JP2003525633A - G protein-coupled receptor-related polypeptide - Google Patents

Abstract

  (57) [Summary] Disclosed herein are nucleic acid sequences encoding a G protein-coupled receptor-related polypeptide. Also disclosed are polypeptides encoded by these nucleic acid sequences, and antibodies that immunospecifically bind to the polypeptides, as well as derivatives, variants, and variants of these polypeptides, polynucleotides or fragments of the antibodies. . The present invention further discloses therapeutic, diagnostic, and research methods for diagnosing, treating, and preventing disorders involving any one of these novel human nucleic acids and proteins.

Description

Detailed Description of the Invention

BACKGROUND OF THE INVENTION The present invention relates generally to nucleic acids and polypeptides. More particularly, the invention relates to nucleic acids encoding novel G protein coupled receptor (GPCR) polypeptides, as well as vectors, host cells, antibodies and recombinant methods for producing these nucleic acids and polypeptides.

SUMMARY OF THE INVENTION The present invention is based, in part, on the discovery of nucleic acid sequences that encode novel polypeptides. These novel nucleic acids and polypeptides are referred to herein as NOVX, or NOV1.
, NOV2, NOV3, NOV4, NOV5, NOV6, NOV7, NOV8,
Called NOV9 and NOV10 nucleic acids and polypeptides. These nucleic acids and polypeptides, as well as their derivatives, homologs, analogs and fragments, are collectively referred to hereafter as "NOVX" nucleic acid or polypeptide sequences.

In one aspect, the invention provides an isolated NOVX nucleic acid molecule encoding a NOVX polypeptide, which is SEQ ID NO: 1, 3, 5, 7, 9, 11, 1.
3, 15, 17, 19, 20, 22, 24, 26, 28, and 30 and include nucleic acid sequences having identity to the nucleic acids disclosed. In some embodiments,
The NOVX nucleic acid molecule hybridizes under stringent conditions to a nucleic acid sequence complementary to the nucleic acid molecule containing the protein coding sequence of the NOVX nucleic acid sequence.
The present invention also includes NOVX polypeptides, or fragments, homologs thereof,
Included are isolated nucleic acids that encode analogs or derivatives. For example, this nucleic acid is SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 21, 23.
, 25, 27, 29, and 31 amino acid sequences may be encoded by a polypeptide that is at least 80% identical. This nucleic acid is, for example,
SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 20, 22, 2
It can be a genomic DNA fragment or a cDNA molecule comprising the nucleic acid sequence of any of 4, 26, 28 and 30.

Oligonucleotides (eg, NOVX nucleic acids (eg, SEQ ID NOs: 1, 3, 5,
7, 9, 11, 13, 15, 17, 19, 20, 22, 24, 26, 28, and 30) an oligonucleotide comprising at least 6 contiguous nucleotides or the complement of the oligonucleotide). Included in the invention.

A substantially purified NOVX polypeptide (SEQ ID NOs: 2, 4, 6, 8, 10,
12, 14, 16, 18, 21, 23, 25, 27, 29, and 31) are also included in the present invention. In a particular embodiment, the NOVX polypeptide is
It comprises an amino acid sequence which is substantially identical to the amino acid sequence of human NOVX polypeptide.

The invention also features antibodies that immunoselectively bind to NOVX polypeptides, or fragments, homologs, analogs or derivatives thereof.

In another aspect, the invention includes a pharmaceutical composition comprising a therapeutically or prophylactically effective amount of a therapeutic agent and a pharmaceutically acceptable carrier. The therapeutic agent can be, for example, a NOVX nucleic acid, a NOVX polypeptide, or an antibody specific for a NOVX polypeptide. In a further aspect, the invention comprises a therapeutically or prophylactically effective amount of this pharmaceutical composition in one or more containers.

[0008] In a further aspect, the invention includes a method of producing a polypeptide, the method comprising converting a cell containing a NOVX nucleic acid into a NOV encoded by the DNA.
By culturing under conditions that allow expression of the X polypeptide. If desired,
The NOVX polypeptide can then be recovered.

In another aspect, the invention includes a method of detecting the presence of NOVX polypeptide in a sample. In this method, a sample is contacted with a compound that selectively binds to the polypeptide under conditions that allow the formation of a complex between the polypeptide and the compound. This complex, if present, is detected, thereby identifying the NOVX polypeptide in this sample.

The present invention also includes methods for identifying a particular cell or tissue type based on the expression of NOVX.

Also included in the invention is a method of detecting the presence of a NOVX nucleic acid molecule in a sample, which method comprises contacting the sample with a NOVX nucleic acid probe or primer, and the nucleic acid probe or primer NOVX in
By detecting whether or not it has bound to a nucleic acid molecule.

[0012] In a further aspect, the invention provides a method for modulating the activity of a NOVX polypeptide, the method comprising adding to a cell sample containing the NOVX polypeptide a compound that binds to the NOVX polypeptide. By contacting in an amount sufficient to modulate the activity of this polypeptide. The compound may be a small molecule (eg, a nucleic acid, peptide, polypeptide, peptidomimetic, carbohydrate, lipid or other organic (carbon-containing) or inorganic molecule, eg, as further described herein. ) Can be.

The use of therapeutic agents in the manufacture of a medicament for treating or preventing disorders or syndromes including, for example, is also within the scope of the invention: diabetes, metabolic disorders associated with obesity, metabolic syndrome X, Anorexia, wasting (related to chronic diseases, metabolic disorders, diabetes, obesity, infectious diseases, anorexia, cancer-related cachexia, cancer, neurodegenerative disorders, Alzheimer's disease, Parkinson's disease, immune disorders and hematopoietic disorders) ), Or other disorders associated with cell signaling processing and metabolic pathway regulation. The therapeutic agent is
For example, it can be a NOVX nucleic acid, a NOVX polypeptide, or a NOVX-specific antibody, or a biologically active derivative or fragment thereof.

For example, the compositions of the invention have efficacy for the treatment of patients suffering from: developmental disorders, MHC II and III disorders (immune disorders), impaired taste and olfactory detectability, Burkitt lymphoma. , Corticoneurog
disease, signal transduction pathway disorder, retinal disease (including photoreceptor-related diseases), cell growth rate disorder; cell shape disorder, eating disorder; feeding regulation; potential obesity due to overeating; starvation Potential disorders due to (loss of appetite), non-insulin dependent diabetes mellitus (NIDDM1), bacterial, fungal, protist and viral infections (especially,
Infections caused by HIV-1 or HIV-2), pain, cancer (neoplasm; adenocarcinoma; lymphoma; prostate cancer; uterine cancer, including but not limited to), anorexia, bulimia, asthma, Parkinson's disease , Acute heart failure, low blood pressure, high blood pressure, residual urine,
Osteoporosis, Crohn's disease; Multiple sclerosis; Albright hereditary dysplasia, angina, myocardial infarction, ulcer, asthma, allergies, benign prostatic hypertrophy, and psychological and neurological disorders (anxiety, Schizophrenia, manic depression, delirium, dementia, severe mental retardation, erythematosus nucleus valvular pallidum atrophy (DRPLA), hypophosphatemic rickets, autosomal dominant (2) apical corpus callosum (Acrocallosal) syndrome and dyskinesia (eg Huntington's disease or Gilles de la Tourette's syndrome)
And / or other conditions and disorders.

The polypeptides can be used as immunogens to produce antibodies specific for the invention and as vaccines. These can also be used to screen for potential agonist and antagonist compounds. For example, N
The cDNA encoding OVX may be useful in gene therapy, and NO
VX can be useful when administered to a subject in need thereof. By way of non-limiting example, the compositions of the present invention may be used for bacterial, fungal, protist and viral infections (particularly infections caused by HIV-1 or HIV-2), pain, cancer (neoplasm; adenocarcinoma; lymphoma). Prostate cancer; uterine cancer, but not limited to),
Treatment of patients suffering from anorexia, bulimia, asthma, Parkinson's disease, acute heart failure, hypotension, hypertension, residual urine, osteoporosis, Crohn's disease, multiple sclerosis; and allbright hereditary bone Dysplasia, angina, myocardial infarction, ulcer, asthma,
Allergies, benign prostatic hypertrophy, and psychological and neurological disorders (anxiety, schizophrenia, manic depression, delirium, dementia, severe mental retardation and dyskinesia (eg,
Huntington's disease or Gilles de la Tourette's syndrome)), and / or other conditions and disorders.

The invention further includes methods for screening for modulators of disorders or syndromes including, for example: diabetes, obesity-related metabolic disorders, metabolic syndrome X, anorexia, wasting disorder (chronic disease). , Metabolic disorders, diabetes, obesity, infectious diseases, anorexia, cancer-related cachexia, cancer, neurodegenerative disorders, Alzheimer's disease, Parkinson's disease, immune and hematopoietic disorders), or cell signaling processing and metabolism Other disorders associated with pathway regulation. The method involves contacting a test compound with a NOVX polypeptide, and determining whether the test compound binds to the NOVX polypeptide. Binding of a test compound to a NOVX polypeptide indicates that the test compound is an activity against, or a potential or predisposing modulator of, the aforementioned disorder or syndrome.

Also within the scope of the invention is a method of screening for modulators of the activity of a disorder or syndrome that includes, or for modulators of latency or predisposition to a disorder or syndrome that includes: for example, diabetes, obesity Related metabolic disorders, metabolic syndrome X, anorexia, wasting disorders associated with chronic diseases, metabolic disorders, diabetes, obesity, infectious diseases, anorexia, cachexia associated with cancer, cancer, Neurodegenerative disorders, Alzheimer's disease, Parkinson's disorders, immune disorders, and hematopoietic disorders, or other disorders associated with cellular signal processing and metabolic pathway regulation. This screening method involves administering test compounds to test animals with an increased risk for the disorders or syndromes described above. The test animal expresses the recombinant polypeptide encoded by the NOVX nucleic acid. Expression or activity of the NOVX polypeptide is then measured in this test animal, as well as control animals (which are NOVX
The polypeptide is recombinantly expressed and the expression or activity of this protein in) is not increased risk for the above disorders or syndromes. The expression of NOVX polypeptide in both test and control animals is then compared. Changes in the activity of the NOVX polypeptide in the test animals compared to control animals indicate that the test compound is a modulator of latency for these disorders or syndromes.

[0018] In yet another aspect, the invention provides a NOV in a subject (eg, a human subject).
Methods of determining the presence or predisposition to a disease associated with altered levels of X polypeptide, NOVX nucleic acid, or both. This method comprises the steps of measuring the amount of NOVX polypeptide in a test sample from this subject, and the amount of this polypeptide in this test sample relative to the amount of NOVX polypeptide present in a control sample. The step of comparing. Changes in NOVX polypeptide levels in the test sample as compared to the control sample are indicative of the presence or predisposition to the disease in this subject. Preferably, this predisposition includes the following predispositions: for example, diabetes, obesity-related metabolic disorders, metabolic syndrome X, anorexia, chronic disease-related wasting disorders, metabolic disorders,
Diabetes, obesity, infectious diseases, anorexia, cancer-related cachexia, cancer, neurodegenerative disorders, Alzheimer's disease, Parkinson's disorders, immune disorders, and hematopoietic disorders. Also, the expression levels of the novel polypeptides of the present invention can be used in methods for screening for various cancers and for determining cancer staging.

In a further aspect, the invention provides a NOVX polypeptide, a NOVX nucleic acid, in a subject (eg, a human subject) in an amount sufficient to ameliorate or prevent a pathological condition.
Alternatively, a method of treating or preventing a pathological condition associated with a disorder in a mammal by administering a NOVX-specific antibody is included. In a preferred embodiment, the disorder includes: for example, diabetes, obesity-related metabolic disorders, metabolic syndrome X, anorexia, chronic disease-related wasting disorders, metabolic disorders, diabetes, obesity, infections. Sexual disorders, anorexia, cachexia associated with cancer, cancer, neurodegenerative disorders, Alzheimer's disease, Parkinson's disorders, immune disorders, and hematopoietic disorders.

In yet another aspect, the invention is used in a method of identifying the cellular receptor and downstream effectors of the invention by any one of a number of techniques commonly used in the art. Can be done. These techniques include, but are not limited to, two-hybrid systems, affinity purification, co-precipitation with antibodies or other specific interacting molecules.

In another aspect, the invention provides SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14,
It relates to a method of screening for candidates that interact with 16, 18, 21, 23, 25, 27, 29 or 31 olfactory receptor polypeptides or fragments thereof. In this aspect, the method provides a olfactory receptor polypeptide; obtaining a candidate; contacting the candidate with the polypeptide: and detecting the complex formed, if present. Includes.

In a further aspect, the invention relates to a method of screening for ligand molecules that interact with an olfactory receptor polypeptide according to the invention. In this aspect, the method provides a recombinant eukaryotic host cell comprising a nucleic acid molecule encoding the polypeptide; preparing a membrane extract of the recombinant eukaryotic host cell; extracting the membrane. Contacting the product with a selected ligand molecule; and detecting the production level of the second messenger metabolite.

In a still further aspect, a method of screening for a ligand molecule comprises providing an adenovirus comprising a nucleic acid encoding an olfactory receptor polypeptide; infecting the olfactory epithelium with this adenovirus; Contacting with the ligand molecule; and detecting the increased response to the ligand molecule, if present.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents and other references cited herein are hereby incorporated by reference in their entireties. In case of conflict, the present specification, including definitions, will control. Furthermore, the materials, methods, and examples are illustrative only and not intended to be limiting.

Other features and advantages of the invention will be apparent from the following detailed description and claims.

DETAILED DESCRIPTION OF THE INVENTION The present invention is based, in part, on the discovery of novel nucleic acid sequences that encode novel polypeptides. These novel nucleic acids and the polypeptides they encode can be individually isolated from NOV
1, NOV2, NOV3, NOV4, NOV5, NOV6, NOV7, NOV8
, NOV9 and NOV10. These nucleic acids and the polypeptides they encode are collectively referred to herein as "NOVX."

The novel NOVX nucleic acids of the present invention are shown in Tables 1A, 1C, 1E, 2A, 2C and 2E.
2G, 3A, 4A, 4C, 5A, 6A, 7A, 8A, 9A and 10A nucleic acids of the sequences provided generically, fragments, derivatives, analogs or homologs thereof. The novel NOVX proteins of the present invention are shown in Table 1B.
1D, 1F, 2B, 2D, 1F, 2H, 3B, 4B, 5B, 6B, 7B, 8B
, 9B, and 10B, including protein fragments of the sequences provided comprehensively. Individual NOVX nucleic acids and proteins are described below. Methods of using these nucleic acids and peptides in the treatment or prevention of disorders associated with cellular signaling or metabolic pathway regulation are within the scope of the invention.

G-protein coupled receptor proteins (GPCRs) have been identified as a large family of G-protein coupled receptors in numerous species. These receptors share a seven transmembrane domain structure with many neurotransmitter and hormone receptors and appear to underlie recognition of various signals and G protein-mediated transduction. Human GPCRs generally belong to four different gene subfamilies that do not contain introns and exhibit high sequence variability. These genes are predominantly expressed in the olfactory epithelium. For example, Ben-Arie et al., Hum. Mol. Genet. 1994 3: 229-
235; and Online Mendelian Inheritance
in Man (OMIM) entry number 164342 (http: // www
． ncbi. nlm. nih. gov / entrez / dispomim. cg
See i). The olfactory receptor (OR) gene family constitutes one of the largest GPCR multigene families and is distributed among many chromosomal sites in the human genome. Rouquier et al., Hum. Mol. Genet. 7 (9): 1
337-45 (1998); Malnic et al., Cell 96: 713-23 (
1999). The olfactory receptor constitutes the largest family of G protein-coupled receptors with an estimated 1000 members. Van
derhaeghen et al., Genomics 39 (3): 239-46 (19.
97); Xie et al., Mamm. Genome 11 (12): 1070-78 (
2000); Issel-Tarver et al., Proc. Natl. Acad. S
ci. USA 93 (20): 10897-902 (1996).
The recognition of odorants by olfactory receptors is the first step in odor discrimination. Krauthurst et al., Cell 95 (7): 917-26 (1998).
See Buck et al., Cell 65 (1): 175-87 (1991). Many ORs share some characteristic sequence motifs and have central variable regions that correspond to putative ligand binding sites. Issel-Tarver et al., P
roc. Natl. Acad. Sci. USA 93: 10897-902 (1
996).

Another example of a GPCR-related seven-transmembrane protein is a chemoreceptor. T
See homas et al., Gene 178 (1-2): 1-5 (1996). Chemoreceptors have been identified in taste, olfactory, and male reproductive tissues. Id .; Walensky et al. Biol. Chem. 273 (16):
9378-87 (1998); Parmentier et al., Nature 355.
(6359): 453-55 (1992); Asai et al., Biochem. Bi
ophys. Res. Commun. 221 (2): 240-47 (1996).
checking ...

(NOV1) NOV1 comprises three novel G protein-coupled receptors (disclosed below)
“GPCR”) family of proteins. NO the disclosed protein
Named V1a, NOV1b and NOV1c, each associated with an olfactory receptor.

(NOV1a) A novel NOV1a nucleic acid was added to CuraG for GPCR probes or homologs.
T performed on Genomic Daily Files made available by GenBank using a sequence file from en Corporation
Identified on chromosome 6 by blastN. This nucleic acid is further added to program G
Predicted by enScan ^{™ including} exon selection. These further,
It was adjusted by similar means using the BLAST study. These sequences were then manually corrected for apparent discrepancies, resulting in sequences encoding the full-length protein.

The disclosed 993 nucleotide NOV1a nucleic acid (CuraGen accession number d
j408b20_B) is shown in Table 1A. The disclosed NOV1a open reading frame (“ORF”) is shown in bold in Table 1A,
It begins with the ATG start codon at nucleotides 15-17. The encoded polypeptide is referred to herein as the NOV1a polypeptide. The disclosed NOV1a ORF terminates at the TAA codon at nucleotides 954-956. As shown in Table 1A, the putative untranslated region 5'to the start codon and the putative untranslated region 3'to the stop codon are underlined. And the start and stop codons are in bold.

[0033]

[Table 1] The disclosed encoded NOV1a protein has 313 amino acid residues and is referred to as the NOV1a protein. The NOV1a protein was analyzed for signal peptide prediction and cellular localization. The SignalP results predict NOV1a to be cleaved between positions 38 and 39 of SEQ ID NO: 2 (ie, with a slash in the amino acid sequence TVT-IF). The Psort and Hydropathy profiles also show that NOV1a contains a signal peptide, and plasma membrane (confidence of 0.6000), Golgi (confidence of 0.400).
), Endoplasmic reticulum (membrane) (confidence 0.3000) and microbodies (peroxisomes) (confidence 0.3000). The disclosed NOV1a polypeptide sequences are represented in Table 1 using the single letter amino acid code.
B.

[0034]

[Table 2] (NOV1b) The previously identified target sequence, accession number dj408b20_B (NOV1a), was subjected to the exon binding process to confirm this sequence. PCR primers were designed by starting at the most upstream sequence available for the forward primer and at the most downstream sequence available for the reverse primer. In each case, from the end to the coding sequence until an appropriate sequence, either unique or highly selective, is encountered or, in the case of the reverse primer, the stop codon is reached. Scan in the direction
This sequence was tested. Such appropriate sequences were then used as forward and reverse primers in PCR amplification based on a library containing a wide range of cDNA species. The resulting amplicons were gel purified, cloned, and sequenced to a high degree of redundancy providing the following repetitive sequences. This is NOV
1b (registration number dj408b20B-1). There is one nucleotide change at position 365 of the dj408b20B-1 sequence.

The disclosed NOV1b nucleic acids of 943 nucleotides are shown in Table 1C. The open reading frame begins at the ATG start codon at nucleotides 2-4,
It was identified as ending at the AAA codon at nucleotides 938-940. In Table 1C, the putative untranslated region upstream from the start codon and the putative untranslated region downstream from the stop codon are underlined, and the start and stop codons are in bold. N
OV1b contains the Kozac sequence.

[0036]

[Table 3] The disclosed encoded NOV1b protein contains 313 amino acid residues (
It has SEQ ID NO: 4) and is called NOV1b protein. The NOV1b protein was analyzed for signal peptide prediction and cellular localization. Signa
The 1P results predict NOV1b to be cleaved between positions 38 and 39 of SEQ ID NO: 4 (ie the slash in the amino acid sequence TVT-IF). Psort and Hydropathy profiles are also NOV1
Predicting that b contains a signal peptide and may be localized to the plasma membrane (confidence 0.6000). The disclosed NOV1b polypeptide sequences are shown in Table 1D, using the one-letter amino acid code.

[0037]

[Table 4] The disclosed NOV1b proteins differ only in position 1 from the disclosed NOV1b proteins. At position 122, NOV1a has P, but NOV1b has W
Have.

(NOV1c) In the present invention, the previously identified target sequence (accession number dj408b20_B (
NOV1a)) was subjected to the exon binding process and matched the sequence. PCR primers were designed by starting with the most upstream sequence available for the forward primer and the most downstream sequence available for the reverse primer. In each case, the appropriate sequence, which is either unique or highly selective, was encountered, or in the case of the reverse primer, from each end towards the coding sequence until the stop codon was reached. This sequence was tested by walking inward. Primers can be used in silico for the entire length or portions (one or more exons) of the DNA / protein sequences of the invention.
ico) based on predicted or by translated homology of the putative exons to closely related human sequences or sequences from other species.

Then, these primers were subjected to PCR based on the following human cDNA pool.
Used in amplification: adrenal gland, bone marrow, brain-tonsils, brain-cerebellar, brain-hippocampus, brain-substantia nigra, brain-thalamus, brain-whole, fetal brain, fetal kidney, fetal liver, fetal lung, heart, kidney, kidney, Lymphoma-large, mammary gland, pancreas, pituitary gland, placenta, prostate, salivary gland, skeletal muscle, small intestine,
Spinal cord, spleen, stomach, testis, thyroid, trachea, uterus. The resulting amplicons were typically gel purified, cloned and sequenced to high redundancy. The sequences resulting from all clones were assembled on their own with other fragments in the database of CuraGen Corporation and with the published ESTs. Fragments and ESTs have a degree of 50b of their identity with other components of the assembly.
Incubated as a component for assembly if at least 95% over p. In addition, sequence signatures were manually evaluated and, where appropriate, edited for correction. These procedures provide the sequences reported below, which are NOV
1c (reception number CG50369-01). This is the previously identified N
The sequence of OV1b (accession number dj408b20_B) is as follows: position 270 (Gl
n> Arg) and 295 (Lys> Arg) with two amino acid changes.

The 956 nucleotide disclosed NOV1c nucleic acids are shown in Table 1E. The disclosed NOV1c open reading frame is the ATG of nucleotides 7-9.
It was identified that it begins at the start codon and ends at the TAA codon at nucleotides 946-948. 5'to the start codon and 3 to the stop codon
The putative untranslated region on the'side is underlined in Table 1E. And the start and stop codons are in bold type.

[0041]

[Table 5] The disclosed NOV1c amino acid residue (SEQ ID NO: 6), which has 313 amino acid residues, is shown in Table 1F using the one-letter code. Analysis using the PSORT program predicts that the NO1c protein will be localized in the plasma membrane with a certainty of 0.6000. The protein is also predicted to have a single peptide with most of the cleavage sites between residues 38 and 39 (ie shaded in TVT-IF).

[0042]

[Table 6] Disclosed NOV1c sequences and / or cDNA fragments covering the full-length DNA sequences of the invention, or a portion of the sequences, by laboratory cloning and / or
Or derived by in silico prediction of the full-length DNA sequence of the invention, or a portion of that sequence, from public human sequence databases. Laboratory cloning was performed using one or more of the methods summarized below: SeqCalling ^™ Technology: cDNA is derived from various human samples. This sample represents multiple histological types, normal and disease states, physiological states, and developmental states from different donors. Samples were obtained as whole tissue, primary cells or tissue culture primary cells or cell lines. Biological agents that regulate gene expression in cells and cell lines (eg growth factors, chemokines, or steroids)
Could be treated with. The derived cDNA was then sequenced using the CuraGen proprietary SeaCalling technology. Sequence tracing
Were manually evaluated and, where appropriate, edited for corrections. Sequence traces from all samples are collected together, sometimes including public human sequences, to produce consensus sequences for each assembly using bioinformatics programs. Include each assembly in the CuraGen Corporation database. The sequence was included as a component for assembly, where the degree of identity with another component was at least 95% over 50 bp. Each assembly represents a gene or portion thereof and contains information for variants, such as splicing to form single nucleotide polymorphisms (SNPs), insertions, deletions, and other sequence variants.

Exon ligation: Polymerase chain reaction (PCR) using the following primers
Cloned by: GAATTTGGGTAAATGACAGCATC (
SEQ ID NO: 32) and TTAGCAAAGCTTATCATTTGC (SEQ ID NO: 33). These primers were used to amplify cDNA from pools containing expressed human sequences derived from the following tissues: adrenal gland, bone marrow, brain-tonsils, brain-cerebellar, brain-hippocampus, brain-substantia nigra, brain-. Thalamus, brain-whole, fetal brain, fetal kidney, fetal liver, fetal lung, heart, kidney, lymphoma-large, mammary gland, pancreas, pituitary gland, placenta, prostate, salivary gland, skeletal muscle, small intestine, spinal cord, spleen, stomach, Testis, thyroid, trachea, and uterus.

Primers are deduced based on in silico predictions for the full length or portions (one or more exons) of the DNA / protein sequences of the invention, or for closely related human sequences or sequences from other species. Designed by the translated homology of exons. Usually, multiple clones were sequenced to drive this sequence, which was then constructed similarly to the SeqCalling process. In addition, sequence traces were manually evaluated and, where appropriate, edited for correction.

Physical clones: PCR products driven by exon binding were cloned into Invit
It was cloned into the pCR2.1 vector from Rogen. Bacterial clone dj4
08B20_B. 698008. B11 is PCR2 manufactured by Invitrogen
． It has an insert that covers the entire open reading frame cloned into 1.

Variant sequences are also included in this application. The variant sequence contains a single nucleotide polymorphism (SNP). In some examples, SNPs are referred to as "cSNPs" and refer to a nucleotide sequence that includes the SNP starting as a cDNA. SNP
Occurs in several ways. For example, a SNP can result from the substitution of another nucleotide for another nucleotide at a polymorphic site. Such substitutions can either be at transfer positions or at transversions. SNPs also result from nucleotide deletions, as well as nucleotide insertions, associated with a reference allele. In this case, a polymorphic site is a site that is one allele that creates a gap in identity at another allele. The SNP present in the gene results in a change in the amino acid encoded by the gene at the SNP's position. However, SNPs within a gene are SNs that encode the same amino acid as a result of redundancy in the genetic code.
If it is a codon containing P, it is silent. SNPs that are located outside of the region of the gene or located within the gene may result in altered regulation of expression patterns (eg, changes in expression over time, physiological response control, cell-type expression control). , Expression intensity, transcriptional message stability).

The NOV1c disclosed herein is expressed in at least the following tissues: microvilli at the tip of the retinal pigment epithelium, arteries (aorta), basal forebrain, brain, Burkitt lymphoma cell line, brain Trabeculae, heart (atria and chambers), caudate, CNS and peripheral tissues,
Cerebellum, cerebral cortex, colon, cortical neurons, endothelial (coronary and umbilical vein) cells, palate epithelium, eye, neonatal eye, frontal cortex, fetal hematopoietic cells, heart, hippocampus, hypothalamus, white blood cells, liver, fetal liver, Lung, lung lymphoma cell line, fetal lymphoid tissue, adult lymphoid tissue, tissue expressing MHCII and III, nerve tissue, medulla, subthalamic nucleus, ovary, pancreas, pituitary gland, placenta, pons, prostate, putamen, Serum, skeletal muscle, small intestine, smooth muscle (coronary arteries in the aorta), spinal cord, spleen, stomach, tongue taste receptor cells, testis, thalamus,
And thymus tissue. This information includes but is not limited to SeqCalling sources, public EST sources, literature sources, and / or RACE sources,
Derived by determining the tissue source of the sequences included in the present invention.

At the following positions, one or more consensus positions (Cons. Pos.) Of the GPCR4a3 nucleotide sequence have been identified as SNPs. “Depth” indicates the number of clones covering the region of SNP. Estimated allele frequency (Put
active Allele Freq. ) Is a fraction of all clones containing SNP. When indicated, a dash ("-") means that the base is absent. The symbol “>” means “changed to”. Cons. Pos. : 42 depth: 43 change: T> C, Putative Allele Freq. : 0.070 Cons. Pos. : 59 depth: 43 change: T> C, Putative Allele Freq. : 0.047 Cons. Pos. : 60 Depth: 43 Change: T> C, Putative Allele Freq. : 0.070 Cons. Pos. : 136 Depth: 41 Change: T> C, Putative Allele Freq. : 0.049 Cons. Pos. 137 Depth: 41 Change: T> C, Putative Allele Freq. : 0.049 Cons. Pos. : 142 Depth: 41 Change: T> C, Putative Allele Freq. : 0.073 Cons. Pos. 194 Depth: 41 Change: T> C, Putative Allele Freq. : 0.098 Cons. Pos. : 244 Depth: 41 Change: T> C, Putative Allele Freq. : 0.049 Cons. Pos. : 276 Depth: 41 Change: T> C, Putative Allele Freq. : 0.049 Cons. Pos. : 300 Depth: 41 Change: T> C, Putative Allele Freq. : 0.049 Cons. Pos. : 305 depth: 41 change: T> C, Putative Allele Freq. : 0.049 Cons. Pos. : 315 Depth: 41 Change: T> C, Putative Allele Freq. : 0.049 Cons. Pos. : 374 Depth: 49 Change: T> C, Putative Allele Freq. : 0.061 Cons. Pos. : 384 Depth: 51 Change: A> G, Putative Allele Freq. : 0.039 Cons. Pos. : 390 Depth: 55 Change: T> C, Putative Allele Freq. : 0.036 Cons. Pos. : 405 Depth: 56 Change: A> G, Putative Allele Freq. : 0.036 Cons. Pos. : 508 Depth: 60 Change: G> A, Putative Allele Freq. : 0.050 Cons. Pos. : 510 Depth: 60 Change: A> G, Putative Allele Freq. : 0.050 Cons. Pos. : 518 Depth: 59 Change: C> T, Putative Allele Freq. : 0.034 Cons. Pos. : 681 Depth: 39 Change: T> C, Putative Allele Freq. : 0.051 Cons. Pos. : 795 Depth: 40 Change: G> A, Putative Allele Freq. : 0.050 NOV1c may have important structural and / or pathological functional properties of the GPCR family. Therefore, the nucleic acids and proteins of the invention are useful in potential diagnostic and therapeutic applications, and as research tools. They serve as specific or selective nucleic acid or protein diagnostics and / or prognostic markers, where the presence or amount of nucleic acid or protein is assessed and in potential therapeutic applications such as: ( i) protein therapy, (ii) small molecule drug target, (iii) antibody target (therapeutic antibody, diagnostic antibody, drug labeled / cytotoxic antibody), (iv) nucleic acid useful for gene therapy (gene delivery / Gene excision),
(V) a composition that promotes tissue regeneration in vitro and in vivo, and (vi) a bioprotective agent.

The NOV1 nucleic acids and proteins of the present invention are useful in potential diagnostic or therapeutic applications associated with the various diseases and disorders and / or other pathologies described below. For example, the compositions of the invention have efficacy for the treatment of patients suffering from: developmental disorders, MHC II and III disorders (immune disorders), impaired taste and olfactory sensing, Burkitt lymphoma, corticoneurogenic. Disease (corticoneurogenic disease), signal transduction pathway disorder, disease of retinal including retinal related to photoreceptor, cell proliferation rate disorder, cell morphological disorder, eating disorder, potential obesity caused by overeating, potential caused by starvation Disorders (anorexia), non-insulin dependent diabetes mellitus (mellit)
us) (NIDDM1), bacterial infections, fungal infections, protozoal infections, and viral infections (especially infections caused by HIV-1 or HIV-2), pain, cancer (neoplasm; adenocarcinoma; lymphoma; prostate cancer; Uterine cancer), anorexia nervosa, bulimia nervosa, asthma, allergy, Parkinson's disease, acute heart failure, hypotension, hypertension, urethral stasis, osteoporosis, Crohn's disease, multiple sclerosis, allbright hereditary bone dysplasia, angina , Myocardial infarction, ulcer, benign prostatic hypertrophy, psychotic disorders and neurological disorders (anxiety, schizophrenia,
Depression (including maniac depression, delirium, dementia, and severe mental retardation), spinocerebellar degeneration
doluisian atrophy (DRPLA), hypophosphatemic rickets, autosomal dominant (aut)
(2) acrocallosal syndrome and dyskinesia (eg, Huntington's disease or Gilles de la Tourette's syndrome and / or other such pathologies and disorders). This polypeptide is
It can be used as an immunogen, produces antibodies specific for the invention, and can be used as a vaccine. They can also be used to screen potential agonist and antagonist compounds. For example, cDNAs encoding OR-like proteins can be used in gene therapy, and OR-like proteins can be useful when administered to patients in need thereof. As a non-limiting example,
The compounds of the present invention treat patients suffering from: bacterial infections, fungal infections, protozoal infections, and viral infections, especially infections caused by HIV-1 or HIV-2.
, Pain, cancer (neoplastic; adenocarcinoma; lymphoma; prostate cancer; uterine cancer), anorexia nervosa, bulimia nervosa,
Asthma, allergies, bulimia, Parkinson's disease, acute heart failure, hypotension, hypertension,
Urethral stasis, osteoporosis, Crohn's disease, multiple sclerosis, and the following: Albright hereditary dysplasia, angina, myocardial infarction, ulcer, benign prostatic hypertrophy, psychotic disorders and neurological disorders (anxiety, mental Schizophrenia, depression (maniac depre)
ssion), delirium, dementia, and severe mental retardation), and acr
It has efficacy against the treatment of ocallosal syndrome and dyskinesia (eg, Huntington's disease or Gilles de la Tourette's syndrome and / or other such pathologies and disorders). The novel nucleic acids encoding the OR-like proteins of the invention, and the OR-like proteins of the invention, or fragments thereof, are further useful in diagnostic applications, where the presence and amount of the nucleic acid or protein is assessed. .

Amino acid differences in the three NOV1 proteins are shown in Table 1G. Differences in the three proteins appear to be localized in several distinct regions. Thus, these proteins have similar functions (see below) such as olfactory or chemokine receptors.

[0051]

[Table 7] In all BLAST alignments described herein, "E value (E
The "value" or "Expect" value is a numerical indication of the probability that the alignment will just accidentally achieve these similarities to the BLAST query sequence in the searched database. All B's described herein
LAST analysis was performed using the NOV1 amino acid sequence. As above, N
Amino acid differences in OV1a, NOV1b, and NOV1c were limited to distinct amino acids (eg, positions 122, 270, and 295).

BLASTX searches were performed against public protein databases. The full length amino acid sequence of the protein of the present invention is dJ40 of 333 amino acids.
8B20.2 (a novel 7-transmembrane olfactory receptor protein derived from Homo sapiens), 313 of 313 residues are the same (100%), and 313 of 313 residues (100%). ) Was found to be positive (
emb | CAC14158.1 (AL133267), E = e-177). The disclosed NOV1a protein (SEQ ID NO: 2) also has sufficient identity with the olfactory receptor protein. For example, the disclosed NOV1a is a 357 amino acid Homo sapiens olfactory receptor (emb | CAC20513.1).
(AJ302593) 25 for protein (Expect = e-143))
Hom of 4/310 (81%) amino acids identical and 310 amino acids
o sapiens olfactory receptor (emb | CAB11427.1 (Z987
44)) has 253/310 (81%) amino acid identity (Expect =
e-142). The disclosed proteins are also similar to the olfactory proteins disclosed in Table 1H.

[0053]

[Table 8] OR protein sequences related to the disclosed proteins of the invention (BLASTX
Analysis of ClustalW (determined by analysis) is given in Table II, where NOV1a is in the first row.

[0054]

[Table 9] The ClustalW alignment of the NOV1 protein, like all other ClustalW analyzes herein, requires that the amino acid residues with the black borders be conserved regions (eg, conserved structural or functional properties). Region), while the non-inverted display of amino acid residues is less conserved and can potentially be mutated extensively without altering the structure or function of the protein. NOV1a, NOV
Any reference to NOV1 is meant to encompass all variants unless specifically referred to as 1b, or NOV1c. Any N in this specification
Residue differences between the OVX variant sequences differ from those in the "one" variant by one residue.
Is described to indicate this residue position for the variant. NOV residues in all the following sequence alignments that differ between individual NOV variants are marked with the symbol (O) above the variant residues in all alignments.
For example, the protein shown in line 1 of Table II has the sequence shown for NOV1a and the positions different from NOV1b and NOV1c are marked by the symbol (O) (eg positions 122, 270, and 295).

The presence of identifiable domains in NOV1 is similar to other NOVX proteins in that searches using software algorithms such as PROSITE, DOMAIN, Blocks, Pfam, Prodom, and Prints, followed by I.
interpro website (http: www.ebi.ac.uk/int)
erpro) Inter according to the combination of domain matches (or numbers) used
It was determined by determining the pro number. For example, DOMAIN for NOV1a
Results were collected from the Conserved Domain Database (CDD) using the Reverse Position Specific BLAST analysis. This BLAST analysis software uses Smart and Pf
Sample the domains found in am's collection. Fully conserved single residues are indicated by black shading and "strong" semi-conserved residues are indicated by gray shading for all consecutive DOMAIN sequence alignments. A “strong” group of conserved residues is one of the following groups of amino acids: STA, NEQK, NHQK, NDEQ, QHRK, MILV, MILF,
HY, FYW.

The region from amino acid residues 41-243 (SEQ ID NO: 2) most likely contains the "7-transmembrane receptor (rhodopsin family) fragment" domain, where this is the 7tm_1 entry of the Pfam database (TM7, sequence Number 3
It is aligned with residues 1 to 187 of 9). This has similar properties with respect to the properties of the protein whose NOV sequence is known to contain this domain and the 377 amino acid 7tm itself. NOV1 also has identity to another region of the TM7 protein. The region of amino acid residues 223 to 290 (SEQ ID NO: 2) is aligned with the amino acid residues 309 to 377 of TM7 (E = 0.003). Table 1
J shows the results of domain analysis of NOV1 and TM7 proteins.

[0057]

[Table 10] A representative member of the 7-transmembrane receptor family is Bos taurus
Origin D2 dopamine receptor (SWISSPROT: locus D2DR_BO
VIN, registration P20288; gene index 118205). D2
The receptor family is an integral membrane protein and belongs to family 1 of G protein coupled receptors. The activity of the D2 receptor is mediated by G proteins that inhibit adenyl cyclase. Chio et al. Nature 34
3: 255-269 (1990). Residues 51 to 444 of this 444 amino acid protein
427 is considered a representative TM7 domain and is shown in Table 1K.

[0058]

[Table 11] The 7-transmembrane receptor family contains many different proteins (
For example, serotonin receptor, dopamine receptor, histamine receptor,
Adrenergic receptor, cannabinoid receptor, angiotensin receptor, chemokine receptor, opioid receptor, G protein coupled receptor (GPCR) protein, olfactory receptor (O
R), etc.). Some proteins and Protein Data Bas
The e identifier (Id) / gene index includes, for example, the following: rhodopsin (129209); 5-hydroxytryptamine receptor; (11282)
1, 8488960, 112805, 231454, 1168221, 3989
71, 112806); G protein coupled receptor (119130, 5438).
23, 1730143, 132206, 137159, 6136153, 416
926, 1169881, 136882, 134079); taste receptor (5
44463, 462208); c-x-c chemokine receptor (416718)
, 128999, 416802, 548703, 1352335); opsin (
129193, 129197, 129203); and olfactory receptor-like proteins (1290901, 1171893, 400672, 548417).

Expression information for NOV1 RNA is derived using tissue sources including, but not limited to: proprietary database sources, public EST sources,
Literature source and / or RACE source.

NOV1 nucleic acids and proteins are associated with various NOV or olfactory receptors (O
R) Useful in potential therapeutic applications related to related symptoms and / or disorders. For example, a cDNA encoding a G protein-coupled receptor-like protein
Can be useful in gene therapy, and G-protein coupled receptor-like proteins can be useful when administered to a subject in need thereof. N
The novel nucleic acids encoding the OV1 protein, as well as fragments thereof, may be further useful in diagnostic applications, where the presence or amount of nucleic acid or protein is assessed. These agents are further useful in the production of antibodies that immunospecifically bind to the novel agents of the invention for use in therapeutic or diagnostic methods. The NOV1 nucleic acids and proteins are useful in potential diagnostic and therapeutic applications related to the various diseases and disorders and / or other conditions described below. For example, the compositions of the present invention have efficacy for the treatment of patients suffering from: cardiomyopathy, atherosclerosis, hypertension, congenital heart disease, aortic stenosis, atrial septal defect (ASD). Atrioventricular (A-V) tube defect, arterial tube, pulmonary valve stenosis, subaortic stenosis, ventricular septal defect (VSD), valve disease, tuberous sclerosis, scleroderma, obesity, transplant, Adrenoleukodystrophy, congenital adrenal hyperplasia, fertility, hemophilia, hypercoagulability, idiopathic thrombocytopenic purpura, immunodeficiency, graft-versus-host disease, bronchial asthma, and similar other disorders and disorders. , And state. By way of non-limiting example, the compositions of the invention have efficacy for the treatment of patients suffering from: neoplasia, adenocarcinoma, lymphoma, prostate cancer, uterine cancer, immune response, AIDS, asthma, Crohn's disease. , Multiple sclerosis, and allbright hereditary dysplasia. Further NO
V-related diseases and disorders are mentioned throughout the specification.

In addition, protein similarity information, expression patterns, and map arrangements for NOV1 suggest that NOV1 may have important structural and / or physiological functional characteristics of the NOV family. Accordingly, the nucleic acids and proteins of the invention are useful in potential diagnostic and therapeutic applications and as search tools. These include functioning as specific or selective nucleic acid or protein diagnostic and / or prophylactic markers, where the presence or amount of nucleic acid or protein is assessed, and potential therapeutic applications such as: :
(I) protein therapeutic agent, (ii) small molecule drug target, (iii) antibody target (therapeutic, diagnostic, drug target / cytotoxic antibody), (iv) nucleic acid useful for gene therapy (
Gene delivery / gene excision), and (v) compositions that promote tissue regeneration in vitro and in vivo, (vi) biological defense weapons.

These agents are further useful in the generation of immunospecifically binding antibodies of the novel NOV1 agents for use in therapeutic or diagnostic methods.
These antibodies can be produced according to methods known in the art, using predictions from the hydrophobicity chart, as described in the "Anti-NOV Antibodies" section below.

(NOV2) NOV2 is one of four novel G protein-coupled receptors (““
GPCR ") family of proteins. The disclosed protein is N
They have been named OV2a, NOV2b, NOV2c and NOV2d, and these proteins are associated with olfactory receptors, respectively.

NOV2a The disclosed 960 nucleotide NOV2a nucleic acids are shown in Table 2A (Cur).
aGen accession number 6-L-19-D). The disclosed NOV2a open reading frame ("ORF") begins at the ATG start codon at nucleotides 14-16, shown in bold in Table 2A. The encoded polypeptide is N
Referenced herein as OV2a polypeptide. This disclosed NOV2
The a ORF ends at the TAG codon at nucleotides 955-957. As shown in Table 2A, the 5'side of the putative untranslated region to the start codon and the 3'side of the putative untranslated region to the stop codon are underlined and the start and stop codons are in bold.

[0065]

[Table 12] The open reading frame (ORF) for NOV2a was identified from nucleotides 14-955. The disclosed NOV2a polypeptide encoded by SEQ ID NO: 7 (SEQ ID NO: 8) is 314 amino acid residues and is provided in Table 2B using the single letter code. The NOV2a protein was analyzed for signal peptide prediction and cell localization. The SignalPep results predict NOV2a is cleaved between position 43 and position 44 of SEQ ID NO: 8 (ie at the slash in the amino acid sequence VVG-NL).
The Psor and Hydropathy profiles also indicate that NOV2a contains a signal peptide and appears to localize to the plasma membrane (0.6000).
, Or the Golgi body with a lower certainty.

[0066]

[Table 13] A novel nucleic acid is used by TblastN, using the sequence files of CuraGen Corporation for GPCR probes and homologs, and made available by GenBank to the Genomic Dairy Fi.
It was performed on les and identified on chromosome 11. This nucleic acid was further predicted by the program GenScan ^™ , which included exon selection. These were further modified by similarity using the BLAST search. These sequences were then manually corrected for apparent discrepancies, resulting in sequences encoding the full-length protein.

(NOV2b) The target sequence identified above as NOV2a (Accession No. 6_L_19_D) was subjected to the exon binding process to confirm this sequence. PCR primers were designed by starting at the most upstream sequence available for the forward primer and the most downstream sequence available for the reverse primer. In each case, from the end to the coding sequence until an appropriate sequence, either unique or highly selective, is encountered or, in the case of the reverse primer, the stop codon is reached. This sequence was tested by scanning in the orientation. Such appropriate sequences were then used as forward and reverse primers in PCR amplification based on an extensive cDNA library. The resulting amplicon was gel purified, cloned, and sequenced to high redundancy to provide the sequence reported below, designated NOV2b (Accession No. 6_L_19_D_da1). The resulting nucleotide sequence differs from that of NOV2a at nucleotides 344 and 900.

The disclosed 954 nucleotide NOV2a nucleic acids are shown in Table 2C. The disclosed NOV2b open reading frame ("ORF") begins at the ATG start codon at nucleotides 7-9, shown in bold in Table 2C. The encoded polypeptide is referred to herein as the NOV2b polypeptide. The disclosed NOV2b ORF ends at the TGA codon at nucleotides 949-951. As shown in Table 2C, the 5'side of the putative untranslated region to the start codon and the 3'side of the putative untranslated region to the stop codon are underlined, and the start and stop codons are in bold.

[0069]

[Table 14] The open reading frame (ORF) for NOV2b was identified from nucleotides 7-949. Disclosed N encoded by SEQ ID NO: 9
The OV2b polypeptide (SEQ ID NO: 10) is 314 amino acid residues and is provided using the single letter code in Table 2D. The NOV2b protein was analyzed for signal peptide prediction and cell localization. The SignalPep results predict NOV2b is cleaved between position 43 and position 44 of SEQ ID NO: 10 (ie at the slash in the amino acid sequence VVG-NL). The Psor and Hydropathy profiles also predict whether NOV2b contains a signal peptide and appears to localize to the plasma membrane (certainty of 0.6000).

[0070]

[Table 15] (NOV2c) The target sequence identified above as NOV2a (Accession No. 6_L_19_D) was subjected to the exon binding process to confirm this sequence. PCR primers were designed by starting at the most upstream sequence available for the forward primer and the most downstream sequence available for the reverse primer. In each case, from the end to the coding sequence until an appropriate sequence, either unique or highly selective, is encountered or, in the case of the reverse primer, the stop codon is reached. This sequence was tested by scanning in the orientation. Such primers are used for in silico prediction of full-length cDNA, DNA
Was designed based on the protein sequence of a portion (one or more exons) or target sequence, or by the translational homology of the putative exon to closely related human sequences or sequences from other species.

These primers were then PCR-based on the following pool of human cDNAs:
Used in amplification: adrenal gland, bone marrow, brain-tonsils, brain-cerebellar, brain-hippocampus, brain-substantia nigra,
Brain-thalamus, brain-whole, fetal brain, fetal kidney, fetal liver, fetal lung, heart, kidney, lymphoma-Raji, mammary gland, pancreas, pituitary gland, placenta, prostate, salivary gland, skeletal muscle, small intestine,
Spinal cord, spleen, stomach, testis, thyroid, trachea, uterus. Usually, the resulting amplicons were gel purified, cloned and sequenced to high redundancy. The sequences obtained from all the clones were compared to each other, CuraGen Corporation.
n with other fragments in the database and with the public EST. Fragments and ESTs were included as components for construction if the degree of identity of the fragments and ESTs with another component of the construction was at least 95% over 50 bp. In addition, the rest of the sequence was manually evaluated and, if appropriate, edited for correction. These procedures provided the sequences reported below, designated NOV2c and NOV2d. NOV2c and N
OV2d is bp: 344, 386, 900 (NOV2d; 6_L_19_D_
da1) and 344,386 (NOV2c; 6_L_19_D_da2), which differ from the above identified sequence (NOV2a).

The disclosed 954 nucleotide NOV2c nucleic acids are shown in Table 2E. The disclosed NOV2c open reading frame ("ORF") begins at the ATG start codon at nucleotides 7-9, shown in bold in Table 2E. The encoded polypeptide is referred to herein as the NOV2c polypeptide. The disclosed NOV2c ORF ends at the TGA codon at nucleotides 949-951. As shown in Table 2E, the 5'side of the putative untranslated region to the start codon and the 3'side of the putative untranslated region to the stop codon are underlined and the start and stop codons are in bold.

[0073]

[Table 16] An open reading frame (ORF) for NOV2c was identified at nucleotides 7-949. Disclosed N encoded by SEQ ID NO: 11
The OV2c polypeptide (SEQ ID NO: 12) is 314 amino acid residues and is provided in Table 2F using the single letter code. The NOV2c protein was analyzed for signal peptide prediction and cell localization. The SignalPep results predict NOV2c is cleaved between positions 43 and 44 of SEQ ID NO: 12 (ie, at the slash in the amino acid sequence VVG-NL). Ps
or and Hydropathy profiles also predict that NOV2b contains a signal peptide and appears to localize to the plasma membrane (0.
6000 certainty).

[0074]

[Table 17] Possible SNPs for the disclosed NOV2c include:

[0075]

[Equation 18] (NOV2d) The disclosed 954 nucleotide NOV2d nucleic acids are shown in Table 2G. The disclosed NOV2d open reading frame ("ORF") begins at the ATG start codon at nucleotides 7-9, shown in bold in Table 2G. The encoded polypeptide is alternatively referred to herein as the NOV2d polypeptide. The disclosed NOV2d ORF contains nucleotides 949-951.
It ends with the TGA codon. 5'to the start codon, as shown in Table 2G
The putative untranslated region 3'to the side and stop codon is underlined. And the start and stop codons are in bold. The nucleic acid sequence of NOV2d differs from NOV2b at position 386, which is C in NOV2b and T in NOV2d.

[0076]

[Table 19] An open reading frame (ORF) for NOV2d was identified at nucleotides 7-949. Disclosed N encoded by SEQ ID NO: 13
The OV2d polypeptide (SEQ ID NO: 14) is 311 amino acid residues and is provided in Table 2H using the single letter code. The NOV2d protein was analyzed for signal peptide prediction and cell localization. The SignalPep results predict NOV2d is cleaved between positions 43 and 44 of SEQ ID NO: 14 (ie, at the slash in the amino acid sequence VVG-NL). P
The sor and Hydropathy profiles also predict that NOV2b contains a signal peptide and appears to localize to the plasma membrane (0.
． 6000 certainty).

[0077]

[Table 20] Possible SNPs for the disclosed NOV2d include:

[0078]

[Table 21] The NOV2 nucleic acids and proteins of the present invention may also be used for infections such as bacterial, fungal, protozoal and viral infections (particularly HIV-1 or HIV-2).
Infection, pain, cancer (including but not limited to neoplasm; adenocarcinoma; lymphoma; prostate cancer; uterine cancer), anorexia, bulimia, asthma, Parkinson's disease,
Acute heart failure, hypotension, hypertension, urinary retention, osteoporosis, Crohn's disease; treatment of multiple sclerosis; and allbright hereditary dysplasia, angina, myocardial infarction, ulcer, asthma, allergy, benign prostate Hypertrophy and psychotic and neurological disorders (anxiety, schizophrenia, manic depression, delirium, dementia, severe mental retardation and movement disorders (
(E.g. Huntington's disease or Gilles de la Tourette's syndrome)) and / or other pathologies and disorders are used in potential therapeutic applications. This polypeptide can be used as an immunogen for producing antibodies specific for the invention and as a vaccine. These can also be used to screen for potential agonist and antagonist compounds. For example, a cDNA encoding a GPCR-like protein can be useful in gene therapy, and a GPCR-like protein can be useful when administered to a subject in need. By way of non-limiting example, compositions of the invention may be used for infections such as bacterial, fungal, protozoal and viral infections (particularly HIV-
1 or infection caused by HIV-2, pain, cancer (including but not limited to)
Neoplasm; adenocarcinoma; lymphoma; prostate cancer; including uterine cancer), anorexia, bulimia, asthma, Parkinson's disease, acute heart failure, hypotension, hypertension, urinary retention, osteoporosis, Crohn's disease; multiple sclerosis Treatment of patients suffering from illness; and Albright hereditary dysplasia, angina, myocardial infarction, ulcers, asthma, allergies, benign prostatic hypertrophy, and psychotic and neurological disorders (anxiety, schizophrenia, manic Efficacy for treating patients suffering from depression, delirium, dementia, severe mental retardation and movement disorders (including, for example, Huntington's disease or Gilles de la Tourette's syndrome) and / or other pathologies and disorders . GPCR protein of the present invention, and GP
The novel nucleic acids encoding CR-like proteins or fragments thereof may also be useful in diagnostic applications, where the presence or amount of this nucleic acid or protein is assessed. These agents are further useful in the generation of antibodies that immunospecifically bind to the novel agents of the invention for use in therapeutic and diagnostic methods.

Amino acid differences between the three NOV2 proteins are shown in Table 2I. The differences between the three proteins appear to be localized in a few different areas. Thus, these proteins have similar functionality (eg, olfactory or chemokine receptors (
(See below)).

[0080]

[Table 22] In all BLAST alignments herein, the "E-value" or "expected" value is a numerical representation of the probability that the aligned sequences are simply by chance in the searched database, the BLAST query sequence. To reach their similarity to. All BLAST analyzes described herein were performed using the NOV2a amino acid sequence. As described above, NOV2a, NOV2b, NOV2c
, And NOV2d nucleic acid sequences differ in that the interspersed nucleotides (eg,
344th, 386th and 900th).

BLASTX searches were performed against public protein databases. The amino sequence of the protein of the present invention has the amino acid sequence of Homo sapiens olfactory receptor protein (gi | 3831598 | gbAAC7005.1 | (AF065860).
), E = 2e-69), 159 of 214 amino acid residues have the same amino acid (74%), and 181 of 214 residues have 181 positive residues (84%). Found to have. The disclosed proteins are listed in Table 2.
It is similar to the olfactory receptor protein disclosed in J.

[0082]

[Table 23] Clusta comparing the disclosed proteins of the present invention to OR protein sequences
The 1W analysis (as determined by BLASTX analysis) is given in Table 2K, N
OV2a is shown in the first line.

[0083]

[Table 24] In the ClustalW alignment of the NOV2 protein, as well as all other ClustalW analyzes disclosed herein, the black outlined amino acid residues conserve a region of conserved sequence (ie, a structural or functional property). Regions which may be required), but which are not highlighted are less conserved and can potentially be more extensively mutated without altering the structure or function of the protein. Although not specifically referred to as NOV2a, NOV2b, NOV2c or NOV2d, any reference to NOV2 is considered to include all variants. Residue differences between any NOVX variant sequences herein are written to indicate residues in the "a" variant and residue positions with respect to the "a" variant. NOV residues in all alignments of the following sequences that differ between individual NOV variants are marked with an (o) symbol above all aligned variant residues herein. For example, the protein shown in the first row of Table 2K is NO
Positions showing the sequence for V2a and differing in NOV2, NOV2c and NOV2d are marked with (o) symbols (eg positions 130 and 147).
Rank).

The existence of identifiable domains in NOV2, as well as in all other NOVX proteins, is determined by software algorithms (eg PROSITE, DOMAI).
N, Blocks, Pfam, ProDomain, and Prints), and then the Interpro number is a horizontal line to the domain match (or number) using the Interpro website (http: www.ebi.ac.uk/interpro). Determined by subtracting. For example, the DOMAIN result for NOV2a is the Reverse Positi
on Specific BLAST analysis using Conserved Do
Collected from main Database (CDD). This BLAST analysis software sample samples the domains found in the Smart and Pfam collections. In all consecutive DOMAIN sequence alignments, single residues that are perfectly conserved are indicated by black shades and "strong" semi-conserved residues are indicated by gray shades. The "strong" group of conserved amino acid residues can be any one of the following groups of amino acids: STA, NEQK, NHQK, ND.
EQ, QHRK, MILV, MILF, HY, FYW.

[0085]   The region of amino acid residues 43-231 (SEQ ID NO: 8) is most likely (E = 2e ^-19 ), "7 transmembrane receptor (rhodopsin family) fragment"
In, which is referred to herein as 7tm_1 ent in the Pfam database.
Aligned with residues 1-170 of ry (TM7, SEQ ID NO: 39). This is
, The NOV2 sequence is unique to other proteins known to contain this domain.
Sex and properties similar to those of the 377 amino acid 7tm domain itself.
Indicates having. Table 2 shows the results of NOV2 protein and TM7 protein.
Indicates.

[0086]

[Table 25] A representative member of the 7-transmembrane receptor family is Bos tauru.
s-derived D2 dopamine receptor (SWISSPROT: locus D
2DR_BOVIN, registration number P20288; gene index 118205
). This D2 receptor is an essential membrane protein and belongs to the family 1 of G protein coupled receptors. The activity of the D2 receptor is mediated by the G protein, which inhibits adenylyl cyclase. Chio et al., Nat
ure 343: 255-269 (1990). Residues 51-427 of this 444 amino acid protein are believed to be a typical TM7 domain and are shown in Table 2M.

[0087]

[Table 26] The 7-transmembrane receptor family comprises a number of different proteins including, for example, serotonin receptors, dopamine receptors, histamine receptors, adrenergic receptors, cannabinoid receptors, angiotensin II receptors, chemokine receptors, opioid receptors, G proteins. Examples include coupled receptor (GPCR) protein, olfactory receptor (OR) and the like. Some proteins and protein database Ids / gene indexes include, for example, rhodopsin (129209); 5-hydroxytryptamine receptor (112821, 8488860, 112805, 231).
454, 1168221, 398971, 112806); G protein coupled receptor (119130, 543823, 1730143, 132206, 13).
7159, 6136153, 416926, 1169881, 136882, 1
34079); taste receptor (5444463, 462208); c-x-c chemokine receptor (416718, 128899, 416802, 54870).
3, 1352335); Opsin (129193, 129197, 129203)
); And olfactory receptor-like proteins (1290901, 1171893, 4)
00672, 548417).

The homology of this NOV2 to the olfactory receptor is due to the fact that the endogenous small molecule ligand regulates this gene, so that a drug structurally similar to this endogenous ligand is NOV2.
It is possible to act as agonists and antagonists to regulate the biological effects of 2.

NOV2 nucleic acids and proteins are useful in potential therapeutic applications involving a variety of NOV-related or olfactory receptor (OR) -related pathologies and / or disorders. For example, a cDNA encoding a G protein-coupled receptor-like protein can be useful in gene therapy, and a G protein-coupled receptor-like protein can be useful when administered to a subject in need thereof. The novel nucleic acids encoding NOV2 or fragments thereof may also be useful in diagnostic applications, where the presence or amount of nucleic acid or protein is assessed. These materials are further useful in the production of antibodies that immunospecifically bind to the novel agents of the invention for use in therapeutic or diagnostic methods. NOVX nucleic acids and proteins are useful in potential diagnostic and therapeutic applications involving the various diseases and disorders and / or other medical conditions described below. For example, the compositions of the present invention are effective in treating patients suffering from: cardiomyopathy, atherosclerosis,
Hypertension, congenital heart defect, aortic stenosis, atrial septal defect (ASD), atrioventricular (A-V) duct defect, arterial duct, pulmonary stenosis, subaortic stenosis (subaor)
tic stenosis), ventricular septal defect (VSD), valve disease, tuberous sclerosis, scleroderma, obesity, transplantation, adrenoleukodystrophy, congenital adrenal hyperplasia, fertility, hemophilia, Hypercoagulation, idiopathic thrombocytopenic purpura, immunodeficiency, graft-versus-host disease, bronchial asthma, and other diseases, disorders and conditions. By way of non-limiting example, the compositions of the present invention may be used in neoplasms, adenocarcinomas, lymphomas, prostate cancers, uterine cancers, immune responses, AIDS, asthma, Crohn's disease, multiple sclerosis, and Albright H.
It has an effect on the treatment of patients suffering from ereditary bone dystrophy. Additional NOV-related diseases and disorders are mentioned throughout the specification.

In addition, NOV2 protein similarity information, expression patterns, and map location suggest that NOV2 may have important structural and / or physiological functions characteristic of the NOV family. Thus, the nucleic acids and proteins of the invention are useful as potential diagnostic and therapeutic applications and research tools. These include acting as specific or selective nucleic acid or protein diagnostic and / or prognostic markers, where the presence or amount of nucleic acid or protein is assessed, and potential therapeutics such as: Applications include: (i) protein therapeutics, (ii) small molecule drug targets, (iii) antibody targets (
Therapeutics, diagnostics, drug targeting / cytotoxic antibodies), (iv) nucleic acids useful in gene therapy (gene delivery / gene removal), and (v) in vitro and in vivo composition-enhanced tissue regeneration, (vi) biology Defense weapon.

These materials are further useful in the production of antibodies that immunospecifically bind to novel NOV2 agents for use in therapeutic or diagnostic methods. These antibodies can be made according to methods known in the art by estimation from the hydrophobicity chart, as described in the "Anti-NOVX Antibodies" section below.

(NOV3) A further NOV-like protein of the present invention (referred to herein as NOV3).
Is an olfactory receptor (OR) -like protein. The new nucleic acid is GenBank
Run against a Genomic Daily File available from G
Identified on Chromosome 11 by TblastN using the CuraGen sequence file for PCR probes or homologues. This nucleic acid was further deduced by the program GenScan ^™ (including exon selection). These were further modified by similarity using the BLAST search. This sequence was then manually corrected for apparent discrepancies, resulting in the sequence encoding the full length protein.

A novel nucleic acid of 957 nucleotides encoding a novel olfactory receptor-like protein (6-L-19-E, SEQ ID NO: 15) is shown in Table 3A. Nucleotides 13-1
An open reading frame (ORF) was identified that begins at the ATG start codon at 5 and ends at the TAA codon at nucleotides 955-957. The putative untranslated region upstream of the start codon and downstream of the stop codon is underlined in Table 3A, and its start and stop codons are in bold.

[0094]

[Table 27] The disclosed NOV3 polypeptide encoded by SEQ ID NO: 15 (SEQ ID NO: 16) is 314 amino acid residues and is shown in Table 3B using the one letter code. This disclosed NOV3 protein was analyzed for signal peptide estimation and cellular localization. The results of SignalP show that NOV3 is 4 in SEQ ID NO: 16.
It is predicted to be cleaved between positions 3 and 44 (ie the slash of the amino acid sequence VLG-NL). The Psort and Hydropathy profiles also predict with high comparable certainty that NOV3 contains a signal peptide and is probably localized to the endoplasmic reticulum (membrane) or plasma membrane.

[0095]

[Table 28] The NOV3 nucleic acids and proteins of the invention are useful in potential therapeutic applications involving use in the treatment of the following: infections (eg, bacterial, fungal, protozoal and viral infections (particularly HIV-1 or HIV-2). Infections caused by)))
, Pain, cancer (including but not limited to neoplasia; adenocarcinoma; lymphoma; prostate cancer; uterine cancer), anorexia, bulimia, asthma, Parkinson's disease, acute heart failure, hypotension, hypertension, urinary retention, osteoporosis, Crohn's disease; multiple sclerosis; and Albright
Treatment of hereditary bone dystrophy, angina, myocardial infarction, ulcer, asthma, allergy, benign prostatic hyperplasia, and psychotic disorders and neurological disorders (anxiety, schizophrenia, manic depression, delirium, dementia, severe Mental retardation and dyskinesia (including, for example, Huntington's disease or Gilles de la Tourette's syndrome) and / or other medical conditions and disorders. The polypeptides can be used as immunogens as well as vaccines to produce antibodies specific for the invention. They can also be used to screen potential agonist and antagonist compounds. For example, a cDNA encoding a GPCR-like protein is
It may be useful in gene therapy, and GPCR-like proteins may be useful when administered to a subject in need thereof. As a non-limiting example, the compositions of the present invention are effective in treating patients suffering from: bacterial, fungal, protozoal and viral infections (particularly infections caused by HIV-1 or HIV-2), Pain, cancer (including but not limited to neoplasm; adenocarcinoma; lymphoma; prostate cancer; uterine cancer)
, Anorexia, overeating, asthma, Parkinson's disease, acute heart failure, hypotension, hypertension, urinary retention, osteoporosis, Crohn's disease; multiple sclerosis; and Albright Here
treatment of diary bone dystrophy, angina, myocardial infarction, ulcer, asthma, allergy, benign prostatic hyperplasia, and psychotic disorders and neurological disorders (anxiety, schizophrenia, manic depression, delirium, dementia, severe Mental retardation and dyskinesia (including, for example, Huntington's disease or Gilles de la Tourette's syndrome) and / or other medical conditions and disorders. The novel nucleic acids encoding GPCR-like proteins and the GPCR proteins of the invention or fragments thereof may also be useful in diagnostic applications, where the presence or amount of nucleic acids or proteins is assessed. These materials are further useful in the production of antibodies that immunospecifically bind to the novel agents of the invention for use in therapeutic or diagnostic methods.

In all BLAST alignments described herein, the “E value” or “expected” value is relative to the BLAST query sequence by chance in the database searched by the aligned sequences. It is a numerical indicator of the possibility that the similarity could be reached. All BLAST analyzes described herein were performed with the NOV3 amino acid sequence.

BLASTX searches were performed against public protein databases. The amino acid sequence of the protein of the present invention is 216 amino acids of Homo sapien human olfactory receptor 5D4 (olfactory receptor 11-8C (OR11-8C) (gi
| 9297024 | sp | Q9UP62 | O5D4, E = 7e-73), 21
153 out of 6 amino acid residues (70%) are identical and 1 out of 216 residues
75 residues (80%) were found to be positive. The disclosed proteins are also similar to the olfactory proteins disclosed in Table 3C.

[0098]

[Table 29] A ClustalW analysis comparing the relevant OR protein sequences (determined by BLASTX analysis) with the disclosed proteins of the invention is shown in Table 3D, and NOV3 is shown in the first row.

[0099]

[Table 30] In ClustalW alignments of the NOV3 protein, as well as other ClustalW analyzes described herein, amino acid residues outlined in black conserve conserved sequence regions (ie, structural or functional properties). Area that may be needed for this). In contrast, unemphasized amino acid residues are poorly conserved and can potentially be mutated to a very wide range without changing the structure or function of the protein.

The existence of identifiable domains in NOV3, as well as in all other NOVX proteins, is determined by software algorithms (eg PROSITE, DOMAI).
N, Blocks, Pfam, ProDomain, and Prints), and then the Interpro number is the domain match (or number) using the Interpro website (http: www.ebi.ac.uk/interpro). Determined by crossing. For example,
The DOMAIN results for NOV3 are displayed in the Reverse Position.
Collected from the Conserved Domain Database (CDD) using the Specific BLAST analysis. This BLAST analysis software samples the domains found in the Smart and Pfam collections. For all consecutive DOMAIN sequence alignments, a single perfectly conserved residue is indicated by a black shade and a "strong" semi-conserved residue is indicated by a gray shade. The "strong" group of conserved amino acid residues can be any one of the following groups of amino acids: STA, NEQK, NHQK, NDEQ, QHR.
K, MILV, MILF, HY, FYW.

The region of amino acid residues 43-238 (SEQ ID NO: 15) is most probably (E =
4e- ¹⁷ ), a "7-transmembrane receptor (rhodopsin family) fragment" domain, which is aligned herein with residues 1-177 of the 7tm_1 entry (TM7, SEQ ID NO: 39) of the Pfam database. ing. This indicates that the NOV3 sequence has properties similar to those of other proteins known to contain this domain, as well as to the 377 amino acid 7tm domain itself. Table 3 shows the results for NOV3 and TM7 proteins.

[0102]

[Table 31] A representative member of this 7-transmembrane receptor family is Bos tau.
rus (SWISSPROT: locus D2DR_BOVIN, acces
sion P20288; gene index 118205). This D2 receptor is an integral membrane protein,
And it belongs to Family 1 of G protein coupled receptor. The activity of this D2 receptor is mediated by G proteins that inhibit adenylyl cyclase. Chio et al., Nature 343: 255-269 (1990). Residues 51-427 of the 444-amino acid protein here are believed to be the representative TM7 domain shown in Table 3F.

[0103]

[Table 32] This 7-transmembrane receptor family contains many different proteins (eg,
(Including serotonin receptor, dopamine receptor, histamine receptor, adrenergic receptor, cannabinoid receptor, angiotensin II receptor, chemokine receptor, opioid receptor, G protein coupled receptor (GPCR) protein, olfactory receptor (OR), etc.).
Several proteins and Protein Data Base Ids / g
ene indexes include, for example: rhodopsin (129209).
5-hydroxytryptamine receptor; (112821, 8488860,
112805, 231454, 1168221, 398971, 112806).
G protein-coupled receptors (119130, 543823, 173143
, 132206, 137159, 6136153, 416926, 116988
1, 136882, 134079); taste receptor (544443, 4622)
08); c-x-c chemokine receptor (416718, 128899, 41)
6802, 548703, 1352335); Opsin (129193, 129).
197, 129203); and olfactory receptor-like proteins (1299091,
1171893, 400672, 548417).

NOV3 nucleic acids and proteins are associated with various NOV or olfactory receptors (O
R) Useful in potential therapeutic applications related to related pathologies and / or disorders. For example, a cDNA encoding a G protein-coupled receptor-like protein
Can be useful in gene therapy, and G protein coupled receptor-like proteins can be useful when administered to a subject in need thereof. NOV3
Novel nucleic acids encoding proteins, as well as fragments thereof, may be further useful in diagnostic applications, where the presence or amount of nucleic acid or protein is assessed. These agents are further useful in the production of antibodies that immunospecifically bind to the novel agents of the invention for use in therapeutic or diagnostic methods.
The NOVX nucleic acids and proteins are useful in potential diagnostic and therapeutic applications related to the various diseases and disorders and / or other pathologies described below. For example, the compositions of the present invention have efficacy for the treatment of patients suffering from: cardiomyopathy, atherosclerosis, hypertension, congenital heart disease, aortic stenosis,
Atrial septal defect (ASD), atrioventricular (A-V) duct defect, arterial duct, pulmonary stenosis,
Aortic subvalvular stenosis, ventricular septal defect (VSD), valve disease, tuberous sclerosis, scleroderma, obesity, transplantation, adrenoleukodystrophy, congenital adrenal hyperplasia, fertility, hemophilia, coagulation Hypersensitivity, idiopathic thrombocytopenic purpura, immunodeficiency, graft-versus-host disease, bronchial asthma, and similar other diseases, disorders, and conditions. As a non-limiting example,
The compositions of the present invention have efficacy for the treatment of patients suffering from: neoplasia, adenocarcinoma, lymphoma, prostate cancer, uterine cancer, immune response, AIDS, asthma, Crohn's disease, multiple sclerosis, and Allbright hereditary osteodystrophy. Additional NOV-related diseases and disorders are mentioned throughout the specification.

Furthermore, protein similarity information, expression patterns, and map arrangements for NOV3 suggest that NOV3 may have important structural and / or physiological functional features of the NOV family. Accordingly, the nucleic acids and proteins of the invention are useful in potential diagnostic and therapeutic applications and as search tools. They function as specific or selective nucleic acid or protein diagnostic and / or prophylactic markers, where the presence or amount of nucleic acid or protein is assessed, and potential therapeutic applications such as: Including: (i) protein therapeutics, (ii) small molecule drug targets, (iii) antibody targets (therapeutic, diagnostic, drug targeted / cytotoxic antibodies), (iv) nucleic acids useful in gene therapy ( Gene delivery / gene excision), and (v) compositions that promote tissue regeneration in vivo and in vitro, (vi) biological defense weapons.

These substances are novel NOVs for use in therapeutic or diagnostic methods.
It is further useful in the production of antibodies that immunospecifically bind to the three substances. These antibodies can be produced according to methods known in the art, using predictions from the hydrophobicity chart, as described in the "Anti-NOVX Antibodies" section below.

(NOV4) NOV4 comprises two families of nucleic acids disclosed below. The disclosed nucleic acids encode NOV-like proteins.

(NOV4a) A novel nucleic acid is CuraGen for GPCR probes or homologs.
Ge by TblastN using the sequence file of Corporation
It was performed on the Genomic Daily File available by nBank and identified on chromosome 11. This nucleic acid is also the program Gen
Inferred by Scan ^™ (including exon selection). These are
Modified by similarity using BLAST search. This sequence was then manually corrected for apparent discrepancies, resulting in the sequence encoding the full-length protein.

The 968 nucleotide disclosed NOV4a nucleic acid (95-h-6-A, SEQ ID NO: 17) encoding a novel olfactory receptor-like protein is shown in Table 4A. Starting at the ATG start codon at nucleotides 8-10, nucleotides 956-958
An open reading frame (ORF) ending with the TAA codon was identified.
The putative untranslated region, upstream of the start codon and downstream of the stop codon, is underlined in Table 4A, and the start and stop codons are in bold.

[0110]

[Table 33] The disclosed NOV4a polypeptide encoded by SEQ ID NO: 17 (SEQ ID NO: 18) is 316 amino acid residues and is represented in Table 4B using the one letter code. The disclosed NOV4a proteins were analyzed for signal peptide speculation and cellular localization. The SignalP results show that NOV4a is 39 of SEQ ID NO: 18.
Predict to be cleaved between positions 40 and 40 (ie the slash in the amino acid sequence VGG-NM). The Psort and Hydropathy profiles also speculate that NOV4a contains a signal peptide and is probably localized to the plasma membrane (certainty of 0.6000).

[0111]

[Table 34] (NOV4b) The target sequence previously identified as NOV4b (accession number 95-h-6-A) was subjected to the exon ligation process to confirm this sequence. PCR primers were designed by starting with the most upstream sequence available for the forward primer and the most downstream sequence available for the reverse primer. In each case, the appropriate sequence, which is either unique or highly selective, was encountered, or in the case of the reverse primer, from each end towards the coding sequence until the stop codon was reached. This sequence was tested by walking inward. Such an appropriate sequence is then transformed into a wide range of cDNAs.
The library-based PCR was used as forward and reverse primers for littermate. The resulting amplicon was gel-generated, cleaned, and sequenced for the high degree of redundancy that provided the sequences reported below, which was NOV4b (
The registration number is 95-h-6-A). There is a single nucleotide difference between the two clones at base 274 that is unchanged in the amino acid sequence.

The disclosed NOV4b nucleic acid of 968 nucleotides (SEQ ID NO: 19) encoding a novel olfactory receptor-like protein is shown in Table 4C. The (ORF) open reading frame begins at the ATG start codon at nucleotides 8-10,
It ends with the TAA codon at nucleotides 956-958. Putative non-transcribed regions upstream from the start codon and downstream from the stop codon are shown underlined in Table 4C, and the start and stop codons are shown in bold.

[0113]

[Table 35] Disclosed NOV4b polypeptides are disclosed NOV4b polypeptides (
It is the same as SEQ ID NO: 18). This polypeptide has 368 amino acid residues and is represented in Table 4B using the single letter code. The disclosed NOV4b proteins are analyzed for one peptide prediction, and cell location. Signa
The result of 1P is that NOV4 is between positions 39 and 40 of SEQ ID NO: 18, ie
It is predicted to be cleaved with a slash in the amino acid sequence VGG-NM. P
The sort and Hydropathy profiles also predict that NOV4 contains a single peptide and appears to localize to the plasma membrane (accuracy =
0.6000).

The NOV4 nucleic acids and proteins of the present invention are useful in potential therapeutic applications related to use in the treatment of: bacterial, fungal, protozoal, and viral infections (particularly HIV-1 or HIV). -2 infection), pain, cancer (neoplastic; adenocarcinoma; lymphoma; prostate cancer; uterine cancer, but not limited to), anorexia, bulimia, asthma, Parkinson's disease, acute heart failure, low Blood pressure, hypertension, retention of urine, osteoporosis, Crohn's disease; multiple sclerosis; and treatment of: Albright hereditary dysplasia, angina, myocardial infarction, ulcer,
Asthma, allergies, benign prostatic hyperplasia, and psychotic and neurological disorders (
Including anxiety, schizophrenia, manic depression, delirium, dementia, severe mental retardation), dentate nucleus red nucleus, pallidum Louis atrophy (DRPLA), hypophosphatemia, autosomal dominant limb Acrocallosal syndrome and dyskinesia (eg, Huntington's disease or Gilles de la Tourette's syndrome) and / or other pathologies and disorders. The polypeptide may be used as an immunogen to produce antibodies specific for the invention. It can then be used as a vaccine. They can also be used to screen for potential agonist and antagonist compounds. For example, a cDNA encoding a GPCR-like protein can be useful in gene therapy, and a GPCR-like protein can be useful when administered to a subject in need thereof. As a non-limiting example, the compositions of the present invention may be used for bacterial, fungal, protozoal, and viral infections (especially HIV-1).
Or infections caused by HIV-2), pain, cancer (neoplasm; adenocarcinoma; lymphoma; prostate cancer; uterine cancer, including but not limited to), anorexia,
Binge eating, asthma, Parkinson's disease, acute heart failure, hypotension, hypertension, retention of urine, osteoporosis, Crohn's disease; multiple sclerosis; and treatment of: Albright hereditary dysplasia, angina, myocardium Infarcts, ulcers, asthma, allergies, benign prostatic hypertrophy, and psychotic and neurological disorders (including anxiety, schizophrenia, manic depression, delirium, dementia, severe mental retardation), and dyskinesia (eg, It has efficacy for the treatment of patients with Huntington's disease or Gilles de la Tourette's syndrome) and / or other pathologies and disorders. The novel nucleic acids encoding GPCR-like proteins, and GPCR-like proteins of the invention or fragments thereof, may further be useful in diagnostic applications, where the presence or amount of this nucleic acid or protein is assessed. These agents are further useful in the production of antibodies that immunospecifically bind to the novel substrates of the invention for use in therapeutic or diagnostic methods.

The amino acid differences between the two NOV4s are shown in Table 4D. Thus, these proteins may have similar functions (acting as olfactory or chemokine receptors) (see below).

[0116]

[Table 36] The amino acid differences between the two NOV4s are shown in Table 4E. These nucleic acid differences appear to be localized in several distinct regions.

[0117]

[Table 37] In all BLAST alignments described herein, the "E value" or "expected" value is the BLAST that happens to be in the database in which the aligned H dissociation is searched.
A numerical representation of the probabilities that they can achieve their similarity to the query sequence. All BLAST analyzes described herein were performed using the NOV4a amino acid sequence. As mentioned above, there are no differences between the amino acid sequences of NOV4a and NOV4b.

A BLASTX search was performed against the public protein database. The amino acid sequence of the NOV4 protein of the present invention is 3 from Mus musculus.
08 amino acid odorant receptor 16, olfactory receptor protein (gi | 114
96249 | ref | NP_067343.1, E = 1e-93), identity at 187 amino acid residues (62%) of 301 amino acid residues, positive at 228 residues (70%) of 301 residues. And was found to have a gap at one of the 301 residues. The disclosed NOV4 protein (SEQ ID NO: 18) also has good identity with many olfactory receptor proteins. The disclosed proteins are also similar to the olfactory proteins disclosed in Table 4F.

[0119]

[Table 38] The disclosed proteins of the present invention have been described as related OR protein sequences (BLASTX
ClustalW analysis (as determined by analysis) is shown in Table 4G (NOV4 is shown in the first row).

[0120]

[Table 39] In ClustalW alignments of NOV4 proteins, as well as in all other ClustalW analyzes described herein, amino acid residues outlined in black represent regions of conserved sequence (ie, those that preserve structural or functional properties). Regions that may be required to mutate), while unmarked amino acid residues are less conserved and potentially mutated to a higher degree without altering the structure or function of the protein. obtain. Unless otherwise specified as NOV4a or NOV4b, any reference to NOV4 is assumed to include all variants.

Identity identifiable in NOV4 and all other NOVX proteins (
The existence of an identifiable domain is defined as PROSITE, DOMAIN.
, Blocks, Pfam, ProDomain, and Prints, and then domain match (ie, number) using the Interpro website (http: www.ebi.ac.uk/interpro). ) Was determined by determining the Interpro number. The result of DOMAIN (for example, for NOV4a) is the reverse position sp
Using the Econic BLAST analysis, the Conserved Domain
Collected from Database (CDD). This BLAST analysis software sample domain was found in the Smart and Pfam collections. For all contiguous DOMAIN sequence alignments, completely conserved single residues are indicated by shading in black and "strong" semi-conserved residues are indicated by shading in gray. The group of “strong” conserved amino acid residues can be any one of the following amino acid groups: STA, NEQK.
, NHQK, NDEQ, QHRK, MILV, MILF, HY, FYW.

The region of amino acid residues 39-231 (SEQ ID NO: 18) most likely contains the "7-transmembrane receptor (rhodopsin family) fragment" domain (
E = 2e− ²¹ ), this domain is referred to herein as 7t in the Pfam database.
Aligned with residues 1-173 of the m_1 entry (TM7, SEQ ID NO: 39). This indicates that the NOV4 sequence has properties that are similar to sequences of other proteins known to contain this domain and to the 377 amino acid 7tm domain itself. Table 4H shows the results of domain analysis of NOV4 and TM7 proteins.

[0123]

[Table 40] A representative member of the 7-transmembrane receptor family is Bos tauru.
s-derived D2 dopamine receptor (SWISSPROT: D2DR_BOVI
N locus, accession number P20288: Gene index 118205). The D2 receptor is an essential membrane protein and belongs to the family 1 of G protein-coupled receptors. The activity of the D2 receptor is mediated by the G protein, which activity inhibits adenylyl cyclase. Chio et al., Nature 343: 2.
55-269 (1990). Residues 51-42 of this 444 amino acid protein
7 is considered to be the representative TM7 domain shown in Table 4I.

[0124]

[Table 41] This 7-transmembrane receptor family includes many different proteins including, for example, serotonin receptors, dopamine receptors, histamine receptors, androgen receptors, cannabinoid receptors, angiotensin II receptors, chemokine receptors, opioid receptors, G protein-coupled types. Receptor (GPCR) proteins, olfactory receptors (OR) and the like can be mentioned. Several proteins and Protein Data Base Id
Examples of the s / gene index include the following: rhodopsin (129209)
); 5-hydroxytryptamine receptor; (112821, 8488890)
, 112805, 231454, 1168221, 398971, 112806.
); G protein-coupled receptor (119130, 543823, 17301)
43, 132206, 137159, 6136153, 416926, 1169
881, 136882, 134079); taste receptors (5444463, 4622)
08); c-x-c chemokine receptor (416718, 128899, 41)
6802, 548703, 1352335); Opsin (129193, 129).
197, 129203); and olfactory receptor-like proteins (1290901, 11)
71893, 400672, 548417).

NOV4 nucleic acids and proteins are associated with various GPCRs or olfactory receptors (
(OR) useful in potential therapeutic applications related to related symptoms and / or disorders. For example, cDNA encoding a G protein-coupled receptor-like protein
A may be useful in gene therapy, and G protein coupled receptor-like proteins may be useful when administered to a subject in need thereof.
Novel nucleic acids encoding NOV4 proteins, as well as fragments thereof, may be further useful in diagnostic applications, where the presence or amount of nucleic acid or protein is assessed. These agents are further useful in the production of antibodies that immunospecifically bind to the novel agents of the invention for use in therapeutic or diagnostic methods. The NOVX nucleic acids and proteins are useful in potential diagnostic and therapeutic applications related to the various diseases and disorders and / or other conditions described below. For example, the compositions of the present invention have efficacy for the treatment of patients suffering from: cardiomyopathy, atherosclerosis, hypertension, congenital heart disease, aortic stenosis, atrial septal defect (ASD). Atrioventricular (A-V) tube defect, arterial tube, pulmonary valve stenosis, subaortic stenosis, ventricular septal defect (VSD), valve disease, tuberous sclerosis, scleroderma, obesity, transplant, Adrenoleukodystrophy, congenital adrenal hyperplasia, fertility, hemophilia, hypercoagulability, idiopathic thrombocytopenic purpura, immunodeficiency, graft-versus-host disease, bronchial asthma, and similar other disorders and disorders. , And state. By way of non-limiting example, the compositions of the present invention have efficacy for the treatment of patients suffering from:
Neoplasia, adenocarcinoma, lymphoma, prostate cancer, uterine cancer, immune response, AIDS, asthma, Crohn's disease, multiple sclerosis, and allbright hereditary osteodystrophy. Further N
OV-related diseases and disorders are mentioned throughout the specification.

In addition, protein similarity information, expression patterns, and map arrangements for NOV4 suggest that NOV4 may have important structural and / or physiological functional characteristics of the NOV family. Accordingly, the nucleic acids and proteins of the invention are useful in potential diagnostic and therapeutic applications and as search tools. These include functioning as specific or selective nucleic acid or protein diagnostic and / or prophylactic markers, where the presence or amount of nucleic acid or protein is assessed, and potential therapeutic applications such as: :
(I) protein therapeutic agent, (ii) small molecule drug target, (iii) antibody target (therapeutic, diagnostic, drug target / cytotoxic antibody), (iv) nucleic acid useful for gene therapy (
Gene delivery / gene excision), and (v) compositions that promote tissue regeneration in vivo and in vitro, (vi) biological defense weapons.

These agents are further useful in the generation of immunospecifically binding antibodies of the novel NOV4 agents for use in therapeutic or diagnostic methods.
These antibodies can be produced according to methods known in the art, using predictions from the hydrophobicity chart, as described in the "Anti-NOVX Antibodies" section below.

(NOV5) A novel nucleic acid is used by TblastN, using the CuraGen Corporation sequence files for GPCR probes and homologs, and made available by GenBank to the Genomic Dairy Fi.
Performed on the les and identified. This nucleic acid was further predicted by the program GenScan ^™ , which included exon selection. These are BLA
Further modifications were made by similarity using the ST search. These sequences were then manually corrected for apparent discrepancies, resulting in sequences encoding the full-length protein.

The disclosed 946 nucleotide nucleic acid (95-h-6-B, SEQ ID NO: 20) encoding a novel NOV5 olfactory receptor-like protein is shown in Table 5A. The open reading frame (ORF) is from nucleotide 7 to the ATG start codon.
It begins at 9 and ends at nucleotides 937-939 at the TAA codon. The putative untranslated regions upstream of the start codon and downstream of the stop codon are underlined in Table 5A, and the start and stop codons are in bold.

[0130]

[Table 42] The disclosed NOV5 polypeptide encoded by SEQ ID NO: 20 (SEQ ID NO: 21) is 308 amino acid residues and is represented in Table 5B using the single letter code. The disclosed NOV5 protein was analyzed for signal peptide prediction and cell localization. The SignalP results predict NOV5 is cleaved between position 49 and position 50 of SEQ ID NO: 21 (ie, at the slash in the amino acid sequence VKA-SQ). Psor and Hyd
The ropathy profile also predicts that NOV5 contains a signal peptide and appears to localize to the plasma membrane (certainty of 0.6000).
.

[0131]

[Table 43] The NOV5 nucleic acids and proteins of the present invention can be used for infections (eg, bacterial, fungal, protozoal, and viral infections (particularly infections caused by HIV-1 or HIV-2)), pain, cancer (neoplasm; line cancer; lymph). Species; prostate cancer; uterine cancer, but not limited to), anorexia, bulimia, asthma, Parkinson's disease, acute heart failure, hypotension, hypertension, urinary retention, osteoporosis, Crohn's disease, multiple sclerosis , And Albright hereditary dysplasia, angina, myocardial infarction, ulcer,
Asthma, allergies, benign prostatic hyperplasia, and psychotic and neurological injuries (including anxiety, schizophrenia, manic depression, delirium, dementia, severe mental retardation) and movement disorders (eg, Huntington's disease or Jill. De la Tourette's syndrome) and / or other pathologies and uses in potential therapeutic applications relevant for use in the treatment of injuries. These polypeptides can be used as immunogens for the production of antibodies specific for the invention as vaccines. These can also be used to screen for potential agonist and antagonist compounds. For example, a cDNA encoding a GPCR-like protein
Can be useful in gene therapy, and GPCR-like proteins can be useful when administered to a subject in need thereof. By way of non-limiting example, compositions of the present invention may be useful for bacterial, fungal, protozoal, and viral infections (especially HI).
Infections caused by V-1 or HIV-2), pain, cancer (neoplastic; lineal cancer; lymphoma; prostate cancer; uterine cancer, including but not limited to), anorexia,
About treatment of patients suffering from bulimia, asthma, Parkinson's disease, acute heart failure, hypotension, hypertension, urinary retention, osteoporosis, Crohn's disease, multiple sclerosis, and allbright hereditary dysplasia, angina , Myocardial infarction, ulcers, asthma, allergies, benign prostatic hyperplasia, and psychotic and neurological injuries (anxiety, schizophrenia,
It has efficacy in treating manic depression, delirium, dementia, severe mental retardation) and movement disorders (Huntington's disease or Gilles de la Tourette's syndrome) and / or other pathologies and injuries. The novel nucleic acids encoding GPCR-like proteins, and GPCR-like proteins of the invention, or fragments thereof, are further useful in diagnostic applications, where the presence or amount of nucleic acids or proteins is assessed. These materials are further useful in the production of antibodies that immunospecifically bind to the novel agent for use in therapeutic or diagnostic methods.

In all BLAST alignments herein, the "E value" or "expected value" values are numerical representations of probabilities, and the aligned sequences are simply by chance in the searched database. Their similarity to the BLAST query sequence may be reached. All BLAST analyzes described herein were performed using the NOV5 amino acid sequence.

BLASTX searches were performed on public protein databases. The amino acid sequence of the protein of the present invention is the 308 amino acid olfactory receptor 16 (gi│11496249│ref│NP derived from Mus musculus. 067343. 1 |, E = 8e-77), 157/302 (51%) identical amino acid residues, and this 308 amino acid olfactory receptor 16 to 215/302 (70)
%) Found to have positive residues. The disclosed proteins are also listed in Table 5C.
Similar to the olfactory proteins disclosed in.

[0134]

[Table 44] Clu comparing the disclosed proteins of the invention with related OR protein sequences
The stalW analysis (determined by BLASTX analysis) is shown in Table 5D,
NOV5 is shown in the first line.

[0135]

[Table 45] Amino acid residues outlined in black in the Clusta1W alignment of the NOV5 protein, and in the Clusta1W analysis herein, may be required to conserve a conserved sequence region (ie, structural or functional properties). Area). In contrast, unemphasized amino acid residues are poorly conserved and can potentially be mutated to a very wide range without changing the structure or function of the protein.

The existence of identifiable domains in NOV5, as well as in all other NOVX proteins, is determined by software algorithms (eg PROSITE, DOMAI).
N, Blocks, Pfam, ProDomain, and Prints), and then the Interpro number is a horizontal line to the domain match (or number) using the Interpro website (http: www.ebi.ac.uk/interpro). Determined by subtracting. For example, the DOMAIN results for NOV3 as disclosed in Table 1M are Rev
using erse Position Specific BLAST analysis, C
Collected from on-site Domain Database (CDD).
This BLAST analysis software sample samples the domains found in the Smart and Pfam collections. Table 1M and all consecutive Ds
In the OMAIN sequence alignment, single residues that are completely conserved are indicated by black shades and "strong" semi-conserved residues are indicated by gray shades. The "strong" group of conserved amino acid residues can be any one of the following groups of amino acids: STA, NEQK, NHQK, NDEQ, QHRK, MILV, MILF, H.
Y, FYW.

The region of amino acid residues 47-234 (SEQ ID NO: 21) (probably (E = 1e ^{- 12} ) contains the "7-transmembrane receptor (rhodopsin family) fragment" domain and is of the 7tm_1 entry of the Pfam database. Residues 9-177
(TM7, SEQ ID NO: 39). This is a characteristic of other proteins whose NOV5 sequence is known to contain this domain, as well as 377 amino acids 7t.
It is shown to have similar features to the m-domain itself. Table 5E shows the results of domain analysis of NOV5 and TM7 proteins.

[0138]

[Table 46] A representative member of this 7-transmembrane receptor domain family is Bos
taurus (SWISSPROT: locus D2DR_BOVIN, a
accession P20288; D derived from gene index 118205)
2 Dopamine receptor. The D2 receptor is an integral membrane protein and belongs to the G protein-coupled receptor, Family 1. This D
Bireceptor activity is mediated by G proteins that inhibit adenylyl cyclase. Chio et al., Nature 343: 255-269 (1990).
). Residues 51-427 of the 444-amino acid protein here are considered to be the representative TM7 domain shown in Table 5F.

[0139]

[Table 47] This 7-transmembrane receptor family includes many different proteins (eg, serotonin receptors, dopamine receptors, histamine receptors, adrenergic receptors, cannabinoid receptors, angiotensin II receptors, chemokine receptors, opioid receptors, G protein coupled receptor (GPCR) proteins. , Including olfactory receptors (OR)).
Some proteins and Protein Data Base Ids / gene indexes include, for example: rhodopsin (129209);
Hydroxytryptamine receptor; (112821, 8488960, 112
805, 231454, 1168221, 398971, 112806); G protein coupled receptor (119130, 543823, 1730143, 13).
2206, 137159, 6136153, 416926, 1169881, 1
36882, 134079); taste receptors (5444463, 462208)
C-x-c chemokine receptor (416718, 128899, 41680)
2, 548703, 1352335); Opsin (129193, 129197).
, 129203); and olfactory receptor-like proteins (1290901, 117).
1893, 400672, 548417).

NOV5 nucleic acids and proteins are associated with various NOV or olfactory receptors (O
R) Useful in potential therapeutic applications related to related symptoms and / or disorders. For example, a cDNA encoding a G protein-coupled receptor-like protein
Can be useful in gene therapy, and G-protein coupled receptor-like proteins can be useful when administered to a subject in need thereof. N
The novel nucleic acids encoding the OV5 protein, as well as fragments thereof, may be further useful in diagnostic applications, where the presence or amount of nucleic acid or protein is assessed. These agents are further useful in the production of antibodies that immunospecifically bind to the novel agents of the invention for use in therapeutic or diagnostic methods. The NOVX nucleic acids and proteins are useful in potential diagnostic and therapeutic applications related to the various diseases and disorders and / or other conditions described below. For example, the compositions of the present invention have efficacy for the treatment of patients suffering from: cardiomyopathy, atherosclerosis, hypertension, congenital heart disease, aortic stenosis, atrial septal defect (ASD). Atrioventricular (A-V) tube defect, arterial tube, pulmonary valve stenosis, subaortic stenosis, ventricular septal defect (VSD), valve disease, tuberous sclerosis, scleroderma, obesity, transplant, Adrenoleukodystrophy, congenital adrenal hyperplasia, fertility, hemophilia, hypercoagulability, idiopathic thrombocytopenic purpura, immunodeficiency, graft-versus-host disease, bronchial asthma, and similar other disorders and disorders. , And state. By way of non-limiting example, the compositions of the invention have efficacy for the treatment of patients suffering from: neoplasia, adenocarcinoma, lymphoma, prostate cancer, uterine cancer, immune response, AIDS, asthma, Crohn's disease. , Multiple sclerosis, and allbright hereditary dysplasia. Further NO
V-related diseases and disorders are mentioned throughout the specification.

In addition, protein similarity information, expression patterns, and map arrangements for NOV5 suggest that NOV5 may have important structural and / or physiological functional features of the NOV family. Accordingly, the nucleic acids and proteins of the invention are useful in potential diagnostic and therapeutic applications and as search tools. These include functioning as specific or selective nucleic acid or protein diagnostic and / or prophylactic markers, where the presence or amount of nucleic acid or protein is assessed, and potential therapeutic applications such as: :
(I) protein therapeutic agent, (ii) small molecule drug target, (iii) antibody target (therapeutic, diagnostic, drug target / cytotoxic antibody), (iv) nucleic acid useful for gene therapy (
Gene delivery / gene excision), and (v) compositions that promote tissue regeneration in vivo and in vitro, (vi) biological defense weapons.

These substances are novel NOVs for use in therapeutic or diagnostic methods.
It is further useful in the production of antibodies that immunospecifically bind five substances. These antibodies can be produced according to methods known in the art, using predictions from the hydrophobicity chart, as described in the "Anti-NOV Antibodies" section below.

(NOV6) Novel nucleic acids were identified on chromosome 11 by TblastN using the CuraGen Corporation sequence file for GPCR probes or homologues, and Genomic Dail available by GenBank.
It was carried out with ly Files. This nucleic acid contains GenSc containing an exon portion.
Further predicted by the an ^™ program. These were further modified by similar means using the BLAST search. These sequences were then automatically corrected for apparent inconsistencies, resulting in sequences encoding the full-length protein.

A 1000 nucleotide disclosed NOV6 nucleic acid (95-h-6-C, SEQ ID NO: 22) encoding a novel NOV6 olfactory receptor-like protein is shown in Table 6A. The open reading frame (ORF) is defined by nucleotides 9-11 of A
It was identified as starting at the TG start codon and ending at the TGA codon at nucleotides 987-989. The putative untranslated region upstream from the start codon and downstream from the stop codon is underlined in Table 6A, and the start and stop codons are shown in bold.

[0145]

[Table 48] The disclosed NOV6 polypeptide (SEQ ID NO: 2) encoded by SEQ ID NO: 22.
3) is a 326 amino acid residue and is represented in Table 6B using the one letter code. Initiated NOV6 protein was analyzed for signal peptide prediction and cell localization. The SignalPep results predict NOV6 is cleaved between position 42 and position 43 of SEQ ID NO: 8 (ie at the slash in the amino acid sequence TCT-QL). Psort and Hydr
The opathy profile also predicts that NOV6 contains a signal peptide and appears to localize to the plasma membrane (certainty of 0.6000).

[0146]

[Table 49] The NOV6 nucleic acids and proteins of the invention are useful in potential therapeutic applications related to their use in the treatment of: bacterial, fungal, protozoal and viral infections (especially caused by HIV-1 or HIV-2). Infection, pain, cancer (neoplasm; adenocarcinoma; lymphoma; prostate cancer; uterine cancer, but not limited to),
Anorexia, bulimia, asthma, Parkinson's disease, acute heart failure, hypotension, hypertension, urinary retention, osteoporosis, Crohn's disease, multiple sclerosis; and treatment of allbright hereditary dysplasia, angina, Myocardial infarction, ulcer, asthma, allergy, benign prostatic hypertrophy and psychotic and neurological disorders (anxiety, schizophrenia, major depression, delirium,
Dementia, severe mental retardation and dyskinesia (eg Huntington's disease or Gilles de la Tourette's syndrome and / or other pathologies and injuries). This polypeptide can be used as an immunogen and as a vaccine to produce antibodies specific for the invention. They are also used in screening for potential agonist and antagonist compounds. For example, a cDNA encoding a GPCR-like protein can be useful in gene therapy, and when the GPCR-like protein is administered to a subject in their need.
By way of non-limiting example, the compositions of the present invention may include bacterial, fungal, protozoal and viral infections (especially infections caused by HIV-1 or HIV-2), pain, cancer (neoplasm; adenocarcinoma; lymphoma; Prostate cancer; includes but is not limited to uterine cancer)
, Anorexia, bulimia, asthma, Parkinson's disease, acute heart failure, hypotension, hypertension,
Urinary retention, osteoporosis, Crohn's disease, multiple sclerosis; and treatment of allbright hereditary osteodystrophy, angina, myocardial infarction, ulcers, asthma, allergies, benign prostatic hyperplasia and psychotic and neurological Patients suffering from disorders (anxiety, schizophrenia, major depression, delirium, dementia, severe mental retardation and dyskinesia (eg Huntington's disease or Gilles de la Tourette syndrome and / or other pathologies and injuries)) Has an effect on the treatment of. The novel nucleic acids encoding GPCR-like proteins, GPCR-like proteins of the invention or fragments thereof are further useful in diagnostic applications, where the presence or amount of nucleic acids or proteins is assessed. These materials are further useful in the production of antibodies that immunospecifically bind to the novel agents of the invention for use in therapeutic or diagnostic methods.

In all of the BLAST alignments described herein, the “E value” or “expected value” means that the aligned sequences are at their own chance to the BLAST query sequence in the searched database. Multiple indicators of likelihood that identity can be achieved. All BLAST analyzes described herein were tested for NOV6
Performed using the amino acid sequence.

A BLASTX search was performed against the public protein database. The full-length amino acid sequence of the protein of the present invention is 308 derived from Mus musculus.
Amino acid odorant receptor 16 (gi | 11496249 | ref | NP_067
343.1 |, E = 1e- ⁷⁷ ), 163 of 300 amino acid residues are the same (54%), and 216 of 300 are positive (71%) Was found. The disclosed proteins are also similar to the olfactory proteins disclosed in Table 6C.

[0149]

[Table 50] Clu comparing the disclosed proteins of the invention to related OR protein sequences
The stalW analysis (determined by BLASTX analysis) is provided in Table 6D (NOV3 shown in row 1).

[0150]

[Table 51] In the ClustalW alignment of the NOV6 protein, as well as in all other ClustalW analyzes described herein, amino acid residues outlined in black represent conserved sequence regions (ie structural or functional properties). Areas that may be required to be saved). In contrast, unemphasized amino acid residues are less conserved and can potentially be mutated to a very wide range without changing the structure or function of the protein.

The existence of identifiable domains in NOV6, as well as in all other NOVX proteins, is determined by software algorithms (eg PROSITE, DOMAI).
N, Blocks, Pfam, ProDomain, and Prints), and then the Interpro number is a horizontal line to the domain match (or number) using the Interpro website (http: www.ebi.ac.uk/interpro). Determined by subtracting. For example,
DOMAIN results for NOV3 can be found in Reverse Position
Using the Specific BLAST analysis, the Conserved Doma
Collected from in Database (CDD). This BLAST analysis software sample domain was found in the Smart and Pfam collections.
For all consecutive DOMAIN sequence alignments, a single perfectly conserved residue is indicated by a black shade and a "strong" semi-conserved residue is indicated by a gray shade. The "strong" group of conserved amino acid residues can be any one of the following groups of amino acids: STA, NEQK, NHQK, NDEQ, QHRK.
, MILV, MILF, HY, FYW.

The region of amino acid residues 53 to 213 (SEQ ID NO: 23) most likely corresponds to the “7-transmembrane receptor (rhodopsin family) fragment” domain (E = 3
e- ¹⁶ ), which is referred to herein as 7tm_1e in the Pfam database.
Aligned with residues 1-156 of entry (TM7, SEQ ID NO: 39). This indicates that the NOV6 sequence has properties similar to those of other proteins known to contain this domain, as well as to the 377 amino acid 7tm domain itself. Table 6E shows the results of domain analysis of NOV6 and TM7 proteins.

[0153]

[Table 52] A representative member of this 7-transmembrane receptor domain family is Bos
taurus (SWISSPROT: locus D2DR_BOVIN, a
accession P20288; gene index 118205). This D2 receptor is an integral membrane protein,
And it belongs to Family 1 of G protein coupled receptor. The activity of this D2 receptor is mediated by G proteins that inhibit adenylyl cyclase. Chio et al., Nature 343: 255-269 (1990). Residues 51-427 of this 444 amino acid protein are considered to be the representative TM7 domain shown in Table 6F.

[0154]

[Table 53] This 7-transmembrane receptor family contains many different proteins (eg,
(Including serotonin receptor, dopamine receptor, histamine receptor, adrenergic receptor, cannabinoid receptor, angiotensin II receptor, chemokine receptor, opioid receptor, G protein coupled receptor (GPCR) protein, olfactory receptor (OR), etc.). Several proteins and Protein Data Base Ids /
Gene indexes include, for example: rhodopsin (129209).
); 5-hydroxytryptamine receptor; (112821, 8488890)
, 112805, 231454, 1168221, 398971, 112806.
); G protein coupled receptor (119130, 543823, 173014)
3, 132206, 137159, 6136153, 416926, 11698
81, 136882, 134079); taste receptor (5444463, 462)
208); c-x-c chemokine receptors (416718, 128899, 4)
16802, 548703, 1352335); Opsin (129193, 12)
9197, 129203); and olfactory receptor-like protein (1290901)
, 1171893, 400672, 548417).

NOV6 nucleic acids and proteins are associated with various NOV or olfactory receptors (O
R) Useful in potential therapeutic applications related to related symptoms and / or disorders. For example, a cDNA encoding a G protein-coupled receptor-like protein
Can be useful in gene therapy, and G-protein coupled receptor-like proteins can be useful when administered to a subject in need thereof. The novel nucleic acids encoding the NOV6 protein, as well as fragments thereof, may be further useful in diagnostic applications, where the presence or amount of nucleic acid or protein is assessed. These agents are further useful in the production of antibodies that immunospecifically bind to the novel agents of the invention for use in therapeutic or diagnostic methods. The NOVX nucleic acids and proteins are useful in potential diagnostic and therapeutic applications related to the various diseases and disorders and / or other conditions described below. For example, the compositions of the present invention have efficacy for the treatment of patients suffering from: cardiomyopathy, atherosclerosis, hypertension, congenital heart disease, aortic stenosis, atrial septal defect (ASD). Atrioventricular (A-V) tube defect, arterial tube, pulmonary valve stenosis, subaortic stenosis, ventricular septal defect (VSD), valve disease, tuberous sclerosis, scleroderma, obesity, transplant, Adrenoleukodystrophy, congenital adrenal hyperplasia, fertility, hemophilia, hypercoagulability, idiopathic thrombocytopenic purpura, immunodeficiency, graft-versus-host disease, bronchial asthma, and similar other disorders and disorders. , And state. By way of non-limiting example, the compositions of the present invention have efficacy for the treatment of patients suffering from: neoplasms,
Adenocarcinoma, lymphoma, prostate cancer, uterine cancer, immune response, AIDS, asthma, Crohn's disease,
Multiple sclerosis, and allbright hereditary bone dysplasia. Additional NOV-related diseases and disorders are mentioned throughout the specification.

Furthermore, protein similarity information, expression patterns, and map arrangements for NOV6 suggest that NOV6 may have important structural and / or physiological functional features of the NOV family. Accordingly, the nucleic acids and proteins of the invention are useful in potential diagnostic and therapeutic applications and as search tools. These include functioning as specific or selective nucleic acid or protein diagnostic and / or prognostic markers, where the presence or amount of nucleic acid or protein is assessed, and potential therapeutic applications such as: :
(I) protein therapeutic agent, (ii) small molecule drug target, (iii) antibody target (therapeutic, diagnostic, drug target / cytotoxic antibody), (iv) nucleic acid useful for gene therapy (
Gene delivery / gene excision), and (v) compositions that promote tissue regeneration in vivo and in vitro, (vi) biological defense weapons.

These agents are further useful in the generation of immunospecifically binding antibodies to the novel NOV6 agents for use in therapeutic or diagnostic methods.
These antibodies can be produced according to methods known in the art, using predictions from the hydrophobicity chart, as described in the "Anti-NOV Antibodies" section below.

(NOV7) The novel NOV7 nucleic acids are Cura related to GPCR probes or homologs.
11th run on Genomic Daily File available by GenBank with TblastN using Gen sequence file.
Identified on the chromosome. This nucleic acid was further inferred by the program GenScan ^™ (including exon selection). These were further modified by similarity using the BLAST search. This sequence was then manually corrected for apparent inconsistencies, thereby obtaining the sequence encoding the protein fragment.

The disclosed 868 nucleotide nucleic acid (95-h-6-D, SEQ ID NO: 24) encoding a novel NOV7 olfactory receptor-like protein is shown in Table 7A. An open reading frame (ORF) starting at the ATG start codon at nucleotides 11-13 and extending to nucleotide 868 was identified. The putative untranslated region upstream of the start codon is underlined in Table 7A, and the start codon is in bold.

[0160]

[Table 54] The disclosed NOV7 polypeptide encoded by SEQ ID NO: 24 (SEQ ID NO: 25) is 286 amino acid residues and is represented in Table 7B using the single letter code. The disclosed NOV7 proteins were analyzed for signal peptide speculation and cellular localization. The SignalP results infer that NOV7 is cleaved between positions 50 and 51 of SEQ ID NO: 25 (ie, the slash in the amino acid sequence CLS-NL). The Psort and Hydropathy profiles also show that NOV7 contains a signal peptide and is localized to the plasma membrane (0.60).
(Certainty of 00).

[0161]

[Table 55] The NOV7 nucleic acids and NOV7 proteins of the present invention are associated with infections (eg, bacterial, fungal, protozoal, and viral infections, particularly those caused by HIV-1 or HIV-2), pain, cancer (neoplasm; Lymphoma; prostate cancer; uterine cancer, but not limited to), anorexia, bulimia, asthma, Parkinson's disease, acute heart failure, hypotension, hypertension, urinary retention, osteoporosis, Crohn's disease, multiple sclerosis And in allbright hereditary bone dysplasia, angina, myocardial infarction, ulcers, asthma, allergies, benign prostatic hyperplasia, and psychotic and neurological injuries (anxiety, schizophrenia, manic depression, delirium , Dementia, including severe mental retardation) and movement disorders (eg Huntington's disease or Gilles de la Tourette's syndrome) and / or Associated in the pathology and use in the treatment of injuries, it is useful in potential therapeutic applications. These polypeptides can be used as immunogens for the production of antibodies specific for the invention as vaccines. These can also be used to screen for potential agonist and antagonist compounds. For example, a cDNA encoding a GPCR-like protein can be useful in gene therapy, and a GPCR-like protein can be useful when administered to a subject in need thereof. By way of non-limiting example, the compositions of the present invention may include bacterial, fungal, protozoal, and viral infections (
Infections caused especially by HIV-1 or HIV-2), pain, cancer (neoplasm; neoplastic; lymphoma; prostate cancer; uterine cancer, including but not limited to), anorexia, bulimia, asthma, Parkinson's Disease, acute heart failure, hypotension, hypertension, urinary retention, osteoporosis, Crohn's disease, multiple sclerosis, and treatment of patients with allbright hereditary dysplasia, angina, myocardial infarction, ulcers, Asthma, allergies, benign prostatic hyperplasia, and psychotic and neurological injuries (including anxiety, schizophrenia, manic depression, delirium, dementia, severe mental retardation) and movement disorders (
Huntington's disease or Jill de la Tourette's syndrome) and / or other pathologies and disorders. The novel nucleic acids encoding the GPCR-like proteins of the present invention, and GPCR-like proteins, or fragments thereof, may be further useful in diagnostic applications, where the presence or amount of this nucleic acid or protein is assessed. These materials are further useful in the production of antibodies that immunospecifically bind to the novel agents of the invention for use in therapeutic or diagnostic methods.

“E value” in all BLAST alignments described herein.
Alternatively, the "expected value" value is a numerical representation of the probability that the aligned sequences may just by chance reach their similarity to the BLAST query sequence within the searched database. All BLAST analyzes described herein were performed using the NOV7 amino acid sequence.

BLASTX searches were performed on public protein databases. The amino acid sequence of the protein of the present invention is the 308 amino acid odor receptor 16 (gi | 11496249 | ref | NP | derived from Mus musculus. 067343.
1 |, E = 2e−78) and 159 of 286 amino acid residues (
55%), and 286 positive for this 308 amino acid odor receptor 16
It was found to have 192 of the residues (66%). The disclosed proteins are also similar to the olfactory proteins disclosed in Table 7C.

[0164]

[Table 56] A ClustalW analysis comparing the disclosed proteins of the invention with the related OR proteins (determined by BLASTX analysis) is provided in Table 7D with NOV7 shown in line 6.

[0165]

[Table 57] In the Clusta1W alignment of the NOV7 protein, and in all other Clusta1W analyzes described herein, amino acid residues outlined in black represent conserved sequence regions (ie structural or functional properties). Areas that may be required to be saved). In contrast, unemphasized amino acid residues are poorly conserved and can potentially be mutated to a very wide range without changing the structure or function of the protein.

The presence of identifiable domains in NOV7, as well as in all other NOVX proteins, was determined by software algorithms (eg PROSITE, DOMAI).
N, Blocks, Pfam, ProDomain, and Prints), and then the Interpro number is a horizontal line to the domain match (or number) using the Interpro website (http: www.ebi.ac.uk/interpro). Determined by subtracting. For example, the DOMAIN result for NOV3 is the Reverse Position.
n Specific BLAST analysis using Conserved Dom
Collected from ain Database (CDD). This BLAST analysis software samples the domains found in the Smart and Pfam collections. In all consecutive DOMAIN sequence alignments, single residues that are perfectly conserved are indicated by black shades and "strong" semi-conserved residues are indicated by gray shades. The "strong" group of conserved amino acid residues can be any one of the following groups of amino acids: STA, NEQK, NHQK, NDEQ, QH.
RK, MILV, MILF, HY, FYW.

The region from amino acid residues 46-197 (SEQ ID NO: 25) is most likely (E
= 4e- ²⁰ ), a "7 transmembrane receptor (rhodopsin family) fragment" domain, which is referred to herein as 7tm_1 of the Pfam database.
Aligned with residues 8-154 of entry (TM7, SEQ ID NO: 39). This indicates that the NOV6 sequence has properties similar to those of other proteins known to contain this domain, as well as to the 377 amino acid 7tm domain itself. Table 7E shows the results of domain analysis of NOV7 and TM7 proteins.

[0168]

[Table 58] A representative member of this 7-transmembrane receptor domain family is Bos
taurus (SWISSPROT: locus D2DR_BOVIN, a
accession P20288; gene index 118205) derived D2 dopamine receptor. The D2 receptor is an integral membrane protein and belongs to the G protein-coupled receptor, Family 1. The activity of this D2 receptor is mediated by G proteins that inhibit adenylyl cyclase. Chio et al., Nature 343: 255-269 (199).
0). Residues 51-427 of the 444-amino acid protein here are believed to be the representative TM7 domain shown in Table 7F.

[0169]

[Table 59] This 7-transmembrane receptor family includes many different proteins (eg, serotonin receptors, dopamine receptors, histamine receptors, adrenergic receptors, cannabinoid receptors, angiotensin II receptors, chemokine receptors, opioid receptors, G protein coupled receptor (GPCR) proteins. , Including olfactory receptors (OR)).
Several proteins and Protein Data Base Ids / g
ene indexes include, for example: rhodopsin (129209).
5-hydroxytryptamine receptor; (112821, 8488860,
112805, 231454, 1168221, 398971, 112806).
G protein-coupled receptors (119130, 543823, 173143
, 132206, 137159, 6136153, 416926, 116988
1, 136882, 134079); taste receptor (544443, 4622)
08); c-x-c chemokine receptor (416718, 128899, 41)
6802, 548703, 1352335); Opsin (129193, 129).
197, 129203); and auditory receptor-like protein (1299091,
1171893, 400672, 548417).

NOV7 nucleic acids and proteins are associated with various NOV or olfactory receptors (O
R) Useful in potential therapeutic applications related to related pathologies and / or disorders. For example, a cDNA encoding a G protein-coupled receptor-like protein
Can be useful in gene therapy, and G protein-coupled receptor-like proteins can be useful when administered to a subject in need thereof. NOV
Novel nucleic acids encoding 7 proteins, as well as fragments thereof, may be further useful in diagnostic applications, where the presence or amount of nucleic acid or protein is assessed. These agents are further useful in the production of antibodies that immunospecifically bind to the novel agents of the invention for use in therapeutic or diagnostic methods. The NOVX nucleic acids and proteins are useful in potential diagnostic and therapeutic applications related to the various diseases and disorders and / or other pathologies described below. For example, the compositions of the present invention have efficacy for the treatment of patients suffering from: cardiomyopathy, atherosclerosis, hypertension, congenital heart disease, aortic stenosis, atrial septal defect (ASD). Atrioventricular (A-V) tube defect, arterial tube, pulmonary valve stenosis, subaortic stenosis, ventricular septal defect (VSD), valve disease, tuberous sclerosis, scleroderma, obesity, transplant, Adrenoleukodystrophy, congenital adrenal hyperplasia, fertility,
Hemophilia, hypercoagulability, idiopathic thrombocytopenic purpura, immunodeficiency, graft-versus-host disease,
Bronchial asthma, and other similar diseases, disorders, and conditions. By way of non-limiting example, the compositions of the invention have efficacy for the treatment of patients suffering from: neoplasia, adenocarcinoma, lymphoma, prostate cancer, uterine cancer, immune response, AIDS, asthma, Crohn's disease. , Multiple sclerosis, and allbright hereditary dysplasia. Additional NOV-related diseases and disorders are mentioned throughout the specification.

In addition, protein similarity information, expression patterns, and map arrangements for NOV7 suggest that NOV7 may have important structural and / or physiological functional features of the NOV family. Accordingly, the nucleic acids and proteins of the invention are useful in potential diagnostic and therapeutic applications and as search tools. They function as specific or selective nucleic acid or protein diagnostic and / or prophylactic markers (wherein the presence or amount of nucleic acid or protein is assessed) and potential therapeutic applications such as: Including: (i) protein therapeutic agent, (ii) small molecule drug target, (iii) antibody target (therapeutic, diagnostic, drug targeting / cytotoxic antibody), (iv) nucleic acid useful for gene therapy (gene) Delivery / gene excision), and (v) compositions that promote tissue regeneration in vivo and in vitro, (vi) biological defense weapons.

These substances are novel NOVs for use in therapeutic or diagnostic methods.
It is further useful in the production of antibodies that immunospecifically bind to seven substances. These antibodies can be produced according to methods known in the art, using predictions from the hydrophobicity chart, as described in the "Anti-NOVX Antibodies" section below.

(NOV8) A novel NOV8 nucleic acid was labeled with C against a GPCR probe or GPCR homolog.
Sequence files from uraGen Corporation are used to generate Genban
Identified on Chromosome 11 by TblastN performed on Genomic Daily Files made available by k. This nucleic acid was further predicted by the program GenScan ^™ , which included exon selection. These were further modified by homology using the BLAST search. This sequence was then manually corrected for apparent discrepancies, resulting in the sequence encoding the full-length protein.

This disclosed 94 encoding a novel NOV8 olfactory receptor-like protein
A novel nucleic acid consisting of 8 nucleotides (95-h-6-E, SEQ ID NO: 26) is shown in Table 8A. The open reading frame (ORF) was identified as starting at the ATG start codon at nucleotides 10-12 and ending at the TAA codon at nucleotides 943-945. The putative untranslated region upstream of the start codon and the putative untranslated region downstream of the stop codon are underlined in Table 8A, with the start and stop codons shown in bold.

[0175]

[Table 60] The disclosed NOV8 polypeptide encoded by SEQ ID NO: 26 (SEQ ID NO: 27) has 311 amino acid residues and is represented in Table 8B using the one letter code. The disclosed NOV8 proteins were analyzed for signal peptide prediction and cell localization. The SignalP results indicate that NOV8 is between position 42 and position 43 of SEQ ID NO: 27 (ie, the amino acid sequence MLA-N
Predict to be truncated (at the slash in L). The Psort and Hydropathy profiles also predict that NOV8 contains a signal peptide and localizes to the plasma membrane (certainty of 0.6000).

[0176]

[Table 61] The NOV8 nucleic acids and proteins of the present invention include the following: infections such as bacterial, fungal, protozoal and viral infections (particularly HIV-1 or HIV-).
2), pain, cancer (including but not limited to neoplasm; adenocarcinoma; lymphoma; prostate cancer; uterine cancer), anorexia, bulimia, asthma, Parkinson's disease, acute heart failure, hypotension, hypertension. , Urinary retention, osteoporosis, Crohn's disease; treatment of multiple sclerosis; and Albright hereditary dysplasia, angina, myocardial infarction,
Ulcers, asthma, allergies, benign prostatic hyperplasia, and psychotic and neurological disorders (anxiety, schizophrenia, manic depression, delirium, dementia, severe mental retardation and movement disorders (eg Huntington's disease or Jill de la • Tourette's syndrome)) and / or other potential pathologies and uses in the treatment of potential therapeutic applications. This polypeptide can be used as an immunogen for producing antibodies specific for the invention and as a vaccine. These can also be used to screen for potential agonist and antagonist compounds. For example, a cDNA encoding a GPCR-like protein can be useful in gene therapy, and a GPCR-like protein can be useful when administered to a subject in need. By way of non-limiting example, the compositions of the present invention may be used for bacterial, fungal, protozoal and viral infections (particularly HIV-1 or H-1).
Infection caused by IV-2), pain, cancer (including but not limited to neoplasm; adenocarcinoma; lymphoma; prostate cancer; uterine cancer), anorexia, bulimia, asthma, Parkinson's disease, acute heart failure, hypotension , Hypertension, urinary retention, osteoporosis, Crohn's disease; treatment of patients with multiple sclerosis; and albrite hereditary dysplasia, angina, myocardial infarction, ulcer, asthma, allergy, benign prostatic hypertrophy And / or psychotic and neurological disorders (including anxiety, schizophrenia, manic depression, delirium, dementia, severe mental retardation and movement disorders (eg, Huntington's disease or Jill de la Tourette syndrome) and / or Alternatively, it has efficacy in treating other pathologies and disorders. The novel nucleic acids encoding the GPCR proteins and GPCR-like proteins of the present invention or fragments thereof may be further useful in diagnostic applications, where the presence or amount of this nucleic acid or protein is assessed. These agents are further useful in the generation of antibodies that immunospecifically bind to the novel agents of the invention for use in therapeutic and diagnostic methods.

In all BLAST alignments herein, the "E value" or "expected value" means that the aligned sequences are simply by chance relative to the BLAST query sequence in the searched database. Is a numerical representation of the probability that the similarity of can be reached. All BLAST analyzes described herein were performed using the NOV8 amino acid sequence.

BLASTX searches were performed on public protein databases. The amino sequence of the protein of the present invention is a 302 amino acid gene (gi | 11464995 | ref | for the odorant receptor A16 derived from Mus musculus).
NP_065261.1 |, E = 2e-96) with 189 of the 299 amino acid residues identical (63%), and 234 of the 299 positive residues with this 302 amino acid gene (74) (74%). %). The disclosed proteins are similar to the olfactory proteins shown in Table 8C.

[0179]

[Table 62] Clus comparing the disclosed proteins of the invention with related OR protein sequences
The talW analysis (determined by BLASTX analysis) is given in Table 8D and NOV8 is shown in the first column.

[0180]

[Table 63] In ClustalW alignments of the NOV8 protein and all other ClustalW analyzes described herein, amino acid residues outlined in black are regions of conserved sequence (ie, that preserve structural or functional properties). Regions, which may be required for amino acid residues), while the non-emphasized amino acid residues are relatively conserved and potentially altered to a much larger extent without altering the structure or function of the protein. obtain.

The existence of identifiable domains in NOV8 and all other NOVXX proteins was determined by software algorithms (eg PROSITE, DOMAI).
Search using N, Blocks, Pfam, ProDomain, and Prints, and then the Interpro website (http: www.
/ Ebi. ac. It was determined by determining the Interpro number by crossing the domain match (or number) using uk / interpro). The DOMAIN results (eg, for NOV8) are
Consserve using the position Specific BLAST analysis
d Domain Database (CDD). This BLAST
The analysis software samples the domains found in the Smart and Pfam collections. For all consecutive DOMAIN sequence alignments, the perfectly conserved single residue is indicated by the black shade and the "strong" semiconservative residue is indicated by the gray shade. Conservative amino acid residues
The "strong" group can be any one of the following amino acid groups: STA, NE.
QK, NHQK, NDEQ, QHRK, MILV, MILF, HY, FYW.

The region of amino acid residues 43-237 (SEQ ID NO: 27) is most probably (E-1
e- ¹⁶ ) "7-transmembrane receptor (rhodopsin family) fragment" domain (7tm_1 entry of Pfam database (TM7, SEQ ID NO: 39)
), Here aligned with residues 2-181)). This indicates that this NOV8 sequence has properties similar to other proteins known to contain this domain and the 377 amino acid 7tm domain itself. NOV8 is also TM
Has identity to another region of the 7 protein. The region of amino acid residues 224-288 (of SEQ ID NO: 27) aligns with amino acid residues 310-377 of TM7 (E = 9e04). Table 8E shows the results of domain analysis of NOV8 and TM7 proteins.

[0183]

[Table 64] A representative member of this 7-transmembrane receptor family is Bos taur.
us-derived D2 dopamine receptor (SWISSPROT: position D2DR_B
OVIN, registration number P20288; gene index 118205). This D2
Receptors are integral membrane proteins and belong to family 1 of G protein-coupled receptors. The activity of the D2 receptor is mediated by G proteins, which inhibit adenylyl cyclase. Chio et al., Nature 343:
255-269 (1990). Residues 51-42 of this 444 amino acid protein
7 is considered to be a representative TM7 domain, shown in Table 8F.

[0184]

[Table 65] The 7-transmembrane receptor family comprises a number of different proteins (eg, serotonin receptors, dopamine receptors, histamine receptors, adrenergic receptors, cannabinoid receptors,
Angiotensin II receptor, chemokine receptor, opioid receptor, G protein coupled receptor (GPCR) protein, olfactory receptor (O
R) and the like are included). Some proteins and Protein Dat
Examples of a Base Id / gene index include the following: rhodopsin (129209); 5-hydroxytryptamine receptor (112821)
, 8488960, 112805, 231454, 1168221, 39897.
1, 112806); G protein-coupled receptor (119130, 54382).
3, 1730143, 132206, 137159, 6136153, 4169
26, 1169881, 136882, 134079); taste receptor (54
4463, 462208); c-x-x chemokine receptor (416718,
128899, 416802, 548703, 1352335); opsin (1
29193, 129197, 129203); and olfactory receptor-like proteins (1299091, 117183, 400672, 548417).

NOV8 nucleic acids and proteins are useful in potential therapeutic applications involving various NOV receptor or olfactory receptor (OR) related pathologies and / or disorders. For example, a cDNA encoding a G protein-coupled receptor-like protein can be useful in gene therapy, and a G protein-coupled receptor-like protein can be useful when administered to a subject in need thereof. The novel nucleic acids encoding the NOV8 protein or fragments thereof may be further useful in diagnostic applications where the presence or amount of the nucleic acid or protein is assessed. These agents are further useful in the generation of antibodies that immunospecifically bind to the novel agents of the invention for use in therapeutic or diagnostic methods. N
OVX nucleic acids and NOVX proteins are useful in potential diagnostic and therapeutic applications involving a variety of diseases and disorders and / or other pathologies described below. For example, the compositions of the present invention have efficacy in treating patients suffering from: cardiomyopathy, atherosclerosis, hypertension, congenital heart defects, aortic stenosis, atrial septal defect (ASD). ), Atrioventricular (A-V) tube defect, arterial duct, pulmonary valve stenosis, subaortic stenosis, ventricular septal defect (VSD), valve disease, tuberous sclerosis,
Scleroderma, obesity, transplantation, adrenoleukodystrophy, congenital adrenal hyperplasia, fertility,
Hemophilia, hypercoagulability, idiopathic thrombocytopenic purpura, immune deficiency, graft-versus-host disease, bronchial asthma, and other diseases, disorders and conditions. By way of non-limiting example, the composition of the present invention may be used in neoplasms, adenocarcinomas, lymphomas, prostate cancers, uterine cancers, immune responses, AIDS,
It has efficacy in treating patients suffering from asthma, Crohn's disease, multiple sclerosis, and Albright hereditary osteodystrophy. Additional NOV-related diseases and disorders are mentioned throughout the specification.

In addition, protein similarity information, expression patterns, and map positions for NOV8 suggest that NOV8 may have important structural and / or physiological functions characteristic of the NOV family. Thus, the nucleic acids and proteins of the invention are useful in potential diagnostic and therapeutic applications and as research tools. These include acting as a specific or selective nucleic acid diagnostic marker and / or nucleic acid prognostic marker, or protein diagnostic marker and / or protein prognostic marker, the presence or amount of which nucleic acid or protein should be evaluated, And potential therapeutic applications such as: (i) protein therapeutics, (ii) small molecule drug targets, (iii) antibody targets (therapy, diagnostics, drug targets / cytotoxic antibodies), (iv). Nucleic acids useful in gene therapy (gene delivery / gene excision), and (v) compositions that promote tissue regeneration in vitro and in vivo, (vi) biological defense weapons.

These agents are further useful in the production of antibodies that immunospecifically bind to the novel NOV8 agents for use in therapeutic or diagnostic methods. These antibodies can be generated according to methods known in the art, using predictions from the hydrophobicity chart, as described in the "Anti-NOVX Antibodies" section below.

(NOV9) A novel NOV9 nucleic acid was identified on Chromosome 11 by TblastN using the CuraGen Corporation sequence file for GPCR probes or homologs performed on the Genomic Daily Files made available by GenBank. did. This nucleic acid was further inferred by the program GenSacn ^™ (including exon selection). These were further modified by similarity using the BLAST cert. This sequence was then manually corrected for apparent discrepancies to give the sequence encoding the full-length protein.

The disclosed 944 nucleotide NO9 nucleic acid (95-h-6-F, SEQ ID NO: 28) encoding a novel NOV olfactory receptor-like protein is shown in Table 9A. TAs at nucleotides 934-936 beginning with the ATG start codon at nucleotides 7-9
An open reading frame (ORF) ending in the G codon was identified. The putative untranslated region upstream of the start codon and the putative untranslated region downstream of the stop codon are underlined in Table 9A, and the start and stop codons are shown in bold.

[0190]

[Table 66] The disclosed NOV9 polypeptide encoded by SEQ ID NO: 28 (SEQ ID NO: 29) is 309 amino acid residues and is shown using the one letter code in Table 9B. The disclosed NOV9 protein was analyzed for signal peptide estimation and cell localization. The SignalP results speculate that NOV9 is cleaved between positions 48 and 49 of SEQ ID NO: 29 (ie, the slash in the amino acid sequence TLA-AS). Psort Profile and Hy
The dropathy profile also speculates that NOV9 contains a signal sequence and is located at the plasma membrane (certainty = 0.6000).

[0191]

[Table 67] The NOV9 nucleic acids and NOV9 proteins of the present invention can be used in infections (eg, bacterial infections, fungal infections, protist infections and viral infections (particularly HIV-1 or HIV).
-2)), pain, cancer (neoplastic; adenocarcinoma; lymphoma; prostate cancer; uterine cancer, but not limited to), anorexia, bulimia, asthma, Parkinson's disease, acute heart failure, low Blood pressure, hypertension, urinary retention, osteoporosis, Crohn's disease; treatment of multiple sclerosis, as well as allbright hereditary dysplasia, angina, myocardial infarction,
Ulcers, asthma, allergies, benign prostatic hypertrophy, and psychotic and neurological disorders (anxiety, schizophrenia, manic depression, delirium, dementia, severe mental retardation and movement disorders (eg Huntington's disease or Jill de It is useful in potential therapeutic applications involving use in the treatment of La Tourette syndrome) and / or other pathologies and disorders. This polypeptide can be used as an immunogen to raise antibodies specific for the invention and as a vaccine. These are also
It can be used to screen for potential agonist and antagonist compounds. For example, a cDNA encoding a GPCR-like protein may be useful in gene therapy, and a GPCR-like protein may be useful when administered to a subject in need thereof. By way of non-limiting example, compositions of the present invention may be used for bacterial, fungal, protist and viral infections (particularly HIV-
1 or infection caused by HIV-2), pain, cancer (neoplasm; adenocarcinoma; lymphoma;
Prostate cancer; including but not limited to uterine cancer), anorexia, bulimia, asthma, Parkinson's disease, acute heart failure, hypotension, hypertension, urinary retention, osteoporosis, Crohn's disease; multiple sclerosis, and allbright Hereditary bone dysplasia, angina, myocardial infarction, ulcer, asthma, allergy, benign prostatic hypertrophy, and psychotic and neurological disorders (anxiety, schizophrenia, manic depression, delirium, dementia, severe mental illness) It has efficacy in treating patients suffering from retardation and movement disorders (eg, Huntington's disease or Gilles de la Tourette's syndrome) and / or other pathologies and disorders. Novel nucleic acid encoding the GPCR-like protein of the present invention and GPC
R-like proteins, or fragments thereof, may be further useful in diagnostic applications, where the presence or amount of the nucleic acid or protein is assessed. These agents are further useful in the production of antibodies that immunospecifically bind to the novel agents of the invention for use in therapeutic or diagnostic methods.

In all BLAST alignments described herein, the “E value” or “Expect” means that the aligned sequence happens to achieve its similarity to the BLAST query sequence alone in the searched databases. It is a numerical indicator of the probability obtained. All BLAST analyzes herein were performed using the NOV9 amino acid sequence.

BLAST searches were performed against public protein databases. The amino acid sequence of the protein of the present invention is 308 amino acid odorant receptor A16 (gi | 11496249 | ref | NP_0673) derived from Mus musculus.
43.1 |, E = 4e-80), having 168 amino acid residues identical in 308 amino acid residues (54%) and having positive 227 amino acid residues in 308 amino acid residues ( 73%), and 2 of 308 residues have a gap. The disclosed proteins are also similar to the olfactory proteins disclosed in Table 9C.

[0194]

[Table 68] OR protein sequences related to the disclosed proteins of the invention (BLASTX
ClustalW analysis (as determined by analysis), Table 9D.
(NOV9 is shown in lane 1).

[0195]

[Table 69] In ClustalW alignments of the NOV9 protein, as well as in all other ClustalW analyzes described herein, open amino acid residues are required to preserve regions of conserved sequence (ie, to preserve structural or functional properties). Region), while the non-emphasized amino acid residues are less conserved,
And potentially, it can be mutated to a wider extent without altering the structure or function of the protein.

The existence of identifiable domains in NOV9 as well as in all other NOVX proteins was determined by software algorithms (eg PROSITE, DOMAIN).
, Blocks, Pfam, ProDomain and Prints), and then the Interpro website (http: www.ebi.com).
ac. It was determined by determining the Interpro number by crossing the domain match (or number) using uk / interpro). For example, for NOV9, DOMAIN results are
Conse using e Position Specific BlAST analysis
Collected from rved Domain Database (CDD). This BL
The AST analysis software samples the domains found in the Smart and Pfam collections. For all consecutive DOMAIN sequence alignments, single residues that are perfectly conserved are indicated by black shading, and "strong" semi-conserved residues are shown by gray shading. A “potent” group of conserved amino acid residues can be any one of the following groups of amino acids: STA, NEQA,
NHQK, NDEQ, QHRK, MILV, MILF, HY, FYW.

The region of amino acid residues 39-199 (SEQ ID NO: 29) is almost likely (E = 7
e-11), "7 transmembrane receptor (rhodopsin family) fragment" domain (here, 7tm_1 entry (TM7, Pfam database)
Aligned with residues 1-156 of SEQ ID NO: 39)). This is NOV9
It is shown that the sequence has similar properties to other proteins known to contain this domain as well as the 377 amino acid 7tm domain itself.

[0198]

[Table 70] A representative member of the seven transmembrane receptor family is Bos taur.
us-derived D2 dopamine receptor (SWISSPROT: locus D2DR
_BOVIN, registration P20288, gene index 118205). This D2
Receptors are integral membrane proteins and belong to family 1 of G protein coupled receptors. The activity of the D2 receptor is mediated by G proteins that do not inhibit adenylyl cyclase. Chio et al., Nature 343: 255.
-269 (1990). Residues 51-427 of this 444 amino acid protein are believed to be a representative TM7, which is shown in Table 9F.

[0199]

[Table 71] The seven transmembrane receptor family includes many different proteins, including, for example, serotonin receptors, dopamine receptors, histamine receptors, androgenetic receptors, cannabinoid receptors, angiotensin II receptors, chemokine receptors. , Opioid receptor, G protein coupled receptor (GPCR)
Proteins, olfactory receptors (OR), etc. are included. Some proteins and Protein Data Base Ids / gene markers include, for example: rhodopsin (129209); 5-hydroxytryptamine receptor (112821, 8488860, 112805, 231454).
, 1168221, 398971, 112806); G protein coupled receptor (119130, 543823, 1730143, 132206, 13715).
9, 6136153, 416926, 1169881, 136882, 1340
79); taste receptor (544443, 462208); cx-c chemokine receptor (416718, 128899, 416802, 548703, 1)
352335); opsin (129193, 129197, 129203); and olfactory receptor-like protein (1299091, 1171893, 40067).
2, 548417).

NOV9 nucleic acids and proteins are useful in potential therapeutic applications associated with various NOV receptor or olfactory receptor (OR) related pathologies and / or disorders. For example, a cDNA encoding a G protein-coupled receptor-like protein may be useful in gene therapy, and a G protein-coupled receptor-like protein may be useful when administered to a subject in need thereof. The novel nucleic acids encoding the NOV9 protein or fragments thereof may also be useful in diagnostic applications, where the presence or amount of nucleic acid or protein is assessed. These materials are further useful in the generation of antibodies that immunospecifically bind to the novel agents of the invention for use in therapeutic or diagnostic methods. NOVX nucleic acids and proteins are useful in potential diagnostic and therapeutic applications associated with the various diseases and disorders and / or other pathologies described below. For example, the compositions of the invention have efficacy in treating patients suffering from: cardiomyopathy, atherosclerosis, hypertension, congenital heart defects,
Aortic stenosis, Atrial septal defect (ASD), Atrioventricular (A-V) tube defect, Arterial tube, Pulmonary valve stenosis, Inferior aortic stenosis, Ventricular septal defect, Valve disease, Tuberous sclerosis, Strong Dermatosis, obesity, transplantation, adrenoleukodystrophy, congenital adrenal hypertrophy, fertility, hemophilia,
Hypercoagulation, idiopathic thrombocytopenic purpura, immunodeficiency, graft-versus-host disease, bronchial asthma, and other diseases, disorders and conditions. As a non-limiting example, the compositions of the present invention have efficacy for the treatment of patients suffering from: neoplasm, adenocarcinoma, lymphoma, prostate cancer, uterine cancer, immune response, AIDS, asthma, clones. Disease, multiple sclerosis, and allbright hereditary osteodystrophy. Additional NOV related diseases and disorders are described throughout the specification.

In addition, protein similarity information, expression patterns and map positions for NOV9 suggest that NOV9 may have important structural and / or physiological functions characteristic of the NOV family. Thus, the nucleic acids and proteins of the invention are useful as potential diagnostic and therapeutic applications and research tools. These include the use of specific or selective nucleic acids or proteins as diagnostic and / or prognostic markers, where the presence or amount of nucleic acids or proteins is assessed, and potential therapeutics such as: Applications include: (i) protein therapy, (ii) small molecule drug targets, (iii) antibody targets (therapeutic antibodies, diagnostic antibodies, drug targets / cytotoxic antibodies), (iv) gene therapy (gene delivery / Nucleic acids useful in (gene excision), (v) compositions that promote tissue regeneration in vitro and in vivo, and (vi) biological defense weapons (defens).
e weapon).

These materials are further useful in the generation of antibodies that immunospecifically bind to novel NOV9 agents for use in therapeutic or diagnostic methods. These antibodies can be generated according to methods known in the art, using predictions from the hydrophobicity chart, as described in the "Anti-NOVX Antibodies" section below.

(NOV10) A novel NOV10 nucleic acid was isolated from Genomic Da available from GenBank.
Tbl using CuraGen Corporation sequence files for GPCR probes or homologs run against ily Files
Identified on chromosome 11 by astN. This nucleic acid was further predicted by the program GenScan ^™ , which included exon selection. These were further corrected for similarity using a BLAST search. These sequences were then manually corrected for apparent discrepancies, resulting in a protein encoding the full-length protein.

The disclosed NOV10 nucleic acid of 1003 nucleotides (AC023078_A, SEQ ID NO: 30) encoding a novel NOV10 olfactory receptor-like protein is shown in Table 10A. An open reading frame (ORF) was identified that begins at the ATG start codon at nucleotides 5-7 and ends at the TGA codon at nucleotides 995-997. The putative untranslated region upstream of the start codon and downstream of the stop codon is underlined in Table 10A and the start and stop codons are shown in bold.

[0205]

[Table 73] This disclosed NOV10 polypeptide (encoded by SEQ ID NO: 30
SEQ ID NO: 31) is a 330 amino acid residue and is shown in Table 10B using the one letter code. The disclosed NOV10 proteins were analyzed for signal peptide prediction and subcellular localization. SignalP is NOV1
0 is between the 65th position and the 66th position of SEQ ID NO: 31 (ie, the amino acid sequence TF
It indicates that it is cleaved with a slash in S-LY). Psort and hydropathic index profiles also predict that NOV10 contains a signal peptide and is localized in the plasma membrane (certainty = 0.6000). It can also be localized to the Golgi apparatus.

[0206]

[Table 74] The NOV10 nucleic acids and proteins of the invention are useful in potential therapeutic applications related to use in the treatment of: infections (eg, bacterial infections, fungal infections, protozoal infections and viral infections (particularly HIV- 1 or infection caused by HIV-2)), pain, cancer (neoplasia; adenocarcinoma; lymphoma; prostate cancer; uterine cancer, including but not limited to), anorexia nervosa, bulimia nervosa, asthma, Parkinson's disease. , Acute heart failure, hypotension, hypertension, urinary retention, osteoporosis, Crohn's disease; multiple sclerosis; and Albright hereditary dysplasia, angina, myocardial infarction, ulcer,
Asthma, allergies, benign prostatic hyperplasia, and psychotic and neurological disorders (anxiety, schizophrenia, manic depression, delirium, dementia,
Treatment of severe mental retardation and dyskinesia (eg, Huntington's disease or Gilles de la Tourette's syndrome, and / or other pathologies and disorders).
This polypeptide can be used as an immunogen to produce antibodies specific for the present invention and as a vaccine. They can also be used to screen potential agonist and antagonist compounds.
For example, a cDNA encoding a GPCR-like protein can be useful in gene therapy, and the GPCR-like protein can be useful when administered to a subject in need of the GPCR-like protein. As a non-limiting example, the compositions of the present invention have efficacy in treating patients suffering from: bacterial, fungal, protozoal and viral infections (especially caused by HIV-1 or HIV-2). Infection), pain, cancer (including but not limited to neoplasm; adenocarcinoma; lymphoma; prostate cancer; uterine cancer), anorexia, bulimia, asthma, Parkinson's disease, acute heart failure, hypotension, hypertension, Urinary retention, osteoporosis, Crohn's disease; multiple sclerosis; and albrite hereditary bone dysplasia, angina, myocardial infarction, ulcer, asthma, allergies, benign prostatic hyperplasia, and psychotic and neurological disorders (anxiety , Schizophrenia, manic depression, delirium, dementia, severe mental retardation and dyskinesia (eg Huntington's disease or Jill de la To) Retto syndrome, and / or other pathologies and disorders) Treatment of the included). The novel nucleic acids encoding GPCR-like proteins, and GPCR-like proteins of the invention, or fragments thereof, may further be useful in diagnostic applications. here,
The presence or amount of this nucleic acid or this protein is evaluated. These agents are further useful in producing antibodies that immunospecifically bind to the novel agents of the invention for use in therapeutic or diagnostic methods.

[0207] In all BLAST alignments described herein, the value "E-value" or "Expect" is the value within the database in which the aligned sequences were searched. It is a numerical representation of the probability that its similarity to the BLAST query sequence could be achieved only by chance.
All BLAST analyzes described herein were performed with the NOV10 amino acid sequence.

BLAST searches were performed on public protein databases. The amino acid sequence of the protein of the present invention is a deduced protein of 324 amino acids derived from Mus musculus (gi | 12853220 | dbj | BAB29684.1).
| (AK015036)), E = 6e-26) and 8 out of 265 amino acid residues
Identity at 9 amino acid residues (33%), 146 out of 265 residues (54%)
Was found positive and had a gap at 10 of 265 residues. The disclosed proteins are also similar to the proteins disclosed in Table 10C.

[0209]

[Table 75] The disclosed proteins of the present invention have been described as related OR protein sequences (BLASTX
ClustalW analysis (as determined by analysis), Table 10D.
(NOV10 is shown in the first line).

[0210]

[Table 76] In ClustalW alignments of the NOV10 protein, as well as in all other ClustalW analyzes described herein, amino acid residues outlined in black represent regions of conserved sequence (ie, those that preserve structural or functional properties). Regions that may be required to mutate), while unmarked amino acid residues are less conserved and potentially mutated to a higher degree without altering the structure or function of the protein. obtain.

The presence of an identifiable domain in NOV10 and all other NOVX proteins was confirmed by PROSITE, DOMAI.
Search using software algorithms such as N, Blocks, Pfam, ProDomain, and Prints, then use the Interpro website (http: www.ebi.ac.uk/interpro) to search for domain matches (ie, It was determined by determining the Interpro number by crossing the number. The result of DOMAIN (for example, for NOV9) is the reverse position sp
Using the Econic BLAST analysis, the Conserved Domain
Collected from Database (CDD). This BLAST analysis software sample domain was found in the Smart and Pfam collections. For all contiguous DOMAIN sequence alignments, completely conserved single residues are indicated by shading in black and "strong" semi-conserved residues are indicated by shading in gray. The group of “strong” conserved amino acid residues can be any one of the following amino acid groups: STA, NEQK.
, NHQK, NDEQ, QHRK, MILV, MILF, HY, FYW.

The region of amino acid residues 47-210 (SEQ ID NO: 31) most likely contains the "7-transmembrane receptor (rhodopsin family) fragment" domain (
E = 8e- ⁸ ), this domain is referred to herein as 7tm of the Pfam database.
Aligned with residues 1-166 of the _1 entry (TM7, SEQ ID NO: 39). This indicates that the NOV10 sequence has properties that are similar to sequences of other proteins known to contain this domain and to the 377 amino acid 7tm domain itself. NOV10 also has identity with another region of the TM7 protein. The region of amino acid residues 225 to 280 (of SEQ ID NO: 31) aligns with amino acid residues 325 to 377 of TM7 (E = 6e-04). Table 10E shows NOV1
The results of domain analysis of 0 and TM7 proteins are shown.

[0213]

[Table 77] A representative member of the 7-transmembrane receptor family is Bos tauru.
s-derived D2 dopamine receptor (SWISSPROT: D2DR_BOVI
N locus, accession number P20288: Gene index 118205). The D2 receptor is an essential membrane protein and belongs to the family 1 of G protein-coupled receptors. The activity of the D2 receptor is mediated by the G protein, which activity inhibits adenylyl cyclase. Chio et al., Nature 343: 2.
55-269 (1990). Residues 51-42 of this 444 amino acid protein
7 is considered to be the representative TM7 domain shown in Table 10F.

[0214]

[Table 78] This 7-transmembrane receptor family includes many different proteins including, for example, serotonin receptors, dopamine receptors, histamine receptors, androgen receptors, cannabinoid receptors, angiotensin II receptors, chemokine receptors, opioid receptors, G protein-coupled types. Receptor (GPCR) proteins, olfactory receptors (OR) and the like can be mentioned. Several proteins and Protein Data Base Id
Examples of the s / gene index include the following: rhodopsin (129209)
); 5-hydroxytryptamine receptor; (112821, 8488890)
, 112805, 231454, 1168221, 398971, 112806.
); G protein-coupled receptor (119130, 543823, 17301)
43, 132206, 137159, 6136153, 416926, 1169
881, 136882, 134079); taste receptors (5444463, 4622)
08); c-x-c chemokine receptor (416718, 128899, 41)
6802, 548703, 1352335); Opsin (129193, 129).
197, 129203); and olfactory receptor-like proteins (1290901, 11)
71893, 400672, 548417).

NOV10 nucleic acids and proteins are associated with various NOV or olfactory receptors (ORs).
) Is useful in potential therapeutic applications relating to pathologies and / or disorders. For example, a cD encoding a G protein-coupled receptor-like protein
NA may be useful in gene therapy, and G protein-coupled receptor-like proteins may be useful when administered to a subject in need of G protein-coupled receptor-like proteins. The novel nucleic acids encoding the NOV10 protein, or fragments thereof, may also be useful in diagnostic applications. Here, the presence or amount of this nucleic acid or this protein is assessed. These agents are further useful in producing antibodies that immunospecifically bind to the novel agents of the invention for use in therapeutic or diagnostic methods. NO
VX nucleic acids and proteins are used in various diseases and disorders and / or
Alternatively, it is useful in potential diagnostic and therapeutic applications associated with other pathologies. For example, the compositions of the invention have efficacy for the treatment of patients suffering from: cardiomyopathy, atherosclerosis, hypertension, congenital heart defects, aortic stenosis, atrial septal defect ( ASD), atrioventricular (AV) hole defect, arterial duct, pulmonary valve stenosis, subaortic stenosis (subaortic stenosis), ventricular septal defect (VSD), valve disease (valve disease), tuberous sclerosis , Scleroderma, obesity, transplantation, adrenoleukodystrophy, congenital adrenal hyperplasia, fertility (
fertility), hemophilia, hypercoagulation, idiopathic thrombocytopenic purpura, immunodeficiency, graft-versus-host disease, bronchial asthma, and other such diseases, disorders, and conditions. As a non-limiting example, the compositions of the present invention have efficacy for the treatment of patients suffering from: neoplasia, adenocarcinoma, lymphoma, prostate cancer, uterine cancer, immune response, AI.
DS, asthma, Crohn's disease, multiple sclerosis, and allbright hereditary bone dysplasia. Additional NOV-related diseases and disorders are mentioned throughout the specification.

Further, protein similarity information, expression patterns, and map positions for NOV10 suggest that NOV10 may have important structural and / or physiological functions characteristic of the NOV family. Thus, the nucleic acids and proteins of the invention are useful in potential diagnostic and therapeutic applications, and as research tools. These serve as specific or selective nucleic acid or protein diagnostic markers and / or prognostic markers, where the presence or amount of this nucleic acid or protein is assessed, and the potential for: Therapeutic application: (i) protein therapy, (ii) small molecule drug targeting, (iii) antibody targeting (therapeutic, diagnostic, drug targeting / cytotoxic antibody)
, (Iv) Nucleic acids useful for gene therapy (gene delivery / ablation)
n)), and (v) compositions that promote tissue regeneration in vitro and in vivo, (vi) biological defense weapons.

These agents are further useful in the production of antibodies that immunospecifically bind to the novel NOV10 agent for use in therapeutic and diagnostic methods. These antibodies can be produced according to methods known in the art, using the predictions from the hydrophobicity chart, as described in the "Anti-NOVX Antibodies" section below.

The ClustalW alignments of NOV4a, NOV4b, NOV5, NOV6, NOV7, NOV8, and NOV9 are shown in Table 11.

[0219]

[Table 79] A summary of all NOVX nucleic acids and proteins of the invention is provided in Table 12.

[0220]

[Table 80] NOVX Nucleic Acids and Polypeptides One aspect of the invention pertains to isolated nucleic acid molecules that encode NOVX polypeptides or biologically active proteins thereof. Also, a nucleic acid fragment sufficient for use as a hybridization probe to identify a nucleic acid encoding NOVX (eg, NOVX mRNA), and for use as a PCR primer for amplification and / or mutation of a NOVX nucleic acid molecule. Fragments of the present invention are also included in the present invention. As used herein, the term "nucleic acid molecule" refers to a DNA molecule (eg, cDNA or genomic DNA), RNA.
Molecules (eg mRNA), DNA made using nucleotide analogues
Or it is intended to include analogs of RNA, and their derivatives, fragments and homologs. The nucleic acid molecule can be single-stranded or double-stranded, but is preferably double-stranded DNA.

The NOVX nucleic acid can encode a mature NOVX polypeptide. As used herein, a "mature" form or protein of a polypeptide disclosed in the present invention refers to the production of a naturally occurring polypeptide or precursor form or proprotein. Naturally occurring polypeptide or precursor forms or proproteins include, by way of non-limiting example only, the full length gene product encoded by the corresponding gene. Alternatively, they may be defined as polypeptides, precursors or proproteins encoded by the open reading frames disclosed herein. The product “mature” form also results, for purposes of non-limiting example, as a result of one or more naturally occurring processing steps, if they occur in the cell in which this gene product occurs or the host cell. Examples of such processing steps leading to the "mature" form of a polypeptide or protein include cleavage of the N-terminal methionine residue encoded by the start codon of the open reading frame, or proteolytic cleavage of the signal peptide or leader sequence. Can be mentioned. Therefore, residues 1-N
The mature form resulting from the precursor polypeptide or protein having (where residue 1 is the N-terminal methionine) has residues 2 to N after removal of the N-terminal methionine. Alternatively, the mature form resulting from a precursor polypeptide or protein having residues 1-N, where the N-terminal signal sequence (residues 1-M) is cleaved, is:
It has the remaining residues M + 1 to N. Further, as used herein, a "mature" form of a polypeptide or protein is not a proteolytic event,
It may result from a post-translational modification step. Such additional processes include, by way of non-limiting example, glycosylation, myristoylation or phosphorylation. In general, a mature polypeptide or protein may result from the manipulation of only one of these processes or any combination thereof.

The term “probe” as used herein refers to nucleic acid sequences of various lengths, preferably at least about 10 nucleotides (depending on the particular application).
nt), 100 nt, or as large as about 6,000 nt, for example. The probe is used in the detection of identical, similar or complementary nucleic acid sequences.
Longer probes are usually obtained from natural or recombinant sources, are highly specific, and hybridize much slower than shorter length oligomeric probes. The probe can be single-stranded or double-stranded, and PCR
, Is designed to have specificity in membrane-based hybridization techniques, or ELISA-like techniques.

The term “isolated” nucleic acid molecule, as used herein, is a nucleic acid molecule that is separated from other nucleic acid molecules that are present in the natural source of this nucleic acid. Preferably, an "isolated" nucleic acid has the sequences that naturally flank the nucleic acid in the genomic DNA of the organism from which it is derived (ie, the sequences located at the 5'and 3'ends of the nucleic acid). Not included. For example, in various embodiments, isolated NOVX
A nucleic acid molecule is about 5 kb, 4 kb, 3 kb naturally flanking this nucleic acid in the genomic DNA of the cell / tissue from which it is derived (eg, brain, heart, liver, spleen, etc.).
It may contain less than 2 kb, 1 kb, 0.5 kb, or 0.1 kb of nucleotide sequence. Further, an "isolated" nucleic acid molecule, eg, a cDNA molecule, is substantially free of other cellular material or culture medium when produced by recombinant techniques, or chemically synthesized, It may be substantially free of chemical precursors or other chemicals.

Nucleic acid molecules of the invention, eg SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15
, 17, 19, 20, 22, 24, 26, 28, and 30 nucleotide sequences, or the complements of the above nucleotide sequences, are provided by standard molecular biology techniques and herein. Sequence information can be used to isolate. As hybridization probes, SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13,
Using all or a portion of 15, 17, 19, 20, 20, 22, 24, 26, 28, and 30 nucleic acids, NOVX molecules can be isolated using standard hybridization and cloning techniques (eg, Sambrook et al. (Eds.)). , MOLECULAR
CLONING: A LABORATORY MANUAL 2nd Edition, Cold
Spring Harbor Laboratory Press, Cold
Spring Harbor, NY, 1989; and Ausubel et al., (
Ed), CURRENT PROTOCOLS IN MOLECULAR BI
OLOGY, John Wiley & Sons, New York, NY, 19
As described in 93).

Nucleic acids of the invention are labeled with cD as template according to standard PCR amplification techniques.
It can be amplified using NA, mRNA or genomic DNA, and appropriate oligonucleotide primers. The nucleic acid so amplified can be cloned into an appropriate vector and characterized by DNA sequence analysis. Furthermore, NO
Oligonucleotides corresponding to VX nucleotide sequences can be prepared by standard synthetic techniques, eg, using an automated DNA synthesizer.

As used herein, the term “oligonucleotide” refers to a series of linked nucleotide residues, which oligonucleotide has a sufficient number of nucleotide bases to be used in a PCR reaction. Short oligonucleotide sequences can be based on, or designed from, genomic or cDNA sequences, and amplify, confirm, or confirm the presence, in a particular cell or tissue, of identical, similar or complementary DNA or RNA. Used to indicate. Oligonucleotides include portions of nucleic acid sequences having a length of about 10 nt, 50 nt, or 100 nt, preferably about 15 nt to 30 nt. In one embodiment of the invention, the oligonucleotide comprising a nucleic acid molecule of less than 100 nt has
Further, SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 20,
At least 6 consecutive nucleotides of 22, 24, 26, 28, and 30;
Or its complement. Oligonucleotides can be chemically synthesized and used as probes.

In another embodiment, the isolated nucleic acid molecule of the invention is SEQ ID NO: 1, 3, 5, 7
, 9, 11, 13, 15, 17, 17, 19, 20, 22, 24, 26, 28, and 30 or a portion of this nucleotide sequence (eg, a fragment that can be used as a probe or primer, or NOV).
Nucleic acid molecule that is the complement of a fragment that encodes the biologically active portion of the X polypeptide. SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17,
Nucleic acid molecules that are complementary to the nucleotide sequences shown in 19, 20, 22, 24, 26, 28, and 30 have the sequence of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 15.
A nucleic acid molecule that is sufficiently complementary to the nucleotide sequences shown in 17, 19, 20, 22, 24, 26, 28, and 30, and is represented by SEQ ID NOs: 1, 3, 5, 7, 9, 11.
, 13, 15, 17, 19, 20, 22, 24, 26, 28, and 30, capable of hydrogen bonding with little or no mismatch, thereby forming a stable duplex. It is a molecule.

As used herein, the term “complementary” refers to Watson-Crick or Hoogsteen base pairing between nucleotide units of nucleic acid molecules, and the term “binding” refers to two polypeptides or compounds or related By physical or chemical interaction between polypeptides or compounds or combinations thereof. Binding includes ionic, nonionic, van der Waals, hydrophobic interactions and the like.
Physical interactions can be direct or indirect. Indirect interactions are
It may be via, or due to, another polypeptide or compound. Direct binding refers to interactions without other substantial chemical intermediates that do not occur through or due to the effect of another polypeptide or compound.

Fragments provided herein include at least 6 (consecutive) nucleic acid sequences or at least 4 (consecutive) amino acid sequences (respectively for specific hybridization in the case of nucleic acids). Enablement, or in the case of amino acids, sufficient length to allow specific recognition of the epitope), and at most some portion less than the full length sequence. Fragments can be derived from any contiguous portion of the selected nucleic acid or amino acid sequences. Derivatives are nucleic acid or amino acid sequences formed from a native compound either directly or by modification or partial substitution. An analog is a nucleic acid sequence or amino acid sequence that has a structure (but not identical) similar to that of the native compound, but differs with respect to a particular component or side chain. Analogs can be synthetic or they can be derived from evolutionarily different sources and have similar or opposite metabolic activity as compared to wild type. Homologs are nucleic acid or amino acid sequences of specific genes from different species.

Derivatives and analogs can be full length, or other than full length, if the derivative or analog comprises a modified nucleic acid or amino acid, as described below. A derivative or analog of a nucleic acid or protein of the invention, in various embodiments, when compared to a nucleic acid or protein of the invention, across a nucleic acid or amino acid sequence of identical size, or to an aligned sequence (the alignment is Performed by computer homology programs known in the art), at least about 30%, 50%, 70%, 80%, or 95% identity (preferred identity is 80-95%). Or a region in which the encoding nucleic acid is capable of hybridizing under stringent, moderately stringent, or low stringent conditions to the complement of a sequence encoding the above protein. Includes, but is not limited to, molecules. For example, Ausub
el et al., CURRENT PROTOCOLS IN MOLECULAR B
IOLOGY, John Wiley & Sons, New York, NY
, 1993, and below.

“Homologous nucleic acid sequence” or “homologous amino acid sequence” or variants thereof refer to sequences characterized by homology at the nucleotide or amino acid level, as discussed above. The homologous nucleotide sequence is NOVX.
Encodes a sequence encoding an isoform of a polypeptide. Isoforms can be expressed in different tissues of the same organism as a result of, for example, alternative splicing of RNA. Alternatively, the isoforms can be encoded by different genes. In the present invention, homologous nucleotide sequences include species other than humans, including but not limited to vertebrates, and thus, for example, frogs, mice, rats, rabbits, dogs, cats, cows, horses and other Organisms can be mentioned)
Of the NOVX polypeptide. Homologous nucleotide sequences also include, but are not limited to, naturally occurring allelic variants and variants of the nucleotide sequences described herein. However, homologous nucleotide sequences do not include the exact nucleotide sequence encoding the human NOVX protein. Homologous nucleic acid sequences are SEQ ID NOs: 2, 4, 6, 8, 10, 12, 1
Includes nucleic acid sequences encoding polypeptides that retain 4, 16, 18, 21, 23, 25, 27, 29, and 31 conservative amino acid substitutions (see below), and NOVX biological activity. Various biological activities of NOVX proteins are described below.

NOVX polypeptides are encoded by the open reading frame of NOVX nucleic acids. The ORF corresponds to a nucleotide sequence that can potentially be translated into a polypeptide. The stretch of nucleic acid containing the ORF is uninterrupted by the stop codon. The ORF, which represents the coding sequence for all proteins, begins with the ATG "start" codon and ends with one of the three "stop" codons (ie, TAA, TAG, or TGA). For the purposes of the present invention, the ORF can be any part of the coding sequence, with or without a start codon, a stop codon, or both. For ORFs that are considered good candidates for the coding of the bonafide cell proteins, minimal size requirements often set stretches of DNA encoding proteins, eg, 50 amino acids or more.

Nucleotide sequences determined from cloning of the human NOVX gene have been used to identify and / or clone NOVX homologs in other cell types (eg, from other tissues), as well as NOVX homologs from other vertebrates. Allows the production of probes and primers designed for use. The probe / primer typically comprises a substantially purified oligonucleotide.
This oligonucleotide is typically represented by SEQ ID NOs: 1, 3, 5, 7, 9, 11,
13, 15, 17, 19, 20, 22, 24, 26, 28, and 30 of at least about 12, about 25, about 50, about 100, about 150, about 200, about 250, About 300, about 350 or about 400 contiguous sense strand nucleotide sequences; or SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 1.
9, 20, 22, 24, 26, 28, and 30 antisense strand nucleotide sequences; or SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19,
At least about 12, about 25, about 50, about 100, about 150, about 200, about 2 of 20, 22, 24, 26, 28, and 30 naturally occurring variants.
A region of nucleotide sequence that hybridizes under stringent conditions to 50, about 300, about 350 or about 400 contiguous sense strand nucleotide sequences.

Probes based on human NOVX nucleotide sequences can be used to detect transcripts or genomic sequences encoding the same or homologous proteins. In various embodiments, the probe further comprises a labeling group attached to the probe, eg, the labeling group can be a radioisotope, a fluorescent compound, an enzyme, or an enzyme cofactor. Such a probe may, for example, measure the level of nucleic acid encoding NOVX in a sample of cells from a subject as part of a diagnostic test kit for identifying cells or tissues that misexpress NOVX protein. (Eg, detecting NOVX mRNA levels, or determining whether the genomic NOVX gene is mutated or deleted).

A "polypeptide having a biologically active portion of a NOVX polypeptide" is
A polypeptide that exhibits activities that are similar but not necessarily identical to those of the polypeptides of the invention, including mature forms as measured in a particular biological assay, with or without dose dependence. A nucleic acid fragment encoding a "NOVX biologically active portion" is SEQ ID NO: that encodes a polypeptide having NOVX biological activity (NOVX protein biological activity is described below). 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 20, 22, 24,
26, 28, and 30 were isolated, expressed the encoded portion of the NOVX protein (eg, by recombinant expression in vitro), and NOVX
Can be prepared by assessing the activity of the encoded portion of

Variants of NOVX Nucleic Acids and Polypeptides The present invention further comprises SEQ ID NOs: 1, 3, 5, 7, 9 due to the degeneracy of the genetic code.
, 11, 13, 15, 17, 19, 20, 22, 24, 26, 28, and 30.
A nucleic acid molecule that differs from the nucleotide sequence shown in SEQ ID NO: 1
3, 5, 7, 9, 11, 13, 15, 17, 19, 20, 22, 24, 26,
It encodes the same NOVX protein as the protein encoded by the nucleotide sequences shown at 28 and 30. In another embodiment, the isolated nucleic acid molecule of the invention is SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18,
It has a nucleotide sequence that encodes a protein having the amino acid sequences shown at 21, 23, 25, 27, 29, and 31.

SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 20, 22,
In addition to the NOVX nucleotide sequences shown at 24, 26, 28, and 30,
It will be appreciated by those of skill in the art that DNA sequence polymorphisms that lead to changes in the amino acid sequence of this NOVX polypeptide may exist within a population (eg, the human population). Such genetic polymorphisms in the NOVX gene may exist among individuals within a population due to natural allelic variation. As used herein,
The terms "gene" and "recombinant gene" refer to an open reading frame (OR) encoding a NOVX protein, preferably a vertebrate NOVX protein.
A nucleic acid molecule containing F). Such natural allelic variations are
Typically, there may be 1-5% variability in the nucleotide sequence of the NOVX gene. Any and all such nucleotide variations within the NOVX polypeptide and resulting amino acid polymorphisms that are the result of natural allelic variation and do not alter the functional activity of the NOVX polypeptide are within the scope of the invention. Intended to be within.

In addition, it encodes NOVX proteins from other species, thus SEQ ID NO: 1,
3, 5, 7, 9, 11, 13, 15, 17, 19, 20, 22, 24, 26, 2
Nucleic acid molecules having nucleotide sequences that differ from the 8 and 30 human sequences are intended to be within the scope of the invention. Nucleic acid molecules corresponding to naturally occurring allelic variants and homologs of the NOVX cDNAs of the invention are based on their homology to the human NOVX nucleic acids disclosed herein under standard stringent hybridization conditions. Can be isolated using human cDNA or a portion thereof as a hybridization probe according to conventional hybridization techniques.

Thus, in another embodiment, an isolated nucleic acid molecule of the invention is at least 6 nucleotides in length and under stringent conditions SEQ ID NOs: 1, 3, 5, 7
, 9, 11, 13, 15, 17, 19, 20, 22, 24, 26, 28, and 30 nucleotide sequences. In another embodiment, the nucleic acid is at least 10, 25, 50, 100, 250, 500, 75.
It has a nucleotide length of 0, 1000, 1500, 2000 or more. In yet another embodiment, the isolated nucleic acid molecule of the invention hybridizes to the coding region. As used herein, the term “hybridize under stringent conditions” refers to conditions under which hybridization, and washing, nucleotide sequences that are at least 60% homologous to one another typically remain hybridized to each other. Intended to be listed.

Homologs (ie, nucleic acids encoding NOVX proteins from non-human species) or other related sequences (eg, paralogs) are probed with all or part of a particular human sequence and are labeled with nucleic acid hybrids. It can be obtained by low, medium, or high stringency hybridization using methods well known in the art for hybridization and cloning.

As used herein, the phrase “stringent hybridization conditions” refers to the conditions under which a probe, primer or oligonucleotide is
It is a condition that hybridizes to the target sequence but does not hybridize to other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures than shorter sequences. Generally, stringent conditions are selected to be about 5 ° C below the thermal melting point (Tm) of a particular sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength, pH and nucleic acid concentration) at which 50% of the probe complementary to the target sequence hybridizes to the target sequence at equilibrium. Since the target sequence is generally present in excess, at Tm 50% of the probe is occupied in equilibrium. Typically, stringent conditions are pH 7.0-8.3 and salt concentrations less than about 1.0 M sodium ion, typically about 0.01-1.0.
M sodium ion (or other salt), and temperature at least about 30 ° C. for short probes, primers or oligonucleotides (eg 10 nt to 50 nt) and at least about 60 ° C. for longer probes, primers and oligonucleotides. It is a condition. Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.

Stringent conditions are known to those of skill in the art and are described by Ausubel et al. (Eds.), CURRENT PROTOCOLS IN MOLECULAR BIO.
LOGY, John Wiley & Sons, N.M. Y. (1989), 6.
It can be found in 3.1-6.3.6. Preferably, this condition is such that sequences that are at least about 65%, about 70%, about 75%, about 85%, about 90%, about 95%, about 98% or about 99% homologous to each other, typically to each other. Conditions are such that they will remain hybridized. A non-limiting example of stringent hybridization conditions is 6 × SSC, 50 mM Tris-HCl (pH 7.5), 1 mM EDT.
Hybridization at 65 ° C. in high salt buffer containing A, 0.02% PVP, 0.02% Ficoll, 0.02% BSA, and 500 mg / ml denatured salmon sperm DNA, followed by 0 Perform one or more washes at 50 ° C. in 2 × SSC, 0.01% BSA. SEQ ID NO: 1 under stringent conditions,
3, 5, 7, 9, 11, 13, 15, 17, 19, 20, 22, 24, 26, 2
An isolated nucleic acid molecule of the present invention that hybridizes to sequences 8 and 30 is:
Corresponds to a naturally occurring nucleic acid molecule. As used herein, a "naturally-occurring" nucleic acid molecule refers to an RNA or DNA molecule that has a naturally-occurring (eg, encoding a native protein) nucleotide sequence.

In a second embodiment, SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17
, 19, 20, 22, 24, 26, 28, and 30, or fragments, analogs or derivatives thereof, are provided with a nucleic acid sequence capable of hybridizing under moderate stringency conditions to a nucleic acid molecule. .. A non-limiting example of moderate stringency hybridization conditions is 6 × SSC at 55 ° C., 5 × Denhardt's solution, 0.5% SDS and 100 mg / ml.
Hybridization in denatured salmon sperm DNA, followed by 1 × SSC, 0.1
One or more washes at 37 ° C in% SDS. Other conditions of moderate stringency that can be used are well known in the art. For example, Ausubel
Et al., 1993, CURRENT PROTOCOLS IN MOLEC
ULAR BIOLOGY, John Wiley & Sons, NY and Kriegler, 1990, GENE TRANSFER AND EXPR
ESSION, A LABORATORY MANUAL, Stockton
See Press, NY.

In a third embodiment, SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17
, 19, 20, 22, 24, 26, 28, and 30, or fragments, analogs, or derivatives thereof, to nucleic acid molecules that are capable of hybridizing under low stringency conditions to a nucleic acid molecule. A non-limiting example of low stringency hybridization conditions is 35% formamide, 5X.
SSC, 50 mM Tris-HCl (pH 7.5), 5 mM EDTA, 0
． 02% PVP, 0.02% Ficoll, 0.2% BSA, 100 mg
/ Ml denatured salmon sperm DNA, 4 in 10% (weight / volume) dextran sulfate
Hybridization at 0 ° C., followed by 2 × SSC, 25 mM Tris-H.
One or more washes at 50 ° C. in Cl (pH 7.4), 5 mM EDTA and 0.1% SDS. Other conditions of low stringency that can be used are well known in the art (eg, as used for cross-species hybridization). For example, Ausubel et al. (Eds.), 1993, CURRENT P
ROTOCOLS IN MOLECULAR BIOLOGY, John W
iley & Sons, NY and Kriegler, 1990, GENE
TRANSFER AND EXPRESSION, A LABORATOR
Y MANUAL, Stockton Press, NY; Shilo and W
einberg, 1981, Proc Natl Acad Sci USA
78: 6789-6792.

Conservative Variations In addition to naturally occurring allelic variants of NOVX sequences that may be present in the population, one of skill in the art would appreciate that SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19,
Changes can be introduced by mutations to the nucleotide sequences of 20, 22, 24, 26, 28, and 30, thereby altering the amino acid sequence of the encoded NOVX protein without altering the functional capacity of this NOVX protein. Understand that change will occur. For example, nucleotide substitutions that result in amino acid substitutions at "non-essential" amino acid residues are described in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 1.
It can be performed in sequences of 4, 16, 18, 21, 23, 25, 27, 29, and 31. A "non-essential" amino acid residue is a residue that can be modified from the wild-type sequence of this NOVX protein without significantly modifying its biological activity, while an "essential" amino acid residue is Are required for such biological activity. For example,
Amino acid residues that are conserved among the NOVX proteins of the invention are predicted to be particularly unacceptable for alteration. Amino acids that can be conservatively substituted are well known in the art.

Another aspect of the invention includes changes in amino acid residues that are not essential for activity,
It relates to nucleic acid molecules encoding NOVX proteins. Such NOVX proteins have amino acid sequences of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16,
Unlike 18, 21, 23, 25, 27, 29, and 31, it still retains biological activity. In one embodiment, the isolated nucleic acid molecule comprises a nucleotide sequence that encodes a protein, wherein the protein is SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, respectively. 18, 21, 23, 25, 27
, 29, and 31 with at least about 45% homology to the amino acid sequences. Preferably, the protein encoded by this nucleic acid molecule is
SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 21, 23, 25,
27, 29, and 31 with at least about 60% homology; more preferably SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 21, 23, 25,
27, 29, and 31 with at least about 70% homology; and even more preferably, SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 21, 23.
, 25, 27, 29, and 31 with at least about 80% homology;
Still more preferably, SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18
, 21, 23, 25, 27, 29, and 31 are at least about 90% homologous; and most preferably, SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14,
At least about 95% homology to 16, 18, 21, 23, 25, 27, 29, and 31.

SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 21, 23, 25
, 27, 29, and 31 homologous to the NOVX proteins homologous to the proteins of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 1, 1.
1 for the nucleotide sequences of 7, 19, 20, 22, 24, 26, 28, and 30
Can be created by introducing the above nucleotide substitutions, additions or deletions,
As a result, one or more amino acid substitutions, additions or deletions are introduced into the encoded protein.

Mutations are standard techniques (eg, site-directed mutagenesis and PCR-mediated mutagenesis).
By SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 21, 23
, 25, 27, 29, and 31. Preferably, conservative amino acid substitutions are made at one or more putative nonessential amino acid residues. A "conservative amino acid substitution" is an amino acid substitution in which an amino acid residue is replaced with an amino acid residue having a similar side chain. A family of amino acid residues with similar side chains is defined in the art. These families include: amino acids with basic side chains (eg lysine, arginine, histidine), amino acids with acidic side chains (eg aspartic acid, glutamic acid), uncharged polar side chains. Amino acids (eg, glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), amino acids having non-polar side chains (eg, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), β-branched side Amino acids with chains (eg threonine, valine, isoleucine) and amino acids with aromatic side chains (eg tyrosine, phenylalanine, tryptophan, histidine). Thus, a predicted nonessential amino acid residue in the NOVX protein is replaced with another amino acid residue from the same side chain family. Alternatively, in another embodiment, the mutation is along all or part of the NOVX coding sequence (eg, saturation mutagenesis).
Mutagenesis) and the resulting mutants can be screened for biological activity of NOVX to identify those that retain the activity. SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17
, 19, 20, 22, 24, 26, 28, and 30 mutagenesis, the encoded protein can be expressed by any recombinant technique known in the art, and the activity of this protein determined. Can be done.

Amino acid family relevance can also be determined based on side chains. Substituted amino acids are completely conserved “strong” residues or completely conserved “weak”
It can be a residue. The "strong" group of conserved amino acid residues can be any of the following groups: STA, NEQK, NHQK, NDEQ, QHRK, MILV, M.
ILF, HY, FYW (where the single letter amino acid codes are grouped by those amino acid residues that can be substituted for each other). Similarly, the "weak" group of conserved residues can be any of the following: CSA, ATV, SAG, ST.
NK, STPA, SGND, SNDEQK, NDEQHK, NEQHRK, VL
IM, HFY (where the letters in each group represent the one letter amino acid code).

In one embodiment, mutant NOVX proteins can be assayed for: (i) other NOVX proteins, other cell surface proteins, or biologically active portions thereof, and protein: protein interactions. The ability to form an action,
(Ii) complex formation between the mutant NOVX protein and the ligand of NOVX;
(Iii) The ability of the mutant NOVX protein to bind to intracellular target proteins or biologically active portions thereof; (eg, avidin protein).

In yet another embodiment, mutant NOVX proteins can be assayed for their ability to modulate a particular biological function (eg, the ability to release insulin).

(Antisense Nucleic Acid) Another aspect of the present invention is SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17.
, 19, 20, 22, 24, 26, 28, and 30 or fragments thereof,
It relates to an isolated antisense nucleic acid molecule which is capable of hybridising to or complementary to a nucleic acid molecule comprising an analogue or derivative nucleotide sequence. An "antisense" nucleic acid comprises a nucleotide sequence that is complementary to a "sense" nucleic acid that encodes a protein (eg, complementary to the coding strand of a double-stranded cDNA molecule or complementary to an mRNA sequence). . In a particular aspect, an antisense nucleic acid molecule comprising a sequence complementary to at least about 10, about 25, about 50, about 100, about 250 or about 500 nucleotides or the entire NOVX coding strand, or only a portion thereof, is provided. Provided. SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16,
Nucleic acid molecules encoding fragments, homologues, derivatives and analogs of the NOVX protein of 18, 21, 23, 25, 27, 29, and 31, or SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 20, 22, 24,
Further provided are antisense nucleic acids complementary to 26, 28, and 30 NOVX nucleic acid sequences.

In one embodiment, the antisense nucleic acid molecule is antisense to the "coding region" of the coding strand of a nucleotide sequence encoding a NOVX protein. The term "coding region" refers to the region of nucleotide sequence that contains codons translated into amino acid residues. In another embodiment, the antisense nucleic acid molecule is NO
It is antisense to the "non-coding region" of the coding strand of the nucleotide sequence encoding the VX protein. The term “non-coding region” refers to the 5 ′ and 3 ′ sequences that are flanked by coding regions and are not translated into amino acids (ie, also referred to as 5 ′ untranslated region and 3 ′ untranslated region).

Given the coding strand sequences encoding the NOVX proteins disclosed herein, the antisense nucleic acids of the invention include Watson and Crick or H.
It can be designed according to the rules of Oogsteen base pairing. The antisense nucleic acid molecule can be complementary to the entire coding region of NOVX mRNA, but more preferably is an oligonucleotide that is antisense to only a portion of the coding or noncoding region of NOVX mRNA. For example, the antisense oligonucleotide can be complementary to the region surrounding the translation start site of NOVX mRNA. Antisense oligonucleotides have, for example, lengths of about 5, about 10, about 15,
It can be about 20, about 25, about 30, about 35, about 40, about 45 or about 50 nucleotides. The antisense nucleic acids of the invention can be constructed using chemical synthesis or enzymatic ligation reactions using procedures known in the art. For example, antisense nucleic acid (
Antisense oligonucleotides) are naturally occurring nucleotides,
Or variously engineered to increase the biological stability of this molecule or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids. It can be chemically synthesized with nucleotides (eg, phosphorothioate derivatives and acridine substituted nucleotides can be used).

Examples of modified nucleotides that can be used to make antisense nucleic acids include: 5-fluorouracil, 5-bromouracil, 5-
Chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5- (carboxyhydroxymethyl) uracil, 5-carboxymethylaminomethyl 2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, β- D-galacto silk eosin
ylqueosine), inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-.
Adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, β-D-mannosyleosin (mann
osylqueosine), 5'-methoxycarboxymethyluracil, 5-
Methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wibutoxin, pseudouracil, queocin (
queosine), 2-thiocytosine, 5-methyl-2-thiouracil, 2-
Thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3- (3-amino-3-N-2 -Carboxypropyl) uracil, (
acp3) w, and 2,6-diaminopurine. Alternatively, the antisense nucleic acid can be biologically produced using an expression vector in which the nucleic acid has been subcloned in the antisense orientation (ie, the RNA transcribed from the inserted nucleic acid is
In antisense orientation to the target nucleic acid of interest, further described in the following subsections).

The antisense nucleic acid molecules of the invention are typically administered to a subject or produced in situ so that they hybridize to the cellular mRNA and / or genomic DNA encoding the NOVX protein. Soybeans or binds thereto, thereby inhibiting expression of this protein (eg, by inhibiting transcription and / or translation). Hybridization may be by conventional nucleotide complementation to form a stable duplex, or in the case of antisense nucleic acid molecules that bind to DNA duplexes, for example, in the major group of the double helix. Through physical interaction.
Examples of routes of administration of the antisense nucleic acid molecules of the invention include direct injection at the tissue site. Alternatively, antisense nucleic acid molecules can be modified to target selected cells and then administered systemically. For example, for systemic administration,
Antisense molecules can be modified so that they specifically bind to the receptor or antigen expressed on the selected cell surface (eg, a peptide that binds the antisense nucleic acid molecule to a cell surface receptor or antigen or By linking to an antibody). The antisense nucleic acid molecule can also be delivered to cells using the vectors described herein. Vector constructs in which the antisense nucleic acid molecule is placed under the control of the strong pol II or pol III promoter to achieve sufficient nucleic acid molecule are preferred.

In yet another embodiment, the antisense nucleic acid molecule of the invention is an α-anomeric nucleic acid molecule. Alpha-anomeric nucleic acid molecules form specific double-stranded hybrids with complementary RNA, where the strands run parallel to each other, as opposed to the normal α-unit (see, eg, Gaultier et al. 1987, Nucl. Acids
Res. 15: 6625-6641). The antisense nucleic acid molecule also contains 2'-o-methyl ribonucleotides (eg, Inoue et al., 198).
7, Nucl. Acids Res. 15: 6131-6148).
Or chimeric RNA-DNA analogs (eg, Inoue et al., 1987, FE
BS Lett. 215: 327-330).

(Ribozyme and PNA moieties) [0258] Non-limiting examples of nucleic acid modifications include modified bases and nucleic acids with modified or derivatized sugar phosphate backbones. These modifications are performed, at least in part, to enhance the chemical stability of the modified nucleic acids so that they are used as antisense binding nucleic acids, eg, in therapeutic applications in a subject. obtain.

[0259] In one embodiment, the antisense nucleic acid of the invention is a ribozyme. Ribozymes are catalytic RNA molecules having ribonuclease activity that can cleave single-stranded nucleic acids (eg, mRNA), and these have a complementary region to the single-stranded nucleic acid. Therefore, ribozymes (eg Haselhoff and Gerl)
ach 1988. The hammerhead ribozymes described in Nature 334: 585-591) can be used to catalytically cleave NOVX mRNA transcripts, thereby inhibiting NOVX mRNA translation. Ribozymes with specificity for NOVX-encoding nucleic acids are disclosed in the NOVX cDs disclosed herein.
The nucleotide sequence of NA (ie, SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13
, 15, 17, 19, 20, 22, 24, 26, 28, and 30). For example, the active site nucleotide sequence is complementary to the nucleotide sequence that is cleaved within the NOVX-encoding mRNA, Tetrahymena L-1.
Derivatives of 9 IVS RNA can be constructed. See, eg, Cech et al., US Pat. No. 4,987,071 and Cech et al., US Pat. No. 5,116,742. NOVX mRNA can also be used to select catalytic RNAs with specific ribonuclease activity from a pool of RNA molecules. For example, Bart
See eL et al. (1993) Science 261: 1411-1418.

Alternatively, NOVX gene expression is regulated by a regulatory region of a NOVX nucleic acid (eg, NOVX).
It can be inhibited by targeting a nucleotide sequence complementary to the X promoter and / or enhancer) and forming a triple helix structure that interferes with transcription of the NOVX gene in target cells. For example, Helene, 1991. Antic
cancer Drug Des. 6: 569-84; Helene et al. 1992
． Ann. N. Y. Acad. Sci. 660: 27-36; Maher, 19
92. See Bioassays 14: 807-15.

In various embodiments, NOVX nucleic acids may be modified at the base, sugar or phosphate backbones to improve, eg, the stability, hybridization or solubility of the molecule. For example, the deoxyribose phosphate backbone of nucleic acids can be modified to produce peptide nucleic acids (eg, Hyrup et al., 1996. Bioorg Me.
d Chem 4: 5-23). As used herein, the term "peptide nucleic acid" or "PNA" replaces the deoxyribose phosphate backbone with a pseudopeptide backbone, and the four natural nucleobases.
A) nucleic acid mimic (eg, DNA mimic). The neutral backbone of PNA has been shown to allow specific hybridization to DNA and RNA under conditions of low ionic strength. The synthesis of PNA oligomers is described by Hyrup et al., 1996. Supra; Perry-O'Keefe et al., 199.
6. Proc. Natl. Acad. Sci. USA 93: 14670-14
Standard solid phase peptide synthesis protocol as described at 675.

NOVX PNAs can be used in therapeutic and diagnostic applications. For example, PNAs can be used as antisense or antigene agents for sequence-specific regulation of gene expression, for example by inducing transcription or translation arrest or inhibiting replication. NOVX PNAs also include, for example, PNA directional PCs.
In the analysis of single base pair mutations in genes by R-clamping; other enzymes (
For example, as an artificial restriction enzyme when used in combination with S1 nuclease) (see Hyrup B. et al., 1996. supra); or as a probe or primer for DNA sequences and hybridization (Hyrup).
Et al., 1996, supra; Perry-O'Keefe et al., 1996, supra).

In another embodiment, NOVX PNAs are conjugated to PNA-DNA chimeras, eg, by attaching lipophilic groups or other helper groups to the PNAs to enhance their stability or cellular uptake. Or by the use of liposomes or other techniques of drug delivery known in the art. For example, NOVX PNAs that may combine the advantageous properties of PNAs and DNA.
-A DNA chimera can be generated. While the PNA moiety provides high binding affinity and specificity, such chimeras have DNA recognition enzymes (eg, RNase H
And DNA polymerase) to interact with the DNA portion. PN
A-DNA chimeras can be ligated using linkers of suitable length selected with regard to stacking of bases, the number and orientation of bonds between nucleobases (Hyrup et al.,
1996, supra). Synthesis of PNA-DNA chimeras can be performed as described in Hyrup et al., 1996, supra and Finn et al., 1996, Nucl Acids Res 24: 3357-3363. For example, D
The NA chain can be synthesized on a solid support using standard phosphoramidite coupling chemistry and modified nucleoside analogs such as 5 '-(4-methoxytrityl) amino-5'-deoxy-. Thymidine phosphoramidite)
It can be used between the PNA and the 5'end of DNA (Mag et al., 1989, Nuc.
l Acid Res 17: 5973-5988). Then P
NA monomers are coupled in a stepwise fashion, with 5'PNA segment and 3 '
Generate a chimeric molecule with a DNA segment (see Finn et al., 1996, supra). Alternatively, a 5'DNA segment and a 3'PNA segment can be used to synthesize a chimeric molecule. For example, Petersen et al., 1975.
,) Bioorg. Med. Chem. Lett. 5: 1119-11124.

In other embodiments, the oligonucleotides may include other accessory groups such as: peptides (eg, for targeting host cell receptors in vivo), or to facilitate transport across cell membranes. Factors (eg Letsinger
Et al., 1989, Proc. Natl. Acad. Sci. U. S. A. 86: 6
553-6556; Lemaitre et al., 1987, Proc. Natl. Ac
ad. Sci. 84: 648-652; PCT Publication No. WO88 / 09810), or the blood-brain barrier (eg PCT Publication No. WO89 / 1013).
4). In addition, the oligonucleotide may be conjugated to a hybridization-triggered cleavage agent (eg, Krol et al., 1988, BioTechniques 6:
958-976), or an intercalator agent (eg, Zon.
, 1988, Pharm. Res. 5: 539-549)). To this end, the oligonucleotide may be linked to another molecule, such as a peptide, hybridization-triggered cross-linking agent, transport agent, hybridization-triggered cleavage agent, and the like.

NOVX Polypeptides Polypeptides according to the present invention have the sequence SEQ ID NO: 2, 4, 6, 8, 10, 12,
N provided to 14, 16, 18, 21, 23, 25, 27, 29, and 31
It includes a polypeptide comprising the amino acid sequence of the OVX protein. The present invention also encodes a protein, or a functional fragment thereof, which still retains its NOVX activity and physiological function, any residue of which is SEQ ID NO: 2, 4, 6, 8, 1.
Included are mutant or variant proteins that may vary from the corresponding residues shown at 0, 12, 14, 16, 18, 21, 23, 25, 27, 29, and 31.

[0266] In general, NOVX variants that retain NOVX-like function will have residues at specific positions in the sequence replaced by other amino acids, and will further insert additional residues between the two residues of the parent protein. And the possibility of deleting one or more residues from the parent sequence. Any amino acid substitution, insertion or deletion is included in the present invention.
In the preferred situation, this substitution is a conservative substitution as defined above.

One aspect of the present invention relates to an isolated NOVX protein, and biologically active portions thereof, or derivatives, fragments, analogs or homologs thereof. Also provided are polypeptide fragments suitable for use as immunogens to raise anti-NOVX antibodies. In one embodiment, native NOVX proteins can be isolated from cell or tissue sources by a suitable purification scheme using standard protein purification techniques. In another embodiment, the NOVX protein is produced by recombinant DNA technology. As an alternative to recombinant expression, NOVX proteins or polypeptides can be chemically synthesized using standard peptide synthesis techniques.

An "isolated" or "purified" polypeptide or protein or biologically active portion thereof is a cellular material or other contaminating protein derived from the cell or tissue source from which the NOVX protein is derived. Or substantially free of chemical precursors or other chemicals when chemically synthesized. The term "substantially free of cellular material" includes preparations of NOVX proteins,
In this preparation, the NOVX protein is separated from the cellular components of cells in which it is isolated or recombinantly produced. In one embodiment, the term "substantially free of cellular material" refers to less than about 30% (by dry weight) of non-NOVX proteins (also referred to herein as "contaminant proteins"), more preferably. Include preparations of NOVX proteins having less than about 20% non-NOVX proteins, even more preferably less than about 10% non-NOVX proteins, and most preferably less than about 5% non-NOVX proteins. If the NOVX protein or biologically active portion thereof is recombinantly produced, preferably the preparation is also substantially free of culture medium. That is, the culture medium exhibits less than about 20%, more preferably less than about 10%, and most preferably less than about 5% of the volume of the protein preparation.

The term “substantially free of chemical precursors or other chemicals” refers to a preparation of NOVX proteins in which the protein is separated from the chemical precursors or other chemicals involved in the synthesis of that protein. including. In one embodiment, the term "substantially free of chemical precursors or other chemicals" refers to chemical precursors or non-NO
Less than about 30% VX chemistry (by dry weight), more preferably less than about 20% chemical precursor or non-NOVX chemistry, even more preferably less than about 10% chemical precursor or non-NOVX chemistry. , And most preferably, a preparation of NOVX protein having less than about 5% chemical precursors or non-NOVX chemicals.

The biologically active portion of the NOVX protein contains fewer amino acids than the full-length NOVX protein and exhibits at least one activity of the NOVX protein (eg, SEQ ID NOs: 2, 4, 6). , 8, 1
0, 12, 14, 16, 18, 21, 23, 25, 27, 29, and 31)), a peptide containing an amino acid sequence sufficiently homologous to the amino acid sequence of NOVX protein. including. Typically, the biologically active portion comprises at least one active domain or motif of the NOVX protein. The biologically active portion of the NOVX protein is
For example, it can be a polypeptide that is 10, 25, 50, 100 or more amino acid residues in length.

In addition, other biologically active portions in which other regions of the protein are deleted are:
It can be prepared by recombinant techniques and evaluated for one or more of the functional activities of the native NOVX protein.

[0272] In one embodiment, the NOVX protein has SEQ ID NOs: 2, 4, 6, 8,
It has the amino acid sequences shown in 10, 12, 14, 16, 18, 21, 23, 25, 27, 29, and 31. In other embodiments, the NOVX protein is SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 21, 23, 25.
, 27, 29, and 31, and as discussed in detail below, differ in amino acid sequence due to natural allelic variants or mutagenesis, but SEQ ID NOs: 2, 4, , 6, 8, 10, 12, 14, 16, 18, 21, 23
, 25, 27, 29, and 31 proteins retain the functional activity. Thus, in another embodiment, the NOVX protein has SEQ ID NOs: 2, 4, 6, 8, 1.
0, 12, 14, 16, 18, 21, 23, 25, 27, 29, and 31 containing at least about 45% homology to the amino acid sequences, and SEQ ID NOs: 2, 4, 6, 8, 10. , 12, 14, 16, 18, 21, 23, 25, 27, 2
It is a protein that retains the functional activity of the 9 and 31 NOVX proteins.

Determination of Homology between Two or More Sequences To determine the percentage of homology between two amino acid sequences or two nucleic acids, the sequences are aligned for the purpose of optimal comparison. (For example, a gap may be introduced in the first amino acid or nucleic acid sequence for optimal alignment with the second amino acid or nucleic acid sequence). The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. If a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence,
Molecules are homologous at that position (ie, as used herein, "homology" of amino acids or nucleic acids is equivalent to "identity" of amino acids or nucleic acids)
.

Homology of nucleic acid sequences can be determined as the degree of identity between two sequences. Homology can be determined using computer programs known in the art, such as GAP software provided in the GCG program package. See Needleman and Wunsch, 1970 J Mol Biol 48: 443-453. The following settings for comparing nucleic acid sequences (GA
Using GCG GAP software with a P production penalty of 5.0, and a GAP extension penalty of 0.3), the coding regions for similar nucleic acid sequences referred to above are SEQ ID NOs: 1, 3, 5, 7 , 9, 11, 13, 15, 17, 19
, 20, 22, 24, 26, 28, and 30 of the CDS of the DNA sequences (
Code) portion, and preferably at least 70%, 75%, 80%, 85%, 90
%, 95%, 98% or 99% degree of identity is indicated.

The term “sequence identity” refers to the degree to which two polynucleotide or polypeptide sequences are identical on a residue-by-residue basis over a particular region of comparison. The term “percentage of sequence identity” is calculated by: comparing two sequences that are optimally aligned over this region of comparison, the same nucleobase in both sequences (eg A in the case of nucleic acids). , T, C, G, U, or I) determines the number of positions that are present and derives the number of matched positions;
Dividing by the total number of positions within the comparison region (ie, window size), and multiplying the result by 100 yields the percentage sequence identity. The term "substantial identity" as used herein refers to a characteristic of a polynucleotide sequence, where the polynucleotide has at least 80% of the sequence compared to the reference sequence over the comparison region. Identity, preferably at least 85% sequence identity, and often 90-95% sequence identity, more usually at least 99%.
Includes sequences with% sequence identity.

Chimeric and Fusion Proteins The present invention also provides NOVX chimeric or fusion proteins.
As used herein, a NOVX "chimeric protein" or NOVX "
A "fusion protein" is a NOV operably linked to a non-NOVX polypeptide.
X polypeptides. "NOVX polypeptide" refers to NOVX protein (SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 21, 23, 25, 2;
7, 29, and 31), but refers to a polypeptide having an amino acid sequence corresponding to a “non-NOVX polypeptide”, which is a protein that is not substantially homologous to a NOVX protein (eg, unlike a NOVX protein, and A polypeptide having an amino acid sequence corresponding to the same or a protein derived from a different organism). In the NOVX fusion protein, the NOVX polypeptide may correspond to all or a portion of the NOVX protein. In one embodiment, the NOVX fusion protein comprises at least one biologically active portion of the NOVX protein. In another embodiment, the NOVX fusion protein is NOVX.
It comprises at least two biologically active portions of a protein. In yet another embodiment, the NOVX fusion protein comprises at least 3 biologically active moieties. In a fusion protein, the term "operably linked" is intended to indicate that the NOVX polypeptide and the non-NOVX polypeptide are fused in frame with each other. The non-NOVX polypeptide can be fused to the N-terminus or C-terminus of the NOVX polypeptide.

In one embodiment, the fusion protein is a GST-NOVX fusion protein, where the NOVX sequence is fused to the C-terminus of the GST (glutathione S-transferase) sequence. Such fusion proteins may facilitate the purification of recombinant NOVX polypeptides.

In another embodiment, the fusion protein is a NOVX protein containing a heterologous signal sequence at the N-terminus. Specific host cells (eg, mammalian host cells)
In, NOVX expression and / or secretion can be increased through the use of heterologous signal sequences.

In yet another embodiment, the fusion protein is a NOVX-immunoglobulin fusion protein, wherein the NOVX sequence is fused to sequences derived from a member of the immunoglobulin protein family. This NOVX-immunoglobulin fusion protein of the invention is incorporated into a pharmaceutical composition and administered to a subject to inhibit the interaction between a NOVX ligand and a NOVX protein on the surface of cells, May inhibit NOVX-mediated signaling in vivo.
This NOVX-immunoglobulin fusion protein can be used to influence the bioavailability of NOVX cognate ligands. Inhibition of the NOVX ligand / NOVX interaction
It may be therapeutically useful in treating both proliferative and differentiation disorders, and in modulating (eg, promoting or inhibiting) cell survival. Further, this NOV of the present invention
The X-immunoglobulin fusion protein can be used as an immunogen to produce anti-NOVX antibodies in a subject, a screen that purifies NOVX ligands and identifies molecules that inhibit NOVX interactions with NOVX ligands. It can be used in an assay.

The NOVX chimeric or fusion proteins of the invention can be produced by standard recombinant DNA techniques. For example, DNA fragments encoding different polypeptide sequences may be labeled according to conventional techniques, eg, blunt-ended or cohesive (for ligation).
stagger) ends, restriction enzyme digestion to provide suitable ends, cohesive end fill-ins where necessary, alkaline phosphatase treatment to avoid unwanted ligations, and enzymatic ligation Connect together in a frame. In another embodiment, the fusion gene may be synthesized by conventional techniques including automated DNA synthesizers. Alternatively, PCR amplification of gene fragments can be performed with anchor primers that produce complementary overhangs between two consecutive gene fragments that can then be annealed and reamplified to produce a chimeric gene sequence (eg, Ausbel et al. (Edit) CURRENT P
ROTOCOLS IN MOLECULAR BIOLOGY, John W
See iley & Sons, 1992). In addition, fusion components (eg G
Many expression vectors that already encode ST polypeptides) are commercially available.
The nucleic acid encoding NOVX can be cloned into such an expression vector such that the fusion component is linked in-frame to the NOVX protein.

NOVX Agonists and Antagonists The present invention also relates to variants of NOVX proteins that function as NOVX agonists (mimetics) or as NOVX antagonists. Variants of NOVX proteins, such as discrete point mutations or truncations of NOVX proteins, can be generated by mutagenesis. An agonist of a NOVX protein may retain substantially the same biological activity as the naturally occurring form of the NOVX protein, or a subset of that biological activity. NOVX protein antagonists are
The activity of one or more of the naturally occurring forms of NOVX protein may be determined, for example, by NOV
It may be inhibited by competitively binding to a downstream or upstream member of the cell signaling cascade containing the X protein. Therefore, specific biological effects can be elicited by treatment with variants of limited function. In one embodiment, treatment of the subject with a variant having a subset of biological activities of the naturally occurring form of the protein is performed on the subject relative to treatment with the naturally occurring form of the NOVX protein. Have less side effects in.

Variants of NOVX proteins that function either as NOVX agonists (mimetics) or as NOVX antagonists are combinatorial of variants of NOVX protein (eg, truncated variants) for NOVX protein agonist or antagonist activity. It can be identified by screening the library. In one embodiment, the diverse library of NOVX variants comprises
It is produced by combinatorial mutagenesis at the nucleic acid level and is encoded by a diverse gene library. A diverse library of NOVX variants includes, for example, a mixture of synthetic oligonucleotides, a degenerate set of potential NOVX sequences, either as individual polypeptides or within a set of NOVX sequences (eg, It can be produced by enzymatically linking to a gene sequence so that it can be expressed as a larger set of fusion proteins (for phage display). There are a variety of methods that can be used to generate libraries of potential NOVX variants from degenerate oligonucleotide sequences. Chemical synthesis of degenerate gene sequences can be performed in an automated DNA synthesizer, which synthetic gene is then ligated into an appropriate expression vector. The use of a degenerate set of genes allows for the supply of all of the sequences encoding the desired set of potential NOVX sequences in one mixture. Methods of synthesizing degenerate oligonucleotides are well known in the art. For example, Narang, 1983. Tetrahedron 39: 3; Itak
ura et al., 1984. Annu. Rev. Biochem. 53: 323; It
akura et al., 1984. Science 198: 1056; Ike et al., 19
83. Nucl. Acids Res. 11: 477.

Polypeptide Libraries In addition, a library of fragments of the NOVX protein coding sequences can be used to generate a diverse population of NOVX fragments for screening and subsequent selection of variants of the NOVX protein. In one embodiment, the library of coding sequence fragments comprises treating a double-stranded PCR fragment of a NOVX coding sequence with a nuclease under conditions that produce only about one nick per molecule, Denaturing, sense from different nick products /
Regenerating this DNA to form a double-stranded DNA which may contain an antisense pair, removing the single-stranded portion from the double-stranded reformed by treatment with S1 nuclease, and the resulting fragment It can be generated by ligating the library into an expression vector. By this method, an expression library can be derived which encodes various sized N-terminal and internal fragments of the NOVX protein.

Various techniques are known in the art for screening gene products of combinatorial libraries generated by point mutations or truncations, and for screening cDNA libraries of gene products having selected properties. Such techniques are applicable to rapid screening of gene libraries generated by combinatorial mutagenesis of NOVX proteins. The most widely used technique suitable for high-throughput analysis for screening large gene libraries is typically cloning the gene library into a replicable expression vector, in which the resulting library of vectors is Transforming appropriate cells, and expressing the combinatorial gene under conditions under which detection of the desired activity facilitates isolation of the vector encoding the gene for which the product was detected. A novel technique for increasing the frequency of functional variants in the library, Recruitable Ensemble Mutagenesis (REM), can be used in combination with screening assays to identify NOVX variants. For example, Arkin and Yourvan, 1992. Proc. Natl. Acad. Sci. USA 89: 7811-7815; Delgrave et al., 1993. See Protein Engineering 6: 327-331.

Anti-NOVX Antibodies The present invention provides for immunospecific binding to any NOVX polypeptide of the invention, F.
Antibodies or antibody fragments such as ab or (Fab) ₂ are included.

The isolated NOVX protein, or portion or fragment thereof, is used as an immunogen to produce antibodies that bind to NOVX polypeptides using standard techniques for polyclonal and monoclonal antibody preparation. Can be done. The full length NOVX protein can be used, but alternatively the invention provides antigenic peptide fragments of the NOVX protein for use as immunogens. The antigenic peptides of NOVX are SEQ ID NOs: 2, 4, 6, 8, 10, 12
, 14, 16, 18, 21, 23, 25, 27, 29, and 31 containing at least 4 amino acid residues of the amino acid sequence, and the antibody raised against this peptide is specific to NOVX. It contains an epitope of NOVX so as to form a complex. Preferably the antigenic peptide is at least 6, 8, 10
, 15, 20, or 30 amino acid residues. Longer antigenic peptides are often preferred over shorter antigenic peptides depending on the application and according to methods well known to those skilled in the art.

In a particular embodiment of the invention, at least one epitope comprised in the antigenic peptide is a region of NOVX located on the surface of the protein, eg a hydrophilic region. As a means of targeting antibody production, hydropathic plots showing hydrophilic and hydrophobic regions, eg, with or without a Fourier transform, Ky
It can be produced by any method known in the art, including the te Doolittle or Hopp Woods method. See, for example, Hopp and Woods, 1981, Proc. Na
t. Acad. Sci. USA 78: 3824-3828; Kyte and D.
oolittle 1982, J. Mol. Biol. 157: 105-142
checking ... Each of which is incorporated herein by reference in its entirety.

SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, as disclosed herein.
NOVX protein sequences of 16, 18, 21, 23, 25, 27, 29, and 31, or derivatives, fragments, analogs or homologs thereof, as immunogens in the production of antibodies that immunospecifically bind to these protein components. Available. The term “antibody” as used herein includes immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, ie, antigen binding sites that specifically bind (immunoreact) with an antigen such as NOVX. Refers to a molecule. Such antibodies are
Non-limiting examples include polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab and F _{(ab ') 2} fragments, and Fab expression libraries. In certain embodiments, antibodies to human NOVX proteins are disclosed. Various procedures known in the art are described in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 1.
It can be used for the production of polyclonal or monoclonal antibodies against 4, 16, 18, 21, 23, 25, 27, 29, and 31 NOVX protein sequences, or derivatives, fragments, analogs or homologs thereof. Some of these proteins are discussed below.

For the production of polyclonal antibodies, a variety of suitable host animals (eg, rabbits, goats, mice or other mammals) are injected with native protein, or synthetic variants thereof, or derivatives thereof as described above. Can be immunized with. Suitable immunogenic preparations can contain, for example, recombinantly expressed NOVX protein or chemically synthesized NOVX polypeptides. The preparation may further include an adjuvant. Various adjuvants used to increase immunological response include, without limitation, Freund's complete and incomplete adjuvants, mineral gels (eg, aluminum hydroxide), surfactants (eg, lysolecithin, pluronic polyols, Polyanions, peptides, oil emulsions, dinitrophenol, etc.), human adjuvants such as Bacille Calmette-Guerin and Corynebacterium parvum, or similar immunostimulants. If desired, antibody molecules raised against NOVX can be isolated from a mammal (eg, blood), and further to obtain IgG fractions by well known techniques such as protein A chromatography. Can be purified by.

The term “monoclonal antibody” or “monoclonal antibody composition” as used herein refers to a population of antibody molecules that contain only one type of antigen binding site, which is capable of immunoreacting with a particular epitope of NOVX. Thus, a monoclonal antibody composition typically displays a single binding affinity for a particular NOVX protein with which it immunoreacts. For the preparation of monoclonal antibodies raised against a particular NOVX protein, or derivative, fragment, analog or homologue thereof, any technique which provides for the production of antibody molecules by continuous cell line culture can be utilized. Such techniques include, without limitation, hybridoma techniques (eg, Kohl.
er & Milstein, 1975 Nature 256: 495-497); trioma technology; human B cell hybridoma technology (eg Kozbor et al., 1983 Immunol. Today 4: 7).
2) and EBV hybridoma technology for producing human monoclonal antibodies (eg, Cole et al., 1985 MONOCLONAL ANTIBODIE.
S AND CANCER THERAPY, Alan R.S. Liss, Inc
． Pp. 77-96)). Human monoclonal antibodies may be utilized in the practice of the invention and by using human hybridomas (eg, Cote et al., 1983. Proc Natl Acad Sci USA 8).
0: 2026-2030), or by transforming human B cells with Epstein-Barr virus in vitro (eg, Cote et al., 19).
85 MONOCLONAL ANTIBODIES AND CANCER
THERAPY, Alan R .; Liss, Inc. Pp. 77-96). Each of the above citations is incorporated herein by reference in its entirety.

According to the present invention, the technique can be adapted for the production of single chain antibodies specific for NOVX proteins (see, eg, US Pat. No. 4,946,778).
In addition, the method is adapted for the construction of Fab expression libraries (eg,
Huse et al., 1989 Science 246: 1275-1281), NOVX protein, or a monoclonal Fab fragment with the desired specificity for a derivative, fragment, analog or homologue thereof. Non-human antibodies can be "humanized" by techniques well known in the art. See, eg, US Pat. No. 5,225,539. Antibody fragments containing the idiotype to the NOVX protein can be produced by techniques known in the art, including but not limited to: (i) F (ab ') ₂ fragments produced by pepsin digestion of antibody molecules; (Ii) F (
ab ′) F produced by reducing the disulfide bridge of the ₂ fragment
ab fragments; (iii) Fab fragments produced by treatment of antibody molecules with papain and a reducing agent; and (iv) Fv fragments.

In addition, recombinant anti-NOVX antibodies, such as chimeric antibodies and humanized monoclonal antibodies that include both human and non-human portions (these are standard recombinant DNA
(Which can be made using techniques) are within the scope of the invention. Such chimeric antibodies and humanized monoclonal antibodies can be produced by recombinant DNA techniques known in the art. This technique uses, for example, the method described below: International Application No. P
CT / US86 / 02269; European Patent Application No. 184,187; European Patent Application No. 171,496; European Patent Application No. 173,494; PCT International Publication No. WO 86/01533; US Pat. No. 4,816,567; US Patent No. 5,2
25,539; European Patent Application No. 125,023; Better et al. (198).
8) Science 240: 1041-1043; Liu et al. (1987) Pr.
oc. Natl. Acad. Sci. USA 84: 3439-3443; Li.
u et al. (1987) J Immunol. 139: 3521-3526; Sun et al. (1987) Proc. Natl. Acad. Sci. USA 84: 214-
218; Nishimura et al. (1987) Cancer Res 47:99.
9-1005; Wood et al. (1985) Nature 314: 446-449.
Shaw et al. (1988) J .; Natl. Cancer Inst. 80:15
53-1559); Morrison (1985) Science 229: 1.
202-1207; Oi et al. (1986) BioTechniques 4:21.
4; Jones et al. (1986) Nature 321: 552-525; Ver.
Hoeyan et al. (1988) Science 239: 1534; and Be.
idler et al. (1988) J. Am. Immunol. 141: 4053-4060.
Each of the above citations is incorporated herein by reference in their entirety.

In one embodiment, the method for screening for antibodies possessing the desired specificity is performed by an enzyme-linked immunosorbent assay (ELISA) known in the art.
) And other immunologically mediated techniques. In certain embodiments, selection of antibodies that are specific for particular domains of the NOVX protein is facilitated by the production of hybridomas that bind to fragments of the NOVX protein that possess such domains. Therefore, NOVX
Antibodies that are specific for the desired domain within the protein, or derivatives, fragments, analogs or homologs thereof, are also provided herein.

Anti-NOVX antibodies can be used in methods known in the art for localization and / or quantification of NOVX proteins (eg, for use in measuring levels of NOVX protein in a suitable physiological sample). For use in diagnostic methods, for use in protein imaging, etc.). In certain embodiments, antibodies (including antibody-derived binding domains) to NOVX proteins, or derivatives, fragments, analogs or homologs thereof, are labeled with pharmacologically active compounds (hereinafter "therapeutic"). It is used as an agent.

Anti-NOVX antibodies (eg, monoclonal antibodies) can be used to isolate NOVX polypeptides by standard techniques (eg, affinity chromatography or immunoprecipitation). Anti-NOVX antibody is a natural NOVX from cells
Polypeptide, and recombinantly produced NOV expressed in host cells
Purification of the X polypeptide may be facilitated. In addition, anti-NOVX antibodies (eg,
It can be used to detect NOVX proteins (in cell lysates or cell supernatants) to assess the abundance and pattern of NOVX protein expression. Anti-NOVX antibodies can be used, for example, to diagnostically monitor protein levels in tissues as part of a clinical trial procedure to determine the efficacy of a given therapeutic regimen. Detection can be facilitated by coupling (ie, physically linking) the antibody to a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent substances, luminescent substances, bioluminescent substances and radioactive substances. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin /
Examples include biotin and avidin / biotin; examples of suitable fluorophores are umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine.
amine) fluorescein, dansyl chloride or phycoerythrin; examples of luminescent substances include luminol; examples of bioluminescent substances include luciferase, luciferin and aequorin; and examples of suitable radioactive substances ^{Include 125} I, ¹³¹ I, ³⁵ S or ³ H.

(NOVX Recombinant Expression Vector and Host Cell) Another aspect of the present invention is a vector, preferably a vector, containing a nucleic acid encoding a NOVX protein, or a derivative, fragment, analog or homolog thereof.
Regarding expression vectors. As used herein, the term "vector" refers to
A nucleic acid molecule capable of transporting another nucleic acid to which it is linked. One type of vector is a "plasmid." This refers to a circular double stranded DNA loop to which additional DNA segments can be ligated. Another type of vector is a viral vector, where additional DNA segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in the host cell into which they are introduced (eg, bacterial vectors having a bacterial origin of replication, and episomal mammalian vectors). Other vectors, such as non-episomal mammalian vectors, integrate into the host cell's genome upon introduction into the host cell, and thereby replicate with the host genome. Furthermore, certain vectors may direct the expression of genes to which they are operably linked. Such vectors are referred to herein as "expression vectors." In general, expression vectors useful in recombinant DNA technology are often in the form of plasmids. In the present specification, "plasmid" and "vector" may be used interchangeably as the plasmid is the most commonly used form of vector. However, the invention is intended to include such other forms of expression vectors, such as viral vectors (eg, replication defective retroviruses, adenoviruses, and adeno-associated viruses), which serve equivalent functions. .

The recombinant expression vector of the invention comprises a nucleic acid of the invention in a form suitable for expression of the nucleic acid in host cells. This means that the recombinant expression vector comprises one or more regulatory sequences selected on the basis of the host cell used for expression, which is operably linked to the nucleic acid sequence to be expressed. In a recombinant expression vector, "operably linked" means that the nucleotide sequence of interest is a nucleotide (eg, in an in vitro transcription / translation system, or in the host cell if the vector is introduced into a host cell). It is meant to be linked to regulatory sequences in a manner that allows expression of the sequence.

The term “regulatory sequence” is intended to include promoters, enhancers and other expression control elements (eg, polyadenylation signals). Such regulatory sequences are described, for example, by Goeddel; GENE EXPRESSION TEC.
HNOLOGY: METHODS IN ENZYMOLOGY 185, Ac
acoustic Press, San Diego, Calif. (1990). Regulatory sequences include sequences that direct constitutive expression of nucleotide sequences in many types of host cells, and sequences that direct expression of nucleotide sequences only in the particular host cell (eg, tissue-specific regulatory sequences). It will be apparent to those skilled in the art that the design of the expression vector may depend on such factors as the choice of host cell to be transformed, the level of expression of the desired protein and the like. The expression vector of the present invention can be introduced into a host cell, whereby a protein or peptide (including fusion protein or peptide) encoded by the nucleic acid described herein.
(Eg, NOVX proteins, mutant forms of NOVX proteins, fusion proteins, etc.) can be produced.

Recombinant expression vectors of the invention can be used in prokaryotic or eukaryotic cells,
It can be designed for NOVX protein expression. For example, the NOVX protein can be expressed in bacterial cells (eg Escherichia coli), insect cells (using baculovirus expression vectors) yeast cells or mammalian cells. Suitable host cells are Goeddel; GENE EXPRESSIO
N TECHNOLOGY: METHODS IN ENZYMOLOGY 1
85, Academic Press, San Diego, Calif. (1
990). Alternatively, the recombinant expression vector can be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.

Expression of proteins in prokaryotes is most often carried out in Escherichia coli with vectors containing constitutive or inducible promoters directing the expression of either fusion or non-fusion proteins. Fusion vectors add a number of amino acids to the protein encoded therein, usually at the amino terminus of recombinant proteins. Such fusion vectors typically serve three purposes: (i) to increase expression of the recombinant protein; (ii) to increase the solubility of the recombinant protein; and ( iii) To assist in the purification of recombinant proteins by acting as a ligand in affinity purification. Often, in fusion expression vectors, a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant protein to allow the recombinant protein to be separated from the fusion moiety after purification of the fusion protein. Such an enzyme, and its cognate (cogn)
ate) recognition sequences include Factor Xa, thrombin, and enterokinase. Typical fusion expression vectors include pGEX (Pharmacia Biote), which fuses glutathione S-transferase (GST), maltose E-binding protein, or protein A to a target recombinant protein, respectively.
ch Inc. Smith and Johnson (1988) Gene 67;
: 31-40), pMAL (New England Biolabs, Bev).
erly, Mass. ) And pRIT5 (Pharmacia, Piscat)
Away, N.N. J. ) Is mentioned.

Suitable inducible unfused E. An example of an E. coli expression vector is pTrc (Amra
nn et al. (1988) Gene 69: 301-315) and pET 11d (
Studio et al., GENE EXPRESSION TECHNOLOGY:
METHODS IN ENZYMOLOGY 185, Academic P
less, San Diego, Calif. (1990) 60-89).

E. One strategy to maximize recombinant protein expression in E. coli is to express the protein in a host bacterium that lacks the ability to proteolytically cleave the recombinant protein. For example, Gottesman, G
ENE EXPRESSION TECHNOLOGY: METHODS IN
ENZYMOLOGY 185, Academic Press, San D
iego, Calif. (1990) 119-128. Another strategy is that the individual codons for each amino acid are to change the nucleic acid sequence of the nucleic acid inserted into the expression vector so that it is the preferentially used codon in E. coli (see, eg, Wada et al. (1992) Nucleic Acid).
s Res. 20: 2111-2118). Such alterations of the nucleic acid sequences of the invention can be carried out by standard DNA synthesis techniques.

In another embodiment, the NOVX expression vector is a yeast expression vector.
Examples of vectors for expression in the yeast Saccharomyces cerevisiae include pYepSec1 (Baldari et al. (1987) EMBO J. 6: 229-234), pMFa (Kurjan and Herskowi).
tz, (1982) Cell 30: 933-943), pJRY88 (Sch.
ultz et al., (1987) Gene 54: 113-123), pYES2 (I.
nvitrogen Corporation, San Diego, Cali
f. ), And picZ (InVitrogen Corp., San Die).
go, Calif. ) Is mentioned.

Alternatively, NOVX can be expressed in insect cells using a baculovirus expression vector. Baculovirus vectors available for expression of proteins in cultured insect cells (eg, SF9 cells) include pAc series (Smi
th et al. (1983) Mol. Cell. Biol. 3: 2156-2165) and the pVL series (Lucklow and Summers (1989) Vir.
170: 31-39).

In yet another embodiment, the nucleic acids of the invention are expressed in mammalian cells using mammalian expression vectors. An example of a mammalian expression vector is pCDM8
(Seed (1987) Nature 329: 840) and pMT2PC (
Kaufman et al. (1987) EMBO J. 6: 187-195). When used in mammalian cells, the expression vector's control functions are often
Provided by the regulatory elements of the virus. For example, commonly used promoters are derived from polyoma, adenovirus 2, cytomegalovirus, and simian virus 40. For other expression systems suitable for both prokaryotic and eukaryotic cells, see, eg, Sambrook et al., MOLECUL.
AR CLONING: A LABORATORY MANUAL. Second edition, C
old Spring Harbor Laboratory, Cold Sp
ring Harbor Laboratory Press, Cold Sp
ring Harbor, N.M. Y. , 1989, chapters 16 and 17.

In another embodiment, the recombinant mammalian expression vector may direct the expression of the nucleic acid preferentially in a particular cell type (eg, expressing the nucleic acid using tissue-specific regulatory elements). . Tissue-specific regulatory elements are known in the art. Non-limiting examples of suitable tissue-specific promoters include the albumin promoter (liver-specific; Pinkert et al. (1987) Genes Dev. 1: 268-2.
77), lymphoid-specific promoters (Calame and Eaton (1988).
) Adv. Immunol. 43: 235-275), at a specific promoter of the T cell receptor (Winoto and Baltimore (1989).
EMBO J.M. 8: 729-733) and in specific promoters of immunoglobulins (Banerji et al. (1983) Cell 33: 729-740;
Queen and Baltimore (1983) Cell 33: 741-7.
48), neuron-specific promoters (eg, neurofilament promoter; Byrne and Ruddle (1989) Proc. Natl. Acad.
． Sci. USA 86: 5473-5477), pancreas-specific promoter (E
drund et al. (1985) Science 230: 912-916), as well as mammary gland-specific promoters (eg, whey promoter; US Pat. No. 4,873).
, 316 and European Application Publication No. 264,166). Developmentally regulated promoters are also included (eg, mouse hox promoter (K
Essel and Gruss (1990) Science 249: 374-3.
79) and the a-fetoprotein promoter (Campes and Tilg)
hman (1989) Genes Dev. 3: 537-546).

The invention further provides a recombinant expression vector comprising a DNA molecule of the invention cloned into the expression vector in the antisense orientation. That is, the DNA molecule expresses an RNA molecule that is antisense to NOVX mRNA (DN
(By transcription of the A molecule) is operably linked to the regulatory sequences in a manner that enables
Can Regulatory Sequences (eg, Viral Promoters and / or Enhancers) Operately Linked to Nucleic Acid Cloned in the Antisense Direction Directing Sustained Expression of Antisense RNA Molecules in Different Cell Types Can Be Selected? ,
Alternatively, regulatory sequences that direct constitutive, tissue-specific, or cell-specific expression of antisense RNA can be selected. Antisense expression vectors can be in the form of recombinant plasmids, phagemids, or attenuated viruses, where the antisense nucleic acid is produced under the control of high efficiency regulatory regions, the activity of which is
It can be determined by the cell type into which the vector is introduced. For a discussion of the regulation of gene expression using antisense genes, see, eg, Weintraub et al., “A.
antisense RNA as a molecular tool for
genetic analysis ", Reviews-Trends in
See Genetics, Volume 1 (1) 1986.

Another aspect of the present invention relates to a host cell into which the recombinant expression vector of the present invention has been introduced. The terms "host cell" and "recombinant host cell" are used interchangeably herein. It is understood that such terms refer not only to the particular test cell, but also to the progeny or potential progeny of such a cell. Such progeny may, in fact, not be identical to the parental cell, as the particular modification may occur in subsequent generations, either due to mutations or environmental influences, but still Included within the scope of this term when used in the text.

The host cell can be any prokaryotic or eukaryotic cell. For example, N
The OVX protein is a bacterial cell (eg, E. coli), insect cell, yeast or mammalian cell (eg, Chinese Hamster Ovary cell (CHO) or C).
OS cells). Other suitable host cells are known to those of skill in the art.

Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques. As used herein, the terms "transformation" and "transfection" refer to various art-recognized techniques for introducing exogenous nucleic acid (eg, DNA) into a host cell. Are intended to include and include calcium phosphate or calcium chloride co-precipitation, DEAE dextran mediated transfection, lipofection, or electroporation. Suitable methods for transforming or transfecting host cells are described by Sambrook et al. (MOLECULAR C
LONING: A LABORATORY MANUAL. Second Edition, Cold
Spring Harbor Laboratory, Cold Spring
Harbor Laboratory Press, Cold Spring
Harbor, N.M. Y. , 1989) and other laboratory manuals.

For the transfection of stable mammalian cells, depending on the expression vector and transfection technique used, only a small proportion of the cells will be exogenous D
It is known that NA can be integrated into its genome. To identify and select for these elements, a gene encoding a selectable marker (eg, resistance to antibiotics) is generally introduced into the host cell along with the gene of interest. Various selectable markers include those that confer resistance to drugs such as G418, hygromycin, and methotrexate. The nucleic acid encoding the selectable marker can be introduced into the host cell on the same vector as the vector encoding NOVX or can be introduced on a separate vector. Cells that are stably transfected with the introduced nucleic acid can be identified by drug selection (eg, cells that have incorporated the selectable marker gene will survive while other cells die).

Host cells of the invention (eg, prokaryotic and eukaryotic host cells in culture) can be used to produce (ie, express) NOVX protein. Accordingly, the invention further provides methods for producing NOVX proteins using the host cells of the invention. In one embodiment, the method of the invention comprises
The host cell of the present invention (wherein the recombinant expression vector encoding the NOVX protein has been introduced) in a suitable medium in which the NOVX protein is produced.
And culturing. In another embodiment, the invention further comprises the step of isolating NOVX protein from the medium or host cells.

Transgenic NOVX Animals The host cells of the invention can also be used to produce non-human transgenic animals. For example, in one embodiment, the host cell of the invention is NOVX.
A fertilized oocyte or embryonic stem cell into which a protein coding sequence has been introduced. Such host cells can then be used to produce non-human transgenic animals with exogenous NOVX sequences introduced into the genome, or homologous recombinant animals with altered endogenous NOVX sequences. Such animals are useful for studying NOVX protein function and / or activity, and for identifying and / or evaluating modulators of NOVX protein activity. As used herein, a "transgenic animal" is a non-human animal, preferably a mammal, more preferably a rodent such as a rat or mouse, where: One or more cells of the animal contain the transgene. Other examples of transgenic animals include non-human primates, sheep, dogs, cows, goats, chickens, amphibians and the like. The transgene integrates into the genome of the cell (from which the transgenic animal was generated) and remains in the genome of the mature animal, thereby encoded in one or more cell types or tissues of the transgenic animal. Exogenous DNA that directs the expression of a gene product. As used herein, a "homologous recombinant animal" is a non-human animal, preferably a mammal, more preferably a mouse, wherein the endogenous NOVX gene is , Modified by homologous recombination between an endogenous gene and an exogenous DNA molecule introduced into the animal's cells (eg, the animal's embryonic cells) prior to development of the animal.

The transgenic animals of the invention may include nucleic acids encoding NOVX, eg,
Introducing into the male pronucleus of fertilized oocytes by microinjection, retroviral infection, and the oocytes of pseudopregnant female foster animals (foster)
It can be made by allowing it to develop in an animal).
SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 20, 22, 2
4, 26, 28, and 30 human NOVX cDNA sequences can be introduced as a transgene into the genome of a non-human animal. Alternatively, the non-human homologue of the human NOVX gene (eg, the mouse NOVX gene) is a human NOVX cDNA.
It can be isolated based on hybridization to A (further described above) and used as a transgene. Intron sequences and polyadenylation signals can also be included in the transgene to increase the efficiency of expression of the transgene. Tissue-specific regulatory sequence (s) can be operably linked to the NOVX transgene to direct expression of NOVX protein to particular cells. Methods for producing transgenic animals (particularly animals such as mice) via embryo manipulation and microinjection are conventional in the art and are described, for example, in US Pat. No. 4,736,866. No. 4,870,009; and No. 4,873,191; and Hogan 1986, MANIPULATING THE MOUSE EMBRYO,
Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.M. Y. It is described in. Similar methods are used for the production of other transgenic animals. A transgenic founder animal can be identified based on the presence of the NOVX transgene in its genome and / or the expression of NOVX mRNA in the tissues or cells of the animal. The transgenic founder animal can then be used to breed additional animals carrying the transgene. In addition, transgenic animals carrying transgenes encoding NOVX proteins can be further crossed to other transgenic animals carrying other transgenes.

To produce a homologous recombinant animal, a vector containing at least a portion of the NOVX gene is prepared. Here, this gene has been introduced with deletions, additions, or substitutions, thereby altering (eg, functionally disrupting) its NOVX gene. The NOVX gene is a human gene (eg, SEQ ID NOs: 1, 3, 5, 7,
9, 11, 13, 15, 17, 19, 20, 22, 24, 26, 28, and 3
0 cDNA), but more preferably a non-human homolog of the human NOVX gene. For example, SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 1
Mouse homologues of 7, 19, 20, 22, 22, 24, 26, 28, and 30 human NOVX genes were used to construct a homologous recombination vector suitable for altering the endogenous NOVX gene in the mouse genome. Can be used. In one embodiment, the vector is designed such that upon homologous recombination, its endogenous NOVX gene is functionally disrupted (ie, it no longer encodes a functional protein; also known as a “knockout” vector). Will be).

Alternatively, the vector may be designed such that upon homologous recombination, the endogenous NOVX gene is mutated or otherwise altered but still encodes a functional protein (eg, Upstream regulatory regions may be altered, thereby altering the expression of the endogenous NOVX protein). In the homologous recombination vector, the altered part of the NOVX gene is flanked by additional nucleic acid of the NOVX gene at its 5 ′ and 3 ′ ends so that homologous recombination is carried by the vector. Genes and endogenous NOVX in embryonic stem cells
Allows to happen with genes. The additional flanking NOVX nucleic acid is of sufficient length for successful homologous recombination with the endogenous gene. Typically, several kilobases of flanking DNA (at both the 5'and 3'ends) are included in the vector. See, for example, Thomas et al. (19) for a description of homologous recombination vectors.
87) See Cell 51: 503. This vector is then introduced (eg, by electroporation) into an embryonic stem cell line, and cells in which the introduced NOVX gene has homologous recombination with the endogenous NOVX gene are selected (eg, Li et al. 1992) Cell 69: 915).

The selected cells are then injected into undifferentiated embryonic cells of the animal (eg mouse) to form aggregated chimeras. For example, Tera from Bradley (1987)
tocarcinomas and Embryonic Stem Cell
s: A Practical Approach, edited by Robertson, IR
See L, Oxford, pages 113-152. The chimeric embryo can then be transferred to a suitable pseudopregnant female foster animal and the embryo is delivered. Offspring carrying the homologously recombined DNA in their germ cells can be used to breed animals, in which all cells of the animal have been homologously recombined by germline transmission of the transgene. Contains DNA. Methods for constructing homologous recombination vectors and homologous recombination animals are described further below; Bradley (1991) Cu.
rr. Opin. Biotechnol. 2: 823-829; PCT International Publication Number: WO90 / 11354; WO91 / 01140; WO92 / 0968; and WO / 93/04169.

In another embodiment, non-human transgenic animals can be produced that contain selected systems that allow for regulated expression of the transgene. One example of such a system is the cre / loxP recombinase system of bacteriophage P1. c
For a description of the re / loxP recombinase system, see, eg, Lakso et al.
992) Proc. Natl. Acad. Sci. USA 89: 6232-6.
See 236. Another example of a recombinase system is Saccharomyce.
S. cerevisiae FLP recombinase system (O'Gorman
(1991) Science 251: 1351-1355.)
. If the cre / loxP recombinase system is used to regulate transgene expression, an animal containing the transgene encoding both the Cre recombinase and the selected protein is required. Such animals are, for example, “double” transduced by crossing two transgenic animals, one containing the transgene encoding the selected protein and the other containing the transgene encoding the recombinase. It can be provided by the construction of transgenic animals.

A clone of the non-human transgenic animal described herein also contains W
can be produced according to the method described in ilmut et al. (1997) Nature 385: 810-813. Briefly, cells from transgenic animals (
Somatic cells, for example, can be isolated and the growth cycle (growth cycle)
e) can be exited and induced to enter the G ₀ phase. The quiescent cells can then be fused, eg, by use of electric pulses, to oocytes isolated from the same animal from which the quiescent cells were isolated. The reconstructed oocytes are then cultured, which allows them to develop into morula or undifferentiated embryo cells and then transferred to pseudopregnant female foster animals. The offspring born from this female rearing animal are
For example, a clone of an animal whose somatic cells) have been isolated.

Pharmaceutical Compositions NOVX nucleic acid molecules, NOVX proteins, and anti-NOVX antibodies of the invention (also referred to herein as “active compounds”), and derivatives, fragments, analogs thereof. , And homologues can be incorporated into pharmaceutical compositions suitable for administration. Such a composition typically comprises a nucleic acid molecule, a protein or antibody, and a pharmaceutically acceptable carrier. As used herein, "pharmaceutically acceptable carrier" means any solvent, dispersion medium, coating, antibacterial and antifungal agent, isotonic and absorbable, which is compatible with pharmaceutical administration. It is intended to include delaying agents and the like. A suitable carrier is Remington's Pharmaceutical Sciences.
es (a standard reference in the art, incorporated herein by reference). Preferred examples of such carriers or diluents include water, saline, finger solution, dextrose solution,
And 5% human serum albumin, but is not limited thereto. Liposomes and non-aqueous vehicles such as fixed oils can also be used. The use of such media and agents for pharmaceutically active substances is well known in the art. Except when any conventional vehicle or agent is incompatible with the active compound,
Its use in a composition is intended. Supplementary active compounds can also be incorporated into the compositions.

A pharmaceutical composition of the invention is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral (eg, intravenous, intradermal, subcutaneous) administration, oral (eg, inhalation) administration, transdermal (ie, topical) administration, transmucosal (trans).
mucosal) administration, and rectal administration. Solutions or suspensions used for parenteral, intradermal or subcutaneous application may include the following components:
Sterile diluents such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerin, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methylparaben; ascorbic acid or sodium bisulfite. Antioxidants; ethylenediaminetetraacetic acid (EDTA), chelating agents; acetates, citrates or phosphates, buffers, and tonicity adjusting agents such as sodium chloride or dextrose. For drugs. pH
Can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.

Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. . For intravenous administration, suitable carriers include saline, bacteriostatic water, Cremophor EL ^™ (BASF, Parsipp.
any, N.N. J. ) Or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be easy to inject (s)
It should be fluid to the extent that yringability) is present. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium, including, for example: water, ethanol, polyols such as glycerol, propylene glycol, and liquid polyethylene glycols, and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion medium and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents such as paraben, chlorobutanol, phenol, ascorbic acid, thimerosal and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, sodium chloride in the composition. Prolonged absorption of injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, aluminum monostearate and gelatin.

Sterile injectable solutions are prepared by incorporating the required amount of the active compound, eg, a NOVX protein or anti-NOVX antibody, in a suitable solvent with one or a combination of the above-listed components. In some cases, it can be prepared by subsequent filter sterilization. Generally, dispersion media are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the method of preparation is vacuum drying and freeze-drying, whereby powders of the active ingredient and any further desired ingredients are obtained from the previously sterile-filtered solution. obtain.

Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash, where:
The compound in the fluid carrier was applied orally and squeezed (
swish), and then exhaled or swallowed. Pharmaceutically compatible binding agents, and / or adjuvant materials can be included as part of the composition. Tablets, pills, capsules, troches, etc. may contain any of the following ingredients or compounds having similar properties: binders (eg microcrystalline cellulose, gum tragacanth or gelatin); excipients (eg starches). Or lactose), disintegrants (eg alginic acid, primogel, or corn starch); lubricants (eg magnesium stearate or sterotes (St
erotes)); lubricants (eg colloidal silicon dioxide); sweeteners (eg sucrose or saccharin); or flavoring agents (eg peppermint, methyl salicylate, or orange flavors).

For administration by inhalation, the compounds are delivered in the form of an aerosol spray from pressured container or dispenser which contains a suitable propellant, eg, a gas such as carbon dioxide, or a nebulizer.

Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example:
For transmucosal administration, surfactants, bile salts, and fusidic acid derivatives can be mentioned. Transmucosal administration can be accomplished by nasal spray or the use of suppositories. For transdermal administration, the active compound is an ointment (oi) which is generally known in the art.
ntment), salve, gel, or cream.

The compounds may also be suppositories (eg, with conventional suppository bases such as cocoa butter and other glycerides) or retention for rectal delivery.
) It may be prepared in the form of an enema.

In one embodiment, the active compound is prepared with a carrier that protects the compound against rapid elimination from the body (eg, controlled release formulations),
This includes implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid.
Methods for the preparation of such formulations will be apparent to those of ordinary skill in the art. These materials are also commercially available from Alza Corporation and NOVXa Phar.
scientifics, Inc. Commercially available from Liposomal suspensions, including liposomes targeted to cells infected with monoclonal antibodies against viral antigens, can also be used as pharmaceutically acceptable carriers.
These can be prepared according to methods known to those skilled in the art, such as those described in US Pat. No. 4,522,811.

It is especially advantageous to formulate oral or parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form, as used herein, refers to a physically individual unit suitable as a unit dosage for the subject to be treated; each unit being a desired unit in association with the required pharmaceutical carrier. It contains a predetermined amount of active compound calculated to produce a therapeutic effect. The details of the dosage unit form of the present invention are determined by the unique characteristics of this active compound, and the particular therapeutic effect achieved, as well as the limitations specific to the field of formulating such active compound for the treatment of individuals. Is done or depends directly on these.

The nucleic acid molecule of the present invention can be inserted into a vector and used as a gene therapy vector. Gene therapy vectors can be administered to a subject, eg, by intravenous injection, topical administration (see US Pat. No. 5,328,470), or stereotactic injection (eg, Chen et al. (1994) Proc. Natl. Acad. Sci.U
SA 91: 3054-3057). The pharmaceutical preparation of the gene therapy vector can include the gene therapy vector in an acceptable diluent or can include a sustained release matrix in which the gene delivery vehicle is imbedded. Alternatively, the complete gene delivery vector can be produced intact from recombinant cells (eg, retroviral vectors) and the pharmaceutical preparation can include one or more cells that produce the gene delivery system.

The pharmaceutical composition can be included in a container, package, or dispenser together with instructions for administration.

Screening and Detection Methods The isolated nucleic acid molecules of the present invention may be NOVX proteins (eg, via recombinant expression vectors in host cells in gene therapy applications), as described further below. To detect gene damage in the NOVX mRNA (eg, in a biological sample) or the NOVX gene, and NO
It can be used to regulate VX activity. Furthermore, NOVX protein is
NOVX proteins for screening drugs or compounds that modulate the activity or expression of VX proteins, as well as due to insufficient or excessive production of NOVX proteins, or having reduced or aberrant activity as compared to NOVX wild-type proteins It can be used to treat disorders characterized by the production of forms. In addition, the anti-NOVX antibodies of the invention can be used to detect and isolate NOVX proteins, as well as modulate NOVX activity.

The invention further relates to novel agents identified by the screening assays described herein, and their use for treatment as described herein above.

Screening Assays The present invention provides modulators, ie, candidate or test compounds that bind to a NOVX protein or have a stimulatory or inhibitory effect on, for example, NOVX protein expression or NOVX protein activity. Alternatively, a method (also referred to herein as a “screening assay”) for identifying an agent (eg, peptide, peptidomimetic, small molecule or other drug) is provided. The invention also includes compounds identified in the screening assays described herein.

In one embodiment, the invention provides a candidate compound or agent that binds to or modulates the activity of a NOVX protein or polypeptide, or a biologically active portion thereof, in a membrane bound form. An assay is provided for screening test compounds. The test compounds of the invention can be obtained using any of a number of approaches in combinatorial library methods known in the art, including: biological libraries; spatially located. Possible parallel solid phase or solution phase libraries; synthetic library methods that require deconvolution; "one-bead-one-compound" library methods; and synthetic library methods using affinity chromatography selection. The biological library approach is limited to peptide libraries, while the other four approaches include peptides,
Applicable to small molecule libraries of non-peptide oligomers or compounds (
For example, Lam (1997) Anticancer Drug Design.
12: 145).

As used herein, "small molecule" is meant to refer to a composition having a molecular weight of less than about 5 kD, most preferably less than about 4 kD. Small molecules can be, for example, nucleic acids, peptides, polypeptides, peptidomimetics, carbohydrates, lipids or other organic or inorganic molecules. Libraries of chemical and / or biological mixtures (eg fungal, bacterial or algae extracts) are known in the art and can be screened using any of the assays of the invention.

Examples of methods for the synthesis of molecular libraries can be found in the art, for example: DeWitt et al. (1993) Proc. Natl. Acad.
Sci. USA 90: 6909; Erb et al. (1994) Proc Natl.
Acad Sci U. S. A. 91: 11422; Zuckermann et al. (
1994) J. Med. Chem. 37: 2678; Cho et al. (1993) Sc.
ience 261: 1303; Carrell et al. (1994) Angew. C
hem. Int. Ed. Engl. 33: 2059; Carell et al. (1994).
) Angew. Chem. Int. Ed. Engl. 33: 2061; and G
allop et al. (1994) J. Med. Chem. 37: 1233.

Compound libraries are available in solution (see, eg, Houghten (1992).
Biotechniques 13: 412-421) or on beads (L
am (1991) Nature 354: 82-84) on chip (Fodor)
(1993) Nature 364: 555-556), bacteria (Ladner.
US Pat. No. 5,223,409), spores (Ladner US Pat. No. 5,23)
3,409), plasmid (Cull et al. (1992) Proc. Natl. A.
cad. Sci. USA 89: 1865-1869) or on phage (Sc
Ott and Smith (1990) Science 249: 386-390.
Devlin (1990) Science 249: 404-406; Cwi
rla et al. (1990) Proc. Natl. Acad. Sci. USA 87:
6378-6382; Felici (1991) J. Mol. Biol. 222
: 301-310; Ladner, US Pat. No. 5,233,409).

[0339] In one embodiment, the assay is a cell-based assay, wherein:
Cells expressing a membrane-bound form of the NOVX protein, or a biologically active portion thereof, on the cell surface are contacted with a test compound, and the test compound is a NOVX protein.
The ability to bind the X protein is determined. For example, the cell can be of mammalian origin or a yeast cell. Determining the ability of the test compound to bind to the NOVX protein can be accomplished, for example, by coupling the test compound with a radioisotope or an enzyme label, which results in the NOVX protein of the test compound or a biologically active portion thereof. Can be achieved by being able to be determined by detecting its labeled compound in the complex. For example, a test compound can be labeled either directly or indirectly with ¹²⁵ I, ³⁵ S, ¹⁴ C, or ³ H, and its radioisotope can be labeled by direct counting of radiation emission or by scintillation counting. Can be detected by Alternatively, the test compound can be enzymatically labeled with, for example, horseradish peroxidase, alkaline phosphatase, or luciferase, and the enzymatic label detected by determining conversion of the appropriate substrate to product. . In one embodiment, the assay involves contacting cells expressing a membrane-bound form of the NOVX protein, or a biologically active portion thereof, on its cell surface with a known compound that binds NOVX, Forming a mixture, contacting a test compound with the assay mixture,
And a step of determining the ability of the test compound to interact with NOVX protein, wherein the step of determining the ability of the test compound to interact with NOVX protein allows the test compound to be compared to a known compound. And NOV
Determining the ability to bind preferentially to X or a biologically active portion thereof.

[0340] In another embodiment, the assay is a cell-based assay, which comprises:
Contacting a cell expressing a membrane-bound form of the NOVX protein or a biologically active portion thereof on the cell surface with a test compound, as well as the test compound comprising:
The step of determining the ability to modulate (eg, stimulate or inhibit) the activity of the NOVX protein or biologically active portion thereof. This test compound is NOV
Determining the ability to modulate the activity of X or a biologically active portion thereof can be accomplished, for example, by N
This can be accomplished by determining the ability of the OVX protein to bind to or interact with NOVX target molecules. As used herein, a "target molecule" is a molecule with which a NOVX protein naturally binds or interacts, eg, a molecule on the cell surface that expresses a NOVX interacting protein, a second A molecule on the cell surface, a molecule in the extracellular environment, a molecule that associates with the inner surface of the cell membrane, or a cytoplasmic molecule. The NOVX target molecule can be a non-NOVX molecule or a NOVX protein or polypeptide of the invention. In one embodiment, the NOVX target molecule is a component of a signal transduction pathway, which results from an extracellular signal through the cell membrane into the cell (eg, a compound binding to a membrane-bound NOVX molecule). Signal). The target can be, for example, a second intracellular protein having catalytic activity, or a protein that facilitates association of a downstream signaling molecule with NOVX.

Determining the ability of a NOVX protein to bind to or interact with a NOVX target molecule is accomplished by one of the above methods for determining direct binding.
Can be achieved. In one embodiment, determining the ability of a NOVX protein to bind to or interact with a NOVX target molecule can be accomplished by determining the activity of that target molecule. For example, the activity of this target molecule is
Detecting the induction of the cellular second messenger of the target (ie intracellular Ca ²⁺ , diacylglycerol, IP3, etc.), detecting the catalytic / enzymatic activity of the target to the appropriate substrate, the reporter gene (detectable Detection of induction of a NOVX-responsive regulatory element operably linked to a nucleic acid encoding a different marker (eg, luciferase), or a cellular response (eg, cell viability, cell differentiation, or cell proliferation) Can be determined by detecting

In yet another embodiment, the assay of the present invention is cell-free.
e) an assay, which comprises contacting the NOVX protein or biologically active portion thereof with a test compound, and determining the ability of the test compound to bind to the NOVX protein or biologically active portion thereof. Include. The binding of this test compound to the NOVX protein can be determined either directly or indirectly, as described above. In one such embodiment, the assay comprises contacting a NOVX protein or biologically active portion thereof with a known compound that binds NOVX to form an assay mixture, the assay mixture being tested. Contacting the compound, as well as determining the ability of the test compound to interact with the NOVX protein, wherein determining the ability of the test compound to interact with the NOVX protein comprises: , Determining the ability to preferentially bind NOVX, or a biologically active portion thereof, as compared to a known compound.

In yet another embodiment, the assay is a cell-free assay, wherein the NOVX protein or biologically active portion thereof is contacted with a test compound, as well as the test compound is a NOVX protein or biologically active thereof. Determining the ability of the active ingredient to modulate (eg, stimulate or inhibit) the activity. Determining the ability of this test compound to modulate the activity of NOVX is accomplished, for example, by determining the ability of the NOVX protein to bind to the NOVX target molecule by one of the methods described above for determining direct binding. Can be done. In an alternative embodiment, the determination of the ability of this test compound to modulate the activity of NOVX protein is NOV
This can be accomplished by determining the ability of the X protein to further regulate the NOVX target molecule. For example, the catalytic / enzymatic activity of the target molecule on the appropriate substrate can be determined as described above.

In yet another embodiment, the cell-free assay comprises contacting a NOVX protein or biologically active portion thereof with a known compound that binds a NOVX protein to form an assay mixture, the assay mixture. Contacting the test compound with a test compound, as well as determining the ability of the test compound to interact with the NOVX protein, wherein determining the ability of the test compound to interact with the NOVX protein comprises: The step of determining the ability to bind preferentially to a NOVX target molecule or to modulate the activity of that target molecule preferentially.

The cell-free assay of the present invention is acceptable for the use of both soluble or membrane bound forms of NOVX proteins. For cell-free assays that include a membrane-bound form of the NOVX protein, it may be desirable to utilize a solubilizer such that the membrane-bound form of the NOVX protein is maintained in solution. Examples of such solubilizers include nonionic surfactants such as n-octyl glucoside, n
-Dodecyl glucoside, n-dodecyl maltoside, octanoyl-N-methylglucamide, decanoyl-N-methylglucamide, Triton® X-
100, Triton (registered trademark) X-114, Thesit (registered trademark), isotridecyl poly (ethylene glycol ether) _n (Isotridecyp)
poly (ethylene glycol ether) _n , N-dodecyl-N
, N-dimethyl-3-ammonio-1-propanesulfonate, 3- (3-colamidopropyl) dimethylammineol-1-propanesulfonate (3- (3
-Cholamidopropyl) dimethylammniol-1-
Propane sulphonate (CHAPS), or 3- (3-colamidopropyl) dimethylammineol-2-hydroxy-1-propane sulphonate (3- (3-cholamidopropoxyl) dimethylamine
iniol-2-hydroxy-1-propane sulfonate)
(CHAPSO).

In more than one embodiment of the above assay methods of the invention, either the NOVX protein or its target molecule is immobilized to facilitate separation of the complex form from the uncomplexed form of one or both of the proteins. And adapted to the automation of the assay. The binding of the test compound to the NOVX protein, or the interaction of the NOVX protein with the target molecule in the presence and absence of the candidate compound, can be carried out in any vessel suitable to house these reactants. , Can be achieved. Examples of such vessels include microtiter plates, test tubes, and microcentrifuge tubes. In one embodiment, a fusion protein may be provided that adds a domain that allows one or both of the proteins to bind to the matrix. For example, a GST-NOVX fusion protein or GS
T-target fusion proteins are glutathione sepharose beads (Sigma Ch).
electrical, St. Louis, MO) or glutathione derivatized microtiter plates, which are then combined with the test compound, or with the test compound and either unadsorbed target protein or NOVX protein, and the mixture Conditions that induce complex formation (
(Eg physiological conditions with respect to salt and pH). After incubation, wash the beads or microtiter plate wells to remove any unbound components and, in the case of beads, fix the matrix,
Complexes are determined either directly or indirectly, eg, as described above. Alternatively, the complex can be dissociated from the matrix and the level of NOVX protein binding or activity determined using standard techniques.

Other techniques for immobilizing proteins on matrices can also be used in the screening assays of the invention. For example, either the NOVX protein, or its target molecule, can be immobilized utilizing the binding of biotin and streptavidin. Biotinylated NOVX protein, or target molecule, can be prepared from biotin-NHS (N-hydroxysuccinimide) using techniques well known in the art (eg, biotinylation kit, Pierce Chemi).
cals, Rockford, Ill. ), And can be fixed to the wells of a 96-well plate (Pierce Chemical) coated with streptavidin. Alternatively, the NOVX protein, or an antibody reactive with the target molecule but not interfering with the binding of the NOVX protein to its target molecule, can be derivatized to the wells of the plate and the unbound target or NOVX protein is It can be captured within the wells by the binding of antibodies. Methods for detecting such complexes include immunodetection of the complex using NOVX protein or an antibody reactive with the target molecule, in addition to the methods described above for GST-immobilized complexes, and Enzyme-linked assays that rely on detection of NOVX protein, or enzyme activity with respect to a target molecule, are included.

In another embodiment, modulators of NOVX protein expression are identified in a method of contacting a cell with a candidate compound and determining the expression of NOVX mRNA or protein in the cell. NOVX m in the presence of a candidate compound
RNA or protein expression levels are shown to be NOVX in the absence of candidate compounds.
The mRNA or protein expression level is compared. The candidate compound is then
Based on this comparison, it can be identified as a modulator of NOVX mRNA or protein expression. For example, if the expression of NOVX mRNA or protein is greater (ie, statistically significantly greater) in the presence of the candidate compound than in the absence thereof, the candidate compound is a stimulator of NOVX mRNA or protein expression. Identified as. Alternatively, if NOVX mRNA or protein expression is less (statistically significantly less) in the presence of the candidate compound than in the absence thereof, then the candidate compound is identified as an inhibitor of NOVX mRNA or protein expression. . The expression level of NOVX mRNA or protein in the cell can be determined by the methods described herein for detecting NOVX mRNA or protein.

In yet another aspect of the invention, a NOVX protein is used as a “bait protein” in a two-hybrid or three-hybrid assay (eg, US Pat. No. 5,283,317; Zervos).
(1993) Cell 72: 223-232; Madura et al., 1993.
J. Biol. Chem. 268: 12046-12054; Bartel et al.,
1993 Biotechniques 14: 920-924; Iwabuc.
hi et al., 1993 Oncogene 8: 1693-1696; and Bre.
nt WO 94/10300), other proteins that bind to or interact with NOVX (“NOVX binding protein” or “NOVX-bp”) and that regulate NOVX activity may be identified. NOVX like this
Binding proteins may also be involved in signal transduction by NOVX proteins, eg, as upstream or downstream elements of the NOVX pathway.

The two-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA-binding and activation domains. Briefly, this assay utilizes two different DNA constructs. NO in one construct
The gene encoding VX is fused to the gene encoding the DNA binding domain of a known transcription factor (eg GAL-4). In the other construct, a DNA sequence encoding an unidentified protein ("prey" or "sample") from a library of DNA sequences is fused to a gene encoding the activation domain of a known transcription factor. To be done. The DNA binding and activation domains of this transcription factor are in close proximity when the "prey" and "prey" proteins can interact in vivo to form a NOVX-dependent complex. By being proximal,
It allows transcription of a reporter gene (eg, LacZ) operably linked to a transcriptional regulatory site responsive to the transcription factor. Expression of the reporter gene can be detected,
Cell colonies containing functional transcription factors can then be isolated and used to obtain cloned genes encoding proteins that interact with NOVX.

The present invention further relates to novel agents identified by the screening assays described above and their use for treatment as described herein.

Detection Assays The portions or fragments of the cDNA sequences identified herein (and the corresponding complete gene sequences) can be used in many ways as polynucleotide reagents. For example, these sequences can be used (i) to map each gene on the chromosome; and thus to locate the genetic region associated with the genetic disease; (ii
) Individuals can be identified from minute biological samples (tissue typing); and (ii
i) Can assist, but is not limited to, forensic identification of biological samples. These applications are described in the sections below.

Chromosomal Mapping Once a gene sequence (or part of a sequence) has been isolated, this sequence can be used to map the position of the gene on the chromosome. This process is called chromosome mapping. Thus, a portion or fragment of the NOVX sequence described herein, SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 20, 2.
2, 24, 26, 28, and 30, or fragments or derivatives thereof, can be used to map the position of the NOVX gene on the chromosome, respectively. NO
Mapping VX sequences to chromosomes is an important first step in correlating these sequences with genes associated with disease.

Briefly, the NOVX gene can be mapped to the chromosome by preparing PCR primers (preferably 15-25 bp in length) from the NOVX sequence.
Computer analysis of NOVX sequences can be used to rapidly select primers that do not span more than one exon in genomic DNA, thus complicating the amplification process. These primers can then be used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only the hybrid containing the human gene corresponding to the NOVX sequence yields an amplified fragment.

Somatic cell hybrids are prepared by fusing somatic cells from different mammals (eg, human and mouse cells). As human and mouse hybrids grow and divide, they gradually lose human chromosomes in a random order, but maintain mouse chromosomes. By using a medium in which mouse cells cannot grow but human cells can grow, they lose certain enzymes, thus maintaining one human chromosome containing the gene encoding the required enzyme. By using different media, a panel of hybrid cell lines can be established. Each cell line in the panel contains either a single human chromosome or a small number of human chromosomes and a complete set of mouse chromosomes, which makes it easy to map individual genes to specific human chromosomes (D'Eustachio et al. (1983)
Science 220: 919-924). Somatic cell hybrids containing only fragments of the human chromosome can also be generated by using human chromosomes with translocations and deletions.

PCR mapping of somatic cell hybrids is a rapid procedure for assigning specific sequences to specific chromosomes. 3 per day with one thermal cycler
More than one array can be assigned. Designing oligonucleotide primers using the NOVX sequence results in sublocalization.
Can be achieved with a panel of fragments from a particular chromosome.

Fluorescence in situ hybridization (FISH) of DNA sequences to metaphase chromosome spreads can further be used to provide the correct chromosomal location in one step. Chromosome spreads can be performed using cells whose division was blocked in metaphase by chemicals such as colcemid, which disrupts the chromosome spindle. This chromosome can be briefly treated with trypsin and then Giemsa stained. A pattern of light and dark bands develops on each chromosome so that the chromosomes can be individually identified. FISH technology can be used with DNA sequences as short as 500 or 600 bases. However, clones larger than 1,000 bases are more likely to bind to unique chromosomal locations with sufficient signal strength for easy detection. Preferably 1,000 bases, and more preferably 2,000 bases, are sufficient to obtain good results in a reasonable amount of time. For a review of this technology, see Verma et al., HUMAN CHROMOSOMES: A MANUAL OF BASIC TECHNIQUES (Pergamon Press,
See New York 1988).

Chromosomal mapping reagents can be used individually to mark a single chromosome or a single site on that chromosome, or a panel of reagents can be multisite and / or
Or it can be used to mark multiple chromosomes. Reagents corresponding to the non-coding regions of the gene are, in fact, preferred for mapping purposes. The coding sequences are conserved within the gene family and therefore the chances of cross-hybridization during chromosomal mapping are likely to increase.

Once a sequence has been mapped to a precise chromosomal location, the physical location of the sequence on the chromosome can be correlated with genetic map data. Such data is, for example,
McKusick, MENDELIAN INHERITANCE IN MA
N (Johns Hopkins University Welch Med
(available online through icial library). Then the relationship between genes and diseases that map to the same chromosomal region is:
For example, Egeland et al. (1987) Nature, 325: 783-787.
Can be identified by the linkage analysis (co-inheritance of physically adjacent genes) described in.

In addition, differences in DNA sequences between individuals who are afflicted with a disease associated with the NOVX gene and individuals who are not afflicted with this disease can be determined. If the mutation is found in some or all of the affected individuals, but not in any of the unaffected individuals, then the mutation is likely a candidate drug for the particular disease. A comparison of affected and unaffected individuals will generally be preceded by structural alterations in the chromosome, such as deletions or translocations that are visible from the chromosome spread or are detectable using PCR based on their DNA sequences. Including searching for. Finally, complete sequencing of genes from some individuals to confirm the presence of the mutation,
And distinguish mutations derived from polymorphisms.

Tissue Typing The NOVX sequences of the present invention can also be used to distinguish individuals from a small biological sample. In this technique, genomic DNA of an individual is digested with one or more restriction enzymes and probed on Southern blots to generate unique bands for identification. The sequences of the present invention are RFLP (US Pat. No. 5,272,
, 057, "Restriction fragment length polymorphism").

In addition, the sequences of the present invention may be used to provide an alternative technique for determining the DNA sequence for each actual base for selected portions of the genome of an individual. Therefore, using the NOVX sequence described herein, two P's from the 5'and 3'ends of the sequence are used.
CR primers can be prepared. These primers can then be used to amplify an individual's DNA and subsequently sequence it.

The panel of corresponding DNA sequences from individuals prepared in this way was
Having a unique set of such DNA sequences due to allelic differences,
It may provide unique identification. The sequences of the present invention can be used to obtain such discrimination of sequences of individual and tissue origin. The NOVX sequences of the present invention uniquely represent portions of the human genome. Allelic variations occur to some extent in the coding regions of these sequences and to a greater extent in non-coding regions. It is estimated that allelic variation between individual humans occurs approximately once every 500 bases. The high degree of allelic variation is due to single nucleotide polymorphisms (SNPs), including restriction fragment length polymorphisms (RFLPs).

Each of the sequences described herein can, to some extent, be used as a standard against which DNA from an individual can be compared for purposes of discrimination. Not so many sequences are required to distinguish individuals, as more polymorphisms occur in non-coding regions. Non-coding sequences can comfortably provide positive individual identification, possibly with a panel of 10-1,000 primers. These primers each yield an amplified non-coding sequence of 100 bases. Putative coding sequence (eg, SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 2
0, 22, 24, 26, 28, and 30) are used, a more suitable number of primers for positive individual identification is 500-2,000.
Is.

Predictive Medicine The present invention also provides diagnostic assays, prognostic assays, drug genomes.
Genomics) and monitoring clinical trials relate to the field of predictive medicine, where prognostic treatment is used for prognostic (predictive) purposes, thereby treating individuals prophylactically. Accordingly, one aspect of the present invention is the expression of NOVX proteins and / or nucleic acids, and the activity of NOVX in a biological sample (eg, blood, serum, cells, tissues).
Diagnostic assay for determining in the context of determining whether an individual suffers from, or is at risk of developing, a disease or disorder associated with aberrant NOVX expression or activity. . This disorder includes the following: metabolic disorders, diabetes, obesity, infections, anorexia, cancer-related cachexia, cancer,
Associated with neurodegenerative diseases, Alzheimer's disease, Parkinson's disease, immune disorders, and hematopoietic disorders, and various dyslipidemias, obesity-related metabolic disorders, X metabolic syndrome (X), and chronic diseases Wasting disorders, and various cancers. The present invention also provides that the individual is
Provide a prognostic (or prognostic) assay to determine if there is a risk of developing a disorder associated with OVX protein, nucleic acid expression or activity. For example, mutations in the gene for NOVX can be assayed in biological samples. Such an assay may be used for prognostic or predictive purposes, whereby a subject is prophylactic prior to the onset of a disorder characterized by or related to the expression of NOVX protein, nucleic acid or biological activity. To be treated.

Another aspect of the invention provides a method for determining the expression or activity of NOVX protein, nucleic acid in an individual, whereby a suitable therapeutic or prophylactic reagent for the individual (the present specification) is provided. (Referred to as "drug genome" in the text). A drug genome is a reagent for therapeutic or prophylactic treatment of an individual based on the individual's genotype (eg, the individual's genotype tested to determine the individual's ability to respond to a particular reagent). Allows selection of (eg drug).

Yet another aspect of the invention relates to monitoring the effects of reagents (eg, drugs, compounds) on NOVX expression or activity in clinical trials.

[0368]   These and other reagents are described in further detail in the sections below.

Diagnostic Assays An exemplary method for detecting the presence or absence of NOVX in a biological sample is to obtain a biological sample from a test subject, and to add the biological sample to NOVX. Nucleic acid encoding a protein or NOVX protein (
Contacting with a compound or agent capable of detecting (eg, mRNA, genomic DNA) such that the presence of NOVX is detected in the biological sample,
Including steps. The agent for detecting NOVX mRNA or genomic DNA is a labeled nucleic acid probe capable of hybridizing to NOVX mRNA or genomic DNA. This nucleic acid probe is, for example, a full-length NOVX nucleic acid (for example, SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 2, and 2).
0, 22, 24, 26, 28, and 30 nucleic acids or portions thereof (eg, at least 15, 30, 50, 100, 250 or 500 nucleotides in length, under stringent conditions) NOVX mRN
A or a nucleic acid that is sufficient to specifically hybridize with genomic DNA). Other suitable probes for use in the diagnostic assays of the invention are described herein.

The agent for detecting the NOVX protein is an antibody capable of binding to the NOVX protein, preferably an antibody having a detectable label. The antibody is
It can be polyclonal or, more preferably, a monoclonal antibody. An intact antibody or fragment thereof (eg, Fab or F (a
b ′) ₂ ) can be used. The term "labeled" refers to a probe or antibody that couples a detectable substance to the probe or antibody (
That is, by physically linking the probe or antibody, as well as indirectly labeling the probe or antibody by reactivity with another reagent that is directly labeled. Is intended. Examples of indirect labeling include detection of primary antibody with a fluorescently labeled secondary antibody, and end labeling with biotin of a DNA probe so that it can be detected with fluorescently labeled streptavidin. To be The term "biological sample" is intended to include tissues, cells and biological fluids isolated from a subject as well as tissues, cells and fluids present in the subject. That is, the detection methods of the invention can be used to detect NOVX mRNA, protein or genomic DNA in a biological sample in vitro and in vivo. For example, NOVX mRNA
In vitro techniques for the detection of E. coli include Northern hybridizations and in situ hybridizations. In vitro techniques for detecting NOVX proteins include enzyme-linked immunosorbent assay (ELISA).
), Western blot, immunoprecipitation and immunofluorescence. In vitro techniques for detecting NOVX genomic DNA include Southern hybridizations. In addition, in vivo techniques for detection of NOVX proteins include introducing a labeled anti-NOVX antibody into the subject.
For example, the antibody can be labeled with a radioactive marker. The presence and location of radioactive markers in a subject can be detected by standard imaging techniques.

[0371] In one embodiment, the biological sample comprises protein molecules from the test subject. Alternatively, the biological sample may include mRNA molecules from the test subject or genomic DNA molecules from the test subject. A preferred biological sample is a peripheral blood leukocyte sample isolated by conventional means from a subject.

In another embodiment, the method of the present invention further comprises the step of obtaining a control biological sample from a control subject, the control sample being NOVX.
Of the NOVX protein, mRNA or genomic DNA, resulting in contact with a compound or drug capable of detecting NOVX protein, mRNA or genomic DNA
The presence of NOVX protein, mRNA or genomic DNA in the process and control samples thereof is detected in the biological sample and the presence of NOVX protein, mRNA or genomic DNA in the test sample is compared. Including steps.

The present invention also includes a kit for detecting the presence of NOVX in a biological sample. For example, the kit may comprise: a labeled compound or agent capable of detecting NOVX protein or mRNA in a biological sample; a means for determining the amount of NOVX in the sample; and in the sample , A means for comparing the amount of NOVX with a standard. The compound or agent can be packaged in a suitable container. This kit is NO
Instructions for using the kit to detect a VX protein or nucleic acid may be provided.

Prognosis Assays The diagnostic methods described herein may be further utilized to identify subjects having or at risk of developing a disease or disorder associated with aberrant expression or activity of NOVX. Can be identified. For example, an assay described herein (eg, the diagnostic assay described above or the assay described below) can be utilized to have or be at risk of developing a disorder associated with NOVX protein, nucleic acid expression or activity. A subject having can be identified. Alternatively, this prognostic assay may be utilized to identify subjects who have or are at risk of developing a disease or disorder. Accordingly, the invention provides methods for identifying diseases or disorders associated with aberrant expression or activity of NOVX. Here, the test sample is obtained from the subject and is a NOVX protein or nucleic acid (eg, mRNA, genomic DNA).
Is detected, where the presence of a NOVX protein or nucleic acid is a diagnostic indicator for a subject having or at risk of developing a disease or disorder associated with aberrant expression or activity of NOVX. As used herein, "test sample" refers to a biological sample obtained from a subject of interest.
For example, the test sample can be a biological fluid (eg, serum), cell sample, or tissue.

In addition, the prognosis assay described herein can be used to provide a subject with an agent (eg, agonist, antagonist, peptidomimetic, protein, peptide, nucleic acid, small molecule, or other drug candidate). Whether one can administer to treat a disease or disorder associated with aberrant expression or activity of NOVX can be determined. For example, such methods can be used to determine whether a subject can be effectively treated with an agent for a disorder. Accordingly, the invention provides a method for determining whether a subject can be effectively treated with an agent for a disorder associated with aberrant expression or activity of NOVX. Here, a test sample is obtained and NOVX protein or nucleic acid is detected (eg, where the presence of NOVX protein or nucleic acid is associated with aberrant expression or activity of NOVX upon administration of the agent). Is a diagnostic indicator for subjects in which the disorder may be treated).

The methods of the invention also detect genetic damage in the NOVX gene, whereby a subject carrying the damage gene is at risk for a disorder characterized by abnormal cell proliferation and / or differentiation. It can also be used to determine whether or not. In various embodiments, the method provides for the presence or absence of a genetic lesion in a sample of cells from the subject characterized by at least one alteration that affects the integrity of the gene encoding the NOVX protein, Alternatively, the step of detecting misexpression of the NOVX gene is included. For example, such genetic damage can be detected by confirming the presence of at least one of: (i) a deletion of one or more nucleotides from the NOVX gene; (ii).
(Iii) addition of one or more nucleotides to the NOVX gene; (iii) substitution of one or more nucleotides of the NOVX gene, (iv) chromosomal rearrangement of the NOVX gene;
v) alterations in the level of messenger RNA transcripts of the NOVX gene, (v
i) abnormal alteration of NOVX gene (for example, abnormal alteration of methylation pattern of genomic DNA), (vii) presence of non-wild type splicing pattern of messenger RNA transcript of NOVX gene, (viii) non-wild type level of NOVX protein , (Ix) allelic deletion of the NOVX gene, and (x) inappropriate post-translational modification of the NOVX protein. As described herein, there are a number of known assay techniques in the art that can be used to detect damage in the NOVX gene. A preferred biological sample is a peripheral blood leukocyte sample isolated from a subject by conventional means. However, any biological sample containing nucleated cells can be used, including, for example, buccal mucosal cells.

In certain embodiments, the detection of damage is performed by polymerase chain reaction (PCR) (
See, eg, US Pat. Nos. 4,683,195 and 4,683,202) (eg, anchor PCR or RACE PCR), or ligation chain reaction (LCR) (eg, Landegran et al. (1988). ) Scien
241: 1077-1080; and Nakazawa et al. (1994) P.
roc. Natl. Acad. Sic. USA 91: 360-364)). The latter may be particularly useful for detecting point mutations in the NOVX gene) (see Abravaya et al., 1995 Nucl Acids Res 23: 675-682). The method comprises collecting a sample of cells from a patient, isolating a nucleic acid (eg, genome, mRNA or both) from the cells of the sample, NO
Contacting one or more primers that specifically hybridize to the VX gene with its nucleic acid sample under conditions such that hybridization and amplification of the NOVX gene (if present) occurs, and the presence of an amplification product Alternatively, it may include detecting its absence, or detecting the size of its amplification product and comparing its length with a control sample. It is envisioned that PCR and / or LCR may be desirably used as a preliminary amplification step with any of the techniques used to detect the mutations described herein.

Alternative amplification methods include: self-sustaining sequence replication (Guatelli et al., Prior to detection of the amplified molecule using techniques well known to those skilled in the art)
1990, Proc. Natl. Acad. Sci. USA 87: 1874-
1878), transcription amplification system (Kwoh et al., 1989, Proc. Na.
tl. Acad. Sci. USA 86: 1173-1177),
Q Replicase (Lizardi et al., 1988, BioTechnology)
6: 1197), or any other nucleic acid amplification method. These detection schemes are particularly useful for the detection of nucleic acid molecules when such nucleic acid molecules are present in very small numbers.

In an alternative embodiment, mutations in the NOVX gene from sample cells can be identified by alterations in restriction enzyme cleavage patterns. For example, sample and control DNA is isolated, amplified (if necessary), digested with one or more restriction endonucleases, and fragment length sizes are determined by gel electrophoresis and compared. To be done. The difference in size of fragment length between sample DNA and control DNA is
The mutation in A is shown. In addition, the use of sequence-specific ribozymes (see, eg, US Pat. No. 5,493,531) can be used to score for the presence of specific mutations by the occurrence or loss of ribozyme cleavage sites. .

In another embodiment, a gene mutation in NOVX is the hybridization of a sample nucleic acid and a control nucleic acid (eg, DNA or RNA) to a high density array containing hundreds or thousands of oligonucleotide probes. Can be identified by (Cronin et al. (1996) Human Mutatio).
n 7: 244-255; Kozal et al. (1996) Nat. Med. 2:75
3-759). For example, the gene mutation in NOVX is Cron.
can be identified in a two-dimensional array containing photogenerated DNA probes as described in in et al., supra. Briefly, by using a first hybridization array of probes to scan over a long stretch of DNA in samples and controls, creating a linear array of consecutively overlapping probes,
Base changes between the sequences can be identified. This step allows the identification of point mutations.
This step is followed by a second hybridization array, which allows the characterization of specific mutations by using smaller specialized probe arrays complementary to all variants or mutants detected. To Each mutation array is composed of parallel probe sets, one complementary to the wild-type gene and the other complementary to the mutant gene.

In yet another embodiment, the NOVX gene may be sequenced directly using any of a variety of sequencing reactions known in the art, and the wild type (control) sequence corresponding to the sample NOVX sequence. The mutation can be detected by comparing with. An example of a sequencing reaction is Maxam and Gilbert (197).
7) Proc. Natl. Acad. Sic. USA 74: 560 or Sa
nger (1977) Proc. Natl. Acad. Sic. USA 74:
One based on the technology developed by 5463. It is also contemplated that any of a variety of automated sequencing procedures may be utilized when performing diagnostic assays (eg, Naeve et al. (1995) Biotechniques 19).
: 448). These include sequencing by mass spectrometry (eg,
PCT International Publication Number WO 94/16101; Cohen et al. (1996) Adv.
Chromatography 36: 127-162; and Griffi
(1993) Appl Biochem Biotechnol 38. :
147-159).

Other methods for detecting mutations in the NOVX gene include methods that use protection from cleaving agents to detect mismatched bases based on RNA / RNA or RNA / DNA heteroduplexes. Is (Myers et al. (1985) S
Science 230: 1242). Generally, "mismatch cutting"
Techniques in the art of heteroduplexes formed by hybridizing (labeled) RNA or DNA containing wild-type NOVX sequences with potential mutant RNA or DNA obtained from a tissue sample. It begins with the process of providing the chains. Treating this double-stranded duplex with an agent that cleaves the single-stranded region of the duplex (eg, which is present due to a base pair mismatch between its control and sample strands) To do. For example, RNA / DNA duplexes can be treated with RNase, and DNA / DNA hybrids can be treated with S ₁ nuclease as opposed to enzymatically digesting its mismatched regions. In other embodiments, either DNA / DNA or RNA / DNA duplexes can be treated with hydroxylamine or osmium tetroxide and piperidine to digest mismatched regions. After digestion of the mismatched regions, the resulting material is then separated by size on a denaturing polyacrylamide gel to determine the site of mutation. For example, Cotton et al. (1988) Proc Natl A.
cad Sci USA 85: 4397; Saleeba et al. (1992) Me.
See methods Enzymol 217: 286-295. In one embodiment, the control DNA or RNA can be labeled for detection.

In yet another embodiment, the mismatch cleavage reaction involves the NOVX obtained from a sample of cells with one or more proteins that recognize mismatched base pairs in double-stranded DNA (so-called “DNA mismatch repair” enzymes). Used in defined systems to detect and map point mutations in cDNA. For example,
E. E. coli mutY enzyme cleaves A at a G / A mismatch and HeL
Thymidine DNA glycosylase from a cell cleaves T at a G / T mismatch (Hsu et al. (1994) Carcinogenesis 15: 16571-1.
662). According to an exemplary embodiment, NOVX sequences (eg, wild type NOVX
A sequence-based probe is hybridized to a cDNA or other DNA product from the test cell. The duplex is treated with a DNA mismatch repair enzyme,
The cleavage product (if any) can then be detected, such as by electrophoresis protocols. See, eg, US Pat. No. 5,459,039.

In another embodiment, alterations in electrophoretic mobility are used to identify mutations in the NOVX gene. For example, single-stranded conformational polymorphisms (SSCPs) can be used to detect differences in electrophoretic mobility between mutant and wild-type nucleic acids (Orita et al. (1989) Proc Natl.
Acad Sci USA: 86: 2766, also Cotton (1993) M.
utat Res 285: 125-144; Hayashi (1992) Ge.
See Net Anal Tech Appl 9: 73-79). Single-stranded DNA fragments of sample and control NOVX nucleic acids are denatured and regenerated. The secondary structure of single-stranded nucleic acids varies according to sequence, and the resulting changes in electrophoretic mobility even allow the detection of single base changes. D
The NA fragment may be labeled or detected with a labeled probe. The sensitivity of the assay can be enhanced by using RNA, rather than DNA, whose secondary structure is more sensitive to changes in sequence. In one embodiment, the method of the invention utilizes heteroduplex analysis to separate double-stranded heteroduplex molecules based on changes in electrophoretic mobility. For example, K
See een et al. (1991) Trends Genet 7: 5.

In yet another embodiment, migration of mutant or wild type fragments in a polyacrylamide gel containing a constant denaturing agent is assayed using denaturing gradient gel electrophoresis (DGGE). For example, Myers et al. (1985) N
See ature 313: 495. When DGGE is used as the method of analysis, the DNA can be, for example, by PCR a high melting point GC-rich DN of about 40 bp.
It is modified by adding a GC clamp of A to ensure that it is not completely denatured. In a further embodiment, temperature gradients are used instead of denaturant gradients to identify differences in the mobility of control and sample DNA. For example, Rosenbaum and Reissner (198
7) See Biophys Chem 265: 12753.

Examples of other techniques for detecting point mutations include, but are not limited to: selective oligonucleotide hybridization, selective amplification, or selective primer extension. For example, oligonucleotide primers are
Known mutations can be prepared that are centrally located and then hybridized to the target DNA under conditions that allow hybridization only if a perfect match is found. For example, Saiki et al. (1986) Nature 324.
163); Saiki et al. (1989) Proc Natl Acad. See Sci USA 86: 6230. Such allele-specific oligonucleotides are PCR amplified target D when the oligonucleotides are attached to a hybridizing membrane and hybridized with labeled target DNA.
It hybridizes to NA or many different mutations.

Alternatively, allele-specific amplification techniques that rely on selective PCR amplification can be used in conjunction with the present invention. Oligonucleotides used as primers for specific amplification are in the center of the molecule (so that amplification depends on differential hybridization) (Gibbs et al. (1989) Nucleic Ac).
ids Res 17: 2437-2448), or may carry the mutation of interest at the 3'-most end of one primer, which may prevent mismatches or reduce polymerase extension under appropriate conditions (Prossner). (1993)
Tibtech 11: 238). Furthermore, introducing a new restriction site into the mutated region for cleavage-based detection may be desirable for cleavage-based detection. For example, Gasparini et al. (1992) Mol Cell.
See Probes 6: 1. It is envisioned that in certain embodiments, amplification may also be performed using Taq ligase for amplification. For example, Bar
any (1991) Proc Natl Acad Sci USA 88: 1.
See 89. In such cases, ligation will only occur if there is an exact match at the 3'end of the 5'sequence, and the presence or absence of amplification will be sought to detect the presence of a known mutation at a particular site. Allows to detect.

The methods described herein include, for example, at least one of the methods described herein.
It may be carried out by utilizing a pre-packaged diagnostic kit comprising one probe nucleic acid or antibody reagent, for example for diagnosing a patient exhibiting symptoms or familial history of a disease or disorder comprising the NOVX gene. It can be conveniently used in the clinical setting.

In addition, any cell type or tissue in which NOVX is expressed, preferably peripheral blood leukocytes, can be utilized in the prognosis assay described herein. However, any biological sample containing nucleated cells (eg, including buccal mucosal cells)
Can be used.

Pharmacogenomics Factors, or modulators, that have a stimulatory or inhibitory effect on NOVX activity (eg, NOVX gene expression) are identified by the screening assays described herein. Thus, disorders (which include the following: metabolic disorders, diabetes, obesity, infections, anorexia, cancer-related cachexia, cancer,
Associated with neurodegenerative diseases, Alzheimer's disease, Parkinson's disease, immune disorders, and hematopoietic disorders, and various dyslipidemias, obesity-related metabolic disorders, X metabolic syndrome (X), and chronic diseases Wasting disorders, and various cancers. ) (Prophylactically or therapeutically) can be administered to an individual. In conjunction with such treatment, an individual's pharmacogenomics, ie, a study of the relationship between an individual's genotype and that individual's response to foreign compounds or drugs, may be considered. Differences in the metabolism of therapeutic agents can lead to severe toxicity or treatment failure by altering the relationship between dose and blood concentration of the pharmacologically active drug. Therefore, the pharmacogenomics of an individual allows for the selection of effective agents (eg, drugs) for prophylactic or therapeutic treatment based on consideration of the individual's genotype. Such pharmacogenomics can further be used to determine the appropriate dosage and therapeutic agent regimen. Therefore, NO
VX protein activity, NOVX nucleic acid expression, or NOVX gene mutation content in an individual may be determined, thereby selecting an appropriate agent for therapeutic or prophylactic treatment of the individual.

Pharmacogenomics deals with clinically significant hereditary alterations in response to drugs due to altered drug properties and aberrant effects in affected individuals. For example, Eich
elbaum, 1996, Clin. Exp. Pharmacol. Physi
ol, 23: 983-985 and Linder, 1997, Clin. Che
m, 43: 254-266. In general, two types of pharmacogenomic states can be distinguished. A genetic condition transmitted as one factor that modifies the way a drug acts on the body (altered drug action), or a genetic condition transmitted as one factor that modifies the way the body acts on a drug ( Modified drug metabolism). These pharmacogenomic states can occur either as rare defects or as polymorphisms. For example, glucose-6-phosphate dehydrogenase (G6PD) deficiency is a common inherited enzymatic disease, the main clinical complications of which are oxidative drugs (antimalarials, sulfonamides, analgesics, nitrofuran). A) and hemolysis after eating fava beans.

In an exemplary embodiment, the activity of drug metabolizing enzymes is a major determinant of both the intensity and duration of drug action. The discovery of genetic polymorphisms in drug-metabolizing enzymes, such as N-acetyltransferase 2 (NAT2) and cytochrome P450 enzymes CYP2D6 and CYP2C19, may indicate that some patients do not have the expected drug effect, or standard And provided explanations regarding excessive drug response and severe toxicity after ingestion of safe doses of the drug. These polymorphisms are associated with two phenotypes in the population, those with high metabolic capacity.
(EM) and poor metabolizing capacity (poor metabol)
It is expressed by an (izer) (PM)). The prevalence of PM varies between different populations. For example, the gene encoding CYP2D6 is highly polymorphic, and some mutations have been identified in PM, all leading to the absence of functional CYP2D6. Those with low metabolic capacity for CYP2D6 and CYP2C19 quite often experience exaggerated drug responses and side effects when they receive standard doses. When the metabolite is the active therapeutic moiety, PM does not show a therapeutic response, as demonstrated for the analgesic effect of codeine mediated by its CYP2D6-forming metabolite, morphine. The other extreme are the so-called ultra-rapid metabolizers who do not respond to standard doses. Molecules that are the basis for ultrarapid metabolism have recently been identified to be due to CYP2D6 gene amplification.

Therefore, the activity of the protein of NOVX, the expression of nucleic acid of NOVX, or the mutation content of the gene of NOVX in an individual is determined, thereby determining the appropriate agent for the therapeutic or prophylactic treatment of that individual. You can choose. In addition, pharmacogenomic studies can be used to apply the genotype of polymorphic alleles encoding drug-metabolizing enzymes to the identification of an individual's drug-responsive phenotype. This finding, when applied to dose or drug selection, may avoid adverse reactions or treatment failures, thus allowing the subject to modulate NOVX (eg, the exemplary screening described herein). The therapeutic or prophylactic efficacy may be enhanced when treated with modulators identified by one of the assays.

Monitoring Effects During Clinical Trials Monitoring the effect of an agent (eg, drug, compound) on NOVX expression or activity (eg, ability to regulate aberrant cell growth and / or differentiation) is It can be applied to basic drug screening and clinical trials. For example,
N determined by a screening assay as described herein.
Efficacy of agents to increase OVX gene expression, protein levels, or upregulate NOVX activity, clinical trials in subjects exhibiting reduced NOVX gene expression, protein levels, or downregulated NOVX activity Can be monitored at. Alternatively, the efficacy of an agent to reduce NOVX gene expression, protein levels, or downregulate NOVX activity, as determined by screening assays, is increased NOVX gene expression,
Protein levels, or can be monitored in clinical trials of subjects exhibiting upregulated NOVX activity. In such clinical trials, NOVX
Expression or activity, and preferably other genes, such as those involved in cell proliferation or immune disorders, "read out."
That is, it can be used as a marker of immunoreactivity of a specific cell.

For example, a gene (eg, compound, drug or small molecule) that modulates NOVX-containing genes, which modulates NOVX activity (eg, identified in a screening assay as described herein). The treatment used may identify (but is not limited to) intracellularly regulated. Thus, to study the effects of agents on cellular proliferative disorders, cells can be isolated and RNA can be prepared and expression of NOVX and other genes involved in this disorder, eg, in clinical trials. It can be analyzed for levels. The level of gene expression (ie, gene expression pattern) can be determined by Northern blot analysis or RT-PCR, as described herein, or by measuring the amount of protein produced. It can be quantified by one of the methods as described in the text or by measuring the level of activity of NOVX or other genes. In this manner, the gene expression pattern can act as a marker that is indicative of the physiological response of cells to the drug. Thus, the response state can be determined prior to treatment of an individual with the agent, and at various times during treatment.

In one embodiment, the invention is a drug (eg, agonist, antagonist, protein, peptide, nucleic acid, peptidomimetic, small molecule, or other identified by a screening assay described herein). Of drug candidates) for monitoring the efficacy of treatment in a subject, which comprises:
Comprising the steps of: (i) obtaining a pre-dose sample from the subject prior to administration of the drug; (ii) in the pre-dose sample, NOVX protein, mR
Detecting the level of expression of NA, or genomic DNA; (iii) obtaining one or more post-administration samples from this subject; (iv) NOVX protein, mRNA, or genomic DNA in the post-administration sample. (V) the level of expression or activity of NOVX protein, mRNA or genomic DNA in this pre-administration sample is compared to the level of expression or activity of NOVX protein in this post-administration sample, mRNA, or genomic DNA And (vi) thus altering the administration of the agent to this subject. For example, increased administration of this agent may increase NOVX expression or activity to levels higher than detected (ie,
Increasing the efficacy of this drug) may be desirable. Alternatively, reduced administration of the agent may be desirable to reduce NOVX expression or activity (ie, reduce the efficacy of the agent) to a level below that detected.

Methods of Treatment The present invention is at risk for disorders associated with abnormal NOVX expression or activity (
Or susceptibility), or both prophylactic and therapeutic methods of treating a subject having this disorder. Such related diseases or disorders include, for example, atherosclerosis, hypertension, congenital heart defect, aortic stenosis, atrial septal defect (ASD), atrioventricular (AV) tube defect. Disease, arterial duct, pulmonary stenosis, subaortic stenosis, ventricular septal defect (VSD), valve disease, tuberous sclerosis, scleroderma,
Obesity, transplantation, adrenoleukodystrophy, congenital adrenal hyperplasia, prostate cancer, neoplasia; adenocarcinoma, lymphoma, uterine cancer, fertility, hemophilia, hypercoagulability, idiopathic thrombocytopenic purpura, immunity Deficiencies, graft-versus-host disease, AIDS, bronchitis asthma, Coulomb's disease; treatment of multiple sclerosis, allbright hereditary osteodystrophy, as well as other diseases, disorders and conditions.

[0398]   These methods of treatment are described in more detail below.

Diseases and Disorders Diseases and disorders characterized by increased levels or biological activity (compared to a subject not afflicted with the disease or disorder) antagonize activity (
That is, it can be treated with a therapeutic agent (which reduces or inhibits). Therapeutic agents that antagonize activity can be administered in a therapeutic or prophylactic manner. Therapeutic agents that may be utilized include, but are not limited to, (i) the peptides, or analogs, derivatives, fragments or homologs thereof; (ii) antibodies to the peptides; (iii) encode the peptides. (Iv) is an antisense nucleic acid and is "dysfunctional" utilized to "knock out" the endogenous function of the peptide by homologous recombination (ie, within the coding sequence of the coding sequence for the peptide. Nucleic acid administration (due to the heterologous insertion of S. cerevisiae), eg, Capecchi, 1989, Science 244: 1288-1292.
Or (v) modulators (ie inhibitors, agonists and antagonists (for further peptidomimetics of the invention or peptides of the invention) that alter the interaction between said peptide and its binding partner. Including antibodies specific for))).

Diseases and disorders characterized by decreased levels or biological activity (compared to a subject not afflicted with the disease or disorder) have increased activity (ie, are agonists of the activity). It can be treated with a therapeutic agent. A therapeutic that upregulates activity can be administered in a therapeutic or prophylactic manner. Therapeutic agents that may be utilized include, but are not limited to, the above peptides, or analogs, derivatives, fragments or homologs thereof; or agonists that increase bioavailability.

Increased or decreased levels can be readily detected by quantifying the peptide and / or RNA. This quantification involves obtaining a tissue sample of a patient (eg, from a biopsy tissue) and measuring the RNA level or peptide level, structure and / or activity of the expressed peptide (or mRNA of the peptide) in vitro. By assaying in. Methods well known in the art include, but are not limited to, immunoassays (eg, Western blot analysis, sodium dodecyl sulfate (SDS)).
Polyacrylamide gel electrophoresis followed by immunoprecipitation, by immunocytochemistry, etc.) and / or hybridization assays to detect mRNA expression (eg, Northern assays, dot blots, in situ hybridization, etc.).

Prophylactic Method In one aspect, the invention provides for a disease or condition associated with aberrant NOVX expression or activity in a subject, including expression of NOVX or at least one NO.
Methods for preventing by administering to the subject an agent that modulates VX activity are provided. A subject at risk of developing a disease caused by or caused by aberrant NOVX expression or activity is, for example, by any of the diagnostic or prognostic assays described herein, or a combination thereof. , Can be identified. Administration of a prophylactic drug will prevent the disease or disorder from
Alternatively, it may precede the onset of symptoms characteristic of this NOVX abnormality so that its progression can be delayed. Depending on the type of NOVX abnormality, for example, a NOVX agonist drug or NOVX antagonist drug can be used to treat the subject. The appropriate agent can be determined based on the screening assays described herein. The prevention method of the present invention is further discussed in the following subsections.

(Treatment Method) Another aspect of the present invention relates to a method of modulating NOVX expression or activity for therapeutic purposes. The modulating methods of the invention include contacting a cell with an agent that modulates one or more of the activities of NOVX protein activity for that cell.
Agents that modulate NOVX protein activity include nucleic acids or proteins, naturally occurring cognate ligands of NOVX proteins, peptides, NOVX peptidomimetics,
Or it may be an agent as described herein, such as other small molecules. 1
In one embodiment, the agent stimulates one or more of NOVX protein activities. Examples of such stimulatory agents include active NOVX proteins and NOVX-encoding nucleic acid molecules introduced into the cell. In another embodiment, the agent inhibits one or more of NOVX protein activities. Examples of such inhibitory agents include antisense NOVX nucleic acid molecules, and anti-NOVX antibodies. These methods of regulation are in vitro (eg,
It can be performed by culturing the cells with the agent) or in vivo (eg, by administering the agent to a subject). in this way,
The present invention provides a method of treating an individual suffering from a disease or disorder characterized by aberrant expression or activity of a NOVX protein or nucleic acid molecule. In one embodiment, the method comprises an agent that modulates (eg, upregulates or downregulates) NOVX expression or activity (eg, an agent identified by a screening assay described herein) or The step of administering a combination of such agents is included. In another embodiment, the method comprises administering a NOVX protein or nucleic acid molecule as a treatment to compensate for reduced or aberrant NOVX expression or activity.

Stimulation of NOVX activity is desirable in situations where NOVX is abnormally downregulated, and / or where increased NOVX activity appears to have a beneficial effect. One example of such a situation is where the subject is a disorder characterized by abnormal cell proliferation and / or cell differentiation (eg, cancer or immune related).
Is the case. Another example of such a situation is when the subject has a gestational disorder (eg, preclampsia).

Determining Biological Effects of Therapeutic Agents In various embodiments of the invention, appropriate in vitro or in vivo assays are performed to determine the effect of a particular therapeutic agent and its administration is indicative of treatment of diseased tissue. Decide whether or not.

In various specific embodiments, an in vitro assay is performed on a representative cell type involved in a disorder in a patient to determine whether a given therapeutic agent exerts a desired effect on this cell type. You can decide. The compounds used in therapy may be tested in suitable animal model systems before testing in human subjects. These animal model systems include, but are not limited to: rat, mouse, chicken, cow, monkey, rabbit and the like. Similarly, for in vivo testing, any animal model system known in the art can be used prior to administration to human subjects.

Prophylactic and Therapeutic Uses of the Compositions of the Invention The NOVX nucleic acids and proteins of the invention include potent prophylactic and therapeutic applications associated with various disorders including, but not limited to: Useful for applications: metabolic disorders, diabetes, obesity, infectious diseases, anorexia, cancer-related cancers, neurodegenerative disorders, Alzheimer's disease, Parkinson's disease, immune disorders, hematopoietic disorders, and various dyslipidemias. , Metabolic disorders related to obesity, X metabolic syndrome (
metabolic syndrome X), and wasting diseases associated with chronic diseases, and various cancers.

As an example, a cDNA encoding a NOVX protein of the invention is useful in gene therapy, and the protein may be useful when administered to a subject in need of gene therapy. As a non-limiting example, the composition of the present invention, metabolic disorders, diabetes, obesity, infections, anorexia, cancer-related cachexia, cancer, neurodegenerative diseases, Alzheimer's disease, Parkinson's disease, immune disorders, hematopoietic disorders, And has efficacy for the treatment of patients suffering from various dyslipidemias.

Both the novel nucleic acids encoding the NOVX proteins of the invention, and the NOVX proteins, or fragments thereof, may be useful in diagnostic applications. Here, the presence or amount of nucleic acid or protein is assessed. A further application is as an antibacterial molecule (ie some peptides have been found to have antibacterial properties). These materials are further useful in the generation of antibodies that immunospecifically bind to the novel agents of the invention for use in therapeutic or diagnostic methods.

Equivalents Particular embodiments are disclosed in detail herein, which are disclosed by way of example for purposes of illustration and are set forth in the accompanying claims. Is not intended to be limiting. In particular, various substitutions, changes and modifications may be made without departing from the spirit and scope of the invention as defined by the claims.
It is contemplated by the present invention that it can be done to the present invention. The choice of nucleic acid starting material, clone of interest, type of library will be routine to those of skill in the art using the knowledge of the embodiments described herein. Other aspects, advantages, and modifications are considered to be within the scope of the appended claims.

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁷ Identification code FI theme code (reference) A61P 1/00 A61P 3/10 4C084 3/00 7/00 4C085 3/10 9/00 4H045 7/00 11 / 00 9/00 13/00 11/00 19/00 13/00 25/00 19/00 27/00 25/00 31/00 27/00 35/00 31/00 37/00 35/00 C07K 14 / 705 37/00 16/28 C07K 14/705 C12N 1/15 16/28 1/19 C12N 1/15 1/21 1/19 C12Q 1/02 1/21 1/68 A 5/10 G01N 33/15 Z C12Q 1/02 33/50 Z 1/68 33/53 D G01N 33/15 M 33/50 33/566 33/53 33/574 Z C12P 21/08 33/566 C12N 15/00 ZNAA 33/574 5 / 00 A // C12P 21/08 A61K 37/02 (31) Priority claim number 60/187, 248 (32) Priority date March 6, 2000 (2000.3.6) (33) Priority claim country United States (US) (31) Yu Right claim number 60 / 187,249 (32) Priority date March 6, 2000 (2000.3.6) (33) Priority claim country United States (US) (31) Priority claim number 60 / 187,250 (32) Priority date March 6, 2000 (March 6, 2000) (33) Priority claiming country United States (US) (31) Priority claim number 60 / 187,253 (32) Priority date 2000 March 6th (2000.3.6) (33) Priority claiming country United States (US) (31) Priority claiming number 60 / 187,295 (32) Priority date March 6th, 2000 (2000.3) .6) (33) Priority claiming country United States (US) (31) Priority claim number 60 / 187,296 (32) Priority date March 6, 2000 (2000.3.6) (33) Priority Claiming country United States (US) (31) Priority claim number 60 / 187,563 (32) Priority date March 7, 2000 (2000.3.7) (33) Priority claiming country United States (US) (31 ) Priority claim number 60 / 219,854 (32) Priority date July 21, 2000 (2000.7) 21) (33) Priority claiming country United States (US) (31) Priority claim number 60 / 220,263 (32) Priority date July 24, 2000 (July 24, 2000) (33) Priority claim Country United States (US) (31) Priority claim number 60 / 221,942 (32) Priority date July 31, 2000 (July 31, 2000) (33) Priority claim country United States (US) (31) Priority claim number 60 / 257,600 (32) Priority date December 21, 2000 (December 21, 2000) (33) Priority claim country United States (US) (31) Priority claim number 60/260, 285 (32) Priority date January 8, 2001 (2001.1.8) (33) Priority claiming country United States (US) (81) Designated country EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE, TR), OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP ( H, GM, KE, LS, MW, MZ, SD, SL, SZ, TZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AE, AG , AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, BZ, CA, CH, CN, CO, CR, CU, CZ, DE, DK, DM, DZ, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV , MA, MD, MG, MK, MN, MW, MX, MZ, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, TZ, UA, UG, US, UZ, VN, YU, ZA, ZW (72) Inventor Majunda, Kumdo United States Connecticut 06905, Stanford, Silver Hill Lane 140 (72) Inventor Mishra, Vishnues. United States Connecticut 06405, Branford, East Main Street 309 Number 306 (72) Inventor Li, Re United States Connecticut 06410, Cheshire, Oak Street 478 (72) Inventor Boungartner, Jason Shee. United States Connecticut 06460, Milford, Darwood Avenue 122 (72) Inventor Spytech, Kimberley A .. United States Connecticut 06511, New Haven, Court Street 28 Number 1 (72) Inventor Tokanev, Feliz Tea. United States Florida 32601, Gainesville, Es W2 2N Avenue 1216, Apartment 156 F Term (reference) 2G045 AA40 DA12 DA13 DA14 DA36 DA78 FB02 FB03 4B024 AA01 AA11 BA63 CA02 CA04 CA09 DA02 DA06 EA02 EA04 HA11 GA18 GA18 GA18 4B063 QA01 QA18 QA19 QQ02 QQ20 QQ42 QR32 QR38 QR41 QR55 QR59 QR69 QR80 QR82 QS12 QS24 QS25 QS28 QS34 QS39 QX01 QX07 4B064 AG27 CA10 CA19 CC24 DA01 DA13 4B065 AA26X AA90X AA91X AA93Y AB01 AC14 BA01 CA24 CA44 CA46 4C084 AA02 AA06 AA07 AA13 BA01 BA22 BA23 CA53 CA56 DB63 NA14 ZA022 ZA332 ZA362 ZA512 ZA592 ZA662 ZA812 ZA962 ZB072 ZB262 ZB322 ZC212 ZC352 4C085 AA13 AA14 BB11 DD61 EE01 4H045 AA10 AA11 AA30 BA10 CA40 DA50 DA76 DA86 EA20 EA50 FA72 FA72

Claims (50)

[Claims] 1. An isolated polypeptide comprising: (a) SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 21, 23.
, 25, 27, 29, and 31, a mature form of an amino acid sequence selected from the group consisting of: (b) SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 21, 23.
, 25, 27, 29, and 31 in the mature form of an amino acid sequence selected from the group consisting of, wherein one or more amino acid residues in the variant is the mature form of the amino acid sequence. (C) SEQ ID NOs: 2, 4, 6, 8, 10, 12, wherein the variant differs from the mature form of the amino acid sequence by 15% or less of its amino acid residues. , 14, 16, 18, 21, 23
, 25, 27, 29, and 31; and (d) SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 21, 23.
, 25, 27, 29, and 31, wherein a variant of the amino acid sequence selected from the group consisting of, wherein one or more amino acid residues in the variant differ from the mature form of the amino acid sequence, However, the variant contains a amino acid sequence selected from the group consisting of a variant that differs from the amino acid sequence by 15% or less of the amino acid residues thereof. 2. The polypeptide according to claim 1, wherein the polypeptide is SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 21, 23, 25.
A polypeptide comprising the amino acid sequence of a naturally occurring allelic variant of an amino acid sequence selected from the group consisting of :, 27, 29, and 31. 3. The polypeptide of claim 2, wherein the allelic variant is SEQ ID NO: 1,3,5,7,9,11,13,15,17,19.
A polypeptide comprising an amino acid sequence that is a translation of a nucleic acid sequence that differs by a single nucleotide from a nucleic acid sequence selected from the group consisting of, 20, 22, 24, 26, 28, and 30. 4. The polypeptide of claim 1, wherein the amino acid sequence of the variant contains conservative amino acid substitutions. 5. An isolated nucleic acid molecule, which comprises: (a) SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 21, 23.
, 25, 27, 29, and 31, a mature form of an amino acid sequence selected from the group consisting of: (b) SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 21, 23.
, 25, 27, 29, and 31 in the mature form of an amino acid sequence selected from the group consisting of, wherein one or more amino acid residues of the variant are the mature form of the amino acid sequence and Different, except that the variant differs from the mature form of the amino acid sequence by 15% or less of its amino acid residues; (c) SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 21, 23
, 25, 27, 29, and 31; (d) SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 21, 23.
, 25, 27, 29, and 31, wherein a variant of the amino acid sequence selected from the group consisting of, wherein one or more amino acid residues of the variant differ from the mature form of the amino acid sequence, The variant is different from the amino acid sequence by 15% or less of the amino acid residues thereof; (e) SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 21, 23
A nucleic acid fragment encoding at least a part of a polypeptide comprising an amino acid sequence selected from the group consisting of :, 25, 27, 29, and 31, or a variant of the polypeptide, wherein the variant of A nucleic acid fragment in which one or more amino acid residues differ from the mature form of the amino acid sequence, provided that the variant differs from the amino acid sequence in no more than 15% of its amino acid residues; and (f) ( a), (b), (c), (d) or (e) complement, a nucleic acid molecule comprising a nucleic acid sequence encoding a polypeptide comprising an amino acid sequence selected from the group consisting of: . 6. The nucleic acid molecule of claim 5, wherein the nucleic acid molecule comprises the nucleotide sequence of a naturally occurring allelic nucleic acid variant. 7. The nucleic acid molecule of claim 5, wherein the nucleic acid molecule encodes a polypeptide comprising the amino acid sequence of a naturally occurring variant of the polypeptide. 8. The nucleic acid molecule of claim 5, wherein the nucleic acid molecule is SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 20, 22. ,
A nucleic acid molecule that differs by a single nucleotide from a nucleic acid sequence selected from the group consisting of 24, 26, 28, and 30. 9. The nucleic acid molecule of claim 5, wherein the nucleic acid molecule is: (a) SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19. , 20,
A nucleotide sequence selected from the group consisting of 22, 24, 26, 28, and 30; (b) SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 20,
A nucleotide sequence that differs in one or more nucleotides from a nucleotide sequence selected from the group consisting of 22, 24, 26, 28, and 30, provided that no more than 20% of the nucleotides differ from the nucleotide sequence, A nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of: a nucleotide sequence; (c) a nucleic acid fragment of (a); and (d) a nucleic acid fragment of (b). 10. The nucleic acid molecule of claim 5, wherein said nucleic acid molecule is SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 20, 22.
A nucleic acid molecule that hybridizes under stringent conditions to a nucleotide sequence selected from the group consisting of, 24, 26, 28, and 30, or a complementary strand of the nucleotide sequence. 11. The nucleic acid molecule according to claim 5, wherein the nucleic acid molecule comprises the following: (a) a first nucleotide sequence comprising a coding sequence encoding the amino acid sequence and one or more nucleotide sequences. A first nucleotide sequence comprising a different coding sequence, provided that no more than 20% of the nucleotides in the coding sequence in the first nucleotide sequence differ from the coding sequence; (b) the complement of the first polynucleotide, A second polynucleotide isolated; and (c) a nucleic acid fragment of (a) or (b); a nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of: 12. A vector comprising the nucleic acid molecule of claim 11. 13. The vector of claim 12, further comprising a promoter operably linked to the nucleic acid molecule. 14. A cell comprising the vector according to claim 12. 15. A polypeptide that immunospecifically binds to the polypeptide according to claim 1,
antibody. 16. The antibody according to claim 15, wherein the antibody is a monoclonal antibody. 17. The antibody of claim 15, wherein the antibody is a humanized antibody. 18. A method for determining the presence or amount of the polypeptide of claim 1 in a sample, the method comprising: (a) preparing the sample; (b) Contacting the sample with an antibody that immunospecifically binds to the polypeptide; and (c) determining the presence or amount of the antibody bound to the polypeptide, and thereby the presence or absence of the polypeptide in the sample. Determining the amount. 19. A method for determining the presence or amount of the nucleic acid molecule of claim 5 in a sample, said method comprising: (a) providing said sample; (b) said Contacting the sample with a probe that binds to the nucleic acid molecule; and (c) determining the presence or amount of the probe bound to the nucleic acid molecule, thereby determining the presence or amount of the nucleic acid molecule in the sample. Determining. 20. The method of claim 19, wherein the presence or amount of the nucleic acid molecule is used as a marker for cell type or tissue type. 21. The method of claim 20, wherein the cell type or tissue type is cancerous. 22. A method of identifying an agent that binds to the polypeptide of claim 1, comprising the following steps: (a) contacting the polypeptide with the agent; and (b) Determining whether an agent binds to the polypeptide; 23. The method of claim 22, wherein the factor is a cell receptor or a downstream effector. 24. A method for identifying a factor that regulates the expression or activity of the polypeptide of claim 1, comprising the following steps: (a) providing a cell expressing the polypeptide; (B) contacting the cell with the factor; and (c) determining whether the factor regulates expression or activity of the polypeptide, thereby expressing the peptide. Alternatively, the change in activity is indicative of a factor that regulates expression or activity of the polypeptide. 25. A method for modulating the activity of the polypeptide of claim 1, wherein the method comprises treating a cell sample expressing the polypeptide of claim 1 with the activity of the polypeptide. A method comprising contacting a compound that binds to the polypeptide in an amount sufficient to modulate. 26. A method of treating or preventing a NOVX-related disorder, wherein the method treats or prevents the NOVX-related disorder in the subject for which such treatment or prevention is desired. A method comprising administering the polypeptide of claim 1 in a sufficient amount. 27. The method of claim 26, wherein the disorder is associated with processing of cell signals and regulation of metabolic pathways. 28. The method of claim 26, wherein the subject is a human. 29. A method of treating or preventing a NOVX-related disorder, wherein the method treats or prevents the NOVX-related disorder in the subject in whom such treatment or prevention is desired. A method comprising administering the nucleic acid of claim 5 in a sufficient amount. 30. The method of claim 29, wherein the disorder is associated with processing of cell signals and regulation of metabolic pathways. 31. The method of claim 29, wherein the subject is a human. 32. A method of treating or preventing a NOVX-related disorder, wherein the method is for treating or preventing the NOVX-related disorder in a subject for which such treatment or prevention is desired. 16. A method comprising administering the antibody of claim 15 in a sufficient amount. 33. The method of claim 32, wherein the disorder is diabetes. 34. The method of claim 32, wherein the disorder is associated with processing of cell signals and regulation of metabolic pathways. 35. The method of claim 32, wherein the subject is a human. 36. A pharmaceutical composition comprising the polypeptide of claim 1 and a pharmaceutically acceptable carrier. 37. A pharmaceutical composition comprising the nucleic acid molecule of claim 5 and a pharmaceutically acceptable carrier. 38. A pharmaceutical composition comprising the antibody of claim 15 and a pharmaceutically acceptable carrier. 39. A kit comprising the pharmaceutical composition of claim 36 in one or more containers. 40. A kit comprising the pharmaceutical composition of claim 37 in one or more containers. 41. A kit comprising the pharmaceutical composition of claim 38 in one or more containers. 42. A method for determining the presence or predisposition to a disease associated with altered levels of the polypeptide of claim 1 in a first mammalian subject, the method comprising: The following: (a) measuring the expression level of the polypeptide in the sample derived from the first mammalian subject; and (b) the amount of the polypeptide in the sample of step (a) is referred to as the disease. Comparing the amount of the polypeptide present in a control sample from a second mammalian subject, known not to have or known to be less susceptible to the disease, Wherein the change in the expression level of the polypeptide in the first subject as compared to the control sample indicates the presence of or predisposition to the disease. 43. The method of claim 42, wherein the predisposition is for cancer. 44. A method for determining the presence or predisposition to a disease associated with altered levels of the nucleic acid molecule of claim 5 in a first mammalian subject, said method comprising: The following: (a) measuring the amount of the nucleic acid in the sample derived from the first mammalian subject; and (b) the amount of the nucleic acid in the sample of step (a) indicating the presence of the disease. Comparing the amount of said nucleic acid present in a control sample from a second mammalian subject known to be absent or less susceptible to said disease, wherein said The method wherein the change in the level of the nucleic acid in the first subject as compared to a control sample is indicative of the presence of or predisposition to the disease. 45. The method of claim 44, wherein the predisposition is for cancer. 46. A method of treating a pathological condition in a mammal comprising:
The method comprises administering to the mammal a polypeptide in an amount sufficient to ameliorate the pathological condition, wherein the polypeptide is SEQ ID NO: 2, 4, 6, 8, 10.
, 12, 14, 16, 18, 21, 23, 25, 27, 29, and 31 at least 95% identical to a polypeptide comprising at least one amino acid sequence or a biologically active fragment thereof. The method, which is a polypeptide having an amino acid sequence. 47. A method of treating a pathological condition in a mammal comprising:
16. A method comprising administering the antibody of claim 15 to the mammal in an amount sufficient to ameliorate the pathological condition. 48. SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18
A method for screening a candidate substance that interacts with an olfactory receptor polypeptide selected from the group consisting of, 21, 23, 25, 27, 29, and 31, or a fragment or variant thereof. The following steps: a) SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 21, 23,
A polypeptide selected from the group consisting of the sequences 25, 27, 29 and 31;
Alternatively, providing a peptide fragment or variant thereof; b) obtaining a candidate substance; c) contacting the polypeptide with the candidate substance; and d) if present, the polypeptide and the candidate. Detecting the complex formed with the substance. 49. SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18
, 21, 23, 25, 27, 29, and 31 for screening for ligand molecules that interact with an olfactory receptor polypeptide, the method comprising the steps of: a) SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 21, 23,
Providing a recombinant eukaryotic host cell comprising a nucleic acid encoding a polypeptide selected from the group consisting of polypeptides comprising the amino acid sequences 25, 27, 29 and 31; b) the recombinant eukaryote Preparing a membrane extract of a host cell; c) contacting the membrane extract prepared in step b) with a ligand molecule of choice; and d) detecting the level of production of a second messenger metabolite. how to. 50. SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18
, 21, 23, 25, 27, 29, and 31 for screening for ligand molecules that interact with an olfactory receptor polypeptide, the method comprising: a) SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 21, 23,
Providing an adenovirus comprising a nucleic acid encoding a polypeptide selected from the group consisting of polypeptides comprising the amino acid sequences 25, 27, 29, and 31; b) infecting the olfactory epithelium with the adenovirus; c) contacting the olfactory epithelium of step b) with a ligand molecule of choice; and d) detecting an increased response to the ligand molecule, if present.