JP2004173693A - Tumor necrosis factor of sweetfish and gene encoding the factor - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a new protein having tumor necrosis factor activity by separating and identifying the tumor necrosis factor of sweetfish, to provide a preventing and treating agent for infectious disease of sweetfish, to provide a method for prevention and treatment of infectious disease of sweetfish, to provide a method and a kit for diagnosing infectious disease of sweetfish, and to provide a method and kit, using expression level acceleration effect of the protein as an index, for screening materials having preventing and treating effect to infectious disease of sweetfish. <P>SOLUTION: The new protein having tumor necrosis factor is provided by utilizing (a) a protein having a specified amino acid sequence or (b) a protein comprising an specified amino acid sequence, wherein one or a plurality of amino acids of the sequence are deleted, substituted or added and the protein has tumor necrosis factor. <P>COPYRIGHT: (C)2004,JPO

Description

  The present invention provides a novel protein having tumor necrosis factor activity, a gene encoding the protein, a recombinant vector containing the gene, a transformant containing the recombinant vector, an antibody against the protein, and a tumor necrosis factor of the protein. A preventive / therapeutic agent and a preventive / therapeutic method for infectious diseases of sweetfish using the activity, a diagnostic method and a diagnostic kit for infectious diseases of sweetfish using the expression level of the protein as an index, and an effect of enhancing the expression level of the protein The present invention relates to a screening method and a screening kit for a substance having a preventive / therapeutic effect on an ayu infectious disease as an index.

  Ayu is a freshwater fish belonging to the salmonid Ayu family, and has abraville, a characteristic of salmonids.It lives in rivers south of Honshu and inhabits the Chinese border of the Korean Peninsula, Taiwan, etc. I do. Ayu is an annual fish that lays eggs and hatches in the river in the fall, lives in the sea in the winter and larvae, becomes a fry in the spring, and grows up to the river to become an adult fish. When grown, it becomes about 200-400 g in size. Ayu has water moss as a staple food, has a watermelon-like aroma, and has an alias of incense fish. Because of the unique flavor and seasonal flavor of Ayu, the value of Ayu as an ingredient in Japan is high, and ayu farming has become an important industry in Tokushima Prefecture and other places.

  Cold water disease is a disease that infects salmon associates whose pathogen is the Gram-negative bacterium Flavobacterium psychrophilum, and is named cold water disease because it develops during the low water temperature period. Infection with cold water causes ulceration of the skin and gills, leading to death. In Japan, cold water pathogens were confirmed in Ayu in Tokushima Prefecture in 1987, and are now prevalent at ayu farms nationwide. The rate of death of cold-water-infected ayu before it becomes an adult fish can reach as much as 70%, causing severe damage to farms due to cold-water disease. Looking at the mortality rate by fish disease in Ayu, cold water disease accounts for 40%. At present, there is no drastic cure for cold water disease, and measures are urgently needed.

  Pseudomonas is an infection caused by Pseudomonas plecoglossicida as a pathogenic bacterium, and exhibits symptoms characterized by intraocular bleeding, intraperitoneal bleeding, and dilated redness of the anus. In 1998, the incidence of pseudomonas disease was 20% by fish disease. Since Pseudomonas plecoglossicida has low sensitivity to drugs and there is no cure at present, it is required to establish a treatment for Pseudomonas disease at an early stage.

  Ayu protects against bacterial infection by activating its immune defenses against bacterial invasion. Therefore, it is thought that the enhancement of the immune defense mechanism in ayu enables protection against bacterial infection. Studies of mammalian cytokines have revealed that tumor necrosis factor (hereinafter sometimes referred to as “TNF”) is an important molecule for controlling immune defense mechanisms. When bacteria, viruses, molds, and the like enter the body, macrophages identify and phagocytose the invading pathogen as foreign substances, and TNF is produced from the activated macrophages. The produced TNF migrates inflammatory cells to induce activation such as enhanced production of active oxygen, and as a result, bacteria are eliminated. In addition, TNF induces apoptosis of virus-infected cells and promotes wound healing by promoting proliferation of fibroblasts and the like.

Thus, since TNF is induced by infection with a pathogen, TNF is an indicator of infectious disease. In addition, enhancement of the amount of TNF in the body is useful for prevention and treatment of infectious diseases, and is also useful for promoting wound healing.
Therefore, it is thought that it is useful to use Ayu TNF in diagnosing, preventing and treating Ayu infectious diseases. However, Ayu TNF and a gene encoding the same have not yet been isolated and identified.

  The TNF gene of fish began to be discovered from flounder by random sequencing (Non-Patent Document 1), and then rainbow trout (Non-Patent Document 2), river trout (Non-Patent Document 3), and Thailand (Non-Patent Document 4). ) And catfish (DNA database: accession No. AJ417565), a gene having homology to the flounder TNF gene has been discovered. The amino acid sequence deduced from the fish TNF gene has about 30% homology to mammalian TNF-α and TNF-β. Although there is structural homology between mammalian TNF and TNF in fish, its function has not been reported yet. In flatfish and rainbow trout, induction of TNF gene expression from macrophages was observed by stimulation of lipopolysaccharide (LPS), a cell component of Gram-negative bacteria, suggesting that TNF is related to protection of fish against bacterial infection. .

Hirono, I. et al., Journal of Immnology, 2000, Vol. 165, p. 4423-4427. Laing, KJ. Et al., European Journal of Biochemistry, 2001, Vol. 268, pp. 1315-1322. Bobe, J. et al., Comparative Biochemistry and Physiology B: Biochemistry and Molecular Biology, 2002, Vol. 129, p. 475-481. Garcia-Castillo, J. et al., Immunogenetics, 2002, Vol. 54, pp. 200-207.

The present invention firstly provides a novel protein having tumor necrosis factor activity (including ayu tumor necrosis factor), a gene encoding the protein, a recombinant vector containing the gene, and a transformation comprising the recombinant vector. It is intended to provide antibodies against the body and the above proteins.
Another object of the present invention is to provide a prophylactic / therapeutic agent and a prophylactic / therapeutic method for infectious diseases of sweetfish utilizing the tumor necrosis factor activity of the above protein.
Still another object of the present invention is to provide a method and a kit for diagnosing ayu infection using the expression level of the protein as an index.
Still another object of the present invention is to provide a screening method and a screening kit for a substance having a preventive / therapeutic effect on ayu infection, using the effect of enhancing the expression level of the protein as an index. I do.

  In order to achieve the above object, the present invention provides the following protein, gene, recombinant vector, transformant, antibody, agent for preventing and treating infectious diseases of Ayu, and method for diagnosing infectious diseases of Ayu And a diagnostic kit, and a screening method and a screening kit for a substance having a prophylactic / therapeutic effect on ayu infection.

(1) A protein represented by the following (a) or (b):
(A) a protein consisting of the amino acid sequence of SEQ ID NO: 2 or an amino acid sequence of positions 73 to 235 of the amino acid sequence; and (b) an amino acid sequence of SEQ ID NO: 2 or the amino acid sequence of positions 73 to 235 of the amino acid sequence. A protein comprising an amino acid sequence in which one or more amino acids have been deleted, substituted or added, and having tumor necrosis factor activity (2) a gene encoding the protein according to (1);
(3) The gene according to the above (2), comprising the DNA shown in the following (c) or (d).
(C) a DNA comprising the nucleotide sequence of SEQ ID NO: 1 or the nucleotide sequence at positions 171 to 878 or the nucleotide sequence at positions 387 to 878 in the nucleotide sequence of SEQ ID NO: 1
(D) conditions that are stringent to the nucleotide sequence of SEQ ID NO: 1 or a DNA complementary to the DNA consisting of the nucleotide sequence at positions 171 to 878 or the nucleotide sequence at positions 387 to 878 of the nucleotide sequence of SEQ ID NO: 1 Encoding a protein that hybridizes with and has tumor necrosis factor activity
(4) A recombinant vector containing the gene according to (2) or (3).
(5) A transformant containing the recombinant vector according to (4).
(6) An antibody or a fragment thereof capable of reacting with the protein of (1).
(7) A prophylactic / therapeutic agent for Ayu infectious diseases containing the protein according to (1).
(8) A method for preventing and treating infectious diseases of sweetfish, comprising a step of administering the protein according to (1) to sweetfish.
(9) A method for diagnosing infectious diseases of sweetfish, comprising the step of diagnosing whether or not the sweetfish has an infectious disease using the expression level of the protein according to (1) in sweetfish as an indicator.
(10) The method for diagnosing infectious disease according to (9), wherein the expression level is measured based on the abundance of mRNA encoding the protein according to (1) in a sample collected from the sweetfish.
(11) The method for diagnosing infectious disease according to (9), wherein the expression level is measured based on the abundance of the protein according to (1) in a sample collected from the sweetfish.
(12) When the expression level of the protein according to (1) in the test Ayu is higher than the expression level of the protein according to (1) in the healthy Ayu, the test Ayu is infected with an infectious disease. The method for diagnosing an infectious disease according to any one of the above (9) to (11), wherein the diagnosis is performed.
(13) A kit for diagnosing Ayu infectious diseases, comprising an oligonucleotide or a polynucleotide capable of hybridizing to the nucleic acid encoding the protein according to (1).
(14) A kit for diagnosing Ayu infectious diseases, comprising an antibody or a fragment thereof capable of reacting with the protein of (1).
(15) After administering the candidate substance to the sweetfish, determining the preventive / therapeutic effect of the candidate substance on infectious diseases of the sweetfish using the effect of enhancing the expression level of the protein according to (1) in the sweetfish as an index. , A method for screening a substance having a prophylactic / therapeutic effect on ayu infection.
(16) A kit for screening a substance having a prophylactic / therapeutic effect against sweetfish infection, comprising an oligonucleotide or a polynucleotide capable of hybridizing to the nucleic acid encoding the protein according to (1).
(17) A kit for screening a substance having a prophylactic and / or therapeutic effect on ayu infection, comprising an antibody or a fragment thereof capable of reacting with the protein according to (1).

  According to the present invention, a novel protein having tumor necrosis factor activity (including ayu tumor necrosis factor), a gene encoding the protein, a recombinant vector containing the gene, a transformant containing the recombinant vector, and the above protein Are provided. The present invention also provides a prophylactic / therapeutic agent and a prophylactic / therapeutic method for ayu infection using the tumor necrosis factor activity of the above protein. In addition, the present invention provides a method and a kit for diagnosing sweetfish infection using the expression level of the protein as an index. Furthermore, the present invention provides a screening method and a screening kit for a substance having a prophylactic / therapeutic effect on ayu infection, using the effect of enhancing the expression level of the protein as an index.

The protein shown in the following (a) or (b) has tumor necrosis factor activity.
(A) a protein comprising the amino acid sequence of SEQ ID NO: 2 or the amino acid sequence of positions 73 to 235 of the amino acid sequence (hereinafter referred to as “protein (a)”);
(B) an amino acid sequence represented by SEQ ID NO: 2 or an amino acid sequence of positions 73 to 235 of the amino acid sequence, wherein the amino acid sequence has one or more amino acids deleted, substituted or added, and has tumor necrosis factor activity. (Hereinafter referred to as “protein (b)”)
Here, the “tumor necrosis factor activity” includes an action as a tumor necrosis factor (TNF), for example, a tumor cytotoxic action, a wound healing promoting action, a regeneration promoting action, an infection protective action, a cell differentiation inducing action, a fetal development control. Action and the like are included. These biological activities start when the TNF molecule binds to the TNF receptor and transmits various signals into the cytoplasm. Then, an intracellular signal activates caspase to induce apoptosis of the cell, thereby damaging the tumor cell. In addition, intracellular signals induce the production of various cytokines and nitric oxide by activating transcription control proteins such as NFκB and AP-1, thereby promoting fibroblast proliferation (wound healing and regeneration), Enhancement of nitric oxide production, induction of activated oxygen, activation of neutrophils (protective action against infection), induction of cell differentiation, and control of embryogenesis occur.

Mammalian TNF is produced as a type II membrane-bound protein. This membrane-bound protein is called membrane-bound TNF or pro-TNF. Membrane-bound TNF is hydrolyzed by TACE (TNF alpha converting enzyme), a type of metalloprotease, to form secreted TNF. Although many biological activities have been reported for secreted TNF in mammals, membrane-bound TNF has also been reported to have biological activities (tumoricidal cell activity, protective action against bacterial infection, etc.). It is known that TNF of many mammals (mouse, cow, rabbit, marmot, etc.) is cleaved by TACE at the site of Thr-Leu. Since this sequence is also conserved in fish TNF, it is presumed that fish are cleaved at the Thr-Leu site in the same manner as mammals and become secreted.
The Thr-Leu site presumed to be cleaved by TACE corresponds to the amino acid sequence at positions 72 to 73 in the amino acid sequence of SEQ ID NO: 2, and the amino acid sequence at positions 73 to 235 of the amino acid sequence of SEQ ID NO: 2. Consists of secreted proteins.

  The number of amino acids to be deleted, substituted or added in the amino acid sequence of SEQ ID NO: 2 is not particularly limited as long as protein (b) has tumor necrosis factor activity, and the number is one or more, preferably Is 1 or several, and the specific range is usually 1 to 10, preferably 1 to 5, and more preferably 1 to 3. At this time, the amino acid sequence of the protein (b) has 90% or more, preferably 95% or more, more preferably 98% or more homology with the amino acid sequence of the protein (a).

The position of the amino acid to be deleted, substituted or added in the amino acid sequence of SEQ ID NO: 2 is not particularly limited as long as protein (b) has tumor necrosis factor activity.
It has been reported that human secretory TNF retains its biological activity even when a mutation is present in the N-terminal 12th amino acid (Soma, GI. Et al., Biochemical and Biophysical Research). Communication (Biochemical and Biophysical Research Communications), 1987, 148, 629-635). Therefore, from the homology with human secretory TNF, it can be considered that the tumor necrosis factor activity is retained even if a mutation is added to the amino acid sequence at positions 73 to 81 in the amino acid sequence described in SEQ ID NO: 2.

  The protein (b) includes not only a protein into which a mutation such as deletion, substitution, and addition is artificially introduced into the protein (a), but also a protein that naturally exists in a deleted, substituted, or added state (for example, And proteins that can be caused by polymorphism or the like in Ayu) or proteins into which mutations such as deletion, substitution, or addition are artificially introduced.

  The proteins (a) and (b) include both proteins to which sugar chains are added and proteins to which sugar chains are not added. The type, position, and the like of the sugar chain added to the protein vary depending on the type of host cell used in the production of the protein, but the protein to which the sugar chain is added can be obtained using any host cell. Also includes proteins. The proteins (a) and (b) also include pharmaceutically acceptable salts thereof.

Proteins (a) and (b) can be produced by a conventional method using genes encoding the respective proteins. As the gene encoding the protein (a), for example, a DNA having the nucleotide sequence of SEQ ID NO: 1 can be used.
A DNA consisting of the nucleotide sequence of SEQ ID NO: 1 is synthesized based on the nucleotide sequence of SEQ ID NO: 1 by preparing a cDNA library using mRNA extracted from tissues such as head and kidney, liver, and spleen of sweetfish. It can be obtained by screening a clone containing a target DNA from a cDNA library using the probe thus obtained. Hereinafter, each step of preparing a cDNA library and screening a clone containing the target DNA will be described.

[Preparation of cDNA library]
When preparing a cDNA library, after obtaining total RNA from tissues such as head and kidney, liver, and spleen of sweetfish, affinity column method using oligo dT-cellulose or poly-U-Sepharose, batch method, etc. Obtain poly (A +) RNA (mRNA). At this time, poly (A +) RNA (mRNA) may be fractionated by sucrose density gradient centrifugation or the like. Next, using the obtained mRNA as a template, a single-stranded cDNA is synthesized using an oligo dT primer and a reverse transcriptase, and then a double-stranded cDNA is synthesized from the single-stranded cDNA. The thus obtained double-stranded cDNA is inserted into an appropriate cloning vector to prepare a recombinant vector, and a host cell such as Escherichia coli is transformed using the recombinant vector. By selecting a transformant as above, a cDNA library can be obtained. A cloning vector for preparing a cDNA library may be any vector that can autonomously replicate in a host cell, and examples include a phage vector and a plasmid vector. As the host cell, for example, Escherichia coli or the like can be used.

  Transformation of host cells such as Escherichia coli can be performed by a method of adding a recombinant vector to competent cells prepared in the presence of calcium chloride, magnesium chloride, or rubidium chloride. When a plasmid is used as a vector, a drug resistance gene such as tetracycline or ampicillin is contained.

  In preparing a cDNA library, a commercially available kit, for example, SuperScript Plasmid System for cDNA Synthesis and Plasmid Cloning (manufactured by Gibco BRL), ZAP-cDNA Synthesis Kit (manufactured by Stratagene), or the like can be used.

[Screening of clones containing the target DNA]
When screening a clone containing the target DNA from the cDNA library, a primer is synthesized based on the nucleotide sequence shown in SEQ ID NO: 1, and a polymerase chain reaction (PCR) is performed using the primer to obtain a PCR amplified fragment. . The PCR amplified fragment may be subcloned using an appropriate plasmid vector. The primer set used for PCR is not particularly limited, and can be designed based on the nucleotide sequence of SEQ ID NO: 1.

The target DNA is obtained by performing colony hybridization or plaque hybridization on the cDNA library using the PCR amplified fragment as a probe. As the probe, a PCR-amplified fragment labeled with an isotope (for example, ³² P, ³⁵ S), biotin, digoxigenin, alkaline phosphatase, or the like can be used. A clone containing the target DNA can also be obtained by expression screening such as immunoscreening using an antibody.

  The nucleotide sequence of the obtained DNA is obtained by digesting the DNA fragment as it is or after cutting it with an appropriate restriction enzyme or the like, incorporating the DNA fragment into a vector by a conventional method, and using a commonly used nucleotide sequence analysis method, for example, a chemical modification method of Maxam-Gilbert. , Using the dideoxynucleotide chain termination method. At the time of nucleotide sequence analysis, a nucleotide sequence analyzer such as a 373A DNA sequencer (manufactured by Perkin Elmer) is usually used.

As described above, a DNA consisting of the nucleotide sequence of SEQ ID NO: 1 is obtained as the gene encoding the protein (a).
In the nucleotide sequence of SEQ ID NO: 1, the protein consisting of the amino acid sequence of SEQ ID NO: 2 is encoded by the nucleotide sequence at positions 171 to 878, and the translation initiation codon ATG is encoded by the nucleotide sequence at positions 171 to 173. The stop codon TAG is encoded by the nucleotide sequence at positions 876 to 878, the transmembrane domain is encoded by the nucleotide sequence at positions 285 to 335, and is an amino acid sequence that is cleaved by TACE (TNF alpha converting enzyme). (Thr-Leu) is encoded by the nucleotide sequence at positions 384 to 389. The protein consisting of the amino acid sequence of positions 73 to 235 in the amino acid sequence of SEQ ID NO: 2 is encoded by the nucleotide sequence of positions 387 to 878 of the nucleotide sequence of SEQ ID NO: 1.

  The gene encoding the protein (a) is limited to the nucleotide sequence of SEQ ID NO: 1 or a DNA consisting of the nucleotide sequence at positions 171 to 878 or the nucleotide sequence at positions 387 to 878 in the nucleotide sequence of SEQ ID NO: 1. However, as long as the protein (a) is encoded, DNAs having other base sequences are also included. Such DNA is obtained by chemical synthesis according to its base sequence. For chemical synthesis of DNA, a commercially available DNA synthesizer, for example, a DNA synthesizer using the thiophosphite method (manufactured by Shimadzu Corporation) and a DNA synthesizer using the phosphoramidite method (manufactured by Perkin Elmer) are used. Can be done.

  The gene encoding protein (b) is complementary to the nucleotide sequence of SEQ ID NO: 1 or the DNA consisting of the nucleotide sequence at positions 171 to 878 or the nucleotide sequence at positions 387 to 878 in the nucleotide sequence of SEQ ID NO: 1. And DNA encoding a protein having a tumor necrosis factor activity, which hybridizes to stringent DNA under stringent conditions.

  As the “stringent conditions”, for example, conditions of 37 to 80 ° C., 0.05 to 5 × SSC and 0.1 to 10% SDS, preferably 50 to 72 ° C., 0.1 to 2 × SSC and 0 .2 to 5% SDS.

  Stringent to a DNA complementary to the target DNA (i.e., the base sequence of SEQ ID NO: 1 or the DNA consisting of the base sequence at positions 171 to 878 or the base sequence at positions 387 to 878 of the base sequence of SEQ ID NO: 1) Specific examples of DNAs that hybridize under suitable conditions include DNAs having at least 70% or more, preferably 80% or more, and more preferably 90% or more homology with the target DNA.

  The gene encoding the protein (b) is, for example, a nucleotide sequence represented by SEQ ID NO: 1, or a DNA consisting of the nucleotide sequence at positions 171 to 878 or the nucleotide sequence at positions 387 to 878 in the nucleotide sequence represented by SEQ ID NO: 1, It can be obtained by artificially introducing a mutation using a known method such as a site-directed mutagenesis method. Mutation can be introduced using, for example, a mutation introduction kit, for example, Mutant-K (manufactured by TAKARA), Mutant-G (manufactured by TAKARA), or TAKARA's LA PCR in vitro Mutagenesis series kit. DNA having a base sequence already determined can also be obtained by chemical synthesis.

  Proteins (a) and (b) can be produced, for example, by expressing genes encoding the respective proteins in host cells according to the following steps.

(Preparation of recombinant vector and transformant)
When preparing a recombinant vector, a DNA fragment of an appropriate length containing the coding region of the target protein is prepared. In addition, base-substituted DNA is prepared so that the base sequence of the coding region of the protein of interest becomes an optimal codon for expression in a host cell.

  A transformant capable of producing a desired protein by inserting this DNA fragment into the downstream of an appropriate expression vector promoter to produce a recombinant vector and introducing the recombinant vector into an appropriate host cell Is obtained. The DNA fragment needs to be incorporated into a vector so that its function can be exhibited. In addition to the promoter, the vector may be a cis element such as an enhancer, a splicing signal, a polyA addition signal, or a selection marker (eg, dihydrogen). (Folate reductase gene, ampicillin resistance gene, neomycin resistance gene), ribosome binding sequence (SD sequence) and the like.

  The expression vector is not particularly limited as long as it is capable of autonomous replication in a host cell. For example, a plasmid vector, a phage vector, a virus vector and the like can be used. Examples of the plasmid vector include E. coli-derived plasmids (eg, pRSET, pBR322, pBR325, pUC118, pUC119, pUC18, pUC19), Bacillus subtilis-derived plasmids (eg, pUB110, pTP5), and yeast-derived plasmids (eg, YEp13). , YEp24, YCp50), and phage vectors include, for example, λ phage (eg, Charon4A, Charon21A, EMBL3, EMBL4, λgt10, λgt11, λZAP), and viral vectors include, for example, retrovirus, vaccinia Animal viruses such as viruses, and insect viruses such as baculoviruses.

  As the host cell, any of a prokaryotic cell, a yeast, an animal cell, an insect cell, a plant cell and the like may be used as long as the gene of interest can be expressed. In addition, animal individuals, plant individuals, silkworm insect bodies, and the like may be used.

When a bacterium is used as a host cell, for example, genus Escherichia such as Escherichia coli, genus Bacillus such as Bacillus subtilis, genus Pseudomonas such as Pseudomonas putida, rhizobium meliloti ( Bacteria belonging to the genus Rhizobium, such as Rhizobium meliloti), can be used as host cells. Specifically, Escherichia coli XL1-Blue, Escherichia coli XL2-Blue, Escherichia coli DH1, Escherichia coli K12, Escherichia coli JM109, Escherichia coli HB101, and other Escherichia coli, Bacillus subtilis MI114, Bacillus subtilis 207-21, etc. Bacteria can be used as host cells. The promoter in this case is not particularly limited as long as it can be expressed in bacteria such as Escherichia coli. For example, a promoter derived from Escherichia coli or a phage such as a trp promoter, a lac promoter, a P _L promoter, or a P _R promoter is used. it can. In addition, artificially designed and modified promoters such as the tac promoter, lacT7 promoter, and let I promoter can also be used.

  The method for introducing the recombinant vector into bacteria is not particularly limited as long as it can introduce DNA into bacteria, and for example, a method using calcium ions, an electroporation method, and the like can be used.

  When yeast is used as a host cell, Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pichia pastoris and the like can be used as host cells. The promoter in this case is not particularly limited as long as it can be expressed in yeast.For example, gal1 promoter, gal10 promoter, heat shock protein promoter, MFα1 promoter, PHO5 promoter, PGK promoter, GAP promoter, ADH promoter, AOX1 promoter Etc. can be used.

  The method for introducing the recombinant vector into yeast is not particularly limited as long as it can introduce DNA into yeast, and for example, an electroporation method, a spheroplast method, a lithium acetate method, or the like can be used.

  When animal cells are used as host cells, monkey cells COS-7, Vero, Chinese hamster ovary cells (CHO cells), mouse L cells, rat GH3, human FL cells, and the like can be used as host cells. The promoter in this case is not particularly limited as long as it can be expressed in animal cells, and examples thereof include SRα promoter, SV40 promoter, LTR (Long Terminal Repeat) promoter, CMV promoter, human cytomegalovirus early gene promoter, and the like. Can be used.

  The method for introducing the recombinant vector into animal cells is not particularly limited as long as it can introduce DNA into animal cells. For example, an electroporation method, a calcium phosphate method, a lipofection method and the like can be used.

  When an insect cell is used as a host, an ovary cell of Spodoptera frugiperda, an ovary cell of Trichoplusia ni, a cultured cell derived from a silkworm ovary, or the like can be used as a host cell. Spodoptera frugiperda ovarian cells include Sf9 and Sf21, Trichoplusia ni ovary cells include High 5, BTI-TN-5B1-4 (manufactured by Invitrogen), and silkworm ovary-derived cultured cells include Bombyx mori N4. Can be

  The method for introducing the recombinant vector into the insect cells is not particularly limited as long as the DNA can be introduced into the insect cells. For example, a calcium phosphate method, a lipofection method, an electroporation method and the like can be used.

(Culture of transformant)
A transformant into which the recombinant vector incorporating the DNA encoding the target protein has been introduced is cultured according to a conventional culture method. Culture of the transformant can be performed according to a usual method used for culturing host cells.

  The medium for culturing a transformant obtained by using a microorganism such as Escherichia coli or yeast as a host cell contains a carbon source, a nitrogen source, inorganic salts, and the like which can be used by the microorganism to efficiently culture the transformant. Any of a natural medium and a synthetic medium may be used as long as the medium can be used.

  As the carbon source, carbohydrates such as glucose, fructose, sucrose and starch, organic acids such as acetic acid and propionic acid, and alcohols such as ethanol and propanol can be used. As the nitrogen source, there can be used ammonium salts of inorganic or organic acids such as ammonia, ammonium chloride, ammonium sulfate, ammonium acetate and ammonium phosphate, peptone, meat extract, yeast extract, corn steep liquor, casein hydrolyzate and the like. As the inorganic salt, potassium (I) phosphate, potassium (II) phosphate, magnesium phosphate, magnesium sulfate, sodium chloride, ferrous sulfate, manganese sulfate, copper sulfate, calcium carbonate and the like can be used.

  Culture of a transformant obtained by using a microorganism such as Escherichia coli or yeast as a host cell is performed under aerobic conditions such as shaking culture or aeration-agitation culture. The culture temperature is usually 20 to 37 ° C., the culture time is usually 6 hours to 6 days, and the pH is maintained at 5.0 to 8.0 during the culture period. The pH can be adjusted using an inorganic acid, an organic acid, an alkaline solution, urea, calcium carbonate, ammonia, or the like. At the time of culturing, an antibiotic such as ampicillin or tetracycline may be added to the medium as needed.

  When culturing a microorganism transformed with an expression vector using an inducible promoter as a promoter, an inducer may be added to the medium as necessary. For example, when culturing a microorganism transformed with an expression vector using a lac promoter, isopropyl-β-D-thiogalactopyranoside or the like is used. When culturing a microorganism transformed with an expression vector using a trp promoter, indole acryl is used. An acid or the like may be added to the medium.

As a medium for culturing a transformant obtained using animal cells as host cells, commonly used RPMI1640 medium, Eagle's MEM medium, DMEM medium, Ham F12 medium, Ham F12K medium or a fetal calf serum or the like in these mediums And the like can be used. Culture of the transformant is usually performed at 20 to 42 ° C. for 24 hours to 6 days in the presence of 5% CO ₂ . At the time of culturing, an antibiotic such as kanamycin, penicillin, streptomycin, etc. may be added to the medium as needed.

  As a medium for culturing a transformant obtained by using an insect cell as a host cell, commonly used TNM-FH medium (Pharmingen), Sf-900 II SFM medium (Gibco BRL), ExCell400 Culture of a transformant that can use ExCell405 (manufactured by JRH Biosciences) or the like is usually performed at 25 to 30 ° C. for 2 to 4 days. At the time of culturing, an antibiotic such as gentamicin may be added to the medium as needed.

  The target protein can be expressed as a secretory protein or a fusion protein. Examples of the protein to be fused include β-galactosidase, protein A, an IgG binding region of protein A, chloramphenicol acetyltransferase, poly (Arg), poly (Glu), protein G, maltose binding protein, and glutathione S-protein. Examples include transferase, polyhistidine chain (His-tag), S peptide, DNA binding protein domain, Tac antigen, thioredoxin, green fluorescent protein, and the like.

[Isolation and purification of protein]
The target protein is obtained by collecting the target protein from the culture of the transformant. Here, the “culture” includes any of culture supernatant, cultured cells, cultured bacterial cells, and crushed cells or bacterial cells.
When the target protein is accumulated in the cells of the transformant, the cells in the culture are collected by centrifuging the culture, the cells are washed, and then the cells are disrupted. Extract the protein to be used. When the target protein is secreted out of the cells of the transformant, the culture supernatant is used as it is, or cells or cells are removed from the culture supernatant by centrifugation or the like.

  The protein (a) or (b) thus obtained is subjected to a solvent extraction method, a salting out method using ammonium sulfate or the like, a desalting method using an organic solvent, a diethylaminoethyl (DEAE) -Sepharose, an ion exchange chromatography method, a hydrophobic chromatography method. It can be purified by a chromatography method, a gel filtration method, an affinity chromatography method, or the like.

  The protein (a) or (b) can also be produced by a chemical synthesis method such as the Fmoc method (fluorenylmethyloxycarbonyl method) or the tBoc method (t-butyloxycarbonyl method) based on the amino acid sequence. At this time, a commercially available peptide synthesizer can be used.

By using the protein (a) or (b) as an antigen for immunization, an antibody or a fragment thereof that can react with the protein (a) or (b) can be produced. Here, the `` antibody '' includes both a monoclonal antibody and a polyclonal antibody, and the `` antibody fragment '' includes a Fab fragment, an F (ab) ′ ₂ fragment, a single-chain antibody (scFv), and the like. .

  Examples of the antigen for immunization include (i) a crushed cell or tissue expressing protein (a) or (b) or a purified product thereof, and (ii) a protein (a) Or a recombinant protein obtained by introducing a DNA encoding (b) (for example, for the protein (a), a DNA comprising the nucleotide sequence of SEQ ID NO: 1) into a host such as Escherichia coli, an insect cell, or an animal cell, and expressing the recombinant protein; (iii) Chemically synthesized peptides and the like can be used.

  In preparing a polyclonal antibody, mammals such as rats, mice, guinea pigs, rabbits, sheep, horses, and cows are immunized with an antigen for immunization. As an immunized animal, it is preferable to use a mouse because an antibody can be easily produced. In immunization, in order to induce antibody production, it is preferable to perform immunization a plurality of times after emulsification using an immunity adjuvant such as Freund's complete adjuvant. As the immunizing aid, Freund's complete adjuvant (FCA), Freund's incomplete adjuvant (FIA), aluminum hydroxide gel and the like can be used. The dose of the antigen per mammal can be appropriately set according to the type of mammal, but is usually 1 to 100 μg for mice. The administration site is, for example, intravenous, subcutaneous, intraperitoneal, or the like. Immunization is usually performed at intervals of several days to several weeks, preferably at intervals of 7 days to 5 weeks, for a total of 1 to 10, preferably 3 to 6 immunizations. Then, 5 to 10 days after the last immunization day, the antibody titer against the protein (a) or (b) is measured. After the antibody titer increases, blood is collected to obtain an antiserum. The antibody titer can be measured by enzyme immunoassay (ELISA), radioimmunoassay (RIA) or the like.

  When purification of the antibody from the antiserum is required, known methods such as salting out with ammonium sulfate, gel chromatography, ion exchange chromatography, affinity chromatography and the like can be appropriately selected or used in combination.

  When preparing a monoclonal antibody, a mammal is immunized with an immunizing antigen in the same manner as in the case of the polyclonal antibody, and antibody-producing cells are collected 2 to 4 days after the last immunization. Examples of the antibody-producing cells include spleen cells, lymph node cells, thymocytes, peripheral blood cells, and the like, and spleen cells are generally used.

  Next, in order to obtain a hybridoma, cell fusion between the antibody-producing cell and the myeloma cell is performed. As the myeloma cells to be fused with the antibody-producing cells, generally available cell lines derived from mammals such as humans and mice can be used. As a cell line to be used, a cell line which has drug selectivity, cannot survive in a selection medium (for example, HAT medium) in an unfused state, and can survive only in a state fused to an antibody-producing cell is preferable. Specific examples of myeloma cells include mouse myeloma cell lines such as P3X63-Ag.8.U1 (P3U1), P3 / NSI / 1-Ag4-1, Sp2 / 0-Ag14.

  For cell fusion, antibody-producing cells and myeloma cells are mixed at a predetermined ratio (for example, 1: 3 to 1:10) in a serum-free animal cell culture medium such as DMEM or RPMI-1640 medium, and polyethylene The fusion reaction is performed in the presence of a cell fusion promoter such as glycol, or by electric pulse treatment (eg, electroporation).

  After the cell fusion treatment, the cells are cultured using a selection medium, and the desired hybridoma is selected. Next, it is screened whether the target antibody is present in the culture supernatant of the grown hybridoma. Hybridoma screening may be performed according to a conventional method, and is not particularly limited. For example, a part of the culture supernatant contained in a well grown as a hybridoma can be collected and screened by enzyme immunoassay (ELISA), radioimmunoassay (RIA), or the like.

  Hybridoma cloning can be performed, for example, by a limiting dilution method, a soft agar method, a fibrin gel method, a fluorescence-excited cell sorter method, etc., and finally obtain a hybridoma that produces a monoclonal antibody.

As a method for collecting a monoclonal antibody from the obtained hybridoma, a usual cell culture method or the like can be used. In the cell culture method, for example, the hybridoma is cultured in an animal cell culture medium such as RPMI-1640 medium containing 10 to 20% fetal bovine serum and MEM medium under normal culture conditions (for example, 37 ° C., 5% CO ₂ concentration). By culturing for 7 days, a monoclonal antibody can be obtained from the culture supernatant. Alternatively, the hybridoma can be transplanted into the abdominal cavity of a mouse or the like, and ascites can be collected 10 to 20 days later, and a monoclonal antibody can be obtained from the ascites.

  When purification of the monoclonal antibody is required, known methods such as salting out with ammonium sulfate, gel chromatography, ion exchange chromatography, affinity chromatography and the like can be appropriately selected or used in combination.

  Since the protein (a) or (b) has tumor necrosis factor activity, it can be used as an active ingredient of a prophylactic / therapeutic agent for Ayu infection. The protein (a) or (b) administered to the sweetfish enhances the immune defense mechanism of the sweetfish, thereby preventing and treating infectious diseases of the sweetfish.

  Infectious diseases in which the protein (a) or (b) can exert a prophylactic / therapeutic effect are not particularly limited. For example, cold water disease (pathogen: Flavobacterium psychrophilum), pseudomonas disease (pathogen: Pseudomonas plecoglossicida), bacteria Sex gill disease (pathogen: Flexibacter species, Cytophaga species), vibrio disease (pathogen: Vibrio anguillarum) and the like can be mentioned.

  When the protein (a) or (b) can exert the effect of preventing or treating infectious diseases in animals other than sweetfish, the protein (a) or (b) is effective for preventing or treating infectious diseases in animals other than sweetfish. It can also be used as a component. Examples of animals other than ayu in which the protein (a) or (b) can exert the effect of preventing or treating infectious diseases include, for example, salmonid fishes such as chum salmon, calamus trout, sockeye salmon, coho salmon, loquat trout, rainbow trout, candy trout and oschocoma , Brook trout, smelt, shishamo, shirouo and the like.

  The prophylactic / therapeutic agent for Ayu infectious disease may be composed of only the protein (a) or (b), but is usually used together with one or more pharmaceutically acceptable carriers and / or additives according to a conventional method. Formulated. The protein content in the preparation can be appropriately adjusted according to the intended effect, administration method, age and weight of the animal to be administered, and the like. A recombinant vector capable of expressing the protein (a) or (b) can also be used as an active ingredient of the prophylactic / therapeutic agent for sweetfish infection.

  Pharmaceutically acceptable carriers include water, pharmaceutically acceptable organic solvents, collagen, polyvinyl alcohol, polyvinylpyrrolidone, carboxyvinyl polymer, sodium alginate, water-soluble dextran, sodium carboxymethyl starch, pectin, xanthan gum, gum arabic , Casein, gelatin, agar, glycerin, propylene glycol, polyethylene glycol, petrolatum, paraffin, stearyl alcohol, stearic acid, human serum albumin, mannitol, sorbitol, lactose and the like.

  Examples of additives used in formulation include fillers, extenders, binders, humectants, disintegrants, surfactants, lubricants, excipients, stabilizers, antibacterial agents, and buffering agents. , A tonicity agent, a chelating agent, a pH adjuster, a surfactant and the like. These additives are appropriately selected according to the dosage unit form of the preparation and the like. Among these, components used in ordinary protein preparations, such as stabilizers, antibacterial agents, buffers, isotonic agents, chelating agents, pH adjusters, and surfactants are preferably selected.

  The protein (a) or (b) may be a pharmaceutically acceptable salt, and specific examples thereof include non-toxic alkali metal salts such as sodium, potassium, lithium, calcium, magnesium, barium, and ammonium; Earth metal salts, ammonium salts and the like. The above salts also include non-toxic acid addition salts formed by the reaction of a protein or amino acid with a suitable organic or inorganic acid. Representative non-toxic acid addition salts include, for example, hydrochloride, hydrochloride, hydrobromide, sulfate, bisulfate, acetate, oxalate, valerate, oleate, laurate , Borate, benzoate, lactate, phosphate, p-toluenesulfonate (tosylate), citrate, maleate, fumarate, succinate, tartrate, sulfonate, glycolic acid Salts, maleates, ascorbates, benzenesulfonates and the like.

  Administration routes of the prophylactic / therapeutic agent for sweetfish infection include, for example, oral administration, parenteral administration (for example, subcutaneous administration, intramuscular administration, intraperitoneal administration, etc.). Preparations, capsules, tablets, granules, solutions, emulsions, suppositories, injections, ointments, tapes, inserts and the like. Further, the prophylactic / therapeutic agent for Ayu infectious disease can also be administered by mixing it with feed or the like.

  The dose and frequency of administration of the prophylactic / therapeutic agent for sweetfish vary depending on the desired effect, the age and weight of the animal to be administered, but the dose per dose is usually 0.0001 to 10 μg per sweetfish. It is suitably adjusted so as to be preferably 0.001 to 1 μg, more preferably 0.005 to 0.1 μg. The number of administrations is appropriately selected from a range of once to several times a day.

  When ayu is infected with an infection, the expression level of the protein (a) or (b) having tumor necrosis factor activity is increased by the action of the immune defense mechanism. Therefore, by using the expression level of the protein (a) or (b) in the sweetfish as an index, it can be diagnosed whether the sweetfish has an infectious disease.

  When diagnosing an infectious disease, for example, a specimen is collected from sweetfish and the expression level of protein (a) or (b) in the specimen is measured. Tissues and organs collected from sweetfish and used as specimens are not particularly limited, and include, for example, blood, skin, liver, muscle, spleen, gills, fins, kidney, intestine, stomach and the like.

  The “expression level of the protein (a) or (b)” includes the level of transcription of the gene encoding the protein (a) or (b) into mRNA and the level of translation into the protein (a) or (b). . Therefore, the expression level of the protein (a) or (b) in the sample is determined by the amount of the mRNA encoding the protein (a) or (b) in the sample, or the amount of the protein (a) or (b) in the sample. Can be measured based on

  In measuring the abundance of mRNA encoding the protein (a) or (b) in the specimen, known gene analysis techniques, for example, hybridization techniques (eg, Northern hybridization, dot blot, DNA microarray, etc.) And a gene amplification technique (for example, RT-PCR or the like).

  When using the hybridization technique, an oligonucleotide or polynucleotide that can hybridize to the nucleic acid encoding the protein (a) or (b) can be used as a probe. When using the gene amplification technique, Nucleotides or polynucleotides can be used as primers.

  The “nucleic acid encoding the protein (a) or (b)” includes both DNA and RNA, and includes, for example, mRNA, cDNA, cRNA and the like. The nucleotide constituting the oligonucleotide or the polynucleotide may be any of deoxyribonucleotide and ribonucleotide. The base length of the oligonucleotide is not particularly limited, but is usually 15 to 30 bases, preferably 18 to 25 bases. The base length of the polynucleotide is not particularly limited, but is usually 50 to 1500 bases, preferably 200 to 800 bases.

  The oligonucleotide or polynucleotide capable of hybridizing to the nucleic acid encoding the protein (a) or (b) is preferably capable of specifically hybridizing to the nucleic acid encoding the protein (a) or (b). "Specifically hybridizable" means that it can hybridize under stringent conditions, and "stringent conditions" include, for example, 37-80 ° C, 0.05-5 × SSC And 0.1 to 10% SDS, preferably 50 to 72 ° C., 0.1 to 2 × SSC and 0.2 to 5% SDS.

  The nucleotide sequence of the oligonucleotide or polynucleotide that can hybridize to the nucleic acid encoding the protein (a) or (b) can be designed based on the nucleotide sequence of the nucleic acid encoding the protein (a) or (b). The oligonucleotide or polynucleotide hybridizes to a region at the 5 'end or 3' end of the CDS region, for example, so that it can hybridize to the CDS region of the nucleic acid encoding the protein (a) or (b). Or to hybridize to a region that extends from the CDS region to the region 5 'or 3' to the CDS region. A restriction enzyme recognition sequence, a tag, and the like can be added to the 5 'end of the primer, and a label such as a fluorescent dye or a radioisotope can be added to the primer and the probe.

  A specific method for measuring the abundance of the mRNA encoding the protein (a) or (b) in the sample will be described using RT-PCR as an example. After extracting total RNA from a sample collected from sweetfish and synthesizing cDNA from the extracted total RNA, using the synthesized cDNA as a template, a primer capable of hybridizing to cDNA encoding protein (a) or (b) is used. By performing PCR and quantifying the PCR-amplified fragment, the amount of mRNA encoding the protein (a) or (b) can be measured. At this time, the PCR is performed under conditions (for example, the number of PCR cycles at which the PCR amplified fragment increases exponentially) so that the amount of the PCR amplified fragment reflects the initial amount of the template cDNA.

  The method for quantifying the PCR-amplified fragment is not particularly limited. For the quantification of the PCR-amplified fragment, for example, a quantification method using a radioisotope (RI), a quantification method using a fluorescent dye, and the like can be used.

As a quantification method using RI, for example, (i) an RI-labeled nucleotide (for example, ³² P-labeled dCTP or the like) is added as a substrate to a reaction solution, incorporated into a PCR amplified fragment, and Labeling, separating the PCR amplified fragment by electrophoresis or the like, and then measuring the radioactivity to quantify the PCR amplified fragment. (Ii) RI-labeling the PCR amplified fragment by using RI-labeled primers to perform PCR amplification After separating the fragments by electrophoresis or the like, a method of measuring radioactivity and quantifying the PCR-amplified fragment, (iii) electrophoresing the PCR-amplified fragment, blotting the membrane, and hybridizing the RI-labeled probe, A method of measuring radioactivity and quantifying a PCR-amplified fragment is exemplified. Radioactivity can be measured using, for example, a liquid scintillation counter, an X-ray film, an imaging plate, or the like.

  Quantitative methods using fluorescent dyes include (i) staining a PCR amplified fragment with a fluorescent dye that intercalates into double-stranded DNA (eg, ethidium bromide (EtBr), SYBR GreenI, PicoGreen, etc.) A method of measuring the intensity of fluorescence emitted by light irradiation to quantify the PCR-amplified fragment, (ii) labeling the PCR-amplified fragment with a fluorescent dye by using a fluorescent-labeled primer, and subjecting the PCR-amplified fragment to electrophoresis or the like. And then quantifying the PCR amplified fragment by measuring the fluorescence intensity. The fluorescence intensity can be measured using, for example, a CCD camera, a fluorescence scanner, a spectrofluorometer, or the like.

  In measuring the abundance of the protein (a) or (b) in the sample, known protein analysis techniques, for example, a western blotting method using an antibody or a fragment thereof capable of reacting with the protein (a) or (b), an immunological method, Sedimentation, ELISA, tissue immunostaining and the like can be used.

  When measuring the abundance of the protein (a) or (b) in a sample using an antibody or a fragment thereof that can react with the protein (a) or (b), for example, radioimmunoassay (RIA) Enzyme immunoassay (EIA), chemiluminescence assay (CLIA), fluorescence immunoassay (FIA), tissue immunostaining, and the like. Specifically, after capturing the protein (a) or (b) in the sample using a solid phase carrier (for example, an immunoplate, latex particles, or the like) to which the antibody is bound by physical adsorption, chemical bonding, or the like, A labeled antibody (for example, an enzyme such as peroxidase, alkaline phosphatase or the like) having a different antigen recognition site for the protein (a) or (b) from the antibody in which the captured protein (a) or (b) is immobilized on a solid support. Antibody labeled with a fluorescent substance such as fluorescens and umbelliferone).

  The measurement of the amount of the protein (a) or (b) in the sample can also be performed by measuring the activity of the protein (a) or (b) in the sample. The activity of the protein (a) or (b) can be measured, for example, by a known method such as a western blotting method or an ELISA method using an antibody or a fragment thereof that can react with the protein (a) or (b).

  It is preferable to correct the measured value of the expression level of the protein (a) or (b) based on the measured value of the expression level of a protein (eg, β-actin, GAPDH) whose expression level does not fluctuate greatly.

  In the method for diagnosing infectious diseases of sweetfish, for example, the expression level of protein (a) or (b) in a sample collected from a test sweetfish is determined by comparing the expression level of protein (a) or (b) in a sample collected from healthy sweetfish. When it is also high, it can be diagnosed that the test sweetfish has an infection.

  When comparing the expression level of the protein (a) or (b) between the test sweetfish and the healthy sweetfish, it is preferable to use the same tissue or organ as the specimen. When comparing the expression level of the protein (a) or (b), the expression level of the protein (a) or (b) in a plurality of healthy ayu (healthy animal group) is quantified, and the distribution of the value is determined from the distribution of the value. It is preferable to set a normal range and determine whether the expression level of the protein (a) or (b) in the test sweetfish is higher than or lower than the normal range. At this time, when the expression level of the protein (a) or (b) in the test sweetfish sample is higher than the normal range, it can be diagnosed that the test sweetfish is suffering from an infection.

  A method for diagnosing infectious diseases of sweetfish using the expression level of the protein (a) or (b) as an index can be widely and generally used for infectious diseases of sweetfish, and infectious diseases that can be diagnosed are not particularly limited. Examples of infectious diseases that can be diagnosed include cold water disease, pseudomonadism, bacterial gill disease (pathogenic bacteria: Flexibacter species, Cytophaga species), vibrio disease (pathogenic bacteria: Vibrio anguillarum), and the like.

  Oligonucleotides or polynucleotides capable of hybridizing to the nucleic acid encoding the protein (a) or (b), or an antibody or a fragment thereof capable of reacting with the protein (a) or (b) are provided with a kit for diagnosing Ayu infectious disease It can be used as a component. These oligonucleotides, polynucleotides, antibodies, or fragments thereof are included in a kit for diagnosing Ayu infectious diseases as a reagent for measuring the expression level of protein (a) or (b) in a sample collected from a test Ayu.

  The kit for diagnosing infectious diseases of sweetfish may be in any form as long as it contains the above-mentioned oligonucleotide or polynucleotide, or the above-mentioned antibody or fragment thereof, and may contain any reagents, instruments and the like.

When the kit for diagnosing infectious diseases of ayu contains the above oligonucleotide or polynucleotide, reagents necessary for PCR (eg, H ₂ O, buffer, MgCl ₂ , dNTP mix, Taq polymerase, etc.), quantification of PCR amplified fragment (E.g., RI, fluorescent dye, etc.), a DNA microarray, a DNA chip, etc., or one or more of them.

  When the kit for diagnosing infectious diseases of ayu contains the above-mentioned antibody or a fragment thereof, a solid-phase carrier for immobilizing the antibody or the fragment thereof (for example, immunoplate, latex particles, etc.), an anti-γ- One type of globulin antibodies (secondary antibodies), labels of antibodies (including secondary antibodies) or fragments thereof (eg, enzymes, fluorescent substances, etc.), various reagents (eg, enzyme substrates, buffers, diluents, etc.) Alternatively, two or more types can be included.

  When the expression level of the protein (a) or (b) having tumor necrosis factor activity in the sweetfish body is enhanced, the defense mechanism of sweetfish is enhanced, and infection of sweetfish can be prevented and treated. Therefore, after administering the candidate substance to the sweetfish, by using the effect of enhancing the expression level of the protein (a) or (b) in the sweetfish as an index, the preventive / therapeutic effect of the candidate substance on the infectious disease of the sweetfish can be determined. By selecting a substance (TNF-inducing substance) having the effect of enhancing the expression level of (a) or (b), a substance having a preventive / therapeutic effect on ayu infection can be screened.

  The “effect of enhancing the expression level of the protein (a) or (b)” includes any of transcription and translation of a gene encoding the protein (a) or (b), and activity expression of the protein (a) or (b). Also includes effects on steps.

  Oligonucleotides or polynucleotides capable of hybridizing to the nucleic acid encoding the protein (a) or (b), or antibodies or fragments thereof that react with the protein (a) or (b) are prevented against ayu infection -It can be used as a component of a screening kit for a substance having a therapeutic effect. These oligonucleotides, polynucleotides, antibodies or fragments thereof are used as reagents for measuring the expression level of protein (a) or (b) in a sample, as a substance having a preventive / therapeutic effect on ayu infection. Included in screening kit.

  The screening kit for a substance having a prophylactic / therapeutic effect against sweetfish infection may be in any form as long as it contains the above-mentioned oligonucleotide or polynucleotide or the above-mentioned antibody or fragment thereof. In addition to the various reagents and instruments exemplified in the kit for use, a candidate substance, a candidate substance synthesis kit, a sweetfish breeding kit, and the like can be included.

Example 1 Cloning of TNF Gene of Ayu The cloning of TNF gene of Ayu was performed by degenerative PCR. Since Ayu belongs to the order Salmonid, the rainbow trout TNF gene of the closely related salmonid, for which the TNF gene has already been cloned (Laing, KJ. Et al., European Journal of Biochemistry, 2001, 268, p. 1315-1322), primers for screening PCR were designed (see FIG. 1). Furthermore, flounder TNF (Hirono, I. et al., Journal of Immnology, 2000, vol. 165, p. 4423-4427) and the conserved region of rainbow trout TNF, primers for degenerative PCR were designed (see FIG. 2). FIG. 1 shows the alignment between the flounder TNF gene and the rainbow trout TNF gene, and the hybridization positions of the screening PCR primers designed based on the rainbow trout TNF gene. FIG. 2 shows the alignment of Ayu TNF, flounder TNF, and rainbow trout TNF, and the hybridization positions of primers for degenerative PCR designed from the conserved region of flounder TNF and rainbow trout TNF.

The base sequences of the screening PCR primer and the degenerative PCR primer designed as described above are as follows.
SP1: 5'-AAAGCAGCCATCCATTTAGA -3 '
SP2: 5'- GAACCAAATCCTCATCCCAC -3 '
SP3: 5'- TTCTTCGTTTACAGCCAGGC -3 '
AP4: 5'- TCATTCAGCTTAAACACTGC -3 '
AP5: 5'- TCAGTCCACAGTTTGTCCCC -3 '
AP6: 5'-AGTGCAAACACACCAAAGAA -3 '
SP9: 5'-CTGGAGATATTCATTGGTGC -3 '
SP11: 5'-GCAGTGTTCCAGCTGAACGAAGGGG -3 '
AP12: 5'- TCATAGTGCAAACACACCAAAGAA -3 '
SP13: 5'-GGGGGACAAACTGTGGACTGAGACCA -3 '
AP14: 5'- TTGTCCCCTTCGTTCAGCTGGAACACT -3 '
SP15: 5'-TTCTTTGGTGTGTTTGCACTATGA -3 '
SP17: 5'- GCAAAAGCAGCCATCCATTTAGA -3 '
SP21: 5'-GGGCGAARGC (Inosine) GC (Inosine) ATHCAYYT -3 '
AP22: 5'-GGCAGGTA (Inosine) AY (Inosine) GCRTTRTACCA -3 '
AP24: 5'-GGGGTCTC (Inosine) GT (Inosine) CD (Inosine) ARYTTRTC -3 '
SP25: 5'-GGTTCTTCGT (Inosine) TAYWS (Inosine) CARG -3 '
AP26: 5'-GCGAG (Inosine) GCRAA (Inosine) ACNCCRAARAA -3 '

  SP indicates a sense primer and AP indicates an antisense primer. In the mixed primer, M is A and C, R is A and G, W is A and T, S is C and G, Y is C and T, K is G and T, V is A and C and G. , H indicates A, C and T, D indicates A, G and T, B indicates C, G and T, and N indicates a mixed type sequence of A, C, G and T.

  In order to facilitate amplification of the target gene by PCR, the presence of more genes is effective. In rainbow trout, the TNF gene is known to be amplified several tens of times by LPS administration, so it is predicted that the TNF gene of ayu will also be amplified by LPS, and LPS (LIST, E. coli LPS) is added to ayu. 1.5 mg / kg body weight was administered intraperitoneally. Three hours later, the head kidney, liver and spleen of the sweetfish were isolated and immediately frozen in liquid nitrogen. Extraction of RNA from the frozen tissue was performed using a commercially available kit (Sepazole RNAI, Hanoi) according to the attached manual.

  In order to synthesize a cDNA from RNA (5 μg) extracted from each of the sweetfish tissues as a template for PCR, Oligo dT (Amersham Pharmacia) was used as a primer, and a reverse transcriptase (Rever Tra Ace, Toyobo) was used. Was synthesized. Genomic DNA was purified from sweetfish liver according to a conventional method.

  PCR was performed using a combination of various primers and cDNA or genomic DNA derived from each tissue of Ayu as a template, and the PCR product was analyzed by agarose gel electrophoresis. PCR was performed using a thermal cycler PC-700 (Astec). The reaction conditions were (i) Step 1: 2 minutes at 94 ° C, (ii) Step 2: 1 minute at 94 ° C, (iii) Step 3: 60 C. for 1 minute, (iv) Step 4: 1 minute at 72 ° C., (v) Steps 2 to 4 were repeated 40 times, (vi) Step 5: 70 ° C. for 10 minutes.

  The PCR product obtained in each combination was subcloned using TA-cloning vector (pGEM-T easy vector system Promega), and the nucleotide sequence of the cloned DNA fragment was analyzed. The obtained nucleotide sequence was subjected to homology search by BLAST for the amino acid database, and homology search to TNF of animals other than ayu was performed. As a result, the PCR product obtained by the combination of the primers in which the sense primer is SP11: 5′-GCAGTGTTCCAGCTGAACGAAGGGG-3 ′ and the antisense primer is AP26: 5′-GCGAG (Inosine) GCRAA (Inosine) ACNCCRAARAA-3 ′, Those containing sequences having homology to TNF of fish and mammals were found.

  From the partial sequence information of this PCR product, 3'RACE and 5'RACE (Rapid amplification of cDNA end) were performed using the above-mentioned mRNA of the head and kidney, and a cDNA (1731 bases) containing one complete open reading frame. (SEQ ID NO: 1). The amino acid sequence (SEQ ID NO: 2) deduced from this nucleotide sequence consists of 235 amino acids. Ayu TNF consisting of the amino acid sequence of SEQ ID NO: 2 contains, at the amino acid level, 43.9% for rainbow trout TNF, 43.3% for river trout TNF, 36.9% for Thai TNF, 36.6% for catfish TNF, It had 36.5% homology with flounder TNF and 27.5% homology with human TNF. The homology search was performed using FASTA by comparing regions expected to be mature.

Example 2 Effect of TNF Gene Expression Induction on Pseudomonas Infection It was examined whether LPS administration to Ayu and induction of TNF gene would provide a protective effect against Pseudomonas infection. LPS was purified from Pantoea agglomerans, a gram-negative bacterium, according to a conventional method. LPS was prepared so that the amount of LPS to be ingested per kg of body weight was 4, 20, 100 μg / kg after estimating the weight of the ingested feed of the sweetfish in the mixed feed.

Ayu was obtained from Tokushima Seed and Seed Center. Ayu (average body weight: 20 g) was divided into 4 groups of 25 animals each, 1 group without LPS administration (control group), 2 groups with LPS 4 μg / kg administration, 3 groups with LPS 20 μg / kg administration, and 4 groups LPS was bred in a water tank as a 100 μg / kg administration group. After ingesting the feed containing LPS for 7 consecutive days, 4.1 × 10 ² pseudomonas were intraperitoneally administered to the sweetfish. After feeding the cells to the sweetfish, survival was observed over time for 2 weeks without feeding. The number of survivors in each section was compared with the control section (Table 1). A significant difference (P <0.05) was observed statistically (Logrank test) in the ayu of the LPS 20 μg / kg administration group (section 3).

[Table 1]
LPS dose (μg / kg) Number of deaths (animals) Number of survivors (animals) Survival rate (%)
District 1 0 14 11 44
District 2 4 11 14 56
3rd ward 20 7 18 72
4th ward 100 15 10 40

  Next, whether or not TNF was induced by LPS administration was analyzed by competitive PCR. Six hours after LPS administration, the head kidney of ayu (fish kidney containing immune tissue and glomerular tissue, particularly the part near the head is rich in immune tissue) was isolated and immediately frozen in liquid nitrogen. Extraction of RNA from the frozen tissue was performed using a commercially available kit (Sepazole RNAI, Hanoi) according to the attached manual.

  In order to synthesize cDNA from RNA (5 μg) extracted from ayu spleen as a PCR template, cDNA was synthesized according to a conventional method using reverse transcriptase (Rever Tra Ace, Toyobo) using Oligo dT as a primer.

The primers used for the competitive PCR are as follows.
[Competitive PCR primers]
Sense P4: 5'-TGTGCGGCACCTGCAGGATG -3 '
Antisense P12: 5'- GTAGTACAGCAGAAGGTACTA -3 '
[Primer for Competitor synthesis]
Sense P4: 5'-TGTGCGGCACCTGCAGGATGGTACGGTCATCATCTGACAC -3 '
Antisense P12: 5'-GTAGTACAGCAGAAGGTACTAGCGCCATCCTGGGAAGACTCC -3 '

  PCR was performed using a thermal cycler PC-700 (Astec). The reaction conditions were (i) Step 1: 2 minutes at 94 ° C, (ii) Step 2: 1 minute at 94 ° C, (iii) Step 3: 60 (Iv) Step 4: 1 minute at 72 ° C, (v) Steps 2 to 4 were repeated 30 times, (vi) Step 5: 10 minutes at 72 ° C.

Competing cDNA (competitor) was synthesized using a commercially available kit (Competitor DNA construction kit, Takara Shuzo) according to the attached manual. The size of the PCR product synthesized by the primer is 408 bases for Ayu cDNA and 341 bases for competitor. The synthesized competitor was electrophoresed by agarose gel electrophoresis (1.5% agarose (Hansui), 100 V) according to a conventional method, and then a PCR product corresponding to 341 bases was cut out and extracted and purified using a commercially available kit (Toyobo) according to the manual. did. Absorption of OD260nm of purified competitor was measured, to calculate the number of moles of competitor as 1OD = 50μgDNA, diluted, was prepared as consisting of 1 × 10 ¹ to 1 × 10 ⁵ cells / [mu] L. PCR was performed under the above conditions using 1 μL of ayu cDNA (50 ng / μL as total RNA) and 1 μL of competitor as a template, and subjected to agarose gel electrophoresis (1.5% agarose (Hanai)) containing ethidium bromide (0.5 μg / mL). , 100 V). By detecting DNA bound to ethidium bromide with ultraviolet light and estimating the amount of PCR product amplified from the number of genes of different competitors and the number of TNF genes contained in unknown cDNA, the amount of TNF mRNA can be compared and quantified.

  The 408 base band is an amplification product derived from ayu cDNA, and the 341 base band is a competitor derived amplification product. The number of copies contained in cDNA per 100 ng of total RNA was calculated from the number of DNA of the comptitor giving the same band intensity. Table 2 shows the results. It was shown that the amount of TNF mRNA in the spleen increased 30-fold compared to the control 3 hours after LPS administration, decreased 10-fold 6 hours later, and returned to the same amount as the control 24 hours later. From this, it was confirmed that the TNF level of ayu was increased by LPS administration.

[Table 2]
Sample type Number of mRNA per 100 ng of total RNA Relative magnification Control 1.2 × 10 ³ 1
3 hours after LPS administration 4.0 × 10 ⁴ 30
6 hours after LPS administration 1.2 × 10 ⁴ 10
24 hours after LPS administration 1.2 × 10 ³ 1

  From the above results, it is considered that by inducing the expression of the TNF gene, it is possible to prevent and treat ayu infections such as Pseudomonas infections.

Example 3 Expression of Ayu TNF and Western Blotting Analysis (1) Construction of Expression Plasmid Intraperitoneal administration (11.5 mg / kg) of lipopolysaccharide (LPS) (derived from Escherichia coli O111: B4, Listo 201) 3 After a period of time, the head kidney was excised from the sweetfish, and total RNA was extracted from the head kidney by the guanidine thiocyanate method. Reverse transcription was performed with M-MLV reverse transcriptase using the above total RNA as a template and oligo dT as a primer to obtain complementary DNA (cDNA). Using the above cDNA as a template, and using oligo DNA having the following two types of primers in the ayu TNF base sequence as primers, a polymerase chain reaction (PCR) reaction is performed using Taq DNA polymerase enzyme, The corresponding DNA sequence was amplified.
Sense primer: CGGGATCCATGTTAAGACACCTTTCCGGAATA
Antisense primer: CGGGATCCTCACAGTGCAAACACACCGAAAAA

  The ends of the amplified DNA sequence were treated with a BamHI restriction enzyme to expose the BamHI restriction enzyme terminals. PUC540K, an expression vector in Escherichia coli (having a drug resistance gene for ampicillin and kanamycin and a tac promoter for expressing foreign proteins in Escherichia coli in an isopropylthiogalactopyranoside (IPTG) -dependent manner), is also treated with BamHI restriction enzyme Then, the 5'-terminal was dephosphorylated using alkaline phosphatase to expose the BamHI restriction enzyme terminal and prevent self-adhesion again. The amplified DNA and the vector DNA were subjected to electrophoresis using a polyacrylamide gel and an agarose gel as carriers, respectively, excised from the gel, purified, and ligated (adhered) with T4 DNA ligase. That is, the BamH1 fragment of the amplified DNA was inserted into the BamH1 site located downstream of the tac promoter of pUC540K.

  The ligation reaction solution was introduced into Escherichia coli JM109, and Escherichia coli transformed with the target expression plasmid was screened on an agar medium containing ampicillin. An expression plasmid was recovered from the transformed Escherichia coli clones screened above, and analyzed using a DNA sequencer to confirm that there was no mutation in the nucleotide sequence of the plasmid, and then used as an expression plasmid.

(2) Protein Expression A single colony of Escherichia coli JM109 carrying the above expression plasmid was placed on an agar medium, and this colony was inoculated into a 2 ml liquid medium and cultured overnight to obtain a preculture liquid. The pre-culture solution was added to 5 ml of the liquid medium at a ratio of 0.5%, IPTG was further added to a final concentration of 1 mM, and the cells were cultured at 37 ° C. for 14 hours. The cultured cells were centrifuged at 3000 rpm for 10 minutes to precipitate. The precipitated cells were resuspended in a buffer (50 mM Tris-HCl, 2 mM EDTA, pH 8.0) 1/10 of the volume of the culture solution. The proteolytic enzyme inhibitor p-APMSF ((p-amidinophenyl) methanesulfonyl fluoride hydrochloride) was added to the suspended E. coli to a final concentration of 2.5 mM, and the cell wall lysing enzyme lysozyme was further added to a final concentration of 5 mg / ml. And left to stand at room temperature for 5 minutes to transform E. coli into protoplasts. The protoplast-converted Escherichia coli solution was crushed by an ultrasonic crusher while cooling with ice. The crushed solution was centrifuged at 12,000 rpm for 10 minutes, the supernatant was separated as a soluble protein fraction, and the precipitate was separated as an insoluble protein fraction. The insoluble protein fraction was resuspended by adding an equal amount of buffer (50 mM Tris-HCl, 2 mM EDTA, pH 8.0) to the supernatant.

(3) Confirmation of protein expression by sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis 4 μl of the above-mentioned soluble and insoluble protein fractions were separated by electrophoresis using a 15% SDS polyacrylamide gel as a carrier. The gel after electrophoresis was stained with a staining solution (0.25% Coomassie brilliant blue, 50% methanol, 10% acetic acid), and then, after decolorization of parts other than the protein using a decolorizing solution (25% methanol, 10% acetic acid). Then, it was confirmed whether or not a staining band of a protein derived from an expression plasmid was observed in addition to a protein unique to Escherichia coli.

(4) Western Blotting In the same manner as above, 1.4 μl of the soluble and insoluble protein fractions was electrophoresed on a 15% SDS polyacrylamide gel as a carrier and separated. The gel after the electrophoresis was immersed in a Western buffer (25 mM Tris, 192 mM glycine, 20% methanol, pH 8.3) for 30 minutes. The gel after immersion, two filter papers and a nitrocellulose filter previously immersed in Western buffer were overlaid from the minus side of the blotting device in the order of filter paper, gel, filter, and filter paper, and were ice-cooled. The sample was set in a blotting device containing a Western buffer, the device was placed in ice water, and electricity was applied at 100 V for 1 hour for blotting. By this operation, the protein in the gel was electrically transferred and adsorbed on the filter. After the blotting, only the portion of the filter where the size marker was blotted was cut out and stained with amide black to confirm that the protein was transferred from the gel to the filter (blotting).

(5) Suppression of nonspecific antibody adsorption reaction (blocking)
The filter after blotting was placed in a HIZEX film bag, 5 ml of a blocking buffer (0.1 M Tris, 0.5 M sodium chloride, 10% skim milk, pH 7.5) was added, the bag was sealed, and stored at 4 ° C overnight. The filter was shaken twice for 5 minutes in a washing buffer (0.1 M Tris, 0.5 M sodium chloride, 0.05% Tween 20, 2% Triton X-100, pH 7.5). Washing was repeated twice with shaking for 5 minutes in a solution of Tris, 0.5 M sodium chloride, pH 7.5).

(6) Protein detection reaction by mouse antibody (Western analysis)
Put the filter after washing in a Hyzex film bag, add 5 ml of primary antibody solution (Anti mouse TNF rabbit pAb, anti-mouse TNF polyclonal antibody made in rabbit diluted 500-fold with blocking buffer), and add the bag. It was sealed and reacted at room temperature for 1 hour. After the reaction, the filter was shaken three times for 5 minutes in a washing buffer (0.1 M Tris, 0.5 M sodium chloride, 0.05% Tween 20, 2% Triton X-100, pH 7.5), and then the TBS buffer ( Excess antibody solution that did not react was washed by shaking for 5 minutes in a solution of 0.1 M Tris, 0.5 M sodium chloride, pH 7.5).
Put the filter after the primary antibody reaction in a Hi-Zex film bag and block the secondary antibody solution (AP-Goat Anti-Rabbit IgG (Zymed, 65-6122) and the alkaline phosphatase-conjugated anti-rabbit IgG antibody made by goats) 5 ml diluted 2000-fold with a buffer) was added, the bag was sealed, and the mixture was reacted at room temperature for 1 hour. After the reaction, washing was performed in the same manner.

  The above filter was immersed in AP buffer (100 mM Tris, 100 mM sodium chloride, 5 mM magnesium chloride, pH 9.5) for 3 minutes, then placed in a HIZEX film bag, and developed with a color buffer (0.033% nitro blue tetrazolium (NBT), 0.021% 5- 5 ml of bromo-4-chloro-3-indolyl-phosphate disodium salt (BCIP) dissolved in AP buffer) was added, and the bag was sealed, incubated at 37 ° C. for 2 hours, and washed with distilled water. . Among the proteins on the filter, where the primary antibody was bound, and where the alkaline phosphatase-bound secondary antibody was further bound, the reduction reaction of NBT and BCIP by alkaline phosphatase occurred, and the color developed blue.

It is a figure which shows the alignment of the flounder TNF gene and the rainbow trout TNF gene, and the hybridization position of the screening PCR primer designed based on the rainbow trout TNF gene. It is a figure which shows the alignment of ayu TNF, flounder TNF, and rainbow trout TNF, and the hybridization position of the primer for degenerative PCR designed from the conserved area of flounder TNF and rainbow trout TNF.

Claims (17)

A protein represented by the following (a) or (b):
(A) a protein consisting of the amino acid sequence of SEQ ID NO: 2 or an amino acid sequence of positions 73 to 235 of the amino acid sequence; and (b) an amino acid sequence of SEQ ID NO: 2 or the amino acid sequence of positions 73 to 235 of the amino acid sequence. A protein comprising an amino acid sequence in which one or more amino acids have been deleted, substituted or added, and having tumor necrosis factor activity   A gene encoding the protein according to claim 1. 3. The gene according to claim 2, comprising a DNA shown in the following (c) or (d).
(C) a DNA comprising the nucleotide sequence of SEQ ID NO: 1 or the nucleotide sequence at positions 171 to 878 or the nucleotide sequence at positions 387 to 878 in the nucleotide sequence of SEQ ID NO: 1
(D) conditions that are stringent to the nucleotide sequence of SEQ ID NO: 1 or a DNA complementary to the DNA consisting of the nucleotide sequence at positions 171 to 878 or the nucleotide sequence at positions 387 to 878 of the nucleotide sequence of SEQ ID NO: 1 Encoding a protein that hybridizes with and has tumor necrosis factor activity   A recombinant vector containing the gene according to claim 2.   A transformant comprising the recombinant vector according to claim 4.   An antibody or a fragment thereof capable of reacting with the protein of claim 1.   An agent for preventing and treating infectious diseases of sweetfish containing the protein according to claim 1.   A method for preventing and treating infectious diseases of sweetfish, comprising a step of administering the protein according to claim 1 to sweetfish.   A method for diagnosing infectious diseases of sweetfish, comprising the step of diagnosing whether or not the sweetfish is infected with the expression level of the protein according to claim 1 in sweetfish.   The method for diagnosing infectious disease according to claim 9, wherein the expression level is measured based on the abundance of mRNA encoding the protein according to claim 1 in a sample collected from the sweetfish.   The method for diagnosing infectious disease according to claim 9, wherein the expression level is measured based on the amount of the protein according to claim 1 in a sample collected from the sweetfish.   When the expression level of the protein according to claim 1 in the test ayu is higher than the expression level of the protein according to the claim 1 in a healthy ayu, the test ayu is diagnosed as suffering from an infectious disease. Item 12. The method for diagnosing infectious disease according to any one of Items 9 to 11.   A kit for diagnosing ayu infectious diseases, comprising an oligonucleotide or a polynucleotide capable of hybridizing to the nucleic acid encoding the protein according to claim 1.   A kit for diagnosing Ayu infectious diseases, comprising an antibody capable of reacting with the protein according to claim 1 or a fragment thereof.   Injecting Ayu comprising administering a candidate substance to Ayu and using the effect of enhancing the expression level of the protein according to claim 1 in the Ayu as an index to determine the preventive and therapeutic effects of the candidate substance on infectious diseases of Ayu. Screening method for a substance having a prophylactic / therapeutic effect on sickness.   A kit for screening a substance having a prophylactic and / or therapeutic effect on ayu infection, comprising an oligonucleotide or a polynucleotide capable of hybridizing to the nucleic acid encoding the protein according to claim 1. A kit for screening a substance having a prophylactic / therapeutic effect against sweetfish infection, comprising an antibody capable of reacting with the protein according to claim 1 or a fragment thereof.

Images