JP2004187676A - Method for cloning antigen receptor gene from antigen-specific lymphocyte - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for efficiently cloning an antigen-specific antigen receptor gene, by simply selecting a lymphocyte specifically reactive with a specified antigen (antigen-specific lymphocyte) and using the selected antigen-specific lymphocyte, to provide a method for producing a monoclonal antibody from a cloned antigen-specific immunoglobulin gene, and to provide a method for producing a material for gene therapy, by using a cloned antigen-specific T-lymphocyte receptor gene. <P>SOLUTION: In this method for cloning the antigen-specific antigen receptor gene, one of the antigen-specific lymphocyte is selected and the antigen-specific antigen receptor gene is cloned from the selected antigen-specific lymphocyte. The antigen-specific immunoglobulin gene is cloned, when the antigen-specific lymphocyte comprises a B-lymphocyte, and the antigen-specific T-lymphocyte receptor gene is cloned, when the antigen-specific lymphocyte comprises a T-lymphocyte. The method for producing the monoclonal antibody comprises using the cloned antigen-specific immunoglobulin gene. The method for producing the material for the gene therapy comprises using the cloned antigen-specific T-lymphocyte receptor gene. <P>COPYRIGHT: (C)2004,JPO&NCIPI

Description

  The present invention relates to a method for cloning an antigen-specific lymphocyte antigen receptor gene.

Conventionally, antigen-specific lymphocytes have been detected by using a 96-well plate as shown in FIG. 6 and adding about 200,000 lymphocytes per well and culturing for 3 days to 1 week in the presence of the antigen. (Non-Patent Documents 1 and 2).
The detection method is
1. cell proliferation ⁽³ H-thymidine incorporation, detection of viable cells)
2. By measuring the production of antibodies and cytokines.
By this method, it was confirmed that antigen-specific lymphocytes were present in a lymphocyte population of about 200,000. However, it was not possible to identify individual antigen-specific lymphocytes present in the lymphocyte population.

  On the other hand, in recent years, antigen molecules labeled with a fluorescent dye have been mixed with lymphocytes to bind the fluorescently labeled antigens to the antigen receptors of antigen-specific lymphocytes, and the lymphocytes to which the fluorescently labeled antigens have been bound to flow. A detection method using a cytometer has been developed and used (Non-Patent Document 3). With this method, it is possible to identify lymphocytes that bind to the antigen. It is also possible to sort lymphocytes that bind to the antigen.

However, in the above detection method, an expensive and complicated device called a cell sorter is required for sorting, and there are also the following problems.
(1) It is difficult to set the conditions of the device for sorting, and skill in operating the device is required to sort cells.
(2) Due to the high background, when the frequency of antigen-specific lymphocytes is 0.1% or less, antigen-specific lymphocytes cannot be detected.
(3) The efficiency of sorting cells is low.
(4) It takes time to sort infrequent cells.
(5) Although the binding of the antigen can be confirmed, it is difficult to analyze the reaction of the lymphocyte bound with the antigen.

As another method for detecting antigen-specific lymphocytes, antigen molecules bound to magnetic beads are mixed with lymphocytes to bind the magnetic beads-bound antigen to the antigen receptor of antigen-specific lymphocytes, and use a magnet to detect the antigen. A method for sorting specific lymphocytes has also been developed (Non-Patent Document 4).
In this method, no complicated device is required, the time for cell sorting is short, and it can be confirmed that antigen is bound. However, it was not possible to analyze whether the lymphocytes to which the antigen was bound react with the antigen (cellular metabolic physiological reactions such as intracellular signal transduction, RNA synthesis, and protein synthesis). In addition, since the background is high as in the method using the fluorescent dye-labeled antigen / cell sorter, it was difficult to detect the antigen-specific lymphocytes when the frequency of the antigen-specific lymphocytes was 0.1% or less.

  The following methods are known as conventional methods for cloning an antigen-specific antibody gene.

  (1) In the case of human, peripheral B lymphocytes are transformed with EB virus and established, and cells producing antigen-specific antibodies are screened, and antibody genes are cloned from the obtained antigen-specific lymphocyte cell lines. (Non-Patent Documents 5 and 6). In this method, it is inefficient to screen for an antigen-specific lymphocyte cell line, and the cell culture takes about one month, which is time-consuming and troublesome. Hybridomas can be produced in the case of mice, but efficient hybridoma lines have not been produced in the case of humans.

  (2) As another method, there is a method of cloning an antigen-specific antibody gene using a bacteriophage (Non-Patent Document 7). In this case, mRNA is extracted from human lymphocytes, cDNA libraries for immunoglobulin H and L chains are respectively prepared, and integrated into one phage DNA, thereby expressing the H and L chains of the antibody on the phage. Let it. The combination of the H chain and the L chain determines the antigen specificity. However, in this system, the combination is random and the antigen is used to screen for phage making antibodies that bind to that antigen. As a result, if a phage producing an antibody that binds to the antigen is obtained, an antigen-specific antibody gene can be cloned. However, since the combination of the H chain and the L chain is random, screening for an antigen-specific antibody gene is very inefficient. For example, if the cDNA of the H chain and the cDNA of the L chain of an antibody to a certain antigen are present in the library at a frequency of 1/4, respectively, the H chain and the L chain capable of binding to the antigen Is 1 / 8th power of 10. Also, in the case of this system, it is not known whether the obtained combination of H chain and L chain is the same as the combination of H chain and L chain actually produced in the human body.

"Lymphocyte Function Retrieval Method", edited by Junichi Yano and Michio Fujiwara, Chugai Medical Company (1994) "Immune Experiment Procedures I and II" Shunsuke Migita, Susumu Konda, Yusuke Honjo, Toshiyuki Hamaoka, Namedo (1995) Altman JD, Moss PA, Goulder PJ, Barouch DH, McHeyzer-Williams MG, Bell JI, McMichael AJ, Davis MM. Phenotypic analysis of antigen-specific T lymphocytes, Science, 274: 94-96, 1996 Abts H, Emmerich M, Miltenyi S, Radbruch A, Tesch H, CD20 positive human B lymphocytes separated with the magnetic sorter (MACS) can be induced to proliferation and antibody secretion in vitro.Journal of Immunological Methods 125: 19-28, 1989 . Roome AJ, Reading CL.The use of Epstein-Barr virus transformation for the production of human monoclonal antibodies.Exp Biol 43: 35-55, 1984 Carson DA, Freimark BD. Human lymphocyte hybridomas and monoclonal antibodies. Adv Immunol. 38: 275-311, 1986 Huston JS, Levinson D, Mudgett-Hunter M, Tai MS, Novotny J, Margolies MN, Ridge RJ, Bruccoleri RE, Haber E, Crea R, et al. Protein engineering of antibody binding sites: recovery of specific activity in an anti- digoxin single-chain Fv analogue produced in Escherichia coli.Proc Natl Acad Sci US A. 85: 5879-5883, 1988.

  As described above, the conventional method of cloning an antigen-specific antibody gene has been a very inefficient method. Nevertheless, with respect to antigen-specific lymphocytes having a relatively high frequency, it was possible to clone an antigen-specific antibody gene by a conventional method with a considerable amount of labor. However, it has not been possible to identify and select antigen-specific lymphocytes that are infrequent with conventional methods.

Thus, the present invention, of course, relatively high frequency antigen-specific lymphocytes, even low-frequency antigen-specific lymphocytes, simply select lymphocytes specifically reacting to a specific antigen, An object is to provide a method for efficiently cloning an antigen-specific antigen receptor gene from the selected antigen-specific lymphocytes.
Further, the present invention provides a method for producing a monoclonal antibody from a cloned antigen-specific immunoglobulin gene, and produces a material for gene therapy using the cloned antigen-specific T cell receptor gene. It is also an object to provide a method.

The present invention for solving the above problems is as follows.
(1) One lymphocyte that specifically reacts with a certain antigen (hereinafter referred to as antigen-specific lymphocyte) is selected, and then an antigen-specific antigen receptor gene is cloned from this one antigen-specific lymphocyte. Method.
(2) The selection of one antigen-specific lymphocyte is performed by adding an antigen to each microwell of a microwell array chip for detecting antigen-specific lymphocytes having a plurality of microwells containing one subject lymphocyte. The method according to (1), wherein the lymphocytes reacted with the antigen are detected, and the detected antigen-specific lymphocytes are removed from the microwell.
(3) The method according to (1), wherein the frequency of the antigen-specific lymphocytes is 0.1% or less.
(4) The method according to any one of (1) to (3), wherein the antigen-specific lymphocytes are lysed using a cell lysing agent, and the antigen-specific antigen receptor gene is amplified using RT-PCR.
(5) The method according to (4), wherein RT-PCR is performed by preparing a cDNA using reverse transcriptase and then performing PCR twice using a primer mix for the antigen receptor gene.
(6) The method according to any one of (1) to (5), wherein the antigen-specific lymphocytes are B lymphocytes or T lymphocytes.
(7) The antigen-specific antigen receptor gene is an immunoglobulin gene when the antigen-specific lymphocyte is a B lymphocyte, and is a T cell receptor gene when the antigen-specific lymphocyte is a T lymphocyte (6) The method described in.
(8) The method according to any one of (1) to (7), wherein the antigen-specific lymphocytes are B lymphocytes, and an antigen-specific immunoglobulin gene is cloned.
(9) The method according to any one of (1) to (7), wherein the antigen-specific lymphocyte is a T lymphocyte, and an antigen-specific T cell receptor gene is cloned.
(10) The method according to any one of (2) to (9), wherein the amplification of the gene is performed in the microwell without removing the detected antigen-specific lymphocytes from the microwell.
(11) A method for producing a monoclonal antibody using the antigen-specific immunoglobulin gene cloned by the method according to (8).
(12) A method for producing a material for gene therapy using the antigen-specific T cell receptor gene cloned by the method according to (9).

  For infectious diseases, pathogen-specific lymphocytes are detected, and by cloning pathogen-specific antibody genes, tumor-specific lymphocytes are detected for cancer, and tumor-specific antibody genes and tumor-specific By cloning a target T cell receptor gene, it is expected that antibody therapy using an antibody and gene therapy using a T cell receptor gene will be possible.

  Detect autoreactive lymphocytes in autoimmune diseases and clone autoantibodies and autoantigen-specific T cell receptor genes, and in allergy, detect allergen-specific lymphocytes and clone IgE gene Thereby, it is possible to accurately grasp the etiology and pathological condition, and to perform treatment corresponding to the etiology and monitor the therapeutic effect.

  In addition, by monitoring all antibody genes and T cell receptor genes of individuals comprehensively for all lymphocytes, we can monitor the immune function of Japanese and Chinese medicine and predict the immune response to pathogens to tailor-made medicine It can be applied to

The cloning method of the present invention selects one lymphocyte (antigen-specific lymphocyte) that specifically reacts with a certain antigen, and then clones an antigen-specific antigen receptor gene from this one antigen-specific lymphocyte. How to
The cloning method of the present invention is particularly effective when the frequency of antigen-specific lymphocytes is 0.1% or less.
However, it goes without saying that the present invention can be applied to the case where the frequency exceeds 0.1%.
The antigen-specific lymphocytes can be, for example, B lymphocytes or T lymphocytes. Further, the antigen-specific antigen receptor gene is an immunoglobulin gene when the antigen-specific lymphocyte is a B lymphocyte, and is a T cell receptor gene when the antigen-specific lymphocyte is a T lymphocyte.

  Each lymphocyte in the blood reacts to a different antigen. Thus, in the present invention, for example, a B lymphocyte that specifically reacts with an antigen can be detected, and an immunoglobulin (antibody) gene that reacts with an antigen (pathogen) can be amplified from the B lymphocyte by RT-PCR. Similarly, T lymphocytes that specifically reacted with the antigen are detected, and a T cell receptor gene that reacts with the antigen (pathogen) can be amplified from the T lymphocytes by RT-PCR.

[Selection of antigen-specific lymphocytes]
Selection of one antigen-specific lymphocyte can be performed, for example, by a method using a microwell array chip. In the method using a microwell array chip, for example, an antigen is added to each microwell of an antigen-specific lymphocyte detection microwell array chip having a plurality of microwells containing one specimen lymphocyte, One antigen-specific lymphocyte can be obtained by detecting the lymphocyte that has reacted with the antigen and removing the detected antigen-specific lymphocyte from the microwell. This method will be described more specifically.

(Microwell array chip)
As the microwell array chip, a chip having a plurality of microwells and each microwell can contain one lymphocyte to be tested can be used. When each microwell contains one test lymphocyte, it becomes possible to identify antigen-specific lymphocytes at a cell level. In other words, when this microwell array chip is used, since there is one specimen lymphocyte contained in the microwell, the specimen lymphocyte that reacts with the antigen can be identified as one cell, and as a result, the antigen-specific Target lymphocytes can be detected as a single cell. Then, one detected antigen-specific lymphocyte is taken out and the gene is cloned.

  However, the same microwell may contain cells other than lymphocytes together with the test lymphocytes. This is because cells other than lymphocytes do not react with the antigen and are not detected.

  It is preferable that the microwell array chip used in the present invention has a plurality of microwells, and the microwell has a shape and a size in which only one lymphocyte is stored in one microwell.

  Although the shape and dimensions of the microwell are not particularly limited, the shape of the microwell can be, for example, a cylindrical shape, and in addition to the cylindrical shape, a rectangular parallelepiped, an inverted cone, an inverted pyramid (an inverted triangular pyramid, (An inverted quadrangular pyramid, an inverted pentagonal pyramid, an inverted hexagonal pyramid, a heptagon or more inverted polygonal pyramid), or a combination of two or more of these shapes. For example, some may be cylindrical and the rest may be inverted conical. In the case of the inverted cone and the inverted pyramid, the bottom surface is the opening of the microwell, but the inverted cone and the inverted pyramid are cut off from the top (in this case, the bottom of the microwell is flat ). In the case of a cylindrical or rectangular parallelepiped, the bottom of the microwell is usually flat, but it may be curved (convex or concave). The reason why the bottom of the microwell can be a curved surface is the same as in the case of a shape in which a part is cut off from the top of an inverted cone or an inverted pyramid.

The shape and size of the microwell are appropriately determined so that one lymphocyte is stored in one microwell in consideration of the type of lymphocyte to be stored in the microwell (such as the shape and size of lymphocyte). It is determined.
In order to store one lymphocyte in one microwell, for example, the diameter of the largest circle inscribed in the planar shape of the microwell is 1 to the diameter of the lymphocyte to be stored in the microwell. Suitably, it is in the range of 2 times, preferably in the range of 1.1 to 1.9 times, more preferably in the range of 1.2 to 1.8 times.
The depth of the microwell may be in the range of 1-2 times the diameter of the lymphocytes to be stored in the microwell, preferably in the range of 1.1-1.9 times, more preferably in the range of 1.2-1.8 times. Appropriate.

  If the microwell is cylindrical, its dimensions can be, for example, 5-100 μm in diameter; if the lymphocytes are B lymphocytes, preferably the diameter is 5-15 μm. In addition, the depth can be, for example, 5 to 100 μm. When the lymphocytes are B lymphocytes, preferably, the depth can be 5 to 40 μm. However, as described above, the size of the microwell is appropriately determined in consideration of a suitable ratio of the diameter of the lymphocyte to be stored in the microwell to the size of the microwell.

The number of microwells present in a single microwell array chip, from the viewpoint of particularly, without limitation, if the frequency of antigen-specific lymphocytes often from 1 to 10 ⁵ is about 500, 1 cm ² Per hit, for example, can range from 2,000 to 1,000,000.

The test lymphocytes are stored in the microwell together with the culture solution. Examples of the culture solution include any of the following.
1.137 mM NaCl, 2.7 mM KCl, 1.8 mM CaCl ₂ , 1 mM MgCl ₂ , 1 mg / ml glucose, 1 mg / ml BSA, 20 mM HEPES (pH 7.4)
2. RPMI1640 medium containing 10% FCS (fetal calf serum)
3. RPMI1640 medium containing 1mg / ml BSA
4.Dulbecco's MEM medium containing 10% FCS (fetal calf serum)
5.Dulbecco's MEM medium containing 1 mg / ml BSA

  The subject lymphocytes can be of blood origin and can be, for example, B lymphocytes or T lymphocytes. Other examples include lymphocytes derived from lymphoid tissues such as tonsils (lymph nodes) and spleen, and lymphocytes infiltrating a lesion site such as cancer-infiltrating lymphocytes.

(Method for detecting antigen-specific lymphocytes)
The method for detecting antigen-specific lymphocytes includes adding an antigen to each microwell of the microwell array chip, stimulating cells, and detecting cells that respond to the antigen.

The addition of the antigen to each microwell can be performed as follows.
1. Add the antigen solution using a pipette so as to cover the entire surface of the microwell array chip.
2. Add the antigen solution to each well using an automatic spotter.

  The antigen detected by this method is not particularly limited, but may be, for example, a protein, peptide, DNA, RNA, lipid, sugar chain, or organic compound. Also, the antigen can be a bacterium, virus, self-antigen, cancer antigen or allergen or the like.

The cells can be cultured, for example, by suspending lymphocytes in a culture solution, dispensing the suspension into wells, and culturing at room temperature or 37 ° C. in the air or in a CO ₂ incubator.

Detection of cells that react with the antigen can be performed as follows.
For example, when an antigen binds to an antigen receptor (immunoglobulin) of a B lymphocyte, first intracellular signal transmission occurs, followed by cell proliferation and antibody production. Therefore, cells that respond to the antigen can be detected by detecting intracellular signal transduction, cell proliferation, and antibody production by various methods. Alternatively, for example, when an antigen binds to an antigen receptor of a T lymphocyte, intracellular signaling occurs first, followed by cell proliferation and cytokine production. Therefore, cells that respond to the antigen can be detected by detecting intracellular signaling, cell proliferation, and cytokine production by various methods.

The detection of cells that respond to an antigen by detecting intracellular signal transduction can be performed, for example, by changing the concentration of intracellular Ca ions using a Ca ion-dependent fluorescent dye.
For the change in intracellular Ca ion concentration, Fura-2, Fluo-3 or Fluo-4 is used as a fluorescent dye, and a fluorescence microscope or a microarray scanner is used as a detection device.

  Specifically, as shown in FIG. 1, Fura-2 or Fluo-3, which is a Ca ion-dependent fluorescent dye, is introduced into B lymphocytes. Then, when the B lymphocytes are stimulated with the antigen, the intracellular Ca ion concentration increases. As a result, Ca ions bind to the Ca ion-dependent fluorescent dye, and the fluorescence intensity is enhanced. The color is bluish when the Ca ion concentration is low, and reddish when the Ca ion concentration is high. According to this method, B lymphocytes (antigen-specific) whose intracellular Ca ions have been increased by stimulation with an antigen can be detected using a microwell array chip.

Detection of cells that respond to the antigen by detecting cell proliferation can also be performed, for example, by counting the number of cells using a living cell-specific fluorescent dye. According to this method, specifically, when B lymphocytes are stimulated with an antigen and cultured in a CO ₂ incubator at 37 ° C. for 3 days, the cells proliferate. After the cells have proliferated, add fluorescein diacetate (Fluorescein diacetate (FDA)) or carboxy fluorescein diacetate succinimidyl ester (Carboxy-fluorescein diacetate, succinimidyl ester (CFSE)) solution to the culture medium . These reagents permeate the membrane of living cells and are degraded intracellularly by esterases to produce membrane-impermeable fluorescent dyes. Since the emission of this fluorescent dye is proportional to the number of cells, the number of living cells is measured by measuring the sum of the fluorescence intensities emitted by the living cells in the well using a fluorescence microscope or a microarray scanner.

By measuring antibody production, cells that react with the antigen can also be detected. Antibody production can be detected by measuring the antibody immunochemically.
Specifically, when B lymphocytes are stimulated with an antigen and cultured at 37 ° C. for 1 week in a CO ₂ incubator, the antibody is secreted into the culture solution. The antigen-specific antibody secreted into the culture solution is detected by an ELISA method (enzyme-labeled immunosorbent method).
In this detection method, signal transduction, cell proliferation, and antibody production can be detected by using mitogen, lectin, antibody, cytokine, PMA, and Ca ionophore.

Hereinafter, the process of dispensing cells to a microwell array chip, stimulating antigen, and removing the cells in a method using a fluorescent dye will be described with reference to FIG.
(1) Dispensing cells Put cells into each well.
The cells to be put into the wells can be obtained by separating the lymphocyte fraction from peripheral blood and then separating and purifying the B lymphocyte fraction.
Next, the cells are suspended in a Fluo3 / AM (2 μM) solution, left at room temperature for 30 minutes, and the cells are further washed with a buffer to remove the dye not loaded into the cells.
The cells from which the dye has been removed are dispensed into microwells.
A sticker is attached to both sides of the microwell array chip, a cover glass is put on the chip, and a buffer is filled to prevent drying.

(2) Fluorescence measurement First, the fluorescence of unstimulated cells is measured. The fluorescence intensity (A) at that time is measured.
Next, the antigen solution is poured into the gap between the slide glass and the cover glass and exchanged with the buffer solution, and the fluorescence of cells stimulated by the antigen is measured. The fluorescence intensity (B) 1-2 minutes after the stimulation is measured. Cells in wells with a high fluorescence intensity ratio (B / A) before and after stimulation are selected.

(3) Removal of cells in response to antigen stimulation When air is introduced into the gap between the slide glass and the cover glass, the cover glass is easily peeled off. Cells that have responded to the antigen stimulation are selected based on the ratio (B / A) of the fluorescence intensity of the unstimulated cells to the fluorescence intensity of the cells stimulated with the antigen, and are removed.
However, the selected (detected) antigen-specific lymphocytes can be subjected to the next gene amplification, which is performed in the microwell without being removed from the microwell.

(Gene amplification)
The extracted antigen-specific lymphocytes are lysed using a cell lysing agent, and then RT-PCR is used to clone an antigen-specific immunoglobulin (antibody) gene if the antigen-specific lymphocytes are B lymphocytes. If the antigen-specific lymphocytes are T lymphocytes, the antigen-specific T cell receptor gene is cloned.
Known cell lysing agents can be used as they are, and examples thereof include the following.
1x 1 ^st strand buffer [GIBCO-BRL, attached to SuperScriptII], 0.2 mM dNTP, 0.25% NP-40, 0.1 mg / mL BSA, 10 mM DTT, Random Primer 0.05 μM, 1 U / μL RNasin

  The antigen receptor gene in B lymphocytes is the same as the antibody gene, and the protein is called immunoglobulin. Antigen receptors are present on the membrane surface of B lymphocytes (membrane immunoglobulins) and antibodies are usually produced as secreted proteins (secretory immunoglobulins). The difference is on the C-terminal side of the protein. Membrane-type immunoglobulins have a membrane domain buried in the cell membrane and a portion sticking to the cytoplasmic side. Secreted immunoglobulins are produced from the same gene. However, unlike the membrane immunoglobulin, the C-terminal side of the protein has no membrane domain due to alternative splicing. As a result, it is produced as a secreted protein. However, the antigen binding sites of the two proteins are identical. Therefore, in the case of B lymphocytes, cloning of the antibody gene and cloning of the antigen receptor gene are the same.

  In the case of T lymphocytes, there is no secreted form of the antigen receptor. Therefore, the antigen receptor gene will be cloned. In the case of T lymphocytes, primers are designed in the same way as primers designed for B lymphocytes. This is because the gene composition of the antigen receptor (TCR) of T lymphocytes is almost the same as the gene composition of immunoglobulin genes of B lymphocytes. Therefore, primers can be designed based on the same concept. Therefore, if the antibody gene can be cloned, the TCR gene can be cloned by almost the same method.

Hereinafter, the amplification of the antigen-specific immunoglobulin gene will be further described as an example.
Using a solution obtained by lysing the extracted antigen-specific lymphocytes with a cell lysing agent, cDNA is prepared using reverse transcriptase. Next, the desired antigen-specific immunoglobulin gene can be amplified (cloned) by performing PCR twice using the primer mix for the immunoglobulin gene.

Preparation of cDNA by reverse transcriptase, a conventional method (e.g., Sambrook J, Russell DW in Molecular Cloning: A Laboratory Manual 3 rd ed (Cold Spring Harbor Laboratory Press, New York, 2001)) can be carried out by.
In the present invention, it is appropriate to perform an RT reaction directly using a cell lysate, instead of performing an RT reaction using RNA extracted and purified from cells.

(Amplification of antibody gene by PCR method)
In the amplification of the antibody gene by the PCR method, it is appropriate to amplify the V region gene of the antibody gene by performing the PCR reaction twice.
Antibody molecules are composed of a combination of H and L chains, and the H chain of a human antibody gene is composed of about 200 V region gene fragments, about 20 D fragments, and 6 J fragments in the germline. When differentiating into B lymphocytes, one kind of V fragment, D fragment, and J fragment are combined by gene rearrangement (V / D / J rearrangement) to form one antigen binding site. The same applies to the L chain.
Each B lymphocyte expresses one type of antibody molecule on the cell surface. In order to amplify an antigen-specific antibody gene from an antigen-specific B lymphocyte, it is necessary to use a primer matching the sequence of each V fragment.

The antibody molecule is composed of two peptide chains each of H chain and L chain, and binds to the antigen in the V region (H chain is _VH region, L chain is Vκ or Vλ region) on the left side of the structural diagram shown in FIG. . The numbers of H chain and L chain subfamilies are shown in the table below.

As shown in Table 1 above, the V region of the H chain of the human antibody gene is classified into seven subfamilies. Since the sequences of the V fragments in the subfamily are very similar, it is possible to set a common primer. (* C _H region includes Cγ1-4, Cμ, Cδ, Cα1-2, and Cε. Among them, primers were designed for IgG and IgM, which are main types of antibodies in serum, and used for PCR. For Cγ1 to 4, two kinds of primers are used together with Cμ because one kind of common sequence is used. ** Cλ chain includes Cλ1 to Cλ7 chains, but one kind of common sequence is used as a primer. Is used.)
Since the same can be said for each subfamily of the V region and C region of the L chain, primers were set for each subfamily, and primers for all subfamilies of the H chain or L chain were mixed in the PCR reaction. Use primer mix. That is, all kinds of mixes of the H chain and the L chain are used as primers.

The PCR reaction is performed twice as follows to amplify the antibody gene.
Since the number of amino acids in the V region of the H chain and the L chain is around 110 to 120, the gene of the V region is about 400 bp.
Therefore, as shown in FIG. 3, in the first PCR reaction, PCR1, the cDNA in the C region is amplified from the leader sequence (L).
In the second PCR, PCR2, a cDNA of about 400 bp inside PCR1 (from the start of the V region to the start of the C region) is amplified.
Then, the sequence of the cDNA amplified in the second PCR reaction is analyzed.

This will be further described.
In the present invention, PCR1 and PCR2 use different primer mixes for the following reasons. The product amplified by PCR1 is amplified again by PCR2. The product of PCR1 includes not only specific products but also nonspecific amplification products. When PCR2 is amplified with the same primers, a specific DNA sequence is also amplified, but a non-specific sequence is also amplified. Therefore, in PCR2, a sequence that is slightly inside the primer position of PCR1 in the DNA sequence to be amplified in PCR1 is used as a primer. By doing so, the specific DNA sequence can be amplified without amplifying the non-specific DNA sequence amplified by PCR1. In addition, as described above, in addition to performing the second PCR2 by changing primers to amplify a specific DNA sequence, when a single B lymphocyte is used to amplify an antibody gene, a single PCR requires amplification. It is also appropriate to carry out the PCR reaction twice, because the amount is insufficient.

  In the above method, the sequence of the cDNA amplified in the second PCR reaction is analyzed. At this time, it is not necessary to separate the first PCR reaction product and the second PCR reaction product. This is because the product of PCR1 is usually negligible compared to the product amplified by PCR2.

  When the antigen-specific lymphocyte is a T lymphocyte, the antigen-specific T cell receptor gene is cloned. The cloning method can be performed in the same manner as in the case of the B lymphocyte. The subfamily of T lymphocyte antigen receptors (TCRs) is shown in the table below.

  In the cloning method of the present invention, when the antigen-specific lymphocytes are B lymphocytes, the antigen-specific immunoglobulin (antibody) gene is cloned. Then, a monoclonal antibody can be produced using the cloned gene. The monoclonal antibody can be produced using the cloned gene by a conventional method. The cDNA of the V region and the gene sequence of the C region amplified by the PCR method are combined to prepare an antibody molecule using an expression vector. .

  Production of monoclonal antibodies is, for example, Kanda H, Mori K, Koga H, Taniguchi K, Kobayashi H, Sakahara H, Konishi J, Endo K, Watanabe T. Construction and expression of chimeric antibodies by a simple replacement of heavy and light chain V genes into a single cassette vector. 13: 359-366, 1994.

  In the method of the present invention, it is not necessary to produce the whole antibody molecule, and it is sufficient to obtain the V region. The gene sequence obtained by the PCR method is a part of the V region and the C region. Therefore, the gene to be introduced into the expression vector in the method for producing a monoclonal antibody may be not the antibody molecule (whole) but only the V region or a part of the V region + C region.

  The H and L chains are usually cloned separately. In this case, the reaction is performed in one tube until RT, and in the subsequent PCR, two tubes for the H chain and the L chain are used. In some cases, H and L chains can be synthesized in a single tube, but it is often the case that the number of easy to amplify mainly increases. Preferably, the PCR is performed separately in tubes.

To obtain an antibody, it is necessary to express both the H chain and the L chain, and the expression vector contains both the H chain and the L chain.
In this case, when the H chain and the L chain are inserted into separate expression vectors and both proteins are simultaneously introduced into the same cell when expressing the protein, the H chain and the L chain can be expressed in one cell. And constructing an expression vector in which the H chain and L chain are simultaneously inserted into one vector, and introducing it into cells to express the H chain and L chain in one cell. is there.

  When an expression vector is introduced into animal cells, the antibodies produced will be exactly the same as those produced in the human or mammalian body. When made in Escherichia coli, the amino acid sequence is exactly the same as above, but one without sugar chains is produced. In the method of the present invention, it is preferable to produce antibodies in animal cells, since the antibodies produced are exactly the same as those produced in the human or mammalian body.

  In the cloning method of the present invention, when the antigen-specific lymphocyte is a T lymphocyte, the antigen-specific T cell receptor gene is cloned. Gene therapy can be performed using the cloned antigen-specific receptor gene. For example, by introducing the cloned T cell receptor gene into T lymphocytes or T lymphocyte precursor cells, T lymphocytes expressing a T cell receptor specific to a pathogen or the like can be artificially created. The immune function can be restored by administering the T lymphocytes thus produced to a patient having a reduced immune function.

Hereinafter, the present invention will be described in more detail with reference to Examples.
1. Separation of B lymphocytes The lymphocyte fraction was separated from peripheral blood using Ficoll-Paque (Pharmacia, Uppsala, Sweden), and B was separated from the lymphocyte fraction using AutoMACS (Miltenyi Biotec, Bergisch Gladbach, Germany). The lymphocyte fraction was further separated and purified.

2. Introduction of Fluo3 into cells (see Fig. 1)
2 × 10 ⁶ B lymphocytes were added to 2 μM Fluo3 / AM (Dojin, Kumamoto) / loading buffer (137 mM NaCl, 2.7 mM KCl, 1.8 mM CaCl ₂ , 1 mM MgCl ₂ , 1 mg / mL glucose, 1 mg / mL BSA, The suspension was suspended in 20 mM HEPES (pH 7.4) and incubated at room temperature for 30 minutes. The cells are washed with a loading buffer to remove Fluo3 / AM that has not been introduced into the cells. The cells were then suspended in RPMI 1640/10% FCS solution.

3. Microwell array chip (see Fig. 2)
The microwell array chip is fabricated using poly (dimethylsiloxane) (PDMS), and microwells with a diameter of 10 μm and a depth of 32 μm are placed on a 2 cm x 2 cm chip with a vertical and horizontal distance of 30 μm (the center of The distance from the center to the center is 40 μm). A sticker having a thickness of 1 mm, a width of about 1 mm, and a length of 2 cm was attached to both sides of the chip.

4. Microarray Scanner This device basically uses a microarray scanner (CRBIO Iie) of Hitachi Software Engineering Co., Ltd. (Yokohama), with the following changes. One of the lasers (Cy3, 532 nm; Cy5, 635 nm) is replaced with a 473 nm laser.

5. Detection of activated B lymphocytes using a microwell array chip (see Fig. 2)
The cell suspension is added to the microwell array chip, and the mixture is allowed to stand for 5 minutes. Cells that did not enter the microwells were washed away using RPMI 1640/10% FCS solution. The diameter of a lymphocyte is about 8 μm, and one microwell contains one lymphocyte because the diameter of a microwell used is 10 μm. A cover glass was placed on the seal and filled between the chip and the cover glass with an RPMI 1640/10% FCS solution. This microwell array chip was inserted into a microarray scanner, scanned at a resolution of 10 μm, and data was stored (fluorescence data before antigen stimulation: A).

  Next, the RPMI1640 / 10% FCS solution between the chip and the cover glass is removed, and an antigen (10 μg / mL) dissolved in the RPMI1640 / 10% FCS solution is added thereto. One minute after the addition of the antigen, the microwell array chip was inserted into a microarray scanner, scanned at a resolution of 10 μm, and the data was stored (data of fluorescence after antigen stimulation: B).

  The ratio of fluorescence intensity before and after stimulation (B / A) is calculated, and wells with a large ratio are specified. Antigen-specific B lymphocytes were present in the wells.

6. Sorting cells from microwells.
Cells were sorted under a microscope by using a glass capillary with a micromanipulator.

7. Amplification of antibody genes from antigen-specific B lymphocytes by PCR (see Fig. 3)
One antigen-specific B lymphocyte was added to the PCR tube (5 μL). Cells 15.15 [mu] L final concentration of cell lysate (when diluted to ^{25μL: 1x 1 st strand buffer [} GIBCO-BRL, attached to SuperScriptII], 0.2 mM dNTP, 0.25 % NP-40, 0.1 mg / mL BSA, 10 mM DTT, Random Primer 0.05 μM, 1 U / μL RNasin [Promega, Madison, WI]), and reverse transcriptase SuperScript II (GIBCO-BRL, Rockville, MD) (4.85 μL, 50 U) Then, the mixture was reacted at 37 ° C. for 1 hour to synthesize cDNA from mRNA.

RT-PCR reaction
Cell sol. (1 cell) 5.0μL
1 ^st strand buffer (5x) 5.0
2.5 mM dNTP 2.0
2.5% NP-40 2.5
1 mg / ml BSA 2.5
0.1M DTT 2.5
Random primer (50 pmol / μL) 0.025
RNase Inhibitor (RNasin 40U / μL) 0.625
Super Script II 4.85 (50U)
Total 25.0 μL
37 ^o C 1 h

By the above reaction, cDNA was prepared from mRNA of one lymphocyte using reverse transcriptase.

Amplification of antibody genes:
The V region of the H chain of the human antibody gene is classified into seven subfamilies. Since the sequences of the V fragments of the subfamily are very similar, it is possible to set a common primer. Primers were set for each H chain and L chain subfamily, and primers for all H chain or L chain subfamilies were mixed, and the PCR reaction was performed twice as follows to amplify the antibody gene. .

In the reaction of PCR1, 5 μL of the above cDNA was added to 15 μL of PCR mix (final concentration: 1 × TAKARA ExTaq buffer, 0.25 mM dNTP, Primer 1 0.5 μM for each subfamily, 0.05 U / μL ExTaq [Takara, Kyoto]), and 94 ° C. , 3 min; (94 ° C, 30 sec; 60 ° C, 1 min; 72 ° C, 1 min 30 sec) x 40 cycles; 72 ° C, 5 min;
PCR 1
cDNA (RT reaction solution above) 5.0 μL
10x ExTaq buffer 2.0
2.5 mM dNTP 2.0
Primer 1 5 'Mix (10 μM each) 1.0
Primer 1 3 'Mix (10 μM each) 1.0
H ₂ O 7.0
Takara ExTaq (0.5 U / μL) 2.0
Total 20.0 μL

94 ℃, 3 min.
94 ° C, 30 sec; 60 ° C, 1 min; 72 ℃, 1.5 min.40 cycles
72 ℃, 5 min.
Ten ° C

The DNA sequence from the leader sequence of the immunoglobulin (antibody) gene to the constant region (C) region was amplified by the PCR1 reaction.

The sequence of the primer (for H chain) used in the above reaction is shown below.
Primer 1 5 'Mix (10 μM each) (V region primer)
hVH17a.1 atggactgsayytggagvdtc (SEQ ID No = 1)
hVH2a.1 tccacrctcctgctrctgac (SEQ ID No = 2)
hVH3a.1 gggcygagstggvttttyct (SEQ ID No = 3)
hVH4a.1 tcctcctsctggtggcagct (SEQ ID No = 4)
hVH5.1 tcaaccgccatcctcgccct (SEQ ID No = 5)
hVH6.1 ctccttcctcatcttcctgcc (SEQ ID No = 6)
Primer 1 3 'Mix (10 μM each) (C region primer)
hIGHG1-4out agtccttgaccaggcagccca (SEQ ID No = 7)
hIGHMout attctcacaggagacgagggg (SEQ ID No = 8)

The sequence of the primer (for L chain) used in the above reaction is shown below.
PCR 1
5 'primer
hKV12.1 atgaggstcccygctcagctc (SEQ ID No = 9)
hKV3.1 ctcttcctcctgctactctggc (SEQ ID No = 10)
hKV45.1 ctsttsctytggatctctg (SEQ ID No = 11)
hKV6.1 tgggtttctgctgctctggg (SEQ ID No = 12)
hKV7.1 atagggtccggggctcctttg (SEQ ID No = 13)
hLV12.1 cykctsctcctcactctcctc (SEQ ID No = 14)
hLV3.1 ttctcctcctcggcctcctct (SEQ ID No = 15)
hLV4.2-2 ccagcytgtgctgactcaatc (SEQ ID No = 16)
hLV789.2 tcycagmctgtgstgacycag (SEQ ID No = 17)
hLV6.1 ttttatgctgactcagcccc (SEQ ID No = 18)
hLV7.1 ggcctggactcctctctttctg (SEQ ID No = 19)
hLV8.1 ggcctggatgatgcttctcctc (SEQ ID No = 20)
hLV9.1 tcctctgctcctcaccctcct (SEQ ID No = 21)
hLV10.1 cctgggtcatgctcctcctga (SEQ ID No = 22)
hLV11.1 gcctgggctccactacttctc (SEQ ID No = 23)
3 'primer
hIGK1 ctgctcatcagatggcggga (SEQ ID No = 24)
hIGL1 gacacacyagtgtggccttgt (SEQ ID No = 25)

  For the reaction of PCR2, 2 μL of the reaction solution of PCR1 was added to 18 μL of PCRmix (final concentration: 1 × TAKARA ExTaq buffer, 0.25 mM dNTP, Primer2 0.5 μM for each subfamily, ExTaq 0.05 U / μL), 94 ° C., 3 min; 94 ° C, 30 sec; 60 ° C, 1 min; 72 ° C, 1 min 30 sec) x 40 cycles; 72 ° C, 5 min; 10 ° C, ∞ reaction.

PCR 2
PCR 1 sol. 2.0
10x ExTaq buffer 2.0
2.5 mM dNTP 2.0
Primer 2 5 'Mix (10 μM each) 1.0
Primer 2 3 'Mix (10 μM each) 1.0
H ₂ O 10.0
Takara ExTaq (0.5 U / μL) 2.0
Total 20.0

94 ^o C, 3 min.
94 ^o C, 30 sec; 60 ^o C, 1 min; 72 ^o C, 1.5 min. 40 cycles
72 ^o C, 5 min.
10 ^o C

The DNA sequence from the variable region (VH) region to the constant region region of the immunoglobulin (antibody) gene amplified by PCR1 was amplified by the reaction of PCR2.

The sequence of the primer (for H chain) used in the above reaction is shown below.
Primer2 Mix
Primer 2 5 'Mix (10μM each)
hVH17a.2 ggtgcagctkgtrcartctgg (SEQ ID No = 26)
hVH2a.2 caccttgarggagtctggtcc (SEQ ID No = 27)
hVH3a.2 aggtdcarctgktggagtcyg (SEQ ID No = 28)
hVH4a.2 ggtcctgtcycagstgcagct (SEQ ID No = 29)
hVH5a.2 gtgcagctggtgcagtctgg (SEQ ID No = 30)
hVH6.2 gcagcagtcaggtccaggact (SEQ ID No = 31)
Primer 2 3 'Mix (10μM each)
hIGHG1-4s aagacsgatgggcccttggtg (SEQ ID No = 32)
hIGHM aagggttgggcggatgcact (SEQ ID No = 33)

The sequence of the primer (for L chain) used in the above reaction is shown below.
PCR 2
5 'primer
hKV1.2 ccagatgacccagtctccatc (SEQ ID No = 34)
hKV2.2 ccagtggggatattgtgatgac (SEQ ID No = 35)
hKV3.2 cagtctccagccaccctgtct (SEQ ID No = 36)
hKV4.2 gtgatgacccagtctccagac (SEQ ID No = 37)
hKV 5.2 acactcacgcagtctccagca (SEQ ID No = 38)
hKV67.2 ttgtgctgacycagtctccag (SEQ ID No = 39)
hLV1.2 agtctgtgctgacgcagccgc (SEQ ID No = 40)
hLV23.2 tgactcagccwcyctcmgtgtc (SEQ ID No = 41)
hLV4.2-3 caatcatcctctgcmtctgc (SEQ ID No = 42)
hLV5.2-2 gactcagccaacctccctctc (SEQ ID No = 43)
hLV6.2 gactcagccccactctgtgtc (SEQ ID No = 44)
hLV789.2 tcycagmctgtgstgacycag (SEQ ID No = 45)
hLV1011.2 tgactcagccmcmctckgtgtc (SEQ ID No = 46)
3 'primer
hIGK2 gacagatggtgcagccacagt (SEQ ID No = 47)
hIGL2 cttgragctcctcagaggaggg (SEQ ID No = 48)

  The PCR product was analyzed and purified using an agarose gel, cloned into pT7Blue-T vector (Novagen, Madison, Wis.), And the antibody gene sequence was determined. The comparison with the sequence of the antibody gene contained in the existing database is shown in FIGS. FIG. 4 shows the sequence of the L chain, and FIG. 5 shows the sequence of the H chain. In each figure, the base sequence shown on the upper side is the sequence of the antibody gene actually amplified and sequenced from one B lymphocyte by RT-PCR, and the base sequence shown on the lower side is registered in the database. Is an existing array.

FIG.
1st nucleotide sequence (sequence determined antibody gene)
File Name: L1 (SEQ ID No = 49)
2nd base sequence (existing sequence)
File Name: L33038 (SEQ ID No = 50)
FIG.
1st nucleotide sequence (sequence determined antibody gene)
File Name: H1 (SEQ ID No = 51)
2nd base sequence (existing sequence)
File Name: AF062204 (SEQ ID No = 52)

  94% and 98% in FIGS. 4 and 5 indicate homology between the sequenced antibody gene and the existing sequence. Based on the homology values, it was assumed that the sequenced antibody gene was an antibody corresponding to an antigen different from the existing sequence.

Introduction of Fluo3 dye into cells. Detection of antigen-specific lymphocytes. Dispensing of cells into which the Fluo3 dye has been introduced into microwells. Amplification of antibody genes from antigen-specific B lymphocytes by PCR. 3 shows a comparison between the sequence of the antibody (L chain) gene obtained in the example and the sequence of the antibody gene contained in the existing database. 3 shows a comparison between the sequence of the antibody (H chain) gene obtained in the example and the sequence of the antibody gene stored in the existing database. 96-well plate used for conventional antigen-specific lymphocyte measurement.

Claims (12)

A method of selecting one lymphocyte specifically reacting with a certain antigen (hereinafter, referred to as antigen-specific lymphocyte), and then cloning an antigen-specific antigen receptor gene from this one antigen-specific lymphocyte. The selection of one antigen-specific lymphocyte is performed by adding an antigen to each microwell of an antigen-specific lymphocyte detection microwell array chip having a plurality of microwells containing one test subject lymphocyte, The method according to claim 1, wherein the method is performed by detecting lymphocytes that have reacted with the antigen, and removing the detected antigen-specific lymphocytes from the microwell. The method according to claim 1, wherein the frequency of the antigen-specific lymphocytes is 0.1% or less. The method according to any one of claims 1 to 3, wherein the antigen-specific lymphocytes are lysed using a cell lysing agent, and the antigen-specific antigen receptor gene is amplified using RT-PCR. The method according to claim 4, wherein the RT-PCR is carried out by performing PCR twice using a primer mix for the antigen receptor gene after preparing cDNA with reverse transcriptase. The method according to any one of claims 1 to 5, wherein the antigen-specific lymphocytes are B lymphocytes or T lymphocytes. 7. The antigen-specific antigen receptor gene according to claim 6, wherein the antigen-specific lymphocyte is an immunoglobulin gene when the antigen-specific lymphocyte is a B lymphocyte, and a T cell receptor gene when the antigen-specific lymphocyte is a T lymphocyte. Method. The method according to any one of claims 1 to 7, wherein the antigen-specific lymphocyte is a B lymphocyte, and the antigen-specific immunoglobulin gene is cloned. The method according to any one of claims 1 to 7, wherein the antigen-specific lymphocyte is a T lymphocyte, and the antigen-specific T cell receptor gene is cloned. The method according to any one of claims 2 to 9, wherein the gene is amplified in the microwell without removing the detected antigen-specific lymphocytes from the microwell. A method for producing a monoclonal antibody using the antigen-specific immunoglobulin gene cloned by the method according to claim 8. A method for producing a material for gene therapy using the antigen-specific T cell receptor gene cloned by the method according to claim 9.

Images