JP2005065661A - ROLE OF Id IN ACTIVATION OF VEGF-INDUCING PROPERTY IN HUMAN BLOOD VESSEL ENDOTHELIAL CELL AND IN ANGIOGENESIS - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for promoting and inhibiting the angiogenesis in endothelial cells. <P>SOLUTION: This method for inhibiting the angiogenesis by inhibiting Id protein expression in the blood vessel endothelial cells and the method for promoting the angiogenesis by inducing the expression of the Id protein in the blood vessel endothelial cells are provided. The shRNA designed by taking sequences starting with "aa" or "a" from the vicinity of 5'-terminal in an objective mRNA for inhibiting the expression, as a target sequence, the medicinal composition containing the shRNA and the medicinal composition containing a gene encoding the Id protein are also provided. <P>COPYRIGHT: (C)2005,JPO&NCIPI

Description

  The present invention relates to a method for promoting or inhibiting angiogenesis by regulating the expression of Id protein in endothelial cells.

  Rheumatoid arthritis (RA) is a disease characterized by joint inflammation followed by bone and cartilage destruction and is expected to involve autoimmunity. In RA, abnormal proliferation of fibroblast-like synovium and accompanying migration of inflammatory cells to the joint site (Non-patent Document 1) and infiltration into the synovium, production of inflammatory cytokines (Non-patent Document 2), It is known that phenomena such as angiogenesis (Non-patent Document 3) occur in the field of joint destruction.

  In a previous study, the present inventor has compared the mRNA expression profiles in RA and osteoarthritis (OA) synovial tissues to identify the ID (inhibitor of DNA binding / differentiation) genes in RA synovial tissues. It was found that expression is enhanced, and Id1 and Id3 proteins are localized in vascular endothelial cells in RA synovial tissue (Non-patent Document 4). The Id protein is a molecular group composed of Id1 to Id4, all having a helix loop-helix (HLH) domain, but lacking a basic region necessary for binding to DNA (Non-Patent Document) 5). Originally, Id protein has been identified as a dominant negative antagonist molecule against basic HLH transcription factors such as MyoD and Rb for structural reasons (Non-Patent Documents 5 and 6) and is very important in the process of differentiation. (Non-Patent Documents 7, 8, 9, 10, and 11). These molecules are known to be strongly expressed in embryonic tissues and some cancer cells (Non-patent Document 12), but their expression is known to be suppressed at the differentiation stage ( Non-patent documents 13, 14). Id also controls cell proliferation and cell cycle advancement (for example, transition from G1 phase to S phase) (Non-patent Document 15).

  So far, Id directly binds to Ets1, Ets2, or bHLH transcription factors that promote transcription of the promoter region of the p16 gene that regulates the cell cycle and inhibits its action, and expression of p16 protein (Non-patent Document 16) It is known to inhibit cell cycle arrest by suppressing. According to previous reports, it is known that transcription of Id3 is induced by receiving a Ras-ERK MAPK cascade (Non-patent Document 17) and a signal of Smad1 / 5 (Non-patent Document 18).

Recent research has revealed new functions of Id other than the above. For example, in Id1 ^+/− Id3 ^{− / −} mice, angiogenesis necessary for the growth of transplanted tumor tissue did not occur (Non-patent Document 19), and cancer progression did not progress. This indicates that the presence of Id1 and Id3 is essential for angiogenesis in mature tissues. In adult tissues, angiogenesis is not only a phenomenon that occurs in cancer, but is also a phenomenon that is observed for chronic inflammatory diseases such as RA.

  On the other hand, since angiogenesis was suppressed in cancer in ID gene knockout mice, it has been described that the ID gene has a potential therapeutic target for proliferative diseases associated with angiogenesis (WO01 / 66784: Patent) Reference 1). An antisense compound targeting the ID gene is also disclosed (US Pat. No. 6,372,433: Patent Document 2).

However, the importance of Id associated with human inflammatory diseases is not known.
International Publication No. 01/66784 Pamphlet US Pat. No. 6,372,433 Firestein, GS Arthritis Rheum. 39, 1781-1790 (1996) Feldmann, M. et al. Cell 85, 307-310 (1996) Koch, AE Arthritis Rheum. 41, 951-962 (1998) Sakurai, D. et al. Biochem. Biophys. Res. Commun. 284, 436-442 (2001) Benezra, R. et al. Cell 61, 49-59 (1990) Lasorella, A. et al. Nature 407, 592-598 (2000) Wilson, RB et al. Mol. Cell Biol. 11, 6185-6191 (1991) Sun, XH et al. Mol. Cell Biol. 11, 5603-5611 (1991) Hara, E. et al. J. Biol. Chem. 269, 2139-2145 (1994) Cooper, CL et al. Blood 89, 3155-3165 (1997) Norton, JD et al. Trends Cell Biol. 8, 58-65 (1998) Lasorella, A. et al. Oncogene 20, 8326-8333 (2001) Rivera, R. & Murre, C. Oncogene 20, 8308-8316 (2001) Yokota, Y. Oncogene 20, 8290-8298 (2001) Zebedee, Z. & Hara, E. Oncogene 20, 8317-8325 (2001) Ohtani, N. et al. Nature 22, 1067-1070 (2001) Bain, G. et al. Nat. Immunol. 2, 165-171 (2001) Ota, T. et al. J. Cell Physiol. 193, 299-318 (2002) Lyden, D. et al. Nature 401, 670-617 (1999)

  An object of the present invention is to provide a method for promoting or inhibiting angiogenesis in endothelial cells.

  As a result of intensive studies to solve the above problems, the present inventor succeeded in solving the above problems by promoting or inhibiting the expression of Id protein, thereby completing the present invention.

  That is, the present invention is as follows.

 (1) A method for inhibiting angiogenesis, comprising suppressing the expression of Id protein in vascular endothelial cells (for example, human umbilical vein-derived vascular endothelial cells (HUVEC), the same applies hereinafter).

  In this case, suppression of Id protein expression can utilize RNA interference (RNAi), for example, short hairpin RNA (shRNA). The expression of Id1 and / or Id3 protein is suppressed by shRNA.

Examples of the shRNA include ID1 shRNA and / or ID3 shRNA. The ID1 shRNA can be exemplified by at least one selected from the group consisting of any of the nucleotide sequences shown in SEQ ID NOs: 1 to 5, and the ID3 shRNA can be any of those shown in SEQ ID NOs: 6-8. Examples thereof include at least one selected from the group consisting of those containing the nucleotide sequence.
(2) A method for promoting angiogenesis, which comprises inducing expression of Id protein in vascular endothelial cells (for example, HUVEC).

  When angiogenesis promoting factors such as vascular endothelial growth factor (VEGF) and transforming growth factor β (TGFβ) are allowed to act on vascular endothelial cells, the expression of Id protein can be induced. The Id protein from which expression is induced is, for example, an Id1 protein and / or an Id3 protein.

 (3) shRNA designed using a sequence beginning with “aa” or “a” from the vicinity of the 5 ′ end in the target mRNA to inhibit expression as a target sequence.

The shRNA is preferably composed of a sequence having a length of 72 bases or less. Examples of the shRNA used in the present invention include ID1 shRNA and ID3 shRNA. ID1 shRNA is at least one selected from the group consisting of any one of the nucleotide sequences shown in SEQ ID NOs: 1 to 5, and ID3 shRNA is any one of the nucleotide sequences shown in SEQ ID NOs: 6 to 8. Is at least one selected from the group consisting of: These shRNAs can inhibit target mRNA expression by RNAi.
(4) A pharmaceutical composition comprising the shRNA according to (3).

The pharmaceutical composition can be used, for example, as a gene therapy agent. Examples of the disease to be treated include rheumatoid arthritis.
(5) A pharmaceutical composition comprising a gene encoding an Id protein.

  The pharmaceutical composition can be used, for example, as a gene therapy agent. The disease to be treated is, for example, a circulatory system disease.

  The present invention provides a method for regulating (promoting or inhibiting) the expression of Id protein. Inhibiting the expression of Id protein is useful as a novel therapeutic method for RA, for example, because it can cause inhibition or suppression of angiogenesis.

  Hereinafter, the present invention will be described in detail.

The present invention provides a method of promoting angiogenesis by inducing the expression of Id protein (also simply referred to as Id) in vascular endothelial cells. Also provided is a method of inhibiting angiogenesis by suppressing Id protein expression in endothelial cells.
1. Overview Abnormal growth of synovial tissue is observed in joints, which are the mainstay of rheumatoid arthritis (RA) lesions, and angiogenesis is known to be an important step in synovial cell proliferation. Previously, the present inventor reported that the expression of an Id protein-encoding gene (ID gene (also simply referred to as ID)) is elevated in vascular endothelial cells in RA patient-derived synovial tissue. Therefore, in the present invention, in order to clarify the role of Id in angiogenesis, by performing functional analysis of Id using human umbilical vein-derived vascular endothelial cells (HUVEC), chronic inflammation that is important in the pathology of RA and We investigated the relationship between angiogenesis and the action of Id in vascular endothelial cells.

  The present inventor believes that the overexpression of Id in vascular endothelial cells in the RA synovium means that Id is involved in inflammation and angiogenesis typically seen in RA synovial tissue. It was. And, because Id is observed only in very weak expression in adult tissues other than proliferating cells, I think that suppression of angiogenesis by controlling Id could be an effective therapeutic target for RA. It was.

  Therefore, in the present invention, whether forced expression of Id can induce activation and angiogenesis of cultured vascular endothelial cells, and conversely, suppression of Id expression can inhibit activation of vascular endothelial cells and angiogenesis by VEGF. We examined two points.

  Endothelial cells used in the present invention are a generic term for a single layer of flat cells covering the inner walls of blood vessels and lymphatic vessels, and are not limited to these types. For example, human umbilical vein endothelial cells (HUVEC), human umbilical artery endothelial cells (HUAEC), intratumoral microvessels and the like can be mentioned.

  In the present invention, the following matters can be explained by the results of model experiments using HUVEC.

  Stimulation of vascular endothelial cells such as HUVEC with vascular endothelial growth factor (VEGF) or transforming growth factor β (TGF-β) induces Id3 expression. Induction of Id3 expression by stimulation of angiogenesis-promoting factors VEGF and TGF-β indicates that Id is involved in the mechanism of angiogenesis. In addition, overexpression of Id can induce HUVEC proliferation, activation and angiogenic properties with Id alone, comparable to that induced when VEGF stimulated HUVECs not transfected with ID. is there.

  In addition to the increased proliferation of HUVEC, forced expression of Id3 enhances cell surface expression of ICAM-1 and E-selectin, further increases cell migration ability, and matrix metalloprotease (MMP) that degrades collagen ) 2 and MMP9 expression induction and increased angiogenesis phenotype, such as increased lumen formation.

  In contrast, when the expression of Id1 and Id3 in HUVEC is suppressed by RNA interference (RNAi), etc., the increase in HUVEC cell proliferation and the induction of angiogenic phenotype can be suppressed even under VEGF stimulation. That is, knocking down ID1 and ID3 in HUVEC can almost completely eliminate the proliferation, activation and angiogenesis induced by VEGF. These results indicate that Id plays an important role in the VEGF signaling pathway of HUVEC. Since Id is expressed in endothelial cells of RA synovial tissue but not in osteoarthritis (OA) endothelial cells (Sakurai, D. et al. Biochem. Biophys. Res. Commun. 284 436-442 (2001)), the findings obtained by the present invention indicate that Id is strongly involved in inflammation and angiogenesis in RA synovium.

From the above results, Id is considered to have an essential role in VEGF-induced vascular endothelial cell activation and angiogenesis in vascular endothelial cells, and is a new therapeutic target for RA.
2. By the way, experiments using Id1 ^+/− Id3 ^{− / −} mice (mice having ID1 knockout hetero and ID3 knockout homo) have shown the following. (1) Id expression is required to maintain angiogenesis in tumors (Lyden, D. et al. Nature 401, 670-617 (1999)), and (2) VEGFR1 expressing Id ⁺ Supplementation of BM-derived endothelial progenitor cells (VEGF receptor 1-positive bone marrow-derived endothelial progenitor cells) is necessary for tumor growth (Lyden, D. et al. Nat. Med. 7, 1194-1201 (2001) )). However, the importance of Id associated with human inflammatory diseases such as rheumatism has not been known so far.

  Previous reports have shown that Id regulates the cell cycle in several ways (Zebedee, Z. & Hara, E. Oncogene 20, 8317-8325 (2001)). For example, methods that bind to Rb protein and block its tumor suppressor function (Bain, G. et al. Nat. Immunol. 2, 165-171 (2001)), as well as promote transcription of the p16 gene promoter region Method to suppress p16 expression by inhibiting the binding of Est1 and Est2 transcription factors to the p16 promoter and inhibit cell cycle arrest (Ohtani, N. et al. Nature 22, 1067-1070 (2001)), etc. It is. In the present invention, it was shown that at least the latter mechanism of action is functioning in HUVEC.

  As described above, ICAM-1 and E-selectin, whose expression on the cell surface is increased by forced expression of Id, are known to be strongly expressed in endothelial cells in RA synovium (Szekanecz, Z et al. Arthritis Rheum. 37, 221-231 (1994), Koch, AE et. al. Lab Invest. 64, 313-320 (1991)). These molecules are important in recruiting inflammatory cells to synovial tissue (Cutolo, M. et. Al. Clin. Exp. Rheumatol. 11, 331-339 (1993)).

  Thus, Id expression in synovial endothelial cells is not only involved in angiogenesis, but may also be involved in the initiation and / or perpetuation of chronic inflammation.

Treatment of HUVEC with VEGF or TGF-β induces Id expression. Id3 expression is induced by the Ras-ERK pathway in thymocytes (Bain, G. et al. Nat. Immunol. 2, 165-171 (2001)) and in TUV-β pathway type I receptors in HUVEC Is induced by Smad1 / 5 signaling (Ota, T. et al. J. Cell Physiol. 193, 299-318 (2002)). On the other hand, Id1 expression is associated with Raf / MEK1 / 2 activation in human prostate cancer cell lines (Ling, MT et. Al. Oncogene 21, 8498-8505 (2002)) and Smad1 / in HUVEC. 5 is associated with signal transduction (Ota, T. et al. J. Cell Physiol. 193, 299-318 (2002)). In addition, the MAPK cascade exists downstream of the VEGF signaling pathway (Takahashi, T. et. Al. Oncogene 18, 2221-2230 (1999)). On the other hand, stimulation with IL-1β, IL-8 or TNF-α does not induce Id3 in HUVEC. This indicates that Id is not a ubiquitous inflammatory mediator but is more specifically related to signal transduction pathways leading to angiogenesis.
3. Design of RNA for suppression of ID gene expression
In order to suppress the expression of the ID gene, RNA interference (RNAi) can be used. RNAi is a phenomenon in which dsRNA (double-strand RNA) specifically and selectively binds to a target gene and efficiently cleaves the target gene by cleaving the target gene. For example, when dsRNA is introduced into a cell, expression of a gene having a homologous sequence with that RNA is suppressed (knocked down).

  When knocking down ID, in the present invention, either ID1 or ID3 can be knocked down, but both may be knocked down (double knockdown). Double knockdown is preferred because ID1 and ID3 have similar promoter region sequences and have been shown to play common biochemical functions and roles.

  Double knockdown of both ID1 and ID3 blocks almost all of the total angiogenic properties induced by VEGF in HUVEC. This means that Id2 and Id4 are independent of angiogenesis signaling induced by VEGF.

  In order to suppress the expression of the ID gene, for example, shRNA (short hairpin RNA) or siRNA (small interfering RNA) for the ID gene may be designed and synthesized, and this may be used to cause RNAi. shRNA is a small RNA molecule folded into a hairpin structure and has a stem-loop structure in which the sense strand and antisense strand are connected by a loop. On the other hand, siRNA is a short RNA produced by processing by Dicer in cells. Both shRNA and siRNA are used as RNAi effectors.

  The design criteria for shRNA are as follows.

  (a) ID1 and ID3 shRNA sequences used for RNAi are designed from the 5 ′ end region specific to each gene to 300 bases (Elbashir, SM et. al. Genes Dev. 15, 188-200 ( 2001)).

  (b) From the region near the 5 ′ end of each gene transcript, an mRNA sequence starting from aa or a is selected and designed as a target sequence. The length of the target region is not particularly limited, and is preferably 30 bp or less, more preferably about 18 to 25 bp.

  (c) Predict the secondary structure of the target sense strand-loop-target antisense strand and design appropriately so that a stable stem-loop structure can be formed. The loop sequence can be 7-12 bases.

  Specifically, the following base sequence is used as a target sequence, and the entire target sequence is 72 bases or less, for example, 43 to 72 bases in length (preferably 45 to 67 bases in length). Can be used as shRNA. Of the following base sequences, it is preferable to target the sequence (iii) for ID1 shRNA and the sequence (i) for ID3 shRNA in terms of the highest inhibition efficiency.

ID1 shRNA
(i) aacuguuccauuuuccguauc (SEQ ID NO: 1)
(ii) aaucaugaaagucgccagugg (SEQ ID NO: 2)
(iii) aagaaucaugaaagucgccag (SEQ ID NO: 3)
(iv) aaggccggcaagacagcgagc (SEQ ID NO: 4)
(v) aagucgccaguggcagcaccg (SEQ ID NO: 5)
ID3 shRNA
(i) aaccucacagcaccucacuu (SEQ ID NO: 6)
(ii) aaggcgcugagcccggugcgc (SEQ ID NO: 7)
(iii) aauggauccugcaccacggga (SEQ ID NO: 8)
The design criteria for siRNA are as follows.

  (a) Select a region downstream of the start codon of the gene encoding Id. The sequence is not particularly limited as long as it is a sequence downstream from the start codon, and any region can be used as a candidate.

  (b) From the selected region, a sequence of 15 to 30 bases, preferably 18 to 25 bases starting from aa is selected, and a sequence having a GC content of, for example, 20 to 80% is selected. In the present invention, all the sequences listed as the shRNA can be used as siRNA target sequences.

  In order to introduce siRNA and shRNA into vascular endothelial cells, it is possible to adopt a method in which siRNA and shRNA synthesized in vitro are linked to plasmid DNA and introduced into cells, or two RNAs are annealed. it can.

As described above, HUVEC with double knockdown of ID significantly suppresses angiogenesis. Inhibition of angiogenesis can be explained by decreased expression of α ₂ and β ₁ integrins with laminin, the main component of Matrigel (Dickeson, SK et. Al. Cell Adhes. Commun. 5, 273-281 (1998) Davis, GE et. Al. Exp. Cell Res. 216, 113-123 (1995)). Thus, Id is thought to be involved in multiple pathways leading to endothelial cell activation and angiogenesis. Since the functions of Id1 and Id3 are substantially common (Yokota, Y. Oncogene 20, 8290-8298 (2001), Norton, JD et. Al. Trends Cell Biol. 8, 58-65 (1998)) Paths from proteins to numerous endothelial cell activation and angiogenic properties can be drawn.

  Id1 was recently reported to down-regulate the expression of thrombospondin 1 (TSP-1), an inhibitor of angiogenesis (Volpert, OV et. Al. Cancer Cell 2, 473-483 (2002)). . Thus, all angiogenic processes associated with Id can be considered from the perspective of TSP-1 down-regulation.

In conclusion, the inventor has shown that Id plays an essential role in VEGF-induced HUVEC activation and angiogenesis. (a) Endothelial cell activation and angiogenesis are inhibited by RNAi, (b) in healthy adult tissues, the expression of Id is low in most of them, and (c) Id is converted into diseased tissue by intra-articular injection. Since it can be administered, Id is considered to be a target for developing new therapies for cell proliferative diseases such as RA.
4). Pharmaceutical Composition Nucleic acids such as shRNA and siRNA produced in the present invention are used as a pharmaceutical composition for treating immune system diseases, cell proliferative diseases, or angiogenic diseases such as diabetic retinopathy and macular degeneration. can do.

  When the nucleic acid of the present invention is used as a gene therapy agent for a cell proliferative disease, for example, a disease occurring in the following tissues can be used for the specific purpose of treatment or prevention.

Digestive system: oral cavity, pharynx, esophagus, stomach, small intestine, large intestine, liver, pancreas, etc. Respiratory system: trachea, bronchi, lung, etc. Urinary system: kidney, bladder, etc. Cardiovascular system: heart, artery, vein Lymphatic system: lymph Tube, lymph node, spleen, thymus Sensory system: visual organ, auditory organ Central nervous system: brain (cerebrum, diencephalon, midbrain, cerebellum), medulla, spinal cord Skeletal system: skull, spine, rib, sternum, upper limb bone , Humerus, lower limb bone, femur, joint, etc. Muscle: Skeletal muscle, smooth muscle, etc. Other: Skin, teeth, gingiva These diseases may be isolated or combined, other than those mentioned above The above-mentioned diseases may be combined, and any of them can be used for the pharmaceutical composition of the present invention. In the present invention, for example, it is preferable to prevent or treat rheumatoid arthritis.

  In the present invention, a gene encoding Id protein can be used as a pharmaceutical composition (for example, gene therapy agent) for treating cardiovascular diseases.

  Examples of circulatory diseases include coronary artery stenosis, limb ischemic disease, obstructive arteriosclerosis, ischemic ulcer / necrosis, and Buerger's disease.

  The gene encoding the Id protein (ID gene) is known as follows and includes information disclosed in NCBI (National Center for Biotechnology Information: http://www.ncbi.nlm.nih.gov/). In addition, it can be easily obtained by those skilled in the art by ordinary cloning techniques (J. Sambrook, Molecular cloning: A Laboratory Manual, 3rd edition, CSHL Press, 2001).

ID1 gene: NCBI accession number NM_181353
Homo sapiens inhibitor of DNA binding 1, dominant negative helix-loop-helix protein (ID1), transcript variant 2, mRNA
ID3 gene: NCBI accession number NM_002167
Homo sapiens inhibitor of DNA binding 3, dominant negative helix-loop-helix protein, mRNA
The base sequence of the ID1 gene is shown in SEQ ID NO: 23, and the amino acid sequence of the Id1 protein is shown in SEQ ID NO: 24. The base sequence of the ID3 gene is shown in SEQ ID NO: 25, and the amino acid sequence of the Id3 protein is shown in SEQ ID NO: 26.

  When the pharmaceutical composition of the present invention is used as a gene therapy agent, a method of administering a vector in which a nucleic acid is incorporated may be mentioned in addition to a method of directly administering the pharmaceutical composition of the present invention by injection. Examples of the vector include an adenovirus vector, an adeno-associated virus vector, a herpes virus vector, a vaccinia virus vector, a retrovirus vector, a lentivirus vector, and the like, and can be efficiently administered by using these virus vectors. In addition, a method of introducing the pharmaceutical composition of the present invention into a phospholipid vesicle such as a liposome and administering the liposome may be employed. Since the liposome is a vesicle containing a biocompatible material (lipid membrane), the nucleic acid can be held in the liposome or in the lipid bilayer by mixing the liposome and the pharmaceutical composition of the present invention. Next, when the liposome retaining the nucleic acid is cultured with the cell, the gene in the complex is taken into the cell (lipofection method). Then, the obtained cells may be administered by the following administration method.

As the administration form of the pharmaceutical composition of the present invention, it can be administered locally to the affected area, muscle, subcutaneous, intracutaneous, etc., in addition to the usual intravenous, intraarterial and other systemic administration. Furthermore, it is possible to adopt a dosage form combined with catheter technique, surgical operation, and the like. The dosage of the pharmaceutical composition of the present invention varies depending on age, sex, symptom, administration route, frequency of administration, dosage form, for example, the dosage in the case of adenovirus is about 10 ¹⁰ to 10 ¹¹ PFU per day And administered at 1 to 4 week intervals.

  In addition, the expression of ID gene has been suggested to be associated with tumorigenesis (Norton JD. Journal of Cell Science 113, 3897-3905, 2000). Therefore, when expressing the ID gene (when used for the treatment of cardiovascular diseases), the dosage is adjusted while paying attention to tumorigenicity, or a drug delivery system (DDS) using liposomes is applied. By doing so, it is expected that the optimum condition regarding safety can be determined.

  When the ID gene is used as a gene therapy agent using plasmid DNA, a direct injection method of plasmid DNA can be employed. Plasmid DNA can be prepared in large quantities in a short time, is easy to handle, has no particular concentration at the time of injection, and is a highly stable molecule, so the target tissue It has various advantages such as being able to be stably expressed even after reaching.

  The DNA injection method involves dissolving purified plasmid DNA in physiological saline and directly injecting it into muscle. The dose for intramuscular injection of plasmid DNA is 0.1 μg to 1 mg, preferably 5 μg to 100 μg. As a result, plasmid DNA is taken up around the injection site, and an expression product of the Id protein gene is produced after injection. Thereby, the treatment or improvement effect of an ischemic disease can be acquired.

  In order to introduce the ID gene or shRNA into the target tissue or organ, a commercially available gene introduction kit (for example, GenomONE: Ishihara Sangyo) can also be used.

Hereinafter, the present invention will be described more specifically with reference to examples. However, the present invention is not limited to the examples.
1. Method
(1) Transfection Primary HUVEC was isolated as usual, and pretreated with 0.1% gelatin using MCDB151 culture medium supplemented with 10% FCS, heparin 500 μl / ml, and bFGF 2 ng / ml The culture was performed above. Transfection was performed using Effectene transfection reagent (QIAGEN). The forced expression of ID was performed using the pBLAST vector (InvivoGen). PBLAST49-mcs was used as a negative control. The sequence of shRNA was designed to knock down the expression of ID1 and ID3. The sequence is as follows. The 3 ′ end of each sequence is an overhanging sequence for incorporation into an RNA expression vector (psiRNA-hH1neo (InvivoGen) for ID1 and pSilencer 2.0-U6 (Ambion) for ID3). The underlined part is the target RNA region and its complementary region.

ID1: TCCCA AAGAA TCATGAAAGT CGCCAG TTCA AGAGA CTGGC GACTTTCATG ATTCTT TT (SEQ ID NO: 9)
as well as
ID3: TCGGATCC AA CCTCACAGCA CCTCACTT CT TCAAGAGAG A AGTGAGGTGC TGTGAGGTT T TTTTTGGAAA AGCTTGG (SEQ ID NO: 10)
(2) RT-PCR
Total RNA was extracted using the RNeasy mini kit (QIAGEN) and treated with DNase. The initial cDNA synthesis from RNA used the ImProm-II reverse transcriptase system (Promega). Quantitative RT-PCR was performed on a real-time RT-PCR machine using LightCycler® DNA master SYBR Green I and each specific primer. Data analysis was performed with the Fit-points method using LightCycler analysis software (Roche Diagnostics). Each cDNA sample was standardized at the total RNA level using β-actin or GAPDH. The analysis of Id3 expression induction by VEGF and TGFβ in HUVEC was performed by ordinary RT-PCR. The primer pairs used for RT-PCR are as follows.
Id3:
Forward: 5'-CTCCACGCTCTGAAAAGACC-3 '(SEQ ID NO: 11)
Reverse: 5'-ACTCAGATTAAGCCAGGTGGA-3 '(SEQ ID NO: 12)
p16:
Forward: 5'-AGCCTTCGGCTGACTGGCTGG-3 '(SEQ ID NO: 13)
Reverse: 5'-GCAGTTAAGGGGGCACGAGTG-3 '(SEQ ID NO: 14)
ICAM-1:
Forward: 5'-ACCTGGCAATGCCCAGACATCTGTGT-3 '(SEQ ID NO: 15)
Reverse: 5'-GTACACGGTGAGGAAGGTTTTAGCTGTTG-3 '(SEQ ID NO: 16)
E-selectin:
Forward: 5'-AAAACTTCCATGAGGCCAAA-3 '(SEQ ID NO: 17)
Reverse: 5'-GCATTCCTCTCTTCCAGAGC-3 '(SEQ ID NO: 18)
MMP2:
Forward: 5'-ATGACAGCTGCACCACTGAG-3 '(SEQ ID NO: 19)
Reverse: 5'-TGATGTCATCCTGGGACAGA-3 '(SEQ ID NO: 20)
MMP9:
Forward: 5'-GGCGCTCATGTACCCTATGT-3 '(SEQ ID NO: 21)
Reverse: 5'-CCCTCAGTGAAGCGGTACAT-3 '(SEQ ID NO: 22)
PCR was performed by using LightCycler (registered trademark) DNA master SYBR Green I for 95 minutes at 95 ° C for 10 minutes, followed by 45 cycles of 95 ° C for 5 seconds, 58 ° C for 10 seconds and 72 ° C for 45 cycles.

After the PCR product was electrophoresed and stained with SYBR Gold, the expression level of Id3 and β-actin was measured by calculating the relative value of the mRNA expression level and calculating the relative density of the band.
(3) Cell proliferation assay
HUVEC proliferation was measured by WST-1 cell proliferation assay (Takara Bio). Cells were seeded in a 96-well plate coated with gelatin. 10 μl of WST-1 solution was mixed in each well and allowed to stand at 37 ° C. for 4 hours. The solution was transferred to a 96-well plate and the absorbance at 480 nm was measured.
(4) Flow cytometry HUVECs cultured on the plate are collected using trypsin-EDTA and 0.02% EDTA-PBS, redissolved in PBS containing 0.1% BSA and 0.1% sodium azide, and 50 ng / ml For 30 minutes at room temperature. When using direct immunofluorescence, the cells were treated with a fluorescently labeled monoclonal antibody and an isotype control antibody for 30 minutes. When using indirect immunofluorescence, treatment with unlabeled monoclonal antibody and isotype control antibody for 30 minutes on ice, followed by washing and treatment with PE-labeled goat anti-mouse IgG. The fluorescence was analyzed using EPICS XL (Beckman Coulter). The monoclonal antibodies used were FITC-labeled anti-human α _v integrin, PE-labeled anti-human ICAM-1, PE-labeled anti-human β ₁ integrin, Cy-chromium-labeled anti-human E-selectin, and unlabeled anti-human It was α ₂ integrin. As an isotype control, mouse IgG1-RD1 / mouse IgG1-FITC, IgG1-PE, IgG1-Cy-chrome and unlabeled IgG1 were used.
(5) Migration assay The migration assay was performed using an 8 μ-hole transwell chamber (Corning). After the cells were collected, they were resuspended in a culture medium without serum, and seeded in a chamber after being treated with gelatin so that 1 × 10 ⁴ wells were obtained. The lower chamber was filled with culture medium containing 10% FCS and each cytokine. The upper and lower chambers were combined and allowed to stand at 37 ° C. for 8 hours, and then cells in the lower layer were collected using trypsin-EDTA, and the number of cells was counted using EPICS.
(6) Zymography
HUVEC was plated on a 100 mm plate and allowed to stand at 37 ° C. for 8 hours in a culture solution in which DMEM and F-12 HAM culture solution were mixed at a ratio of 1: 1. The supernatant was collected and concentrated with Centricon YM-10. Enzyme activity was developed by electrophoresis of MMP in SDS polyacrylamide gel containing 0.1% gelatin and immersing the gel in a buffer containing 5 mM CaCl ₂ and 1 μM ZnCl ₂ . The gel was stained with Coomassie blue and decolorized with methanol and acetic acid. Gelatin degradation sites are detected as unstained bands.
(7) In vitro tube formation
In vitro tube formation was performed using Matrigel. Matrigel was spread on a 6-well plate on ice and allowed to set by standing at 37 ° C. for 30 minutes. Here, cells were plated on Matrigel so that each well had 5 × 10 ^4, and allowed to stand at 37 ° C. for 24 hours in the presence or absence of VEGF. The formation of lumens on the gel was observed under a microscope.
2. result
(1) Induction of Id expression of HUVEC by VEGF and TGFβ
To investigate whether Id is involved in physiological angiogenesis, we examined the induction of Id3 expression by stimulating VEGF, TGF (stimulated with HUVEC. In HUVECs stimulated or not stimulated with VEGF or TGF ( ID3 mRNA levels were measured by RT-PCR, HUVEC (Id3-t) transfected with ID3 was used as a positive control.

When vascular endothelial cells were stimulated with VEGF (20 ng / ml) (FIGS. 1a and b) and TGFβ (0.5 ng / ml) (FIGs. 1c and d), significant expression enhancement of Id1 and Id3 was observed (FIG. 1). 1b, d, P <0.05). 1b and 1d show the relative intensities of the bands shown in FIGS. 1a and 1c, respectively. From this result, it was shown that Id is located in the angiogenesis induction signal pathway by the above factors. On the other hand, angiogenesis-promoting factors such as IL-1, IL-8, and TNFα could not induce Id expression.
(2) Induction of HUVEC proliferation by forced expression of Id3 Next, in order to investigate whether HUVEC activation and angiogenesis can be induced by stimulation with Id alone, IUV3 was overexpressed in HUVEC by gene transfer. . The pBLAST49-hId3 (c) (Id3-t) or pBLAST49-mcs (Mock-t) vector was introduced into HUVEC. Total RNA was isolated from each transduced cell and ID3 mRNA levels were continuously quantified by real-time RT-PCR. Cell proliferation was also measured by MTT assay.

  24 hours after gene transfer, a 4.1-fold increase in the expression of Id3 at the mRNA level was observed in the transfected cells compared with the negative control (FIG. 2a). In the cells transfected with ID3, the proliferation ability was increased by 1.9 times compared to the negative control at 24 hours, showing almost the same proliferation as the non-gene-transfected cells after VEGF stimulation (FIG. 2b). In FIG. 2b, ID3-introduced cells (black bars) showed significantly higher proliferation compared to cells in which only the vector was introduced (open bars). Growth of ID3 transduced cells was comparable to that of untransfected HUVEC (shaded bars) (stimulated with 10 ng / ml VEGF). Thus, ID3 overexpression was shown to induce HUVEC proliferation.

Although it is already known that Id regulates the cell cycle by regulating the expression of p16, in this experiment, the expression of p16 and Id3 at the mRNA level is inversely related, as shown in Fig. 2c. It was shown that this mechanism is functioning in HUVEC.
(3) Induction of HUVEC activation by forced expression of Id3
In order to examine whether forced expression of Id3 can induce HUVEC activation, the expression of ICAM-1 and E-selectin was measured as an activation marker of vascular endothelial cells. Flow cytometry was performed 24 hours after transfection.

By forced expression of Id3, expression of both ICAM-1 and E-selectin was increased 4.8 times (Fig. 3a) and 4.2 times (Fig. 3b) at the mRNA level, and cell surface expression was also increased (Figs. 3a, b). ). In ID3 transfectants, both activation markers were significantly upregulated. These results indicate that HUVEC activation can be induced only by forced expression of Id3.
(4) Induction of angiogenesis by forced expression of Id3 Next, it was examined whether an angiogenesis could be induced by HUVEC by forced expression of Id3. Id3 forced expression vascular endothelial cells have enhanced migration ability, and ID3 transduced cells have markedly increased migration activity, especially when stimulated with IL-1β (0.5 ng / ml) or VEGF (20 ng / ml) (FIG. 4a). Due to forced expression of Id3, the expression level of MMP2 and MMP9 increased 3.2 times and 3.7 times at the mRNA level under non-stimulation, which was equivalent to the increase in MMPs production capacity of non-gene-transduced cells by VEGF stimulation. (Figure 4b). Increases in the enzyme activity levels of MMP2 and MMP9 were also confirmed by zymography. In both molecules, the amount of activated MMP2 and MMP9 increased, and up-regulation of MMP2 and MMP9 activities was confirmed. (Figure 4c). Furthermore, when the tube formation was examined using matrigel, sufficient tube formation was induced in the cells transfected with ID3 even without VEGF stimulation (FIG. 4d). This degree of angiogenesis was comparable to that of Mock-introduced cells cultured in the presence of VEGF (10 ng / ml). Together, these results indicate that angiogenesis is induced by forced expression of Id3 in HUVEC.
(5) VEGF-induced proliferation and activation of HUVEC are inhibited by ID1 and ID3 shRNA. Next, whether Id3 is essential for HUVEC cell proliferation, activation and angiogenesis induced by VEGF stimulation. Verified. RNAi was used to inhibit the expression of Id1 and Id3. Vectors expressing ID1 and ID3 small hairpin RNA (shRNA) were introduced into HUVEC at concentrations of 1.25, 5, and 10 ng / ml. HUVECs were cultured for 24 hours in the presence or absence of VEGF (20 ng / ml), and then mRNA of ID3 and GAPDH was quantified.

  As shown in FIG. 5a, VEGF-induced ID3 expression was inhibited in a dose-dependent manner in the vector. ID1 induction was also suppressed in the same way as ID3. From this result, the concentration used in the subsequent experiments was 10 ng / ml for both ID1 and ID3 shRNA vectors.

  Further, 24 hours after forced expression of shRNA, proliferation of HUVEC was analyzed using WST-1. Id1 / Id3 knockdown cells, even when stimulated with VEGF, significantly inhibited cell proliferation compared to controls (FIG. 5b, P <0.05).

Also surface of ICAM-1, E-selectin and α _v integrin in mock transfectants stimulated with or without VEGF (20 ng / ml) and ID1 / ID3 shRNA double knockout cells stimulated with VEGF Expression was measured.

ID1 / ID3 double knockdown almost completely suppressed the expression of ICAM-1 and E-selectin induced by VEGF, and reduced the basal expression level of α _v integrin. The increase in the expression of ICAM-1 (FIG. 5c) and E-selectin (FIG. 5d) by VEGF was also suppressed. Furthermore, the expression of αv integrin, which is another activation marker, was also reduced as compared with non-shRNA-introduced cells (FIG. 5e). When the expression of ID1 or ID3 shRNA alone was inhibited, the expression of ICAM-1 was suppressed, but the expression of other activation markers such as E-selectin and αv integrin could not be inhibited.
(6) VEGF-induced angiogenesis is inhibited by ID1 and ID3 shRNA The present inventors examined whether VEGF-induced angiogenesis is inhibited in ID1 / ID3 double knockdown HUVEC.

  In the ID1 / ID3 shRNA-introduced cells after stimulation with VEGF (20 ng / ml) for 8 hours, activation of VEGF-induced migration ability was suppressed (FIG. 6a). In the ID1 / ID3 knockdown cells, MMP9 production did not decrease under VEGF stimulation, whereas MMP2 expression was significantly suppressed (FIG. 6b).

  In addition, non-gene-introduced HUVEC, Mock-introduced HUVEC, and ID1 and ID3 shRNA double-introduced HUVEC cells were cultured in the presence of VEGF (20 ng / ml) for 24 hours.

  A marked inhibition of lumen formation was observed with ID1 / ID3 double knockdown. Tube formation in the presence of VEGF was also reduced in cells transfected with ID1 and ID3 shRNA (FIG. 6c). As one of the reasons for the inhibition of these angiogenesis, suppression of the expression of α2 and β1 integrin in ID1 and ID3 shRNA-introduced cells (both integrins were down-regulated) as shown in FIGS.

  These results indicate that Id plays an essential role in VEGF-induced HUVEC angiogenesis.

  Inhibition method using Id RNAi because Id is important for vascular endothelial cell activation activated by VEGF, angiogenesis is important, and strong expression of Id is not seen in adult tissues. It can be a new target for the treatment of RA.

It is an electrophoresis photograph which shows the result of having induced the expression of ID3 mRNA in HUVEC by VEGF (20 ng / ml). It is a figure which shows the result of having induced the expression of ID3 mRNA in HUVEC by VEGF (20 ng / ml). It is an electrophoresis photograph showing the result of inducing the expression of ID3 mRNA in HUVEC by TGF-β (0.5 ng / ml). It is a figure which shows the result of having induced the expression of ID3 mRNA in HUVEC by TGF-β (0.5 ng / ml). It is a figure which shows the result of having quantified ID3 mRNA level over time by real-time RT-PCR. It is a figure which shows the proliferation of HUVEC 24 hours after transfection. It is a figure which shows the result of having measured the P16 mRNA level of ID3 introduction | transduction cell and a non-introduction cell by real-time RT-PCR. P16 expression was inversely correlated with ID3 expression. It is a figure which shows the mRNA level of ICAM-1 in an ID3 introduction | transduction cell and a non-introduction cell. It is a figure which shows the mRNA level of E-selectin in ID3 introduction | transduction cell and a non-introduction cell. It is a figure which shows the surface expression of ICAM-1 in an ID3 introduction | transduction cell and a non-introduction cell. MFI: Average fluorescence intensity. It is a figure which shows the surface expression of E-selectin in ID3 introduction | transduction cell and a non-introduction cell. MFI: Average fluorescence intensity. It is a figure which shows the result of a migration assay. It is a figure which shows the mRNA level of MMP2 and MMP9. In ID3 transfected cells, the expression of MMP2 and MMP9 was significantly increased. It is a photograph showing zymography. It is a photograph which shows the lumen formation by ID3 introduction | transduction cell. It is a figure which shows the result of having quantified mRNA when HUVEC was transfected using ID1 and ID3 shRNA expression vectors at various concentrations, or using pSilencer alone (Mock). It is a figure which shows the measurement result of the cell proliferation in a double knockdown cell. In ID1 / ID3 double knockdown cells, proliferation induced by VEGF was significantly suppressed. It is a figure which shows the surface expression of ICAM-1 when ICAM-1 activation induced by VEGF is suppressed by ID1 / ID3 double knockdown. MFI: Average fluorescence intensity. It is a figure which shows the surface expression of E-selectin when E-selectin activation induced by VEGF is suppressed by ID1 / ID3 double knockdown. MFI: Average fluorescence intensity. It is a figure which shows the surface expression of (alpha) v integrin when (alpha) v integrin activation induced by VEGF was suppressed by ID1 / ID3 double knockdown. MFI: Average fluorescence intensity. It is a figure which shows the result of a migration assay. It is a figure which shows the expression of MMP mRNA in the ID1 / ID3 shRNA introduction | transduction cell or non-introduction cell cultured for 8 hours in presence of VEGF (20 ng / ml). It is a photograph which shows the result of a tube formation assay. It is a figure which shows the surface expression of (alpha) ₂ integrin in ID1 / ID3 shRNA introduction | transduction cell stimulated with VEGF (20 ng / ml). MFI: Average fluorescence intensity. It is a figure which shows the surface expression of (beta) ₁ integrin in ID1 / ID3 shRNA introduction | transduction cell stimulated with VEGF (20 ng / ml). MFI: Average fluorescence intensity.

SEQ ID NO: 1 synthetic RNA
Sequence number 2: Synthetic RNA
Sequence number 3: Synthetic RNA
Sequence number 4: Synthetic RNA
Sequence number 5: Synthetic RNA
Sequence number 6: Synthetic RNA
Sequence number 7: Synthetic RNA
Sequence number 8: Synthetic RNA
SEQ ID NO: 9: synthetic RNA
Sequence number 10: Synthetic RNA
Sequence number 11: Synthetic DNA
Sequence number 12: Synthetic DNA
Sequence number 13: Synthetic DNA
Sequence number 14: Synthetic DNA
SEQ ID NO: 15: synthetic DNA
Sequence number 16: Synthetic DNA
Sequence number 17: Synthetic DNA
Sequence number 18: Synthetic DNA
Sequence number 19: Synthetic DNA
Sequence number 20: Synthetic DNA
SEQ ID NO: 21: synthetic DNA
Sequence number 22: Synthetic DNA

Claims (22)

  A method for inhibiting angiogenesis, comprising suppressing expression of Id protein in vascular endothelial cells.   The method according to claim 1, wherein the suppression of Id protein expression utilizes RNA interference.   The method according to claim 2, wherein the RNA interference is caused by shRNA.   The method according to claim 3, wherein the shRNA is ID1 shRNA and / or ID3 shRNA.   The method according to claim 4, wherein the ID1 shRNA is at least one selected from the group consisting of any of the nucleotide sequences represented by SEQ ID NOs: 1 to 5.   The method according to claim 4, wherein the ID3 shRNA is at least one selected from the group consisting of any of the nucleotide sequences represented by SEQ ID NOs: 6 to 8.   The method according to claim 1, wherein the Id protein is an Id1 protein and / or an Id3 protein.   A method for promoting angiogenesis, which comprises inducing expression of Id protein in vascular endothelial cells.   The method according to claim 8, wherein the induction of Id protein expression is caused to act on an angiogenesis promoting factor.   The method according to claim 9, wherein the angiogenesis-promoting factor is vascular endothelial cell growth factor or transforming growth factor β.   The method according to claim 8, wherein the Id protein is an Id1 protein and / or an Id3 protein.   ShRNA designed using a base sequence beginning with “aa” or “a” from the vicinity of the 5 ′ end in the target mRNA to inhibit expression as a target sequence.   13. The shRNA according to claim 12, comprising a sequence having a length of 72 bases or less.   14. The shRNA according to claim 12 or 13, wherein the shRNA is ID1 shRNA or ID3 shRNA.   15. The shRNA according to claim 14, wherein the ID1 shRNA is at least one selected from the group consisting of any of the nucleotide sequences represented by SEQ ID NOs: 1 to 5.   15. The shRNA according to claim 14, wherein the ID3 shRNA is at least one selected from the group consisting of any of the nucleotide sequences shown in SEQ ID NOs: 6 to 8.   A pharmaceutical composition comprising the shRNA according to any one of claims 12 to 16.   18. The pharmaceutical composition according to claim 17, which is a gene therapy agent.   19. The pharmaceutical composition according to claim 17 or 18, which is used for the treatment of rheumatoid arthritis.   A pharmaceutical composition comprising a gene encoding an Id protein.   21. The pharmaceutical composition according to claim 20, which is a gene therapy agent. 22. The pharmaceutical composition according to claim 20 or 21, which is used for the treatment of cardiovascular disease.

Images