JP2003524636A - Method of treating gastrointestinal tract with purinergic receptor agonist - Google Patents

Abstract

  (57) [Summary] The present invention relates to a method for controlling water and mucin secretion and fluid transport in the gastrointestinal tract. The present invention relates to a method for treating gastrointestinal disorders in which the gastrointestinal tract mucosal barrier is impaired. The present invention further provides a method for normalizing disorders of fluid secretion or absorption in the gastrointestinal tract, causing either diarrhea or constipation. The method comprises administering to a patient a pharmaceutical composition comprising a purinary P2Y receptor ligand in an amount effective to control water and mucin secretion and fluid transport in the gastrointestinal tract. Pharmaceutical compositions for use in the present invention include P2Y purinergic receptor agonists such as uridine 5'-diphosphate (UDP) and uridine 5'-triphosphate (UTP), cytidine 5'-diphosphate (CDP). And cytidine 5'-triphosphate (CTP), adenosine 5'-diphosphate (ADP) and adenosine 5'-triphosphate (ATP), and analogs thereof; and dinucleotide polyphosphate compounds of general formula IV (General formula IV). The compounds are prepared in oral, injectable, or suppository form, and are administered to a patient.

Description

Detailed Description of the Invention

This application is incorporated by reference in its entirety in 1999, 1
It claims priority to US Provisional Application No. 60 / 171,710, filed February 22.

TECHNICAL FIELD The present invention relates to purinergic receptor agonists such as some uridines, adenines,
Alternatively, it relates to a method of controlling mucus secretion and fluid transport in the gastrointestinal system of a patient by administering cytidine 5'-di- and triphosphates, dinucleoside polyphosphates and analogs thereof.

[0003] Secretion of mucin in the background gastrointestinal system of the present invention, the amount of secretion of bicarbonate, and / or be allowed to increase the degree of hydration there are many therapeutically desirable situation. The gastrointestinal system is primarily responsible for extracting the basic elements of energy and metabolism from the presented nutritional material. The digestive tract includes the oral cavity (mainly salivary glands), esophagus, stomach, small intestine, large intestine, rectum, and auxiliary organs (pancreas, liver and gallbladder). Diseases such as dry mouth, gastroesophageal reflux disease, peptic ulcers, and inflammatory bowel disease occur when the mucosal barrier of the digestive tract is compromised. Abnormal fluid and electrolyte transport in the lower gastrointestinal tract results in diseases such as constipation and diarrhea.

Mucus is a viscous material that coats many epithelial surfaces and is secreted into liquids such as saliva. It is mainly composed of mucin and inorganic salts suspended in water. Mucus adheres to many epithelial surfaces where it acts as a diffusion barrier against contact with harmful substances such as gastric acid, digestive enzymes and bacteria, and as a lubricant to minimize shear stress. Such mucus coatings are particularly prominent on the epithelium of the gastrointestinal tract, respiratory tract and reproductive tract. Mucus is also an abundant and important ingredient in saliva, giving it virtually unmatched lubricating properties. Mucus-secreting cells, such as goblet cells, are abundant in the epithelium of the gastrointestinal tract. Many submucosal mucous glands are distributed along the esophagus, and are clustered especially above the lower and upper parts of the esophageal sphincter. Many acinar epithelial cells in the salivary glands secrete mucus. The major structural molecule of the mucus layer is mucin, which is a large, heavily glycosylated family of proteins. The thick "sugar coating" of mucins gives them considerable water retention capacity and confers on them resistance to proteolysis, which seems to be most important for maintaining the mucosal barrier.

[0005] Secretion of bicarbonate plays an important role in maintaining mucosal health in the gastrointestinal tract. The production of bicarbonate and mucus by the esophagus to local acidification provides a unique mechanism for withstanding acid-induced damage. Secretion of salivary protective factors such as bicarbonate, as well as bicarbonate secreted by the esophageal submucosa, is important in preventing esophageal mucosal damage associated with gastroesophageal reflux disease. Mucosal bicarbonate also provides an important mechanism for protection against acid damage in the proximal duodenum, and viscous mucus provides a stable mucosal bicarbonate-supported superficial neutralization of acid. Providing a protective layer [Nucleotides stimulate bicarbonate secr
etion in guinea pig pancreatic duct (Ishiguro et al. 1999, J. Physiol, 51
9 Pt 2: 551-558) and CFTR Knockout mouse gall bladder epithelium (Clark
e et al. 2000, Am.J.Physiol.Gastrointest.Liver Physiol. 279: G132-138)]
.

Proper control of the absorption of fluids and electrolytes in the proper regions along the gastrointestinal system is required for normal digestive function. Fluid transport dysfunction results in various disorders such as constipation and diarrhea. Constipation is associated with delayed delivery of feces through the large intestine. Increasing fecal sedentary time in the large intestine results in increased absorption of fluid by the epithelium of the colon, and leads to fecal dehydration and subsequent production of dry, hard feces in the descending colon. In contrast, diarrhea results from the rapid movement of feces through the large intestine, which results from either increased secretion of liquid in the small intestine or decreased absorption of liquid in the colon.

Dry mouth is commonly known as dry mouth and results from insufficient saliva production. Dry mouth is caused by radiation treatment or disease that damages the salivary glands and reduces salivary flow. Gastroesophageal reflux disease is a symptom of greater than normal exposure of the esophageal mucosa to the contents of the stomach. The most common sign is heartburn. Pharmacological treatments include H2 antagonists (eg Tag
amet ™, Zantac ™, Pepcid ™, Axid (
)) And proton pump inhibitors such as Prilosec ™ or Pr.
Includes the use of evacid ™ for the treatment of acute illness. Peptic ulcer disease includes gastric ulcer, pyloric channel ulcer and duodenal ulcer. Ulceration is caused by complex interactions of acids and chronic inflammation induced by Helicobacter pylori infection. Patients with duodenal ulcers have a high acid secretion. Increased acid secretion leads to changes in the wall of the duodenum, which is due to H.
It sets the stage for invasion by H. pylori. Agents for treating peptic ulcers include histamine-2 (H2) blockers (Tagamet ™, Zant).
ac (TM), Axid (TM), Pepcid (TM), etc.), sucralfate, proton pump inhibitors, and antacids. Inflammatory bowel disease is divided into two types: ulcerative colitis and Crohn's disease. Ulcerative colitis acts on the colon / rectum and involves the mucosal or deepest lining of the colon wall. Crohn's disease is a full-thickness disease involving all layers of the intestine, and can involve any part of the intestine from the mouth to the anus. Medical treatments for inflammatory bowel disease include aminosalicylate and corticosteroids. Corticosteroids are virtually long-term toxic. As an alternative to conventional therapies, laboratories in the medical community are seeking to develop new treatments for gastrointestinal disorders.

The following references disclose the role of mucus integrity and mucin secretion in several diseases of the gastrointestinal tract. Rhodes et al. (Gut, 26: 1312-1318 (1985)) found that the mucosa of the colon undergoes continuous desulfurization and desialation in vivo as a result of fecal enzymatic activity; altered colonic mucous gut. It has been suggested that susceptibility may be important in the etiology of colonic disease. Somasundaram etc. (Clin.Exp.Pharmacol.Physiol
., 14: 309-318 (1987)), the integrity of the gastric mucosa and its ability to secrete mucus,
It is reported to be essential for the protection of the gastric mucosa against aggressive agent-induced ulcers in some stress situations. Desai et al. (J. Pharm.
Pharmacol. 47: 734-738 (1995)) showed that a specific dopamine D1 receptor agonist, SKF38393, was effective in protecting rat gastric and duodenal ulcers. Sarosiek et al. (Digestion, 56 Sappl. 1: 10-23 (199
5)) reported that the secretion rate of esophageal mucin, EGF and PGE2 under the influence of HC1 / pepsin was significantly reduced in patients with reflux esophagus. Saitoh et al. (Dig.Dis.Sci. 41: 1768-1774 (1996)) found that the total mucin production from patients with ulcerative colitis was higher than that of healthy subjects due to neutral mucin. Low, whereas those from patients with Crohn's disease showed higher due to higher molecular weight mucins. Sarosiek et al. (Gastroenterology, 110: 675-681 (1996)
), Suggests that the secretion rate of inorganic and organic protective components in saliva may be useful in the treatment of gastroesophageal reflux disease. Zeeh (Gastroenterology, 110: 1077-1083
(1996)) reported that administration of keratinocyte growth factor ameliorates mucosal damage in an experimental colitis model in rats. Abbas et al. (Indian J.Exp.Bio
l. 36: 182-186 (1998)) show that the antiulcerative effects of GABA and baclofen are their dominant anti-mucosal defense factors, such as increased mucin secretion and reduced cellular opening or mucosal damage. It is reported that it may be caused by the action. Nath et al. (Clin.Exp
Pharmacol. Physiol. 25: 564-567 (1998)) shows that polyriboinosinic acid-polyribocytidylic acid has a strong anti-gastric ulcer effect on rats;
It is reported that polyribocytidylic acid was shown to cause an increase in total free acid and pepsin as well as an increase in mucin content in Shay rats. Newton et al. (Gut, 43: 470-475 (1998)) H. It has been reported that Helicobacter pylori causes structural changes in the viscous gastric mucosal layer in vivo, but the mucus barrier thickness is not compromised.

The following references disclose compositions of purinergic receptor agonists and / or treatment of diseases. Uridine 5'-triphosphate has been shown to increase both the rate and total amount of mucin secretion by goblet cells in vitro (Lethem et al.
al., Am. J. Respir. Cell Mol. Biol., 9: 315-322 (1993)). USPN 5,90
0,407 (Yerxa et al.) Discloses a method of stimulating tear secretion in a subject in need of treatment. The method comprises purine receptor agonists such as uridine 5'-triphosphate, cytidine 5'-triphosphate, adenosine 5 on the surface of the subject's eye.
It comprises administering'-triphosphate, or analogs and derivatives thereof, in an amount effective to stimulate the secretion of tears. USPN 5,837,861 (Penderga
st et al.) is of formula I, wherein X is oxygen, methylene, or difluoromethylene; n = 0 or 1, m = 0 or 1, and n + m = 0, 1 or 2. And B and B'are each independently a purine residue or a pyrimidine residue linked via the 9 or 1 position);
2Y ₂ purinergic receptors are disclosed. The compounds are useful in the treatment of chronic obstructive pulmonary disease, bronchitis, certain pneumonia, cystic fibres, sinusitis, and otitis media. USPN 5,763,447 (Jacobus et al.) Discloses a method of promoting the excretion of mucosal secretions in the occluded airways of immobile patients. The method involves uridine phosphate, such as uridine 5'-triphosphate (UT), to the respiratory tract of a patient.
P), or P ¹ , P ⁴ -di (uridine-5 ′) tetraphosphate, by hydrating mucosal secretions or by stimulating contraction frequency of cilia in the respiratory tract.
Administering in an amount effective to promote drainage of the occluded airways, eg, sinuses. USPN 5,789,391,5,981,506,5
972,904 and 5,958,897 describe a method of promoting drainage of clogged mucosal secretions in the sinuses of a subject in need. The method involves applying uridine phosphate, such as uridine 5'-triphosphate (UTP), to the subject's sinuses.
) Or P ¹ , P ⁴ -di (uridine-5 ′) tetraphosphate, an analogue of UTP, or any other analogue, by hydrating the secretions of the mucosa or of cilia in the sinuses. Comprising administering in an amount effective to promote drainage of the sinus-filled fluid by stimulating contraction frequency. USPN 5,968,913 describes a pharmaceutical composition for use in promoting increased clearance of mucociliary secretions of retained mucous membranes of the respiratory tract, middle / inner ear or sinuses of humans. There is. USP
N 5,763,447 describes a method of preventing or treating pneumonia, such as ventilator-associated pneumonia, in bedridden or immobile patients in need of treatment. The method involves uridine phosphate, such as uridine 5′-triphosphate (UTP), P ¹ , P ⁴ -di (uridine-5 ′) tetraphosphate, to the respiratory tract of a patient.
Or administering the analogs thereof in an amount effective to promote the elimination of liquid in the occluded airways. WO 99/09998 discloses methods of using uridine 5'-diphosphate and its analogs for treating lung diseases. The above cited documents ('391,' 506, '904,' 897, '913 and'447
Patents and WO 99/09998), which have purine receptor activity, are incorporated herein by reference. USPN 5,733,91
6 (Neely) is a selective A ₁ adenosine receptor antagonist and / or P ₂ X
Disclosed are methods of preventing or treating ischemia-reperfusion injury or endotoxin-related lung injury by administering a composition comprising a purinoceptor antagonist. Somers
Et al. (Laboratory Investigation, 78: 1375-1383 (1998)) showed that the P2Y ₆ receptor was highly expressed in T cells infiltrating active inflammatory bowel disease, while P
Expression of 2Y _6, in T cells unaffected have reported that there was no.
Boyer et al. (Br.J.Pharmacol. 118: 1959 (1996)) described phospholipase C-binding P2Y purinoceptor of turkey erythrocyte membrane, adenyl cyclase-binding P2Y purinoceptor of C6 rat glioma cells, and 1321N1 human. Synthesis and testing of a series of chain-extended 2-thioether derivatives of adenosine monophosphate (AMP) as agonists for activation of cloned human P2U receptors, which are stably expressed in astrocytoma cells did.

Other specific dinucleotide phosphate compounds known in the prior art are:
List along with their corresponding references. These compounds have not been used in the prior art to increase mucus secretion or normalize fluid and electrolyte imbalances in the gastrointestinal tract, and applicants intend to include them in the present invention. is doing.

[Table 1]

[Table 2]

P2Y purinergic receptors are receptors for purine and pyrimidine nucleotides that couple to G proteins; they are proteins of 308-377 amino acids with a molecular weight of 41-53 kDa after glycosylation. P2Y receptors, such as P2Y ₁ , P2Y ₂ and P2Y ₆ receptors, are present in the gastrointestinal tract (Ralevic et al.
al., Pharm. Rev. 50: 415-492 (1998)). Inside and around the eyes (USPN 5,
900, 407), and the proven ability of purinergic receptors to stimulate mucus / mucin secretion in the lungs and sinuses, Applicants have determined that the P2Y purinergic receptor ligands produce mucus and / or mucin secretions. , And normalize abnormal fluid transport in the gastrointestinal tract, resulting in incentives to study whether it is effective in treating diseases and disorders of the upper and lower gastrointestinal tract.

Applicants have discovered that all P2Y receptors, such as P2Y ₄ and P2Y _11, are present in tissues of the gastrointestinal tract. Applicants have further discovered that mucus and mucin secretion, bicarbonate secretion, and fluid transport in these tissues can be regulated via mechanisms that mediate P2Y purinergic receptors. Orally or systemically administered P2Y purinergic receptor ligands provide a novel method of treating gastrointestinal disorders.

SUMMARY OF THE INVENTION The present invention provides methods for controlling mucus / mucin secretion and fluid transport in the gastrointestinal tract. The present invention provides methods for treating gastrointestinal disorders in which the mucosal barrier of the gastrointestinal system is impaired. The present invention further provides methods for normalizing disorders of fluid secretion or absorption in the gastrointestinal tract that cause either diarrhea or constipation. The method comprises administering to the patient a pharmaceutical composition comprising a purinergic P2Y receptor ligand in an amount effective to control mucus / mucin secretion and fluid transport in the gastrointestinal tract. Administration methods include oral and systemic administration.
Diseases to be treated include diseases and disorders of the oral cavity, esophagus, stomach, small intestine, large intestine, rectum, and auxiliary organs such as the pancreas, liver and gallbladder.

The pharmaceutical composition used in the present invention comprises a P2Y purinergic receptor agonist. P2Y agonists increase water, bicarbonate and mucin secretion in the mucosal epithelium of the gastrointestinal tract. P2Y agonists are uridine 5'-di and triphosphates (UDP,
UTP) and their analogs (formula Ia and Ib), adenosine 5'-monophosphate (AMP) and its analogs, adenosine 5'-di- and triphosphate (ADP, ATP) and their analogs (formulas IIa and IIb), cytidine 5'-di and triphosphates (CDP, CTP) and their analogs (formula IIIa and IIIb), and dinucleotide polyphosphate compounds (general formula IV).

[0015] SUMMARY OF THE INVENTION The Detailed Description of the Invention The present invention is the secretion of mucous in the gastrointestinal tract, secretion of bicarbonate, and a method of controlling the transport of the liquid. The present invention provides a method for treating gastrointestinal disorders in which the mucosal barrier of an organ is impaired and the imbalance of fluid absorption of secretions occurs in the small and large intestines. The method comprises administering to a mammal a pharmaceutical composition comprising a purinergic P2Y receptor ligand in an amount effective to control mucus or mucin secretion, bicarbonate secretion, or liquid transport in the gastrointestinal tract. Comprising administering. The method enhances mucin release, pH and hydration, or controls fluid transport in the gastrointestinal tract.

Gastrointestinal disorders suitable for treatment according to the present invention include those diseases or disorders affecting the oral cavity (mainly salivary glands), esophagus, stomach, small intestine, large intestine, rectum, and auxiliary organs such as the pancreas, liver and gallbladder. Including. For example, dry mouth, stomatitis, periodontal disease, esophageal reflux disease, peptic ulcer, inflammatory bowel disease (ulcerative colitis and Crohn's disease), mycosis, diarrhea and constipation can be treated by the present invention. In addition, problems associated with cystic fibrosis disease, such as reduced absorption of nutrients by dry mucin and epithelial cells of the gastrointestinal tract, can also be treated by the present invention. In addition, gastrointestinal problems caused by cancer and chemotherapy can also be treated by this method.

Mucin has been shown to be important in protecting mucosal surfaces from environmental exposure; it has been shown to act as an acid barrier and to bind pathogens. Mucin is thus part of the body's natural mucosal defense system, and stimulation of its secretion appears to lead to protection of the mucosal superficial epithelium. The method of the present invention is
It increases mucosal secretions in the gastrointestinal tract, for example the stomach and esophagus, thus enhancing the natural defense system.

The epithelial lining of the human esophagus acts as a natural barrier between the lumen and blood and as a protective lining against physical perturbations of the input food and against acidic gastric juice from the stomach. It consists of working squamous epithelium and submucosal glands. The esophageal submucosa includes mucosa, serum, and myoepithelial cell types. The submucosal glands of the respiratory tract and conjunctiva are located in the mucosal epithelium of the esophagus.
Includes the 2Y ₂ receptor. Activation of the P2Y ₂ receptor by natural and synthetic agonists is
Increases mucus secretion into the mucosal layer of the respiratory tract and its hydration.

Various pathophysiological conditions result in the erosion of the protective mucosal barrier of the respiratory tract, resulting in gastroesophageal reflux disease (GERD). Symptoms of GERD include mild to severe heartburn and esophageal inflammation (
Esophagitis), reflux, swallowing, and chest pain. GERD is caused by a variety of factors, including dysfunction of the lower esophageal sphincter (which causes gastric juice to reflux into the lower esophagus), delayed fasting, decreased esophageal clearance, and reduced salivation. When the esophagus is exposed to high acid contents during reflux of gastric juice, a disruption of the protective mucosal layer occurs. The present invention relates to the destruction of esophagus in an animal model of esophagitis, in which a P2Y ₂ receptor agonist spontaneously stimulates mucin, bicarbonate, and liquid production by squamous epithelium and / or submucosa. It is disclosed that the health of the mucosal layer can be restored.

Gastric ulcer and gastric reflux are conditions characterized in part by disruption of the mucosal barrier of the upper gastrointestinal epithelium. Excessive acid secretion in the stomach can result in the breakdown of the natural mucus layer, which protects epithelial cells from acid damage. Gastric ulcers include, but are not limited to stress, diet, H. It is associated with H. pylori infection, chemotherapy or radiation therapy, other autoimmune diseases such as Sjogren's syndrome, surgery, psychosomatic disorders, stress, anxiety, and pharmacological drug-related side effects.

The Lieberkuhn crypts along the small intestine play an important role in mediating the secretion of fluid into the lumen of the small intestine. Chloride efflux along these crypts, through apical membrane chloride channels located in the apical membrane of epithelial cells, provides a driving force for the osmotically required secretion of fluid in the small intestine. Constipation and diarrhea result from abnormal fluid transport (absorption vs. secretion) through the small and large intestine. The present invention discloses methods of normalizing fluid transport imbalances leading to either constipation or diarrhea by targeting activation of P2Y receptors along the small and large intestine. Upon exposure to pathological conditions such as cholera toxin, apical chloride channels are constitutively active, resulting in uncontrolled fluid secretion into the small intestine, extreme diarrhea, and fatal systemic dehydration. Lead the state. This observation provided a scientific rationale for treating constipation and diarrhea.

Activation of chloride and fluid secretions through the small intestine is known to provide additional fluid to the chimes before becoming fecal in the large intestine. The addition of liquid to this Chimes thus offsets the excessive absorption of liquid in the large intestine, which leads to constipation. The present invention provides that the activation of P2Y receptors by agonists provides a mechanism that provides such an increase in chloride and fluid secretion into the small intestine and can be used therapeutically to treat constipation. Is disclosed.

The colonic epithelium of the large intestine normally functions to absorb fluid and remove it from invading chyme from the small intestine and convert it into feces. Diarrhea results from excess fluid of Chimes during entry, or malabsorption of fluid through the colon. Liquid absorption along the colonic epithelium is mediated by sodium absorption through the apical membrane sodium channels and basolateral membrane sodium-potassium transporters. The liquid absorption properties of this epithelium can be electromodulated by calcium-activated potassium channels in the basolateral membrane. Increased basolateral membrane potassium conductivity hyperpolarizes the apical and basolateral membranes, and consequently increases the electromotive force for sodium influx across the apical membrane. This results in a concomitant increase in sodium and potassium absorption by the epithelium and increases absorption of ion-coupled liquids. The present invention discloses that activation of the P2Y purinoceptor by an agonist increases basolateral membrane potassium conduction and facilitates removal of fecal-derived fluid. Therefore, direct administration of P2Y receptor agonists can be used therapeutically to treat diarrhea.

[0024]   The present invention regulates mucus / mucin secretion, hydration and fluid transport in the gastrointestinal tract.
Comprising administering to the patient a pharmaceutical composition comprising: This method is commonly used in other
It has advantages over the treatments used. The method involves the production of mucus by the patient himself.
Control secretion and mucosal hydration levels. Thus, the method is a gastrointestinal system
Maintains the membrane's natural protective and lubricious properties and results from mucus dysfunction
Address the issue directly. The present invention relates primarily to the treatment of human subjects, but in veterinary
May be applied to the treatment of other mammalian subjects, such as dogs and cats, for various purposes.
It Applicants have (a) identified many purinergic P2Y receptors (P2Y₁, P2Y₂, P2Y _Four , P2Y₆, And P2Y₁₁) Is gastrointestinal tissue, eg salivary gland, esophagus, stomach, small intestine, colon
(B) potent purinergic receptor agonists are present in the lung, duodenum, and rectum;
It increases the secretion of insulin and regulates the transport of fluids in the mucosal epithelium of the gastrointestinal tract.
I found it.

P2Y agonists include nucleotide monophosphates, diphosphates, and triphosphates and dinucleotide polyphosphates. Nucleotide monophosphates useful in the present invention include adenosine 5'-monophosphate (AMP) and variants thereof such as 2-thioether substituted AMPs such as 2-hexylthio AMP (Br. J. Pharmacol. 118: 1959 ( 1996)) is included. The nucleotide diphosphates and triphosphates useful in this application are uridine 5
'-Diphosphate and triphosphate (UDP and UTP) and their analogs of general formula Ia and Ib; adenosine 5'-diphosphate and triphosphate (ADP and ATP) and general formula IIa and
IIb and their analogs; and cytosine 5'-diphosphate and triphosphate (CDP and CT
P) and their analogs of general formula IIIa and IIIb.

[0026]   UDP and its analogs have the formula Ia

[Chemical 10] (Where X ₁ and X ₂ are each independently either O ⁻ or S ⁻ ;
Y is H or OH; R ₁ is O, imido, methylene, and Jiharomechiren (e.g., dichloromethylene, difluoromethylene) is selected from the group consisting of; R ₂ is H, halo, alkyl, substituted alkyl, alkoxyl, nitro R ₃ is selected from the group consisting of absent H, alkyl, acyl (including arylamyl), and arylalkyl; and R ₄ is —OR ′, —SR ′, NR ′, And NR′R ″,
Wherein R ′ and R ″ are independently selected from the group consisting of H, alkyl, substituted alkyl, aryl, substituted aryl, arylalkyl, alkoxyl, and aryloxyl, where R ′ is R ₄ is oxygen or It is not present if it is a double bond from a sulfur atom to the carbon at the 4-position of the pyrimidine ring).

As used herein, the term “alkyl” refers to C _1-10 generic straight chain, branched chain, or cyclic, saturated or unsaturated (ie alkenyl and alkynyl) hydrocarbon chains such as methyl. , Ethyl, propyl, isopropyl, butyl, isobutyl, tert
-Butyl, pentyl, hexyl, octyl, ethenyl, propenyl, butenyl,
Pentenyl, hexenyl, octenyl, butadienyl, propynyl, butynyl,
Mention is made of pentynyl, hexynyl, heptynyl, allenyl, and optionally substituted arylalkenyl and arylalkynyl groups. As used herein,
The term "acyl" refers to an organic acid group (-OH of a carboxyl group substituted with another substituent (
That is, those represented by RCO-, where R is an alkyl or aryl group. Thus, the term "acyl" specifically includes arylacyl groups. Specific examples of acyl groups include acetyl and benzoyl. As used herein, the term "aryl" refers to 5 and 6 membered hydrocarbon and heterocyclic aromatic rings. Specific examples of aryl groups include, but are not limited to, cyclopentadienyl, phenyl,
It includes furan, thiophene, pyrrole, pyran, pyridine, imidazole, isothiazole, isoxazole, pyrazole, pyrazine, pyrimidine and the like. The term “alkoxyl” as used herein includes C _1-10 generic straight chain, branched chain, or cyclic, saturated or unsaturated oxo-hydrocarbon chains such as methoxy, ethoxy, propoxy, Reference is made to isopropoxy, butoxy, t-butoxy, and pentoxy. The term “aryloxy” as used herein refers to aryloxy, such as phenyloxyl, and alkyl, halo, or alkoxyl substituted aryloxyl. As used herein, the terms "substituted alkyl" and "substituted aryl", as defined herein, are such that one or more atoms or functional groups of the aryl and alkyl groups are different atoms or functional groups, such as Halogen, aryl, alkyl,
Includes alkoxy, hydroxy, nitro, amino, alkylamino, dialkylamino, sulfate, and mercapto substituted alkyl and aryl groups. the term"
“Halo”, “halide”, or “halogen” as used herein refers to fluoro, chloro, bromo, and iodo groups.

Exemplary compounds of formula (Ia) include those disclosed in WO99 / 09998, incorporated herein by reference. The compound of formula Ia is, for example, uridine 5'-diphosphate (UDP); uridine 5'-O- (thiodiphosphate) (UDPβS); 5-bromouridine 5'-diphosphate (5-BrUDP); 5- (1-phenylethynyl) -uridine 5'-diphosphate (5- (1-phenylethynyl) UDP); 5-methyluridine 5'-diphosphate (5-methylUDP); 4-hexylthiouridine 5'diphosphate (
4-hexylthio UDP); 4-mercaptouridine 5'-diphosphate (4-mercapto UDP); 4-methoxyuridine 5'-diphosphate (4-methoxy UDP); 4- (
N-morpholino) uridine 5'-diphosphate (4- (N-morpholino) UDP; 4-hexyloxyuridine 5'-diphosphate (4-hexyloxy UDP); N, N-dimethylcytidine 5'-di Phosphoric acid (N, N-dimethyl CDP); N-hexyl cytidine 5'-diphosphate (N-hexyl CDP); and N-cyclopentyl cytidine 5'-diphosphate (N-cyclopentyl CDP).

Preferred compounds of formula Ia include UDP and UDPβS and 4-thioUDP. Some compounds of formula Ia (eg UDP, dUDP, UDPβS, and 4-mercapto UDP) are known and can be made according to known methods or modifications thereof known to those skilled in the art. For example, some thiophosphate analogs of nucleoside diphosphate (
For example, the identification and preparation of UTPβ-S) is described in US Pat. No. 3,846,402 (Ecks
tein et al.) and RS Goody and Eckstein, J. Am. Chem. Soc. 93: 6252-6257.
(1971). Alternatively, UDP, and other analogs thereof,
Commercially available, for example, from Sigma (St. Lousi, MO) and Pharmacia (Uppsala, Sweden).

[0030]   UTP and its analogs have the general formula Ib;

[Chemical 11] (Wherein X ₁ , X ₂ and X ₃ are independently O ⁻ or S ⁻ , Y is H or OH; R ₁ , R ₂ , R ₃ and R ₄ are defined as in formula Ia. Will be represented).

Preferably X ₂ and X ₃ are O ⁻ , R ₁ is oxygen or imide and R ₂ is H
Is. Particularly preferred compounds of formula Ib include uridine 5'-triphosphate (UTP) and uridine 5'-O- (3-thiophosphate) (UTPγS).

[0032]   ADP and its analogs have the general formula IIa;

[Chemical 12] (Wherein R ₁ , X ₁ , X ₂ and Y are defined as in formula Ia; Z is H, Cl, or SR, where R is alkyl (C ₁ -C ₂₀ saturated or unsaturated). R ₃ and R ₄ are H, while R ₂ is absent and there is a double bond between N-1 and C-6 (adenine), or R ₃ and R ₄ are H, while R ₂ is absent, and Z is SR, or R ₃ and R ₄ are H, while R ₂ is O, and N-1 and C-6 (adenine 1- A double bond is present between the oxidase) and R ₃ , R ₄ and R ₂ together form N-6 and C-6 (1, N 6 -ethenoadenine).
Is a -CH = CH- forming a ring from N-6 to N-1 having a double bond between and.

Particularly preferred compounds of formula IIa include 5′-adenosine diphosphate (ADP) and 2-methyl-SADP.

[0034]   ATP and its analogs have the general formula IIb:

[Chemical 13] (Wherein R ₁ , X ₁ , X ₂ , X ₃ and Y are defined as in formula Ib and R ₂ , R ₃ , R ₄ and Z are defined as in formula IIa). It

[0035]   A preferred compound of formula IIb comprises 5'-adenosine triphosphate (ATP).

[0036]   CDP and its analogs have the general formula IIIa:

[Chemical 14] (Where R ₁ , X ₁ , X ₂ and Y are defined as in formula Ia; R ₅ and R ₆ are H, while R ₇ is absent and N-3 and C-4 A double bond exists between (C) (cytosine) or R ₅ , R ₆ and R ₇ together form a double bond between N-4 and C-4 (3, N ⁴ -ethenocytosine). -CH = CH-, which forms a ring from N-3 to N-4 having a bond, wherein hydrogen at the 4- or 5-position of the etheno ring is alkyl, substituted alkyl, aryl,
Substituted aryl (such as heteroaryl), alkoxyl, nitro, halo, or azido substituted).

[0037]   CTP and its analogs have the general formula IIIb:

[Chemical 15] (Wherein R ₁ , X ₁ , X ₂ , X ₃ and Y are defined as in formula Ib, and R ₅ , R ₆ and R ₇ are defined as in formula IIIa). .

Preferred compounds of formula IIIb are cytidine-5′-triphosphate (CTP) and 4-
Contains nitrophenylethenocytidine 5'-triphosphate.

For simplicity, Formulas I, II, and III herein refer to active compounds in the natural D configuration, but the present invention further refers to compounds in the L configuration, and D unless otherwise indicated. And mixtures of L configurations. The natural D configuration is preferred.

[0040]   P2Y agonists also have the general formula (IV):

[Chemical 16] (Where X is oxygen, methylene, difluoromethylene, or imide; n = 0, 1 or 2; m = 0, 1 or 2; n + m = 0, 1, 2, 3, or 4 Z = OH or H; Z '= OH or H; Y = H or OH; Y' = H or OH).

Although the sugar moieties are shown in the D configuration, they may be L or D and L. The D configuration is preferred. Nucleoside residues may be in the alpha or beta and D or L configurations, but are most preferably in the beta-D-configuration.

B and B ′ are each independently a purine residue or a pyrimidine residue as defined in formulas V and VI, respectively, attached through the 9 or 1 position, respectively.

[Chemical 17] [(Where R₁ Is hydrogen, chlorine, amino, monosubstituted amino, disubstituted amino, alkyl
Is ruthio, arylthio, or aralkylthio, wherein the substituent on sulfur is
Containing up to 20 carbon atoms, which may or may not be unsaturated; R₂ Is hydroxy, amino, mercapto, alkylthio, arylthio, aral
Kirthio, acylthio, alkyloxy, aryloxy, aralkyloxy,
Acyloxy, monosubstituted alkylamino, heterocyclic-substituted cycloalkylamino
, Monosubstituted aralkylamino, monosubstituted arylamino, diaralkylamino, dia
Reel amino, dialkylamino (wherein the alkyl group is optionally N₇ Connected with
Form a substituted ring), acylamino, diacylamino, or NHR_Y And R_X Is O (adenine 1-oxide derivative) or absent (adenine derivative).
conductor); However, R₂ Is NHR_Y Then R_Y And R_X Together with the five-member fusion imidazo
Ring (1, N⁶ -Ethenoadenine derivative), which is optional
At the 4 or 5 position of the etheno moiety by an alkyl, aryl or aralkyl moiety
, Replaced as defined below; R₃ Is hydrogen, azide, alkoxy, aryloxy, aral as defined below.
Is alkyloxy, alkylthio, arylthio, or aralkylthio; or ω
-A (C_1-6 Alkyl) OCONH (C_1-6 Alkyl) B- (where A and B are
Independently amino, mercapto, hydroxy or carboxyl); or
Is a pharmaceutically acceptable ester, amide or salt thereof; or is not present
I). Thus, the substituted derivative of adenine is adenine 1-oxide; 1, N⁶ -(4-Mata
Is 5-substituted etheno) adenine; 6-substituted adenine; or 8-substituted aminoadenine
Including, Where the R'of the 6- or 8-HNR 'group is: optionally functionalized as described below.
Arylalkyl (C_1-6 ) Group; alkyl; and (
[6-aminohexyl] carbamoylmethyl)-, and ω-acylated-amino (
Hydroxy, thiol and carboxy) alkyl (C_2-10)-And their ω-
Acylated-like amino (hydroxy, thiol and carboxy) derivatives,
Selected from the group consisting of alkyl groups having a functional group therein, wherein the acyl group is
Without limitation, acetyl, trifluoroacetyl, benzoyl, substituted benzoyl
Or the carboxylic acid moiety is derived from its ester or amide.
Body, eg ethyl or methyl ester or its methyl, ethyl or benzua
It exists as a amide derivative. ω-amino (hydroxy, thiol) moiety is C_1-4 
May be alkylated with an alkyl group. J is carbon or nitrogen, provided that when J is nitrogen, R₃ Does not exist; Wherein the alkyl group is linear, branched or cyclic; Here, the aryl group is optionally lower alkyl, amino, alkylamino, NO ₂  , N₃ , Carboxylic acids, amides, sulfonamides, or halo groups);
And B and B ′ further have the general formula of formula VI linked to the ribosyl residue via the 1-position
May be pyrimidine]

[Chemical 18] (Where R_Four Is hydrogen, hydroxy, oxo, mercapto, amino, cyano, C _7-12 Arylalkoxy, C_1-6 Alkylthio, C_1-6 Alkoxy, C_1-6 Al
Kiramino or di C_1-4 Alkylamino, where the alkyl group is optionally linked.
Combine to form a heterocycle; R_Five Is hydrogen, oxo, acetyl, benzoyl, C_1-6 Alkyl, C_1-5 Alkano
Or aroyl; R₆ Is hydroxy, oxo, mercapto, C_1-4 Alkoxy, C_7-12Arylua
Lucoxy, C_1-6 Alkylthio, amino, S-phenyl, C_1-5 Disubstituted amino,
Triazolyl, C_1-6 Alkylamino or di-C_1-4 This is alkylamino
Here, the dialkyl group is optionally linked to form a heterocycle, or³ Connected with
To form a substituted ring; or R_Five And R₆ Together with a 5-membered fused imidazo between the 3- and 4-positions of the pyrimidine ring.
Form a ring and 3, N^Four -Forms an etenocytosine derivative, where
The etheno part is optionally C at the 4th or 5th position._1-4 Alkyl, phenyl, or phenyl
Substituted with luoxy; wherein C_1-4 Alkyl, phenyl or phenyloxy
At least one of the hydrogens is optionally halogen, hydroxy, C_1-4 Al
Coxy, C_1-4 Alkyl, C_6-10Aryl, C_7-12Arylalkyl, carboxy
Si, cyano, nitro, sulfonamide, sulfonate, phosphate, sulfonic acid,
Amino, C_1-4 Alkylamino and di-C_1-4 Selected from the group consisting of alkylamino
Optionally substituted by a moiety, wherein the dialkyl group is optionally linked to a heterocycle.
To form; R₇ Is hydrogen, hydroxy, cyano, nitro, and C_2-8 A group consisting of alkenyl
Wherein the alkenyl moiety is optionally linked via oxygen to form a ring.
Forming; where the alkenyl moiety on the carbon adjacent to the oxygen is
At least one hydrogen is C_1-6 Alkyl or phenyl; substituted C_2-8 Archi
Nyl, halogen, substituted C_1-4 Alkyl, CF₃ , C_2-3 Alkenyl, C_2-3 Al
Is it quinyl, allylamino, bromovinyl, ethylpropenoate, or propenoic acid?
Optionally substituted with a substituent selected from the group consisting of; or R₆ And R₇ Together, R₆ Of 5 or 6 members linked via N or O or S
Forming a saturated or unsaturated ring, said ring optionally containing functional groups which themselves contain functionality;
; However, R₈ R is amino or substituted amino, R₇ Is hydrogen; and R₈ Is hydrogen, amino or di-C_1-4 Alkylamino, C_1-4 Alkoxy, C_7-12A
Reel alkoxy, C_1-4 Alkylthio, C_7-12Arylalkylthio, carbo
Xamidomethyl, carboxymethyl, methoxy, methylthio, phenoxy, and
Selected from the group consisting of phenylthio).

In the general structure of Formulas I-III above, the dotted lines at positions 2 to 6 are intended to indicate the presence of single or double bonds at those positions, and the relative double or single bond relative. The position is determined by whether the substituents on R ₄ , R ₅ and R ₆ are keto-enol tautomers.

In the general structure of Formulas I-III above, the acyl group comprises an alkanoyl or aroyl group. Alkyl groups contain 1 to 8 carbon atoms, especially 1 to 4 carbon atoms, which are optionally substituted by one or more suitable substituents, as described below. Aryl groups containing aryl moieties of groups such as aryloxy are preferably phenyl groups, optionally substituted with one or more suitable substituents, as described below. Alkenyl and alkynyl groups mentioned above have 2 to 8
Carbon atoms, especially 2 to 6 carbon atoms, such as ethyl or ethynyl, which are optionally substituted by one or more substituents as described below.

The mentioned alkyl hereinbefore, alkenyl, alkynyl, and suitable substituents on aryl groups, halogen, hydroxy, C _1-4 alkoxy, C _1-4 alkyl, C _{6- 12} aryl, C _{6- 12} arylalkoxy, carboxy, cyano, nitro, sulphonamide, sulphonate, phosphate, sulphonic acid, amino and substituted amino, wherein the amino is _singly or doubly substituted by C _1-4 alkyl. And are double substituted, the alkyl groups are optionally joined to form a heterocycle.

The present invention further provides a novel dinucleotide having a sugar moiety selected from the group consisting of (1) arabinofuranosyl, 3'-deoxyribofuranosyl, xylofuranosyl, and lyxofuranosyl; and (2) an azapurine base. And (3) a novel dinucleotide having a 6-substituted purine, and a novel pharmaceutical composition comprising a compound of the general formula IV. In the first type of novel composition, Z and Z'are H when the sugar moiety is 3'-deoxyribofuranosyl.
Is. In the second type of novel compositions having azapurine base, J is nitrogen, and R ₃ is absent. In a third type of novel composition having 6-substituted purines, 6-monosubstituted aminopurine bases are excluded.

Preferred dinucleotide polyphosphate compounds useful in the present invention are P ¹ ,
P ⁴ - di (uridine 5 ') - _{tetraphosphate, dUP 4 U, U 2 P} 3, U 2 P 5, d
CP ₄ U, CP ₄ U, CP ₄ U, IP ₅ I, AP ₄ A, CP ₃ U, UP ₃ A and A ₂ P ₃ .

Some compounds of formula I, II and III may be made by methods known to those skilled in the art; some compounds are for example Sigma Chemical Co.
(St. Louis, MO 63178). A compound of formula Ia (UD
P and its analogs) can be prepared according to WO 99/09998. Formula Ib,
The compounds of IIb and IIIb (UTP, ATP, CTP and their analogs) are U
It can be prepared according to SPN 5,763,447. The compound of formula IV is Zamecnik,
et al., Proc. Natl. Acad. Sci. USA 89, 838-42 (1981); and Ng and Orgel, Nu.
cleic Acids Res. 15: 3572-80 (1987), Pendergast et al., USPN 5,837,861 or a modified method thereof.

The compounds of the invention are also their non-toxic pharmaceutically acceptable salts, eg
Without limitation, alkali metal salts such as sodium or potassium salts; alkaline earth metal salts such as manganese salts, magnesium salts or calcium salts; or ammonium salts or tetraalkylammonium salts, ie NX ₄ ⁺ (where X is C _{1 -4} ). Pharmaceutically acceptable salts are salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects. The present invention also includes acylated prodrugs of the compounds disclosed herein. Those of ordinary skill in the art will be aware of various synthetic methodologies that can be used to prepare non-toxic pharmaceutically acceptable salts and acylated prodrugs of the compounds.

The utility of the P2Y agonist compounds of the invention as pharmaceuticals has been demonstrated by the inositol phosphate assay for P2Y activity. E. Lazarowski et al.,
Brit. J. Pharm. 116, 1619-1627 (1995), this widely used assay relies on the measurement of inositol phosphate formation as a measure of the activity of compound-activated receptors linked to phospholipase C via the G protein. ing.

Furthermore, the usefulness of the P2Y agonist compounds of the present invention as a medicament is demonstrated by the intracellular calcium mobilization for P2Y activity. In this assay, cultured cells are stimulated by increasing concentrations of P2Y receptor agonists. Intracellular calcium levels are monitored by measuring changes in fluorescence intensity of calcium sensitive dyes using a FLIPR (Molecular Devices Corp., Sunnyvale, CA) or equivalent device.

P2Y agonist compounds increase mucus production in in vitro preparations of esophagus, gastric mucosa, duodenum, proximal and distal colon epithelium. Mucus secretion can be assayed by various techniques, such as impression cytology, enzyme-linked immunosorbent assay (ELISA), and dot blots using mucin-specific antibodies (Danjo et al., Invest. Ophtalm.
ol. Vis. Sci., 39: 2602-2609 (1998); Jumblatt et al., Invest. Ophtalmol.
Vis. Sci. 40: 43-49 (1999); and Jumblatt et al., Invest. Ophthalmol. Vis.
Sci. 39: 5803 (1998)). Our results indicate that P2Y receptor agonists are potent, prolong in mucus production when administered to the luminal surface of epithelial preparations,
And shows a significant increase. Mucin production can be repeatedly increased by repeated stimulation with agonists.

P2Y agonists significantly alter short circuit currents (Isc) in epithelial preparations from the gastrointestinal system, such as the esophagus, jejunum and distal and proximal colon. Changes in Isc are consistent with an increase in chloride flux or transerosal potassium flux through the lumen and are therefore expected to recruit absorption or secretion of fluid across the epithelium.

The efficacy of P2Y agonists for the amelioration of the symptoms associated with gastrointestinal disorders can be demonstrated in animal models. For example, Helicobacter pylori infection by administration of acetic acid to the antrum mucosa of cynomolgus monkeys is a model for chronic gastritis; the model has a histological and clinical phenotype similar to that of human gastric ulcers. Indicates. Oral administration of P2Y receptor agonists to monkeys with gastritis showed a significant restoration of periodate-Schiff positive staining and increased anti-mucin immunoreactivity, both of which reflected increased mucin secretion. To do. A reduction in the histological incidence of gastric ulcers is also an indicator of the efficacy of P2Y receptor agonists.

The desired compounds of the invention are administered orally, systemically, intraoperatively, rectally, in dosage unit formulations containing conventional non-toxic pharmaceutically acceptable carriers, adjuvants and excipients. obtain. The term "systemic" as used herein means subcutaneous injection, intravenous, intramuscular,
Includes intrasternal or infusion techniques.

The pharmaceutical formulation of the present invention comprises a ligand compound and a pharmaceutically acceptable carrier. The one or more ligand compounds may be present together with one or more non-toxic pharmaceutically acceptable carriers or diluents or excipients and, optionally, other active ingredients. One such carrier is a sugar, where the compound is homogeneously incorporated into the matrix via vitrification, or the carrier (eg lactose,
Sucrose, trehalose, mannitol) or other acceptable excipients for oral or systemic delivery.

For oral use, the pharmaceutical composition may be in any suitable dosage form such as tablets, lozenges, aqueous or oily suspensions, viscous gels, chewable gums, dispersible powders or granules, emulsions, It may be a hard or soft capsule, or a syrup or elixir. Compositions intended for oral use are prepared according to any method known in the art for the manufacture of pharmaceutical compositions. Such compositions may include one or more agents selected from the group consisting of sweetening agents, flavoring agents, coloring agents and preservatives to provide pharmaceutically aesthetically pleasing and palatable preparations. is there. Tablets usually contain the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients which are suitable for the manufacture of tablets. These excipients are, for example, inert diluents,
For example calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents such as corn starch or alginic acid;
Includes binders such as starch, gelatin or acacia; as well as lubricants such as magnesium stearate, stearic acid or talc. The tablets may be uncoated or they may be coated by known techniques to provide long lasting action. For example, a sustained release agent such as glyceryl monostearate or glyceryl distearate may be utilized.

For oral use, hard gelatine capsules are prepared by mixing the active ingredient with an inert solid diluent such as calcium carbonate, calcium phosphate or kaolin. Soft gelatin capsules are prepared by mixing the active ingredient with water or an oil medium such as peanut oil, liquid paraffin or olive oil.

For oral use, chewable gums are prepared by embedding the active ingredient in the gum; the active ingredient is slowly released by chewing. This dosage form is suitable for the treatment of stomatitis.

For oral use, aqueous suspensions are prepared by addition of water to a dispersible powder or granules, with dispersing or wetting agents, suspending agents and one or more preservatives. . Suspensions include, for example, sodium carboxymethylcellulose, methylcellulose and sodium alginate. The dispersant or wetting agent is a natural phosphatide, a condensation product of a fatty acid and an arylene oxide, a condensation product of a long-chain aliphatic alcohol and an ethylene oxide, a condensation product of a partial ester derived from a fatty acid and hexitol, and an ethylene oxide. , Or a condensation product of ethylene oxide with a partial ester derived from a fatty acid and hexitol anilide. Preservatives include, for example, ethyl and n-propyl p-hydroxybenzoate. Aqueous suspensions may further contain one or more coloring agents, one or more flavoring agents and one or more sweetening agents such as sucrose or saccharin. Those skilled in the art will recognize a number of specific excipients and humectants included in the above general description.

For systemic administration, the pharmaceutical composition is prepared in a sterile medium. The active ingredient, depending on the vehicle and concentration used, can either be suspended or dissolved in the vehicle. Adjuvants such as local anesthetics, preservatives and buffers may also be dissolved in the vehicle. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic acceptable diluent or solvent. Among the acceptable vehicles and solvents that may be employed are sterile water, saline, or Ringer's solution.

The pharmaceutical composition may further be administered in the form of suppositories for rectal administration. These compositions are suitable, non-irritating, complementary forms of the active ingredient, which at the normal temperature are solid but at the temperature of the rectum are liquid and consequently dissolve in the rectum and release the compound. It can be prepared by mixing with a drug. Such excipients include cocoa butter and polyethylene glycol.

Dosage levels of the active ingredient on the order of about 10-2000 mg are useful in treating the conditions suggested above. A preferred dosage is about 50-1000 mg, and a more preferred dosage is about 75-850 mg of active ingredient. These dosages may be given more than once daily if desired. The amount of active ingredient that is combined with the carrier materials to produce a single dosage form may vary depending upon the host treated and the particular mode of administration. However, the specific dosage level for any particular patient will depend on a variety of factors, such as the activity of the specific compound utilized, age, weight, general physical condition, sex, diet, time of administration, It will depend on the route of administration, the frequency of excretion, the drug combination and the severity of the particular disease being treated.

The present invention is further illustrated by the following examples, which should not be considered as limiting the scope and spirit of the invention to the specific methods described therein.

[0065] Examples Example 1. The presence of P2Y _1, P2Y _2, P2Y _4, P2Y ₆ and P2Y ₁₁ purinergic receptors in identifying gastrointestinal tissue of P2Y receptors in human tissues, in in vitro, human R purchased from commercial supply destination
It was determined using the RT-PCR technique of NA. Human normal stomach poly A ⁺ mRN
A was purchased from Clontech (Palo Alto, CA). First strand cDNA was prepared using oligo (dT) 18 primer and MMLV reverse transcriptase (60 min, 42 ° C.),
Synthesized from 100 ng of gastric poly A ⁺ mRNA (Advantage RT-Tor PCR kit;
Clontech, Palo Alto, CA). A control reaction in the absence of reverse transcriptase was also performed. Human normal esophagus, rectum, duodenum and salivary gland cDNAs have been cloned using Invitrogen (
Carlsbad, CA). The first strand cDNA for normal human colon, liver and small intestine is from Clontech's multiple tissue cDNA panel. RT
-PCR was performed with gastric tissue and PCR was performed with other tissues.

Sequence-specific primers for the P2Y ₁ , P2Y ₂ , P2Y ₄ , P2Y ₆ and P2Y ₁₁ genes are listed below: P2Y ₁ (accession number U42029) upstream 5′CGATCTGTATCAGCGTGCTGGTGTG 3 ′, downstream 5′TCTAGAAGCTTTCCTTGTGGCTCGG. '; P2Y ₂ (Accession No. S74902) upstream 5'AGGAGATGTGTTGGGCAGCAGTGAGGAC 3'; downstream 5'ACCAGGGTTTTCTGGCCAACCTGTGACT 3 '; P2Y ₄ (accession number X91852) upstream 5'ATGCAACGGCCACCTACATGTTCC 3'; downstream 5'GTACTCGGCAGTCAGCTTCCAACA 3 '; P2Y ₆ (Accession Session number U52464) Upstream 5′ATGGCATGGCTCTCACTGTCATCG 3 ′; Downstream 5′TTGGTGAGCTTCTGGGTCCTGTGAG 3 ′; P2Y ₁₁ (Accession number AF030335) Upstream 5′ATACTGGTGGTTGAGTTCCTGG 3 ′; Downstream 5′ACCAGGCTATACGCTCTGTAG.

PCR is performed for each P2Y (P2Y ₁ , P2Y ₂ , P2Y ₄ , P2Y ₆ , P2Y ₁₁ )
Of all tissues listed above using a combination of upstream and downstream primers (1 μl of each primer) designed to amplify a partial cDNA of
Performed on 1 μl of cDNA. The reaction further contained 400 mM of each deoxynucleotide triphosphate, 3.5 mM MgCl ₂ and 1 μl of Advantage cDNA polymerase mix (Clontech, Palo Alto, CA). The reaction conditions are:
2.5 minutes starting at 94 ° C, and then 30 seconds at 94 ° C, 60 ° C (P2Y ₄ , P2
Y ₁₁ ) or 65 ° C. (P2Y ₁ , P2Y ₂ , P2Y ₆ ) for 30 seconds, 72
1 minute at ℃, 35 cycles of this, and finally 10 minutes at 72 ℃. Some of the PCR products were cloned into the pCR2.1-TOPO vector (TOPO TA Cloning Kit; Invitrogen, Carlsbad, CA) and fully sequenced using an automated DNA sequencer.

All tissues tested were positive for the P2Y receptor. The results are summarized in Table 2.

[Table 3]

Example 2. Subcellular localization of P2Y nucleotide receptor gene expression in monkey gastrointestinal epithelial tissue by non-isotopic in situ hybridization. Tissue study tissue was obtained from Pathology Associates International, Frederick, MD. The tissues included in this study are the stomach, esophagus, small intestine (jejunum), and large intestine (colon). Tissues were excised from a 3.25 year old rhesus macaque in India immediately after euthanasia, and O. C. Flash frozen in T embedding medium. Frozen tissues were stored at -80 ° C prior to cryosectioning. Tissues were excised into 5 μm sections and hematoxylin-
Eosin (H & E) staining and in situ hybridization (ISH
A) on a microscope slide.

Evaluation of Tissue Sections H & E stained tissue sections were prepared to assess the quality and localization of the study tissue. Testing of H & E slides showed that all tissues were suitable for ISH.

Riboprobe synthetic nucleotides 253-from human P2Y ₂ -R cDNA
The PCR product containing 651 was obtained from the sponsor. The P2Y ₂ -R nucleotides 272-627 were designed to be integrated into the upstream T3 promoter or the downstream T7 promoter (P2Y ₂ primer (upstream primer sequence: 5′AGGAGATG
TGTTGGGCAGCAGTGAGGAC 3'backflow primer sequence: backflow 5'ACCAGGGTTTTCTGGCCAA
It was reamplified using CCTGTGACT 3 '). The resulting PCR product is in vitro
It was used to synthesize a digoxigenin labeled riboprobe by transcription at 0 ° (IVT). Antisense and sense riboprobes are T7 and T3, respectively.
Digoxigenin-11-UTP (Roche Molecu
MEGAscriptIVT kit (Ambion) according to the manufacturer in the presence of
Was synthesized using. After IVT, the template DNA was digested with DNase 1 and unincorporated digoxigenin was removed by ultrafiltration. The integrity of the riboprobe was assessed by electrophoresis through a denaturing polyacrylamide gel. Apparent molecular weight was estimated by comparison with the electrophoretic mobility of RNA ladders (Ambion) of 10 to 1000 base pairs. Probe yield and labeling were assessed by blot immunochemistry. Riboprobes were distributed in 5 μl aliquots and stored at −80 ° C. until used for ISH.

In Situ Hybridization Frozen tissues were cut into 5 μm sections, mounted on SuperFrost Plus slides (Fisher Scientific) and fixed in 4% paraformaldehyde / PBS pH 7.4 for 15 minutes.
Tissue sections were subsequently stained with 0.1% active diethylpyrucarbonate / PBS pH 7.4.
Was used for 30 minutes. The sections were prehybridized in the absence of probe,
It was then incubated overnight in hybridization buffer containing 400 ng / ml of either antisense or sense probe. After hybridization, the slides were subjected to a series of post-hybridization stringent washes to reduce non-specific staining. Hybridization was performed according to the manufacturer according to alkaline phosphatase complexed anti-digoxigenin Fab and nitroblue tetrazolium chloride-bromochloroindolyl phosphate (Roche Mole.
was visualized by immunohistochemistry using cular). Tissue section is nuclea
Counterstain with r fast red. The negative control, including the stained stomach and esophagus in the sense P2Y ₂ -R probe.

Results The results of the in situ hybridization experiments are shown with sense (negative control) and antisense probes for the stomach (Fig. 1), esophagus (Fig. 2), colon (Fig. 3) and jejunum (Fig. 4). . All tissues showed positive staining in the mucosal epithelium, showing P2Y ₂ receptor gene expression by antisense probe (FIGS. 1b, 2b, 3b, and 4b), while staining was observed by control sense probe. Was not done (Fig. 1a, 2a, 3
a, and 4a). More specifically, the expression of the P2Y ₂ gene is expressed in the epithelium of the gastric pit and the neck and base of the gastric gland of the stomach; stratified squamous epithelium of the esophagus; villous epithelium of the jejunum Mucin-secreting goblet cells; as well as columnar absorptive cells of the colon, mucus-secreting goblet cells, and secretory enteroendocrine crypt cells. Demonstration of P2Y ₂ receptor gene expression in the gastrointestinal epithelium, including both secretory and absorbable cell types, has demonstrated a role for P2Y ₂ receptors in gastrointestinal mucosal physiology, and enhanced mucus secretion and / or fluid. Supports its role as a target for the treatment of gastrointestinal disorders where secretion of is therapeutic.

Example 3: Measurement of intracellular calcium mobilization in cultured epithelial cells from the gastrointestinal tract Conventional techniques are used to detect intracellular calcium mobilization induced by P2Y receptor agonists. Such techniques are well known to those of ordinary skill in the art. Cells are seeded in 96-well plates and used for calcium mobilization assay. On the day of the assay, culture medium was aspirated and KCl (10.0), NaCl (
118), CaCl ₂ (2.5), MgCl ₂ (1.0), HEPES (20)
Fluo in assay buffer, pH 7.4, consisting of, glucose (10) (mM)
Replace with -3 AM solution (final concentration of 2.5 μM). Probenecid (Sigma Chemic
al Co.) at a working concentration of 2.5 mM is added to the dye-supplemented medium and dye wash medium to increase the retention of the dye in the cells. After incubation with Fluo-3AM for 60 minutes at 25 ° C, the cells were stained with dye (Columbus Plate Washer, TECAN US, Inc.
, Research Triangle Park, NC) and stimulated with increasing concentrations of P2Y receptor agonist. The intracellular calcium level is FLIPR (Mo
lecular Devices Corp., Sunnyvale, CA) to monitor changes in fluorescence intensity simultaneously in each well.

Human colonic epithelial cell line T84 cells were subjected to the calcium mobilization assay described above. The results show that the P2Y receptor agonists ATP and UTP stimulate calcium mobilization in these cells, which is consistent with P2Y ₂ receptor activation (FIG. 5). 2-Methylthio-ADP, a selective agonist of P2Y ₁ receptor
Did not stimulate calcium mobilization, suggesting a defect in the P2Y ₁ receptor in these cells. Similarly, human colon HT-29 cells showed strong P2Y responses to ATP and UTP, which is consistent with the activation of P2Y ₂ receptor (
(Figure 6). Activation of intracellular calcium mobilization by ATP and UTP in T84 and HT-29 cells suggests usefulness of P2Y receptor agonists in the gastrointestinal tract as a drug [UTP-Stimulated calcium mobilization has been reported in H
T-29 cells: Otero et al. Mol Cell Biochem 2000 Feb; 205 (1-2): 115-23).
.

[0076] Example 4: Epithelial mucus production gastrointestinal epithelium in epithelial cultures and explants, bicarbonate secretion, measurement conventional techniques 及 beauty short-circuit current, mediated by P2Y ₂ and P2Y ₄ purinoceptor agonists Used to study the electrical response of. The technique is well known to those skilled in the art. Natural explants and cultured mucosal epithelial cells from the esophagus, stomach, jejunum and colon epithelium have been isolated or grown as monolayers, where the apical (mucosal) and basement membrane (
The integrity of the binding complex that separates the serosa) remains intact. The epithelial tissue or monolayer allows for the maintenance of epithelial polarity, and an improved Ussing chamber that has the ability to separately perfuse Ringer's solution to the apical and basolateral surfaces.
embedded in r. Short circuit current and transepithelial resistance are continuously measured using conventional electrophysiological techniques. Bicarbonate secretion is pH adjusted using the pH Stat system.
Is measured by monitoring. Changes in these parameters, consistent with changes in chloride ion secretion, bicarbonate secretion, or transmembrane flux of other ions, indicate that P2Y receptor agonists are secreting, absorbing, and / or absorbing in the gastrointestinal tract. It is suggested to modify the hydration of the mucosa.

Mucus production by goblet cells residing in epithelial glands is assayed by various techniques well known to those of skill in the art. Natural explants and culture monolayers of esophageal and gastric mucosal epithelium
Assayed for production of mucin by impression cytology, which consisted of covering a constant surface area of epithelium with polyvinylidene difluoride (PVDF) membrane and staining the PVDF membrane with periodate-Schiff (PAS) reagent. . The degree of PAS positive staining is inversely proportional to mucin secretion. In the mucosal epithelium of the esophagus and stomach,
Agonists of P2Y ₂ and P2Y ₄ purinoceptors have been shown to reduce PAS staining, consistent with increased mucus secretion. Mucus secretion, P
The 2Y purinoceptor-induced increase is demonstrated by enzyme-linked immunosorbent assay (ELISA) using mucin-specific antibodies, and immunoblot. Positive results show a potent, prolonged and significant increase in mucus production when purinoceptor agonists are administered to the luminal surface of epithelial preparations. Mucin production can be repeatedly increased by repeated stimulation with purinoceptor agonists.

Example 5: Infection of Helicobacter pylori by acetic acid administration to the antrum mucosa of the purinoceptor agonist cynomolgus monkey for the recovery of the symptoms associated with ulcerative colitis is a model of chronic gastritis and that of human gastric ulcer Shows a histological and clinical phenotype similar to. Oral administration of P2Y receptor agonists to monkeys with gastritis showed a significant restoration of staining of periodate-Schiff positive substances and increased anti-mucin immunoreactivity, both of which increased mucin secretion. It reflects. A reduction in the histological incidence of gastric ulcers is also an indicator of the efficacy of P2Y receptor agonists.

A human subject suffering from ulcerative colitis or chronic gastritis is treated by the method of the present invention. The patient will undergo an endoscopy followed by a biopsy of the gastric mucosa. Ulcerative colitis is diagnosed according to the confirmation of mucosal inflammation and erosion of the gastric mucosal layer. The present invention treats a patient by oral administration of a suitable formulation of a P2Y receptor agonist that coats the mucosal layer of the esophagus and stomach and stimulates mucosal production under the gastric mucosa.
The compositions are administered as a sustained release oral dosage form, preferably in the form of chewing gum or lozenges and, if necessary, multiple times daily. The activity of the disease is evaluated by clinical researchers by the Clinical Activity Index, Endoscopic Index,
It is monitored based on the Histological Index and Global Efficacy Assessment. An improvement in one or more of these parameters suggests that the P2Y agonist reverses the symptoms of ulcerative colitis.

Example 6: Purinoceptor agonists for alteration of fluid absorption by the small intestine and distal colon and recovery of symptoms associated with diarrhea or constipation A human subject suffering from constipation or diarrhea is according to the invention as follows: Is treated by the method of. Patients with diarrhea or constipation symptoms are given an oral formulation of the compound prepared as a tablet capable of releasing the active compound in the small intestine (for constipation) or large intestine (for diarrhea) in a therapeutic and specific amount. To be The active compound is P2Y in each tissue.
It specifically agonizes receptors and promotes secretion of fluid in the small intestine and absorption of fluid in the large intestine. Assessed by patient questionnaire and clinical observations,
Toilet excretion of 48 hours, measured in grams, and duration of diarrhea or constipation are determined by the following treatments.

The present invention, and the manner and methods of making and using it, are complete, clear, concise, such that any person skilled in the art can make and use the same. And it is written in the correct term. It is to be understood that the foregoing describes preferred embodiments of the invention and that modifications can be made without departing from the spirit or scope of the invention as claimed. . In order to point out and clearly claim the subject matter of the invention, the claims conclude the specification.

[Brief description of drawings]

BRIEF DESCRIPTION OF THE FIGURES This patent application contains at least one drawing executed in color. Copies of this patent application with color drawings will be submitted by the Office upon request and payment of the necessary fee. FIG. 1 shows the results of in situ hybridization of P2Y ₂ receptor in gastric tissue (gastric epithelium) with (a) control sense probe and (b) antisense probe.

FIG. 1b shows the results of in situ hybridization of P2Y ₂ receptor in gastric tissue (gastric epithelium) with (a) control sense probe and (b) antisense probe.

FIG. 2a shows the results of in situ hybridization of P2Y ₂ receptor of esophageal epithelium with (a) control sense probe and (b) antisense probe.

FIG. 2 shows the results of in situ hybridization of P2Y ₂ receptor of esophageal epithelium with (a) control sense probe and (b) antisense probe.

FIG. 3A shows colon ((a) sense probe and (b) antisense probe)
The result of in situ hybridization of the P2Y ₂ receptor of the (colon) epithelium is shown.

FIG. 3b shows colon ((a) sense probe and (b) antisense probe (
The result of in situ hybridization of the P2Y ₂ receptor of the (colon) epithelium is shown.

FIG. 4a shows (a) sense probe and (b) small intestine with antisense probe (
Jejunum) of the epithelium, shows the results of in situ hybridization of the P2Y ₂ receptor.

FIG. 4b shows (a) sense intestine and (b) antisense probe intestine (
Jejunum) of the epithelium, shows the results of in situ hybridization of the P2Y ₂ receptor.

FIG. 5 shows calcium mobilization induced by P2Y receptor agonists in human colon epithelial cells.

FIG. 6 shows calcium mobilization induced by P2Y receptors in HT-29 human colon epithelial cells.

[Procedure amendment]

[Submission date] January 7, 2003 (2003.1.7)

[Procedure Amendment 1]

[Document name to be amended] Statement

[Correction target item name] Full text

[Correction method] Change

[Contents of correction]

Title: Method for treating gastrointestinal tract with purinergic receptor agonist

[Claims]

[Chemical 1] [Where X is oxygen, methylene, difluoromethylene, or imide; n = 0, 1 or 2; m = 0, 1 or 2; n + m = 0, 1, 2, 3, or 4 Z = OH or H; Z '= OH or H; Y = H or OH; Y' = H or OH; The sugar moiety is in the D-configuration or the L-configuration. Nucleoside residues are in the alpha- or beta- and D- or L-configuration;
B and B'are each independently a purine or pyrimidine residue linked through the 9 or 1 position, respectively, as defined in formulas V and VI, respectively;

[Chemical 2] (Where R₁ Is hydrogen, chlorine, amino, monosubstituted amino, disubstituted amino, alkyl
Thio, arylthio, or aralkylthio, where the substituent on the sulfur is
Containing up to 20 carbon atoms which are saturated or not unsaturated; R₂ Is hydroxy, amino, mercapto, alkylthio, arylthio, aral
Kirthio, acylthio, alkyloxy, aryloxy, aralkyloxy,
Acyloxy, monosubstituted alkylamino, heterocyclic monosubstituted cycloalkylamino
, Monosubstituted aralkylamino, monosubstituted arylamino, diaralkylamino, dia
Reel amino, dialkylamino (wherein the alkyl group is optionally N₇ Connected with
Form a substituted ring), acylamino, diacylamino, or NHR_Y And R_X Is O when in the adenine 1-oxide derivative, or adenine derivative.
Not present if in conductor; However, R₂ Is NHR_Y Then R_Y And R_X Together, 1, N⁶ -Ethenoa
May form a 5-membered fused imidazole ring if present in a denine derivative
, Which is optionally at the 4 or 5 position of the etheno moiety, alkyl, aryl or aralkyl
Replaced by a part, as defined below; R₃ Is hydrogen, azide, alkoxy, aryloxy, aral as defined below.
Is alkyloxy, alkylthio, arylthio, or aralkylthio; or ω
-A (C_1-6 Alkyl) OCONH (C_1-6 Alkyl) B- (where A and B are
Independently amino, mercapto, hydroxy or carboxyl); or
Is a pharmaceutically acceptable ester, amide or salt thereof; or is absent
; Here, the substituted derivative of adenine is adenine 1-oxide; 1, N⁶ -(4- or
5-substituted etheno) adenine; 6-substituted adenine; or 8-substituted aminoadenine
Including, Where the R'of the 6- or 8-HNR 'group is: optionally functionalized as described below.
Arylalkyl (C_1-6 ) Group; alkyl; and (
[6-aminohexyl] carbamoylmethyl)-, and ω-acylated-amino (
Hydroxy, thiol and carboxy) alkyl (C_2-10)-And their ω-
Acylated-like amino (hydroxy, thiol and carboxy) derivatives,
Selected from the group consisting of alkyl groups having a functional group therein, wherein the acyl group is
Without limitation, acetyl, trifluoroacetyl, benzoyl, substituted benzoyl
Or the carboxylic acid moiety is its ester or amide derivative
, Eg ethyl or methyl esters or their methyl, ethyl or benzamites
Exist as a derivative and the ω-amino (hydroxy, thiol) moiety is C_{1- Four}  Optionally alkylated with an alkyl group; J is carbon or nitrogen, provided that when J is nitrogen, R₃ Does not exist; Wherein the alkyl group is linear, branched or cyclic; Here, the aryl group is optionally lower alkyl, amino, alkylamino, NO ₂  , N₃ , Carboxylic acids, amides, sulfonamides, or halo groups);

[Chemical 3] (Where R_Four Is hydrogen, hydroxy, oxo, mercapto, amino, cyano, C _7-12 Arylalkoxy, C_1-6 Alkylthio, C_1-6 Alkoxy, C_1-6 Al
Kiramino or di C_1-4 Alkylamino, where the alkyl group is optionally linked.
Combine to form a heterocycle; R_Five Is hydrogen, oxo, acetyl, benzoyl, C_1-6 Alkyl, C_1-5 Alkano
Or aroyl; R₆ Is hydroxy, oxo, mercapto, C_1-4 Alkoxy, C_7-12Arylua
Lucoxy, C_1-6 Alkylthio, amino, S-phenyl, C_1-5 Disubstituted amino,
Triazolyl, C_1-6 Alkylamino or di-C_1-4 Alkylamino, here before
The dialkyl groups are optionally linked to form a heterocycle, or N³ Connected with
Form a ring; or R_Five And R₆ Together with a 5-membered fused imidazo between the 3- and 4-positions of the pyrimidine ring.
Form a ring and 3, N^Four -Forms an etenocytosine derivative, where
The etheno part is optionally C at the 4th or 5th position._1-4 Alkyl, phenyl, or phenyl
Substituted with luoxy; wherein C_1-4 Alkyl, phenyl or phenyloxy
At least one of the hydrogens is optionally halogen, hydroxy, C_1-4 Al
Coxy, C_1-4 Alkyl, C_6-10Aryl, C_7-12Arylalkyl, carboxy
Si, cyano, nitro, sulfonamide, sulfonate, phosphate, sulfonic acid,
Amino, C_1-4 Alkylamino and di-C_1-4 Selected from the group consisting of alkylamino
Optionally substituted by a moiety, wherein the dialkyl group is optionally linked to a heterocycle.
To form; R₇ Is hydrogen, hydroxy, cyano, nitro, and C_2-8 A group consisting of alkenyl
Wherein the alkenyl moiety is optionally linked via oxygen to form a ring.
Forming; where the alkenyl moiety on the carbon adjacent to the oxygen is
At least one hydrogen is C_1-6 Alkyl or phenyl; substituted C_2-8 Archi
Nyl, halogen, substituted C_1-4 Alkyl, CF₃ , C_2-3 Alkenyl, C_2-3 Al
Is it quinyl, allylamino, bromovinyl, ethylpropenoate, or propenoic acid?
Optionally substituted with a substituent selected from the group consisting of; or R₆ And R₇ Together, R₆ Of 5 or 6 members linked via N or O or S
Forming a saturated or unsaturated ring, the ring containing functional groups which themselves contain functionality;
, R₈ R is amino or substituted amino, R₇ Is hydrogen; and R₈ Is hydrogen, amino or di-C_1-4 Alkylamino, C_1-4 Alkoxy, C_7-12A
Reel alkoxy, C_1-4 Alkylthio, C_7-12Arylalkylthio, carbo
Xamidomethyl, carboxymethyl, methoxy, methylthio, phenoxy, and
Selected from the group consisting of phenylthio))]
The method is dinucleoside polyphosphate.

[Chemical 4] [Where X is oxygen, methylene, difluoromethylene, or imide; n = 0, 1 or 2; m = 0, 1 or 2; n + m = 0, 1, 2, 3, or 4 Z = OH or H; Z '= OH or H; Y = H or OH; Y' = H or OH; The sugar moiety is in the D-configuration or the L-configuration. Nucleoside residues are in the alpha- or beta- and D- or L-configuration;
B and B'are each independently a purine or pyrimidine residue linked through the 9 or 1 position, respectively, as defined in formulas V and VI, respectively;

[Chemical 5] (Where R₁ Is hydrogen, chlorine, amino, monosubstituted amino, disubstituted amino, alkyl
Thio, arylthio, or aralkylthio, where the substituent on the sulfur is
Containing up to 20 carbon atoms which are saturated or not unsaturated; R₂ Is hydroxy, amino, mercapto, alkylthio, arylthio, aral
Kirthio, acylthio, alkyloxy, aryloxy, aralkyloxy,
Acyloxy, monosubstituted alkylamino, heterocyclic monosubstituted cycloalkylamino
, Monosubstituted aralkylamino, monosubstituted arylamino, diaralkylamino, dia
Reel amino, dialkylamino (wherein the alkyl group is optionally N₇ Connected with
Form a substituted ring), acylamino, diacylamino, or NHR_Y And R_X Is O when in the adenine 1-oxide derivative, or adenine derivative.
Not present if in conductor; However, R₂ Is NHR_Y Then R_Y And R_X Together, 1, N⁶ -Ethenoa
May form a 5-membered fused imidazole ring if present in a denine derivative
, Which is optionally at the 4 or 5 position of the etheno moiety, alkyl, aryl or aralkyl
Replaced by a part, as defined below; R₃ Is hydrogen, azide, alkoxy, aryloxy, aral as defined below.
Is alkyloxy, alkylthio, arylthio, or aralkylthio; or ω
-A (C_1-6 Alkyl) OCONH (C_1-6 Alkyl) B- (where A and B are
Independently amino, mercapto, hydroxy or carboxyl); or
Is a pharmaceutically acceptable ester, amide or salt thereof; or is absent
; Here, the substituted derivative of adenine is adenine 1-oxide; 1, N⁶ -(4- or
5-substituted etheno) adenine; 6-substituted adenine; or 8-substituted aminoadenine
Including, Where the R'of the 6- or 8-HNR 'group is: optionally functionalized as described below.
Arylalkyl (C_1-6 ) Group; alkyl; and (
[6-aminohexyl] carbamoylmethyl)-, and ω-acylated-amino (
Hydroxy, thiol and carboxy) alkyl (C_2-10)-And their ω-
Acylated-like amino (hydroxy, thiol and carboxy) derivatives,
Selected from the group consisting of alkyl groups having a functional group therein, wherein the acyl group is
Without limitation, acetyl, trifluoroacetyl, benzoyl, substituted benzoyl
Or the carboxylic acid moiety is its ester or amide derivative
, Eg ethyl or methyl esters or their methyl, ethyl or benzamites
Exist as a derivative and the ω-amino (hydroxy, thiol) moiety is C_{1- Four}  Optionally alkylated with an alkyl group; J is carbon or nitrogen, provided that when J is nitrogen, R₃ Does not exist; Wherein the alkyl group is linear, branched or cyclic; Here, the aryl group is optionally lower alkyl, amino, alkylamino, NO ₂  , N₃ , Carboxylic acids, amides, sulfonamides, or halo groups);

[Chemical 6] (Where R_Four Is hydrogen, hydroxy, oxo, mercapto, amino, cyano, C _7-12 Arylalkoxy, C_1-6 Alkylthio, C_1-6 Alkoxy, C_1-6 Al
Kiramino or di C_1-4 Alkylamino, where the alkyl group is optionally linked.
Combine to form a heterocycle; R_Five Is hydrogen, oxo, acetyl, benzoyl, C_1-6 Alkyl, C_1-5 Alkano
Or aroyl; R₆ Is hydroxy, oxo, mercapto, C_1-4 Alkoxy, C_7-12Arylua
Lucoxy, C_1-6 Alkylthio, amino, S-phenyl, C_1-5 Disubstituted amino,
Triazolyl, C_1-6 Alkylamino or di-C_1-4 Alkylamino, here before
The dialkyl groups are optionally linked to form a heterocycle, or N³ Connected with
Form a ring; or R_Five And R₆ Together with a 5-membered fused imidazo between the 3- and 4-positions of the pyrimidine ring.
Form a ring and 3, N^Four -Forms an etenocytosine derivative, where
The etheno part is optionally C at the 4th or 5th position._1-4 Alkyl, phenyl, or phenyl
Substituted with luoxy; wherein C_1-4 Alkyl, phenyl or phenyloxy
At least one of the hydrogens is optionally halogen, hydroxy, C_1-4 Al
Coxy, C_1-4 Alkyl, C_6-10Aryl, C_7-12Arylalkyl, carboxy
Si, cyano, nitro, sulfonamide, sulfonate, phosphate, sulfonic acid,
Amino, C_1-4 Alkylamino and di-C_1-4 Selected from the group consisting of alkylamino
Optionally substituted by a moiety, wherein the dialkyl group is optionally linked to a heterocycle.
To form; R₇ Is hydrogen, hydroxy, cyano, nitro, and C_2-8 A group consisting of alkenyl
Wherein the alkenyl moiety is optionally linked via oxygen to form a ring.
Forming; where the alkenyl moiety on the carbon adjacent to the oxygen is
At least one hydrogen is C_1-6 Alkyl or phenyl; substituted C_2-8 Archi
Nyl, halogen, substituted C_1-4 Alkyl, CF₃ , C_2-3 Alkenyl, C_2-3 Al
Is it quinyl, allylamino, bromovinyl, ethylpropenoate, or propenoic acid?
Optionally substituted with a substituent selected from the group consisting of; or R₆ And R₇ Together, R₆ Of 5 or 6 members linked via N or O or S
Forming a saturated or unsaturated ring, the ring containing functional groups which themselves contain functionality;
, R₈ R is amino or substituted amino, R₇ Is hydrogen; and R₈ Is hydrogen, amino or di-C_1-4 Alkylamino, C_1-4 Alkoxy, C_7-12A
Reel alkoxy, C_1-4 Alkylthio, C_7-12Arylalkylthio, carbo
Xamidomethyl, carboxymethyl, methoxy, methylthio, phenoxy, and
Selected from the group consisting of phenylthio))]
The method is dinucleoside polyphosphate.

[Chemical 7] (Where X ₁ and X ₂ are each independently either O ⁻ or S ⁻ ;
Y is H or OH; R ₁ is O, imido, methylene, and is selected from the group consisting of Jiharomechiren; R ₂ is H, halo, alkyl, substituted alkyl, alkoxy is selected from the group consisting of nitro and azido; R ₃ is selected from the group consisting of H, alkyl, acyl, and arylalkyl;
And R ₄ is selected from the group consisting of -OR ', -SR', NR ', and NR'R ",
Wherein R ′ and R ″ are independently selected from the group consisting of H, alkyl, substituted alkyl, aryl, substituted aryl, arylalkyl, alkoxyl, and aryloxyl, where R ′ is R ₄ is oxygen or Not present if there is a double bond from the sulfur atom to the carbon at the 4-position of the pyrimidine ring);

[Chemical 8] (Wherein R ₁ , X ₁ , X ₂ and Y are defined as in formula Ia; Z is H, Cl, or SR, where R is C ₁ -C ₂₀ saturated or unsaturated alkyl. R ₃ and R ₄ are H, while R ₂ is absent and there is a double bond between N-1 and C-6, or R ₃ and R ₄ are H, R ₂ is O, and there is a double bond between N-1 and C-6, or R ₃ , R ₄ , and R ₂ together are between N-6 and C-6. N- having a double bond in
-CH = CH- forming a ring from 6 to N-1);

[Chemical 9] (Where R ₁ , X ₁ , X ₂ , and Y are defined as in formula Ia; R ₅ and R ₆ are H, while R ₇ is absent, and N-3 and C-4 A double bond is present between them, or R ₅ , R ₆ and R ₇ together are N-3 having a double bond between N-4 and C-4 (3, N ⁴ -ethenocytosine). To -CH = CH- forming a ring of N-4, wherein hydrogen at the 4- or 5-position of the etheno ring is optionally substituted with alkyl, substituted alkyl, alkoxyl, nitro, halo and azide), The method is nucleoside diphosphoric acid.

[Chemical 10] (Where X ₁ and X ₂ are each independently either O ⁻ or S ⁻ ;
Y is H or OH; R ₁ is O, imido, methylene, and is selected from the group consisting of Jiharomechiren; R ₂ is H, halo, alkyl, substituted alkyl, alkoxy is selected from the group consisting of nitro and azido; R ₃ is selected from the group consisting of H, alkyl, acyl, and arylalkyl;
And R ₄ is selected from the group consisting of -OR ', -SR', NR ', and NR'R ",
Wherein R ′ and R ″ are independently selected from the group consisting of H, alkyl, substituted alkyl, aryl, substituted aryl, arylalkyl, alkoxyl, and aryloxyl, where R ′ is R ₄ is oxygen or Not present if there is a double bond from the sulfur atom to the carbon at the 4-position of the pyrimidine ring);

[Chemical 11] (Wherein R ₁ , X ₁ , X ₂ and Y are defined as in formula Ia; Z is H, Cl, or SR, where R is C ₁ -C ₂₀ saturated or unsaturated alkyl. R ₃ and R ₄ are H, while R ₂ is absent and there is a double bond between N-1 and C-6, or R ₃ and R ₄ are H, R ₂ is O, and there is a double bond between N-1 and C-6, or R ₃ , R ₄ , and R ₂ together are between N-6 and C-6. N- having a double bond in
-CH = CH- forming a ring from 6 to N-1);

[Chemical 12] (Where R ₁ , X ₁ , X ₂ , and Y are defined as in formula Ia; R ₅ and R ₆ are H, while R ₇ is absent, and N-3 and C-4 A double bond is present between them, or R ₅ , R ₆ and R ₇ together are N-3 having a double bond between N-4 and C-4 (3, N ⁴ -ethenocytosine). To -CH = CH- forming a ring of N-4, wherein hydrogen at the 4- or 5-position of the etheno ring is optionally substituted with alkyl, substituted alkyl, alkoxyl, nitro, halo and azide), The method is nucleoside diphosphoric acid.

Detailed Description of the Invention

This application is incorporated by reference in its entirety in 1999, 1
It claims priority to US Provisional Application No. 60 / 171,710, filed February 22.

TECHNICAL FIELD The present invention relates to purinergic receptor agonists such as some uridines, adenines,
Alternatively, it relates to a method of controlling mucus secretion and fluid transport in the gastrointestinal system of a patient by administering cytidine 5'-di- and triphosphates, dinucleoside polyphosphates and analogs thereof.

[0003] Secretion of mucin in the background gastrointestinal system of the present invention, the amount of secretion of bicarbonate, and / or be allowed to increase the degree of hydration there are many therapeutically desirable situation. The gastrointestinal system is primarily responsible for extracting the basic elements of energy and metabolism from the presented nutritional material. The digestive tract includes the oral cavity (mainly salivary glands), esophagus, stomach, small intestine, large intestine, rectum, and auxiliary organs (pancreas, liver and gallbladder). Diseases such as dry mouth, gastroesophageal reflux disease, peptic ulcers, and inflammatory bowel disease occur when the mucosal barrier of the digestive tract is compromised. Abnormal fluid and electrolyte transport in the lower gastrointestinal tract results in diseases such as constipation and diarrhea.

Mucus is a viscous material that coats many epithelial surfaces and is secreted into liquids such as saliva. It is mainly composed of mucin and inorganic salts suspended in water. Mucus adheres to many epithelial surfaces where it acts as a diffusion barrier against contact with harmful substances such as gastric acid, digestive enzymes and bacteria, and as a lubricant to minimize shear stress. Such mucus coatings are particularly prominent on the epithelium of the gastrointestinal tract, respiratory tract and reproductive tract. Mucus is also an abundant and important ingredient in saliva, giving it virtually unmatched lubricating properties. Mucus-secreting cells, such as goblet cells, are abundant in the epithelium of the gastrointestinal tract. Many submucosal mucous glands are distributed along the esophagus, and are clustered especially above the lower and upper parts of the esophageal sphincter. Many acinar epithelial cells in the salivary glands secrete mucus. The major structural molecule of the mucus layer is mucin, which is a large, heavily glycosylated family of proteins. The thick "sugar coating" of mucins gives them considerable water retention capacity and confers on them resistance to proteolysis, which seems to be most important for maintaining the mucosal barrier.

[0005] Secretion of bicarbonate plays an important role in maintaining mucosal health in the gastrointestinal tract. The production of bicarbonate and mucus by the esophagus to local acidification provides a unique mechanism for withstanding acid-induced damage. Secretion of salivary protective factors such as bicarbonate, as well as bicarbonate secreted by the esophageal submucosa, is important in preventing esophageal mucosal damage associated with gastroesophageal reflux disease. Mucosal bicarbonate also provides an important mechanism for protection against acid damage in the proximal duodenum, and viscous mucus provides a stable mucosal bicarbonate-supported superficial neutralization of acid. Providing a protective layer [Nucleotides stimulate bicarbonate secr
etion in guinea pig pancreatic duct (Ishiguro et al. 1999, J. Physiol, 51
9 Pt 2: 551-558) and CFTR Knockout mouse gall bladder epithelium (Clark
e et al. 2000, Am.J.Physiol.Gastrointest.Liver Physiol. 279: G132-138)]
.

Proper control of the absorption of fluids and electrolytes in the proper regions along the gastrointestinal system is required for normal digestive function. Fluid transport dysfunction results in various disorders such as constipation and diarrhea. Constipation is associated with delayed delivery of feces through the large intestine. Increasing fecal sedentary time in the large intestine results in increased absorption of fluid by the epithelium of the colon, and leads to fecal dehydration and subsequent production of dry, hard feces in the descending colon. In contrast, diarrhea results from the rapid movement of feces through the large intestine, which results from either increased secretion of liquid in the small intestine or decreased absorption of liquid in the colon.

Dry mouth is commonly known as dry mouth and results from insufficient saliva production. Dry mouth is caused by radiation treatment or disease that damages the salivary glands and reduces salivary flow. Gastroesophageal reflux disease is a symptom of greater than normal exposure of the esophageal mucosa to the contents of the stomach. The most common sign is heartburn. Pharmacological treatments include H2 antagonists (eg Tag
amet ™, Zantac ™, Pepcid ™, Axid (
)) And proton pump inhibitors such as Prilosec ™ or Pr.
Includes the use of evacid ™ for the treatment of acute illness. Peptic ulcer disease includes gastric ulcer, pyloric channel ulcer and duodenal ulcer. Ulceration is caused by complex interactions of acids and chronic inflammation induced by Helicobacter pylori infection. Patients with duodenal ulcers have a high acid secretion. Increased acid secretion leads to changes in the wall of the duodenum, which is due to H.
It sets the stage for invasion by H. pylori. Agents for treating peptic ulcers include histamine-2 (H2) blockers (Tagamet ™, Zant).
ac (TM), Axid (TM), Pepcid (TM), etc.), sucralfate, proton pump inhibitors, and antacids. Inflammatory bowel disease is divided into two types: ulcerative colitis and Crohn's disease. Ulcerative colitis acts on the colon / rectum and involves the mucosal or deepest lining of the colon wall. Crohn's disease is a full-thickness disease involving all layers of the intestine, and can involve any part of the intestine from the mouth to the anus. Medical treatments for inflammatory bowel disease include aminosalicylate and corticosteroids. Corticosteroids are virtually long-term toxic. As an alternative to conventional therapies, laboratories in the medical community are seeking to develop new treatments for gastrointestinal disorders.

The following references disclose the role of mucus integrity and mucin secretion in several diseases of the gastrointestinal tract. Rhodes et al. (Gut, 26: 1312-1318 (1985)) found that the mucosa of the colon undergoes continuous desulfurization and desialation in vivo as a result of fecal enzymatic activity; altered colonic mucous gut. It has been suggested that susceptibility may be important in the etiology of colonic disease. Somasundaram etc. (Clin.Exp.Pharmacol.Physiol
., 14: 309-318 (1987)), the integrity of the gastric mucosa and its ability to secrete mucus,
It is reported to be essential for the protection of the gastric mucosa against aggressive agent-induced ulcers in some stress situations. Desai et al. (J. Pharm.
Pharmacol. 47: 734-738 (1995)) showed that a specific dopamine D1 receptor agonist, SKF38393, was effective in protecting rat gastric and duodenal ulcers. Sarosiek et al. (Digestion, 56 Sappl. 1: 10-23 (199
5)) reported that the secretion rate of esophageal mucin, EGF and PGE2 under the influence of HC1 / pepsin was significantly reduced in patients with reflux esophagus. Saitoh et al. (Dig.Dis.Sci. 41: 1768-1774 (1996)) found that the total mucin production from patients with ulcerative colitis was higher than that of healthy subjects due to neutral mucin. Low, whereas those from patients with Crohn's disease showed higher due to higher molecular weight mucins. Sarosiek et al. (Gastroenterology, 110: 675-681 (1996)
), Suggests that the secretion rate of inorganic and organic protective components in saliva may be useful in the treatment of gastroesophageal reflux disease. Zeeh (Gastroenterology, 110: 1077-1083
(1996)) reported that administration of keratinocyte growth factor ameliorates mucosal damage in an experimental colitis model in rats. Abbas et al. (Indian J.Exp.Bio
l. 36: 182-186 (1998)) show that the antiulcerative effects of GABA and baclofen are their dominant anti-mucosal defense factors, such as increased mucin secretion and reduced cellular opening or mucosal damage. It is reported that it may be caused by the action. Nath et al. (Clin.Exp
Pharmacol. Physiol. 25: 564-567 (1998)) shows that polyriboinosinic acid-polyribocytidylic acid has a strong anti-gastric ulcer effect on rats;
It is reported that polyribocytidylic acid was shown to cause an increase in total free acid and pepsin as well as an increase in mucin content in Shay rats. Newton et al. (Gut, 43: 470-475 (1998)) H. It has been reported that Helicobacter pylori causes structural changes in the viscous gastric mucosal layer in vivo, but the mucus barrier thickness is not compromised.

The following references disclose compositions of purinergic receptor agonists and / or treatment of diseases. Uridine 5'-triphosphate has been shown to increase both the rate and total amount of mucin secretion by goblet cells in vitro (Lethem et al.
al., Am. J. Respir. Cell Mol. Biol., 9: 315-322 (1993)). USPN 5,90
0,407 (Yerxa et al.) Discloses a method of stimulating tear secretion in a subject in need of treatment. The method comprises purine receptor agonists such as uridine 5'-triphosphate, cytidine 5'-triphosphate, adenosine 5 on the surface of the subject's eye.
It comprises administering'-triphosphate, or analogs and derivatives thereof, in an amount effective to stimulate the secretion of tears. USPN 5,837,861 (Penderga
st et al.) is of formula I, wherein X is oxygen, methylene, or difluoromethylene; n = 0 or 1, m = 0 or 1, and n + m = 0, 1 or 2. And B and B'are each independently a purine residue or a pyrimidine residue linked via the 9 or 1 position);
2Y ₂ purinergic receptors are disclosed. The compounds are useful in the treatment of chronic obstructive pulmonary disease, bronchitis, certain pneumonia, cystic fibres, sinusitis, and otitis media. USPN 5,763,447 (Jacobus et al.) Discloses a method of promoting the excretion of mucosal secretions in the occluded airways of immobile patients. The method involves uridine phosphate, such as uridine 5'-triphosphate (UT), to the respiratory tract of a patient.
P), or P ¹ , P ⁴ -di (uridine-5 ′) tetraphosphate, by hydrating mucosal secretions or by stimulating contraction frequency of cilia in the respiratory tract.
Administering in an amount effective to promote drainage of the occluded airways, eg, sinuses. USPN 5,789,391,5,981,506,5
972,904 and 5,958,897 describe a method of promoting drainage of clogged mucosal secretions in the sinuses of a subject in need. The method involves applying uridine phosphate, such as uridine 5'-triphosphate (UTP), to the subject's sinuses.
) Or P ¹ , P ⁴ -di (uridine-5 ′) tetraphosphate, an analogue of UTP, or any other analogue, by hydrating the secretions of the mucosa or of cilia in the sinuses. Comprising administering in an amount effective to promote drainage of the sinus-filled fluid by stimulating contraction frequency. USPN 5,968,913 describes a pharmaceutical composition for use in promoting increased clearance of mucociliary secretions of retained mucous membranes of the respiratory tract, middle / inner ear or sinuses of humans. There is. USP
N 5,763,447 describes a method of preventing or treating pneumonia, such as ventilator-associated pneumonia, in bedridden or immobile patients in need of treatment. The method involves uridine phosphate, such as uridine 5′-triphosphate (UTP), P ¹ , P ⁴ -di (uridine-5 ′) tetraphosphate, to the respiratory tract of a patient.
Or administering the analogs thereof in an amount effective to promote the elimination of liquid in the occluded airways. WO 99/09998 discloses methods of using uridine 5'-diphosphate and its analogs for treating lung diseases. The above cited documents ('391,' 506, '904,' 897, '913 and'447
Patents and WO 99/09998), which have purine receptor activity, are incorporated herein by reference. USPN 5,733,91
6 (Neely) is a selective A ₁ adenosine receptor antagonist and / or P ₂ X
Disclosed are methods of preventing or treating ischemia-reperfusion injury or endotoxin-related lung injury by administering a composition comprising a purinoceptor antagonist. Somers
Et al. (Laboratory Investigation, 78: 1375-1383 (1998)) showed that the P2Y ₆ receptor was highly expressed in T cells infiltrating active inflammatory bowel disease, while P
Expression of 2Y _6, in T cells unaffected have reported that there was no.
Boyer et al. (Br.J.Pharmacol. 118: 1959 (1996)) described phospholipase C-binding P2Y purinoceptor of turkey erythrocyte membrane, adenyl cyclase-binding P2Y purinoceptor of C6 rat glioma cells, and 1321N1 human. Synthesis and testing of a series of chain-extended 2-thioether derivatives of adenosine monophosphate (AMP) as agonists for activation of cloned human P2U receptors, which are stably expressed in astrocytoma cells did.

Other specific dinucleoside phosphate compounds known in the prior art are:
List along with their corresponding references. These compounds have not been used in the prior art to increase mucus secretion or normalize fluid and electrolyte imbalances in the gastrointestinal tract, and applicants intend to include them in the present invention. is doing.

[Table 1]

[Table 2]

P2Y purinergic receptors are receptors for purine and pyrimidine nucleotides that couple to G proteins; they are proteins of 308-377 amino acids with a molecular weight of 41-53 kDa after glycosylation. P2Y receptors, such as P2Y ₁ , P2Y ₂ and P2Y ₆ receptors, are present in the gastrointestinal tract (Ralevic et al.
al., Pharm. Rev. 50: 415-492 (1998)). Inside and around the eyes (USPN 5,
900, 407), and the proven ability of purinergic receptors to stimulate mucus / mucin secretion in the lungs and sinuses, Applicants have determined that the P2Y purinergic receptor ligands produce mucus and / or mucin secretions. , And normalize abnormal fluid transport in the gastrointestinal tract, resulting in incentives to study whether it is effective in treating diseases and disorders of the upper and lower gastrointestinal tract.

Applicants have discovered that all P2Y receptors, such as P2Y ₄ and P2Y _11, are present in tissues of the gastrointestinal tract. Applicants have further discovered that mucus and mucin secretion, bicarbonate secretion, and fluid transport in these tissues can be regulated via mechanisms that mediate P2Y purinergic receptors. Orally or systemically administered P2Y purinergic receptor ligands provide a novel method of treating gastrointestinal disorders.

SUMMARY OF THE INVENTION The present invention provides methods for controlling mucus / mucin secretion and fluid transport in the gastrointestinal tract. The present invention provides methods for treating gastrointestinal disorders in which the mucosal barrier of the gastrointestinal system is impaired. The present invention further provides methods for normalizing disorders of fluid secretion or absorption in the gastrointestinal tract that cause either diarrhea or constipation. The method comprises administering to the patient a pharmaceutical composition comprising a purinergic P2Y receptor ligand in an amount effective to control mucus / mucin secretion and fluid transport in the gastrointestinal tract. Administration methods include oral and systemic administration.
Diseases to be treated include diseases and disorders of the oral cavity, esophagus, stomach, small intestine, large intestine, rectum, and auxiliary organs such as the pancreas, liver and gallbladder.

The pharmaceutical composition used in the present invention comprises a P2Y purinergic receptor agonist. P2Y agonists increase water, bicarbonate and mucin secretion in the mucosal epithelium of the gastrointestinal tract. P2Y agonists are uridine 5'-di and triphosphates (UDP,
UTP) and their analogs (formula Ia and Ib), adenosine 5'-monophosphate (AMP) and its analogs, adenosine 5'-di- and triphosphate (ADP, ATP) and their analogs (formulas IIa and IIb), cytidine 5′-di and triphosphates (CDP, CTP) and their analogs (formula IIIa and IIIb), and dinucleoside polyphosphate compounds (general formula IV).

[0015] SUMMARY OF THE INVENTION The Detailed Description of the Invention The present invention is the secretion of mucous in the gastrointestinal tract, secretion of bicarbonate, and a method of controlling the transport of the liquid. The present invention provides a method for treating gastrointestinal disorders in which the mucosal barrier of an organ is impaired and the imbalance of fluid absorption of secretions occurs in the small and large intestines. The method comprises administering to a mammal a pharmaceutical composition comprising a purinergic P2Y receptor ligand in an amount effective to control mucus or mucin secretion, bicarbonate secretion, or liquid transport in the gastrointestinal tract. Comprising administering. The method enhances mucin release, pH and hydration, or controls fluid transport in the gastrointestinal tract.

Gastrointestinal disorders suitable for treatment according to the present invention include those diseases or disorders affecting the oral cavity (mainly salivary glands), esophagus, stomach, small intestine, large intestine, rectum, and auxiliary organs such as the pancreas, liver and gallbladder. Including. For example, dry mouth, stomatitis, periodontal disease, esophageal reflux disease, peptic ulcer, inflammatory bowel disease (ulcerative colitis and Crohn's disease), mycosis, diarrhea and constipation can be treated by the present invention. In addition, problems associated with cystic fibrosis disease, such as reduced absorption of nutrients by dry mucin and epithelial cells of the gastrointestinal tract, can also be treated by the present invention. In addition, gastrointestinal problems caused by cancer and chemotherapy can also be treated by this method.

Mucin has been shown to be important in protecting mucosal surfaces from environmental exposure; it has been shown to act as an acid barrier and to bind pathogens. Mucin is thus part of the body's natural mucosal defense system, and stimulation of its secretion appears to lead to protection of the mucosal superficial epithelium. The method of the present invention is
It increases mucosal secretions in the gastrointestinal tract, for example the stomach and esophagus, thus enhancing the natural defense system.

The epithelial lining of the human esophagus acts as a natural barrier between the lumen and blood and as a protective lining against physical perturbations of the input food and against acidic gastric juice from the stomach. It consists of working squamous epithelium and submucosal glands. The esophageal submucosa includes mucosa, serum, and myoepithelial cell types. The submucosal glands of the respiratory tract and conjunctiva are located in the mucosal epithelium of the esophagus.
Includes the 2Y ₂ receptor. Activation of the P2Y ₂ receptor by natural and synthetic agonists is
Increases mucus secretion into the mucosal layer of the respiratory tract and its hydration.

Various pathophysiological conditions result in the erosion of the protective mucosal barrier of the respiratory tract, resulting in gastroesophageal reflux disease (GERD). Symptoms of GERD include mild to severe heartburn and esophageal inflammation (
Esophagitis), reflux, swallowing, and chest pain. GERD is caused by a variety of factors, including dysfunction of the lower esophageal sphincter (which causes gastric juice to reflux into the lower esophagus), delayed fasting, decreased esophageal clearance, and reduced salivation. When the esophagus is exposed to high acid contents during reflux of gastric juice, a disruption of the protective mucosal layer occurs. The present invention relates to the destruction of esophagus in an animal model of esophagitis, in which a P2Y ₂ receptor agonist spontaneously stimulates mucin, bicarbonate, and liquid production by squamous epithelium and / or submucosa. It is disclosed that the health of the mucosal layer can be restored.

Gastric ulcer and gastric reflux are conditions characterized in part by disruption of the mucosal barrier of the upper gastrointestinal epithelium. Excessive acid secretion in the stomach can result in the breakdown of the natural mucus layer, which protects epithelial cells from acid damage. Gastric ulcers include, but are not limited to stress, diet, H. It is associated with H. pylori infection, chemotherapy or radiation therapy, other autoimmune diseases such as Sjogren's syndrome, surgery, psychosomatic disorders, stress, anxiety, and pharmacological drug-related side effects.

The Lieberkuhn crypts along the small intestine play an important role in mediating the secretion of fluid into the lumen of the small intestine. Chloride efflux along these crypts, through apical membrane chloride channels located in the apical membrane of epithelial cells, provides a driving force for the osmotically required secretion of fluid in the small intestine. Constipation and diarrhea result from abnormal fluid transport (absorption vs. secretion) through the small and large intestine. The present invention discloses methods of normalizing fluid transport imbalances leading to either constipation or diarrhea by targeting activation of P2Y receptors along the small and large intestine. Upon exposure to pathological conditions such as cholera toxin, apical chloride channels are constitutively active, resulting in uncontrolled fluid secretion into the small intestine, extreme diarrhea, and fatal systemic dehydration. Lead the state. This observation provided a scientific rationale for treating constipation and diarrhea.

Activation of chloride and fluid secretions through the small intestine is known to provide additional fluid to the chimes before becoming fecal in the large intestine. The addition of liquid to this Chimes thus offsets the excessive absorption of liquid in the large intestine, which leads to constipation. The present invention provides that the activation of P2Y receptors by agonists provides a mechanism that provides such an increase in chloride and fluid secretion into the small intestine and can be used therapeutically to treat constipation. Is disclosed.

The colonic epithelium of the large intestine normally functions to absorb fluid and remove it from invading chyme from the small intestine and convert it into feces. Diarrhea results from excess fluid of Chimes during entry, or malabsorption of fluid through the colon. Liquid absorption along the colonic epithelium is mediated by sodium absorption through the apical membrane sodium channels and basolateral membrane sodium-potassium transporters. The liquid absorption properties of this epithelium can be electromodulated by calcium-activated potassium channels in the basolateral membrane. Increased basolateral membrane potassium conductivity hyperpolarizes the apical and basolateral membranes, and consequently increases the electromotive force for sodium influx across the apical membrane. This results in a concomitant increase in sodium and potassium absorption by the epithelium and increases absorption of ion-coupled liquids. The present invention discloses that activation of the P2Y purinoceptor by an agonist increases basolateral membrane potassium conduction and facilitates removal of fecal-derived fluid. Therefore, direct administration of P2Y receptor agonists can be used therapeutically to treat diarrhea.

[0024]   The present invention regulates mucus / mucin secretion, hydration and fluid transport in the gastrointestinal tract.
Comprising administering to the patient a pharmaceutical composition comprising: This method is commonly used in other
It has advantages over the treatments used. The method involves the production of mucus by the patient himself.
Control secretion and mucosal hydration levels. Thus, the method is a gastrointestinal system
Maintains the membrane's natural protective and lubricious properties and results from mucus dysfunction
Address the issue directly. The present invention relates primarily to the treatment of human subjects, but in veterinary
May be applied to the treatment of other mammalian subjects, such as dogs and cats, for various purposes.
It Applicants have (a) identified many purinergic P2Y receptors (P2Y₁, P2Y₂, P2Y _Four , P2Y₆, And P2Y₁₁) Is gastrointestinal tissue, eg salivary gland, esophagus, stomach, small intestine, colon
(B) potent purinergic receptor agonists are present in the lung, duodenum, and rectum;
It increases the secretion of insulin and regulates the transport of fluids in the mucosal epithelium of the gastrointestinal tract.
I found it.

P2Y agonists include nucleoside monophosphates, diphosphates, and triphosphates and dinucleoside polyphosphates. Nucleoside monophosphates useful in the present invention include adenosine 5'-monophosphate (AMP) and variants thereof, such as 2-thioether substituted AMPs such as 2-hexylthio AMP (Br. J. Pharmacol. 118: 1959 ( 1996)) is included. Nucleoside diphosphates and triphosphates useful in the present application include uridine 5
'-Diphosphate and triphosphate (UDP and UTP) and their analogs of general formula Ia and Ib; adenosine 5'-diphosphate and triphosphate (ADP and ATP) and general formula IIa and
IIb and their analogs; and cytosine 5'-diphosphate and triphosphate (CDP and CT
P) and their analogs of general formula IIIa and IIIb.

[0026]   UDP and its analogs have the formula Ia

[Chemical 13] (Where X ₁ and X ₂ are each independently either O ⁻ or S ⁻ ;
Y is H or OH; R ₁ is O, imido, methylene, and Jiharomechiren (e.g., dichloromethylene, difluoromethylene) is selected from the group consisting of; R ₂ is H, halo, alkyl, substituted alkyl, alkoxyl, nitro R ₃ is selected from the group consisting of absent H, alkyl, acyl (including arylamyl), and arylalkyl; and R ₄ is —OR ′, —SR ′, NR ′, And NR′R ″,
Wherein R ′ and R ″ are independently selected from the group consisting of H, alkyl, substituted alkyl, aryl, substituted aryl, arylalkyl, alkoxyl, and aryloxyl, where R ′ is R ₄ is oxygen or It is not present if it is a double bond from a sulfur atom to the carbon at the 4-position of the pyrimidine ring).

As used herein, the term “alkyl” refers to C _1-10 generic straight chain, branched chain, or cyclic, saturated or unsaturated (ie alkenyl and alkynyl) hydrocarbon chains such as methyl. , Ethyl, propyl, isopropyl, butyl, isobutyl, tert
-Butyl, pentyl, hexyl, octyl, ethenyl, propenyl, butenyl,
Pentenyl, hexenyl, octenyl, butadienyl, propynyl, butynyl,
Mention is made of pentynyl, hexynyl, heptynyl, allenyl, and optionally substituted arylalkenyl and arylalkynyl groups. As used herein,
The term "acyl" refers to an organic acid group (-OH of a carboxyl group substituted with another substituent (
That is, those represented by RCO-, where R is an alkyl or aryl group. Thus, the term "acyl" specifically includes arylacyl groups. Specific examples of acyl groups include acetyl and benzoyl. As used herein, the term "aryl" refers to 5 and 6 membered hydrocarbon and heterocyclic aromatic rings. Specific examples of aryl groups include, but are not limited to, cyclopentadienyl, phenyl,
It includes furan, thiophene, pyrrole, pyran, pyridine, imidazole, isothiazole, isoxazole, pyrazole, pyrazine, pyrimidine and the like. The term “alkoxyl” as used herein includes C _1-10 generic straight chain, branched chain, or cyclic, saturated or unsaturated oxo-hydrocarbon chains such as methoxy, ethoxy, propoxy, Reference is made to isopropoxy, butoxy, t-butoxy, and pentoxy. The term “aryloxy” as used herein refers to aryloxy, such as phenyloxyl, and alkyl, halo, or alkoxyl substituted aryloxyl. As used herein, the terms "substituted alkyl" and "substituted aryl", as defined herein, are such that one or more atoms or functional groups of the aryl and alkyl groups are different atoms or functional groups, such as Halogen, aryl, alkyl,
Includes alkoxy, hydroxy, nitro, amino, alkylamino, dialkylamino, sulfate, and mercapto substituted alkyl and aryl groups. the term"
“Halo”, “halide”, or “halogen” as used herein refers to fluoro, chloro, bromo, and iodo groups.

Exemplary compounds of formula (Ia) include those disclosed in WO99 / 09998, incorporated herein by reference. The compound of formula Ia is, for example, uridine 5'-diphosphate (UDP); uridine 5'-O- (thiodiphosphate) (UDPβS); 5-bromouridine 5'-diphosphate (5-BrUDP); 5- (1-phenylethynyl) -uridine 5'-diphosphate (5- (1-phenylethynyl) UDP); 5-methyluridine 5'-diphosphate (5-methylUDP); 4-hexylthiouridine 5'diphosphate (
4-hexylthio UDP); 4-mercaptouridine 5'-diphosphate (4-mercapto UDP); 4-methoxyuridine 5'-diphosphate (4-methoxy UDP); 4- (
N-morpholino) uridine 5'-diphosphate (4- (N-morpholino) UDP; 4-hexyloxyuridine 5'-diphosphate (4-hexyloxy UDP); N, N-dimethylcytidine 5'-di Phosphoric acid (N, N-dimethyl CDP); N-hexyl cytidine 5'-diphosphate (N-hexyl CDP); and N-cyclopentyl cytidine 5'-diphosphate (N-cyclopentyl CDP).

Preferred compounds of formula Ia include UDP and UDPβS and 4-thioUDP. Some compounds of formula Ia (eg UDP, dUDP, UDPβS, and 4-mercapto UDP) are known and can be made according to known methods or modifications thereof known to those skilled in the art. For example, some thiophosphate analogs of nucleoside diphosphate (
For example, the identification and preparation of UTPβ-S) is described in US Pat. No. 3,846,402 (Ecks
tein et al.) and RS Goody and Eckstein, J. Am. Chem. Soc. 93: 6252-6257.
(1971). Alternatively, UDP, and other analogs thereof,
Commercially available, for example, from Sigma (St. Lousi, MO) and Pharmacia (Uppsala, Sweden).

[0030]   UTP and its analogs have the general formula Ib;

[Chemical 14] (Wherein X ₁ , X ₂ and X ₃ are independently O ⁻ or S ⁻ , Y is H or OH; R ₁ , R ₂ , R ₃ and R ₄ are defined as in formula Ia. Will be represented).

Preferably X ₂ and X ₃ are O ⁻ , R ₁ is oxygen or imide and R ₂ is H
Is. Particularly preferred compounds of formula Ib include uridine 5'-triphosphate (UTP) and uridine 5'-O- (3-thiophosphate) (UTPγS).

[0032]   ADP and its analogs have the general formula IIa;

[Chemical 15] (Wherein R ₁ , X ₁ , X ₂ and Y are defined as in formula Ia; Z is H, Cl, or SR, where R is alkyl (C ₁ -C ₂₀ saturated or unsaturated). R ₃ and R ₄ are H, while R ₂ is absent and there is a double bond between N-1 and C-6 (adenine), or R ₃ and R ₄ are H, while R ₂ is absent, and Z is SR, or R ₃ and R ₄ are H, while R ₂ is O, and N-1 and C-6 (adenine 1- A double bond is present between the oxidase) and R ₃ , R ₄ and R ₂ together form N-6 and C-6 (1, N 6 -ethenoadenine).
Is a -CH = CH- forming a ring from N-6 to N-1 having a double bond between and.

Particularly preferred compounds of formula IIa include 5′-adenosine diphosphate (ADP) and 2-methyl-SADP.

[0034]   ATP and its analogs have the general formula IIb:

[Chemical 16] (Wherein R ₁ , X ₁ , X ₂ , X ₃ and Y are defined as in formula Ib and R ₂ , R ₃ , R ₄ and Z are defined as in formula IIa). It

[0035]   A preferred compound of formula IIb comprises 5'-adenosine triphosphate (ATP).

[0036]   CDP and its analogs have the general formula IIIa:

[Chemical 17] (Where R ₁ , X ₁ , X ₂ and Y are defined as in formula Ia; R ₅ and R ₆ are H, while R ₇ is absent and N-3 and C-4 A double bond exists between (C) (cytosine) or R ₅ , R ₆ and R ₇ together form a double bond between N-4 and C-4 (3, N ⁴ -ethenocytosine). -CH = CH-, which forms a ring from N-3 to N-4 having a bond, wherein hydrogen at the 4- or 5-position of the etheno ring is alkyl, substituted alkyl, aryl,
Substituted aryl (such as heteroaryl), alkoxyl, nitro, halo, or azido substituted).

[0037]   CTP and its analogs have the general formula IIIb:

[Chemical 18] (Wherein R ₁ , X ₁ , X ₂ , X ₃ and Y are defined as in formula Ib, and R ₅ , R ₆ and R ₇ are defined as in formula IIIa). .

Preferred compounds of formula IIIb are cytidine-5′-triphosphate (CTP) and 4-
Contains nitrophenylethenocytidine 5'-triphosphate.

For simplicity, Formulas I, II, and III herein refer to active compounds in the natural D configuration, but the present invention further refers to compounds in the L configuration, and D unless otherwise indicated. And mixtures of L configurations. The natural D configuration is preferred.

[0040]   P2Y agonists also have the general formula (IV):

[Chemical 19] (Where X is oxygen, methylene, difluoromethylene, or imide; n = 0, 1 or 2; m = 0, 1 or 2; n + m = 0, 1, 2, 3, or 4 Z = OH or H; Z '= OH or H; Y = H or OH; Y' = H or OH).

Although the sugar moieties are shown in the D configuration, they may be L or D and L. The D configuration is preferred. Nucleoside residues may be in the alpha or beta and D or L configurations, but are most preferably in the beta-D-configuration.

B and B ′ are each independently a purine residue or a pyrimidine residue as defined in formulas V and VI, respectively, attached through the 9 or 1 position, respectively.

[Chemical 20] [(Where R₁ Is hydrogen, chlorine, amino, monosubstituted amino, disubstituted amino, alkyl
Is ruthio, arylthio, or aralkylthio, wherein the substituent on sulfur is
Containing up to 20 carbon atoms, which may or may not be unsaturated; R₂ Is hydroxy, amino, mercapto, alkylthio, arylthio, aral
Kirthio, acylthio, alkyloxy, aryloxy, aralkyloxy,
Acyloxy, monosubstituted alkylamino, heterocyclic-substituted cycloalkylamino
, Monosubstituted aralkylamino, monosubstituted arylamino, diaralkylamino, dia
Reel amino, dialkylamino (wherein the alkyl group is optionally N₇ Connected with
Form a substituted ring), acylamino, diacylamino, or NHR_Y And R_X Is O (adenine 1-oxide derivative) or absent (adenine derivative).
conductor); However, R₂ Is NHR_Y Then R_Y And R_X Together with the five-member fusion imidazo
Ring (1, N⁶ -Ethenoadenine derivative), which is optional
At the 4 or 5 position of the etheno moiety by an alkyl, aryl or aralkyl moiety
, Replaced as defined below; R₃ Is hydrogen, azide, alkoxy, aryloxy, aral as defined below.
Is alkyloxy, alkylthio, arylthio, or aralkylthio; or ω
-A (C_1-6 Alkyl) OCONH (C_1-6 Alkyl) B- (where A and B are
Independently amino, mercapto, hydroxy or carboxyl); or
Is a pharmaceutically acceptable ester, amide or salt thereof; or is not present
I). Thus, the substituted derivative of adenine is adenine 1-oxide; 1, N⁶ -(4-Mata
Is 5-substituted etheno) adenine; 6-substituted adenine; or 8-substituted aminoadenine
Including, Where the R'of the 6- or 8-HNR 'group is: optionally functionalized as described below.
Arylalkyl (C_1-6 ) Group; alkyl; and (
[6-aminohexyl] carbamoylmethyl)-, and ω-acylated-amino (
Hydroxy, thiol and carboxy) alkyl (C_2-10)-And their ω-
Acylated-like amino (hydroxy, thiol and carboxy) derivatives,
Selected from the group consisting of alkyl groups having a functional group therein, wherein the acyl group is
Without limitation, acetyl, trifluoroacetyl, benzoyl, substituted benzoyl
Or the carboxylic acid moiety is derived from its ester or amide.
Body, eg ethyl or methyl ester or its methyl, ethyl or benzua
It exists as a amide derivative. ω-amino (hydroxy, thiol) moiety is C_1-4 
May be alkylated with an alkyl group. J is carbon or nitrogen, provided that when J is nitrogen, R₃ Does not exist; Wherein the alkyl group is linear, branched or cyclic; Here, the aryl group is optionally lower alkyl, amino, alkylamino, NO ₂  , N₃ , Carboxylic acids, amides, sulfonamides, or halo groups);
And B and B ′ further have the general formula of formula VI linked to the ribosyl residue via the 1-position
May be pyrimidine]

[Chemical 21] (Where R_Four Is hydrogen, hydroxy, oxo, mercapto, amino, cyano, C _7-12 Arylalkoxy, C_1-6 Alkylthio, C_1-6 Alkoxy, C_1-6 Al
Kiramino or di C_1-4 Alkylamino, where the alkyl group is optionally linked.
Combine to form a heterocycle; R_Five Is hydrogen, oxo, acetyl, benzoyl, C_1-6 Alkyl, C_1-5 Alkano
Or aroyl; R₆ Is hydroxy, oxo, mercapto, C_1-4 Alkoxy, C_7-12Arylua
Lucoxy, C_1-6 Alkylthio, amino, S-phenyl, C_1-5 Disubstituted amino,
Triazolyl, C_1-6 Alkylamino or di-C_1-4 This is alkylamino
Here, the dialkyl group is optionally linked to form a heterocycle, or³ Connected with
To form a substituted ring; or R_Five And R₆ Together with a 5-membered fused imidazo between the 3- and 4-positions of the pyrimidine ring.
Form a ring and 3, N^Four -Forms an etenocytosine derivative, where
The etheno part is optionally C at the 4th or 5th position._1-4 Alkyl, phenyl, or phenyl
Substituted with luoxy; wherein C_1-4 Alkyl, phenyl or phenyloxy
At least one of the hydrogens is optionally halogen, hydroxy, C_1-4 Al
Coxy, C_1-4 Alkyl, C_6-10Aryl, C_7-12Arylalkyl, carboxy
Si, cyano, nitro, sulfonamide, sulfonate, phosphate, sulfonic acid,
Amino, C_1-4 Alkylamino and di-C_1-4 Selected from the group consisting of alkylamino
Optionally substituted by a moiety, wherein the dialkyl group is optionally linked to a heterocycle.
To form; R₇ Is hydrogen, hydroxy, cyano, nitro, and C_2-8 A group consisting of alkenyl
Wherein the alkenyl moiety is optionally linked via oxygen to form a ring.
Forming; where the alkenyl moiety on the carbon adjacent to the oxygen is
At least one hydrogen is C_1-6 Alkyl or phenyl; substituted C_2-8 Archi
Nyl, halogen, substituted C_1-4 Alkyl, CF₃ , C_2-3 Alkenyl, C_2-3 Al
Is it quinyl, allylamino, bromovinyl, ethylpropenoate, or propenoic acid?
Optionally substituted with a substituent selected from the group consisting of; or R₆ And R₇ Together, R₆ Of 5 or 6 members linked via N or O or S
Forming a saturated or unsaturated ring, said ring optionally containing functional groups which themselves contain functionality;
; However, R₈ R is amino or substituted amino, R₇ Is hydrogen; and R₈ Is hydrogen, amino or di-C_1-4 Alkylamino, C_1-4 Alkoxy, C_7-12A
Reel alkoxy, C_1-4 Alkylthio, C_7-12Arylalkylthio, carbo
Xamidomethyl, carboxymethyl, methoxy, methylthio, phenoxy, and
Selected from the group consisting of phenylthio).

In the general structure of Formulas I-III above, the dotted lines at positions 2 to 6 are intended to indicate the presence of single or double bonds at those positions, and the relative double or single bond relative. The position is determined by whether the substituents on R ₄ , R ₅ and R ₆ are keto-enol tautomers.

In the general structure of Formulas I-III above, the acyl group comprises an alkanoyl or aroyl group. Alkyl groups contain 1 to 8 carbon atoms, especially 1 to 4 carbon atoms, which are optionally substituted by one or more suitable substituents, as described below. Aryl groups containing aryl moieties of groups such as aryloxy are preferably phenyl groups, optionally substituted with one or more suitable substituents, as described below. Alkenyl and alkynyl groups mentioned above have 2 to 8
Carbon atoms, especially 2 to 6 carbon atoms, such as ethyl or ethynyl, which are optionally substituted by one or more substituents as described below.

The mentioned alkyl hereinbefore, alkenyl, alkynyl, and suitable substituents on aryl groups, halogen, hydroxy, C _1-4 alkoxy, C _1-4 alkyl, C _{6- 12} aryl, C _{6- 12} arylalkoxy, carboxy, cyano, nitro, sulphonamide, sulphonate, phosphate, sulphonic acid, amino and substituted amino, wherein the amino is _singly or doubly substituted by C _1-4 alkyl. And are double substituted, the alkyl groups are optionally joined to form a heterocycle.

The present invention further provides a novel dinucleotide having a sugar moiety selected from the group consisting of (1) arabinofuranosyl, 3'-deoxyribofuranosyl, xylofuranosyl, and lyxofuranosyl; and (2) an azapurine base. And (3) a novel dinucleotide having a 6-substituted purine, and a novel pharmaceutical composition comprising a compound of the general formula IV. In the first type of novel composition, Z and Z'are H when the sugar moiety is 3'-deoxyribofuranosyl.
Is. In the second type of novel compositions having azapurine base, J is nitrogen, and R ₃ is absent. In a third type of novel composition having 6-substituted purines, 6-monosubstituted aminopurine bases are excluded.

Preferred dinucleoside polyphosphate compounds useful in the present invention are P ¹ ,
P ⁴ - di (uridine 5 ') - _{tetraphosphate, dUP 4 U, U 2 P} 3, U 2 P 5, d
CP ₄ U, CP ₄ U, CP ₄ U, IP ₅ I, AP ₄ A, CP ₃ U, UP ₃ A and A ₂ P ₃ .

Some compounds of formula I, II and III may be made by methods known to those skilled in the art; some compounds are for example Sigma Chemical Co.
(St. Louis, MO 63178). A compound of formula Ia (UD
P and its analogs) can be prepared according to WO 99/09998. Formula Ib,
The compounds of IIb and IIIb (UTP, ATP, CTP and their analogs) are U
It can be prepared according to SPN 5,763,447. The compound of formula IV is Zamecnik,
et al., Proc. Natl. Acad. Sci. USA 89, 838-42 (1981); and Ng and Orgel, Nu.
cleic Acids Res. 15: 3572-80 (1987), Pendergast et al., USPN 5,837,861 or a modified method thereof.

The compounds of the invention are also their non-toxic pharmaceutically acceptable salts, eg
Without limitation, alkali metal salts such as sodium or potassium salts; alkaline earth metal salts such as manganese salts, magnesium salts or calcium salts; or ammonium salts or tetraalkylammonium salts, ie NX ₄ ⁺ (where X is C _{1 -4} ). Pharmaceutically acceptable salts are salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects. The present invention also includes acylated prodrugs of the compounds disclosed herein. Those of ordinary skill in the art will be aware of various synthetic methodologies that can be used to prepare non-toxic pharmaceutically acceptable salts and acylated prodrugs of the compounds.

The utility of the P2Y agonist compounds of the invention as pharmaceuticals has been demonstrated by the inositol phosphate assay for P2Y activity. E. Lazarowski et al.,
Brit. J. Pharm. 116, 1619-1627 (1995), this widely used assay relies on the measurement of inositol phosphate formation as a measure of the activity of compound-activated receptors linked to phospholipase C via the G protein. ing.

Furthermore, the usefulness of the P2Y agonist compounds of the present invention as a medicament is demonstrated by the intracellular calcium mobilization for P2Y activity. In this assay, cultured cells are stimulated by increasing concentrations of P2Y receptor agonists. Intracellular calcium levels are monitored by measuring changes in fluorescence intensity of calcium sensitive dyes using a FLIPR (Molecular Devices Corp., Sunnyvale, CA) or equivalent device.

P2Y agonist compounds increase mucus production in in vitro preparations of esophagus, gastric mucosa, duodenum, proximal and distal colon epithelium. Mucus secretion can be assayed by various techniques, such as impression cytology, enzyme-linked immunosorbent assay (ELISA), and dot blots using mucin-specific antibodies (Danjo et al., Invest. Ophtalm.
ol. Vis. Sci., 39: 2602-2609 (1998); Jumblatt et al., Invest. Ophtalmol.
Vis. Sci. 40: 43-49 (1999); and Jumblatt et al., Invest. Ophthalmol. Vis.
Sci. 39: 5803 (1998)). Our results indicate that P2Y receptor agonists are potent, prolong in mucus production when administered to the luminal surface of epithelial preparations,
And shows a significant increase. Mucin production can be repeatedly increased by repeated stimulation with agonists.

P2Y agonists significantly alter short circuit currents (Isc) in epithelial preparations from the gastrointestinal system, such as the esophagus, jejunum and distal and proximal colon. Changes in Isc are consistent with an increase in chloride flux or transerosal potassium flux through the lumen and are therefore expected to recruit absorption or secretion of fluid across the epithelium.

The efficacy of P2Y agonists for the amelioration of the symptoms associated with gastrointestinal disorders can be demonstrated in animal models. For example, Helicobacter pylori infection by administration of acetic acid to the antrum mucosa of cynomolgus monkeys is a model for chronic gastritis; the model has a histological and clinical phenotype similar to that of human gastric ulcers. Indicates. Oral administration of P2Y receptor agonists to monkeys with gastritis showed a significant restoration of periodate-Schiff positive staining and increased anti-mucin immunoreactivity, both of which reflected increased mucin secretion. To do. A reduction in the histological incidence of gastric ulcers is also an indicator of the efficacy of P2Y receptor agonists.

The desired compounds of the invention are administered orally, systemically, intraoperatively, rectally, in dosage unit formulations containing conventional non-toxic pharmaceutically acceptable carriers, adjuvants and excipients. obtain. The term "systemic" as used herein means subcutaneous injection, intravenous, intramuscular,
Includes intrasternal or infusion techniques.

The pharmaceutical formulation of the present invention comprises a ligand compound and a pharmaceutically acceptable carrier. The one or more ligand compounds may be present together with one or more non-toxic pharmaceutically acceptable carriers or diluents or excipients and, optionally, other active ingredients. One such carrier is a sugar, where the compound is homogeneously incorporated into the matrix via vitrification, or the carrier (eg lactose,
Sucrose, trehalose, mannitol) or other acceptable excipients for oral or systemic delivery.

For oral use, the pharmaceutical composition may be in any suitable dosage form such as tablets, lozenges, aqueous or oily suspensions, viscous gels, chewable gums, dispersible powders or granules, emulsions, It may be a hard or soft capsule, or a syrup or elixir. Compositions intended for oral use are prepared according to any method known in the art for the manufacture of pharmaceutical compositions. Such compositions may include one or more agents selected from the group consisting of sweetening agents, flavoring agents, coloring agents and preservatives to provide pharmaceutically aesthetically pleasing and palatable preparations. is there. Tablets usually contain the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients which are suitable for the manufacture of tablets. These excipients are, for example, inert diluents,
For example calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents such as corn starch or alginic acid;
Includes binders such as starch, gelatin or acacia; as well as lubricants such as magnesium stearate, stearic acid or talc. The tablets may be uncoated or they may be coated by known techniques to provide long lasting action. For example, a sustained release agent such as glyceryl monostearate or glyceryl distearate may be utilized.

For oral use, hard gelatine capsules are prepared by mixing the active ingredient with an inert solid diluent such as calcium carbonate, calcium phosphate or kaolin. Soft gelatin capsules are prepared by mixing the active ingredient with water or an oil medium such as peanut oil, liquid paraffin or olive oil.

For oral use, chewable gums are prepared by embedding the active ingredient in the gum; the active ingredient is slowly released by chewing. This dosage form is suitable for the treatment of stomatitis.

For oral use, aqueous suspensions are prepared by addition of water to a dispersible powder or granules, with dispersing or wetting agents, suspending agents and one or more preservatives. . Suspensions include, for example, sodium carboxymethylcellulose, methylcellulose and sodium alginate. The dispersant or wetting agent is a natural phosphatide, a condensation product of a fatty acid and an arylene oxide, a condensation product of a long-chain aliphatic alcohol and an ethylene oxide, a condensation product of a partial ester derived from a fatty acid and hexitol, and an ethylene oxide. , Or a condensation product of ethylene oxide with a partial ester derived from a fatty acid and hexitol anilide. Preservatives include, for example, ethyl and n-propyl p-hydroxybenzoate. Aqueous suspensions may further contain one or more coloring agents, one or more flavoring agents and one or more sweetening agents such as sucrose or saccharin. Those skilled in the art will recognize a number of specific excipients and humectants included in the above general description.

For systemic administration, the pharmaceutical composition is prepared in a sterile medium. The active ingredient, depending on the vehicle and concentration used, can either be suspended or dissolved in the vehicle. Adjuvants such as local anesthetics, preservatives and buffers may also be dissolved in the vehicle. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic acceptable diluent or solvent. Among the acceptable vehicles and solvents that may be employed are sterile water, saline, or Ringer's solution.

The pharmaceutical composition may further be administered in the form of suppositories for rectal administration. These compositions are suitable, non-irritating, complementary forms of the active ingredient, which at the normal temperature are solid but at the temperature of the rectum are liquid and consequently dissolve in the rectum and release the compound. It can be prepared by mixing with a drug. Such excipients include cocoa butter and polyethylene glycol.

Dosage levels of the active ingredient on the order of about 10-2000 mg are useful in treating the conditions suggested above. A preferred dosage is about 50-1000 mg, and a more preferred dosage is about 75-850 mg of active ingredient. These dosages may be given more than once daily if desired. The amount of active ingredient that is combined with the carrier materials to produce a single dosage form may vary depending upon the host treated and the particular mode of administration. However, the specific dosage level for any particular patient will depend on a variety of factors, such as the activity of the specific compound utilized, age, weight, general physical condition, sex, diet, time of administration, It will depend on the route of administration, the frequency of excretion, the drug combination and the severity of the particular disease being treated.

The present invention is further illustrated by the following examples, which should not be considered as limiting the scope and spirit of the invention to the specific methods described therein.

[0065] Examples Example 1. The presence of P2Y _1, P2Y _2, P2Y _4, P2Y ₆ and P2Y ₁₁ purinergic receptors in identifying gastrointestinal tissue of P2Y receptors in human tissues, in in vitro, human R purchased from commercial supply destination
It was determined using the RT-PCR technique of NA. Human normal stomach poly A ⁺ mRN
A was purchased from Clontech (Palo Alto, CA). First strand cDNA was prepared using oligo (dT) 18 primer and MMLV reverse transcriptase (60 min, 42 ° C.),
Synthesized from 100 ng of gastric poly A ⁺ mRNA (Advantage RT-Tor PCR kit;
Clontech, Palo Alto, CA). A control reaction in the absence of reverse transcriptase was also performed. Human normal esophagus, rectum, duodenum and salivary gland cDNAs have been cloned using Invitrogen (
Carlsbad, CA). The first strand cDNA for normal human colon, liver and small intestine is from Clontech's multiple tissue cDNA panel. RT
-PCR was performed with gastric tissue and PCR was performed with other tissues.

Sequence-specific primers for the P2Y ₁ , P2Y ₂ , P2Y ₄ , P2Y ₆ and P2Y ₁₁ genes are listed below: P2Y ₁ (accession number U42029) upstream 5′CGATCTGTATCAGCGTGCTGGTGTG 3 ′, downstream 5′TCTAGAAGCTTTCCTTGTGGCTCGG. '; P2Y ₂ (Accession No. S74902) upstream 5'AGGAGATGTGTTGGGCAGCAGTGAGGAC 3'; downstream 5'ACCAGGGTTTTCTGGCCAACCTGTGACT 3 '; P2Y ₄ (accession number X91852) upstream 5'ATGCAACGGCCACCTACATGTTCC 3'; downstream 5'GTACTCGGCAGTCAGCTTCCAACA 3 '; P2Y ₆ (Accession Session number U52464) Upstream 5′ATGGCATGGCTCTCACTGTCATCG 3 ′; Downstream 5′TTGGTGAGCTTCTGGGTCCTGTGAG 3 ′; P2Y ₁₁ (Accession number AF030335) Upstream 5′ATACTGGTGGTTGAGTTCCTGG 3 ′; Downstream 5′ACCAGGCTATACGCTCTGTAG.

PCR is performed for each P2Y (P2Y ₁ , P2Y ₂ , P2Y ₄ , P2Y ₆ , P2Y ₁₁ )
Of all tissues listed above using a combination of upstream and downstream primers (1 μl of each primer) designed to amplify a partial cDNA of
Performed on 1 μl of cDNA. The reaction further contained 400 mM of each deoxynucleoside triphosphate, 3.5 mM MgCl ₂ and 1 μl of Advantage cDNA polymerase mix (Clontech, Palo Alto, CA). The reaction conditions are:
2.5 minutes starting at 94 ° C, and then 30 seconds at 94 ° C, 60 ° C (P2Y ₄ , P2
Y ₁₁ ) or 65 ° C. (P2Y ₁ , P2Y ₂ , P2Y ₆ ) for 30 seconds, 72
1 minute at ℃, 35 cycles of this, and finally 10 minutes at 72 ℃. Some of the PCR products were cloned into the pCR2.1-TOPO vector (TOPO TA Cloning Kit; Invitrogen, Carlsbad, CA) and fully sequenced using an automated DNA sequencer.

All tissues tested were positive for the P2Y receptor. The results are summarized in Table 2.

[Table 3]

Example 2. Subcellular localization of P2Y nucleotide receptor gene expression in monkey gastrointestinal epithelial tissue by non-isotopic in situ hybridization. Tissue study tissue was obtained from Pathology Associates International, Frederick, MD. The tissues included in this study are the stomach, esophagus, small intestine (jejunum), and large intestine (colon). Tissues were excised from a 3.25 year old rhesus macaque in India immediately after euthanasia, and O. C. Flash frozen in T embedding medium. Frozen tissues were stored at -80 ° C prior to cryosectioning. Tissues were excised into 5 μm sections and hematoxylin-
Eosin (H & E) staining and in situ hybridization (ISH
A) on a microscope slide.

Evaluation of Tissue Sections H & E stained tissue sections were prepared to assess the quality and localization of the study tissue. Testing of H & E slides showed that all tissues were suitable for ISH.

Riboprobe synthetic nucleotides 253-from human P2Y ₂ -R cDNA
The PCR product containing 651 was obtained from the sponsor. The P2Y ₂ -R nucleotides 272-627 were designed to be integrated into the upstream T3 promoter or the downstream T7 promoter (P2Y ₂ primer (upstream primer sequence: 5′AGGAGATG
TGTTGGGCAGCAGTGAGGAC 3'backflow primer sequence: backflow 5'ACCAGGGTTTTCTGGCCAA
It was reamplified using CCTGTGACT 3 '). The resulting PCR product is in vitro
It was used to synthesize a digoxigenin labeled riboprobe by transcription at 0 ° (IVT). Antisense and sense riboprobes are T7 and T3, respectively.
Digoxigenin-11-UTP (Roche Molecu
MEGAscriptIVT kit (Ambion) according to the manufacturer in the presence of
Was synthesized using. After IVT, the template DNA was digested with DNase 1 and unincorporated digoxigenin was removed by ultrafiltration. The integrity of the riboprobe was assessed by electrophoresis through a denaturing polyacrylamide gel. Apparent molecular weight was estimated by comparison with the electrophoretic mobility of RNA ladders (Ambion) of 10 to 1000 base pairs. Probe yield and labeling were assessed by blot immunochemistry. Riboprobes were distributed in 5 μl aliquots and stored at −80 ° C. until used for ISH.

In Situ Hybridization Frozen tissues were cut into 5 μm sections, mounted on SuperFrost Plus slides (Fisher Scientific) and fixed in 4% paraformaldehyde / PBS pH 7.4 for 15 minutes.
Tissue sections were subsequently stained with 0.1% active diethylpyrucarbonate / PBS pH 7.4.
Was used for 30 minutes. The sections were prehybridized in the absence of probe,
It was then incubated overnight in hybridization buffer containing 400 ng / ml of either antisense or sense probe. After hybridization, the slides were subjected to a series of post-hybridization stringent washes to reduce non-specific staining. Hybridization was performed according to the manufacturer according to alkaline phosphatase complexed anti-digoxigenin Fab and nitroblue tetrazolium chloride-bromochloroindolyl phosphate (Roche Mole.
was visualized by immunohistochemistry using cular). Tissue section is nuclea
Counterstain with r fast red. The negative control, including the stained stomach and esophagus in the sense P2Y ₂ -R probe.

Results The results of the in situ hybridization experiments are shown with sense (negative control) and antisense probes for the stomach (Fig. 1), esophagus (Fig. 2), colon (Fig. 3) and jejunum (Fig. 4). . All tissues showed positive staining in the mucosal epithelium, showing P2Y ₂ receptor gene expression by antisense probe (FIGS. 1b, 2b, 3b, and 4b), while staining was observed by control sense probe. Was not done (Fig. 1a, 2a, 3
a, and 4a). More specifically, the expression of the P2Y ₂ gene is expressed in the epithelium of the gastric pit and the neck and base of the gastric gland of the stomach; stratified squamous epithelium of the esophagus; villous epithelium of the jejunum Mucin-secreting goblet cells; as well as columnar absorptive cells of the colon, mucus-secreting goblet cells, and secretory enteroendocrine crypt cells. Demonstration of P2Y ₂ receptor gene expression in the gastrointestinal epithelium, including both secretory and absorbable cell types, has demonstrated a role for P2Y ₂ receptors in gastrointestinal mucosal physiology, and enhanced mucus secretion and / or fluid. Supports its role as a target for the treatment of gastrointestinal disorders where secretion of is therapeutic.

Example 3: Measurement of intracellular calcium mobilization in cultured epithelial cells from the gastrointestinal tract Conventional techniques are used to detect intracellular calcium mobilization induced by P2Y receptor agonists. Such techniques are well known to those of ordinary skill in the art. Cells are seeded in 96-well plates and used for calcium mobilization assay. On the day of the assay, culture medium was aspirated and KCl (10.0), NaCl (
118), CaCl ₂ (2.5), MgCl ₂ (1.0), HEPES (20)
Fluo in assay buffer, pH 7.4, consisting of, glucose (10) (mM)
Replace with -3 AM solution (final concentration of 2.5 μM). Probenecid (Sigma Chemic
al Co.) at a working concentration of 2.5 mM is added to the dye-supplemented medium and dye wash medium to increase the retention of the dye in the cells. After incubation with Fluo-3AM for 60 minutes at 25 ° C, the cells were stained with dye (Columbus Plate Washer, TECAN US, Inc.
, Research Triangle Park, NC) and stimulated with increasing concentrations of P2Y receptor agonist. The intracellular calcium level is FLIPR (Mo
lecular Devices Corp., Sunnyvale, CA) to monitor changes in fluorescence intensity simultaneously in each well.

Human colonic epithelial cell line T84 cells were subjected to the calcium mobilization assay described above. The results show that the P2Y receptor agonists ATP and UTP stimulate calcium mobilization in these cells, which is consistent with P2Y ₂ receptor activation (FIG. 5). 2-Methylthio-ADP, a selective agonist of P2Y ₁ receptor
Did not stimulate calcium mobilization, suggesting a defect in the P2Y ₁ receptor in these cells. Similarly, human colon HT-29 cells showed strong P2Y responses to ATP and UTP, which is consistent with the activation of P2Y ₂ receptor (
(Figure 6). Activation of intracellular calcium mobilization by ATP and UTP in T84 and HT-29 cells suggests usefulness of P2Y receptor agonists in the gastrointestinal tract as a drug [UTP-Stimulated calcium mobilization has been reported in H
T-29 cells: Otero et al. Mol Cell Biochem 2000 Feb; 205 (1-2): 115-23).
.

[0076] Example 4: Epithelial mucus production gastrointestinal epithelium in epithelial cultures and explants, bicarbonate secretion, measurement conventional techniques 及 beauty short-circuit current, mediated by P2Y ₂ and P2Y ₄ purinoceptor agonists Used to study the electrical response of. The technique is well known to those skilled in the art. Natural explants and cultured mucosal epithelial cells from the esophagus, stomach, jejunum and colon epithelium have been isolated or grown as monolayers, where the apical (mucosal) and basement membrane (
The integrity of the binding complex that separates the serosa) remains intact. The epithelial tissue or monolayer allows for the maintenance of epithelial polarity, and an improved Ussing chamber that has the ability to separately perfuse Ringer's solution to the apical and basolateral surfaces.
embedded in r. Short circuit current and transepithelial resistance are continuously measured using conventional electrophysiological techniques. Bicarbonate secretion is pH adjusted using the pH Stat system.
Is measured by monitoring. Changes in these parameters, consistent with changes in chloride ion secretion, bicarbonate secretion, or transmembrane flux of other ions, indicate that P2Y receptor agonists are secreting, absorbing, and / or absorbing in the gastrointestinal tract. It is suggested to modify the hydration of the mucosa.

Mucus production by goblet cells residing in epithelial glands is assayed by various techniques well known to those of skill in the art. Natural explants and culture monolayers of esophageal and gastric mucosal epithelium
Assayed for production of mucin by impression cytology, which consisted of covering a constant surface area of epithelium with polyvinylidene difluoride (PVDF) membrane and staining the PVDF membrane with periodate-Schiff (PAS) reagent. . The degree of PAS positive staining is inversely proportional to mucin secretion. In the mucosal epithelium of the esophagus and stomach,
Agonists of P2Y ₂ and P2Y ₄ purinoceptors have been shown to reduce PAS staining, consistent with increased mucus secretion. Mucus secretion, P
The 2Y purinoceptor-induced increase is demonstrated by enzyme-linked immunosorbent assay (ELISA) using mucin-specific antibodies, and immunoblot. Positive results show a potent, prolonged and significant increase in mucus production when purinoceptor agonists are administered to the luminal surface of epithelial preparations. Mucin production can be repeatedly increased by repeated stimulation with purinoceptor agonists.

Example 5: Infection of Helicobacter pylori by acetic acid administration to the antrum mucosa of the purinoceptor agonist cynomolgus monkey for the recovery of the symptoms associated with ulcerative colitis is a model of chronic gastritis and that of human gastric ulcer Shows a histological and clinical phenotype similar to. Oral administration of P2Y receptor agonists to monkeys with gastritis showed a significant restoration of staining of periodate-Schiff positive substances and increased anti-mucin immunoreactivity, both of which increased mucin secretion. It reflects. A reduction in the histological incidence of gastric ulcers is also an indicator of the efficacy of P2Y receptor agonists.

A human subject suffering from ulcerative colitis or chronic gastritis is treated by the method of the present invention. The patient will undergo an endoscopy followed by a biopsy of the gastric mucosa. Ulcerative colitis is diagnosed according to the confirmation of mucosal inflammation and erosion of the gastric mucosal layer. The present invention treats a patient by oral administration of a suitable formulation of a P2Y receptor agonist that coats the mucosal layer of the esophagus and stomach and stimulates mucosal production under the gastric mucosa.
The compositions are administered as a sustained release oral dosage form, preferably in the form of chewing gum or lozenges and, if necessary, multiple times daily. The activity of the disease is evaluated by clinical researchers by the Clinical Activity Index, Endoscopic Index,
It is monitored based on the Histological Index and Global Efficacy Assessment. An improvement in one or more of these parameters suggests that the P2Y agonist reverses the symptoms of ulcerative colitis.

Example 6: Purinoceptor agonists for alteration of fluid absorption by the small intestine and distal colon and recovery of symptoms associated with diarrhea or constipation A human subject suffering from constipation or diarrhea is according to the invention as follows: Is treated by the method of. Patients with diarrhea or constipation symptoms are given an oral formulation of the compound prepared as a tablet capable of releasing the active compound in the small intestine (for constipation) or large intestine (for diarrhea) in a therapeutic and specific amount. To be The active compound is P2Y in each tissue.
It specifically agonizes receptors and promotes secretion of fluid in the small intestine and absorption of fluid in the large intestine. Assessed by patient questionnaire and clinical observations,
Toilet excretion of 48 hours, measured in grams, and duration of diarrhea or constipation are determined by the following treatments.

The present invention, and the manner and methods of making and using it, are complete, clear, concise, such that any person skilled in the art can make and use the same. And it is written in the correct term. It is to be understood that the foregoing describes preferred embodiments of the invention and that modifications can be made without departing from the spirit or scope of the invention as claimed. . In order to point out and clearly claim the subject matter of the invention, the claims conclude the specification.

[Brief description of drawings]

BRIEF DESCRIPTION OF THE FIGURES This patent application contains at least one drawing executed in color. Copies of this patent application with color drawings will be submitted by the Office upon request and payment of the necessary fee. FIG. 1 shows the results of in situ hybridization of P2Y ₂ receptor in gastric tissue (gastric epithelium) with (a) control sense probe and (b) antisense probe.

FIG. 1b shows the results of in situ hybridization of P2Y ₂ receptor in gastric tissue (gastric epithelium) with (a) control sense probe and (b) antisense probe.

FIG. 2a shows the results of in situ hybridization of P2Y ₂ receptor of esophageal epithelium with (a) control sense probe and (b) antisense probe.

FIG. 2 shows the results of in situ hybridization of P2Y ₂ receptor of esophageal epithelium with (a) control sense probe and (b) antisense probe.

FIG. 3A shows colon ((a) sense probe and (b) antisense probe)
The result of in situ hybridization of the P2Y ₂ receptor of the (colon) epithelium is shown.

FIG. 3b shows colon ((a) sense probe and (b) antisense probe (
The result of in situ hybridization of the P2Y ₂ receptor of the (colon) epithelium is shown.

FIG. 4a shows (a) sense probe and (b) small intestine with antisense probe (
Jejunum) of the epithelium, shows the results of in situ hybridization of the P2Y ₂ receptor.

FIG. 4b shows (a) sense intestine and (b) antisense probe intestine (
Jejunum) of the epithelium, shows the results of in situ hybridization of the P2Y ₂ receptor.

FIG. 5 shows calcium mobilization induced by P2Y receptor agonists in human colon epithelial cells.

FIG. 6 shows calcium mobilization induced by P2Y receptors in HT-29 human colon epithelial cells.

─────────────────────────────────────────────────── ─── Continued Front Page (51) Int.Cl. ⁷ Identification Code FI Theme Coat (Reference) A61K 31/7084 A61K 31/7084 A61P 1/00 A61P 1/00 1/02 1/02 1/04 1 / 04 1/10 1/10 1/12 1/12 31/10 31/10 43/00 105 43/00 105 111 111 111 // A61K 31/706 A61K 31/706 31/708 31/708 C07H 19/048 C07H 19/048 19/10 19/10 19/20 19/20 19/207 19/207 (81) Designated countries EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE, TR), OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG) , AP (GH, GM, KE, LS, MW, MZ, SD, SL, SZ TZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AE, AG, AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, BZ, CA, CH, CN, CR, CU, CZ, DE, DK, DM, DZ, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN , IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MA, MD, MG, MK, MN, MW, MX, MZ, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, TZ, UA, UG, US, UZ, VN, YU, ZA, ZW (72) Invention Ride out, Janet L. 27607-3010, North Carolina, USA, Morningside Drive, Raleigh, 3101 (72) Inventor Pendergast, William United States, North Carolina 27713, Durham, Williamsburg Way 5816 (72) Inventor Shaver, Sammy Earl. 27516-9459, North Carolina, United States, Chapel Hill, Harrow Court 614 (72) Inventor Tsang, Zhen United States, North Carolina 27502, Apex, Annora Drive 1232 (72) Inventor Peterson, Ward Em. United States, North Carolina 27703, Durham, Edinburgh Dry Drive 332 (72) Inventor Kaulen, Matthew United States, North Carolina 27707, Chapel Hill, Clark Lake Road 208 F Term (Reference) 4C057 BB02 BB05 DD03 LL05 LL09 LL10 LL17 LL18 LL23 LL22 LL22 LL22 LL28 LL29 LL30 LL31 LL32. ZA66 ZA67 ZA68 ZA72 ZA73 ZB11 ZB21 ZB35 ZC41

Claims (13)

[Claims] 1. A method for controlling the secretion of mucus or mucin, the secretion of bicarbonate, or the transport of liquid in the gastrointestinal tract, which comprises providing a pharmaceutical composition comprising a purine P2Y receptor ligand in the gastrointestinal tract. Or a method comprising administering to said mammal an amount effective for mucin secretion, bicarbonate secretion or fluid transport. 2. A method of treating a gastrointestinal disease or disorder in which the mucosal barrier of the gastrointestinal system or the secretion of hydrogen carbonate is abnormal, or the fluid passing through the lumen tube is abnormal, which is purine. A pharmaceutical composition comprising a P2Y receptor agonist compound,
A method comprising administering to the mammal an amount effective to control mucus or mucin secretion, bicarbonate secretion in the gastrointestinal tract, or to normalize fluid transport. 3. The P2Y receptor is P2Y₁ , P2Y₂ , P2Y_Four , P2Y ₆  And P2Y₁₁A method according to claim 1 or 2 selected from the group consisting of: 4. The purine receptor is a group consisting of compounds of the formulas Ia, IIa and IIIa: (Where X ₁ and X ₂ are each independently either O ⁻ or S ⁻ ;
Y is H or OH; R ₁ is O, imido, methylene, and Jiharomechiren (e.g., dichloromethylene, difluoromethylene) is selected from the group consisting of; R ₂ is H, halo, alkyl, substituted alkyl, alkoxyl, nitro and is selected from the group consisting of azido; R ₃ is H, alkyl, (including aryl acyl) acyl, and is selected from the group consisting of arylalkyl; and R ₄ is -OR ', - SR', NR ', and Selected from the group consisting of NR′R ″,
Where R ′ and R ″ are independently selected from the group consisting of H, alkyl, substituted alkyl, aryl, substituted aryl, arylalkyl, alkoxyl, and aryloxyl, where R ′ is R ₄ is oxygen or Not present if it is a double bond from a sulfur atom to the carbon at the 4-position of the pyrimidine ring); (Wherein R ₁ , X ₁ , X ₂ and Y are defined as in formula Ia; Z is H, Cl, or SR, where R is C ₁ -C ₂₀ saturated or unsaturated alkyl. R ₃ and R ₄ are H, while R ₂ is absent and there is a double bond between N-1 and C-6, or R ₃ and R ₄ are H, R ₂ is O, and there is a double bond between N-1 and C-6, or R ₃ , R ₄ , and R ₂ together are between N-6 and C-6. N- having a double bond in
-CH = CH- forming a ring from 6 to N-1); (Where R ₁ , X ₁ , X ₂ , and Y are defined as in formula Ia; R ₅ and R ₆ are H, while R ₇ is absent, and N-3 and C-4 A double bond is present between the two, or R ₅ , R ₆ and R ₇ together form N-3 having a double bond between N-4 and C-4 (3, N ⁴ -ethenocytosine). From -CH = CH- to form a ring of N-4, wherein hydrogen at the 4- or 5-position of the etheno ring is optionally substituted with alkyl, substituted alkyl, alkoxyl, nitro, halo and azide), The method of claim 3, wherein the method is performed. 5. The nucleotide diphosphate is 5'-uridine diphosphate, 5
The method of claim 4, wherein the method is selected from the group consisting of'-adenosine diphosphate and 5'-cytidine diphosphate. 6. The group of purine receptor agonists consisting of compounds of formula Ib, IIb and IIIb: (Wherein X ₁ , X ₂ and X ₃ are each independently either O ⁻ or S ⁻ , Y is H or OH; R ₁ is O, imide, methylene, or dihalomethylene. R ₂ is H or Br; R ₃ is selected from the group consisting of absent, H, alkyl, acyl and arylalkyl; and R ₄ is —OR ′, —SR ′, NR ′, and NR′R. ″ Selected from the group consisting of
Where R'and R "are independently selected from the group consisting of H, alkyl, substituted alkyl, aryl, substituted aryl, arylalkyl, alkoxyl, and aryloxyl, provided that R'is R ₄ is oxygen. Or from the sulfur atom to 4 of the pyrimidine ring
Not present if double-bonded to the carbon atom at position); (Where R ₁ , X ₁ , X ₂ , X ₃ and Y are defined as in formula Ib, Z is H, Cl, or SR, where R is C ₁ -C ₂₀ saturated or unsaturated. Alkyl; R ₃ and R ₄ are H, while R ₂ is absent and there is a double bond between N-1 and C-6, or R ₃ and R ₄ are H , While R ₂ is O and there is a double bond between N-1 and C-6, or R ₃ , R ₄ and R ₂ together are between N-6 and C-6. N-6 having a double bond in
To form a ring from N to N-1) is -CH = CH-); (Where R ₁ , X ₁ , X ₂ , X ₃ and Y are defined as in formula Ib, and R ₅ and R ₆ are H, while R ₇ is absent and N-3 and A double bond exists between C-4, or R ₅ , R ₆ and R ₇ together form N-3 having a double bond between N-4 and C-4.
To N-4 are -CH = CH-, optionally 4 or 5 of the etheno ring.
The hydrogen at position is a nucleotide triphosphate selected from alkyl, substituted alkyl, alkoxyl, nitro, halo and azide). 7. The nucleotide triphosphate is 5'-uridine triphosphate, 5
Selected from the group consisting of'-adenine triphosphate and 5'-cytidine triphosphate,
The method of claim 6. 8. The purinergic receptor agonist has the formula IV:     [Chemical 7] [Wherein X is oxygen, methylene, difluoromethylene, or imide; n = 0, 1 or 2; m = 0, 1 or 2; n + m = 0, 1, 2, 3, or 4; Z = OH or H; Z '= OH or H; Y = H or OH; Y '= H or OH; The sugar moiety is represented by the D-configuration, but may be L- or D- and L-
And the D-configuration is preferred; Nucleoside residues are in the alpha- or beta- and D- or L-configuration,
And most preferably in the beta-D-configuration; B and B'are each independently defined as in formulas V and VI, respectively.
Is a purine residue or a pyrimidine residue linked via the 9 or 1 position, respectively.
;     [Chemical 8] (Where R₁ Is hydrogen, chlorine, amino, monosubstituted amino, disubstituted amino, alkyl
Thio, arylthio, or aralkylthio, where the substituent on the sulfur is
Containing up to 20 carbon atoms which are saturated or not unsaturated; R₂ Is hydroxy, amino, mercapto, alkylthio, arylthio, aral
Kirthio, acylthio, alkyloxy, aryloxy, aralkyloxy,
Acyloxy, monosubstituted alkylamino, heterocyclic monosubstituted cycloalkylamino
, Monosubstituted aralkylamino, monosubstituted arylamino, diaralkylamino, dia
Reel amino, dialkylamino (wherein the alkyl group is optionally N₇ Connected with
Form a substituted ring), acylamino, diacylamino, or NHR_Y And R_X Is O when in the adenine 1-oxide derivative, or adenine derivative.
Not present if in conductor; However, R₂ Is NHR_Y Then R_Y And R_X Together, 1, N⁶ -Ethenoa
May form a 5-membered fused imidazole ring if present in a denine derivative
, Which is optionally at the 4 or 5 position of the etheno moiety, alkyl, aryl or aralkyl
Replaced by a part, as defined below; R₃ Is hydrogen, azide, alkoxy, aryloxy, aral as defined below.
Is alkyloxy, alkylthio, arylthio, or aralkylthio; or ω
-A (C_1-6 Alkyl) OCONH (C_1-6 Alkyl) B- (where A and B are
Independently amino, mercapto, hydroxy or carboxyl); or
Is a pharmaceutically acceptable ester, amide or salt thereof; or is absent
; Here, the substituted derivative of adenine is adenine 1-oxide; 1, N⁶ -(4- or
5-substituted etheno) adenine; 6-substituted adenine; or 8-substituted aminoadenine
Including, Where the R'of the 6- or 8-HNR 'group is: optionally functionalized as described below.
Arylalkyl (C_1-6 ) Group; alkyl; and (
[6-aminohexyl] carbamoylmethyl)-, and ω-acylated-amino (
Hydroxy, thiol and carboxy) alkyl (C_2-10)-And their ω-
Acylated-like amino (hydroxy, thiol and carboxy) derivatives,
Selected from the group consisting of alkyl groups having a functional group therein, wherein the acyl group is
Without limitation, acetyl, trifluoroacetyl, benzoyl, substituted benzoyl
Or the carboxylic acid moiety is its ester or amide derivative
, Eg ethyl or methyl esters or their methyl, ethyl or benzamites
Exist as a derivative and the ω-amino (hydroxy, thiol) moiety is C_{1- Four}  May be alkylated with an alkyl group; J is carbon or nitrogen, provided that when J is nitrogen, R₃ Does not exist; Wherein the alkyl group is linear, branched or cyclic; Here, the aryl group is optionally lower alkyl, amino, alkylamino, NO ₂  , N₃ , Carboxylic acids, amides, sulfonamides, or halo groups);
And B and B ′ further have the general formula of formula VI linked to the ribosyl residue via the 1-position
May be pyrimidine):     [Chemical 9] (Where R_Four Is hydrogen, hydroxy, oxo, mercapto, amino, cyano, C _7-12 Arylalkoxy, C_1-6 Alkylthio, C_1-6 Alkoxy, C_1-6 Al
Kiramino or di C_1-4 Alkylamino, where the alkyl group is optionally linked.
Combine to form a heterocycle; R_Five Is hydrogen, oxo, acetyl, benzoyl, C_1-6 Alkyl, C_1-5 Alkano
Or aroyl; R₆ Is hydroxy, oxo, mercapto, C_1-4 Alkoxy, C_7-12Arylua
Lucoxy, C_1-6 Alkylthio, amino, S-phenyl, C_1-5 Disubstituted amino,
Triazolyl, C_1-6 Alkylamino or di-C_1-4 Alkylamino, here before
The dialkyl groups are optionally linked to form a heterocycle, or N³ Connected with
Form a ring; or R_Five And R₆ Together with a 5-membered fused imidazo between the 3- and 4-positions of the pyrimidine ring.
Form a ring and 3, N^Four -Forms an etenocytosine derivative, where
The etheno part is optionally C at the 4th or 5th position._1-4 Alkyl, phenyl, or phenyl
Substituted with luoxy; wherein C_1-4 Alkyl, phenyl or phenyloxy
At least one of the hydrogens is optionally halogen, hydroxy, C_1-4 Al
Coxy, C_1-4 Alkyl, C_6-10Aryl, C_7-12Arylalkyl, carboxy
Si, cyano, nitro, sulfonamide, sulfonate, phosphate, sulfonic acid,
Amino, C_1-4 Alkylamino and di-C_1-4 Selected from the group consisting of alkylamino
Optionally substituted by a moiety, wherein the dialkyl group is optionally linked to a heterocycle.
To form; R₇ Is hydrogen, hydroxy, cyano, nitro, and C_2-8 A group consisting of alkenyl
Wherein the alkenyl moiety is optionally linked via oxygen to form a ring.
Forming; where the alkenyl moiety on the carbon adjacent to the oxygen is
At least one hydrogen is C_1-6 Alkyl or phenyl; substituted C_2-8 Archi
Nyl, halogen, substituted C_1-4 Alkyl, CF₃ , C_2-3 Alkenyl, C_2-3 Al
Is it quinyl, allylamino, bromovinyl, ethylpropenoate, or propenoic acid?
Optionally substituted with a substituent selected from the group consisting of; or R₆ And R₇ Together, R₆ Of 5 or 6 members linked via N or O or S
Forming a saturated or unsaturated ring, the ring containing functional groups which themselves contain functionality;
, R₈ R is amino or substituted amino, R₇ Is hydrogen; and R₈ Is hydrogen, amino or di-C_1-4 Alkylamino, C_1-4 Alkoxy, C_7-12A
Reel alkoxy, C_1-4 Alkylthio, C_7-12Arylalkylthio, carbo
Xamidomethyl, carboxymethyl, methoxy, methylthio, phenoxy, and
Selected from the group consisting of phenylthio))]
The method according to claim 2, which is a dinucleotide polyphosphate. 9. The dinucleotide polyphosphate is U ₂ P ₄ , dUP ₄ U,
U ₂ P ₃ , U ₂ P ₅ , dCP ₄ U, CP ₄ U, IP ₅ I, AP ₄ A, CP ₃ U,
It is selected from the group consisting of UP ₃ A and A ₂ P _3, The method of claim 8. 10. The method of claim 1 or 2 wherein said administration comprises administering an oral form of said pharmaceutical composition such that a therapeutically effective amount of said compound contacts said tissue of said gastrointestinal system of said mammal. The method described in. 11. The administration comprises injecting the pharmaceutical composition in injectable form such that a therapeutically effective amount of the compound contacts the tissues of the gastrointestinal system via systemic absorption and circulation. The method according to claim 1 or 2. 12. The administration is accomplished by administering the pharmaceutical composition in suppository form such that a therapeutically effective amount of the compound contacts the tissues of the gastrointestinal system via systemic absorption and circulation. The method according to claim 1, which is performed. 13. The method of claim 2, wherein the gastrointestinal disorder is gastroesophageal reflux disease (GERD).