JP2004166695A - CONTROL OF RAPL-Rap1 INTERACTION - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To understand pathologic conditions of immune diseases, such as inflammation, allergies, autoimmune diseases, cancerous immune diseases, and transplantation immunological rejection, and to develop a method for treating the diseases, by clarifying a mechanism of integrin adhesiveness control by Pap1, because it is thought that functional failure of the Rap1 as an integrin adhesiveness controlling molecule closely relates to the pathologic conditions of the immune diseases. <P>SOLUTION: An inhibitor in binding of p30 to the Rap1, etc., is developed by utilizing a discovery that the p30 binds to the Rap1 and controls its function, while the p30 is identified as a molecule relating to the integrin adhesiveness control by the Pap1, so that a remedy for the inflammation, the allergies, the autoimmune diseases, the cancerous immune diseases, the transplantation immunological rejection, etc., is developed and further control mechanisms of the diseases are clarified. <P>COPYRIGHT: (C)2004,JPO

Description

  The present invention relates to controlling the biological activity induced by interacting with p30 (ie, RAPL). The present invention relates to a technique for controlling, for example, inhibiting or promoting the binding between Rap1 and p30, and a technique for using the same.

  Although the low-molecular-weight G protein Rap1 has been reported to function as an antagonist of H-Ras, it has recently been found to be an intracellular regulator of the adhesion molecule integrin. In the immune system, Rap1 positively regulates the adhesion of b2 integrins such as LFA-1 expressed by immune cells, and promotes adhesion between leukocytes and vascular endothelial cells, migration and localization in tissues, and antigen-presenting cells. Has an important effect on adhesion. It is expected that the disruption of Rap1 function as an integrin adhesion controlling molecule will be closely related to pathological conditions such as inflammation, allergy, autoimmune disease, cancer immunity, and transplant immunity, which are immune diseases. There is also a report that p30 was identified as a molecule involved in the regulation of integrin adhesion by Rap1 (Non-Patent Document 1).

The 31st Annual Meeting of the Immunological Society of Japan (December 11 (Tue)-13 (Thu), 2001, Osaka International Convention Center) and its proceedings (October 31, 2001)

  Elucidation of the mechanism of Rap1 regulation of integrin adhesion will lead to the understanding of the pathology of these immune diseases and the development of therapeutic methods.

The present inventors have made intensive studies and have succeeded in elucidating that p30 (that is, RAPL) functions as a Rap1 effector molecule and is a molecule that positively controls adhesion and migration by LAF-1. Based on this finding, further studies have led to the present invention. In the following description, p30 refers to RAPL.
The present invention
[1] (1) (a) An active polypeptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 2, a partial peptide thereof or a salt thereof, and SEQ ID NO: An amino acid sequence selected from the group consisting of an amino acid sequence in which the 12th glycine in the amino acid sequence represented by 2 is valine or an active polypeptide having an amino acid sequence substantially identical to the amino acid sequence having the point mutation. One polypeptide selected from the group consisting of a polypeptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by (b) SEQ ID NO: 4, or a partial peptide thereof, or a salt thereof And (c) contacting with a test sample,
(2) detecting the interaction and / or formation of a bond between one polypeptide selected from the group (a) and one polypeptide selected from the group (b), wherein Rap1 and p30 A method of screening for a compound or a salt thereof that promotes or inhibits the interaction and / or binding with the compound;
[2] (1) contacting one polypeptide selected from the group (a), one polypeptide selected from the group (b) and a test sample,
(2) detecting the interaction and / or formation of a bond between one polypeptide selected from the group (a) and one polypeptide selected from the group (b),
(3) the screening method according to the above [1], comprising a step of selecting a compound that promotes or inhibits the interaction and / or binding of these polypeptides;
[3] the above-mentioned [1] or [2], wherein one polypeptide selected from the group (a) and / or one polypeptide selected from the group (b) is fused with another peptide; Screening method;
[4] one polypeptide selected from the group (a) and / or one polypeptide selected from the group (b) is labeled, and the binding of the polypeptide is formed by detecting or measuring the label; And / or the screening method according to any one of the above [1] to [3], wherein the interaction is detected;
[5] a primary antibody against the polypeptide of group (b) or the polypeptide of (b), wherein one of the polypeptides selected from group (b) is bound to one of the polypeptides selected from group (a); The method according to any one of the above [1] to [3], wherein the interaction and / or the formation of a bond between these polypeptides is detected or detected by using a primary antibody against another peptide fused with the polypeptide. Screening method;
[6] a first antibody selected from the group (a) bound to one polypeptide selected from the group (b), a primary antibody against the polypeptide of the group (a) or the polypeptide of the (a); The method according to any one of the above [1] to [3], wherein detection or measurement is carried out using a primary antibody against another peptide fused with, and the formation and / or interaction of the bond between these polypeptides is detected. Screening method;
[7] a primary antibody against the polypeptide of the group (b) or the polypeptide of the (b), wherein the one polypeptide selected from the group (b) is bound to one polypeptide selected from the group (a). [1] to [3] detecting the formation and / or interaction of the binding of these polypeptides by detecting or measuring using a primary antibody against another peptide fused to the peptide and a secondary antibody against the primary antibody. The screening method according to any one of the above;
[8] The polypeptide of group (a) is a polypeptide having the amino acid sequence represented by SEQ ID NO: 2 and a polypeptide obtained by fusing glutathione-S-transferase to the N-terminal side of the polypeptide or represented by SEQ ID NO: 2. An active polypeptide of a polypeptide obtained by fusing glutathione-S-transferase to the N-terminal side of a polypeptide having an amino acid sequence in which glycine at position 12 of the amino acid sequence is valine, or any of its salts, (1) to (3), wherein the polypeptide of group (b) is a polypeptide having a Myc epitope fused to the N-terminal side of a polypeptide having the amino acid sequence represented by SEQ ID NO: 4, or a salt thereof. The screening method according to any one of the above;

[9] (a) a polypeptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 2, a partial peptide thereof or a salt thereof, and the amino acid represented by SEQ ID NO: 2 (B) one polypeptide selected from the group consisting of an amino acid sequence in which the glycine at position 12 is valine or a polypeptide containing an amino acid sequence substantially identical to the point-mutated amino acid sequence; : Comprising a polypeptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by 4, or one polypeptide selected from the group consisting of partial peptides or salts thereof, Rap1 and a screening kit for a compound or a salt thereof that promotes or inhibits the interaction and / or binding with p30;
[10] The screening kit according to the above [9], wherein one polypeptide selected from the group (a) and / or one polypeptide selected from the group (b) is fused with another peptide. ;
[11] the screening kit of the above-mentioned [9], wherein one polypeptide selected from the group (a) and / or one polypeptide selected from the group (b) is labeled;
(12) the polypeptide of group (a) is a polypeptide in which glutathione-S-transferase is fused to the N-terminal side of a polypeptide having the amino acid sequence represented by SEQ ID NO: 2, or represented by SEQ ID NO: 2. The polypeptide having an amino acid sequence in which the glycine at position 12 of the amino acid sequence is valine is a polypeptide obtained by fusing glutathione-S-transferase to the N-terminal side of the polypeptide, or a salt thereof, The screening kit according to the above [9], wherein the polypeptide is a polypeptide having a Myc epitope fused to the N-terminal side of a polypeptide having the amino acid sequence represented by SEQ ID NO: 4, or a salt thereof;

[13] a compound or a salt thereof that promotes or inhibits the interaction and / or binding between Rap1 and p30 obtained using the screening method according to [1] or the screening kit according to [9];
[14] the compound of the above-mentioned [13], which inhibits the interaction and / or binding between Rap1 and p30, or a salt thereof;
[15] a pharmaceutical composition comprising the compound of the above-mentioned [13] or a salt thereof;
[16] a pharmaceutical composition comprising the compound of [14] or a salt thereof;
[17] The target of treatment or prevention is
(a) Inflammatory disease
(b) Immune disease
(c) rejection during organ transplantation, and
(d) the pharmaceutical composition according to the above [15] or [16], which is selected from the group consisting of cancer;
[18] a monoclonal antibody recognizing a polypeptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 4;
[19] a diagnostic method comprising using the monoclonal antibody of [18];
[20] a diagnostic kit comprising the monoclonal antibody according to [18];
[21] a polypeptide or a salt thereof that functions as a dominant-suppressing type in a cell relative to a polypeptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 4;
(22) comprising the polypeptide or a salt thereof according to (21),
(a) Inflammatory disease
(b) Immune disease
(c) rejection during organ transplantation, and
(d) a composition for treating or preventing a member selected from the group consisting of cancer;
[23] a polynucleotide encoding the polypeptide of [21];
(24) containing the polynucleotide according to (23),
(a) Inflammatory disease
(b) Immune disease
(c) rejection during organ transplantation, and
(d) a composition for treating or preventing a member selected from the group consisting of cancer;

〔式中、Ｘが−ＣＷ¹Ｒ¹基又は−Ｃ（＝Ｗ¹）Ｗ²Ｒ²基であり、Ｒ¹がアルキル基、ハロアルキル基、アルコキシカルボニルアルキル基、アルケニル基、ハロアルケニル基、チエニル基で置換されたアルケニル基、シクロアルキル基、ハロゲン原子で置換されたシクロアルキル基、フェニル基、ハロゲン原子で置換されたフェニル基、アルキル基若しくはハロアルキル基で置換されたフェニル基、アルコキシ基若しくはハロアルコキシ基で置換されたフェニル基、テトラヒドロナフチル基、インダニル基、フラニル基又はチエニル基であり、Ｒ²がアルキル基又はハロアルキル基であり、Ｗ¹及びＷ²はそれぞれ独立して、酸素原子又は硫黄原子であり、Ｙが−ＳＯ₂Ｒ⁹基であり、Ｒ⁹がアルキル基、ハロアルキル基、フェニル基、ハロゲン原子で置換されたフェニル基、アルキル基若しくはハロアルキル基で置換されたフェニル基又はアルコキシ基若しくはハロアルコキシ基で置換されたフェニル基である〕で表される化合物又はその塩を有効成分とすることを特徴とするRap1とp30 の結合阻害剤； [25] a transgenic animal in which the expression of a polypeptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 10 is regulated;
[26] the transgenic animal of the above-mentioned [25], wherein the expression of a polypeptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 10 is excessive;
[27] the transgenic animal of the above-mentioned [25] or [26], wherein the transgenic animal is a mouse;
[28] Formula (I)

[In the formula, X is a —CW ¹ R ¹ group or —C (＝ W ¹ ) W ² R ² group, and R ¹ is an alkyl group, a haloalkyl group, an alkoxycarbonylalkyl group, an alkenyl group, a haloalkenyl group, a thienyl group. Alkenyl group, cycloalkyl group, cycloalkyl group substituted with halogen atom, phenyl group, phenyl group substituted with halogen atom, phenyl group substituted with alkyl group or haloalkyl group, alkoxy group or halo group. A phenyl group, a tetrahydronaphthyl group, an indanyl group, a furanyl group or a thienyl group substituted with an alkoxy group, R ² is an alkyl group or a haloalkyl group, and W ¹ and W ² are each independently an oxygen atom or a sulfur atom; An atom, Y is a —SO ₂ R ⁹ group, and R ⁹ is an alkyl group, a haloalkyl group, a phenyl group, a halogen A phenyl group substituted with an atom, a phenyl group substituted with an alkyl group or a haloalkyl group, or a phenyl group substituted with an alkoxy group or a haloalkoxy group) or a salt thereof. A binding inhibitor of Rap1 and p30, characterized by:

[29] In the above [28], X is an alkoxycarbonylalkylcarbonyl group, an alkenylcarbonyl group, an alkenylcarbonyl group substituted with a thienyl group, a cycloalkylcarbonyl group, an indanylcarbonyl group, a furancarbonyl group, a thiophenecarbonyl group, A benzoyl group which may be substituted with a naphthylcarbonyl group or a halogen atom or a haloalkyl group, wherein Y is an alkylsulfonyl group; the binding inhibitor between Rap1 and p30 according to the above-mentioned [28];
[30] The method according to the above [28], wherein in the above [28], X is a cycloalkylcarbonyl group, a furancarbonyl group or a benzoyl group optionally substituted by halogen, and Y is an alkylsulfonyl group. A binding inhibitor between Rap1 and p30;
[31] The compound according to the above [28], wherein the compound is N- (2-ethylsulfonylamino-5-trifluoromethyl-3-pyridyl) cyclohexanecarboxamide, N- (2-methylsulfonylamino-5-trifluoromethyl-3- Pyridyl) -4-fluorobenzamide, N- (2-isopropylsulfonylamino-5-trifluoromethyl-3-pyridyl) -3-fluorobenzamide, N- (2-methylsulfonylamino-5-trifluoromethyl-3- (28) The above-mentioned [28], which is selected from the group consisting of pyridyl) -2-furancarboxamide or N- (2-isopropylsulfonylamino-5-trifluoromethyl-3-pyridyl) cyclopentanecarboxamide. [32] N- (2-ethylsulfur) Provides a binding inhibitor of Rap1 and p30, wherein Niruamino 5-trifluoromethyl-3-pyridyl) cyclohexanecarboxamide or a salt thereof as an active ingredient.

In another aspect, the invention provides:
[33] a method of screening for a compound having an activity of inhibiting the interaction between p30 and Rap1, and the screening reagent;
[34] a method of screening for a compound having an activity of modulating a biological activity controlled by p30 expression, and the screening reagent;
[35] biological activity controlled by p30 expression is
(a) microtubule system development or microtubule system development induction,
(b) leading edge and / or uropod formation induction,
(c) increased adhesion activity of LFA-1;
(d) Chemokine stimulation increases T cell migration activity,
(e) increased cell adhesion,
(f) induction of cell migration,
(g) induction of redistribution of CXCR4 and / or CD44,
(h) polarity formation by TCR or chemokine,
(i) clustering at the leading edge of LFA-1,
(j) Polarization of LFA-1,
(k) localization of p30 to the microtubule system,
(l) LFA-1 clustering and p30 colocalization at the leading edge,
(m) co-accumulation of LFA-1 and p30 on the adhesion surface due to antigen-dependent T cell-APC conjugate formation,
(n) promoting integrin-dependent migration ability,
(o) T cell polarity formation, and
(p) the screening method and the screening reagent according to the above [34], which is selected from the group consisting of SMAC formation of T cells;

(36) in the presence of a p30-expressing cell or a p30-containing substance derived therefrom,
(i) contacting a screening target in the presence of a Rap1 activator;
(ii) contacting the screening target in the absence of a Rap1 activator;
(iii) the screening method according to the above [33] or [34], wherein the test result of the above (i) is compared with the test result of the above (ii);
[37] the screening method of the above-mentioned [36], wherein Rap1 is co-expressed together with p30;
[38] the screening method of the above-mentioned [36] or [37], wherein the screening is performed in the presence of activated Rap1;

[39] a medicament comprising, as an active ingredient, a compound having an activity of inhibiting the interaction between p30 and Rap1;
(40) (a) Microtubule system development or microtubule system development induction,
(b) leading edge and / or uropod formation induction,
(c) increased adhesion activity of LFA-1;
(d) Chemokine stimulation increases T cell migration activity,
(e) increased cell adhesion,
(f) induction of cell migration,
(g) induction of redistribution of CXCR4 and / or CD44,
(h) polarity formation by TCR or chemokine,
(i) clustering at the leading edge of LFA-1,
(j) Polarization of LFA-1,
(k) localization of p30 to the microtubule system,
(l) LFA-1 clustering and p30 colocalization at the leading edge,
(m) co-accumulation of LFA-1 and p30 on the adhesion surface due to antigen-dependent T cell-APC conjugate formation,
(n) promoting integrin-dependent migration ability,
(o) T cell polarity formation, and
(p) the medicament according to the above (39), which comprises a compound having an activity of inhibiting a biological activity selected from the group consisting of SMAC formation of T cells as an active ingredient;

[41] a p30 regulator, which regulates a biological activity of p30;
[42] the p30 regulator of the above-mentioned [41], wherein the agent regulates the activity of p30 through interaction with Rap1;
[43] a medicament comprising the p30 regulator of the above-mentioned [41] or [42] as an active ingredient;
[44] a p30 inhibitor, which inhibits the biological activity of p30;
[45] the p30 inhibitor of the above-mentioned [44], which inhibits the activity of p30 through the interaction with Rap1;
[46] a medicament comprising the p30 inhibitor according to [44] or [45] as an active ingredient;
[47] a p30 activator characterized by promoting the biological activity of p30;
[48] the p30 activator of the above-mentioned [47], which promotes the activity of p30 through interaction with Rap1;
[49] a medicament comprising the p30 activator according to [47] or [48] as an active ingredient;
[50] a screening method characterized by using p30 and the screening reagent; and [51] a screening method according to the above [50] characterized by performing drug screening, and the screening reagent.

In the present invention, it can be found that the activation of cells and the control of information transmission are performed by the interaction between p30-Rap1, and a technology utilizing the knowledge can be developed. Screening of p30-Rap1 interaction regulators such as compounds that inhibit Rap1 binding, development of reagents and the like used for such screening, and p30-Rap1 binding regulators such as identified inhibitors as pharmaceuticals And can also develop anti-inflammatory drugs, immunosuppressants, transplant immunosuppressants, anticancer agents, and the like. Furthermore, it is possible to provide and use modified p30-related peptides and nucleic acids, as well as anti-p30 antibodies and the like, for example, those that function in a predominantly suppressed form in cells and those that function to inhibit p30-Rap1 binding. is there. Using the technology and knowledge of the present invention, reagents and assay methods for analyzing biological functions can also be developed.
Other objects, features, advantages and aspects of the present invention will be apparent to those skilled in the art from the following description. However, it is understood that the description of the present specification, including the following description and the description of specific examples, etc., shows preferred embodiments of the present invention and is given only for explanation. I want to. Various changes and / or alterations (or modifications) within the spirit and scope of the present invention disclosed herein will be apparent to those skilled in the art, based on the following description and knowledge from other portions of the present specification. Will be readily apparent. All patents and references cited herein are cited for explanatory purposes, which are to be construed as being incorporated herein by reference. is there.

  In the present invention, for example, downstream of Rap1 by interaction and / or binding between the polypeptide p30 represented by SEQ ID NO: 4 and the polypeptide Rap1 represented by SEQ ID NO: 2, particularly, the active form Rap1 Have been found to be importantly involved in the expression of biological activities such as cell adhesion, and a technique utilizing such a phenomenon is provided. Examples of the biological activity involving p30 include microtubule system development or microtubule system development induction, leading edge and / or uropod formation induction, increased LFA-1 adhesion activity, and chemokine. Stimulation increases T cell migration activity, increases cell adhesion, induces cell migration, induces redistribution of CXCR4 and / or CD44, cross-links the T cell receptor (TCR) complex with antibodies -Linking) or cell polarization by stimulation with chemokines, etc., clustering at the leading edge of LFA-1, clustering of LFA-1, localization of p30 to the microtubule system, LFA at the leading edge Clustering of 1 and p30 co-localization, LFA-1 and p on the adhesion surface by forming a conjugate between antigen-dependent T cell-APC (antigen-presenting cell) 30 co-accumulation, integrin-dependent migration ability promotion, T cell polarity formation, T cell SMA formation, and the like. Therefore, p30 was named RAPL (regulator for cell adhesion and polarization enriched in lymphoid tissues) (Koko Katagiri et al., Nature Immunology, August 4, 2003 (8): 741-748). In the present invention, p30 and RAPL are the same polypeptide and have the amino acid sequence represented by SEQ ID NO: 4. In the following description, p30 refers to RAPL.

The interaction between p30 and activated Rap1 can also be detected or measured by detecting or measuring any of the aforementioned biological activities involving p30. By using this technique, inhibitors or promoters of the interaction and / or binding between p30 and activated Rap1 can be screened, and drug development can be carried out using the identified inhibitors or promoters. Further, according to the present technology, it is also possible to regulate the binding between p30 and active Rap1, and to control their interaction, and to screen for compounds that are involved in the regulation and regulation of the binding, and the like. Physiological phenomena and biological phenomena can be studied, and pharmaceuticals related to them can be developed.
According to the present invention, a compound that inhibits or promotes the interaction and / or binding between the active polypeptide of the polypeptide Rap1 represented by SEQ ID NO: 2 and the polypeptide p30 represented by SEQ ID NO: 4 Are provided. The screening method comprises: (a) an active polypeptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 2, a partial peptide thereof or a salt thereof; One polypeptide selected from the group consisting of an amino acid sequence in which the 12th glycine of the amino acid sequence to be converted is valine or an active polypeptide containing an amino acid sequence substantially identical to the amino acid sequence having the point mutation Or (b) a polypeptide containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 4 with one polypeptide selected from the group consisting of a partial peptide or a salt thereof, or a portion thereof Test sample for screening in the presence of one polypeptide selected from the group consisting of peptides or salts thereof It made by coexistence. Typically, as the polypeptide of the group (a) or the polypeptide of the group (b), those obtained as recombinant proteins by genetic recombination techniques are used, but these polypeptides are co-expressed. It is also possible to use existing cells or extracts thereof.

  In the present invention, the active polypeptide of group (a) refers to a polypeptide capable of binding to p30. When the polypeptide of the active form (a) is a polypeptide or the like which has been extracted extracellularly, GTP or a GTP analog such as GTPγS or GppNHp is used in a buffer at 4-37 ° C. The active form can be obtained by treating for 10 minutes to 1 hour. Activation by a GTP analog such as GTPγS or GppNHp is preferred, and activation by GTPγS is more preferred. When the polypeptide of the group (a) is expressed in a cell, the cell is stimulated by cross-linking of a T cell receptor (TCR) complex with an antibody or by a chemokine. The peptide can be in an active form. Stimulation by cross-linking of the TCR complex with an antibody includes, for example, treatment with an anti-CD3 monoclonal antibody, and incubating the cells for 10 minutes to 1 hour at 37 ° C. in the presence of antibody 2C11 (at a concentration of 10 μg / ml). This makes the polypeptide an active form. Stimulation with chemokines includes treatment with secondary lymphoid tissue chemokine (SLC), chemokine cc motif ligand 21 (CCL21), stromal cell-derived factor-1 (SDF-1), and the presence of these substances (100 nM). The polypeptide can be made active by incubating the cells at 37 ° C. under 10 minutes to 1 hour.

  In the screening method, a test sample can be screened by various techniques.For example, (1) (a) an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 2 And an active polypeptide or a partial peptide thereof or a salt thereof, and an amino acid sequence substantially the same as the amino acid sequence in which glycine at position 12 of the amino acid sequence represented by SEQ ID NO: 2 is valine or the point-mutated amino acid acid sequence One polypeptide selected from the group consisting of active polypeptides containing the same amino acid sequence, (b) containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 4 Contacting a test sample with a polypeptide selected from the group consisting of (2) detecting the interaction and / or bond formation between one polypeptide selected from the group (a) and one polypeptide selected from the group (b). May be. In the present invention, as a method of coexisting the polypeptide of the group (a), the polypeptide of the group (b) and the test sample, a method of simultaneously contacting the three, the test sample in advance of the polypeptide of (a) or A method of keeping the polypeptide in contact with the polypeptide of (b) can be considered. When using cells that co-express these polypeptides, these methods can be selected by adjusting the timing of expression of each polypeptide and the timing of contact between the test sample and the cells. It is possible.

  In the present invention, "substantially the same amino acid sequence" refers to about 70% or more, preferably about 80% or more, more preferably 90% or more, and most preferably about 95% or more homology with the original amino acid sequence. Refers to an amino acid sequence having For example, in the case of "an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 4", the original amino acid sequence is the amino acid sequence represented by SEQ ID NO: 4. Further, “a polypeptide containing an amino acid sequence substantially identical to an amino acid sequence” is a polypeptide containing the aforementioned “substantially identical amino acid sequence” and substantially equivalent to a polypeptide having the original amino acid sequence. Polypeptides and the like are preferred. In the present invention, “substantially equivalent” means that the activities of proteins, for example, binding activity, physiological activity, and biological activity are substantially the same. Furthermore, the meaning of the term may include a case having substantially the same activity, and the substantially same activity includes cell adhesion, cell migration, cell polarization, and the like. Control and the like. The substantially equivalent activities indicate that those activities are of the same nature. For example, activities such as binding activity are equivalent (eg, about 0.001 to about 1000 times, preferably about 0.01 to about 100 times, more preferably about 0.1 to about 20 times, and still more preferably about 0.5 to about 2 times). However, the quantitative factors such as the degree of the activity and the molecular weight of the protein may be different.

  The polypeptides of the group (a) or the group (b) of the present invention may have favorable changes such as amino acid substitutions, deletions, insertions, additions, etc., and may have physiological properties or chemical properties. The characteristics may be changed. The polypeptide with the substitution, deletion, insertion or addition may be one which is said to be substantially the same as the polypeptide without such substitution, deletion, insertion or addition. Substantially identical substitutions of amino acids in the amino acid sequence may be selected from other amino acids of the class to which the amino acid belongs. For example, non-polar (hydrophobic) amino acids include alanine, phenylalanine, leucine, isoleucine, valine, proline, tryptophan, methionine and the like, and polar (neutral) amino acids include glycine, serine, threonine, cysteine, tyrosine , Asparagine, glutamine, and the like. Amino acids having a positive charge (basic amino acids) include arginine, lysine, and histidine, and amino acids having a negative charge (acidic amino acids) include aspartic acid and glutamic acid. No. In some cases, cysteine may be replaced with serine, glycine with alanine or leucine, or leucine with alanine, isoleucine, valine and the like. The polypeptides of the present invention can be modified by chemical means to modify the amino acid residues contained therein, or modified with enzymes such as peptidases such as pepsin, chymotrypsin, papain, bromelain, endopeptidase, exopeptidase. Or partially decomposed into derivatives thereof.

The subject peptide or polypeptide (or protein) is one in which one or more amino acid residues differ from the natural one in terms of identity, and one in which the position of one or more amino acid residues differs from the natural one. Is also good. One or more amino acid residues unique to the Rap1 or p30 protein (for example, 1 to 80, preferably 1 to 60, more preferably 1 to 40, more preferably 1 to 20, especially 1 to 10 Missing analogs, one or more unique amino acid residues (eg, 1 to 80, preferably 1 to 60, more preferably 1 to 40, more preferably 1 to 20) , In particular, 1 to 10 or the like is substituted with another amino acid residue, and 1 or more (eg, 1 to 80, preferably 1 to 60, more preferably 1 to 40, More preferably, 1 to 20, particularly 1 to 10 amino acid residues are added, and one or more additional analogs (for example, 1 to 80, preferably 1 to 60, and more preferably Has 1 to 40, more preferably 1 to 20, especially 1 to 10) amino acid residues inserted. And are inserted analogues are also included in the polypeptides of the present invention. When the amino acid sequence is inserted, deleted or substituted as described above, the position of the insertion, deletion or substitution is not particularly limited.
All of the above mutants are included in the present invention as long as the domain structure or substrate binding ability characteristic of a natural protein is maintained. It is also considered that those having a primary structural conformation substantially equivalent to a natural protein or a part thereof may be included, and further, having a biological activity substantially equivalent to that of a natural protein. It is conceivable that some of them may be included. It can also be one of the naturally occurring variants.

  In the present invention, a test sample can be screened based on the inhibition of binding between Rap1 and p30, instead of the biological activity as an interaction between Rap1 and p30. The polypeptide of the group (a) used in such a case is not particularly limited as long as it has an activity of binding to wild-type p30. It may have lost the biological activity of Rap1. As long as it has an activity of binding to wild-type p30, the amino acid sequence represented by SEQ ID NO: 2 is modified by substitution, deletion and / or addition of amino acid residues as described above. Polypeptide. The polypeptide of the group (b) used in such a case is not particularly limited as long as it has an activity of binding to wild-type Rap1. It may have lost the biological activity of p30.

  Test samples include, for example, proteins, peptides, non-peptidic compounds, synthetic compounds, fermentation products, plant extracts, tissue extracts of animals and the like, cell extracts, and the like. Examples of the test compound used in the test sample may preferably include an anti-p30 antibody, an enzyme inhibitor, a cytokine, a compound having various inhibitory activities, particularly a synthetic compound, and the like. These compounds may be novel compounds or known compounds. Representative compounds include, for example, various diaminotrifluoromethylpyridine derivatives disclosed in JP-A-6-263735. The screening can be carried out according to a usual method for measuring binding activity or biological activity.

[Screening method]
One embodiment of the screening method of the present invention comprises contacting an active polypeptide of any one of the groups (a), a polypeptide of any one of the groups (b) and a test sample, and then contacting an organism with p30. It is carried out by detecting or measuring the activity to detect the interaction between the polypeptides of both groups and selecting a compound that promotes or inhibits the interaction. When screening a purified compound or the like, the selection step may be omitted.
Examples of the biological activities involving p30 include microtubule system development or microtubule system development induction, leading edge and / or uropod formation induction, increased LFA-1 adhesion activity, and chemokine. Stimulation increases T cell migration activity, increases cell adhesion, induces cell migration, induces redistribution of CXCR4 and / or CD44, cross-links the T cell receptor (TCR) complex with antibodies -linking) or cell polarity formation by stimulation with chemokines, etc., clustering at the leading edge of LFA-1, clustering of LFA-1, localization of p30 to the microtubule system, LFA- at the leading edge Clustering of 1 and p30 co-localization, co-accumulation of LFA-1 and p30 on the adhesion surface by forming a conjugate between antigen-dependent T cell-APC (atigen-presenting cell), Integrin dependent migration-enhancing, polarity formation of T cell, and the like SMA formation of T cell (Koko Katagiri et al, Nature Immunology, (8): 741-748).

Another embodiment of the screening method of the present invention, the polypeptide of any active form of the group (a), the polypeptide of any of the group (b) and a test sample are contacted, then the polypeptide of both groups This is carried out by detecting the formation of the bond and selecting a compound that promotes or inhibits the formation of the bond. When screening a purified compound or the like, the selection step may be omitted. If activation of the polypeptide of group (a) is required, it is activated using a GTP derivative as described above. When the polypeptide is immobilized, activation may be performed before or after immobilization, but more preferably after immobilization.
The polypeptide used in the present invention can be used by binding to a support. First, in the combination of the polypeptide of the group (a), which is purified or partially purified, and the polypeptide of the group (b), one of them is bound to a support. In order to bind the polypeptide to the support, the polypeptide may be immobilized on the support by a standard method. Examples of the support to which the polypeptide is bound include insoluble polysaccharides such as agarose, dextran, cellulose, and synthetic resins such as polystyrene, polyacrylamide, and silicon. More specifically, commercially available beads and plates manufactured using them as raw materials are used. In the case of beads, a column or the like filled with these may be used. In the case of a plate, a multi-well plate (eg, a 96-well multi-well plate) or a biosensor chip can be used.

In order to bind the polypeptide to the support, a generally used method utilizing chemical bonding, physical adsorption, or the like may be used. Alternatively, an antibody that specifically recognizes the polypeptide can be bound to a support in advance, and the antibody can be bound to the polypeptide. Furthermore, it can be bound via avidin / biotin.
The binding between the polypeptide of the group (a) and the polypeptide of the group (b) is usually performed in a buffer. As the buffer, for example, a phosphate buffer, a Tris buffer, or the like is used. Incubation conditions include conditions that have already been used, for example, incubation at 4 ° C. to room temperature for 1 second to 3 hours, preferably 3 seconds to 2 hours, more preferably 10 seconds to 30 minutes. . Washing after the incubation may be any as long as it does not hinder protein binding. For example, a buffer containing a surfactant is used. As the surfactant, for example, 0.05% Tween20 is used.

To select a compound of interest, the polypeptide of group (a) and the polypeptide of group (b) and a test sample are incubated under appropriate conditions, and then washed, so that specific binding and Specific binding can be separated. Then, the binding state between the polypeptide of the group (a) and the polypeptide of the group (b) may be evaluated.
When selecting the desired compound, the polypeptide to be bound to the support may be either the polypeptide of the above-mentioned group (a) or the polypeptide of the above-mentioned group (b). That is, when the polypeptide of the group (a) is bound to a support, the polypeptide of the group (a) is preliminarily mixed with the polypeptide of the group (b) and a test sample after immobilization of the polypeptide of the group (a). Alternatively, the polypeptide of the group (b) may be added after the addition of the test sample. When the polypeptide of the group (b) is immobilized on a support, the polypeptide of the group (a) and the test sample are similarly mixed in advance, or the (a) is added after the test sample is added. ) Group of polypeptides may be added. The polypeptide of group (a) added in the above order, the polypeptide of group (b) and the test sample were incubated under appropriate conditions, and the polypeptide of group (a) and the polypeptide of group (b) were incubated. The state of binding to the polypeptide can be evaluated.

In the screening method of the present invention, a control group may be provided together with a group in which the test sample is brought into contact with the polypeptide. As the control group, a negative control group or a positive control group containing no test sample or both groups can be set.
When detecting or measuring the bound polypeptide in the present invention, the bound polypeptide may be simply detected, or the bound polypeptide may be quantitatively measured. In these cases, the target compound is detected by comparing the results obtained in the negative control group without the test sample, the results obtained in the group containing the test sample, and / or the results obtained in the positive control group. can do.
In addition, by obtaining these results as numerical values and comparing those numerical values, the activity of the target compound can be quantitatively measured. In the case of quantitative measurement, the target compound can be detected by comparing the value obtained in the negative control group containing no test sample with the value obtained in the group to which the test sample is applied. If the obtained value increases or decreases as compared with the negative control, it can be determined that the test sample contains the target compound. Further, when quantitatively measured, the numerical value obtained in a positive control group containing a known amount of a compound known to inhibit the binding of the polypeptide of the (a) group and the polypeptide of the (b) group Can be quantified based on the standard curve created by When the number of bound polypeptides is large, the activity of the compound that inhibits the binding of the polypeptide is low, while when the number of bound polypeptides is small, the binding inhibitory activity of the compound that inhibits the binding of the polypeptide is presumed to be strong. .

  In the present invention, a biosensor utilizing the surface plasmon resonance phenomenon can be used as a means for detecting or measuring the bound polypeptide. A biosensor utilizing the surface plasmon resonance phenomenon can observe the interaction between polypeptides in real time as a surface plasmon resonance signal using a small amount of polypeptide and without labeling (for example, manufactured by BIAcore, Pharmacia). ). Therefore, it is possible to evaluate the binding of the polypeptide used in the present invention by using a biosensor such as BIAcore. That is, a sensor chip in which one of the combination of the polypeptide of the group (a) and the polypeptide of the group (b) is immobilized, and the other polypeptide of the combination is brought into contact with the polypeptide to immobilize the other polypeptide. A polypeptide that binds to is detected as a change in resonance signal.

Specifically, it may be performed as follows. First, the sensor chip CM5 (manufactured by Biosensor) is activated to immobilize one of the combinations of the polypeptide of the group (a) and the polypeptide of the group (b) on the sensor chip. That is, after activating the sensor chip with an EDC / NHS aqueous solution (200 mM EDC (N-ethyl-N '-(3-dimethylaminopropyl) carbonate hydrochloride), 50 mM NHS (N-hydroxysuccinimide)), HBS buffer (10 mM HEPES pH7. The sensor chip is washed with 4, 150 mM NaCl, 3.4 mM EDTA, 0.05% Tween 20). Next, an appropriate amount of the polypeptide having an interaction dissolved in the HBS buffer is brought into contact with the sensor chip to be immobilized. After washing the sensor chip with an HBS buffer, the remaining active groups on the sensor chip are blocked with an ethanolamine solution (1 M ethanolamine hydrochloride, pH 8.5). The sensor chip is washed again with the HBS buffer and used for binding evaluation. Next, an appropriate amount of the polypeptide dissolved in the HBS buffer is injected. At this time, the amount of the polypeptide having an interaction binding to the polypeptide immobilized on the sensor chip is observed as an increase in the resonance signal value.
Further, in the above-mentioned binding evaluation system, a test sample is injected following the other polypeptide having an interaction with one polypeptide. In addition, a control group may be provided together with the group into which the test sample is injected. As a control group, a negative control group or a positive control group containing no test sample or both groups can be provided.
The bound polypeptide can be quantitatively measured as a change in resonance signal value. In this case, the target compound is detected by comparing the result obtained in the negative control group not containing the test sample, the result obtained in the group containing the test sample, and / or the result obtained in the positive control group, Can be determined. In the present invention, as a means for detecting or measuring the bound polypeptide, any polypeptide can be labeled, and the label of the bound polypeptide can be used. For example, in the above-mentioned screening method, the other polypeptide to be brought into contact with one of the polypeptides together with the test sample is labeled in advance, and after incubation with the test sample, the polypeptide bound thereto is washed and the bound polypeptide is labeled with the label. Detect or measure. That is, the test sample and the other labeled polypeptide are preferably brought into contact with one of the polypeptides bound to the support. After incubation, washing may be performed to detect or measure the label of the bound polypeptide.

The polypeptide used in the present invention can be labeled by a generally known method. Labeling substances include, for example, radioisotopes, enzymes, fluorescent substances, biotin / avidin and the like. As these labeling substances, commercially available labeling substances can be used. Examples of radioisotopes include ³² P, ³³ P, ¹³¹ I, ¹²⁵ I, ³ H, ¹⁴ C, and ³⁵ S. Examples of the enzyme include alkaline phosphatase, horseradish peroxidase (HRP), β-galactosidase, β-glucosidase and the like. Examples of the fluorescent substance include fluorescein isothiocyanate (FITC) and rhodamine. These can be obtained commercially and labeled by a known method. Specifically, it can be performed as follows. That is, a solution containing any of the polypeptides is added to the plate and left overnight. After washing, the plate is blocked, for example with BSA, to prevent non-specific binding of the polypeptide. Wash again and add the test sample and the other labeled polypeptide to the plate. At the same time, a negative control group containing no test sample and / or a positive control group are placed and incubated. After incubation, the washed and bound polypeptide is detected or measured. For detection or measurement, in the case of a radioisotope, detection or measurement is performed by liquid scintillation. In the case of an enzyme, its substrate is added, and the enzymatic change of the substrate, eg, color development, is detected or measured by an absorptiometer. In the case of a fluorescent substance, it is detected or measured by a fluorometer. The desired compound can be determined by comparing these results with the values obtained in the control group.

  In the present invention, as a means for detecting or measuring the bound polypeptide, in the combination of the polypeptide of the group (a) and the polypeptide of the group (b), a primary polypeptide that specifically recognizes one of the polypeptides is used. Antibodies can be used. For example, one polypeptide is contacted with another polypeptide together with a test sample, incubated with the test sample, washed, and the bound polypeptide is detected or detected by a primary antibody that specifically recognizes the polypeptide. Measure. That is, the test sample and the other polypeptide are preferably brought into contact with one of the polypeptides bound to the support. After incubation, washing may be performed, and the bound polypeptide may be detected or measured with a primary antibody that specifically recognizes the polypeptide. The primary antibody is preferably labeled with a labeling substance. Specifically, it can be performed as follows. That is, a solution containing any of the polypeptides is added to the plate and left overnight. After washing, the plate is blocked, for example with BSA, to prevent non-specific binding of the polypeptide. Wash again and add the test sample and the other polypeptide to the plate. At the same time, a negative control group containing no test sample and / or a positive control group are placed and incubated. After incubation, antibodies to the polypeptide that was washed and added with the test sample are added. After an appropriate incubation, the plate is washed and the polypeptide is detected or measured by a primary antibody that specifically recognizes the polypeptide. For detection or measurement, in the case of a radioisotope, detection or measurement is performed by liquid scintillation. In the case of an enzyme, its substrate is added, and the enzymatic change of the substrate, eg, color development, is detected or measured by an absorptiometer. In the case of a fluorescent substance, it is detected or measured by a fluorometer. The desired compound can be determined by comparing these results with the values obtained in the control group.

  In the present invention, as a means for detecting or measuring the bound polypeptide, a primary antibody that specifically recognizes another peptide fused to the polypeptide used in the present invention can be used. For example, in the screening method described above, one of the polypeptides is brought into contact with another polypeptide together with a test sample, incubated with the test sample, and then washed to fuse the bound polypeptide with the polypeptide. Is detected or measured by a primary antibody that specifically recognizes the peptide. That is, the test sample and the other polypeptide are preferably brought into contact with one of the polypeptides bound to the support. After incubation, the plate may be washed, and the bound polypeptide may be detected or measured with a primary antibody that specifically recognizes another peptide fused to the polypeptide. The primary antibody is preferably labeled with a labeling substance. Specifically, it can be performed as follows. That is, a solution containing any of the polypeptides is added to the plate and left overnight. After washing, the plate is blocked, for example with BSA, to prevent non-specific binding of the polypeptide. Wash again and add the test sample and the other polypeptide fused to the other peptide to the plate. At the same time, a negative control group containing no test sample and / or a positive control are placed and incubated. After incubation, wash and add antibodies against other peptides fused to the polypeptide added with the test sample. After a suitable incubation, the plate is washed and the polypeptide is detected or measured by a primary antibody that specifically recognizes the other peptide fused to the polypeptide. For detection or measurement, in the case of a radioisotope, detection or measurement is performed by liquid scintillation. In the case of an enzyme, its substrate is added, and the enzymatic change of the substrate, eg, color development, is detected or measured by an absorptiometer. In the case of a fluorescent substance, it is detected or measured by a fluorometer. The desired compound can be determined by comparing these results with the values obtained in the control group.

  In the present invention, as a means for detecting or measuring the bound polypeptide, a primary antibody that specifically recognizes the polypeptide used in the present invention and a secondary antibody that specifically recognizes the primary antibody can be used. . For example, one of the polypeptides is contacted with the other polypeptide together with the test sample, incubated with the test sample, and then washed to recognize the bound polypeptide, as a primary antibody and a primary antibody that specifically recognize the polypeptide. Detection or measurement is performed using a secondary antibody that specifically recognizes the antibody. That is, the test sample and the other polypeptide are preferably brought into contact with any of the polypeptides bound to the support. After incubation, washing is performed, and the bound polypeptide may be detected or measured by a primary antibody that specifically recognizes the polypeptide and a secondary antibody that specifically recognizes the primary antibody. The secondary antibody is preferably labeled with a labeling substance. Specifically, it can be performed as follows. That is, a solution containing any of the polypeptides is added to the plate and left overnight. After washing, the plate is blocked, for example with BSA, to prevent non-specific binding of the polypeptide. Wash again and add the test sample and the other polypeptide to the plate. At the same time, a negative control group containing no test sample and / or a positive control group are placed and incubated. After incubation, primary antibodies to other peptides that are washed and fused to the polypeptide added with the test sample are added. After a suitable incubation, the plate is washed and then a secondary antibody that specifically recognizes the primary antibody is added. After an appropriate incubation, washing is performed, and the polypeptide is detected or measured by a secondary antibody that specifically recognizes a primary antibody that specifically recognizes the polypeptide. For detection or measurement, in the case of a radioisotope, detection or measurement is performed by liquid scintillation. In the case of an enzyme, its substrate is added, and the enzymatic change of the substrate, eg, color development, is detected or measured by an absorptiometer. In the case of a fluorescent substance, it is detected or measured by a fluorometer. The desired compound can be selected by comparing these results with the values obtained in the control group.

In the present invention, as a means for detecting or measuring the bound polypeptide, a primary antibody that specifically recognizes another peptide fused to the polypeptide and a secondary antibody that specifically recognizes the primary antibody can be used. For example, in the above-described screening method, one of the polypeptides is brought into contact with the other polypeptide together with the test sample, incubated with the test sample, and then washed to fuse the bound polypeptide with the polypeptide. Or a secondary antibody that specifically recognizes the primary antibody. That is, the test sample and the other polypeptide are preferably brought into contact with one of the polypeptides preferably bound to the support. After incubating, washing, and detecting or measuring the bound polypeptide with a primary antibody that specifically recognizes another peptide fused to the polypeptide and a secondary antibody that specifically recognizes the primary antibody. Good. The secondary antibody is preferably labeled with a labeling substance.
Specifically, it can be performed as follows. That is, a solution containing any of the polypeptides is added to the plate and left overnight. After washing, the plate is blocked, for example with BSA, to prevent non-specific binding of the polypeptide. Wash again and add the test sample and the other polypeptide fused to the other peptide to the plate. At the same time, a negative control group containing no test sample and / or a positive control group are placed and incubated. After incubation, primary antibodies to other peptides that are washed and fused to the polypeptide added with the test sample are added. After a suitable incubation, the plate is washed and then a secondary antibody that specifically recognizes the primary antibody is added. After an appropriate incubation, washing is performed, and the polypeptide is detected or measured by a secondary antibody that specifically recognizes a primary antibody that specifically recognizes another peptide fused to the polypeptide. For detection or measurement, in the case of a radioisotope, detection or measurement is performed by liquid scintillation. In the case of an enzyme, its substrate is added, and the enzymatic change of the substrate, eg, color development, is detected or measured by an absorptiometer. In the case of a fluorescent substance, it is detected or measured by a fluorometer. The desired compound can be determined by comparing these results with the values obtained in the control group.

More specifically, the present invention can be carried out particularly preferably by ELISA (Enzyme-linked Immunosorbent Assay) as follows. That is, the polypeptide of the group (a) fused with another peptide, for example, 6 × His, is diluted with a solid phase buffer (0.1 M NaHCO ₃ , 0.02% NaN ₃ , pH 9.6). An appropriate amount of the diluted aqueous solution is added to each well of a 96-well immunoplate (manufactured by Nunc) and incubated at 4 ° C. overnight.
After washing each well three times with a washing buffer (prepared to be 0.05% Tween 20 in PBS), 200 μl of a 5% BSA (manufactured by SIGMA) solution in PBS is added, and blocking is performed at 4 ° C. overnight. Next, each well was washed three times with a washing buffer, and the polypeptide of the group (b) fused with another peptide, for example, FLAG, diluted with a dilution buffer (1% BSA, 0.5% Tween 20, PBS), and a test sample were used. Add an appropriate amount and incubate at 4 ° C to room temperature for 1 second to 3 hours, preferably 3 seconds to 2 hours, more preferably 10 seconds to 30 minutes. Each well is washed three times with a washing buffer, 100 μl of mouse anti-FLAG M2 antibody (manufactured by IBI) diluted to 3 μg / ml with a dilution buffer is added to each well, and the mixture is incubated at room temperature for 1 hour. Each well is washed three times with a washing buffer, 100 μl of an alkaline phosphatase-labeled goat anti-mouse IgG antibody (manufactured by ZYMED) diluted 1000-fold with a dilution buffer is added to each well, and incubated at room temperature for 1 hour. Wash each well 5 times with a washing buffer, and add 100 μl of a color-forming solution (substrate buffer; 50 mM NaHCO ₃ , 10 mM MgCl ₂ , p-phenylphosphate dissolved at a concentration of 1 mg / ml in pH9.8; SIGMA) to each well. After reacting at room temperature, the absorbance at 405 nm is measured using a microplate reader (Model 3550, manufactured by BIO-RAD). By comparing these results with the numerical values obtained in the negative control group and / or the positive control group, the target compound can be determined. In the detection or measurement using the antibody of the present invention, protein G or protein A can be used instead of the secondary antibody.

The screening method of the present invention can use High Throughput Screening (HTS). Specifically, the steps up to blocking are performed manually, and the subsequent reactions are performed by robots, thereby automating the system and realizing High Throughput screening. That is, the polypeptide of the group (a) fused with another peptide, for example, 6 × His, is diluted with a solid phase buffer (0.1 M NaHCO ₃ , 0.02% NaN ₃ , pH 9.6). An appropriate amount of the diluted aqueous solution is added to each well of a 96-well immunoplate (manufactured by Nunc) and incubated at 4 ° C. overnight. After washing each well three times with a washing buffer (prepared to give 0.05% Tween 20 in PBS), 200 μl of a 5% BSA (manufactured by SIGMA) solution in PBS is added, and blocking is performed at 4 ° C. overnight. Next, for example, a blocked immunoplate is set in a Biomek 2000 HTS system (manufactured by Beckman), and a system control program is executed. At this time, use a Biomek 2000 dispenser (manufactured by Beckman) or a Multipipette 96-well simultaneous dispenser (manufactured by Sagian) to dispense or remove the solution into each hole of the immunoplate. Can be. Further, for washing each hole of the immunoplate, an EL404 microplate washer (manufactured by BioTek) can be used. For measurement of absorbance, a SPECTRA max 250 plate reader (manufactured by Molecular Devices) can be used. The program is set to perform the following operations. That is, each well was washed three times with a washing buffer, and fused with a test sample and another peptide diluted with a dilution buffer (1% BSA, 0.5% Tween 20, PBS), for example, MBP (maltose binding polypeptide) (b). An appropriate amount of the polypeptide of the group is added. At the same time, a negative control group and a positive control containing no test sample are placed and incubated at 4 ° C. to room temperature for 1 second to 3 hours, preferably 3 seconds to 2 hours, more preferably 10 seconds to 30 minutes. Wash each well three times with wash buffer, add 100 μl rabbit anti-MBP antiserum (New England Biolabs) diluted 5000-fold with dilution buffer to each well and incubate for 1 hour at room temperature. Wash each well three times with a washing buffer, add 100 μl of alkaline phosphatase-labeled goat anti-rabbit IgG antibody (manufactured by TAGO) diluted 5000 times with a dilution buffer to each well, and incubate at room temperature for 1 hour. Wash each well 5 times with a washing buffer, and add 100 μl of a coloring solution (substrate buffer; 50 mM NaHCO ₃ , 10 mM MgCl ₂ , p-nitrophenyl phosphate dissolved at a concentration of 1 mg / ml in pH 9.8; SIGMA) to each well. After addition to the wells and reaction at room temperature, the absorbance at 405 nm is measured using a microplate reader, Biomek plate reader (Beckman / Molecular Devices). By comparing these results with the values obtained in the control group, the target compound can be identified.

  As the antibody used in the present invention, a commercially available antibody or an antibody contained in a commercially available kit can be used, and a monoclonal antibody or a polyclonal antibody obtained by using a known means can also be used. A monoclonal antibody is immunized with a desired sensitizing antigen according to a usual immunization method, and the obtained immunocytes are fused with a known parent cell by a usual cell fusion method, and by a usual screening method, It can be prepared by screening monoclonal antibody producing cells.

In the present invention, as a means for detecting or measuring the bound polypeptide, in the combination of the polypeptide of the (a) group and the polypeptide of the (b) group, both polypeptides and a specific fluorescent protein respectively By using a fusion polypeptide of the above, fluorescence resonance energy transfer (FRET) between fluorescent proteins can be used (A. Miyawaki et al. Nature vol. 388: 882-887, 1997; Mochizuki et al. Nature vol.411: 1065-1068; Miyawaki Atsushi eds. GFP and bioimaging Yodosha). The binding of the polypeptides of the groups (a) and (b) is detected by measuring the fluorescence resonance energy transfer occurring between adjacent fluorescent protein molecules. For example, the active form of the fusion polypeptide of the polypeptide of group (a) and yellow fluorescent protein (YFP) and the fusion polypeptide of the polypeptide of group (b) and cyan fluorescent protein (CFP) are contacted. When both groups of polypeptides bind, the YFP and CFP fused to them are in close proximity. Under such circumstances, when excitation is performed at the excitation wavelength of 433 nm of the CFP, the energy is transferred to the YFP, and as a result of the fluorescence resonance energy transfer, emission of the emission wavelength of 527 nm of the YFP is measured. Therefore, contacting these fusion polypeptides in the presence of a test sample containing a compound that inhibits the binding of the polypeptides of groups (a) and (b), reduces fluorescence resonance energy transfer and reduces the 527 nm Since the emission of the compound decreases, by comparing the intensity of the emission in the presence and absence of the test sample, a compound or the like that regulates the binding of the polypeptides of the groups (a) and (b) is screened. . Fluorescence resonance energy transfer can be performed by using a two-molecule system as described above, or a fusion polypeptide of a polypeptide of group (a) and a yellow fluorescent protein (YFP), a polypeptide of group (b) and a blue dye in one molecule. Fluorescent protein (CFP) also occurs in a molecule in which a spacer is interposed, and the detection sensitivity in this case can be adjusted by adjusting the length of the spacer. Furthermore, even if one or both groups of polypeptides are not fusion polypeptides with these fluorescent proteins and antibodies against the polypeptides of each group are labeled with YFP and CFP, respectively, fluorescence resonance energy transfer Are observed, and these forms can also be used in the screening method of the present invention.
Cells expressing the fusion polypeptide with the fluorescent protein in a cell (co-expression in the case of a two-molecule system) can be used for the screening of the present invention. In this case, the detection or measurement of the binding between the polypeptides of groups (a) and (b) and the detection or measurement of the biological activity involving p30 can be performed simultaneously. For example, it can be performed according to the method described in N. Mochizuki et al. Nature vol. 411: 1065-1068 or Atsushi Miyawaki, edited by GFP and bioimaging Yodosha. The above detection or measurement is possible by culturing in the presence.

  In the present invention, a predetermined nucleic acid can be isolated and sequenced, a recombinant can be prepared, and a predetermined peptide can be obtained by using “gene recombination technology”. Genetic recombination techniques that can be used herein include those known in the art, for example, J. Sambrook, EF Fritsch & T. Maniatis, "Molecular Cloning: A Laboratory Manual (2nd edition)", Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1989); DM Glover et al. Ed., "DNA Cloning", 2nd ed., Vol. 1 to 4, (The Practical Approach Series), IRL Press, Oxford University Press (1995); edited by The Biochemical Society of Japan, "Sequence Chemistry Laboratory Course 1, Gene Research Method II", Tokyo Kagaku Dojin (1986); The Biochemical Society of Japan, "Shinsei Chemistry Laboratory Course 2, nucleic acid III (recombinant DNA technology) ) ", Tokyo Kagaku Doujin (1992);" Methods in Enzymology "series, Academic Press, New York, for example, R. Wed.," Methods in Enzymology ", Vol. 68 (Recombinant DNA), Academic Press, New York ( 1980); R. Wu et al. Ed., "Methods in Enzymology", Vol. 100 (Recombinant DNA, Part B) & 101 (Recombinant DNA, Part C), Academic Press, New York (1983); R. Wu et al. e d., "Methods in Enzymology", Vol. 153 (Recombinant DNA, Part E), 154 (Recombinant DNA, Part E) & 155 (Recombinant DNA, Part F), Academic Press, New York (1987); JH Miller ed ., "Methods in Enzymology", Vol. 204, Academic Press, New York (1991); R. Wed., "Methods in Enzymology", Vol. 216 (Recombinant DNA, Part G), Academic Press, New York ( 1992); R. Wu ed., "Methods in Enzymology", Vol. 217 (Recombinant DNA, Part H) & 218 (Recombinant DNA, Part I), Academic Press, New York (1993); GM Attardi et al. Ed. ., "Methods in Enzymology", Vol. 260 (Mitochondrial Biogenesis and Genetics, Part A), Academic Press, New York (1995); JL Campbell ed., "Methods in Enzymology", Vol. 262 (DNA Replication), Academic Press, New York (1995); GM Attardi et al. Ed., "Methods in Enzymology", Vol. 264 (Mitochondrial Biogenesis and Genetics, Part B), Academic Press, New York (1996); PM Conn ed., " Methods in Enzymology ", Vol. 302 (Green Fluorescent Protein), Academic Press, New York (1999); S. Weissm an ed., "Methods in Enzymology", Vol. 303 (cDNA Preparation and Characterization), Academic Press, New York (1999); JC Glorioso et al. ed., "Methods in Enzymology", Vol. 306 (Expression of Recombinant Genes in Eukaryotic Systems), Academic Press, New York (1999); M. lan Phillips ed., "Methods in Enzymology", Vol. 313 (Antisense Technology, Part A: General Methods, Methods of Delivery and RNA Studies) & 314 (Antisense Technology, Part B: Applications), Academic Press, New York (1999); J. Thorner et al. Ed., "Methods in Enzymology", Vol. 326 (Applications of Chimeric Genes and Hybrid Proteins, Part A: Gene Expression and Protein Purification), 327 (Applications of Chimeric Genes and Hybrid Proteins, Part B: Cell Biology and Physiology) & 328 (Applications of Chimeric Genes and Hybrid Proteins, Part C: Protein-Protein Interactions and Genomics), Academic Press, New York (2000), or the method described in the literature cited therein, or Manner similar methods and modifications method may be used (described in in them are included in the present disclosure by reference thereto).

  As used herein, the term “polypeptide” may refer to any of the polypeptides described below. The basic structure of a polypeptide is well known and is described in numerous references in the art and other publications. In view of these, the term "polypeptide" as used herein refers to any peptide or any protein containing two or more amino acids joined together by peptide bonds or modified peptide bonds. I do. As used herein, the term "polypeptide" is generally known in the art as, for example, a peptide, an oligopeptide or a peptide oligomer, and is also known as a protein and in many forms. Both of the longer chains may usually mean. Polypeptides can often contain amino acids other than the amino acids commonly referred to as naturally occurring amino acids (naturally occurring amino acids: or amino acids encoded by a gene). Polypeptides may also be produced by natural processes, such as processing and other alterations (or modifications) after translation of many of the amino acid residues, including the terminal amino acid residues, as well as by chemical processes well known to those skilled in the art. It will be appreciated that the above polypeptides can also be altered (modified) by targeted modification techniques. Many forms of alterations (modifications) to be added to the polypeptide are known, and they are described in detail in basic reference books and more detailed articles in the art, as well as in many research literatures. And these are well known to those skilled in the art. Some particularly conventional alterations and modifications include, for example, alkylation, acylation, esterification, amidation, glycosylation, lipid binding, sulfation, phosphorylation, γ-carboxylation of glutamic acid residues, hydroxylation and ADP-ribosylation and the like, for example, TE Creighton, Proteins-Structure and Molecular Properties, Second Edition, WH Freeman and Company, New York, (1993); BCJohnson (Ed.), Posttranslational Covalent Modification of Proteins, Academic Press , New York, (1983) (Wold, F., "Posttranslational Protein Modifications: Perspective and Prospects", pp. 1-12); Seifter et al., "Analysis for Protein Modifications and nonprotein cofactors", Methods in Enzymology, 182. : 626-646 (1990); Rattan et al., "Protein Synthesis: Posttranslational Modification and Aging", Ann. NY Acad. Sci., 663: p.48-62 (1992).

Representative p30 proteins of the present invention include the amino acid sequence of the polypeptide of FIG. 1 or a polypeptide having an amino acid sequence substantially equivalent thereto, for example, at least 5-213 of the amino acid sequence. It has continuous amino acid residues and has biological activity including substantially equivalent biological activity such as Rap1 binding activity or dominant-suppressing type function or equivalent antigenicity, or has the characteristics thereof. And at least 50% homology, or at least more than 60% homology, or at least more than 70% homology, or at least more than 80% homology, or at least 90%, to any one of the domains of FIG. %, Or at least 95% or more, or at least 98% or more, What regulations and the like.
As the human p30-related polypeptide of the present invention, continuous amino acid residues containing all or a part of the amino acid sequence of FIG. 1 or 5 or more continuous amino acid residues of the amino acid sequence of FIG. 10 or more, also preferably 20 or more, more preferably 30 or more, more preferably 40 or more, also preferably 50 or more, more preferably 60 or more, more preferably 70 or more, and also preferably 80 or more And more preferably 90 or more, most preferably 100 or more, and more preferably 110 or more. The p30-related polypeptide of the present invention may have part or all of the amino acid sequence of FIG. 1 (may lack Met corresponding to the start codon). Any having such an arrangement may be included.

The nucleic acid encoding the p30 protein or polypeptide and the nucleic acid encoding the p30 protein or polypeptide according to the present invention typically contain the peptide shown in FIG. 1 and a nucleotide sequence encoding a continuous amino acid sequence of a part thereof, or Contains a nucleotide sequence composed of at least the peptide coding region of the nucleotide sequence (including those encoding only characteristic domains), and adds a start codon (codon encoding Met) and a stop codon to the coding sequence Which has an amino acid sequence having at least 50% homology with the protein encoded by the nucleotide sequence and has at least the characteristic continuous amino acid residues of the amino acid sequence shown in FIG. Biology including Rap1 binding activity or biological activity substantially equivalent to that such as dominant-suppressed function or equivalent antigenicity So long as it contains the base sequence of the same same effect such encoding a peptide having an activity may be any.
The nucleic acid encoding the protein is a nucleic acid such as a single-stranded DNA, a double-stranded DNA, an RNA, a DNA: RNA hybrid, a synthetic DNA, a human genomic DNA, a human genomic DNA library, and a cDNA derived from a human tissue / cell. Or synthetic DNA. The nucleotide sequence of the nucleic acid encoding the protein can be modified (eg, added, removed, substituted, etc.), and such modified ones can be included. Further, as described below, the nucleic acid of the present invention may encode the peptide of the present invention or a part thereof, and preferred is DNA. The “equivalent base sequence” refers to, for example, a continuous 5 or more base sequences, preferably 10 or more base sequences, more preferably 15 or more base sequences of the base sequences under stringent conditions. And a sequence that more preferably hybridizes with a base sequence of 20 or more nucleotides and encodes an amino acid sequence substantially equivalent to the protein.

  As one embodiment of a method for obtaining and isolating a functionally equivalent protein, a method for introducing a mutation into an amino acid in a protein is well known to those skilled in the art. That is, those skilled in the art can substitute, delete, add, etc. amino acids in a native protein (for example, the p30 protein shown in FIG. 1) by a known method, and have a function equivalent to this. It is possible to prepare modified proteins. Amino acid mutations may also occur in nature. The protein of the present invention also includes a protein having an amino acid sequence in which one or more amino acids have been substituted, deleted or added in the amino acid sequence of a native protein, and having a function equivalent to that of the native protein. It is. Amino acid alterations in proteins are usually within 50 amino acids of all amino acids, preferably within 30 amino acids, more preferably within 10 amino acids, and even more preferably within 3 amino acids. Amino acid modification, for example, mutations and substitutions can be performed using "Transformer Site-directed Mutagenesis Kit" or "ExSite PCR-Based Site-directed Mutagenesis Kit" (Clontech), Deletion can be performed using a "Quantum leap Nested Deletion Kit" (manufactured by Clontech) or the like.

  For the mutation, conversion, and modification methods, see the Biochemical Society of Japan, “Seizome Chemistry Laboratory Course 1, Gene Research Method II”, p105 (Susumu Hirose), Tokyo Kagaku Dojin (1986); Lecture 2: Nucleic acid III (recombinant DNA technology) ", p233 (Susumu Hirose), Tokyo Kagaku Doujin (1992); R. Wu, L. Grossman, ed.," Methods in Enzymology ", Vol. 154, p. 350 & p. 367, Academic Press, New York (1987); R. Wu, L. Grossman, ed., "Methods in Enzymology", Vol. 100, p. 457 & p. 468, Academic Press, New York (1983) ); JA Wells et al., Gene, 34: 315, 1985; T. Grundstroem et al., Nucleic Acids Res., 13: 3305, 1985; J. Taylor et al., Nucleic Acids Res., 13: 8765, 1985; R. Wu ed., "Methods in Enzymology", Vol. 155, p. 568, Academic Press, New York (1987); AR Oliphant et al., Gene, 44: 177, 1986. No. For example, site-directed mutagenesis using a synthetic oligonucleotide (site-directed mutagenesis) (Zoller et al., Nucl. Acids Res., 10: 6487, 1987; Carter et al., Nucl. Acids Res., 13: 4331, 1986), cassette mutagenesis (cassette mutagenesis: Wells et al., Gene, 34: 315, 1985), restriction selection mutagenesis: Wells et al., Philos. Trans.R Soc. London Ser A, 317: 415, 1986), Alanine scanning method (Cunningham & Wells, Science, 244: 1081-1085, 1989), PCR mutagenesis method, Kunkel method, dNTP [αS] method (Eckstein ), Region-directed mutagenesis using sulfurous acid, nitrous acid, or the like.

  As used herein, “substantially equivalent” or “substantially the same” means that the protein activities, for example, binding activity, physiological activity, and biological activity are substantially the same. . Furthermore, the meaning of the term may include a case having substantially the same activity, and the substantially same activity includes control of cell adhesion / migration and the like. . The term “substantially the same activity” means that those activities are the same in nature, for example, that they are the same physiologically, pharmacologically, or biologically. For example, activities such as binding activity are equivalent (e.g., about 0.001 to about 1000-fold, preferably about 0.01 to about 100-fold, more preferably about 0.1 to about 20-fold, and still more preferably about 0.5 to about 2-fold). Although it is preferable, these factors may differ in quantitative factors such as the degree of activity and the molecular weight of the protein.

When the peptide (or polypeptide) is obtained as a free form, it can be converted to a salt by a method known per se or a method analogous thereto, and they are obtained as a salt. In this case, it can be converted to a free form or another salt by a method known per se or a method analogous thereto.
The salt of the peptide (or polypeptide) is preferably, but not limited to, a physiologically acceptable salt or a pharmaceutically acceptable salt. Examples of such salts include salts with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, and phosphoric acid, such as acetic acid, formic acid, maleic acid, fumaric acid, succinic acid, citric acid, tartaric acid, malic acid, and benzoic acid. Acids, salts with organic acids such as methanesulfonic acid, p-toluenesulfonic acid, and benzenesulfonic acid, and the like. Further, examples of the salt include ammonium salts, for example, salts with organic bases such as ethylamine, dimethylamine, trimethylamine, and hydroxyethylamine.

  Also, it is expressed as a fusion protein at the time of production by a genetic recombination method, and converted and processed into a substance having a biological activity substantially equivalent to that of the natural protein of the present invention in vivo or in vitro. May be. Although a fusion production method commonly used in genetic engineering can be used, such a fusion protein can also be purified by affinity chromatography or the like using the fusion portion. Such fusion proteins include those fused to a histidine tag, or β-galactosidase (β-gal), maltose binding protein (MBP), glutathione-S-transferase (GST), thioredoxin (TRX) or Cre Recombinase. Examples thereof include those fused to an amino acid sequence. Similarly, a polypeptide can be tagged with a heterogeneous epitope so that it can be purified by immunoaffinity chromatography using an antibody that specifically binds to the epitope. In a more suitable embodiment, the epitope tag includes, for example, AU5, c-Myc, CruzTag 09, CruzTag 22, CruzTag 41, Glu-Glu, HA, Ha.11, KT3, FLAG (registered trademark, Sigma-Aldrich ), Omni-probe, S-probe, T7, Lex A, V5, VP16, GAL4, VSV-G. (Field et al., Molecular and Cellular Biology, 8: pp.2159-2165 (1988); Evan et al., Molecular and Cellular Biology, 5: pp.3610-3616 (1985); Paborsky et al., Protein Engineering , 3 (6): pp.547-553 (1990); Hopp et al., BioTechnology, 6: pp.1204-1210 (1988); Martin et al., Science, 255: pp.192-194 (1992) ; Skinner et al., J. Biol. Chem., 266: pp. 15163-15166 (1991); Lutz-Freyermuth et al., Proc. Natl. Acad. Sci. USA, 87: pp. 6393-6397 (1990). )Such) . A two-hybrid method using yeast can also be used.

  Further, the fusion protein may be labeled so as to be a detectable protein. In a more preferred embodiment, the detectable label may be a biotin / streptavidin-based Biotin Avi Tag, a fluorescent substance, and the like. Examples of the fluorescent substance include green fluorescent protein (green fluorescent protein: GFP) derived from a luminescent jellyfish such as Oan jellyfish (Aequorea victorea), and a mutant thereof (GFP variant), for example, EGFP (Enhanced-humanized). GFP), rsGFP (red-shift GFP), yellow fluorescent protein (YFP), green fluorescent protein (GFP), blue fluorescent protein (cyan fluorescent protein: CFP), blue fluorescent Photoprotein (blue fluorescent protein: BFP), GFP derived from Renilla reniformis, etc. (Miyawaki Atsushi, edited by Experimental Medicine, Special Lecture on Post-Genome Era, 3-GFP and Bio-Easing, Yodosha, 2000) ). Detection can also be performed using an antibody (including a monoclonal antibody and a fragment thereof) that specifically recognizes the fusion tag.

For the synthesis of proteins and some peptides thereof, methods known in the field of peptide synthesis, for example, chemical synthesis methods such as a liquid phase synthesis method and a solid phase synthesis method can be used. In such a method, for example, a resin for protein or peptide synthesis is used, and appropriately protected amino acids are sequentially bonded to a desired amino acid sequence on the resin by various condensation methods known per se. For the condensation reaction, various known activating reagents are preferably used. As such a reagent, for example, carbodiimides such as dicyclohexylcarbodiimide can be preferably used. When the product has a protecting group, the desired product can be obtained by appropriately removing the protecting group.
The protein can be prepared by a method known to those skilled in the art as a natural protein or as a recombinant protein prepared using a gene recombination technique. For natural proteins, for example, a column is prepared by binding an antibody obtained by immunizing a small animal such as a mouse or rabbit with the prepared recombinant protein to a suitable adsorbent (CNBr-activated agarose or tosyl-activated agarose). Then, it can be prepared by purifying a protein extract of cells using the obtained column. On the other hand, a recombinant protein can be prepared by a conventional method, for example, by inserting a DNA encoding the protein into an appropriate expression vector, introducing the vector into appropriate cells, and purifying from the transformed cells. It is possible.

  Cells used for producing recombinant proteins include, for example, plant cells, microbial cells such as Escherichia coli and yeast, animal cells, insect cells, and the like. Examples of a vector for expressing a recombinant protein in cells include plasmids “pBI121” and “pBI101” (Clontech) for plants and yeast cells, and a plasmid “pET Expression system” for Escherichia coli. (Stratagene), "GST gene fusion Vectors" (Pharmacia), plasmid "pMAM" (Clontech) for mammalian cells, plasmid "pBacPAK8.9" (Clontech) for insect cells, etc. Is mentioned. Insertion of DNA into a vector can be performed by a conventional method, for example, the method described in Molecular Cloning (Maniatis et al., Cold Spring harbor Laboratry Press). In addition, the introduction of the vector into the host cell can be performed by a conventional method according to the host cell, such as an electroporation method, a microinjection method, or a particle gun method.

Purification of the desired recombinant protein from the obtained transformed cells can be carried out by salting out, precipitation with an organic solvent, ion exchange chromatography, affinity chromatography, column chromatography with an immunoadsorbent, or gel filtration, depending on the properties of the protein. , SDS electrophoresis, isoelectric focusing, etc., can be combined as appropriate. When the recombinant protein is expressed as a fusion protein with a label such as glutathione S-transferase, it can be purified by affinity chromatography or the like for the label.
The present invention also provides a DNA encoding a protein or the like used in connection with control of p30-Rap1 binding / analysis of binding and the like. The DNA is not particularly limited as long as it can encode a predetermined protein according to the present invention, and includes genomic DNA, cDNA, chemically synthesized DNA and the like. Genomic DNA is prepared by using a genomic DNA prepared according to a method known in the art as a template and a polymerase chain primer using primers prepared based on a predetermined DNA base sequence (for example, the base sequence shown in FIG. 1). It can be prepared by performing a reaction (polymerase chain reaction; PCR). In the case of cDNA, it is prepared by preparing mRNA from cells by a conventional method (Maniatis et al. Molecular Cloning Cold Spring harbor Laboratry Press), performing reverse transcription reaction, and performing PCR using the same primers as above. It is possible to For genomic DNA and cDNA, a genomic DNA library or cDNA library is prepared by a conventional method, and this library is synthesized based on, for example, the base sequence of the DNA (eg, the base sequence shown in FIG. 1). It can also be prepared by screening using the probe thus prepared.

  As used herein, PCR generally refers to a method as described in Saiki et al., Science, 239: 487 (1988); U.S. Patent No. 4,683,195, and includes, for example, a desired nucleotide. Refers to a method for enzymatically amplifying a sequence in vitro. In general, PCR involves repeated cycles of performing primer extension synthesis using two oligonucleotide primers that can preferentially hybridize to a template nucleic acid. Typically, as a primer used in the PCR method, a primer complementary to the nucleotide sequence to be amplified inside the template can be used, for example, a primer complementary to the nucleotide sequence to be amplified at both ends. Or those adjacent to the nucleotide sequence to be amplified can be preferably used. In a typical case, the primer at the 5 ′ end contains at least an initiation codon or is selected so that amplification can be performed including the initiation codon, and the primer at the 3 ′ end is at least a stop. It is preferable to select such that it contains a codon or can be amplified so as to include the stop codon. The primer is preferably an oligonucleotide consisting of 5 or more bases, more preferably an oligonucleotide consisting of 10 or more bases, and more preferably an oligonucleotide consisting of 18 to 35 bases.

  PCR can be performed by a method known in the art or a method substantially similar to or a modification thereof. For example, in addition to the above-mentioned documents, R. Saiki, et al., Science, 230: 1350, 1985; HA Erlich ed., PCR Technology, Stockton Press, 1989; DM Glover et al. Ed., "DNA Cloning", 2nd ed., Vol. 1, (The Practical Approach Series), IRL Press, Oxford University Press (1995); MA Innis et al. Ed., "PCR Protocols: a guide to methods and applications", Academic Press, New York (1990)); MJ McPherson, P. Quirke and GR Taylor (Ed.), PCR: a practical approach, IRL Press, Oxford (1991); MA Frohman et al., Proc. Natl. Acad. Sci. USA, 85, 8998-9002 (1988), etc., or a modification or modification thereof. be able to. In addition, PCR can be performed using a commercially available kit suitable for the PCR, and can also be performed according to a protocol specified by a kit manufacturer or a kit distributor.

  In a typical PCR, for example, a template (for example, DNA synthesized using mRNA as a template; 1st strand DNA, etc.) and a primer designed based on the gene are combined with a 10 × reaction buffer (Taq Mix with DNA polymerase), dNTPs (mixture of deoxynucleoside triphosphates dATP, dGTP, dCTP, dTTP), Taq DNA polymerase and deionized distilled water. The mixture is cycled 25 to 60 times under general PCR cycling conditions using an automated thermal cycler such as the GeneAmp 2400 PCR system, Perkin-Elmer / Cetus, but the number of cycles for amplification is The number can be set to an appropriate number according to PCR cycle conditions include, for example, denaturation at 90 to 95 ° C for 5 to 100 seconds, annealing at 40 to 60 ° C for 5 to 150 seconds, extension at 65 to 75 ° C for 30 to 300 seconds, preferably denaturation at 94 ° C for 15 seconds and annealing 58. A cycle of 15 ° C for 15 seconds and an extension of 72 ° C for 45 seconds can be cited, but the annealing reaction temperature and time can be appropriately selected by experiments as appropriate, and the denaturation reaction and extension reaction time can also be estimated as the expected PCR product chain. An appropriate value can be selected according to the length. The annealing reaction temperature is usually preferably changed according to the Tm value of the hybrid between the primer and the template DNA. The time for the extension reaction is generally about 1 minute per 1000 bp chain length, but a shorter time can be selected in some cases. The nucleotide sequence of the obtained DNA can be easily determined by using, for example, “Sequencer Model 310” (manufactured by ABI).

  As used herein, the term "oligonucleotide" refers to a relatively short single-stranded or double-stranded polynucleotide, preferably a polydeoxynucleotide, and Angew. Chem. Int. Ed. Engl., Vol. 28 Chem., pp. 716-734 (1989), for example, by a method such as the phosphphotoester method, the phosphodiester method, the phosphite method, the phosphoramidite method, and the phosphonate method. Can be synthesized. It is generally known that synthesis can be conveniently performed on a modified solid support, for example, using an automated synthesizer, which is commercially available. The oligonucleotide may contain one or more modified bases, for example, it may contain unnatural bases such as inosine or tritylated bases, etc. May contain a base with a marker.

Hybridization technology can be used to identify a predetermined nucleic acid. The hybridization can be performed by the method described in the literature that discloses the above-mentioned “gene recombination technique”, or a method substantially similar thereto or a modification method. For example, in hybridization, a sample containing nucleic acid such as DNA is transferred to a carrier including a membrane such as a nylon filter, and after denaturation treatment, immobilization treatment, washing treatment, etc., if necessary, the carrier (For example, a membrane) is reacted with a denatured labeled probe DNA fragment, if necessary, in a hybridization buffer.
The hybridization treatment is usually performed at about 35 to about 80 ° C, more preferably about 50 to about 65 ° C, for about 15 minutes to about 36 hours, more preferably about 1 to about 24 hours. This can be done by selecting conditions. For example, the hybridization treatment is performed at about 55 ° C. for about 18 hours. The hybridization buffer can be selected from those commonly used in the art, and for example, Rapid hybridization buffer (Amersham) or the like can be used. Examples of the denaturation treatment of the transferred carrier (for example, a membrane) include a method using an alkali denaturing solution, and after the treatment, treatment with a neutralizing solution or a buffer is preferable. The immobilization treatment of a carrier (eg, a membrane) is usually performed at about 40 to about 100 ° C., more preferably at about 70 to about 90 ° C., for about 15 minutes to about 24 hours, and more preferably at about 1 to about 24 hours. This is performed by baking for about 4 hours, but can be performed by appropriately selecting preferable conditions. For example, the immobilization is performed by baking a carrier such as a filter at about 80 ° C. for about 2 hours. Washing of the transferred carrier (eg, a membrane) includes washing solutions commonly used in the art, for example, 50 mM Tris-HC1 buffer containing 1 M NaCl, 1 mM EDTA and 0.1% sodium dodecyl sulfate (SDS), pH 8. It can be performed by washing with 0 or the like. The carrier including the membrane such as a nylon filter can be selected from those commonly used in the art.

The above-mentioned alkali denaturing solution, neutralizing solution, and buffer can be selected from those commonly used in the art, and include, for example, 0.5 M NaOH and 1.5 M NaCl. The neutralizing solution includes, for example, a 0.5 M Tris-HCl buffer containing 1.5 M NaCl, pH 8.0, and the like. The buffer includes, for example, 2 × SSPE (0.36 M NaCl, 20 mM NaH ₂ PO ₄ and 2 mM EDTA). Prior to the hybridization treatment, it is preferable to perform a pre-hybridization treatment on the transferred carrier (for example, a membrane) as necessary in order to prevent a non-specific hybridization reaction. This prehybridization treatment is performed, for example, using a prehybridization solution [50% formamide, 5 × Denhardt's solution (0.2% bovine serum albumin, 0.2% polyvinyl pyrrolidone), 5 × SSPE, 0.1% SDS, 100 μg / ml heat-denatured salmon. Sperm DNA] and the like, and reacting at about 35 to about 50 ° C., preferably about 42 ° C., for about 4 to about 24 hours, preferably for about 6 to about 8 hours. Those skilled in the art can repeat experiments as appropriate to determine more preferable conditions. Denaturation of the labeled probe DNA fragment used for hybridization can be performed, for example, by heating at about 70 to about 100 ° C, preferably about 100 ° C, for about 1 to about 60 minutes, preferably for about 5 minutes. The hybridization can be carried out by a method known per se or a method analogous thereto.In the present specification, the stringent condition means, for example, about 15 to about 50 mM, preferably about 19 to about sodium concentration. About 40 mM, more preferably about 19 to about 20 mM, and the temperature is about 35 to about 85 ° C, preferably about 50 to about 70 ° C, more preferably about 60 to about 65 ° C. After the hybridization is completed, the carrier such as a filter is sufficiently washed to remove the labeled probe other than the labeled probe DNA fragment that has undergone the specific hybridization reaction, and then the detection can be performed. The washing treatment of the carrier such as a filter can be performed by selecting from those commonly used in the art, such as a 0.5 × SSC (0.15M NaCl, 15 mM citric acid) solution containing 0.1% SDS. It can be carried out by washing.

The hybridized nucleic acid can be typically detected by autoradiography, but can also be appropriately selected from methods used in the art and used for the detection. The nucleic acid band corresponding to the detected signal is suspended in an appropriate buffer, for example, an SM solution (50 mM Tris-HCl buffer containing 100 mM NaCl and 10 mM MgSO ₄ , pH 7.5). The nucleic acid can be isolated, purified, and subjected to further amplification.
The process of screening for a target nucleic acid from a nucleic acid sample including a gene library, a cDNA library, and the like by hybridization can be repeatedly performed. A human-derived cDNA library that has been cloned, for example, various human-derived tissues or cultured cells (particularly, human kidney, brain, pineal gland, posterior pituitary gland, nerve cells, retina, retinal vascular cells, retinal nerves) Cells, thymus, blood vessels, endothelial cells, vascular smooth muscle cells, blood cells, macrophages, lymphocytes, testis, ovaries, uterus, intestine, heart, liver, pancreas, small intestine, large intestine, gingival-related cells, skin-related cells, glomeruli Tissue, cells such as cells, tubular cells, connective tissue cells, and various tumor tissues, cancer cells, etc.) cDNA libraries. Further, as a cDNA library used as a template or the like, a commercially available cDNA library derived from various tissues can be directly used. For example, a cDNA library commercially available from Stratagene, Invitrogen, Clontech, or the like can be used. In a typical example, a gene library prepared from human tissues / cells, for example, a human P1 artificial chromosome genomic library (Human Genome Mapping Resource Center), a human tissue cDNA library (e.g., available from Clontech, etc.) is used. be able to. A human genomic DNA library or a human-derived cDNA library constructed from various human tissues or cultured cells can be screened using a probe. Labeling of a probe or the like with a radioisotope or the like can be performed using a commercially available labeling kit, for example, a random prime DNA labeling kit (Boehringer Mannheim). For example, using a random-priming kit (Pharmacia LKB, Uppsala) or the like, the probe DNA is labeled with [α- ³² P] dCTP (Amersham) or the like to obtain a radioactive probe.

Phage particles, recombinant plasmids, recombinant vectors, and the like that carry a predetermined nucleic acid can be purified and separated by a method commonly used in the art. For example, glycerol gradient ultracentrifugation (Molecular Cloning) , a laboratory manual, ed. T. Maniatis, Cold Spring Harbor Laboratory, 2nd ed. 78, 1989), and electrophoresis. Such as from phage particles, DNA can be purified separated by methods commonly used in the art, for example, resulting phage TM solution (10 mM MgSO ₄ containing 50 mM Tris-HCl buffer, pH 7.8 ), Treat with DNase I and RNase A, add 20mM EDTA, 50μg / ml Proteinase K and 0.5% SDS mixture, and incubate at about 65 ° C for about 1 hour. After ether extraction, the DNA is precipitated by ethanol precipitation, and the obtained DNA is then washed with 70% ethanol, dried, and dissolved in a TE solution (10 mM Tris-HC1 buffer containing 10 mM EDTA, pH 8.0). Obtained. The target DNA can also be obtained in large quantities by subcloning or the like. For example, subcloning can be performed using Escherichia coli as a host and a plasmid vector. The DNA obtained by such subcloning can also be purified and separated by methods such as centrifugation, phenol extraction, and ethanol precipitation in the same manner as described above.

  In the present specification, the term `` high homology '' depends on the length of the target sequence, for example, 50% or more, further 60% or more, preferably 70% or more, more preferably 80% or more, and in certain cases. May be 95% or more, particularly preferably 97% or more. The “equivalent nucleotide sequence” may be, for example, a sequence that hybridizes to a sequence having a problematic sequence under stringent conditions. For example, five or more consecutive nucleotide sequences of the nucleotide sequence, preferably Is a base sequence of 10 or more, more preferably a base sequence of 15 or more, more preferably hybridizes with a base sequence of 20 or more, and those encoding an amino acid sequence substantially equivalent to the polypeptide and the like. Can be Nucleic acids can also be obtained by chemical synthesis. In that case, the fragments may be chemically synthesized and ligated with an enzyme.

In the present specification, the obtained nucleic acid such as a PCR product (including DNA) is usually subjected to 1 to 2% agarose gel electrophoresis, cut out from the gel as a specific band, for example, such as a gene clean kit (Bio 101). Extract using a commercially available extraction kit. The extracted DNA is digested with an appropriate restriction enzyme, purified if necessary, and further, if necessary, phosphorylated at the 5 ′ end with T4 polynucleotide kinase or the like, and then is appropriately digested with a pUC-based vector such as pUC18. Ligation into a plasmid vector and transformation of appropriate competent cells. The nucleotide sequence of the cloned PCR product is analyzed. The cloning of PCR products, for example, p-Direct (Clontech, ^{Inc.), pCR-Script TM SK (} +) (Stratagene , Inc.), pGEM-T (Promega Corp.), pAmp ^TM (Gibco-BRL Co.) commercially available, such as Plasmid vectors can be used. For transformation of host cells, for example, phage vectors can be used, calcium method, rubidium / calcium method, calcium / manganese method, TFB high efficiency method, FSB freezing competent cell method, rapid colony method, electroporation The method can be carried out by a method known in the art or a method substantially similar thereto (D. Hanahan, J. Mol. Biol., 166: 557, 1983, etc.). In order to isolate the target DNA, reverse transcription PCR (polymerase chain reaction reverse transcription; RT-PCR) and RACE (rapid amplification of cDNA ends) can be applied. RACE is described, for example, in MA Innis et al. Ed., "PCR Protocols" (MA Frohman, "a guide to methods and applications"), pp. 28-38, Academic Press, New York (1990). It can be done according to the method.

The DNA can be cloned as necessary, and for example, a plasmid, a λ phage, a cosmid, a P1 phage, an F factor, YAC, or the like can be used. Preferably, a vector derived from λ phage is used. For example, Charon 4A, Charon 21A, λgt10, λgt11, λDASHII, λFIXII, λEMBL3, λZAPII ^™ (Stratagene) and the like can be used. Further, the obtained DNA is incorporated into a suitable vector as described in detail below, for example, a vector such as plasmid pEX, pMAMneo, pKG5, and a suitable host cell as described in detail below, for example, Escherichia coli or yeast. , CHO cells, COS cells and the like. Further, the DNA fragment can be used as it is or as a DNA fragment to which an appropriate control sequence is added, or inserted into an appropriate vector, and introduced into an animal to prepare a transgenic animal expressing a predetermined gene. Animals include mammals, for example, mice, rats, rabbits, guinea pigs, cows, and the like. Preferably, a transgenic animal can be prepared by introducing the DNA fragment into a fertilized egg of an animal such as a mouse. Confirmation of the predetermined gene product can be performed using animal cells suitable for the transfection of the foreign gene, such as 293T cells and COS-1 cells.
As a method for introducing a foreign gene into animal cells such as mammals, a method known in the art or a method substantially similar thereto can be used. For example, a calcium phosphate method (for example, FL Graham et al., Virology, 52: 456, 1973), the DEAE-dextran method (eg, D. Warden et al., J. Gen. Virol., 3: 371, 1968, etc.), and the electroporation method (eg, E. Neumann et al. EMBO J, 1: 841, 1982), microinjection method, ribosome method, virus infection method, phage particle method and the like. Gene products produced by animal cells transfected with a predetermined gene can be analyzed.

Plasmids incorporating predetermined genes and the like (such as the DNA obtained in the present invention) include host cells commonly used in genetic engineering (eg, prokaryotic hosts such as Escherichia coli and Bacillus subtilis, yeast, 293T cells, CHO cells, COS Any plasmid can be used as long as it can express the DNA in a eukaryotic host such as a cell or an insect cell host such as Sf21. Of course, it can be used by selecting from those attached to commercially available kits and reagents. Such a sequence may contain, for example, codons suitably modified for expression in the selected host cell, may have a restriction enzyme site, and may have a gene of interest. Controlling sequences for facilitating expression, facilitating sequences, etc., which are useful for binding the target gene, such as linkers and adapters, as well as controlling antibiotic resistance, controlling metabolism, and selecting It may contain useful sequences (including those encoding hybrid proteins and fusion proteins). Preferably, a suitable promoter, for example in plasmid E. coli as a host, a tryptophan promoter (trp), lactose promoter (lac), the tryptophan lactose promoter (tac), lipoprotein promoter (lpp), the λ phage P _L promoter For a plasmid using animal cells as a host, the SV40 rate promoter, MMTV LTR promoter, RSV LTR promoter, CMV promoter, SRα promoter and the like can be used. For a plasmid using yeast as a host, GAL1 and GAL10 promoters can be used. Further, control systems such as CYC1, HIS3, ADH1, PGK, PHO5, GAPDH, ADC1, TRP1, URA3, LEU2, EN0, TP1, AOX1 can also be used.

  An enhancer can be inserted into the vector to promote transcription of the DNA encoding the desired polypeptide, such an enhancer acting on a promoter to promote transcription, usually about 10-100 bp. Elements having a cis action can be mentioned. Many enhancers are known from mammalian genes such as globin, elastase, albumin, α-fetoprotein, and insulin. Typically, enhancers obtained from eukaryotic cell infectious viruses can be suitably used, such as the SV40 enhancer (100-270 bp) in the replication origin rate region, the cytomegalovirus early promoter enhancer, and polyoma replication. Examples include enhancers in the origin rate region, adenovirus enhancers, and the like. If necessary, a signal sequence suitable for the host can be added, and those well known to those skilled in the art can be used.

Examples of plasmids using Escherichia coli as a host include, for example, pBR322, pUC18, pUC19, pUC118, pUC119, pSP64, pSP65, pTZ-18R / -18U, pTZ-19R / -19U, pGEM-3, pGEM-4, pGEM-3Z, pGEM-4Z, pGEM-5Zf (-), pBluescript KS ^™ (Stratagene) and the like. Examples of plasmid vectors suitable for expression in Escherichia coli include pAS, pKK223 (Pharmacia), pMC1403, pMC931, pKC30, pRSET-B (Invitrogen) and the like. Examples of plasmids using animal cells as hosts include SV40 vectors, polyoma virus vectors, vaccinia virus vectors, retrovirus vectors, and the like.Specifically, pcD, pcD-SRα, CDM8, pCEV4, pME18S, pBC12BI, pSG5 (Stratagene) and the like. Examples of plasmids using yeast as a host include YIp-type vectors, YEp-type vectors, YRp-type vectors, and YCp-type vectors, such as pGPD-2. When the host cell is Escherichia coli, for example, those derived from Escherichia coli K12 strain may be mentioned.For example, NM533, XL1-Blue, C600, DH1, DH5, DH11S, DH12S, DH5α, DH10B, HB101, MC1061, JM109 , STBL2 and B834 strains include BL21 (DE3) pLysS and the like. When the host cell is yeast, examples include Saccharomyces cerevisiae, Schizosaccharomyces prombe, Pichia pastoris, Kluyveromyces strain, Candida, Trichoderma reesia, and other yeast strains.

When the host cell is an animal cell, for example, COS-7 cells derived from African green monkey fibroblasts, COS-1 cells, CV-1 cells, 293 cells derived from human kidney cells, A431 cells derived from human epidermal cells, 205 cells derived from human colon , Mouse fibroblast-derived COP cells, MOP cells, WOP cells, Chinese hamster cell-derived CHO cells, CHO DHFR ^- cells, human HeLa cells, mouse cell-derived C127 cells, mouse cell-derived NIH 3T3 cells, mouse L cells , 9BHK, HL-60, U937, HaK, Jurkat cells, other transformed cell lines, normal diploid cells, cell lines derived from primary cultured tissues in vitro, and the like. As insect cells, Bombyx mori nuclear polyhedrosis virus (Bombyx mori nuclear polyhedrosis virus), a vector derived therefrom or any other suitable vector is used as a vector, and Spodoptera frugiperda (caterpillar), Aedes aegypti (mosquito), Aedes albopictus (mosquito) , Drosophila melangaster (fruitfly), silkworm larvae or cultured silkworm cells, such as BM-N cells (for example, Luckow et al., Bio / Technology, 6, 47-55 (1988); Setlow, JK). et al. (eds.), Genetic Engineering, Vol. 8, pp. 277-279, Plenum Publishing, 1986; Maeda et al., Nature, 315, pp. 592-594 (1985)). It is also possible to use plant cells as host cells by utilizing Agrobacterium tumefaciens and the like, and these are widely known in the art together with suitable vectors. In the genetic engineering method of the present invention, a restriction enzyme, reverse transcriptase, or an enzyme for modifying or converting a DNA fragment into a structure suitable for cloning is known or widely used in the art. Certain DNA modifying / degrading enzymes, DNA polymerases, terminal nucleotidyl transferases, DNA ligases, etc. can be used. As a restriction enzyme, for example, RJ Roberts, Nucleic Acids Res., 13: r165, 1985; S. Linn et al. Ed.Nucleases, p. 109, Cold Spring Harbor Lab., Cold Spring Harbor, New York, 1982; RJ Roberts, D. Macelis, Nucleic Acids Res., 19: Suppl. 2077, 1991 and the like.

  In accordance with the present invention, a transformant transformed with an expression vector containing a nucleic acid encoding a polypeptide (or protein) can be repeatedly cloned using an appropriate selection marker if necessary, to achieve high expression ability. Can be obtained stably. For example, in a transformant using an animal cell as a host cell, when the dhfr gene is used as a selection marker, the MTX concentration is gradually increased, culture is performed, and a resistant strain is selected to encode the polypeptide of the present invention. Amplified DNA can be amplified to obtain a cell line that can obtain higher expression. The transformant of the present invention can be cultured under conditions under which the nucleic acid encoding the polypeptide of the present invention can be expressed to produce and accumulate the desired product. The transformant can be cultured in a medium commonly used in the art. For example, a transformant using a prokaryotic host such as Escherichia coli or Bacillus subtilis or a yeast as a host can suitably employ a liquid medium. The medium contains a carbon source, a nitrogen source, inorganic substances and the like necessary for the growth of the transformant. As a carbon source, for example, glucose, dextrin, soluble starch, sucrose, etc. As a nitrogen source, for example, ammonium salts, nitrates, corn steep liquor, peptone, casein, meat extract, malt extract, soybean meal, potato extract Examples of the inorganic or organic substance and the inorganic substance include calcium chloride, sodium dihydrogen phosphate, magnesium chloride, and calcium carbonate. In addition, yeast, vitamins, casamino acids, growth promoting factors and the like may be added. If necessary, an agent such as 3β-indolylacrylic acid can be added to make the promoter work efficiently. The pH of the medium is preferably about 5 to about 8.

  For example, cultivation of Escherichia coli is usually performed at about 15 to about 45 ° C. for about 3 to about 75 hours, and if necessary, aeration and stirring can be applied. When culturing a transformant whose host is an animal cell, for example, a MEM medium containing about 5 to about 20% fetal bovine serum, a PRMI1640 medium, a DMEM medium, and the like are used. Preferably, the pH is from about 6 to about 8. The cultivation is usually performed at about 30 to about 40 ° C. for about 15 to about 72 hours, and if necessary, aeration or stirring is added. A transformant expressing the predetermined gene product can be used as it is, but can also be used as its cell homogenate. Alternatively, the predetermined gene product can be isolated and used. When extracting from the above cultured cells, the cells or cells are collected by a known method after culture, suspended in an appropriate buffer, and disrupted by ultrasonication, lysozyme and / or freeze-thawing. After that, a method of obtaining a crude extract by centrifugation or filtration can be appropriately used. The buffer may contain a protein denaturing agent such as urea or guanidine hydrochloride, or a surfactant such as Triton X-100 (trade name) or Tween-20 (trade name). When the target product is secreted into the culture solution, after completion of the culture, the supernatant is separated from the cells or cells by a method known per se, and the supernatant is collected.

  The target product contained in the culture supernatant or the extract thus obtained can be purified by appropriately combining known separation and purification methods, for example, by a salt such as ammonium sulfate precipitation method. Precipitation, gel filtration by Sephadex, etc., for example, ion-exchange chromatography using a carrier having a diethylaminoethyl group or a carboxymethyl group, etc., for example, a carrier having a hydrophobic group such as a butyl group, an octyl group, a phenyl group, etc. It can be obtained by purification by the used hydrophobic chromatography, dye gel chromatography, electrophoresis, dialysis, ultrafiltration, affinity chromatography, high performance liquid chromatography, or the like. Preferably, it can be purified and separated by polyacrylamide gel electrophoresis, affinity chromatography in which a ligand or the like is immobilized, or the like. Examples include gelatin-agarose affinity chromatography, heparin-agarose chromatography, and the like. The obtained protein (which may include a peptide or a polypeptide) can be bound to an appropriate carrier or solid phase by a known technique such as enzyme immunoassay and solidified. The immobilized protein and the immobilized peptide can be conveniently used for a binding assay and a substance screening.

    Related proteins disclosed herein, fragments thereof, and nucleic acids (including mRNAs and oligonucleotides), including DNA, may be used alone or organically, and may further include antisense technology and monoclonal antibodies. It can be applied to genomics and proteomics technology by appropriately combining the antibodies, transgenic animals, and the like. There is also a way to apply to RNAi (RNA interference) technology using double-stranded RNA (dsRNA). Thus, gene polymorphism analysis centering on single nucleotide polymorphisms (SNPs), nucleic acid arrays, gene expression analysis using protein arrays, gene function analysis, protein interaction analysis, related gene analysis, pesticide analysis It becomes possible to do. For example, in nucleic acid array technology, a cDNA library is used, or DNA obtained by PCR technology is arranged on a substrate at a high density by a spotting device, and a sample is analyzed using hybridization.

  The arraying is performed by using a needle or a pin, or by using an ink-jet printing technique or the like, by attaching DNA to a unique position on a substrate such as a slide glass, a silicon plate, or a plastic plate. Can be. Observing a signal obtained as a result of the hybridization on the nucleic acid array, obtains data. The signal may be obtained from a label such as a fluorescent dye (for example, Cy3, Cy5, BODIPY, FITC, Alexa Fluor dyes (trade name), Texas red (trade name), etc.). A laser scanner or the like may be used for detection, and the obtained data may be processed by a computer system equipped with a program according to an appropriate algorithm. Protein array technology may also utilize tagged recombinantly expressed protein products, including two-dimensional electrophoresis (2-DE), mass spectrometry (MS), including enzymatic digestion fragments (including electrophoresis). Includes techniques such as spray ionization (electrospray ionization: ESI), matrix-assisted laser desorption / ionization (MALDI), MALDI-TOF analyzer, ESI-3 quadrupole analyzer , An ESI-ion trap analyzer, etc.), staining techniques, isotope labeling and analysis, image processing techniques, and the like. Therefore, the present invention may include the above-mentioned p30 and its related analogs / derivatives and the like, software and databases related to antibodies thereto.

In transferring a predetermined DNA (for example, DNA encoding p30 or Rap1) to a target animal, it is generally advantageous to use it as a DNA fragment or by binding the DNA downstream of a promoter capable of expressing the DNA in animal cells. It is. For example, when the DNA is introduced into a mouse, a gene construct obtained by binding the DNA derived from an animal having high homology to the DNA downstream of various promoters capable of expressing the DNA in animal cells is used as a fertilized egg of a target animal, for example, a mouse fertilized egg. By microinjecting the gene into a transgenic mouse, the protein can be produced at a high level. The mouse is not particularly limited to a pure mouse, but includes, for example, C57BL / 6, Balb / C, C3H, (C57BL / 6 × DBA / 2) F ₁ (BDF ₁ ). As this promoter, for example, a virus-derived promoter, a ubiquitous expression promoter such as metallothionein and the like can be preferably used. In addition, when the DNA is introduced, the DNA can be recombined with a recombinant retrovirus and used. Preferably, a mouse fertilized egg into which the target DNA has been introduced can be grown using a foster mother mouse such as ICR.
Transfer of the DNA (eg, DNA encoding p30 or Rap1) at the fertilized egg cell stage is ensured to be present in all germ cells and somatic cells of the target animal. The presence of the DNA encoding the protein in the germinal cells of the produced animal after DNA transfer means that all the offspring of the produced animal have the DNA encoding the protein in all of its germ cells and somatic cells. Progeny of such animals that have inherited the gene have the potential to express the protein in all of their germinal and somatic cells.

After confirming that the DNA-introduced animal stably retains the gene by mating, the animal can be bred in a normal breeding environment as the DNA-bearing animal. Furthermore, by crossing male and female animals having the target DNA, a homozygous animal having the transgene on both homologous chromosomes is obtained, and by crossing the male and female animals, all offspring have the DNA. Breeding can be subcultured. Since the animal into which the DNA has been introduced has high expression of the protein, it is useful as an animal for screening for an inhibitor (inhibitor) against the protein. Further, it is useful as an animal for screening antisense oligonucleotides capable of inhibiting the expression of the gene, for example, antisense DNA.
This transgenic animal can also be used as a cell source for tissue culture. For example, by directly analyzing DNA or RNA in the tissue of a transgenic mouse, or by analyzing a protein or tissue expressed by a gene, it is possible to analyze, for example, a protein related to p30. The cells of the tissue producing the protein are cultured by standard tissue culture techniques and used to produce, for example, vascular cells such as brain, thymus, vascular endothelial cells, blood cells, testis, brain, intestine, kidney and other tissues. Its function can be studied for cells of origin. In addition, by using the cells, it is possible to contribute to the development of drugs that enhance the functions of various tissues, for example. In addition, if there is a high expression cell line, the protein can be isolated and purified therefrom. Techniques relating to transgenic mice and the like are described, for example, in Brinster, RL, et al.,; Proc. Natl. Acad. Sci. USA, 82: 4438, 1985; Costantini, F. & Jaenisch, R. (eds.) : Genetic manipulation of the early mammalian embryo, Cold Spring Harbor Laboratory, 1985, and the like, or the method described in the literature cited therein, or a modification thereof.

As used herein, the term “antibody” may be used in a broad sense, and may include a single monoclonal antibody or various epitopes against a desired p30 protein, its constituent polypeptides and related peptide fragments. And also includes monovalent or multivalent antibodies and polyclonal and monoclonal antibodies, and also represents intact molecules and fragments and derivatives thereof. Yes, encompasses fragments such as F (ab ') ₂ , Fab' and Fab, and further comprises a chimeric or hybrid antibody having at least two antigen or epitope binding sites, or, for example, a quadrome, a triome ( triome), bispecific recombinant antibodies, interspecies hybrid antibodies, anti-idiotype antibodies, and chemically modified antibodies. Alternatively, those which are considered to be derivatives thereof after being processed or the like, known cell fusion or antibody obtained by using hybridoma technology or antibody engineering, or synthesized or semi-synthetic technology, are known from the viewpoint of antibody production. An antibody prepared by applying a conventional technique or using a DNA recombination technique, an antibody having a neutralizing property with respect to a target antigen substance or a target epitope as described and defined herein, or an antibody having a binding property May be included. Particularly preferred antibodies of the present invention include those that can specifically identify a polypeptide selected from the N-terminal region of p30.

Monoclonal antibodies raised against the antigenic substance are produced using any method that can provide for the production of antibody molecules by a series of cell lines in culture. The modifier "monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not deemed necessary to produce the antibody by any particular method. No. Individual monoclonal antibodies are those that contain a population of antibodies that are identical, except that only a small amount of naturally occurring variants may be present. Monoclonal antibodies have high specificity, and are directed against sites with a single antigenicity. In contrast to conventional (polyclonal) antibody preparations, which typically contain various antibodies directed against different antigenic determinants (epitope), each monoclonal antibody is a single antigen on that antigen It is aimed at determinants. In addition to its specificity, monoclonal antibodies are synthesized by hybridoma culture and are excellent in that they are free of or less contaminated by other immunoglobulins. Monoclonal antibodies include hybrid antibodies and recombinant antibodies. They may replace the variable region domain with a constant region domain, replace the light chain with a heavy chain, or replace certain chains, regardless of their origin or type of immunoglobulin class or subclass, as long as they exhibit the desired biological activity. Can be obtained by displacing with another type of chain, or by fusing with a heterogeneous protein (for example, US Pat. No. 4,816,567; Monoclonal Antibody Production Techniques and Applications, pp. 79-97, Marcel Dekker). , Inc., New York, 1987).
Examples of suitable methods for producing monoclonal antibodies include the hybridoma method (G. Kohler and C. Milstein, Nature, 256, pp. 495-497 (1975)); the human B cell hybridoma method (Kozbor et al., Immunology Today, 4, pp. 72-79 (1983); Kozbor, J. Immunol., 133, pp. 3001 (1984); Brodeur et al., Monoclonal Antibody Production Techniques and Applications, pp. 51-63, Marcel Dekker, Inc., New York (1987); Trioma method; EBV-hybridoma method (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96 (1985)) (human monoclonal antibody U.S. Patent No.

S. Biocca et al., EMBO J, 9, pp. 101-108 (1990); RE Bird et al., Science, 242, pp. 423-426 (1988); MA Boss et al., Nucl. Acids Res. ., 12, pp. 3791-3806 (1984); J. Bukovsky et al., Hybridoma, 6, pp. 219-228 (1987); M. DAINO et al., Anal. Biochem., 166, pp. 223 -229 (1987); JS Huston et al., Proc. Natl. Acad. Sci. USA, 85, pp. 5879-5883 (1988); PT Jones et al., Nature, 321, pp. 522-525 (1986). ); JJ Langone et al. (Ed.), "Methods in Enzymology", Vol. 121 (Immunochemical Techniques, Part I: Hybridoma Technology and Monoclonal Antibodies), Academic Press, New York (1986); S. Morrison et al. Natl. Acad. Sci. USA, 81, pp. 6851-6855 (1984); VT Oi et al., BioTechniques, 4, pp. 214-221 (1986); L. Riechmann et al., Nature, 332, pp.323-327 (1988); A. Tramontano et al., Proc. Natl. Acad. Sci. USA, 83, pp.6736-6740 (1986); C. Wood et al., Nature, 314, pp.446-449 (1985); Nature, 314, pp.452-454 (1985) or references cited therein (for descriptions in them, refer to them). Included in the present disclosure by Rukoto). The antibody of the present invention can be used for analysis, detection, and the like of the gene expression product, as well as various uses.

For example, the monoclonal antibodies may have part of the heavy and / or light chains identical to the corresponding sequence of an antibody derived from a particular species or belonging to a particular antibody class or subclass, as long as they exhibit the desired biological activity. Or a "chimeric" antibody (immunoglobulin), wherein the remainder of the chain is identical or homologous to the corresponding sequence of an antibody derived from another species or belonging to another antibody class or subclass. (US Pat. No. 4,816,567; Morrison et al., Proc. Natl. Acad. Sci. USA, 81, pp. 6851-6855 (1984)).
Hereinafter, the production of the antibody will be described in detail using a monoclonal antibody as an example. The monoclonal antibody of the present invention is a monoclonal antibody obtained by using a cell fusion technique using myeloma cells (eg, G. Kohler and C. Milstein, Nature, 256, pp. 495-497 (1975)). It may be an antibody, and can be produced, for example, by the following steps.
1. 1. Preparation of immunogenic antigen 2. Immunization of animals with immunogenic antigens 3. Preparation of myeloma cells (myeloma cells) 4. Cell fusion between antibody-producing cells and myeloma cells 5. Selection and monocloning of hybridomas (fused cells) Production of monoclonal antibodies

1. Preparation of Immunogenic Antigen As described above, an antigen obtained by isolating the p30 polypeptide or a fragment derived therefrom can be used, but the amino acid sequence of the determined p30 protein can be used. Based on the information, an appropriate oligopeptide can be chemically synthesized and used as an antigen. Typically, a peptide having at least 5 consecutive amino acids among the amino acid residues present in FIG. 1 can be mentioned. For example, selection of an appropriate portion from a characteristic sequence, for example, an amino acid sequence on the N-terminal side or the like can be mentioned.
The antigen can be used as it is for immunizing an animal by mixing it with an appropriate adjuvant, but may also be used as an immunogenic conjugate. For example, an antigen used as an immunogen is a fragment of the protein or a synthetic polypeptide fragment obtained by selecting a characteristic sequence region based on the amino acid sequence, designing a polypeptide and chemically synthesizing the polypeptide. You may. In addition, the fragment is bound to various carrier proteins via an appropriate condensing agent to form an immunogenic conjugate such as a hapten-protein, which can be used to react with only a specific sequence (or only a specific sequence). Can be used to design monoclonal antibodies. A cysteine residue or the like can be added to the polypeptide to be designed in advance so that the immunogenic conjugate can be easily prepared. Upon binding to carrier proteins, the carrier proteins can first be activated. For such activation, introduction of an activation bonding group may be mentioned.
Examples of the activated bonding group include (1) an activated ester or an activated carboxyl group such as a nitrophenyl ester group, a pentafluorophenyl ester group, a 1-benzotriazole ester group, an N-succinimide ester group, and the like. A dithio group, for example, a 2-pyridyldithio group and the like can be mentioned. Carrier proteins include keyhole limpet hemocyanin (KLH), bovine serum albumin (BSA), ovalbumin, globulin, polypeptides such as polylysine, and bacterial cell components such as BCG.

2. Immunization of animals with immunogenic antigens Immunization can be performed by methods known to those skilled in the art, for example, Shigeru Muramatsu, et al., Experimental Biology Course 14, Immunobiology, Maruzen Co., Ltd., 1985, Japan Biochemical Society, Ed., Biosediment Chemistry Experiment Course 5, Immunobiochemical Research Method, Tokyo Kagaku Dojin, 1986, The Japanese Biochemical Society, Ed., Neogene Chemistry Experimental Course 12, Molecular Immunology III, Antigen / Antibody / Complement, Tokyo Chemical Dojin , 1992, and the like. The immunizing agent is immunized by injecting the mammal one or more times with an immunizing agent (optionally with an adjuvant). Typically, the immunizing agent and / or adjuvant is injected into a mammal by multiple subcutaneous or intraperitoneal injections. Examples of the immunizing agent include those containing the above antigen peptide or a related peptide fragment thereof. The immunizing agent may be used after forming a conjugate with a protein known to be immunogenic in the mammal to be immunized (for example, the above carrier proteins). Examples of the adjuvant include Freund's complete adjuvant, Ribi adjuvant, pertussis vaccine, BCG, lipid A, liposome, aluminum hydroxide, silica and the like. Immunization is performed using mice such as BALB / c, hamsters, and other suitable animals. The dose of the antigen is, for example, about 1 to about 400 μg / animal for a mouse, which is generally injected intraperitoneally or subcutaneously into a host animal, and thereafter every 1 to 4 weeks, preferably every 1 to 2 weeks. Booster immunization is repeated about 2 to 10 times intraperitoneally, subcutaneously, intravenously or intramuscularly. As a mouse for immunization, an F1 mouse of a BALB / c mouse and another mouse can be used in addition to a BALB / c mouse. If necessary, an antibody titer can be prepared, and the antibody titer can be measured to confirm the degree of animal immunity. The antibody of the present invention may be obtained from the thus obtained immunized animal, and includes, for example, antisera, polyclonal antibodies and the like.

3. Preparation of myeloma cells (myeloma cells) Infinitely proliferative strains (tumor cell lines) used for cell fusion can be selected from cell lines that do not produce immunoglobulin. For example, P3-NS-1-Ag4-1 ( NS-1, Eur.
J. Immunol., 6: 511-519, 1976), SP-2 / 0-Ag14 (SP-2, Nature, 276: 269-270, 1978), P3-X63- derived from mouse myeloma MOPC-21 cell line. Ag8-U1 (P3U1, Curr.topics Microbiol. Immunol., 81: 1-7, 1978), P3-X63-Ag8 (X63, Nature, 256: 495-497, 1975), P3-X63-Ag8-653 ( 653, J. Immunol., 123: 1548-1550, 1979). 8-Azaguanine-resistant mouse myeloma cell line is obtained by adding antibiotics such as penicillin and amikacin, fetal calf serum (FCS), etc. to a cell culture medium such as Dulbecco's MEM medium (DMEM medium) and RPMI-1640 medium. The cells are passaged in a medium supplemented with azaguanine (for example, 5 to 45 μg / ml), and the cells can be passaged in a normal medium 2 to 5 days before cell fusion to prepare a required number of cell lines. The cell strain used was prepared by completely thawing the cryopreserved strain at about 37 ° C, washing it three times or more with a normal medium such as RPMI-1640 medium, and culturing it in a normal medium to prepare the required number of cell lines. There may be.

4. Cell fusion between antibody-producing cells and myeloma cells. An animal, for example, a mouse immunized according to the above step is spleen removed 2 to 5 days after the final immunization to obtain a spleen cell suspension. In addition to spleen cells, lymph node cells from various parts of the body can be obtained and used for cell fusion. The thus obtained spleen cell suspension and 3. The myeloma cell line obtained according to the step is placed in a cell medium such as a minimum essential medium (MEM medium), a DMEM medium, and an RPMI-1640 medium, and a cell fusion agent such as polyethylene glycol is added. As the cell fusion agent, other various agents known in the relevant field can be used, such as inactivated Sendai virus (HVJ: Hemagglutinating Virus of Japan). Preferably, for example, 0.5 to 2 ml of 30 to 60% polyethylene glycol can be added, polyethylene glycol having a molecular weight of 1,000 to 8,000 can be used, and polyethylene glycol having a molecular weight of 1,000 to 4,000 can be more preferably used. It is preferable that the concentration of polyethylene glycol in the fusion medium be, for example, 30 to 60%. If necessary, fusion can be promoted by adding a small amount of, for example, dimethyl sulfoxide. The ratio of spleen cells (lymphocytes) to myeloma cell line used for the fusion may be, for example, 1: 1 to 20: 1, and more preferably 4: 1 to 7: 1.
The fusion reaction is performed for 1 to 10 minutes, and then a cell culture medium such as RPMI-1640 medium is added. The fusion reaction treatment can be performed plural times. After the fusion reaction treatment, the cells are separated by centrifugation or the like, and then transferred to a selection medium.

5. Selection and Monocloning of Hybridoma (Fused Cell) Examples of the selection medium include FCS-containing MEM medium containing hypoxanthine, aminopterin and thymidine, and culture medium such as RPMI-1640 medium, so-called HAT medium. The method of replacing the selective medium is generally such that the same volume as the volume dispensed to the culture plate is added the next day, and then half of the HAT medium is replaced every 1 to 3 days. Changes can be made to this. On the 8th to 16th day after the fusion, the medium can be exchanged every 1 to 4 days with a so-called HT medium excluding aminopterin. As a feeder, for example, mouse thymocytes can be used, which may be preferred.
The culture supernatant of the culture well in which the growth of the hybridoma is extensive can be analyzed using, for example, a measurement system such as radioimmunoassay (RIA), enzyme immunoassay (ELISA), or fluorescence immunoassay (FIA), or a fluorescence-induced cell separation device (FACS). Then, screening is performed by using a predetermined fragment peptide as an antigen, or by measuring a target antibody using a labeled anti-mouse antibody.
The hybridoma producing the desired antibody is cloned. Cloning can be done by picking up colonies in agar medium or by limiting dilution. It can be more preferably performed by a limiting dilution method. Cloning is preferably performed multiple times.

6. Production of Monoclonal Antibody The obtained hybridoma strain is cultured in an appropriate growth medium such as FCS-containing MEM medium or RPMI-1640 medium, and a desired monoclonal antibody can be obtained from the culture supernatant. In order to obtain a large amount of antibodies, ascites of the hybridoma may be mentioned. In this case, each hybridoma is transplanted into the peritoneal cavity of a histocompatible animal that is syngeneic to the myeloma cell-derived animal, and is grown, or, for example, each hybridoma is transplanted and grown in a nude mouse or the like, and grown into the ascites of the animal. The produced monoclonal antibody can be recovered and obtained. Animals can be intraperitoneally administered mineral oil, such as pristane (2,6,10,14-tetramethylpentadecane), prior to hybridoma transplantation, after which the hybridomas are allowed to grow and ascites are collected You can also. Ascites fluid as it is or conventionally known methods such as salting out such as ammonium sulfate precipitation, gel filtration by Sephadex, ion exchange chromatography, electrophoresis, dialysis, ultrafiltration, affinity chromatography And purified by high performance liquid chromatography or the like and used as a monoclonal antibody. Preferably, the ascites fluid containing the monoclonal antibody can be purified and separated by fractionating with ammonium sulfate and then treating it with an anion exchange gel such as DEAE-Sepharose and an affinity column such as a protein A column. Particularly preferably, affinity chromatography in which an antigen or antigen fragment (for example, a synthetic peptide, a recombinant antigen protein or peptide, a site specifically recognized by an antibody, etc.) is immobilized, affinity chromatography in which protein A is immobilized, hydroxy Apatite chromatography and the like.

Also, transgenic mice or other organisms, such as other mammals, can be used to express antibodies, such as humanized antibodies, to the immunogenic polypeptide products of the invention.
Further, it is also possible to determine the sequence of the antibody obtained in such a large amount, or to produce the antibody by a gene recombination technique using a nucleic acid sequence encoding the antibody obtained from the hybridoma strain. The nucleic acid encoding the monoclonal antibody can be isolated and sequenced by a conventional method, for example, using an oligonucleotide probe that can specifically bind to the gene encoding the heavy or light chain of the mouse antibody. . The DNA once isolated can be put into an expression vector as described above and put into a host cell such as CHO or COS. The DNA can be modified, for example, by substituting a sequence encoding the constant region domain of a human heavy or light chain in place of the homogenous mouse sequence (Morrison et al., Proc. Natl. Acad. Sci. USA, 81: 6581, 1984). Thus, chimeric or hybrid antibodies having the desired binding specificity can be prepared. In addition, the antibody can be modified by applying a chemical protein synthesis technique including the use of a condensing agent as described below to prepare a chimeric antibody or a hybrid antibody.
Humanized antibodies can be produced by techniques known in the art (eg, Jones et al., Nature, 321: pp. 522-525 (1986); Riechmann et al., Nature, 332: pp. .323-327 (1988); Verhoeyen et al., Science, 239: pp.1534-1536 (1988)). Human monoclonal antibodies can also be performed by techniques known in the art, and human myeloma cells and human / mouse heteromyeloma cells for producing human monoclonal antibodies are known in the art (Kozbor, J. Immunol., 133, pp. 3001 (1984); Brodeur et al., Monoclonal Antibody Production Techniques and Applications, pp. 51-63, Marcel Dekker, Inc., New York (1987)). Methods for producing bispecific antibodies are also known in the art (Millstein et al., Nature, 305: pp. 537-539 (1983); WO93 / 08829; Traunecker et al., EMBO J., 10: pp. 3655-3659 (1991); Suresh et al., "Methods in Enzymology", Vol. 121, pp. 210 (1986)).

Further, these antibodies may be treated with an enzyme such as trypsin, papain, pepsin and the like, and optionally reduced to obtain antibody fragments such as Fab, Fab 'and F (ab') ₂ , which may be used.
Antibodies can be used in any known assays, such as competitive binding assays, direct and indirect sandwich assays, and immunoprecipitation assays (Zola, Monoclonal Antibodies: A Manual of Techniques, pp. 147-158 (CRC Press, Inc., 1987).
Any method known in the art can be used to conjugate the antibody to each detectable group, for example, David et al., Biochemistry, 13, 1014-1021 (1974); Pain et al, J. Immunol. Meth., 40: pp. 219-231 (1981); and "Methods in Enzymology", Vol. 184, pp. 138-163 (1990). As an antibody to be labeled, an IgG fraction, and a specific binding portion Fab ′ obtained by digestion with pepsin and reduction can be used. Examples of labeled substances in these cases include enzymes (peroxidase, alkaline phosphatase, β-D-galactosidase, etc.), chemical substances, fluorescent substances, radioisotopes, and the like, as described below.

  Detection and measurement in the present invention can be performed by immunostaining, for example, tissue or cell staining, immunoassay, for example, competitive immunoassay or non-competitive immunoassay, radioimmunoassay, ELISA, etc., and BF separation can be performed. The measurement may or may not be performed. Preferred are a radioimmunoassay and an enzyme immunoassay, and further include a sandwich-type assay. For example, in a sandwich-type assay, one is an antibody to the protein of the present invention and its related peptide fragment, the other is an antibody to the N-terminal residue of the protein, and one is detectably labeled. Another antibody that can recognize the same antigen is immobilized on a solid phase. Incubation is performed to react the sample with the labeled antibody and the immobilized antibody sequentially as necessary. After separating the unbound antibody, the labeled substance is measured. The amount of label measured is proportional to the amount of antigen, ie, the polypeptide fragment antigen. This assay is referred to as a simultaneous sandwich assay, a forward sandwich assay, or a reverse sandwich assay, depending on the order of addition of the insolubilized antibody or the labeled antibody. For example, washing, stirring, shaking, filtration, pre-extraction of antigen, etc. are appropriately adopted in these measurement steps under specific circumstances. Other measurement conditions such as the concentration of specific reagents and buffers, temperature, and incubation time can be changed according to factors such as the concentration of the antigen in the sample and the properties of the sample. Those skilled in the art can appropriately select optimal conditions effective for each measurement and perform the measurement using ordinary experimental methods.

Many carriers that can immobilize an antigen or an antibody are known, and in the present invention, they can be appropriately selected and used. As the carrier, various carriers used for an antigen-antibody reaction and the like are known, and in the present invention, of course, any of these known carriers can be used. Particularly preferably used are, for example, glass, for example, activated glass, porous glass, silica gel, silica-alumina, alumina, magnetized iron, magnetized alloys and other inorganic materials, polyethylene, polypropylene, polyvinyl chloride, polyfluoride. Crosslinked albumin such as vinylidene, polyvinyl acetate, polymethacrylate, polystyrene, styrene-butadiene copolymer, polyacrylamide, cross-linked polyacrylamide, styrene-methacrylate copolymer, polyglycidyl methacrylate, acrolein-ethylene glycol dimethacrylate copolymer, etc. Natural or modified cellulose, such as collagen, gelatin, dextran, agarose, cross-linked agarose, cellulose, microcrystalline cellulose, carboxymethyl cellulose, cellulose acetate, etc. Organic polymer substances such as polyamides such as dextran and nylon, polyurethanes and polyepoxy resins, and those obtained by emulsion polymerization of these substances, cells, erythrocytes, etc., and functional groups such as silane coupling agents if necessary. Are introduced.
Furthermore, filter paper, beads, inner walls of test containers, for example, test tubes, titer plates, titer wells, cells made of synthetic materials such as glass cells, synthetic resin cells, glass rods, rods made of synthetic materials, thickening the ends, Alternatively, the surface of a solid substance (object) such as a thinned rod, a rod with a rounded or flat projection at the end, or a thinned rod may be used.

An antibody can be bound to these carriers, and preferably, a monoclonal antibody that specifically reacts with the antigen obtained in the present invention can be bound. The binding between the carrier and those involved in the antigen-antibody reaction is performed by a physical method such as adsorption, a condensing agent, or a chemical method using an activated material, or a mutual method. It can be performed by a method utilizing a chemical binding reaction or the like.
Labels include enzymes, enzyme substrates, enzyme inhibitors, prosthetic molecules, coenzymes, zymogens, apoenzymes, fluorescent substances, dye substances, chemiluminescent compounds, luminescent substances, chromogenic substances, magnetic substances, metal particles, such as gold Radioactive substances such as colloids can be mentioned. Examples of enzymes include dehydrogenases, reductases, oxidoreductases such as oxidases, and transferases that catalyze transfer of amino groups, carboxyl groups, methyl groups, acyl groups, phosphate groups, and the like, such as ester bonds, Examples include a hydrolase that hydrolyzes a glycoside bond, an ether bond, a peptide bond, and the like, a lyase, an isomerase, a ligase, and the like. Enzymes can be used for detection by using a plurality of enzymes in combination. For example, enzymatic cycling can be used.

Representative radioisotope isotopes for labeling include [ ³² P], [ ¹²⁵ I], [ ¹³¹ I],
[ ³ H], [ ¹⁴ C], [ ³⁵ S] and the like.
Representative enzyme labels include peroxidase such as horseradish peroxidase, galactosidase such as Escherichia coli β-D-galactosidase, maleate dehydrogenase, glucose-6-phosphate dehydrogenase, glucose oxidase, glucoamylase, acetylcholinesterase, catalase, and bovine. Alkaline phosphatase such as small intestine alkaline phosphatase and Escherichia coli alkaline phosphatase.
When alkaline phosphatase is used, substrates such as umbelliferone derivatives such as 4-methylumbelliferyl phosphate, phosphorylated phenol derivatives such as nitrophenyl phosphate, enzymatic cycling systems using NADP, luciferin derivatives, and dioxetane derivatives are used. It can be measured by fluorescence, luminescence, and the like generated by use. Luciferin and luciferase systems can also be used. When catalase is used, it reacts with hydrogen peroxide to generate oxygen, and the oxygen can be detected by an electrode or the like. The electrode may be a glass electrode, an ion electrode using a poorly soluble salt film, a liquid film electrode, a polymer film electrode, or the like.
The enzyme label can be replaced with a biotin label and an enzyme-labeled avidin (streptavidin). The sign may use a plurality of different kinds of signs. In such a case, it may be possible to make multiple measurements continuously or discontinuously, and simultaneously or separately.

In the present invention, 4-hydroxyphenylacetic acid, 1,2-phenylenediamine, tetramethylbenzidine and the like for signal formation, horseradish peroxidase, umbelliferyl galactoside, nitrophenyl galactoside and the like and β-D-galactosidase, glucose- A combination of enzyme reagents such as 6-phosphate / dehydrogenase can also be used. What can be formed can be used.
Examples of the fluorescent substance or the chemiluminescent compound include fluorescein isothiocyanate, for example, rhodamine derivatives such as rhodamine B isothiocyanate and tetramethylrhodamine isothiocyanate, dansyl chloride, dansyl fluoride, fluorescamine, phycobiliprotein, acridinium salt, lumiferin, luciferase. Luminol, imidazole, oxalic acid ester, rare earth chelate compound, coumarin derivative and the like.
Labeling can be carried out using a reaction between a thiol group and a maleimide group, a reaction between a pyridyl disulfide group and a thiol group, a reaction between an amino group and an aldehyde group, and the like. The method can be applied by appropriately selecting from the methods that can be used, and the methods that modify them. In addition, a condensing agent that can be used for preparing the immunogenic complex, a condensing agent that can be used for binding to a carrier, and the like can be used.

  Examples of the condensing agent include formaldehyde, glutaraldehyde, hexamethylene diisocyanate, hexamethylene diisothiocyanate, N, N′-polymethylenebisiodoacetamide, N, N′-ethylenebismaleimide, ethylene glycol bissuccinimidyl succinate , Bisdiazobenzidine, 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide, succinimidyl 3- (2-pyridyldithio) propionate (SPDP), N-succinimidyl 4- (N-maleimidomethyl) cyclohexane-1-carboxy Rate (SMCC), N-sulfosuccinimidyl 4- (N-maleimidomethyl) cyclohexane-1-carboxylate, N-succinimidyl (4-iodoacetyl) aminobenzoate, N-succinimidyl 4- (1-maleimidophenyl) Butyrate, N- (ε-maleimidocapro Yloxy) succinimide (EMCS), iminothiolane, S-acetylmercaptosuccinic anhydride, methyl-3- (4'-dithiopyridyl) propionimidate, methyl-4-mercaptobutyrylimidate, methyl-3-mercapto And propionimidate, N-succinimidyl-S-acetylmercaptoacetate.

According to the measurement method of the present invention, a labeled antibody reagent such as a monoclonal antibody in which a substance to be measured is labeled with an enzyme or the like and an antibody bound to a carrier can be sequentially reacted, or can be simultaneously reacted. . The order in which the reagents are added depends on the type of carrier system chosen. When sensitized beads such as plastic are used, a labeled antibody reagent such as a monoclonal antibody labeled with an enzyme or the like is first put together with a specimen sample containing a substance to be measured in an appropriate test tube, and then, The measurement can be performed by adding beads such as sensitized plastic.
In the quantification method of the present invention, an immunological measurement method is used, and in this case, as a solid support, polystyrene, polycarbonate, polypropylene or polyvinyl balls, microplates, and microplates that adsorb proteins such as antibodies well. Various materials and forms, such as, a stick, a fine particle, or a test tube, can be arbitrarily selected and used.
The measurement can be carried out in an appropriate buffer system so as to maintain an optimum pH, for example, a pH of about 4 to about 9. Particularly suitable buffers include, for example, acetate buffers, citrate buffers, phosphate buffers, Tris buffers, triethanolamine buffers, borate buffers, glycine buffers, carbonate buffers, Tris-HCl Buffers and the like can be mentioned. Buffering agents can be used by mixing them at an arbitrary ratio. Preferably, the antigen-antibody reaction is performed at a temperature between about 0 and about 60 ° C.
Incubation of an antibody reagent such as a monoclonal antibody labeled with an enzyme, an antibody reagent bound to a carrier, and a substance to be measured can be performed until equilibrium is reached. At a much earlier point in time, the solid and liquid phases can be separated and the reaction stopped after a limited incubation, reducing the extent of the presence of a label such as an enzyme in either the liquid or solid phase. Can be measured. The measurement operation can be performed using an automated measurement device, and a luminescence detector, a photo detector, or the like is used to detect a display signal generated by the conversion of a substrate by the action of an enzyme and to perform measurement. You can also.

In the antigen-antibody reaction, appropriate measures can be taken to stabilize the reagents to be used, the substance to be measured, the label such as an enzyme, and the antigen-antibody reaction itself. In addition, proteins, stabilizers, surfactants, chelating agents, etc. should be added to the incubation solution to eliminate non-specific reactions and reduce inhibitory effects, or to activate measurement reactions. Can be added. As the chelating agent, ethylenediaminetetraacetic acid salt (EDTA) is more preferable.
It may be subjected to a blocking treatment to prevent a non-specific binding reaction commonly used in the art or known to those skilled in the art. , Collagen, gelatin and the like. These methods can be used without any particular limitation as long as the purpose is to prevent a non-specific binding reaction.
As the sample to be measured by the measurement method of the present invention, any form of solution, colloid solution, non-fluid sample, and the like can be used, but preferably a biological sample, such as thymus, testicle, intestine, kidney, brain, breast cancer , Ovarian cancer, colorectal cancer, blood, serum, plasma, synovial fluid, cerebrospinal fluid, pancreatic juice, bile, saliva, amniotic fluid, urine, other body fluids, cell culture, tissue culture, tissue homogenate, biopsy Samples, tissues, cells and the like can be mentioned.
In applying various analysis and quantification methods including these individual immunological measurement methods to the measurement method of the present invention, no special conditions, operations, and the like need to be set. It is sufficient to construct a measurement system relating to the target substance of the present invention or a substance having an activity substantially equivalent to the target substance of the present invention by adding ordinary technical considerations of those skilled in the art to ordinary conditions and operation methods in each method. .

  For details of these general technical means, it is possible to refer to reviews and compendiums [for example, edited by Hiro Irie, "Radio Immunoassay", Kodansha, published in 1974; edited by Hiro Irie, "Radio Immunoassay" Kodansha, published in 1979; Eiji Ishikawa et al., "Enzyme Immunoassay", Medical Shoin, published in 1978; Eiji Ishikawa et al., "Enzyme Immunoassay" (second edition), Medical Shoin, Showa Published in 1957; Eiji Ishikawa et al., “Enzyme Immunoassay” (3rd edition), Medical Shoin, published in 1987; HV Vunakis et al. (Ed.), “Methods in Enzymology”, Vol. 70 (Immunochemical Techniques, Part A), Academic Press, New York (1980); JJ Langone et al. (Ed.), "Methods in Enzymology", Vol. 73 (Immunochemical Techniques, Part B), Academic Press, New York (1981). ; JJ Langone et al. (Ed.), "Methods in Enzymology", Vol. 74 (Immunochemical Techniques, Part C), Academic Press, New York (1981); JJ La ngone et al. (ed.), "Methods in Enzymology", Vol. 84 (Immunochemical Techniques, Part D: Selected Immunoassays), Academic Press, New York (1982); JJ Langone et al. (ed.), "Methods in Enzymology ", Vol. 92 (Immunochemical Techniques, Part E: Monoclonal Antibodies and General Immunoassay Methods), Academic Press, New York (1983); JJ Langone et al. (ed.)," Methods in Enzymology ", Vol. 121 (Immunochemical Techniques, Part I: Hybridoma Technology and Monoclonal Antibodies), Academic Press, New York (1986); JJ Langone et al. (Ed.), "Methods in Enzymology", Vol. 178 (Antibodies, Antigens, and Molecular Mimicry ), Academic Press, New York (1989); M. Wilchek et al. (Ed.), "Methods in Enzymology", Vol. 184 (Avidin-Biotin Technology), Academic Press, New York (1990); JJ Langone et al. (ed.), "Methods in Enzymology", Vol. 203 (Molecular Design and Modeling: Concepts and Applications, Part B: Anibodies and Antigens, Nucleic Acids, Polysaccharides, and Drugs), Academic Press, New York (199 1) etc. or references cited therein (the descriptions therein are included in the disclosure of the present specification by reference thereto)].

Epitope mapping can also be performed using the anti-p30 antibody of the present invention (anti-human p30 antibody, anti-mouse p30 antibody, etc.), particularly a monoclonal antibody. If an antibody that recognizes each epitope is used, the protein and its related peptide fragments can be used. Can be detected and measured.
Antibodies against the protein and its related peptide fragments detect and / or measure cell adhesion by the protein, binding to activated Rap1, various physiological phenomena resulting therefrom, and phenomena such as control or promotion or suppression of biological activity. In addition, detection and / or measurement of various physiologically active substances or physiological phenomena or biological phenomena caused by excess or decrease of the p30 protein, etc., and research and development of factors and mechanisms controlling the p30-Rap1 interaction Useful for The antibody, particularly a monoclonal antibody, can be used to (i) detect a disorder, abnormality and / or disease associated with a tissue or a cell resulting from the p30-Rap1 interaction, or (ii) detect the p30-Rap1 interaction. Cell transformation, cell migration, invasion, migration and / or metastasis or the possibility thereof, or (iii) in connection with cell adhesion or cell migration involving the p30-Rap1 interaction. Detecting the resulting disorder, abnormality and / or disease or the possibility thereof; (iv) measuring the expression level of the p30 protein; (v) detecting a change in the binding between activated Rap1 and p30 and / or Or (vi) searching for a compound that regulates the p30-Rap1 binding or the like, and / or (vii) detecting and / or measuring the activity of the compound that regulates the p30 protein production. Useful for doing things like Immune response, inflammation, angiogenesis, blood coagulation, wound healing, regenerative processes, canceration, cancer cell invasion, metastasis, autoimmune processes, hematological processes, cellular abnormalities, tissue abnormalities, cancer migration It is expected that it can be used to determine the degree of gender, invasiveness, chemotaxis and / or metastaticity.
According to the present invention, the activity of promoting or suppressing / inhibiting phenomena / actions by various physiological activities or biological activities due to the binding between p30-Rap1 is detected and / or measured, and the agent for preventing / treating tissue diseases, It can be used as an effect determination monitor for inflammatory agents, anticancer agents, cancer metastasis inhibitors, therapeutic agents for arteriosclerosis, therapeutic agents for joint destruction, antiallergic agents and / or immunosuppressants.
Further, the present invention can provide a method for detecting and / or measuring an abnormal phenomenon of a tissue / cell or a protein by the protein and a reagent therefor.

  The compounds found by the screening method of the present invention have effects such as suppression of cell adhesion, suppression of cell migration, suppression of immunity, suppression of cytokine production, suppression of apoptosis occurrence, and suppression of cell proliferation. Therefore, those compounds can be used as anti-inflammatory agents, therapeutic agents for immunological diseases, and cancer metastasis inhibitors. The effects of these compounds can be confirmed by the following methods. They are not intended to limit or limit the scope of the invention disclosed herein.

[1] Acute and chronic gastrointestinal ulcer As an acute model, the effects on Shy ulcer (pylorus-ligated ulcer), water immersion restricted ulcer, indomethacin ulcer, cysteamine duodenal ulcer, and ulcer due to necrotic substances are examined. As a chronic model, the effect on acetic acid ulcer is examined.
(1) Pylorus-ligated ulcer The test of the pylorus-ligated-ulcer can be performed as described on page 249 of Reference 3.
Model preparation: After a rat (140 to 200 g) is fasted for 48 hours or 72 hours (with free drinking), the abdomen is opened under ether anesthesia and the pylorus is ligated. After closing the abdomen, place the animals under fasting water. Administration of test substance: Immediately after pylorus ligation, intraperitoneal or duodenal administration.
Evaluation method: 13 to 17 hours later, the animals are sacrificed under anesthesia, and the stomach is fixed with a 10% neutral buffered formalin aqueous solution. The mucosal surface of the fixed specimen is washed with water, immersed in a 3% acetic acid aqueous solution for 5 minutes, and immersed in 1% alcian blue (dissolved in a 3% acetic acid aqueous solution) for 20 minutes to stain, and then washed with a 3% acetic acid aqueous solution. The area of the dark blue portion stained with Alcian blue is measured using an image analyzer (general image processing “Win ROOF”), and the area is determined as the ulcer area. The ulcer area is compared between the test substance administration group and the non-administration group.

(2) Water immersion-restricted ulcer The test of water immersion-restricted ulcer can be performed as described on page 249 of Reference 3.
Model preparation: Rat limbs are tied to a wire mesh and immersed in cold water (23 ± 0.2 ° C.) for 10-12 hours in a standing position up to the lower border of the sternum.
Administration of test substance: Intraperitoneal or oral administration 10 minutes before restraint in water.
Evaluation method: After completion of restraint by water immersion, the animals are killed under anesthesia, and the evaluation is performed in the same manner as in the above [1] (1).

(3) Indomethacin ulcer A test for indomethacin ulcer can be performed as described on page 250 of Reference 3.
Preparation of Model: Rats (22 to 230 g) are fasted for 24 hours, and then indomethacin (Sigma) 30 mg / kg is administered subcutaneously.
Administration of test substance: Intraperitoneal or oral administration 10 minutes before administration of indomethacin.
Evaluation method: Eight hours after administration of indomethacin, the animal was sacrificed under anesthesia, and the evaluation was performed in the same manner as in the evaluation method of [1] (1).

(4) Cysteamine Duodenal Ulcer A test for cysteamine duodenal ulcer can be performed according to the description on page 250 of Reference 3.
Preparation of model: Rats (Wistar male) are fasted for 24 hours and then subcutaneously administered with 300 to 400 mg / kg of Cysteamine.
Administration of test substance: Intraperitoneal or oral administration 10 minutes before administration of indomethacin.
Evaluation method: Eighteen hours after administration of cysteamine, the animal was killed under anesthesia, and the evaluation was performed in the same manner as in the evaluation method of [1] (1).

(5) Ulcer due to necrotic substance The test for ulcer due to necrotic substance can be performed according to the method described on page 251 of Reference 3.
Model preparation: Rats are fasted for 24 hours and water-free, and orally administered with pure ethanol, 0.6N HCl, 25% NaCl, 80 mM acidic taurocholate or high-temperature water.
Administration of test substance: Intraperitoneal or oral administration 30 minutes before administration of necrotic substance.
Evaluation method: Immediately after administration of the necrotic substance, the animal is killed under anesthesia, and the evaluation is performed in the same manner as in the evaluation method of [1] (1).

(6) Acetic acid ulcer The test for acetic acid ulcer can be performed according to the method described in Reference Model 3, page 251.
Animal model: Rats are laparotomized under ether anesthesia, and 0.04-0.06 ml of a 20% acetic acid solution is injected into the submucosa at the border of the forestomach and glandular stomach.
Administration of test substance: Repeat oral administration for 14 days from the day after acetic acid injection.
Evaluation method: One day after the last administration of the test substance, the animal is killed under anesthesia, and the evaluation is performed in the same manner as in the evaluation method of [1] (1).

[2] Ulcerative Colitis A test for ulcerative colitis can be performed according to the method described in Reference 5.
Preparation of Model: Rats are allowed to freely drink a 3% DSS (dextran sulfate sodium) aqueous solution for 11 days, and then to a 1% DSS aqueous solution for 14 days.
Administration of test substance: Repeat oral administration once a day for 14 days during the administration period of 1% DSS aqueous solution.
Method of evaluation: 13 to 17 hours later, the animals were sacrificed under anesthesia, and the isolated large intestine was fixed with a 10% neutral buffered formalin aqueous solution. The mucosal surface of the fixed specimen is washed with water, immersed in a 3% acetic acid aqueous solution for 5 minutes, and immersed in 1% alcian blue (dissolved in a 3% acetic acid aqueous solution) for 20 minutes to stain, and then washed with a 3% acetic acid aqueous solution. The area of the dark blue portion stained with Alcian blue is measured using an image analyzer (general-purpose image processing “Win ROOF”), and the erosion area is determined. The erosion area is compared between the test substance administration group and the non-administration group.

[3] Crohn's disease The test for Crohn's disease can be performed according to the method described in Reference 6.
Preparation of model: Rats are injected with TNBS (160 mg / kg in 50% ethanol) from the terminal ileum to produce small enteritis.
Administration of test substance: Repeat oral administration once a day for 7 days after the production of enteritis.
Evaluation method: Seven days after the preparation of small intestine, the rats were sacrificed under anesthesia, and pathological anatomical examination (visual observation) was performed. In addition, after formalin fixation, an HE-stained tissue specimen is prepared (Reference Document 44, page 10), and histopathological examination (microscopic observation) is performed. For each lesion recognized by both tests, no classification: 0, minor: 0.5, mild: 1.0, moderate: 2.0, and altitude: 3.0 Are tabulated and compared between the test substance administration group and the non-administration group.

[4] Chronic obstructive pulmonary disease (COPD)
Testing for chronic obstructive pulmonary disease (COPD) can be performed according to the method described in reference 7.
Preparation of model: Guinea pigs are exposed to commercial cigarette mainstream smoke for 30 minutes / day, 5 days / week for 4 weeks using a cigarette mainstream smoke generator (INH06-CIGR01 Co., Ltd. MIPS).
Test substance administration: Repeat oral administration once a day during the 4-week cigarette smoke exposure period.
Method of evaluation: After the administration period, the animals are sacrificed under anesthesia, and the lungs are subjected to histopathological examination (visual observation). In addition, after formalin fixation, an HE-stained tissue specimen is prepared (Ref. 19, page 10) and histopathological examination (microscopic observation) is performed. For each lesion recognized by both tests, no classification: 0, minor: 0.5, mild: 1.0, moderate: 2.0, and altitude: 3.0 Are tabulated and compared between the test substance administration group and the non-administration group.

[5] Cancer metastasis (Reference document 13)
A test for cancer metastasis can be performed as described in Reference 13.
Preparation of model: 5 × 10 ⁴ cells / 0.2 ml of a suspension of cultured B16 mouse melanoma cells were administered to the tail vein of a mouse (C57BL / 6N, ♀).
Administration of test substance: Repeated oral or intraperitoneal administration from the day of B16 cell administration to 21 days later.
Evaluation method: 21 days after B16 cell administration, the mice were killed under anesthesia, and the removed lungs were fixed with a 10% neutral buffered formalin aqueous solution. The fixed specimen is sliced, and the number of metastatic foci of B16 cells is visually counted. The number of metastatic foci is compared between the test substance administration group and the non-administration group.

[6] Atopic dermatitis A test for atopic dermatitis can be performed according to the description in Reference 14.
Preparation of model: Active sensitization of mice (BALB / C) by intraperitoneal administration of DNP-OVA + Alum (Dinitrophenol-Ovalbumin + Aluminum hydroxide gel). 14 days after sensitization, DNFB (Dinitrofluorobenzene) is applied to the auricle to elicit.
Administration of test substance: Repeated oral or intraperitoneal administration for three periods from sensitization to challenge, from challenge to test or from sensitization to test.
Evaluation method: The thickness of the pinna is measured 1 hour, 24 hours and 8 days after the induction. The pinna thickness is compared between the test substance administration group and the non-administration group.

[7] Allergic rhinitis The test for allergic rhinitis can be performed according to the description in Reference 2, page 225.
Guinea pigs are sensitized by intramuscular injection of 0.7 ml of 5% ovalbumin. Fourteen days after the sensitization, the trachea is incised under anesthesia, and air heated to 37 to 40 ° C. at a flow rate of 500 ml / min is discharged from the nasal trachea to the nasal cavity with a compressed air cylinder, and the intranasal pressure is measured. After allowing 0.3 ml of the test substance to flow into the nasal cavity, 0.3 ml of 1% ovalbumin is allowed to flow into the nasal cavity from the trachea to elicit. The changing intranasal pressure is measured with a pressure transducer and compared between the test substance administration group and the non-administration group.

[8] Asthma Asthma test can be performed as described in Reference 16.
Preparation of model: Guinea pigs (Hartley strain) are sensitized by intraperitoneal administration of 0.5 ml OVA + Alum (10 μg OVA + 10 mgAlum) on Day 1 and Day 14.
Administration of test substance: The test substance is orally administered 14 days after the last sensitization.
Evaluation method: test substance administration 30 minutes later, 10 mg / kg pyrilamine (the histamine H ₁ antagonist) is administered intraperitoneally. Thirty minutes later, a 10 mg / ml OVA PBS (-) solution is inhaled for 10 minutes to elicit. Four hours after OVA induction, 400 μg / ml of methacholine was inhaled for 1 minute, and then Penh was measured as an airway resistance parameter using an unrestrained respiratory function analysis system, and the test substance administration group and the non-administration group were compared.

[9] Post-Transplant Rejection (1) Ectopic Heart Transplant The test for ectopic heart transplant can be performed according to the method described on page 44 of Reference 17.
Model creation: Donor rats were opened with anesthesia under ether anesthesia, the inferior vena cava was ligated, the aorta and pulmonary artery were isolated, lactated Ringer's (heparinized, 4 ° C, 5 ml) was injected from the aorta, and drained from the pulmonary artery to perfuse The superior vena cava and pulmonary vein are ligated together and the heart is removed and stored in lactated Ringer's. Under ether anesthesia, incision is made in the right cervical skin to be transplanted in the recipient rat, the right external jugular vein is cut off, and the cuff is cut into the stump (vascular anastomosis tube, body 1.8 mm, support 1.2 mm, O / D 1.34 mm ), The right common carotid artery is dissected, and a cuff (1.8 mm body, 1.2 mm support, O / D 0.99 mm) is attached to the stump. The cuff attached to the recipient's common carotid artery is inserted and ligated into the aorta of the donor heart, and the recipient's external jugular vein and the donor's pulmonary artery are similarly anastomosed. After pulsation stabilization, the skin is sutured so as to wrap the transplanted heart and awaken.
Administration of test substance: Administered orally, intraperitoneally or intravenously once a day from the model preparation to the end of the test.
Evaluation method: Palpation of the subcutaneously transplanted heart and comparison of the survival rate between the test substance administration group and the non-administration group.

[10] Rheumatoid arthritis The test for rheumatoid arthritis can be performed according to the method described in Reference 18.
Model preparation: Mouse (DBA / 1JNCrj) homogenous emulsion (collagen 1.5 mg / ml) of collagen (Type II collagen K-41, containing bovine joint-derived collagen 3 mg / ml) and equivalent amount of FCA (Freund Complete Adjuvant) ) Is intradermally administered to the tail of the mouse at 0.1 ml.
Administration of test substance: Repeat oral administration once a day from 1 week to 9 weeks after model preparation.
Evaluation method: Arthritis score 回 once a week for all finger joints of the limbs, based on the arthritis score (13, no change, mild swelling of one or more fingers 14, medium one or more fingers, etc.) The degree of swelling is 15, and the intensity of swelling or joint deformation (including tonicity) over the entire paw is scored according to 16), and the scores are totaled to obtain the arthritis score of each animal. The number of onset days is defined as the number of days when the score of the arthritis score observation day first becomes 1 or more. The arthritis score and the number of days of onset are compared between the test substance administration group and the non-administration group.
[11] Other target diseases and effect test methods Table 1 shows an effect test for target diseases other than the above.

(References)
1: "Biopharmaceutical Science Laboratory" (Inflammation and Allergy, Volumes I-III), Hirokawa Shoten Co., Ltd.
2: "(Disease-specific) animal models and test / experimental methods for new drug development", Technical Information Association of Japan
3: "Utilization of animal models for new drug development", R & D planning
4: "Models of intractable diseases and animal experiments" (for common understanding with human diseases), Higashihisa Kyogoku, Soft Science
5: Kimura I, Kawasaki M, Nagahama S, Matsuda A, Kataoka M and Kokuba Y., `` Determination of the acute moiety of BX661A, a new therapeutic agent for ulcerative colitis, by studying its therapeutic effect on ulcerative colitis induced by dextran sulfate sodium in rats ". Arzneim.-Forsch./Drug Res 1998 48 (11) 11, 1091-1096.
6: Tsujikawa T, Ohta N, Nakamura T, Satoh J, Uda K, Ihara T, Okamoto T, Araki Y, Andoh A, Sasaki M, Fujiyama Y, Bamba T., "Medium-chain triglycerides modulate ileitis induced by trinitrobenzene sulfonic acid. acid ". J Gastroenterol Hepatol. 1999 Dec; 14 (12): 1166-72.
7: Wright JL and Chung A., "A model of tobacco smoke-induced airway obstruction in the guinea pig". Chest 2002 121 5 188s-191s.
8: Tamura A, Graham DI, McCulloch J, Teasdale GM., "Focal cerebral ischaemia in the rat: 1. Description of technique and early neuropathological consequences following middle cerebral artery occlusion". J Cereb Blood Flow Metab. 1981; 1 (1 ): 53-60.
9: Okamoto I, Abe M, Shibata K, Shimizu N, Sakata N, Katsuragi T, Tanaka K., "Evaluating the role of inducible nitric oxide synthase using a novel and selective inducible nitric oxide synthase inhibitor in septic lung injury produced by cecal ligation and puncture ". Am J Respir Crit Care Med. 2000 Aug; 162 (2 Pt 1): 716-22.
10: van Helden HP, Kuijpers WC, Langerwerf PE, LangenRC, Haagsman HP, Bruijnzeel PL., "Efficacy of Curosurf in a rat model of acute respiratory distress syndrome". Eur Respir J. 1998 Sep; 12 (3): 533 -9.
11: Gardinali M, Borrelli E, Chiara O, Lundberg C, Padalino P, Conciato L, Cafaro C, Lazzi S, Luzi P, Giomarelli PP, Agostoni A., "Inhibition of CD11-CD18 complex prevents acute lung injury and reduces mortality after peritonitis in rabbits ". Am J Respir Crit Care Med. 2000 Mar; 161 (3 Pt 1): 1022-9.
12: Gloor B, Uhl W, Tcholakov O, Roggo A, Muller CA, Worni M, Buchler MW., "Hydrocortisone treatment of early SIRS in acute experimental pancreatitis". Dig Dis Sci. 2001 Oct; 46 (10): 2154- 61.
13: Chirivi RG, Garofalo A, Crimmin MJ, Bawden LJ, Stoppacciaro A, Brown PD, Giavazzi R., "Inhibition of the metastatic spread and growth of B16-BL6 murine melanoma by a synthetic matrix metalloproteinase inhibitor". Int J Cancer. 1994 Aug 1; 58 (3): 460-4.
14: Satoh T, Tahara E, Yamada T, Watanabe C, Itoh T, Terasawa K, Nagai H, Saiki I., "Differential effect of antiallergic drugs on IgE-mediated cutaneous reaction in passively sensitized mice". Pharmacology. 2000 Feb; 60 (2): 97-104.
15: Magone MT, Chan CC, Rizzo LV, Kozhich AT, Whitcup SM., "A novel murine model of allergic conjunctivitis". Clin Immunol Immunopathol. 1998 Apr; 87 (1): 75-84.
16: Andersson P, Bergstrand H., "Antigen-induced bronchial anaphylaxis in actively sensitized guinea-pigs: effect of long-term treatment with sodium cromoglycate and aminophylline". Br J Pharmacol. 1981 Nov; 74 (3): 601-9 .
17: Illustrated and Experimental Animal Techniques Collection II Edited by Japan Institute of Experimental Animal Engineers, ADSREE Inc., first edition issued on June 10, 1998
18: Kato F, Nomura M, Nakamura K., "Arthritis in mice induced by a single immunization with collagen". Ann Rheum Dis. 1996 Aug; 55 (8): 535-9.
19: "All about dyeing method", monthly Medical Technology edition, Medical and Dental Medicine Publishing Co., Ltd., 1st edition, 1st edition issued on March 15, 1980

The active ingredient of the present invention (for example, (a) the p30-related polypeptide, a partial peptide or a salt thereof, a mutant p30 peptide or a peptide related thereto, (b) the p30 or Rap1 protein or the polypeptide, (C) the antibody of the present invention, a partial fragment thereof (including a monoclonal antibody) or a derivative thereof, (d) an interaction between the p30 and Rap1, such as binding, etc. (A compound that promotes, suppresses, and / or inhibits such a phenomenon as promoting, suppressing, or inhibiting the binding, or a biological activity such as denaturation, overproduction, or degradation of a tissue or protein) or the compound thereof A salt, a compound controlling the production of the p30 protein or a salt thereof, and (e) an antisense oligonucleotide for a nucleic acid such as DNA, which is a subject of the present invention. (F) an active substance or the like found using the present invention) as a medicine, for example, the binding inhibitor between p30 and Rap1 or a salt thereof is usually used alone or pharmacologically. Can be administered as a pharmaceutical composition or a pharmaceutical preparation by mixing with various formulation auxiliaries that are acceptable for use. Preferably, it is administered in the form of a pharmaceutical preparation suitable for use such as oral administration, topical administration, or parenteral administration, and depending on the purpose, any administration form (including inhalation or rectal administration) is used. Good.
In addition, the active ingredient of the present invention may be used in combination with various medicines, for example, an antitumor agent (anticancer agent), a tumor transfer inhibitor, a thrombus formation inhibitor, a therapeutic agent for joint destruction, an analgesic, an anti-inflammatory agent and / or an immunosuppressant. They can be used in combination, and they can be used without limitation as long as they have an advantageous function. For example, they can be selected from those known in the art.

Parenteral dosage forms can include topical, transdermal, intravenous, intramuscular, subcutaneous, intradermal, or intraperitoneal administration, but can also be administered directly to the affected area, and in some cases, Is also preferred. Preferably, it is orally or parenterally to mammals including humans (eg, intracellular, intracellular, intravenous, intramuscular, subcutaneous, intradermal, intraperitoneal, intrathoracic, intrathecal, infusion, infusion, Administration to the intestine, the rectum, ear drops, eye drops and nose drops, teeth, skin and mucous membranes, etc.). Specific forms of preparations include solution preparations, dispersion preparations, semi-solid preparations, granular preparations, molded preparations, leaching preparations, and the like.Examples include tablets, coated tablets, sugar-coated preparations, and pills. Agents, troches, hard capsules, soft capsules, microcapsules, implants, powders, powders, granules, fine granules, injections, liquids, elixirs, emulsions, irrigants, syrups, Solutions, emulsions, suspensions, liniments, lotions, aerosols, sprays, inhalants, sprays, ointments, plasters, patches, pasta, cataplasms, creams, oils, suppositories ( For example, rectal suppositories), tinctures, skin solutions, eye drops, nasal drops, ear drops, coatings, infusions, powders for injections, lyophilized preparations, gel preparations, etc. No.
Pharmaceutical compositions can be formulated according to the usual methods. For example, if necessary, a physiologically acceptable carrier, a pharmaceutically acceptable carrier, an adjuvant, an excipient, a excipient, a diluent, a flavor, a flavor, a sweetener, a vehicle, a preservative, and a stable Agents, binders, pH adjusters, buffers, surfactants, bases, solvents, fillers, extenders, solubilizers, solubilizers, tonicity agents, emulsifiers, suspending agents, dispersants , Thickeners, gelling agents, curing agents, absorbents, adhesives, elasticizers, plasticizers, disintegrants, propellants, preservatives, antioxidants, sunscreens, humectants, emollients, antistatic agents, By using a soothing agent or the like alone or in combination with the protein of the present invention and the like, it can be produced in a unit dose form required for generally accepted formulation.
Formulations suitable for parenteral use include sterile solutions or suspensions of the active ingredients with water or other pharmaceutically acceptable vehicles, such as injections. In general, water, saline, aqueous dextrose, other related sugar solutions, and glycols such as ethanol, propylene glycol, and polyethylene glycol are preferred liquid carriers for injections. When preparing an injection, distilled water, Ringer's solution, a carrier such as physiological saline, a suitable dispersant or wetting agent and a suspending agent, by a method known in the art using a solution, , Suspensions and emulsions.

Aqueous liquids for injection include, for example, physiological saline, isotonic solutions containing glucose and other adjuvants (eg, D-sorbitol, D-mannitol, sodium chloride, etc.), and are pharmacologically acceptable It may be used in combination with a suitable solubilizing agent such as an alcohol (eg, ethanol), a polyalcohol (eg, propylene glycol, polyethylene glycol, etc.), a nonionic surfactant (eg, Polysorbate 80 ^™ , HCO-50, etc.). . The oily liquid includes sesame oil, soybean oil and the like, and may be used in combination with solubilizers such as benzyl benzoate and benzyl alcohol. Also, buffers (eg, phosphate buffer, sodium acetate buffer, etc.) or reagents for adjusting osmotic pressure, soothing agents (eg, benzalkonium chloride, procaine hydrochloride, etc.), stabilizers (eg, human Serum albumin, polyethylene glycol, etc.), preservatives (eg, benzyl alcohol, phenol, etc.), antioxidants such as ascorbic acid, absorption promoters and the like may be blended. The prepared injection solution is usually filled in a suitable ampoule.

For parenteral administration, solutions in sterile pharmaceutically acceptable liquids, such as water, ethanol or oils, with or without surfactants and other pharmaceutically acceptable auxiliaries, or Formulated in the form of a suspension. Examples of the oily vehicle or solvent used in the preparation include natural or synthetic or semi-synthetic mono- or di- or triglycerides, natural, semi-synthetic or synthetic oils or fatty acids, such as peanut oil, corn oil, and oil. Vegetable oils such as bean oil and sesame oil are included. For example, this injection can be usually prepared so as to contain about 0.1 to 10% by weight of the compound of the present invention.
Formulations suitable for topical, eg oral, or rectal use include, for example, mouthwashes, dentifrices, mouth sprays, inhalants, ointments, dental fillers, dental coatings, dental pastes, suppositories, etc. Is mentioned. Mouthwashes and other dental agents are prepared by a conventional method using a pharmacologically acceptable carrier. The oral spray or inhalant can be dissolved in a solution for aerosol or nebulizer together with the compound of the present invention itself or a pharmacologically acceptable inert carrier, or can be administered to teeth or the like as a fine powder for inhalation. The ointment is prepared by a conventional method by adding a commonly used base, for example, an ointment base (white petrolatum, paraffin, olive oil, macrogol 400, macrogol ointment, etc.).

Drugs for topical application to teeth and skin can be formulated as solutions or suspensions in suitably sterilized aqueous or non-aqueous vehicles. Additives include, for example, buffers such as sodium bisulfite or disodium edetate; preservatives including bactericidal and antifungal agents such as phenylmercuric acetate or nitrate, benzalkonium chloride or chlorohexidine, and hypromelrose. And thickeners.
Suppositories are carriers well known in the art, preferably non-irritating suitable excipients, such as polyethylene glycols, lanolin, cocoa butter, fatty acid triglycerides, etc., which are preferably solid at room temperature but intestinal It is prepared by a conventional method using a liquid which melts in the rectum and releases the drug, and is usually prepared so as to contain about 0.1 to 95% by weight of the compound of the present invention. The drug, depending on the excipient and concentration used, can either be suspended or dissolved in the excipient. Adjuvants such as local anaesthetics, preservatives and buffering agents can be dissolved in the vehicle. Formulations suitable for oral use include, for example, solid compositions such as tablets, pills, capsules, powders, granules and troches, and liquid compositions such as solutions, syrups and suspensions. No. When preparing a formulation, a formulation auxiliary or the like known in the art is used. Tablets and pills can also be prepared with enteric coating. When the preparation unit form is a capsule, a liquid carrier such as oil and fat can be further contained in the above-mentioned type of material.

Also, when the active ingredient is a protein or polypeptide, it is particularly useful to bind polyethylene glycol (PEG), since polyethylene glycol (PEG) has extremely low toxicity in mammals. In some cases, the conjugation of PEG can effectively reduce the immunogenicity and antigenicity of the heterologous compound. The compound may be provided in a microcapsule device. Polymers such as PEG have amino-terminal amino acid α-amino groups, lysine side chain ε-amino groups, aspartic acid or glutamic acid side chain carboxyl groups, carboxy terminal amino acid α-carboxyl groups, or certain types of amino acids. It can be conveniently attached to an activated derivative of a glycosyl chain attached to an asparagine, serine or threonine residue.
Many activated forms of PEG suitable for direct reaction with proteins are known. PEG reagents useful for reacting with amino groups of proteins include carboxylic acids, active esters of carbonate derivatives, especially those in which the leaving group is N-hydroxysuccinimide, p-nitrophenol, imidazole, or 1-hydroxy-2- Those which are nitrobenzene-4-sulfonates are mentioned. Similarly, PEG reagents containing aminohydrazine or hydrazide groups are useful for reaction with aldehydes generated by periodate oxidation in proteins.

Further, when a nucleic acid such as the DNA of the present invention is used as a therapeutic and / or prophylactic agent as described above, the nucleic acid may be used alone or may be used in a genetic recombination technique as described above. It can be used by binding to an appropriate vector, for example, a virus-derived vector such as a retrovirus-derived vector. The nucleic acid such as the DNA of the present invention can be administered by a commonly known method, and can be used as it is or together with a suitable auxiliary agent or a physiologically acceptable carrier so as to promote the uptake into cells. And can be used as a pharmaceutical composition or a pharmaceutical preparation as described above. Also, a method known as gene therapy can be applied.
The dose of the active ingredient of the present invention can be selected over a wide range, and the dose and the number of doses are determined by the sex, age, body weight, general health condition, diet, administration time, and administration method of the treated patient. It depends on the rate of excretion, the combination of drugs, the degree of the condition of the patient being treated at that time, and considering these and other factors.

In the manufacture of pharmaceuticals, their additives and preparation methods are described, for example, in the Japanese Pharmacopoeia Commentary Editing Committee, 14th Revised Japanese Pharmacopoeia Commentary, issued June 27, 2001, Hirokawa Shoten Co., Ltd .; Takashi Ichigase Other editions Development of Pharmaceuticals, Volume 12, Pharmaceutical Ingredient [I], published on October 15, 1990, Hirokawa Shoten Co., Ltd .; Development of Pharmaceuticals, Volume 12, Pharmaceutical Materials [II] It can be appropriately selected and applied as needed from the descriptions of Hirokawa Shoten Co., Ltd. issued on October 28, 2010, as necessary.
The active ingredient of the present invention is not limited as long as it has a biological activity of controlling (promoting, suppressing, or inhibiting) the interaction activity (eg, biological activity such as binding activity) between p30 and Rap1. Although not particularly limited, those having advantageous effects are preferably mentioned. The active ingredient of the present invention includes, for example, (a) the modified p30 protein, a mutant polypeptide thereof, a partial peptide thereof or a salt thereof, and (b) a DNA encoding the protein, a protein mutant poly (C) the antibody of the present invention, a partial fragment thereof (including a monoclonal antibody) or a derivative thereof, and (d) a living body resulting from the interaction between the p30 and Rap1. A compound having a beneficial effect on a biological activity such as controlling (promoting, suppressing or inhibiting) an interaction with a component or a salt thereof is included.

The active ingredient of the present invention is expected to be useful for controlling (promoting, suppressing or inhibiting) changes in various tissues or cells caused by the interaction between p30 and Rap1. In addition, the active ingredient is useful for controlling the expression of the p30 or activated Rap1 activity, and further controlling (promoting or suppressing / inhibiting) p30-Rap1 binding. It is useful for preventing or treating diseases. Further, it is expected to be useful for, for example, controlling, for example, suppressing, migration, invasion, migration and / or metastasis of tumor cells or the like in which the p30-Rap1 binding is involved.
The active ingredient of the present invention, for example, a p30-Rap1 binding inhibitor is useful as an agent for treating inflammatory diseases, autoimmune diseases, suppression of rejection during organ transplantation, cancer, etc., for example, gastric ulcer, duodenal ulcer , Acute pancreatitis, bronchitis, ARDS (acute respiratory distress syndrome), COPD (chronic obstructive pulmonary disease), septic shock, MOF (multi-organ failure), SIRS (systemic inflammatory response syndrome), systemic lupus erythematosus, mixed type Connective tissue disease, rheumatoid arthritis, Sjogren's syndrome, rheumatic fever, Goodpasture's syndrome, Basedow's disease, Hashimoto's disease, Addison's disease, autoimmune hemolytic anemia, idiopathic thrombocytopenic purpura, myasthenia gravis, ulcerative colon To treat inflammation, Crohn's disease, exchangeable ophthalmitis, multiple sclerosis, psoriasis, allergic rhinitis, asthma, etc., to prevent rejection during organ transplantation For given the news is expected to be used for such inhibiting carcinogenesis, metastasis suppression.

  The dose of the compound of the present invention or a salt thereof (for example, the compound of the formula (I)) that promotes or inhibits the interaction and / or binding between Rap1 and p30 differs depending on the target disease, the administration target, the administration route and the like. However, when administered orally, it is administered in an amount of 10 μg to 10 g / kg, preferably 100 μg to 1 g / kg, more preferably 1 mg to 100 mg / kg. In the case of intravenous drip infusion, the dose is 0.01 μg to 1 g / kg / hr × 6 hr, preferably 0.1 μg to 100 mg / kg / hr × 6 hr, more preferably 1 μg to 10 mg / kg / hr × 6 hr. In the case of a single intravenous injection, the dose is 1 μg to 1 g / kg, preferably 10 μg to 100 mg / kg, more preferably 100 μg to 10 mg / kg. When administered intraperitoneally, the dose is 1 μg to 10 g / kg, preferably 10 μg to 1 g / kg, more preferably 100 μg to 100 mg / kg.

Hereinafter, the present invention will be described in detail with reference to Examples. However, these Examples are merely provided for describing the present invention and for referencing specific embodiments thereof. These exemplifications are intended to illustrate certain specific embodiments of the present invention, but are not intended to limit or limit the scope of the invention disclosed herein. It is to be understood that the invention is capable of various embodiments based on the teachings herein.
The methods necessary for general gene recombination such as DNA cutting, ligation, transformation of E. coli, gene base sequence determination, and hybridization are attached to commercially available reagents and machinery used for each operation. The instructions and experimental manuals (eg, "Molecular cloning (Maniatis T. et al., Cold Spring Harbor Laboratory Press)") were basically followed. All examples, unless otherwise described in detail, are performed or can be performed using standard techniques, which are well known and routine to those skilled in the art. .

(Isolation of Rap1-associated molecule p30)
To identify molecules associated with Rap1, a human leukocyte cDNA library was screened by the yeast Two-hybrid method using the activated Rap1 mutant Rap1V12 as a bait. As a result, a molecule encoding a protein having a molecular weight of 30,000 having a Ras / Rap binding domain (RBD) was isolated and named p30 (FIG. 1). A search of the database revealed that p30 contained Nore1 and the RBD domain, and the amino acids were identical up to the C-terminal (FIG. 1). Analysis of the human genome database indicated that p30 is an alternative splicing product of Nore1. Mouse p30 cDNA was also isolated by RT-PCR.
We examined whether p30 binds to Rap1. Therefore, a protein (GST-Rap1) in which the N-terminal side of Rap1 was fused with GSH (glutathione-S-transferase) was produced in Escherichia coli, and purified using a glutathione binding column. Further, a Myc-p30 gene having a Myc epitope added to the N-terminal side of p30 cDNA was transfected into COS cells to prepare a lysate expressing p30 in a large amount. Since Rap1 becomes activated when bound to GTP and becomes inactivated when bound to GDP, GST-Rap1 is bound to GTPgS and GDPbS, respectively, and an activated and inactivated form is prepared, and Myc-p30 is prepared. COS cell lysate. After inverting and mixing at 4 ° C. for 2 hours, glutathione-bound beads were added to collect GST-Rap1. Detection of myc-p30 bound to Rap1 was performed by ECL chemiluminescence using an anti-Myc mouse IgG2a antibody (Cell Signaling) as the primary antibody and HRP-labeled anti-mouse IgG (Sigma) as the secondary antibody. A film (Amersham) was exposed to light and detected (FIG. 2). As a result, it was revealed that p30 specifically binds to activated Rap1. From the property of binding to activated Rap1, p30 was considered to be a molecule that functions with activation of Rap1.

(Tissue expression distribution of p30 by RT-PCR method)
In order to check the expression of p30 in each tissue, the expression of p30 mRNA was examined by RT-PCR. The expression of the analogous molecule Nore1 was also compared. RNA was extracted from brain, heart, lung, liver, kidney, and spleen, and after synthesizing cDNA, p30 (P) and Nore1 (N) cDNA were detected by PCR (FIG. 3A). Glucose triphosphate dehydrogenase (G3PDH) was used as a control for mRNA amount. As a result, p30 was strongly expressed in spleen and lung. In contrast, Nore1 was mainly expressed in the brain. Further, the expression in various blood, immune cell lines, etc. was examined by the same method. ), But not in melanoma cells (B16). In contrast, Nore1 was not expressed in these cells, and expression was confirmed in melanoma cells (B16). Undifferentiated myeloid cells HL60 differentiate into neutrophils by retinoic acid treatment, but RT-PCR confirmed that expression of p30 mRNA was enhanced (HL60RA).

(Preparation of monoclonal antibody against p30)
A monoclonal antibody was prepared to examine the expression of the p30 protein.
The mouse p30 cDNA was subcloned into a pGEX vector (Amersham Pharmacia), Escherichia coli (BL21) was introduced, and GST-mp30 in which GST was fused to the N-terminal side of mp30 was produced. The introduced BL21 was grown in 400 ml of LB medium at 30 ° C., and when it reached an OD _{600 of} 0.5, IPTG (0.2 mM, Amersham Pharmacia) was added, and the cells were further cultured for 4 hours. BL21 is precipitated at 6,000 rpm, washed once with PBS, suspended in 5 ml of PBS, and then crushed with an ultrasonic crusher (Tomy Seiko, UD-200) at an output of 6, 15 times four times. After centrifugation at 9000 rpm, the supernatant was bound to a glutathione column (Amersham Pharmacia), washed with 100 ml of PBS, eluted with glutathione (5 mM), and dialyzed against PBS to obtain a purified antigen.
Purified GST-humanp30 and complete adjuvant (Difco) were mixed, and 0.2 mg / 0.1 ml was injected into the plantar skin of a rat (WKY / NCrj, female, 8 weeks old, Oriental Bioservice). One week later, GST-mp30 (0.1 mg / 0.1 ml) mixed with incomplete adjuvant (Difco) was injected into the plantar again. Five days later, iliac lymph nodes were collected, cell fusion was performed using myeloma cell line Sp2 / 0 and polyethylene glycol, and hybridomas were cultured in HAT medium (GibcoBRL). , Interdisciplinary planning, 1995). Twelve days later, the culture supernatant was collected, and the antibody against p30 was measured by ELISA.

  As an antigen used for ELISA, MBP-hp30 fused with MBP (maltose-binding protein) produced and purified in Escherichia coli was used. For MBP-hp30, human p30 cDNA was subcloned into a pMAL vector (New England Biolabs) to produce a fusion protein with a maltose binding protein (pML Protein Fusion and Purificiation System, New England Biolabs). MBP-hp30 (0.2 mg / 0.2 ml / well) was immobilized on a 96-well plate, and the antibody in the culture supernatant was detected by a sandwich method (monoclonal antibody production manual, written by Nobuhiko Tada, interdisciplinary planning, 1995) ). The positive supernatant was assayed by Western blotting using COS cells transfected with human p30 cDNA and immunostaining. Six hybridomas that tested positive in these assays were limiting diluted and cloned. For epitope mapping, COS deletion of N-terminal deletion of p30 (including after RBD domain), deletion of C-terminal (including N-terminal and RBD domain), deletion of RBD domain (including only N-terminal and C-terminal) When expressed in cells and assayed by the Western method, four of them recognized the N-terminus (B1.2, E3.7, E11.2, G7.3) and two recognized the C-terminus (B4 .1, H10.5). Although the antibody recognizing the C-terminus also reacted with Nore1, all four antibodies recognizing the N-terminus did not react with Nore1, indicating that the antibody was a p30-specific antibody. FIG. 3B shows the results of Western blotting of blood, immune system cell lines, and T lymphocytes and B lymphocytes purified from lymph nodes using an anti-p30 specific antibody E11.2 (FIG. 3B). HL60 treated cells with retinoic acid and differentiated into neutrophils (HL60 RA), cells stimulated with vitamin D3 (1 mM) and TPA (10 ng / ml) and differentiated into macrophages (HL60 D3 + T) P30 expression was increased compared to HL60. Expression was observed in Nalm6 (B lymphocyte), Molt4, Jurkat (T lymphocyte), K562 (erythroid) and TF-1 (myeloid). (FIG. 3B)

(Effect of p30 on cell migration)
(1) Cell migration when both wild-type p30 and Rap1 are expressed
To investigate the effect of p30 on cell migration by activated Rap1 (Rap1V12) and chemokines, p30, Rap1V12, both Rap1V12 and p30 were expressed in human LFA-1 expressing proB cell line BAF. BAF cells were prepared and cell migration on ICAM-1 was measured. As the ICAM-1 used, a protein (hICAM-1-Fc) obtained by fusing a human ICAM-1 extracellular region with a human immunoglobulin Fc region was used. For cell migration, a ΔT Culture Dish system (ΔT Culture Dish system, Biotechs, Inc) from Bioptechs was used. BAF cells prepared by immobilizing ICAM-1 (0.1 mg / ml) on a temperature control plate having a diameter of 6 cm were added thereto, and videotaped at 37 ° C. for 20 minutes. In each experiment, the distance traveled was measured for 20 cells, and the average velocity was calculated. As a result, Rap1V12 increased the cell migration rate on ICAM-1, and p30 further enhanced its effect (FIG. 4).

(2) Cell migration when a mutant of the p30 RBD domain is expressed together with Rap1 In order to examine whether the enhancement effect of p30 is caused by binding to Rap1 in this system, a p30 RBD domain mutant (p30RBDm )created. p30RBDm is a mutant in which the seven amino acids conserved in the RBD domain, i.e., lysine 123, arginine 135, lysine 135, lysine 154, lysine 155, lysine 160, aspartic acid, and asparagine 161 are substituted with alanine. . This p30RBDm is expressed similarly to the wild type, but unlike the wild type, cannot bind to GTP / Rap1. When Rap1V12 and p30RBDm were expressed in BAF cells and the migration speed on ICAM-1 was measured, no enhancement effect was observed. Therefore, it was found that the effect of p30 promoting cell migration by Rap1V12 requires binding to Rap1.
Next, the effect of chemokines on cell migration was examined. P30 and p30RBDm were introduced into BAF cells expressing human LFA-1, and cell migration on ICAM-1 was measured in the presence of SDF-1 (CXCL12) (20 nM) by the above method. As a result, p30 enhanced cell migration induced by SDF-1 stimulation about twice. On the other hand, p30RBDm had no effect. From the above, it was revealed that p30 has an effect of binding to Rap1 and enhancing cell migration by chemokines (FIG. 5).

(Adhesion control of LFA-1 by p30)
To investigate the possibility of p30 as a downstream effector molecule of Rap1 involved in the action of increasing adhesion, we overexpressed p30 in 3A9T cells and examined the effect of 3A9T cells on LFA-1-mediated adhesion activity to ICAM-1. It was examined by assay. That is, the extracellular region of mouse ICAM-1 was fused to the human immunoglobulin Fc region to produce a dimerized chimeric protein, immobilized on a plate, and the cell adhesion activity to ICAM-1 was measured. . The cells were labeled with a fluorescent dye using BCECF-AM (Molecular Probe), and incubated at 37 ° C. for 30 minutes on a plate on which ICAM-1 (0.1 mg / ml) was immobilized. The number of input cells and the number of cells remaining after washing the plate three or more times (the number of adhered cells) were measured with a fluorescence reader (Cytofluor 4000, Persepetive Biosystems), and the ratio of adhered cells to input cells was determined by the cell adhesion. Active. As a result, it was found that the adhesion activity of LFA-1 to ICAM-1 increased according to the expression level of p30 in 3A9T cells (FIG. 6A).

  Also, if p30 is involved in adhesion downstream of Rap1, no increase in adhesion should be observed in mutants of Rap1 that have lost p30 binding activity. It has been found that an amino acid sequence called an effector region of Rap1 is a region to which downstream effector molecules of Rap1, such as p30, bind. Therefore, a point mutation was introduced into this region of active Rap1V12. Mutants were prepared in which Rap1 threonine was replaced with glutamic acid (T35E), glutamic acid 37 was replaced with glycine (E37G), aspartic acid 38 was replaced with glutamic acid (D38E), and tyrosine 40 was replaced with cysteine (Y40C). From the association with Rap1V12, it was found that E37G retained the binding activity to p30, but T35E, D38E, and Y40C could not bind to p30. Therefore, these mutants were introduced into 3A9T cells. As a result, an increase in the adhesion of LFA-1 to ICAM-1 was observed only in E37G that remained binding to p30 (FIG. 6B). This suggested that p30 may be involved in increasing adhesion downstream of Rap1.

LFA-1 / ICAM-1 adhesion induced by TCR stimulation is mediated by activation of Rap1, which is completely suppressed by expressing Rap1 specific inhibitory molecule Spa-1. I have. Thus, if p30 were involved in adhesion downstream of Rap1, it would be expected to suppress TCR-mediated LFA-1 / ICAM-1 adhesion. Therefore, a mutant of p30 was created, and a mutant (deltaNp30) that functions as a dominantly suppressed type was created. dletaNp30 was prepared by deleting 100 amino acids from the N-terminus of p30. After transfection into 3A9T cells, TFA-stimulated LFA-1 / ICAM-1 adhesion was examined. As a result, as shown in FIG. 6C, it was found that deltaNp30 suppressed TFA-stimulated adhesion of LFA-1 to ICAM-1 in an expression amount-dependent manner.
From the above results, it became clear that p30 plays an important role in LFA-1 / ICAM-1 mediated cell adhesion downstream of Rap1.

(Effect of N- (2-ethylsulfonylamino-5-trifluoromethyl-3-pyridyl) cyclohexanecarboxamide monosodium salt monohydrate (Compound 1) on the binding between Rap1 and p30)
(1) Preparation of GST-Rap1 beads
PGEX-3X (Amersham Pharmacia Biotech) was used as a plasmid for producing a fusion protein of GST-Rap1. The coding sequence of Rap1 represented by SEQ ID NO: 1 was inserted between the BamHI and EcoRI restriction enzyme sites of the vector. At that time, in order to match the frames, two base pairs CC were added before the 5 'terminal ATG of the base sequence represented by SEQ ID NO: 1. As a result, the connection between the BamHI site of this vector and Rap1 was 5 '... GGATCCCCATG ... 3'. The resulting plasmid for producing the fusion protein of GST-Rap1 was transfected into Escherichia coli. Escherichia coli having the plasmid incorporated therein was cultured, and protein production was induced with 0.2 mM IPTG (isopropylthiogalactopyranoside) (30 ° C., 2 hours) to produce GST-Rap1 protein in E. coli. E. coli was recovered by centrifugation, dissolved in Lysis buffer (100 mM NaCl, 50 mM Tris-HCl (pH 7.5), 1% Triton X100, 2 mM MgCl ₂ , 0.1 TIU / ml Aprotinin), and the E. coli membrane was sonicated. Destroyed. Glutathione Sepharose 4B beads (Amersham) were added to the supernatant obtained by centrifuging the solution, and reacted at 4 ° C. for 1 hour to prepare GST-Rap1 beads.

(2) Preparation of solubilized p30
A plasmid of p30-Myc tag was introduced into 70% confluent 293T cells by electroporation. The introduced cells were cultured for 2 days and collected by centrifugation. The collected cells were lysed with a Lysis buffer, and after centrifugation, the supernatant was collected to obtain p30 Lysate.

(3) Binding inhibition test
Wash 25 μL of GST-Rap1 beads with Loading buffer (25 mM Tris-HCl (pH 7.5), 2 mM EDTA, 2.5 mM MgCl ₂ , 1 mM DTT), add 2 mM GTPγs (sigma) and incubate at 37 ° C. for 15 minutes to incubate Rap1. Activated. To this, 250 μL of p30 Lysate was added and reacted at 4 ° C. for 30 seconds. Immediately before this 30-second reaction, N- (2-ethylsulfonylamino-5-trifluoromethyl-3-pyridyl) cyclohexanecarboxamide monosodium salt monohydrate (compound 1) was added to a final concentration of 1 μM. Was. After the reaction, the beads were washed four times with a lysis buffer, and 25 μL of a normal sample buffer was added to the beads precipitated by centrifugation to prepare a sample for SDS-PAGE. This sample was subjected to SDS-PAGE for Western blotting. For detection of P30, use anti-Myc mouse IgG2a antibody (Cell Signaling) as the primary antibody and HRP-labeled anti-mouse IgG (Sigma) as the secondary antibody, and sensitize the chemiluminescence film (Amersham) by ECL chemiluminescence method. Detected.
The band obtained by exposing the film for chemiluminescence was quantified using image analysis software (win Roof, Mitani Shoji). That is, the p30 band to be compared was extracted by binarization processing, and the volume of the category of luminance × area was compared.
In the group treated with 1 μM of compound 1, this value was significantly lower than that in the group without addition (FIG. 7). From this, it is considered that Compound 1 inhibits the binding between Rap1 and p30.
According to the above method, it is considered possible to screen for a useful compound that inhibits the binding between Rap1 and p30.
Similarly, the activity can be screened using various diaminotrifluoromethylpyridine derivatives disclosed in, for example, JP-A-6-263735.

(1) Microtubule development by p30
In order to examine the effect of p30 on the microtubule cytoskeleton, the gene for human p30 was introduced into 3A9T cells. 3A9T cells and cells transfected with p30 (3A9 / p30) were fixed with 3.3% paraformaldehyde for 15 minutes at room temperature, and then mounted on poly-L-lysine-coated slides. After washing with PBS, PBS / 0.2% Tx-100 supplemented with ₂ mM MgCl ₂ was added and incubated for 5 minutes. After washing with PBS, the cells were blocked with 5% goat serum for 20 minutes. Thereafter, a mouse anti-tubulin antibody (500-fold diluted with 1% BSA) was added and incubated for 1 hour. After washing four times with PBS / 0.1% BSA, 400-fold diluted Alexa488-labeled goat anti-mouse IgG (Molecular Probe) was added, incubated for 1 hour, washed four times with PBS / 0.1% BSA, and observed with a confocal laser microscope ( (FIG. 8). As a result, it was revealed that the introduction of p30 transformed the cell morphology and markedly enhanced microtubule development. This indicates that p30 has the effect of developing microtubules.

(2) Localization of p30 and LFA-1 in adhesion between T cells and antigen presenting cells
Adhesion between T cells and antigen presenting cells (APCs) is an important adhesion that enables T cells to recognize antigens, and this adhesion is mediated by LFA-1 / ICAM-1. Therefore, the localization of p30 and LFA-1 in this adhesion was examined. HEL (hen egg lysozyme) -specific 3A9 T cells were used as T cells, and CH27 cells were used as APCs. CH27 cells (1 × 10 ⁵ / ml) were cultured for 16 hours with HEL antigen (100 μg). Thereafter, the same number of 3A9 T cells and CH27 cells (1 × 10 ⁵ / ml) were mixed and incubated at 37 ° C. for 30 minutes. After fixing with 3.3% paraformaldehyde for 15 minutes at room temperature, the slide was mounted on a poly-L-lysine-coated slide. After washing with PBS, PBS / 0.2% Tx-100 supplemented with ₂ mM MgCl ₂ was added and incubated for 3 minutes. After washing with PBS, the cells were blocked with 5% goat serum for 20 minutes. Rat anti-p30 antibody (10 μg / ml) (E11.2) was added and incubated for 1 hour. After washing 4 times with PBS / 0.1%, Alexa-546-conjugated rat anti-mouse IgG (diluted 500-fold with 1% BSA, Molecular Probe) was added and incubated for 1 hour. Biotinylated mouse anti-LFA-1 antibody (Pharmingen diluted 100-fold with 1% BSA). After washing four times with PBS / 0.1%, a FITC-labeled anti-biotin antibody (Jackson Laboratory) diluted 100-fold with 1% BSA was added and incubated for 1 hour. After washing four times with PBS / 0.1%, the cells were observed with a confocal laser microscope. , And LFA- shows a green signal). As a result, LFA-1 and p30 accumulated on the adhesion surface of T-APC, and both co-localized (merge). This is considered to be a localization that closely matches the function of LFA-1 control by p30.

Preparation of transgenic mouse with high expression of p30 (1) Preparation of DNA fragment used for preparation of transgenic mouse Forming a spacer sequence having an EcoRI site at both ends of p30 mouse corresponding gene (SEQ ID NO: 9) cloned from a library The prepared DNA fragment was inserted into a vector pCNX2 having a CMV enhancer sequence and a CAG promoter sequence (available from Professor Honjo Kyoto University) cleaved with EcoRI (Takara Bio Inc.). Next, the plasmid is cleaved with SalI-HindIII to prepare a DNA fragment (3075 bp) used for microinjection, that is, a fragment in which the p30 gene can be expressed downstream of the CMV enhancer sequence and the CAG promoter sequence. did.

(2) Gene Transfer into Mice Transgenic mice are produced by an improved method of the method of Gordon et al. (1980. Proc. Nalt. Acad. Sci. 77: 7380-7384).
First, female mice C57BL / 6N Crj (Nippon Charles River) were subjected to superovulation induction treatment (by administration of 5 IU of pregnant horse serum gonadotropin and then administration of 5 IU of human placental gonadotropin 48 hours later). And mated with male mice of the same strain. The next morning, oviducts are removed from female mice showing vaginal plug formation, and pronuclear stage fertilized eggs are collected.
The DNA fragment solution prepared above (prepared to several ng / μL with TE buffer) is microinjected into the male pronucleus of the fertilized egg using a microcapillary for gene injection. After the injection treatment, culture in a CO ₂ incubator for _{2 to} 3 hours.
After culturing, morphologically normal embryos are selected and transferred to the oviduct of a pseudopregnant female mouse for embryo transfer {Jcl: MCH (ICR) (CLEA Japan)}. As the pseudopregnant female mouse, a female in estrus is allowed to coexist overnight with a male mouse ligating vas deferens, and a vaginal plug is observed the next morning. Embryo transfer to the fallopian tube is performed by incising the back of an anesthetized female mouse, removing the ovaries, making a partial incision between the fallopian tube and the ampulla of the fallopian tube, and filling the tip of a Pasteur pipette for embryo transfer. In addition, a culture solution containing an embryo, an air layer, and a culture solution are injected in this order.
After transplantation, the sutured female mouse (temporary belly) is introduced into a vinyl isolator for isolation and breeding, spontaneously delivered, and maintained until weaning. However, if the child is not delivered by the afternoon of the expected date of delivery, the newborn is removed by hysterectomy, and the resulting newborn is prepared in a separate isolator in advance of foster care (not retaining the specific pathogen: Nursing on SPF). At the time of weaning, a microbiological examination is performed using a stomach or foster parent, and the offspring with confirmed SPF of the parent are introduced into the SPF breeding room and genetic analysis is performed. After the gene analysis, the transfer of the transgene to the next generation is confirmed using offspring having the transgene.

(3) Analysis of introduced genes
After introduction into the SPF breeding room (after weaning and SPF confirmation), the resulting offspring are trimmed. For sampling of the tail tissue, cut the tail at a position of about 10 to 15 mm from the tip with special scissors previously sterilized by dry heat, put in a sterilized Eppendorf tube, and store at -80 ° C until analysis.
DNA is extracted from the cryopreserved tail tissue by the protease K treatment method (Amersham Bioscience: cord; 27-2537-01). Using the extracted DNA as a template, primers designed on the 5 'side of the p30 gene and the 3' side of the vector portion immediately downstream of the p30 gene [introduced by PCR using ATGACCGTGGACAGCAGCATGAGCAGCGGG (SEQ ID NO: 11) and TATTTGTGAGCCAGGGCATTGGCCACACCA (SEQ ID NO: 12), respectively] A mouse having the obtained gene fragment is identified. The introduction of the gene is confirmed by amplification of the 1144 bp gene fragment in this PCR. Furthermore, the transgene is confirmed by PCR for the CMV promoter present on the 5 'side of the transgene [using ATCAATTACGGGGTCATTAG (SEQ ID NO: 13) and TGTACTGCCAAGTAGGAAAG (SEQ ID NO: 14) as primers]. The introduction of the gene is confirmed by amplification of the 320 bp gene fragment in this PCR.

Hereinafter, the DNA base sequence used in the present specification will be described and disclosed.
(1) myc-tag (produced as a protein in the cell and contains an initiation codon to enable detection by an antibody against myc)
ATGGAACAGAAACTCATATCGGAGGAGGATCTA (SEQ ID NO: 7)

(2) Nucleotide sequence of wild-type p30 (when adding the above myc-tag, replace the start codon ATG)
ATGACCGTGG ACAGCAGCAT GAGCAGTGGG TACTGCAGCC TGGACGAGGA ACTGGAAGAC
TGCTTCTTCA CTGCTAAGAC TACCTTTTTC AGAAATGCGC AGAGCAAACA TCTTTCAAAG
AATGTCTGTA AACCTGTGGA GGAAACACAG CGCCCGCCCA CACTGCAGGA GATCAAGCAG
AAGATCGACA GCTACAACAC GCGAGAGAAG AACTGCCTGG GCATGAAACT GAGTGAAGAC
GGCACCTACA CGGGTTTCAT CAAAGTGCAT CTGAAACTCC GGCGGCCTGT GACGGTGCCT
GCTGGGATCC GGCCCCAGTC CATCTATGAT GCCATCAAGG AGGTGAACCT GGCGGCTACC
ACGGACAAGC GGACATCCTT CTACCTGCCC CTAGATGCCA TCAAGCAGCT GCACATCAGC
AGCACCACCA CCGTCAGTGA GGTCATCCAG GGGCTGCTCA AGAAGTTCAT GGTTGTGGAC
AATCCCCAGA AGTTTGCACT TTTTAAGCGG ATACACAAGG ACGGACAAGT GCTCTTCCAG
AAACTCTCCA TTGCTGACCG CCCCCTCTAC CTGCGCCTGC TTGCTGGGCC TGACACGGAG
GTCCTCAGCT TTGTGCTAAA GGAGAATGAA ACTGGAGAGG TAGAGTGGGA TGCCTTCTCC
ATCCCTGAAC TTCAGAACTT CCTAACAATC CTGGAAAAAG AGGAGCAGGA CAAAATCCAA
CAAGTGCAAA AGAAGTATGA CAAGTTTAGG CAGAAACTGG AGGAGGCCTT AAGAGAATCC
CAGGGCAAAC CTGGGTAA (SEQ ID NO: 3)

(3) Predominantly suppressed form of p30 (start codon before 101st alanine at the N-terminal. However, deltaNp30 used in FIG. 6C has the above myc-tag and is replaced with the start codon)
ATGGCTGGGATCC GGCCCCAGTC CATCTATGAT GCCATCAAGG AGGTGAACCT GGCGGCTACC
ACGGACAAGC GGACATCCTT CTACCTGCCC CTAGATGCCA TCAAGCAGCT GCACATCAGC
AGCACCACCA CCGTCAGTGA GGTCATCCAG GGGCTGCTCA AGAAGTTCAT GGTTGTGGAC
AATCCCCAGA AGTTTGCACT TTTTAAGCGG ATACACAAGG ACGGACAAGT GCTCTTCCAG
AAACTCTCCA TTGCTGACCG CCCCCTCTAC CTGCGCCTGC TTGCTGGGCC TGACACGGAG
GTCCTCAGCT TTGTGCTAAA GGAGAATGAA ACTGGAGAGG TAGAGTGGGA TGCCTTCTCC
ATCCCTGAAC TTCAGAACTT CCTAACAATC CTGGAAAAAG AGGAGCAGGA CAAAATCCAA
CAAGTGCAAA AGAAGTATGA CAAGTTTAGG CAGAAACTGG AGGAGGCCTT AAGAGAATCC
CAGGGCAAAC CTGGGTAA (corresponding to SEQ ID NO: 5)

The present invention provides a technique utilizing the knowledge that cell interaction and p30-Rap1 interaction activates and regulates information transmission. Using this technology, it is possible to screen p30-Rap1 interaction regulators such as compounds that inhibit p30-Rap1 binding, and to develop reagents and the like that are used for them. P30-Rap1 binding regulator can be expected as a medicine, and can be used as an anti-inflammatory drug, an immunosuppressant, a transplant immunosuppressant, an anticancer drug and the like. Furthermore, modified p30-related peptides and nucleic acids, as well as anti-p30 antibodies, are highly useful, for example, those that function as a dominantly suppressed type in cells and those that function to inhibit p30-Rap1 binding. Using this technology / knowledge, it is possible to develop reagents and assay methods for biological function analysis.
Obviously, the present invention can be practiced other than as specifically described in the foregoing description and examples. Many modifications and variations of the present invention are possible in light of the above teachings, and so are within the scope of the appended claims.

SEQ ID NO: 1, Human Rap1
SEQ ID NO: 3, Human RAPL (or Human p30)
SEQ ID NO: 5, Dominant-Negative Human RAPL
SEQ ID NO: 7, Nucleotide Sequence for Myc-tag
SEQ ID NO: 8, Peptide Sequence for Myc-tag
SEQ ID NO: 9, House Mouse RAPL (Region 104 to 901 of mRNA)
SEQ ID NO: 11, Description of Artificial Sequence: Oligonucleotide to act as a primer for PCR
SEQ ID NO: 12, Description of Artificial Sequence: Oligonucleotide to act as a primer for PCR
SEQ ID NO: 13, Description of Artificial Sequence: Oligonucleotide to act as a primer for PCR
SEQ ID NO: 14, Description of Artificial Sequence: Oligonucleotide to act as a primer for PCR

1 shows the amino acid sequence of p30 and its gene structure. At the same time, the amino acid sequence of Nore1 is also shown. The analysis result about the association of p30 and Rap1 is shown. It is a photograph in which a film for chemiluminescence was exposed by ECL chemiluminescence method. (A) is an electrophoresis photograph showing the results of tissue expression distribution of p30 by RT-PCR. (B) is an electrophoretic photograph showing the results of Western blot of various cells using an anti-p30 specific antibody. FIG. 6 shows the results of examining the effect on cell migration when coexpressing wild-type p30 or a mutant of the RBD domain of p30 with Rap1. The right side is an electrophoresis photograph showing the result of Western blot. Fig. 4 shows the effect of p30 on chemokine-induced cell migration. (A) LFA-1 adhesion control effect by p30 is shown. (B) shows the effect of mutant p30 on controlling LFA-1 adhesion. Only E37G, which retains the binding activity to p30, showed an increase in LFA-1 adhesion to ICAM-1. (C) DeltaNp30 suppresses the adhesion of LFA-1 to ICAM-1 by TCR stimulation in an expression-dependent manner. The lower panel is an electrophoresis photograph showing the expression of deltaNp30. The results of a test on the effect of compound 1 on the binding between Rap1 and p30 are shown. 4 is a micrograph showing the result of observing the state of microtubule development by p30 using a confocal laser microscope. 4 is a photomicrograph showing the results of local confocal laser microscopy of p30 and LFA-1 in adhesion between T cells and antigen presenting cells.

Claims (32)

(1) (a) an active polypeptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 2, a partial peptide thereof or a salt thereof, and a polypeptide represented by SEQ ID NO: 2 One polypeptide selected from the group consisting of an amino acid sequence in which the 12th glycine of the amino acid sequence to be converted is valine or an active polypeptide containing an amino acid sequence substantially identical to the amino acid sequence having the point mutation (B) one polypeptide selected from the group consisting of a polypeptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 4 or a partial peptide thereof, or a salt thereof, and c) contacting with a test sample;
(2) detecting the interaction and / or formation of a bond between one polypeptide selected from the group (a) and one polypeptide selected from the group (b), wherein Rap1 and p30 A method for screening for a compound or a salt thereof that promotes or inhibits the interaction and / or binding with the compound. (1) contacting one polypeptide selected from (a) group, one polypeptide selected from (b) group and a test sample,
(2) detecting the interaction and / or formation of a bond between one polypeptide selected from the group (a) and one polypeptide selected from the group (b),
(3) The screening method according to claim 1, comprising a step of selecting a compound that promotes or inhibits the interaction and / or binding of these polypeptides. The screening method according to claim 1 or 2, wherein one polypeptide selected from the group (a) and / or one polypeptide selected from the group (b) is fused with another peptide. One polypeptide selected from the group (a) and / or one polypeptide selected from the group (b) is labeled, and by detecting or measuring the label, formation of a bond of the polypeptide and / or The screening method according to any one of claims 1 to 3, wherein the interaction is detected. (a) bound to one polypeptide selected from the group (b) one polypeptide selected from the group (b) was fused to a primary antibody against the polypeptide of the group (b) or the polypeptide of the (b) The screening method according to any one of claims 1 to 3, wherein the interaction and / or the formation of a bond between these polypeptides is detected by detecting or measuring using a primary antibody against another peptide. (b) one polypeptide selected from the group (a) bound to one polypeptide selected from the group was fused to a primary antibody against the polypeptide of the (a) group or the polypeptide of the (a) The screening method according to any one of claims 1 to 3, wherein the formation and / or interaction of these polypeptide bonds is detected by detecting or measuring with a primary antibody against another peptide. (a) bound to one polypeptide selected from the group (b) one polypeptide selected from the group (b) was fused to a primary antibody against the polypeptide of the group (b) or the polypeptide of the (b) The method according to any one of claims 1 to 3, wherein the formation and / or interaction of a bond between these polypeptides is detected by detection or measurement using a primary antibody against another peptide and a secondary antibody against the primary antibody. The screening method as described above. (a) the polypeptide of the group, a polypeptide obtained by fusing glutathione-S-transferase to the N-terminal side of the polypeptide having the amino acid sequence represented by SEQ ID NO: 2 or the amino acid represented by SEQ ID NO: 2 The polypeptide having an amino acid sequence in which the glycine at position 12 of the sequence is valine is an active polypeptide of a polypeptide obtained by fusing glutathione-S-transferase to the N-terminal side, or a salt thereof, (b) The polypeptide of the group is a polypeptide having a Myc epitope fused to the N-terminal side of a polypeptide having the amino acid sequence represented by SEQ ID NO: 4, or a salt thereof. Screening method. (a) a polypeptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 2, its partial peptide or a salt thereof, and 12 of the amino acid sequence represented by SEQ ID NO: 2 The second glycine is valine or one polypeptide selected from the group consisting of polypeptides containing an amino acid sequence substantially identical to the point-mutated amino acid sequence; and (b) SEQ ID NO: 4. Rap1 and p30, comprising a polypeptide containing the same or substantially the same amino acid sequence as the represented amino acid sequence or a partial peptide thereof or one polypeptide selected from the group consisting of salts thereof. A screening kit for a compound or a salt thereof that promotes or inhibits interaction and / or binding. 10. The screening kit according to claim 9, wherein one polypeptide selected from the group (a) and / or one polypeptide selected from the group (b) is fused with another peptide. The screening kit according to claim 9, wherein one polypeptide selected from the group (a) and / or one polypeptide selected from the group (b) is labeled. (a) the polypeptide of the group, a polypeptide obtained by fusing glutathione-S-transferase to the N-terminal side of the polypeptide having the amino acid sequence represented by SEQ ID NO: 2 or the amino acid represented by SEQ ID NO: 2 A polypeptide having an amino acid sequence in which glycine at position 12 of the sequence is valine is a polypeptide obtained by fusing glutathione-S-transferase to the N-terminal side or a salt thereof, and the polypeptide of group (b) is 10. The screening kit according to claim 9, which is a polypeptide having a Myc epitope fused to the N-terminal of a polypeptide having the amino acid sequence represented by SEQ ID NO: 4, or a salt thereof. A compound or a salt thereof that promotes or inhibits the interaction and / or binding between Rap1 and p30, obtained using the screening method according to claim 1 or the screening kit according to claim 9. 14. The compound or a salt thereof according to claim 13, which inhibits the interaction and / or binding between Rap1 and p30. A pharmaceutical composition comprising the compound according to claim 13 or a salt thereof. A pharmaceutical composition comprising the compound according to claim 14 or a salt thereof. The target of treatment or prevention is
(a) Inflammatory disease
(b) Immune disease
(c) rejection during organ transplantation, and
(d) The pharmaceutical composition according to claim 15 or 16, which is selected from the group consisting of cancer. A monoclonal antibody recognizing a polypeptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 4. A diagnostic method using the monoclonal antibody according to claim 18. A diagnostic kit comprising the monoclonal antibody according to claim 18. A polypeptide or a salt thereof that functions as a dominant-suppressing type in a cell with respect to a polypeptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 4. A polypeptide or a salt thereof according to claim 21,
(a) Inflammatory disease
(b) Immune disease
(c) rejection during organ transplantation, and
(d) A composition for treating or preventing a substance selected from the group consisting of cancer. A polynucleotide encoding the polypeptide of claim 21. It contains the polynucleotide according to claim 23,
(a) Inflammatory disease
(b) Immune disease
(c) rejection during organ transplantation, and
(d) A composition for treating or preventing a substance selected from the group consisting of cancer. A transgenic animal in which the expression of a polypeptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 10 is regulated. 26. The transgenic animal according to claim 25, wherein the expression of a polypeptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 10 is excessive. The transgenic animal according to claim 25 or 26, wherein the transgenic animal is a mouse. Formula (I)

[In the formula, X is a —CW ¹ R ¹ group or —C (＝ W ¹ ) W ² R ² group, and R ¹ is an alkyl group, a haloalkyl group, an alkoxycarbonylalkyl group, an alkenyl group, a haloalkenyl group, a thienyl group. Alkenyl group, cycloalkyl group, cycloalkyl group substituted with halogen atom, phenyl group, phenyl group substituted with halogen atom, phenyl group substituted with alkyl group or haloalkyl group, alkoxy group or halo group. A phenyl group, a tetrahydronaphthyl group, an indanyl group, a furanyl group or a thienyl group substituted with an alkoxy group, R ² is an alkyl group or a haloalkyl group, and W ¹ and W ² are each independently an oxygen atom or a sulfur atom; An atom, Y is a —SO ₂ R ⁹ group, and R ⁹ is an alkyl group, a haloalkyl group, a phenyl group, a halogen A phenyl group substituted with an atom, a phenyl group substituted with an alkyl group or a haloalkyl group, or a phenyl group substituted with an alkoxy group or a haloalkoxy group) or a salt thereof. Characteristic Rap1 and p30 binding inhibitor. In claim 28, X is an alkoxycarbonylalkylcarbonyl group, an alkenylcarbonyl group, an alkenylcarbonyl group substituted with a thienyl group, a cycloalkylcarbonyl group, an indanylcarbonyl group, a furancarbonyl group, a thiophenecarbonyl group, a tetrahydronaphthylcarbonyl group or 29. The binding inhibitor of Rap1 and p30 according to claim 28, wherein the inhibitor is a benzoyl group optionally substituted with a halogen atom or a haloalkyl group, and Y is an alkylsulfonyl group. The Rap1 and p30 according to claim 28, wherein X is a cycloalkylcarbonyl group, a furancarbonyl group or a benzoyl group optionally substituted with halogen, and Y is an alkylsulfonyl group. Binding inhibitors. 29. The compound according to claim 28, wherein the compound is N- (2-ethylsulfonylamino-5-trifluoromethyl-3-pyridyl) cyclohexanecarboxamide, N- (2-methylsulfonylamino-5-trifluoromethyl-3-pyridyl) -4. -Fluorobenzamide, N- (2-isopropylsulfonylamino-5-trifluoromethyl-3-pyridyl) -3-fluorobenzamide, N- (2-methylsulfonylamino-5-trifluoromethyl-3-pyridyl) -2 29. Rap1 and p30 according to claim 28, characterized in that they are selected from the group consisting of -furancarboxamide or N- (2-isopropylsulfonylamino-5-trifluoromethyl-3-pyridyl) cyclopentanecarboxamide. And binding inhibitors. A binding inhibitor between Rap1 and p30, wherein N- (2-ethylsulfonylamino-5-trifluoromethyl-3-pyridyl) cyclohexanecarboxamide or a salt thereof is an active ingredient.

Images