestion end, etc. It is done.

  The material of the substrate that is fixed is not particularly limited. Examples thereof include glass, quartz, metal, resin, fiber, a substance constituting a living organism, and a semipermeable membrane. Examples of substances constituting the organism include collagen and chitin. The shape of the substrate is not particularly limited. Examples thereof include thin pieces (chips, wells), thin surfaces (sheets) that can be cut into thin pieces, and the like. A concave portion or a convex portion may be formed on the surface of the substrate. In this case, it is preferable that DNA is immobilized on the formed concave or convex portion. This form is adopted when performing protein synthesis or the like using the DNA immobilization method of the present invention.

  An example of a method for preparing the immobilized adapter DNA in the step (1) will be described below.

  First, a method of preparing a precursor (an immobilized adapter DNA precursor) for obtaining an immobilized adapter DNA, and then treating this with a restriction enzyme can be mentioned. Here, the “immobilized adapter DNA precursor” is a state in which the “adapter DNA precursor” constituting a part thereof is immobilized on a substrate. The adapter DNA precursor part is DNA having a restriction enzyme recognition sequence and having a biotinyl group at one end. And avidin is arrange | positioned on the surface at the base material, The adapter DNA precursor part is fix | immobilized on the base material by the coupling | bonding of the biotinyl group which self has, and the avidin on a base material.

  When such an immobilized adapter DNA precursor is treated with a restriction enzyme, it is cleaved at its own restriction enzyme recognition sequence to generate a restriction enzyme digested end. Examples of restriction enzymes include HindIII, BamHI, EcoRI, PstI, SacI, SacII, XhoI, and other restriction enzymes without particular limitation. A known method can be used as a treatment method with a restriction enzyme. In this way, immobilized adapter DNA can be prepared.

  FIG. 2 is a schematic diagram showing an example of a method for preparing the immobilized adapter DNA as a method for preparing the immobilized adapter DNA in FIG.

  The immobilized adapter DNA precursor prepared in the method illustrated in FIG. 2 may be prepared as follows. For example, the adapter DNA precursor is prepared (that is, a DNA having a restriction enzyme recognition sequence and a DNA having a biotinyl group at one end, which is not immobilized), and is prepared by immobilizing it on a substrate. . As a base material, what avidin is arrange | positioned on the surface is used. That is, the adapter DNA precursor is immobilized on the base material by binding of its own biotinyl group and avidin on the base material.

  Examples of the substrate on which avidin is disposed include those in which avidin is coated on the surface of the substrate. The base material is as described above. The method for binding the biotinyl group and avidin can be performed by a known method. For example, it can be carried out by adding a buffer containing an adapter DNA precursor to a substrate on which avidin is arranged and leaving it at about 37 ° C. for about 1 hour.

  FIG. 3 is a schematic diagram showing an example of a method for preparing the immobilized adapter DNA precursor as a method for preparing the immobilized adapter DNA precursor in FIG.

  The adapter DNA precursor prepared in the method illustrated in FIG. 3 can be prepared as follows. For example, a single-stranded DNA 1 containing a restriction enzyme recognition sequence and having one end biotinylated, and a single-stranded DNA 2 containing a complementary sequence of all or part of the DNA 1 and not biotinylated It is good to prepare it by making a complementary strand bond.

  Furthermore, the immobilized adapter DNA precursor prepared in the method illustrated in FIG. 2 may be prepared as follows. For example, on a substrate on which avidin is arranged, a single-stranded DNA 1 containing a restriction enzyme recognition sequence and biotinylated at one end is personalized by binding of a biotinyl group and avidin. On the other hand, a single-stranded DNA 2 containing a complementary sequence of all or part of the DNA 1 and not biotinylated may be prepared by binding with a complementary strand.

  Next, another example of the method for preparing the immobilized adapter DNA in the step (1) will be described below.

  In this example, first prepare an adapter DNA (that is, a DNA having a biotinyl group at one end and an end capable of nucleic acid ligation reaction at the other end) A method of immobilizing this on a substrate can be mentioned. The base material is as described above, and the immobilization method can be performed according to the above-described example.

  FIG. 4 is a schematic diagram showing another example of a method for preparing the immobilized adapter DNA as a method for preparing the immobilized adapter DNA in FIG.

  The adapter DNA prepared in the method illustrated in FIG. 4 is preferably prepared as follows. For example, an adapter DNA precursor (ie, a DNA having a restriction enzyme recognition sequence and having a biotinyl group at one end) is prepared and treated with a restriction enzyme. When the adapter DNA precursor is treated with a restriction enzyme, it is cleaved at its restriction enzyme recognition sequence to generate a restriction enzyme digested end. A known method can be used as a treatment method with a restriction enzyme. In this way, adapter DNA can be prepared.

  FIG. 5 is a schematic diagram showing an example of a method for preparing adapter DNA as a method for preparing adapter DNA in FIG.

  The adapter DNA precursor can be prepared by the method described above.

  As described above, the terminator capable of ligation reaction in the present invention is a terminator that is obtained by cleaving with a restriction enzyme (restriction enzyme digestion end) or a sequence that is the same as the desired restriction enzyme digestion end. It is an end prepared artificially by a method other than enzymatic treatment. Therefore, the end of the DNA prepared in step (1) capable of ligation reaction is generated as a restriction enzyme digestion end by treating the double-stranded DNA having a restriction enzyme recognition sequence with a restriction enzyme. In addition to this, it may be prepared by nucleic acid synthesis and / or complementary strand bonding so as to have such an end.

  For example, when the same end as the restriction enzyme digestion end is artificially prepared, the method is not particularly limited. For example, when double-stranded DNA is used, the end is the same sequence as the desired restriction enzyme digestion end. Can be prepared by designing a single-stranded DNA in advance and binding the designed single-stranded DNA to a complementary strand.

Therefore, the adapter DNA prepared in the method illustrated in FIG. 4 may be prepared as follows. That is, single-stranded DNAs 1 ′ and 2 ′ having a sequence that is the same sequence as the desired restriction enzyme digestion end when double-stranded DNA is used, and the other end of any one of these DNAs May be prepared by preparing a biotinylated compound and binding these with complementary strands.
Furthermore, according to this method, when the other end of either the above-mentioned single-stranded DNA 1 ′ or 2 ′ is immobilized on a substrate on which avidin is arranged, complementary strand bonding is performed (step ( The immobilized adapter DNA in 1) can be prepared.

  Hereinafter, the step (2) will be further described.

  The target DNA is not particularly limited as described above except that it has the target gene and a terminal capable of ligation reaction (however, it can be ligated to the terminal of the adapter DNA in (1)). Ends capable of ligation are as already described in the step (1). When the end capable of ligation reaction of the immobilized adapter DNA in the step (1) is a restriction enzyme digested end, the target DNA of this step usually has the same end as the restriction enzyme digested end of the immobilized adapter DNA. In order to prepare such a target DNA, a DNA having a desired gene may be prepared and subjected to a restriction enzyme treatment. The DNA having the desired gene prepared in the preparation of the target DNA can be selected without particular limitation from those that have been PCR-amplified using inexpensive DNA that is not labeled, plasmid DNA, and other DNA. it can.

  Hereinafter, the step (3) will be further described.

  Using the immobilized adapter DNA prepared in (1) and the target DNA prepared in (2), the ends capable of ligation are ligated. As a method for the ligation reaction, a known method may be used. Thereby, DNA immobilized on the substrate can be obtained. In this step, any DNA can be immobilized by preparing a target DNA containing a desired gene in the step (2).

  Since the method of the present invention employs biotinylated DNA (biotinylated DNA) as DNA that acts as an adapter, it provides the following advantages. That is, conventionally, in order to immobilize a DNA containing a desired gene, it is necessary to prepare biotinylated DNA corresponding to the number of types of the DNA. Since preparation of biotinylated DNA is costly, it has been problematic in terms of cost to prepare biotinylated DNA for each DNA containing a desired gene. On the other hand, in the present invention, since one kind of biotinylated DNA, that is, adapter DNA can be applied to any DNA containing a desired gene, it is economical and efficient.

  In the method of the present invention, the immobilized adapter DNA can be reused. For example, when the immobilized DNA obtained by the DNA immobilization method of the present invention is used for protein synthesis described below, it can be reused as follows. For example, when restriction enzyme digestion ends are linked to fix DNA, when the immobilized DNA after use is digested with a restriction enzyme, the linked target DNA can be easily removed, and at the same time, the immobilized adapter is regenerated. Then, the target DNA containing another target gene can be linked to the regenerated immobilized adapter DNA. Thus, the DNA immobilization method of the present invention is more economical and efficient because a single biotinylated DNA, that is, an adapter DNA can be reused for any DNA containing a desired gene.

Second, the present invention is a protein synthesis method.
In the protein synthesis method of the present invention, an immobilized DNA obtained by using the above-described DNA immobilization method is used as a template, and a protein is synthesized from this template. That is, the protein synthesis method of the present invention includes the following steps (1) to (4).

(1) Prepare immobilized adapter DNA.
(2) Prepare the target DNA separately.
(3) Ligating the fixed adapter DNA and the target DNA.
(4) Perform protein synthesis on the substrate.

Steps (1) to (3) are as described in the DNA immobilization method. Hereinafter, the step (4) will be further described.
In this step, the immobilized DNA obtained in (3) (hereinafter simply referred to as DNA) is used as a template, and a protein is synthesized from this template by a transcription system and a cell-free protein synthesis system. On the other hand, RNA can be synthesized from such DNA to RNA by transcription, and such RNA can be used as a template for protein synthesis by translation.

  When DNA is used as a template, RNA is synthesized by transcription of DNA genetic information in a transcription system, and protein is synthesized by RNA in a cell-free protein synthesis system, that is, a translation system. Here, RNA includes mRNA, tRNA, rRNA and the like involved in protein synthesis. As the cell-free protein synthesis system, a system containing at least a reagent such as ribosome, RNA, substrate amino acid, ATP and GTP in an aqueous buffer solution can be used without any particular limitation. For example, cell-free protein synthesis systems using cell-free extracts derived from known embryos, E. coli, rabbit reticulocytes, and other eukaryotic cells such as plants, animals, and insects can be used. These can be prepared by known methods as cell extracts for cell-free protein synthesis.

  When DNA is used as a template in the method of the present invention, after immobilizing DNA on a substrate, a transcription system and a cell-free protein synthesis system can be constructed for the immobilized DNA. As the immobilization method, a known method can be used without any particular limitation. In the present invention, double-stranded DNA is used. A plurality of different DNAs can be used so that different proteins can be obtained depending on the position on the substrate.

  RNA is synthesized from the immobilized DNA in a transcription system. The obtained RNA is involved in protein synthesis in a cell-free protein synthesis system. For example, in the case of mRNA, protein is synthesized by translating mRNA information into amino acids in a cell-free protein synthesis system. The transcription process is started by supplying a transcription reagent such as a transcriptase, and the translation process is started by supplying a translation reagent such as a cell extract for cell-free protein synthesis. In the method of the present invention, for example, after the RNA is prepared by the transcription step, the translation step can be started. Further, by allowing a translation reagent to coexist from the beginning of transcription, transcription and translation can be performed continuously. In addition, the reaction conditions in the transcription process and the translation process can be used without any particular limitation.

  When RNA is used as a template in the method of the present invention, a cell-free protein synthesis system can be constructed for the immobilized RNA after the RNA is immobilized on the substrate. As the immobilization method, a known method can be used without any particular limitation. Multiple different RNAs can be used so that different proteins can be obtained depending on the location on the substrate.

  The immobilized RNA is subjected to a cell-free protein synthesis system to synthesize a protein. For example, in the case of mRNA, a protein is synthesized by being translated into amino acids. The translation process is started by supplying a translation reagent such as a cell extract for cell-free protein synthesis. As reaction conditions in the translation step, known methods can be used without any particular limitation.

  In the present invention, the amount of all components constituting the cell-free protein synthesis system on the substrate is a very small amount, which is a scale of several μl at most. In this way, since the protein is synthesized on an extremely small scale, the produced protein can be handled as a protein chip together with the base material. By using the protein chip thus obtained for various analyses, the analysis throughput can be improved and the system can be made compact, that is, integrated.

  As described in the above DNA immobilization method, the base material in the protein synthesis method of the present invention is, for example, glass, quartz, metal, resin, fiber, biological material, semipermeable membrane, or the like. Examples of substances constituting the organism include collagen and chitin. The semipermeable membrane is selected from a dialysis membrane, a semipermeable membrane, an ultrafiltration membrane, an ultrafiltration barrier, and a membrane that can capture a target substance chemically or biologically. When the substrate is a semipermeable membrane, synthesis inhibitors generated as by-products during synthesis may be discharged through the semipermeable membrane, or amino acids and energy sources necessary for synthesis may be supplied. The protein can be obtained with higher yield.

  The shape of the base material in the protein synthesis method of the present invention is a thin piece (chip, well), a thin surface (sheet) that can be cut into thin pieces, etc., as described in the DNA immobilization method. A concave portion or a convex portion can be formed on the surface of the substrate. In this case, DNA or RNA may be immobilized on the formed concave or convex portion and used as a minute reaction field for cell-free protein synthesis. It is preferable to form such uneven portions at a high density in that, when a protein is used as a protein chip together with a substrate, a protein chip in which proteins are arranged at a high density can be obtained.

The form of the cell-free protein synthesis method of the present invention will be described with reference to FIGS. 6 and 7.
FIG. 6 is a diagram illustrating an example of an embodiment of the present invention. In FIG. 6, the base material 1 is shown as a cross section. A plurality of recesses 2 are formed on one side of the substrate 1, and a protein synthesis template 3 is immobilized in the recesses 2. Template 3 may be DNA or RNA.

  When the template 3 is DNA, a transcription reagent is supplied to the DNA. In the present specification, the supply of the reagent to the template 3 includes the following forms. That is, a mode in which the reagent is dispensed into the recess 2 where the template 3 is immobilized, or by immersing the substrate 1 in the reagent together with the immobilized template 3 separately from the above-described mode It is a form to supply. The constructed transcription system is incubated at an appropriate temperature by a known method, and RNA is synthesized. The RNA thus generated is supplied to a cell-free protein synthesis system by further supplying a translation reagent, and a protein is synthesized.

  Alternatively, a transcription reagent and a translation reagent may be supplied together with the DNA. The RNA thus generated is supplied to a cell-free protein synthesis system using the already supplied translation reagent, and a protein is synthesized.

  On the other hand, when the template 3 is RNA, a translation reagent is similarly supplied to the RNA, and a protein is synthesized.

  FIG. 7 is a diagram illustrating another example of the embodiment of the present invention. In FIG. 7, the 1st base material 11 and the 2nd base material 14 are each represented as a cross section. A plurality of concave portions 12 are formed on the upper surface 11a of the base material 11, and a plurality of convex portions 15 corresponding to the respective concave portions 12 of the base material 11 are formed on the lower surface 14a of the base material 14. A mold 13 is fixed to each convex portion 15. The template 13 may be DNA or RNA.

  When the template 13 is DNA, for example, a protein chip may be prepared as follows. A transfer reagent is supplied to the concave portion 12 of the substrate 11 by dispensing or the like. Next, the upper surface 11a of the base material 11 and the lower surface 14a of the base material 14 are overlapped so that the concave portion 12 and the convex portion 15 correspond to each other. At this time, the DNA 13 immobilized on the convex portion 15 is supplied to the transfer reagent in the concave portion 12. That is, the immobilized DNA 13 is supplied to a transcription system constructed between the concave portion 12 and the convex portion 15, and RNA is synthesized in this transcription system. It is preferable that the concave portion 12 and the convex portion 15 are formed so as to be able to secure a volume of the transcription system necessary for RNA synthesis. After the transfer is completed, the base material 14 on which the DNA 13 is fixed can be pulled up to remove the DNA 13 from the transcription system. Further, a translation reagent is supplied to the RNA produced in the recess 12 of the base material 11 by dispensing or the like to synthesize a protein.

Also, for example, both the transcription reagent and the translation reagent are supplied to the recess 12 of the base material 11 by dispensing or the like, and the upper surface 11a of the base material 11 and the lower surface 14a of the base material 14 are overlapped in the same manner as described above. A transcription system and a translation system may coexist between the concave portion 12 and the convex portion 15. At this time, in the coexisting system, protein synthesis is started simultaneously with the production of RNA. It is preferable that the concave portion 12 and the convex portion 15 are formed so as to be able to secure a volume of a transcription system and a translation system of a scale necessary for RNA synthesis and protein synthesis. The substrate 14 can be pulled up after the translation is complete.
The protein is obtained on the base material 11 by the above operation.

  When the template 13 is RNA, for example, it may be performed as follows. A translation reagent is supplied into the recess 12 of the base material 11 by dispensing or the like. Next, the upper surface 11a of the base material 11 and the lower surface 14a of the base material 14 are overlapped in the same manner as described above, and RNA 13 immobilized on the convex portion 15 of the base material 14 is supplied to the translation reagent in the concave portion 12. To do. As a result, RNA is provided to a translation system constructed between the concave portion 12 and the convex portion 15 to synthesize a protein. The concave portion 12 and the convex portion 15 are preferably formed so that a volume of a translation system having a scale necessary for protein synthesis can be secured. After the completion of translation, the base material 14 to which the RNA 13 is fixed is pulled up, and the RNA 13 is removed from the translation system. The protein is obtained on the base material 11 by the above operation.

  Proteins can be synthesized as described above. In the present invention, it is also preferable to improve efficiency by automatically controlling the steps for protein synthesis.

  Third, the present invention is a protein synthesis kit for performing the above-described protein synthesis. The protein synthesis kit of the present invention includes at least one item selected from the immobilized adapter DNA or a base material for preparing the immobilized adapter DNA, DNA, and a restriction enzyme. In the protein synthesis kit of the present invention, the DNA is selected from the adapter DNA, the adapter DNA precursor, the single-stranded DNA 1, 2, 1 ′, 2 ′, etc. described in the DNA immobilization method. These DNAs may be immobilized on a substrate.

  Furthermore, in addition to the item, at least one selected from reagents that perform a ligation reaction for preparing template DNA may be included. Such a reagent is not particularly limited and includes those generally used for ligation reactions.

  Furthermore, in addition to the item, at least one selected from a reagent for performing cell-free protein synthesis and an aqueous buffer solution may be contained. Examples of such reagents include ribosomes, RNAs, substrate amino acids, ATP, GTP and the like as described above. These may be contained as a generally known extract for cell-free protein synthesis. Other reagents include transcription reagents, translation reagents, and the like.

  In performing cell-free protein synthesis, as described above, in the case of using a plurality of base materials, a base material for protein synthesis may be included in addition to the base material for DNA immobilization.

  All of these items can be stored and used for protein synthesis as described above whenever protein is needed. Therefore, using the kit of the present invention, a protein can be synthesized every time it is necessary to use the protein. For this reason, a required protein can be used in a highly active state. Further, as already described in the DNA immobilization method, it can be reused by regenerating the immobilization adapter and ligating DNA containing another target gene. For this reason, it is very economical and efficient to use the protein synthesis kit of the present invention.

  Fourth, the present invention is a method for producing a protein chip using the protein synthesis method described above. For example, the protein obtained as described above can be used as a protein chip together with a substrate. At this time, the protein chip can be used without going through a special purification step. For example, when only looking at the activity of the target protein, special purification may not be required. On the other hand, there may be some degree of purification. In this case, for example, purification is performed as follows. First, a first base material and a second base material are prepared. Next, a DNA having a tag sequence is prepared so that a tag is attached to the protein to be obtained, and used in the above-described method using the first substrate. This produces a tagged protein on the first substrate. Further, a substance that specifically captures the tag is disposed on the second substrate. When both substrates are superimposed, the tagged protein is immobilized on the second substrate via the tag. That is, only the protein is transferred from the first substrate to the second substrate. The transferred tagged protein can be used as a protein chip with the second substrate.

  In the method of the present invention, a protein chip may be prepared so that the produced protein is immobilized on a substrate. As the immobilization method, a known method can be used without any particular limitation. For example, a method of immobilizing the substrate as it is, a method of immobilizing by the method of synthesizing the above-mentioned tagged protein, a membrane having permeability with respect to the reagent solution on the substrate, and immobilizing by sucking the solution after protein synthesis And the like.

  As described above, a protein chip can be prepared. In the present invention, it is also preferable to improve efficiency by automatically controlling a process for producing a protein chip.

  Fifth, the present invention is a protein chip preparation kit including a base material for preparing a protein chip using the protein synthesis method described above. The protein chip preparation kit of the present invention includes at least one item selected from the immobilized adapter DNA or a base material for preparing the immobilized adapter DNA, DNA, and a restriction enzyme. In the protein chip preparation kit of the present invention, the DNA is selected from the adapter DNA, the adapter DNA precursor, the single-stranded DNA 1, 2, 1 ′, 2 ′, etc. described in the DNA immobilization method. These DNAs may be immobilized on a substrate.

  Furthermore, in addition to the item, at least one selected from reagents that perform a ligation reaction for preparing template DNA may be included. Such a reagent is not particularly limited and includes those generally used for ligation reactions.

  Furthermore, in addition to the item, at least one selected from a reagent for performing cell-free protein synthesis and an aqueous buffer solution may be contained. Examples of such reagents include ribosomes, RNAs, substrate amino acids, ATP, GTP and the like as described above. These may be contained as a generally known extract for cell-free protein synthesis. Other reagents include transcription reagents, translation reagents, and the like.

  When performing cell-free protein synthesis for preparing a protein chip, as described above, when using a plurality of base materials, in addition to the base material for DNA immobilization, a separate base material may be included. . Furthermore, the base material for immobilizing the produced | generated protein may be contained.

  In order to produce a protein chip, as already described, when a protein is produced to some extent, a base for preparing a protein chip may be included in addition to the base for immobilizing DNA.

  All of these items can be stored and used for cell-free protein synthesis as described above whenever a protein chip is required. Therefore, when the kit of the present invention is used, a protein chip can be prepared each time a protein chip needs to be used. For this reason, a protein chip can be used in a state with high protein activity. Further, as already described in the DNA immobilization method, it can be reused by regenerating the immobilization adapter and ligating DNA containing another target gene. For this reason, it is very economical and efficient to use the protein chip preparation kit of the present invention.

  In this example, DNA was immobilized on a substrate, and a cell-free (in vitro) protein synthesis reaction was performed on the substrate. Since the immobilized DNA contains a transcription control sequence, the target protein can be synthesized by adding an E. coli cell extract.

  In this example, DNA immobilization was performed by the method shown as a schematic diagram in FIG.

The following were prepared.
・ Streptavidin coated plate (Nalge-Nunc)
Oligonucleotide 1:
bCTTTTCCCAGTCACGACAAGCTTCATGGAC (SEQ ID NO: 1)
However, bC represents biotinylated cytosine. In addition, it contains a HindIII recognition sequence.
Oligonucleotide 2:
GTCCATGAAGCTTGTCGTGACTGGG (SEQ ID NO: 2)
・ Cell-free protein synthesis extract: Escherichia coli extract RTS (Roche)
Plasmid for GFP (green fluorescent protein) synthesis: pIVEX control vector GFP (attached to RTS kit, manufactured by Roche)
・ Restriction enzymes HindIII, EcoRI
・ Ligation kit ver.2 (Takara Shuzo)
・ Cleaning buffer (50mM HEPES-Na pH7.5, 0.5MNaCl, 1v / v% Tween 20)

[1. Binding of biotinylated oligonucleotide to streptavidin plate]
Oligonucleotide 1 (500 pmol) and oligonucleotide 2 (500 pmol) were diluted with a washing buffer to a volume of 60 μl. Oligonucleotide annealing was performed by reducing the temperature to 4 ° C. at 0.1 ° C./second after treatment at 98 ° C. for 5 minutes. Next, the annealed 5 ′ biotinylated double-stranded DNA fragment (adapter DNA precursor) was added to the well of a streptavidin-coated plate and adsorbed at 37 ° C. for 1 hour. Unreacted oligonucleotides were removed from the wells by washing 5 times with 100 μl wash buffer. Thus, an oligonucleotide (immobilized adapter DNA precursor) bound to the well was obtained.

[2. Restriction enzyme treatment]
60 μl of a HindIII reaction solution (medium buffer, HindIII 10U) was added to the oligonucleotide (immobilized adapter DNA precursor) bound to the well, and a cleavage reaction was performed at 37 ° C. for 1 hour. After the reaction, the well was washed 5 times with 100 μl of washing buffer, the buffer was removed, and a restriction enzyme-treated oligonucleotide (immobilized adapter DNA) immobilized on the well was obtained.

  Separately, 5 μg of a control vector containing GFP (pIVEX control vector GFP) was cleaved under the same conditions as described above using a HindIII reaction solution. After the reaction, phenol / chloroform extraction and ethanol precipitation were performed, and the precipitate was dissolved in 15 μl of pure water to obtain a restriction enzyme-treated vector (target DNA) solution.

[3. Ligation of immobilized oligonucleotide and vector containing GFP gene]
15 μl of the above-mentioned restriction enzyme-treated vector solution, 15 μl of ligation kit I solution and 30 μl of II solution were added to the wells on which the restriction enzyme-treated oligonucleotide was immobilized, and stirred. The well was left at 12 ° C. for 1 hour to perform a ligation reaction. After the reaction, the wells were washed 5 times with 100 μl of washing buffer. Thereafter, the buffer was removed, and ligated DNA (immobilized DNA) immobilized on the well was obtained.

[4. In vitro protein synthesis reaction]
10 μl of pure water was added to the wells on which the ligated DNA had been immobilized, followed by the necessary reagents of the RTS protein synthesis system. The composition of the reagents was in accordance with the Roche manual. As a positive control, GFP was synthesized by the RTS system using 0.5 μg of pIVEX control GFP vector as an unimmobilized template. The negative control was treated under the same conditions except that no template DNA was added. After a synthesis reaction at 30 ° C. for 6 hours, the fluorescence intensity of the product was measured with a microplate reader (manufactured by TECAN, GENios) (excitation wavelength 395 nm, emission wavelength 504 nm).

[result]
Each fluorescence intensity (relative fluorescence intensity; RFU) is as follows.
Positive control ... 2421
Immobilized DNA ... 1561
Negative control ... 225

  As this result shows, it was clear that GFP was synthesized from the DNA immobilized on the plate because the method according to the present invention showed about 60% fluorescence compared to the positive control. became. It is thought that the method of the present invention can also react with other genes. According to the RTS manual, GFP synthesis at around 250 μg / ml is possible when a linearized control vector is used. From this, it is considered that GFP synthesis of 100 μg / ml or more is possible even from a DNA template immobilized by this method.

It is a figure showing one form of the DNA immobilization method of this invention. In one form of the DNA immobilization method of this invention, it is a figure showing an example of the method of preparing immobilization adapter DNA. FIG. 3 is a diagram showing a method for preparing an immobilized adapter DNA precursor in an example of a method for preparing an immobilized adapter DNA. FIG. 4 is a diagram showing another example of a method for preparing immobilized adapter DNA in one embodiment of the DNA immobilization method of the present invention. It is a figure showing the method of preparing adapter DNA in another example of the method of preparing fixed adapter DNA. It is a figure showing one embodiment of the protein synthesis method of the present invention. It is a figure showing one embodiment of the protein synthesis method of the present invention. It is a figure showing the immobilization method of DNA by a present Example.

Explanation of symbols

DESCRIPTION OF SYMBOLS 1 Base material 2 Recessed part 3 Mold 11 Base material 11a Upper surface of the base material 12 Recessed part 13 Mold 14 Base material 14a Lower surface of the base material 15 Convex part

SEQ ID NO: 1 is a linking oligonucleotide for linking a target DNA to a substrate coated with streptavidin.
SEQ ID NO: 2 is an oligonucleotide having a sequence complementary to the partial sequence of the oligonucleotide identified in SEQ ID NO: 1.

Claims (16)

(1) An adapter DNA portion having a biotinyl group at one end and an end capable of nucleic acid ligation reaction at the other end is formed on the substrate on which avidin is arranged on the surface, and the biotinyl group and the avidin Preparing an immobilized adapter DNA immobilized by binding with
(2) separately, preparing a target DNA containing a target gene and having an end that can be linked to one end of the adapter DNA part and capable of being linked to the end of the adapter DNA portion;
(3) A method for immobilizing DNA, comprising the step of ligating the immobilized adapter DNA with DNA containing the target gene to obtain DNA immobilized on the substrate. In the step (1), the end capable of the ligation reaction is a restriction enzyme digestion end,
An adapter DNA precursor portion having a biotinyl group at one end and having a restriction enzyme recognition sequence is immobilized by binding of the biotinyl group and the avidin on a substrate on which avidin is arranged on the surface. Prepare an immobilized adapter DNA precursor,
The method of immobilizing DNA according to claim 1, wherein the immobilized adapter DNA is prepared by treating the immobilized adapter DNA precursor with a restriction enzyme that cleaves the recognition sequence. The immobilized adapter DNA precursor,
Preparing an adapter DNA precursor having a biotinyl group at one end and a restriction enzyme recognition sequence;
The method for immobilizing DNA according to claim 2, wherein the adapter DNA precursor is obtained by immobilizing the biotinyl group and the avidin on a substrate on which avidin is arranged. In the step (1),
Preparing an adapter DNA having a biotinyl group at one end and an end capable of nucleic acid ligation at the other end;
The DNA of claim 1, wherein the adapter DNA is prepared by immobilizing the adapter DNA by binding the biotinyl group and the avidin on a substrate on which avidin is arranged. Immobilization method. The end capable of the ligation reaction is a restriction enzyme digestion end,
The adapter DNA is
Preparing an adapter DNA precursor having a biotinyl group at one end and a restriction enzyme recognition sequence;
The method for immobilizing DNA according to claim 4, which is obtained by treating the adapter DNA precursor with a restriction enzyme that cleaves the recognition sequence. The method for immobilizing DNA according to claim 4, wherein the adapter DNA is prepared by nucleic acid synthesis and / or complementary strand bonding so as to have an end capable of ligating the nucleic acid. (1) An adapter DNA portion having a biotinyl group at one end and an end capable of nucleic acid ligation reaction at the other end is formed on the substrate on which avidin is arranged on the surface, and the biotinyl group and the avidin Preparing an immobilized adapter DNA immobilized by binding with
(2) separately, preparing a target DNA containing a target gene and having an end that can be linked to one end of the adapter DNA part and capable of being linked to the end of the adapter DNA portion;
(3) obtaining the template DNA immobilized on the substrate by linking the immobilized adapter DNA and the DNA containing the target gene;
(4) a transcription system in which a transcription step for synthesizing RNA by transcribing the immobilized template DNA and a cell-free protein synthesis system in which a synthesis step for synthesizing a protein with the synthesized RNA is performed; And a method for synthesizing the protein. The method of synthesizing a protein according to claim 7, wherein the substrate is removed from the transcription system after the transfer step, or the substrate is removed from the cell-free protein synthesis system after the synthesis step. The method of synthesizing a protein according to claim 7 or 8, wherein the cell-free protein synthesis system contains at least a reagent selected from ribosome, RNA, amino acid of substrate, ATP and GTP in an aqueous buffer solution. The method for synthesizing a protein according to any one of claims 7 to 9, wherein the substrate is selected from glass, quartz, metal, resin, fiber, a substance constituting a living organism, and a semipermeable membrane. The protein according to claim 10, wherein the semipermeable membrane is selected from a dialysis membrane, a semipermeable membrane, an ultrafiltration membrane, an ultrafiltration barrier, and a membrane capable of capturing a target substance chemically or biologically. How to synthesize. The immobilized adapter DNA, or
The method for synthesizing a protein according to any one of claims 7 to 11, comprising at least one item selected from a base material for preparing the immobilized adapter DNA, DNA, and a restriction enzyme. Protein synthesis kit. The protein synthesis kit according to claim 12, wherein the item further includes at least one selected from a reagent for performing cell-free protein synthesis and an aqueous buffer solution. The method to produce a protein chip using the method of synthesize | combining the protein of any one of Claims 7-11. The immobilized adapter DNA, or
A protein using the method for synthesizing a protein according to any one of claims 7 to 11, comprising at least one item selected from a base material for preparing the immobilized adapter DNA, DNA, and a restriction enzyme. Protein chip creation kit for creating chips. The protein chip preparation kit according to claim 15, wherein the item further includes at least one selected from a reagent for performing cell-free protein synthesis and an aqueous buffer solution.

Images