JP2003524600A - Compositions and methods for treating immune-related diseases - Google Patents

Abstract

  (57) [Summary] The present invention relates to a composition containing a novel protein and a method for treating and diagnosing an immune-related disease.

Description

Detailed Description of the Invention

[0001] (Field of the invention)   The present invention relates to compositions and methods for the diagnosis and treatment of immune related disorders.

BACKGROUND OF THE INVENTION Immune-related and inflammatory diseases are essential in normal physiology for response to injury or damage, initiation of repair from injury or damage, and innate or acquired defense against foreign organisms. Quite complex and often a manifestation or result of multiple interrelated biological pathways. A disease or pathology is one in which these normal physiological pathways are directly related to the strength of the response, as a result of aberrant regulation or overstimulation, as a response to self, or as a combination thereof, resulting in further injury or damage. It occurs when you cause. The origin of these diseases often involves multi-step pathways and often multiple different biological systems / pathways, and intervention at the critical point of one or more of these pathways can have ameliorating or therapeutic effect. . The therapeutic intervention can occur either by antagonizing a deleterious process / pathway or stimulating a beneficial process / pathway. Many immune related diseases are known and have been extensively studied. Such diseases include immune-mediated inflammatory diseases, non-immune-mediated inflammatory diseases, infectious diseases, immunodeficiency diseases, tumorigenesis and the like. T lymphocytes (T cells) are important components of the mammalian immune response. T cells are
Recognizes antigens associated with self-molecules encoded by genes within the tumor histocompatibility complex (MHC). Antigens are presented with MHC molecules on the surface of antigen presenting cells, virus infected cells, cancer cells, grafts and the like. The T cell line eliminates these altered cells that threaten the health of the host mammal. T cells include helper T cells and cytotoxic T cells. Helper T cells proliferate in large numbers following recognition of the antigen-MHC complex on antigen presenting cells. Helper T cells also secrete various cytokines, such as lymphokines, which play a central role in the activation of B cells, cytotoxic T cells and various other cells that oxidize to the immune response.

Central events in both humoral and cell-mediated immune responses are the activation and clonal expansion of helper T cells. Helper T cell activation is initiated by the interaction of the T cell receptor (TCR) -CD3 complex with antigen-MHC on the surface of antigen presenting cells. This interaction mediates a cascade of biological events that triggers entry of resting T cells into the cell cycle (G0-G1 transition), with high affinity for IL-2 and, in some cases, IL-4. It leads to the expression of sex receptors. Activation T
The cells progress through cycle proliferation and differentiation into immune memory cells or effector cells. In addition to signals mediated through the TCR, activation of T cells is triggered by additional simultaneous induction by cytokines released by antigen presenting cells or through the interaction of membrane bound molecules and T cells on antigen presenting cells. Including stimulation. IL-1 and IL-6 have been shown to provide costimulatory signals. In addition, B7 molecule expressed on the surface of antigen-presenting cells and CD28 and CTLA-4 expressed on the surface of T cells
Interactions with molecules also affect T cell activation. Activated T cells have an increased number of cell adhesion molecules such as ICAM-1, integrin, VLA-4, LFA.
-1, express CD56, etc. T cell proliferation in mixed lymphocyte cultures or mixed lymphocyte reactions (MLRs) is an established indication of a compound's ability to stimulate the immune system. In many immune reactions, inflammatory cells infiltrate the site of injury or infection. The migrating cells may be neutrophils, eosinophils, monocytes or lymphocytes. Histological examination of infected tissues provides evidence of immune stimulation or inhibition of the response. Current Protocols in Immunology, Editor E. Coligan, 1994
, John Wiley and Sons, Inc. Immune-related diseases can be treated by suppressing the immune response. The use of neutralizing antibodies that inhibit molecules with immunostimulatory activity would be beneficial in the treatment of immune-mediated and inflammatory diseases. Molecules that inhibit the immune response are available to inhibit the immune response and thus ameliorate immune related disorders (either directly on the protein or through the use of antibody agonists).

SUMMARY OF THE INVENTION The present invention relates to compositions for the diagnosis and treatment of immune related disorders in mammals, including humans. The present invention is based on the identification of proteins (including agonist and antagonist antibodies) that stimulate or inhibit the immune response in mammals. Immune related diseases can be treated by suppressing or promoting an immune response. Molecules that promote an immune response can stimulate or enhance the immune response to an antigen. Molecules that stimulate the immune response can be used therapeutically where promoting the immune response is beneficial.
Such stimulatory molecules can also be inhibited where suppression of the immune response is of value. Neutralizing antibodies are examples of molecules that inhibit molecules with immunostimulatory activity and would be beneficial in the treatment of immune related and inflammatory diseases. Molecules that inhibit the immune response are also available to inhibit the immune response and thus ameliorate immune related disorders (either directly with the protein or through the use of antibody agonists). Therefore, the protein of the present invention encoded by the gene of the present invention is useful for diagnosis and / or treatment (including prevention) of immune-related diseases. Antibodies that bind to stimulatory proteins are useful in suppressing the immune system and immune response. Antibodies that bind to inhibitory proteins are useful in stimulating the immune system and immune response. Further, the protein and antibody of the present invention are useful for preparing a drug and a drug for treating immune-related diseases and inflammatory diseases. In one embodiment, the present invention provides PRO245, PRO217, PRO301, P
It relates to an isolated antibody that binds to RO266, PRO335, PRO331 or PRO326 polypeptide. In one aspect, the antibody is PRO245, PRO21.
7, PRO301, PRO266, PRO335, PRO331 or PRO32
6-polypeptide activity (agonist antibody), or conversely the antibody is PRO
245, PRO217, PRO301, PRO266, PRO335, PRO3
31 or PRO326 polypeptide activity is inhibited or neutralized (antagonist antibody). In another aspect, the antibody is a monoclonal antibody, which preferably has nonhuman complementarity determining region (CDR) residues and human framework region (FR) residues. The antibody may be labeled or may be immobilized on a solid support.
In a further aspect, the antibody is an antibody fragment, a single chain antibody, or an anti-idiotype antibody.

In another embodiment, the invention features PRO245, PRO217, PRO301,
A composition comprising a PRO266, PRO335, PRO331 or PRO326 polypeptide, or an agonist or antagonist antibody that binds to the polypeptide, in admixture with a carrier or excipient. In one aspect, the composition comprises a therapeutically effective amount of the peptide or antibody. In another aspect, when the composition comprises an immunostimulatory molecule, the composition increases (a) the infiltration of inflammatory cells into mammalian tissue in need thereof in response to (a) an antigen, Useful for (b) stimulating or promoting an immune response in a mammal in need thereof, or (c) increasing the proliferation of T lymphocytes in a mammal in need thereof. In a further aspect, where the composition comprises an immunoinhibitory molecule, the composition reduces (a) the infiltration of inflammatory cells into mammalian tissue in need thereof in response to (a) an antigen, It is useful for b) inhibiting or reducing an immune response in a mammal in need thereof, or (c) reducing the proliferation of T lymphocytes in a mammal in need thereof. In another aspect, the composition comprises an additional active ingredient, which may be, for example, an additional antibody or a cytotoxic or chemotherapeutic agent. Preferably the composition is sterile. In one embodiment, the invention relates to the use of the polypeptides and antibodies of the invention for the preparation of a composition or medicament having the above mentioned uses. In a further embodiment, the invention provides an anti-PRO245, PRO217, PRO3.
01, PRO266, PRO335, PRO331 or PRO326 antibody-encoding nucleic acids, and vectors and host cells containing such nucleic acids. In a still further aspect, the invention provides a host cell transformed with a nucleic acid encoding an antibody,
It relates to a method for producing these antibodies by culturing under conditions in which the antibodies are expressed and recovering the antibodies from the cell culture medium.

Further, the present invention provides PRO245, PRO217, PRO301, PRO266.
, PRO335, PRO331, or PRO326 polypeptides that inhibit one or more functions or activities of PRO245, PRO217, PRO301, PRO2.
66, PRO335, PRO331 or PRO326 polypeptide antagonists and agonists. In a further embodiment, the invention features PRO245, PRO217, PRO30.
1. An isolated nucleic acid molecule that hybridizes to the complement of a nucleic acid molecule encoding a PRO266, PRO335, PRO331 or PRO326 polypeptide. The nucleic acid is preferably DNA and hybridization preferably occurs under stringent conditions. Such nucleic acid molecules act as amplified antisense molecules identified herein, which in turn find use in modulating the corresponding amplified gene or as antisense primers in amplification reactions. In addition, these sequences can be used as part of ribozyme and / or triple helix sequences, which may in turn be used in the regulation of amplified genes. In another embodiment, the invention features a PRO245, PRO217, PRO301,
Cells suspected of containing PRO266, PRO335, PRO331 or PRO326 polypeptide were treated with anti-PRO245, PRO217, PRO301,
PRO245, PRO217, comprising exposing to PRO266, PRO335, PRO331 or PRO326 antibody and measuring the binding of the antibody to cells.
It relates to a method for determining the presence of PRO301, PRO266, PRO335, PRO331 or PRO326 polypeptide. In yet another embodiment, the invention relates to a method of diagnosing an immune related disease in a mammal, which comprises (a) in a test sample of tissue cells obtained from the mammal, and (
b) PRO245, PRO in a control sample of known normal cells of the same cell type
217, PRO301, PRO266, PRO335, PRO331 or PRO
Detecting the expression level of the gene encoding the 326 polypeptide, the high expression level in the test sample is indicative of the presence of an immune related disease in the mammal from which the test tissue cells were obtained. In another embodiment, the invention relates to a method of diagnosing an immune related disease in a mammal, which comprises (a) anti-PRO245, PRO217, PRO301, PRO2.
Contacting a 66, PRO335, PRO331 or PRO326 antibody with a sample of tissue cells obtained from the mammal, and (b) detecting complex formation between the antibody and the polypeptide in the test sample. Become. Detection can be qualitative or quantitative and is performed in comparison to monitoring complex formation in a control sample of known normal tissue cells of the same cell type. The high amount of complex formed in the test sample indicates the presence of tumor in the mammal from which the test tissue cells were obtained. The antibody preferably carries a detectable label. Complex formation is monitored, for example, by light microscopy, flow cytometry, fluorometry, or other techniques known in the art. The test sample is usually obtained from an individual suspected of having an immune system deficiency or abnormality.

In another embodiment, the invention features an anti-PRO245, PRO217, PRO30.
The present invention relates to a diagnostic kit comprising 1, PRO266, PRO335, PRO331 or PRO326 antibody and a carrier (eg, buffer) in an appropriate package. This kit preferably comprises the antibodies PRO245, PRO217, PRO301, P
Instructions are provided for use in detecting RO266, PRO335, PRO331 or PRO326 polypeptide. In a further embodiment, the invention comprises a container; a label on the container; and a composition containing an active agent contained in the container, the composition stimulating or promoting an immune response in a mammal. And the label on the container indicates that the composition can be used for the treatment of immune related disorders, and the active agent in the composition is PRO245, PRO217, PRO301, PRO266, PRO335,
It relates to an article of manufacture which is an agent which stimulates or inhibits the expression and / or activity of PRO331 or PRO326 polypeptide. In a preferred embodiment, the active agent is PRO245,
PRO217, PRO301, PRO266, PRO335, PRO331 or PRO326 polypeptide or anti-PRO245, PRO217, PRO301
, PRO266, PRO335, PRO331 or PRO326 antibody. In a further embodiment, the candidate compounds are PRO245, PRO217, PRO3.
01, PRO266, PRO335, PRO331 or PRO326 polypeptide, which is capable of inhibiting the expression and / or activity of PRO245 polypeptide comprising contacting these two components under conditions and for a sufficient time to interact with each other Relating to the identification method. In a particular embodiment, the candidate compound or PRO2
45, PRO217, PRO301, PRO266, PRO335, PRO33
Either 1 or PRO326 polypeptide is immobilized on a solid support. In other embodiments, the non-immobilized component carries a detectable label.

Detailed Description of the Preferred Embodiments I. Definitions The term "immune related disease" means a disease in which a component of the immune system of a mammal causes, mediates or otherwise contributes to morbidity in the mammal. Also included are diseases in which stimulation or intervention of an immune response has a remission effect on disease progression. The term includes immune-mediated inflammatory diseases, non-immune-mediated inflammatory diseases, infectious diseases, immunodeficiency diseases, tumorigenesis and the like. The term "T cell mediated" disease means a disease in which T cells directly or indirectly mediate or contribute to the illness of a mammal. T cell mediated diseases are also associated with cell mediated effects such as m lymphokine mediated effects, and with B cell related effects if, for example, B cells are stimulated by lymphokines secreted by T cells. Immune related and inflammatory diseases, some of which are T cell mediated, examples of diseases treated according to the present invention include systemic lupus erythematosus, rheumatoid arthritis, juvenile chronic arthritis, myeloarthritis, Systemic sclerosis (scleroderma), idiopathic inflammatory myopathy (dermatomyositis, polymyositis), Sjogren's syndrome, systemic vasculitis, sarcoidosis, autoimmune hemolytic anemia (immune pancytopenia, stroke) Nocturnal hemoglobinuria), autoimmune thrombocytopenia (idiopathic thrombocytopenic purpura, immune-mediated thrombocytopenia), thyroiditis (Graves disease, Hashimoto thyroiditis juvenile lymphocytic thyroiditis, atrophic thyroiditis) , Diabetes mellitus, immune-mediated renal disease (glomerulonephritis, renal interstitial nephritis), multiple sclerosis, idiopathic demyelinating polyneuropathy or Guian-Barre syndrome and chronic inflammatory demyelination Central and peripheral nervous system demyelinating diseases such as polyneuropathy, infectious hepatitis (A, B, C, D, E and other non-hepatotrophic viruses), autoimmune chronic active hepatitis, primary biliary Hepatobiliary diseases such as liver cirrhosis, granulomatous hepatitis, and sclerosing cholangitis, inflammatory bowel disease (ulcerative colitis: Crohn's disease), gluten sensitive enteritis, and inflammatory and fibrotic lung diseases such as Whipple's disease, Bullous skin diseases, autoimmune or immune-mediated skin diseases including erythema multiforme and contact dermatitis, psoriasis, asthma, allergic rhinitis, atopic dermatitis, allergic diseases such as food sensitivity and urticaria, Includes lung immune disorders such as eosinophilic pneumonia, idiopathic pulmonary fibrosis and hypersensitivity pneumonia, transplantation-related disorders including transplant rejection and graft versus host disease. AIDS (H
IV infection), hepatitis A, B, C, D and E, bacterial infection, fungal infection, protozoal infection and parasitic infection.

“Treatment” is the intervention carried out by the invention to prevent or alter the progression of disease pathology. Thus, “treatment” refers to both therapeutic treatment and prophylactic or preventative measures. Those in need of treatment include those already with the disorder as well as those in which the disorder is to be prevented. In the treatment of immune related disorders, the therapeutic agent may directly increase or decrease the magnitude of response of components of the immune response, or the disease may be treated with other therapeutic agents, such as antibiotics,
It may be more sensitive to antifungal agents, anti-inflammatory agents, chemotherapy, etc. The "pathology" of immune-related diseases includes all phenomena that compromise the good survival of a patient. This includes, but is not limited to, abnormal or uncontrolled cell growth (neutrophils, eosinophils, monocytes, lymphocytes), antibody production, autoimmune production, complement production, normality of adjacent cells. Inhibition of function, release of cytokines or other secreted products at abnormal levels,
Suppression or exacerbation of inflammation or immune reaction, infiltration of inflammatory cells (neutrophils, eosinophils, monocytes, lymphocytes) into the cell space, and the like. A "mammal" for purposes of treatment means any animal classified as a mammal, including humans, farm and farm animals, zoos, sports, or pet animals such as dogs, horses, cats, cattle, etc. including. Preferably the mammal is a human. Administration of “in combination with” one or more additional therapeutic agents includes simultaneous (temporary) and sequential administration in any order. “Chronic” administration means administration of the drug in a continuous manner as opposed to an acute manner in order to maintain an initial therapeutic effect (activity) for a long period of time. "
An "intermittent" administration is a treatment that is essentially periodic rather than continuous without interruption.

As used herein, “carrier” includes pharmaceutically acceptable carriers, excipients, or stabilizers, which are used for the cells or mammals to which they are exposed at the doses and concentrations used. It is non-toxic. The physiologically acceptable carrier is often a pH buffered aqueous solution. Examples of physiologically acceptable carriers are phosphates, citrate, and other organic acid buffers; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptides; proteins such as Serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone, amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides such as glucose, mannose or dextran, disaccharides and other carbohydrates; such as EDTA Chelating agents; sugar alcohols such as mannitol or sorbitol; salt forming counterions such as sodium; and / or TWEEN (trade name), polyethylene glycol (PEG),
And nonionic surfactants such as PLURONICS (trade name). The term “cytotoxic agent” as used herein means a substance that inhibits or suppresses the function of cells and / or causes cell destruction. The term is meant to include radioisotopes (eg, I ¹³¹ , I ¹²⁵ , Y ⁹⁰ and Re ¹⁸⁶ ), chemotherapeutic agents, and toxins such as enzymatically active toxins of bacterial, fungal, plant or animal origin, or fragments thereof. To be done. A "chemotherapeutic agent" is a compound useful in the treatment of cancer. Examples of chemotherapeutic agents include adriamycin, doxorubicin, epirubicin, 5-fluorouracil, cytosine arabinoside ("Ara-C"), cyclophosphamide, thiotepa, busulfan, cytoxin, taxoids such as paclitaxel (Taxol (trade name). ), Bri
stol-Myers Squibb Oncology, Princeton, NJ) and doxetaxel (Taxotere (
(Trade name), Rhone-Poulenc Rorer, Antony, France), toxotere, methotrexate, cisplatin, melphalan, vinblastine, bleomycin, etoposide, ifosfamide, mitomycin C, mitoxantrone, vincristine, vinorelbine, carboplatin, teniposide, daunomycin, carnomycin, daunomycin , Aminopterin, dactinomycin, mitomycin, esperamicin (US Pat. No. 4,675,187), melphalan, and other related nitrogen mustards. Also included within this definition are hormone-like agents that act to regulate or inhibit hormone action on tumors such as tamoxifen and onapristone.

As used herein, “growth inhibitor” means a compound or composition that inhibits in vitro or in vivo the growth of cells, particularly cancer cells that overexpress any gene identified herein. . Thus, growth inhibitors significantly reduce the proportion of cells overexpressing such genes in S phase. Examples of growth inhibitory agents include agents that inhibit the cell cycle (at a position other than S phase), such as agents that induce G1 arrest or M phase arrest. Classical M-phase blockers include vincas (vincristine and vinblastine), taxol, and topo II, such as doxorubicin, epirubicin, daunorubicin, etoposide, and bleomycin. These agents that arrest G1 also spill over to S-phase arrest, such as DNA alkylating agents, eg,
Tamoxifen, prednisone, dacarbazine, mechlorethamine, cisplatin, methotrexate, 5-fluorouracil, and ara-C. For more information, see The Molecular Basis of Cancer, Mendelsohn and Israel, ed., Chapter 1,
Title `` Cell cycle reguration, oncogene, and antineoplastic drugs '', Murak
ami et al., (WB Saunders: Philadelphia, 1995), especially p13. The term "cytokine" is a general term for proteins released by one cell population that act on another cell as intercellular mediators. Examples of such cytokines are lymphokines, monokines, and traditional polypeptide hormones. Cytokines include growth hormones such as human growth hormone, N-methionyl human growth hormone, and bovine growth hormone; parathyroid hormone; thyroxine; insulin; proinsulin; relaxin; prorelaxin; glycoproteins such as follicle stimulating hormone (FSH). ), Thyroid stimulating hormone (T
SH) and luteinizing hormone (LH); liver growth factor; fibroblast growth factor; prolactin; placental lactogen; tumor necrosis factors-α and -β; Mueller inhibitor; mouse gonadotropin-related peptide; inhibin; activin; blood vessels Endothelial growth factor; Integrin; Thrombopoietin (TPO); Nerve growth factor such as NGF-β; Platelet growth factor; Transforming growth factor (TGF) such as TGF-α and TGF-β; Insulin-like growth factor-I and II; Erythropoietin (EPO
); Bone-inducing factor; Interferons such as interferon-α, -β, and -γ;
Colony stimulating factors (CSFs), such as macrophage-CSF (M-CSF);
Granulocyte-Macrophage-CSF (GM-CSF); and Granulocyte-CSF (G-CS
F); interleukins (ILs) such as IL-1, IL-1, IL-2, IL-
3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-11, I
L-12; tumor necrosis factors such as TNF-α and TNF-β; and other polypeptide factors including LIF and kit ligand (KL). When used here,
The term cytokine includes proteins from natural sources or from recombinant cell culture and is the biologically active equivalent of native sequence cytokines.

As used herein, “PRO245, PRO217, PRO301, PRO
266, PRO335, PRO331 or PRO326 polypeptide "is a naturally derived PRO245, PRO217, PRO301, PRO266, P.
Natural sequences PRO245, PRO217, PRO301, PRO266, PRO335 having the same amino acid sequence as RO335, PRO331 or PRO326.
It means PRO331 or PRO326. Such a native sequence PRO245,
PRO217, PRO301, PRO266, PRO335, PRO331 or PRO326 can be isolated from nature or can be produced by recombinant and / or synthetic means. This term specifically refers to naturally occurring truncated or secreted forms (eg, extracellular domain sequences), naturally occurring mutant forms (eg, alternatively spliced forms) and PRO245, PRO217, PRO30 of a PRO polypeptide.
1, PRO266, PRO335, PRO331 or PRO326 naturally occurring allelic variants are included. In one embodiment of the invention, the native sequence PRO24
5, PRO217, PRO301, PRO266, PRO335, PRO331
Alternatively, PRO326 is a mature or full-length native sequence PRO245, PRO217, PRO containing the amino acid sequences shown in FIG. 4, 6, 8, 10, 12, 14 and 16.
301, PRO266, PRO335, PRO331 or PRO326. The term "polypeptide of the invention" refers to the individual PRO245, PRO217.
, PRO301, PRO266, PRO335, PRO331 or PRO326
By each polypeptide is meant. "A polypeptide of the invention" or "PRO245,
All disclosures herein that refer to "PRO217, PRO301, PRO266, PRO335, PRO331 or PRO326 polypeptides" refer to each individual polypeptide as well as to the whole. For example, the description of its preparation, its purification, its derivatization, the formation of antibodies thereto, its administration, the composition comprising it, the treatment of diseases therewith and the like relates to each individual polypeptide of the invention. The term "compounds of the invention" includes the polypeptides of the invention, as well as agonist and antagonist antibodies of these polypeptides, peptides or small molecules with agonistic or antagonistic activity developed from the polypeptides and the like.

The term “polypeptide of the invention” also refers to PRO245, PRO217,
Also included are variants of PRO301, PRO266, PRO335, PRO331 or PRO326 polypeptides. “Variant” polypeptides include PRO245, PRO217, PRO301, PRO266, PRO335 as defined below.
, PRO331 or PRO326 polypeptide amino acid sequence and at least about 8
It is an active polypeptide with 0% amino acid sequence identity. These variants are
For example, it includes a polypeptide with one or more amino acid residues added or deleted at the N- and / or C-terminus and one or more internal domains. Usually, the variant polypeptide is PRO245, PRO217, PRO301, PRO266, P.
At least about 80% amino acid sequence identity with the amino acid sequence of RO335, PRO331 or PRO326 polypeptide, preferably at least about 81% amino acid sequence identity, more preferably at least about 82% amino acid sequence identity, more preferably At least about 83% amino acid sequence identity, more preferably at least about 84% amino acid sequence identity, more preferably at least about 85% amino acid sequence identity, more preferably at least about 86% amino acid sequence identity, Preferably at least about 87% amino acid sequence identity, more preferably at least about 88% amino acid sequence identity, more preferably at least about 89% amino acid sequence identity, more preferably at least about 90% amino acid sequence identity. , More preferably less Also about 91% amino acid sequence identity, more preferably at least about 92% amino acid sequence identity, more preferably at least about 93% amino acid sequence identity, more preferably at least about 94% amino acid sequence identity, and Preferably at least about 95% amino acid sequence identity, more preferably at least about 96% amino acid sequence identity, more preferably at least about 97% amino acid sequence identity, more preferably at least about 98% amino acid sequence identity. , And, more preferably, has at least about 99% amino acid sequence identity. Variant polypeptides do not include native polypeptide sequences. Generally, variant polypeptides are at least about 10 amino acids in length, more often at least about 20 amino acids in length, more at least about 30 amino acids in length, more at least about 40 amino acids in length, more at least about 50 amino acids in length. , More at least about 60 amino acids long, more than at least about 70 amino acids long,
More than at least about 80 amino acids in length, more than at least about 90 amino acids in length, more at least about 100 amino acids in length, and more at least about 150 in length.
Amino acids long, more often at least about 200 amino acids long, more often at least about 300 amino acids long, or longer.

The “percent (as
%) Amino acid sequence identity ", PRO245, which aligns the sequences and introduces gaps where necessary to obtain maximal percent sequence identity and does not consider any conservative substitutions to be part of the sequence identity. , PRO217, PRO301, PRO266,
It is defined as the percentage of amino acid residues in the candidate sequence that are identical to the amino acid residues in the PRO335, PRO331 or PRO326 polypeptide sequence. Alignment for the purpose of determining percent amino acid sequence identity can be performed by a variety of methods within the skill of the art, including BLAST, BLAST-2, ALIGN, ALIGN-2 or Mega.
This can be accomplished by using publicly available computer software such as lign (DNASTAR) software. One of ordinary skill in the art can determine the appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. However, for the purposes herein, the% amino acid sequence identity values are given in the sequence comparison program ALIGN-, where the complete source code for the ALIGN-2 program is given in Figure 2A-P, as described below. Obtained using 2. The ALIGN-2 sequence comparison computer program was created by Genentech, Inc. and the source code shown in Figure 2A-P is submitted to the US Copyright Office, Washington DC, 20559 with user documentation and under US Copyright Registration No. TXU510087. It is registered in. ALIGN-2 is publicly available through Genentech, Inc., South San Francisco, California and may be compiled from the source code given to Figure 2A-P. ALI
The GN-2 program is compiled for use with a UNIX operating system, preferably Digital UNIX V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and do not change. For purposes herein, the% amino acid sequence identity of a given amino acid sequence A, to or to a given amino acid sequence B (or to or to a given amino acid sequence B or A given amino acid sequence A with or including some degree of% amino acid sequence identity may also be calculated as: 100 times the fraction X / Y, where X is the sequence alignment program ALIGN. -2 is the number of amino acid residues with a score that is identical by alignment of A and B, and Y is the total number of amino acid residues in B. It will be appreciated that when the length of amino acid sequence A differs from the length of amino acid sequence B, the% amino acid sequence identity of A to B is different from the% amino acid sequence identity of B to A. As an example of calculating the% amino acid sequence identity using this method, Fig1A-B is a method for calculating the% amino acid sequence identity of an amino acid sequence called "comparative protein" with an amino acid sequence called "PRO". Indicates.

Unless otherwise indicated, all% amino acid sequence identity values herein are as set forth above.
Obtained using the ALIGN-2 sequence comparison computer program. However,%
Amino acid sequence identity is determined by the sequence comparison program NCBI-BLAST2 (Altschul et al., Nucleic
Acids Res. 25: 3389-3402 (1997)). The NCBI-BLAST2 sequence comparison program can be downloaded from http://ww.ncbi.nlm.nih.gov. NC
BI-BLAST2 uses several search parameters, all of which are set to initial values, eg unmask = OK, chain = all, expected occurrence = 10, minimum low compound length = 15/5 , Multipath e-value = 0.01, multipath constant = 25
, Final gap alignment drop-off = 25, and scoring matrix = BLOSUM62. In the situation where NCBI-BLAST2 is used for amino acid sequence comparisons, the% amino acid sequence identity of a given amino acid sequence A with or to a given amino acid sequence B (or with a given amino acid sequence B, or On the other hand, a certain percentage
A given amino acid sequence A with or containing amino acid sequence identity may also be calculated) as follows: 100 times the fraction X / Y, where X is A in the sequence alignment program NCBI-BLAST2. And the number of amino acid residues in the score that were matched by the alignment of B to be identical, where Y is B
Is the total number of amino acid residues. It will be appreciated that when the length of amino acid sequence A differs from the length of amino acid sequence B, the% amino acid sequence identity of A to B is different from the% amino acid sequence identity of B to A.

The term “polypeptide of the invention” also refers to amino acid residues having similar but not identical characteristics in the compared sequences in the sequence comparisons performed as described above. Also included are polypeptides that include. These polypeptides are termed "positive". The amino acid residue that is scored as a positive value for the target amino acid residue is the same as the target amino acid residue, or the target amino acid residue (as specified in Table 1 below). 2) is a preferable substitution. For the purposes herein, the% positive value of a given amino acid sequence A, with or with respect to a given amino acid sequence B (or with respect to a given amino acid sequence B, or to a certain extent thereto). A given amino acid sequence with or including% positives (also referred to as A) can be calculated as follows: 100 times the fraction X / Y, where X is the sequence alignment program ALIGN-2 A and B. Is the number of amino acid residues that are scored as positive by the alignment, and Y is the total number of amino acid residues in B. It will be appreciated that if the length of the amino acid sequence A differs from the length of the amino acid sequence B, the% positive of A to B is different from the% positive of B to A.

By “variant polynucleotide of the invention” or “variant nucleic acid sequence of the invention” is meant a nucleic acid molecule that encodes a polypeptide of the invention that is active as defined herein, DNA35638, DNA33094, DNA40628, DNA37150
, DNA41388, DNA40981, or DNA37140 or a specifically derived fragment thereof, at least about 80% nucleic acid sequence identity. Usually, the mutant polynucleotide of the present invention comprises DNA35638, DNA33094, DNA40628, DNA37150,
At least about 80% nucleic acid sequence identity with DNA41388, DNA40981, or DNA37140 or a specifically derived fragment thereof, preferably at least about 81.
% Nucleic acid sequence identity, more preferably at least about 82% nucleic acid sequence identity, more preferably at least about 83% nucleic acid sequence identity, more preferably at least about 84% nucleic acid sequence identity, more preferably at least About 85% nucleic acid sequence identity, more preferably at least about 86% nucleic acid sequence identity, more preferably at least about 87% nucleic acid sequence identity, more preferably at least about 88% nucleic acid sequence identity, more preferably Is at least about 89% nucleic acid sequence identity, more preferably at least about 90% nucleic acid sequence identity, more preferably at least about 91% nucleic acid sequence identity, more preferably at least about 92% nucleic acid sequence identity, More preferably at least about 93% nucleic acid sequence identity, more preferably at least about 9
4% nucleic acid sequence identity, more preferably at least about 95% nucleic acid sequence identity,
More preferably at least about 96% nucleic acid sequence identity, more preferably at least about 97% nucleic acid sequence identity, more preferably at least about 98% nucleic acid sequence identity, and more preferably at least about 99% nucleic acid sequence identity. Has sequence identity. Variants do not include the native nucleotide sequence. In this respect, due to the degeneration of the genetic code, the nucleotides DNA35638, DNA33094, DNA
40628, DNA37150, DNA41388, DNA40981, or D
Many variant polynucleotides of the present invention having about 80% nucleic acid sequence identity with NA37140 have been identified as PRO245, PRO217, PRO301, PRO266, P
The amino acid sequence of RO335, PRO331 or PRO326 or A
One of ordinary skill in the art will readily appreciate that it encodes a polypeptide having an amino acid sequence identical to that encoded by the clone deposited with the TCC. Generally, variant polynucleotides of the invention will be at least about 30 nucleotides in length, more at least about 60 nucleotides in length, and more at least about 90 nucleotides in length.
Nucleotide length, more at least about 120 nucleotides, more at least about 150 nucleotides, more at least about 180 nucleotides, more at least about 210 nucleotides, more at least about 2
40 nucleotides, more at least about 270 nucleotides, more at least about 300 nucleotides, more at least about 450 nucleotides, more at least about 600 nucleotides, more at least about 900 nucleotides, or More than that.

The "percent (%) nucleic acid sequence identity" identified for a PRO polypeptide-encoding nucleic acid sequence as defined herein is that required to align the sequences and obtain the maximum percent sequence identity. It is then defined as the percentage of nucleotides in the candidate sequence that are identical to the nucleotides in the PRO polypeptide-encoding sequence, without introducing a gap and not considering any conservative substitutions as part of the sequence identity. Alignment for the purpose of determining percent nucleic acid sequence identity can be performed by a variety of methods within the skill of the art, including BLAST, BLAST-2, ALIGN, ALIGN-2 or Megalign (DNA
This can be achieved by using publicly available computer software such as STAR software. One of ordinary skill in the art can determine the appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. However, for purposes herein, the% nucleic acid sequence identity values are calculated as described below for AL
The complete source code for the IGN-2 program can be obtained using the sequence comparison program ALIGN-2 provided in Fig2A-P. The ALIGN-2 sequence comparison computer program was created by Genentech, Inc. and the source code shown in Figure 2A-P is submitted to the US Copyright Office, Washington DC, 20559 with user documentation and under US Copyright Registration No. TXU510087. It is registered in. ALIGN-2 is publicly available through Genentech, Inc., South San Francisco, California and F
You may compile from the source code given to ig2A-P. The ALIGN-2 program is compiled for use with a UNIX operating system, preferably Digital UNIX V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and do not change. For the purposes herein, the% nucleic acid sequence identity of a given nucleic acid sequence C with or to a given nucleic acid sequence D (or with a given nucleic acid sequence D,
Or a given amino acid sequence C which has or contains some% nucleic acid sequence identity thereto) is calculated as follows: 100 times the fraction W / Z where W Is the number of nucleotides in the score that were matched by the C and D alignments of the sequence alignment program ALIGN-2, and Z is the total number of nucleotides in D. When the length of the nucleic acid sequence C is different from the length of the nucleic acid sequence D, C
It will be appreciated that the% nucleic acid sequence identity of D to C is different from the% nucleic acid sequence identity of D to C. As an example of calculating% nucleic acid sequence identity using this method, Figure 1C-D is a nucleic acid sequence called "PRO-DNA" called "comparative DNA".
2 shows a method of calculating% nucleic acid sequence identity to a nucleic acid sequence referred to as.

Unless otherwise indicated, all% nucleic acid sequence identity values herein are ALIG as described above.
Obtained using the N-2 sequence comparison computer program. However,% nucleic acid sequence identity is determined by the sequence comparison program NCBI-BLAST2 (Altschul et al., Nucleic Acids R
es. 25: 3389-3402 (1997)). The NCBI-BLAST2 sequence comparison program can be downloaded from http://ww.ncbi.nlm.nih.gov. NCBI-BLAST
2 uses some search parameters, all of which are set to initial values, eg unmask = ok, chains = all, expected occurrence = 10, minimum low composite length = 15/5, multi Path e-value = 0.01, multipath constant = 25, final gap alignment dropoff = 25, and scoring matrix = BL
Including OSUM62. In the context where NCBI-BLAST2 is used for sequence comparisons, the% nucleic acid sequence identity of a given nucleic acid sequence C with, or to a given nucleic acid sequence D (or with a given nucleic acid sequence D or A given nucleic acid sequence C which has or contains a certain percentage of nucleic acid sequence identity to it can also be calculated) as: 100 times the fraction W / Z where W is the sequence Alignment program NCBI-BLAST2 C and D alignments are the number of nucleotides with a score that is identical and Z is D
Is the total number of nucleotides in. It will be appreciated that when the length of nucleic acid sequence C differs from the length of nucleic acid sequence D, the% nucleic acid sequence identity of C to D is different from the% nucleic acid sequence identity of D to C.

In another embodiment, the variant polynucleotide of the invention is a nucleic acid molecule encoding an active polypeptide of the invention, preferably under full stringency hybridization and washing conditions. It can hybridize to a nucleotide sequence that encodes a polypeptide. The mutant polypeptide of the present invention may be one encoded by the mutant polynucleotide of the present invention. An "isolated" nucleic acid molecule that encodes a polypeptide of the invention is a nucleic acid molecule that has been identified and separated from at least one contaminating nucleic acid molecule that is normally associated with the natural source of the nucleic acid encoding the polypeptide. . Isolated polypeptide-encoding nucleic acid molecule is in a form or setting other than that found in nature. Thus, isolated nucleic acid molecule is distinguished from the polypeptide-encoding nucleic acid molecule as it exists in natural cells. However, an isolated nucleic acid molecule that encodes a polypeptide of the invention is included, for example, in a cell that normally expresses a polypeptide of the invention, where the nucleic acid molecule is in a chromosomal location different from that of the native cell. It includes a polypeptide-encoding nucleic acid molecule. The expression "control sequence" means a DNA sequence necessary for the expression of an operably linked coding sequence in a particular host organism. For example, control sequences that are suitable for prokaryotes include a promoter, optionally an operator sequence, and a ribosome binding site. Eukaryotic cells are known to utilize promoters, polyadenylation signals and enhancers. Nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For example, if the DNA of the presequence or secretory leader is expressed as a preprotein that participates in the secretion of the polypeptide, the DNA of that polypeptide
Is operably linked to; a promoter or enhancer is operably linked to the coding sequence if it affects the transcription of the sequence; or the ribosome binding site is such that it facilitates translation. Is operably linked to the coding sequence. Generally, "operably linked" means that D is bound to
It means that the NA sequences are contiguous and, in the case of a secretory leader, contiguous and in the reading phase. However, enhancers do not necessarily have to be in close proximity. Binding is accomplished by ligation at convenient restriction sites. If such sites do not exist, then synthetic oligonucleotide adapters or linkers are used in accord with conventional practice.

The “stringency” of a hybridization reaction is readily determined by one of ordinary skill in the art and is an empirical calculation that generally depends on probe length, wash temperature, and salt concentration. In general, longer probes have higher temperatures for proper annealing and shorter probes have lower temperatures. Hybridization generally depends on the ability of denatured DNA to reanneal when complementary strands are present in an environment near, but below their melting temperature. The higher the degree of desired homology between the probe and the hybridizable sequence, the higher the relative temperature that can be used. As a result, higher relative temperatures make the reaction conditions more stringent, while lower temperatures reduce stringency.
Moreover, stringency is inversely proportional to salt concentration. Further details and explanations of the stringency of the hybridization reaction can be found in Ausubel et al., Current Protocols in Molecular Biology, Wiley.
See Interscience Publishers, (1995). “Stringent conditions” or “highly stringent conditions” as defined herein means (1) low ionic strength and high temperature for washing, eg 0.015M sodium chloride / 0.0015M citric acid at 50 ° C. Using sodium / 0.1% sodium dodecyl sulfate; (2) denaturing agents such as formamide during hybridization, eg at 42 ° C
Using 50% (v / v) formamide and 0.1% bovine serum albumin / 0.1% ficoll / 0.1% polyvinylpyrrolidone / 50 mM sodium phosphate buffer pH 6.5, and 750 mM sodium chloride, 75 mM sodium citrate; (3) 50 at 42 ℃
%% formamide, 5xSSC (0.75M NaCl, 0.075M sodium citrate)
, 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5x Denhardt's solution, sonicated salmon sperm DNA (50 μg / ml), 0.1% SDS, and 10% dextran sulfate at 42 ° C. Identified by a wash in 0.2xSSC (sodium chloride / sodium citrate) and a high stringency wash consisting of 50% formamide at 55 ° C followed by 0.1xSSC with EDTA at 55 ° C. “Moderate stringency conditions” are described in Sambrook et al., Molecular Cloning: A Laboratory.
Manual (Identified as described in New York: Cold Spring Harbor Laboratory Press, 1989, and involves the use of less stringent wash solutions and hybridization conditions (eg, temperature, ionic strength and% SDS) as described above. Moderate stringency conditions were 20% formamide, 5x SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate, pH 7.6, 5x Denhardt's solution, 10% dextran sulfate, and 20 mg / mL. Conditions include overnight incubation in a solution containing denatured sheared salmon sperm DNA at 37 ° C., followed by washing the filters in 1 × SSC at 37-50 ° C. Those skilled in the art will need to adapt to factors such as probe length. Accordingly, one will recognize how to adjust temperature, ionic strength, etc.

The term “epitope tag,” as used herein, refers to a chimeric polypeptide comprising a polypeptide of the invention fused to a “tag polypeptide”.
The tag polypeptide has a sufficient number of residues to provide an epitope for which the antibody can be produced, or an epitope identifiable by some other reagent,
Its length is short enough so as not to interfere with the activity of the PRO polypeptide of interest.
Also, the tag polypeptide is preferably fairly unique so that the antibody does not substantially cross-react with other epitopes. Suitable tag polypeptides generally have at least 6 amino acid residues, usually about 8 to about 50 amino acid residues (preferably about 10 to about 20 residues). “Active” and “activity” in the context of variants of the polypeptides of the invention refer to
By a form of a protein of the invention which retains the biological and / or immunological activity of the naturally occurring or naturally occurring polypeptide of the invention. "Biological activity" in the context of an antibody or other antagonist molecule (eg, small organic or inorganic molecule, peptide, etc.) that can be identified by the screening assays disclosed herein is that those molecules are responsible for the organization of inflammatory cells. Used to refer to the ability to induce or inhibit invasion, or to stimulate or inhibit T cell proliferation and to stimulate or inhibit lymphokine release by cells. Another preferred activity is the enhancement or inhibition of vascular permeability. The term "antagonist" is used in its broadest sense and includes any molecule that wholly or partially blocks, inhibits or neutralizes the biological activity of the native polypeptides of the invention disclosed herein. Similarly, the term "agonist" is used in its broadest sense and includes any molecule that mimics the biological activity of a naturally occurring polypeptide of the invention disclosed herein. Suitable agonist or antagonist molecules include in particular agonist or antagonist antibodies or antibody fragments, fragments or amino acid sequence variants of naturally occurring polypeptides of the invention, peptides, small organic molecules and the like. A "small molecule" is defined herein as having a molecular weight of less than about 600 daltons.

“Antibodies” (Abs) and “immunoglobulins” (Igs) are glycoproteins with the same structural characteristics. Antibodies exhibit specificity for a particular antigen, but immunoglobulins include both antibodies and other antibody-like molecules that do not have antigen specificity. The latter type of polypeptide is produced, for example, by the lymphatic system at low levels and by myeloma at enhanced levels. The term "antibody" is used in its broadest sense,
Without limitation, intact monoclonal antibodies, polyclonal antibodies, multispecific antibodies formed from at least two intact antibodies (eg, bispecific antibodies).
, And antibody fragments so long as they have the desired biological activity. Anti-
PRO245, PRO217, PRO301, PRO266, PRO335, P
The RO331 or PRO326 antibody is PRO245, PRO217, PRO30.
1, an antibody that immunologically binds to PRO266, PRO335, PRO331 or PRO326 polypeptide. The antibody may bind to any domain of the polypeptide of the invention which is capable of contacting the antibody. For example, the antibody may bind to any extracellular domain of the polypeptide or, if the entire polypeptide is secreted, to any domain on the polypeptide available for binding by the antibody. "Native antibodies" and "native immunoglobulins" are heterologous tetrameric glycoproteins of about 150,000 daltons, usually composed of two identical light (L) chains and two identical heavy (H) chains. . Each light chain is attached to the heavy chain by one covalent disulfide bond, and the number of disulfide bonds varies among heavy chains of different immunoglobulin isotypes. Each heavy and light chain also has regularly spaced interchain disulfide bridges. Each heavy chain has at one end a variable domain ( _VH ) followed by a number of constant domains. Each light chain has a variable domain ( _VL ) at one end and a constant domain at the other end; the constant domain of the light chain is aligned with the first constant domain of the heavy chain and the variable domain of the light chain is the heavy chain. Aligned with the variable domain of. Particular amino acid residues are believed to form the interface between the light and heavy chain variable domains.

The term “variable” means that certain sites in the variable domain differ extensively in sequence among antibodies and are used in the binding and specificity of each particular antibody for its particular antigen. Means a fact. However, the variability is not evenly distributed over the variable domain of the antibody. It is concentrated in three segments called complementarity determining regions (CDRs) or hypervariable regions, which are both in the variable domains of the light and heavy chains. The more highly conserved portions of variable domains are called the framework region (FR). The variable domains of natural heavy and light chains are largely in beta.
-Sheet structure, each containing four FR regions linked by CDRs that form a loop bond that joins the beta-sheet structure and in some cases forms part of it. The CDRs of each chain are bound in closer proximity by the FRs and the C of the other chain
Together with DR, it contributes to the formation of the antigen-binding site of antibodies (Kabat et al., NIH Publ. No.
.91-3242, Vol. I, pp. 647-669 (1991)). The constant domains are not directly involved in binding the antibody to the antigen, but exhibit various effector functions such as the involvement of the antibody in antibody-dependent cellular cytotoxicity. As used herein, "hypervariable region" or "complementarity determining region" (CDR
The term) forms the antigen binding site and determines the subregions that are the major determinants of antigen specificity. According to one definition, they are eg residues of the light chain variable region (
Kabat nomenclature) 24-34 (L1), 50-56 (L2) and 89-97 (L3) and 31-35 (H1), 50-65 (H2) and 95-102 (H3) of the heavy chain variable region. Can be Kabat et al., Sequences of Proteins of Immunological Interest, 5th edition, P
ublic Health Service, National Institutes of Health, Bethesda, MD. (1991)
. Alternatively, or in addition to the region defined by Kabat, the hypervariable region is
Hypervariable loop ", eg, residues of the light chain variable region (Chothia nomenclature) 26-3
2 (L1), 50-52 (L2) and 91-96 (L3) and residues (Chothia nomenclature)
26-32 (H1), 53-55 (L2) and 96-101 (L3); Choth
ia and Lesk J. Mol. Biol. 196: 901-917 (1987). "Framework" or "F
The "R" residues are the variable domain residues of relatively low sequence variability between the CDR regions.

An “antibody fragment” comprises a portion of a native antibody, preferably the antigen binding or variable region of the native antibody. Examples of antibody fragments are Fab, Fab ′, F (ab ′) ² , and F.
v fragment; diabody; linear antibody (Zapata et al., Protein Eng. 8 (10):
1057-1062 [1995]); single-chain antibody molecules; and multispecific antibodies formed from antibody fragments. Papain digestion of antibodies, termed "Fab" fragments, refers to two identical antigen-binding fragments, each with a single antigen-binding site, and the remaining "Fc" fragment, PRO245,
PRO217, PRO301, PRO266, PRO335, PRO331 or PRO326 reflect the ability to crystallize readily. F (ab '), which has two antigen-binding sites by pepsin treatment, but may be a cross-linking antigen
Two fragments are generated. "Fv" is the minimum antibody fragment that contains a complete antigen recognition and binding site. This region consists of a dimer of one heavy and one light chain in tight, non-covalent association. In this arrangement, the three CDRs of each variable region interact to determine the antigen binding site on the surface of the _VH - _VL dimer. To be precise, the six CDRs confer the antigen binding specificity on the antibody. However, a single variable domain (or three C specific for an antigen)
Even half the Fv containing only DR) has the ability to recognize and bind antigen, but with a lower affinity than the entire binding site. The Fab fragment also contains the constant domain of the light chain and the first constant domain (CH
Also includes 1). Fab fragments are produced by the addition of a few residues at the carboxyl terminus of the heavy chain CH1 domain including one or more cysteines from the antibody hinge region.
It differs from the ab fragment. Fab'-SH is the designation herein for Fab 'in which the cysteine residues of the constant domains bear a free thiol group. F (ab ') 2 antibody fragments originally were produced as pairs of Fab' fragments which have hinge cysteines between them. Other chemical couplings of antibody fragments are also known. "Light chains" of antibodies (immunoglobulins) from any species are classified into one or two distinct types called kappa (kappa) and lambda (lambda) based on the amino acid sequences of their constant domains. it can.

[0026] Based on the amino acid sequences of the constant domain of their heavy chains, immunoglobulins are divided into different classes. Five major classes of immunoglobulins: IgA, Ig
D, IgE, IgG, and IgM, some of which are further subclasses (
Isotype), for example, IgG1, IgG2, IgG3, IgG4, IgA and IgA2. The heavy chain constant domains that correspond to the different classes of immunoglobulins are called α, δ, ε, γ, and μ, respectively. The subunit structure and three-dimensional arrangement of different classes of immunoglobulins are well known. The term "monoclonal antibody" as used herein is derived from a substantially homogeneous population of antibodies, ie, a population that is identical except for the naturally-occurring mutations in which the individual antibodies that make up the population are present in small amounts. Means an antibody. Monoclonal antibodies are highly specific, being directed against a single antigenic site. Furthermore, each monoclonal antibody is directed against a single determinant on the antigen, unlike conventional (polyclonal) antibodies, which typically include different antibodies directed against different determinants (epitopes). . In addition to their specificity, monoclonal antibodies are advantageous in that they are synthesized by hybridoma culture and are not contaminated with other immunoglobulins. The modifier "monoclonal" indicates the character of the antibody as obtained from a substantially homogeneous population of antibodies and not to be construed as requiring production of the antibody by any particular method. For example, the monoclonal antibody used in accordance with the present invention is Kohler
Et al., Nature, 256: 495 [1975] and may be made by the hybridoma method, or recombinant DNA methods (see, eg, US Pat. No. 4,816,567).
May be created by. “Monoclonal antibodies” are also available from phage antibody libraries, for example, Clackson et al., Nature, 352: 624-628 [1991] and Marks et al., J. Mo.
It may be isolated using the technique described in I. Biol., 222: 581-597 (1991). See also US Pat. Nos. 5,750,373, 5,571,698, 5,403,484 and 5,223,409 which describe the preparation of antibodies using phagemids and phage vectors. Here, the monoclonal antibody particularly includes a “chimeric” antibody (immunoglobulin), which corresponds to an antibody in which a part of the heavy or light chain is derived from a specific species or belongs to a specific antibody class or subclass. Antibodies that are identical or homologous to a sequence, but whose remainder of the chain is identical or homologous to the corresponding sequences of antibodies derived from other species or belonging to a particular antibody class or subclass, as well as those desired They are fragments of these antibodies as long as they exhibit biological activity (US Pat. No. 4,816,567; Morrison et al., Proc. Natl. Acad. Sci. USA, 81: 6851-6855 [1984]).

“Humanized” forms of non-human (eg, murine) antibodies are specific chimeric immunoglobulins, immunoglobulin chains or fragments thereof (eg, Fv, Fab) that contain minimal sequence derived from non-human immunoglobulin. , Fab ′, F (ab ′) ₂ or other antigen-binding sequence of an antibody). For the most part, humanized antibodies are human immunoglobulins (recipient antibodies) whose complementarity determining regions (CDRs).
) Is substituted with a residue having a desired specificity, affinity and capacity derived from a CDR (donor antibody) of a species other than human such as mouse, rat and goat. In some cases, residues in the Fv framework region (FR) of human immunoglobulin are replaced with corresponding non-human residues. Furthermore, humanized antibodies may comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. These modifications are made to further refine and maximize antibody performance. Generally, a humanized antibody corresponds to at least one of the CDR regions to that of a non-human immunoglobulin, and at least one of all or substantially all of the FR regions to a human immunoglobulin consensus sequence, typically Will contain substantially all of the two variable domains. Optimal humanized antibodies will also contain at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. For further details, see Jones et al., Nature 321: 522 -525 (1986); Reichmann et al., Nat.
ure 332: 323-329 (1988); and Presta, Curr. Op. struct. Biol. 2: 593 -596.
See (1992). The term “humanized antibody” means that the antigen-binding region of an antibody is
Includes "primatized" antibodies derived from antibodies produced by immunizing macaques with an antigen of interest. Old World Monkey
Antibodies containing residues from are also within the scope of the invention. U.S. Pat.Nos. 5,658,570 and 5,6
93,780, 5,681,722, 5,750,105 and 5,756,096.

Antibodies and fragments thereof according to the invention also include “affinity matured” antibodies in which the antibody has been modified to alter the amino acid sequence of one or more CDR regions and / or framework regions, such that the antibody or fragment thereof. Have altered affinities for the antigen they bind. In affinity maturation, the affinity of the mature antibody for the antigen is increased or decreased compared to the starting antibody. Typically, the starting antibody is a humanized, human, chimeric or murine antibody and the affinity matured antibody has a higher affinity than the starting antibody. During the maturation process, one or more amino acid residues in the CDR or framework regions are changed to different residues using any standard method. Suitable methods include known cassette mutagenesis (Wells et al., 1985, Gene, 34: 315) or oligonucleotide-mediated mutagenesis (Zoller et al., 1987, Nucl. Acids Res., 10: 6487-6504). Including point mutations using. Affinity maturation is also performed using well known selection methods that generate a large number of variants and select variants with the desired affinity from a pool or library of variants based on improved affinity for the antigen or ligand. You may. Known phage display techniques can be conveniently used for this method. See, for example, US Pat. No. 5,750,373; US Pat. No. 5,223,409. Human antibodies are also within the scope of the antibodies of the invention. Human antibodies are expressed in phage display libraries [Hoogenboom and Winter, J. Mol. Biol., 227: 381 (1992); Marks et al., J. Mol.
Biol., 222: 581 (1991)], and various methods known in the art can be used. The methods of Cole et al. And Boerner et al. Can also be used for the preparation of human monoclonal antibodies [Cole et al., Monoclonal Antibodies and Canc
er Therapy, Alan R. Liss. p. 77 (1985) and Boerner et al., J. Immunol., 147 (1):
86-95 (1991); US 5,750,373]. Similarly, human antibodies can be produced by introducing human immunoglobulin loci into transgenic animals, eg, mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon administration, production of human antibodies is observed that is very similar to that found in humans in all respects, including gene rearrangement, assembly, and antibody repertoire. This method is described, for example, in US Pat. Nos. 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425;
Et al., Bio / Technology 10, 779-783 (1992); Lonberg et al., Nature 368 856-859 (19
94); Morrison, Nature 368, 812-13 (1994); Fishwild et al., Nature Biotechnolo.
gy 14, 845-51 (1996); Neuberger, Nature Biotechnology 14, 826 (1996); Lo
nberg and Huszar, Intern. Rev. Immunol. 13 65-93 (1995).

“Single-chain Fv” or “sFv” antibody fragments include antibody fragments that comprise the V _H and V _L domains of an antibody, these domains being present in a single polypeptide chain. Preferably, the Fv polypeptide further comprises a polypeptide linker between the _VH and _VL domains, which enables the sFV to form the desired structure for antigen binding.
For an overview of sFv, see The Pharmacology of Monoclonal Antibodies, vol.
113, Rosenburg and Moore, Springer-Verlag, New York, pp. 269-315 (1994).
See Pluckthun. The term "diabody" refers to a small antibody fragment that has two antigen binding sites, which fragment is within the same polypeptide chain ( _VH - _VL ) and has a light chain variable domain ( _VL ).
To the heavy chain variable domain ( _VH ). A linker that is so short that it allows pairing of two domains on the same chain is used to force the domain to pair with the complementary domain of the other chain, creating two antigen binding sites. Diabodies are described, for example, in EP404097; WO93 / 11161; and Hollinger et al., Pro.
USA Natl. Acad. Sci. USA 90: 6444-6448 (1993). An "isolated" antibody means one that has been identified and separated or recovered from a component of its natural environment. Contaminant components of its natural environment are materials that interfere with the diagnostic or therapeutic use of the antibody, including enzymes, hormones, and other nonproteinaceous solutes. In a preferred embodiment, the antibody is (1) up to 95 wt% or more, most preferably 99 wt% antibody, as determined by the Lowry method, (2)
By using a spinning cup sequenator, at least 15 N
To the extent sufficient to obtain the residues of the terminal or internal amino acid sequence, or (3)
Purified to homogeneity by SDS-PAGE under reducing or non-reducing conditions using Coomassie blue or preferably silver stain. Isolated antibody includes the antibody in situ within recombinant cells since at least one component of the antibody's natural environment will not be present. Ordinarily, however, isolated antibody will be prepared by at least one purification step.

The term “label” as used herein refers to a detectable compound or composition that binds directly or indirectly to the antibody to produce a “labeled” antibody. The label may be detectable by itself (eg radioisotope label or fluorescent label)
Alternatively, in the case of enzymatic labeling, it may catalyze the chemical conversion of a detectable substrate compound or composition. By "solid phase" is meant a non-aqueous matrix to which the compounds of the invention can adhere. Examples of solid phases included herein are those formed partly or wholly of glass (eg controlled pore glass), polysaccharides (eg agarose), polyacrylamides, polystyrenes, polyvinyl alcohols and silicones. including. In some embodiments, depending on the context, the solid phase can include the wells of an assay plate; otherwise, a purification column (eg, an affinity chromatography column). The term also includes a discontinuous solid phase of discrete particles as described in US Pat. No. 4,275,149. “Liposome” refers to a variety of forms, including lipids, phospholipids and / or surfactants, useful for the delivery of drugs (including anti-ErbB2 antibodies disclosed herein, optionally chemotherapeutic agents disclosed herein) to mammals. Is a small vesicle of. The components of the liposome are commonly arranged in a bilayer formation, similar to the lipid arrangement of biological members. As used herein, the term "immunoadhesin" refers to an antibody-like molecule imparted with the binding specificity of a heterologous protein ("adhesin") that has effector functions for immunoglobulin constant domains. Structurally, the immunoadhesin is a fusion of an immunoglobulin constant domain sequence with an amino acid sequence (ie, "heterologous") that has the desired binding specificity other than the antibody's antigen recognition and binding sites. The adhesin portion of the immunoadhesin molecule is typically a contiguous amino acid sequence containing at least the binding site for the receptor or ligand. The immunoglobulin constant domain sequence of the immunoadhesin may be IgG-1, IgG-2, IgG-3, or IgG-4 subtype, IgA (Ig
A-1 and IgA-2), IgE, IgD or IgM.

II. Compositions and Methods of the Invention 1. PREPARATION OF THE POLYPEPTIDES OF THE INVENTION The present invention relates to PRO245, PRO217, PRO301, PR in the present application.
O266, PRO335, PRO331 or PRO326 (UNQ219, respectively)
UNQ191, UNQ264, UNQ233, UNQ287V, UNQ292 or UNQ287) are provided to provide a newly identified and isolated nucleotide sequence encoding the polypeptide. In particular, as disclosed in further detail in the examples below, PRO245, PRO217, PRO301, PRO266, PRO335.
A cDNA encoding a PRO331 or PRO326 polypeptide was identified and isolated. Although proteins produced in separate expression rounds are given different PRO numbers, UNQ numbers are unique and unchanged for any given DNA and encoded protein. However, for simplicity, DNA is herein
35638, DNA33094, DNA40628, DNA37150, DNA
41388, DNA40981, or protein encoded by DNA37140 and the aforementioned PRO245, PRO217, PRO301, PRO266.
, PRO335, PRO331 or PRO326 are included in the definition of any other natural homologues and variants, regardless of their origin or method of preparation, PRO245, PR
O217, PRO301, PRO266, PRO335, PRO331 or PR
It is referred to as O326 or simply "the polypeptide of the present invention". The following description mainly relates to a method for producing the polypeptide of the present invention by culturing cells transformed or transfected with a vector containing a nucleic acid encoding the polypeptide of the present invention. Of course, it is contemplated that other methods well known in the art can be used to prepare the polypeptides of the invention. For example, a polypeptide sequence, or a portion thereof, may be produced by direct peptide synthesis using solid phase techniques [eg, Stewart et al., Solid-Phase Peptide Synthesis.
, WH Freeman Co., San Francisco, CA (1969); Merrifield, J. Am. Chem. S
oc., 85: 2149-2154 (1963)]. In vitro protein synthesis may be performed by manual techniques or by automation. Automated synthesis can be performed, for example, by Applied Biosystems
It may be carried out according to the manufacturer's instructions using a peptide synthesizer (Foster City, CA). Various portions of the polypeptides of the invention may be chemically synthesized separately and combined using chemical or enzymatic methods to produce full length polypeptides.

It is contemplated that variants can be prepared in addition to the full length native sequence polypeptides described herein. Variants can be prepared by introducing appropriate nucleotide changes into the DNA, and / or by synthesizing the desired polypeptide. One of ordinary skill in the art will appreciate that appropriate amino acid changes may alter post-translational processes of the polypeptides of the invention, such as changing the number of glycosylation sites or altering membrane anchoring properties. Mutations in the native full-length sequences or various domains of the polypeptides of the invention described herein can be made using, for example, any technique and guidelines for conservative and non-conservative mutations described in U.S. Patent No. 5,364,934. You can do it. A mutation may be one or more substitutions, deletions or insertions of codons encoding a polypeptide such that the amino acid sequence of the polypeptide is altered as compared to the native sequence polypeptide. In some cases, the mutation is the replacement of at least one amino acid with any other amino acid in one or more domains of the polypeptide of the invention. A guideline for which amino acid residues are inserted, substituted or deleted without adversely affecting the desired activity is to compare the sequence of the polypeptide of the invention with the sequence of known protein molecules of homology, It is found by minimizing the amino acid sequence changes made within the regions of high homology. Amino acid substitutions can be conservative amino acid substitutions, eg, replacement of leucine with serine, as a result of substituting one amino acid for another amino acid with similar structure or chemical properties. Insertions and deletions can optionally be in the range of 1 to 5 amino acids. Permissible mutations are determined by systematically making amino acid insertions, deletions or substitutions in the sequence and testing the resulting variants for activity exerted by the full-length or mature native sequence.

Polypeptide fragments of the polypeptides of the invention are also within the scope of the invention. Such fragments may be truncated at the N-terminus or C-terminus, or may lack internal residues, for example when compared to the full length native protein. Certain fragments lack amino acid residues that are not essential for the desired biological activity of the polypeptides of the invention. Polypeptide fragments can be prepared by any of many conventional methods. The desired peptide fragment may be chemically synthesized. Another approach is to treat the protein by enzymatic digestion, eg by treating the protein with an enzyme known to cleave the protein at a site defined by a particular amino acid residue, or with a suitable restriction enzyme
Digesting A to produce a fragment and isolating the desired fragment. Yet another suitable technique involves isolating and amplifying a DNA fragment encoding the desired polypeptide fragment by polymerase chain reaction (PCR). Oligonucleotides that define the desired ends of the DNA fragments are used as 5'and 3'primers in PCR. Preferably, the polypeptide fragment shares at least one biological and / or immunological activity with the native polypeptide of the invention. In a particular embodiment, the conservative substitutions of interest are shown in Table 1 under the heading of preferred substitutions. If such a substitution results in a change in biological activity, it is named in Table 1 as an exemplary substitution, or as further described below with reference to the amino acid taxonomy,
Greater changes are introduced and the product screened.

[0034] Substantial modification of the function and immunological identity of a polypeptide of the invention may be (a) a structure of the polypeptide backbone of the substitution region, such as a sheet or helical arrangement, (b) charge or hydrophobicity of the target site, or (C) It is achieved by selecting substituents that differ significantly in their effect, while maintaining the bulk of the side chains. Naturally occurring residues are divided into groups based on common side chain properties: (1) Hydrophobicity: nornoucine, met, ala, val, leu, ile; (2) Neutral hydrophilicity: cys, ser, thr; (3) Acidity: asp, glu; (4) Basicity: asn, gln, his, lys, arg; (5) Residues affecting chain orientation: gly, pro; and (6) aromatic: trp , tyr, phe

Non-conservative substitutions will entail exchanging a member of one of these classes for another class. Residues so substituted can also be introduced at conservative substitution sites, more preferably at remaining (non-conserved) sites. Mutations can be made using techniques well known in the art such as oligonucleotide-mediated (site-directed) mutagenesis, alanine scanning, and PCR mutagenesis. Site-directed mutagenesis [Carter et al., Nucl. Acids Res., 13: 4331.
(1986); Zoller et al., Nucl. Acids Res., 10: 6487 (1987)], cassette mutagenesis [Wells et al., Gene, 34: 315 (1985)], restricted selective mutagenesis [Wells et al.
Philos. Trans. R. Soc. London SerA, 317: 415 (1986)] or other techniques known in the art can be performed on the cloned DNA to make mutant DNA. Also, scanning amino acid analysis can be used to identify one or more amino acids along a flanking sequence. Particularly preferred scanning amino acids are relatively small and neutral amino acids. Such amino acids include alanine, glycine, serine, and cysteine. Alanine is typically the preferred scanning amino acid in this group because it excludes side chains above the beta carbon and does not alter the backbone structure of the mutant [Cunninghem and Wells, Science, 244: 1081-
1085 (1989)]. Also, alanine is typically preferred because it is the most common amino acid. Moreover, it is often found in both buried and exposed locations [Creighton, The Proteins, (WH Freeman and Co., NY); Chothia, J.
Mol. Biol., 150: 1 (1976)]. If alanine substitution does not yield a sufficient amount of variant, an isoteric amino acid can be used.

Covalent modifications of the polypeptide of the invention are included within the scope of the invention. One type of covalent modification involves reacting a targeted amino acid residue of a polypeptide of the invention with an organic derivatizing reagent capable of reacting with a selected side chain or N- or C-terminal residue of the polypeptide. Including that. Derivatization with a bifunctional reagent is useful, for example, to crosslink the polypeptides of the invention to a water-insoluble support matrix or surface for use in a method of purifying anti-polypeptide antibodies and vice versa. Commonly used cross-linking agents are, for example, 1,1-bis (diazoacetyl) -2-phenylethane, glutaraldehyde, N-hydroxysuccinimide ester such as 4-azidosalicylic acid, 3,3′-dithiobis (succinimidyl). Homobifunctional imide ester including disuccinimidyl ester such as propionate, bis-N-maleimide-1
, 8-octane and other bifunctional maleimides, and methyl-3-[(p-azidophenyl)-
It includes reagents such as dithio] propioimidate. Other modifications include deamination of glutaminyl and asparaginyl residues to the corresponding glutamyl and aspartyl, hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl or threonyl residues, lysine, arginine, and histidine side chains. Methylation of α-amino groups of [TE Creighton, Proteins: Structur
e and Molecular Properties, WH Freeman and Co., San Francisco, pp.79-8
6 (1983)], acetylation of N-terminal amines, and amidation of any C-terminal carboxyl groups. Another type of covalent modification of the polypeptides of the invention included within the scope of the invention involves altering the native glycosylation pattern of the polypeptide. By "altering the native glycosylation pattern" is meant, for purposes herein, the deletion of one or more carbohydrate moieties found in a native sequence polypeptide (elimination of existing glycosylation sites or chemical and / or chemical Or by removal of glycosylation by enzymatic means) and / or addition of one or more glycosylation sites not present in the native sequence. In addition, the phrase includes qualitative changes in glycosylation of native proteins, including changes in the nature and proportion of the various carbohydrate moieties present. Addition of glycosylation sites to the polypeptide can be accomplished by altering the amino acid sequence. This alteration may also be made, for example, by the addition of, or substitution with, one or more serine or threonine residues to the native sequence polypeptide (in the case of O-linked glycosylation sites). In some cases, the amino acid sequence is altered by changes at the DNA level, particularly by mutating the DNA encoding the polypeptide with preselected bases to produce codons that are translated into the desired amino acid. It

Another means of increasing the number of carbohydrate moieties on the polypeptides of the present invention is by chemical or enzymatic coupling of glycosides to the polypeptide. These methods were dated 1987 9
International Patent Application No. WO 87/05330 published Apr. 11, and Aplin and Wriston, CRC Crit. R
ev. Biochem., pp259-306 (1981). Removal of carbohydrate moieties present on the polypeptides of the invention may be accomplished chemically or enzymatically or by mutational substitution of codons encoding amino acid residues targeted for glycosylation. For example, chemical deglycosylation techniques are known in the art, for example Hakimuddin et al., Arch. Biochem Biophys., 259: 52 (1987) and Edge et al., Anal. Biochem., 118: 131 (1981). It is described by. Enzymatic cleavage of carbohydrate moieties on polypeptides is described by Thotakura et al., Meth. Enzymol., 138: 350 (
This can be achieved using various endo- and exo-glycosidases as described in 1987). Another type of covalent modification is the polypeptide of the invention to one of a variety of non-proteinaceous polymers, such as polyethylene glycol, polypropylene glycol, or polyoxyalkylenes, U.S. Patent Nos. 4,640,835; 4,496,689. No.4,
No. 301,144; No. 4,670,417; No. 4,791,192 or No. 4,179,337. The polypeptides of the invention may also be modified in a way to form chimeric molecules comprising the polypeptides of the invention fused to other heterologous polypeptides or amino acid sequences. In one embodiment, such a chimeric molecule comprises a fusion of a polypeptide of the invention with a tag polypeptide that provides an epitope to which an anti-tag antibody can selectively bind. Epitope tags are generally located at the amino- or carboxyl-terminus of the polypeptides of the invention. The presence of such an epitope-tagged form of the polypeptide of the present invention can be detected using an antibody against the tag polypeptide. Also, provision of the epitope tag enables the polypeptide of the invention to be readily purified by affinity purification using an anti-tag antibody or another type of affinity matrix that binds to the epitope tag. Various tag polypeptides and their respective antibodies are well known in the art. Examples include poly-histidine (poly-his) or poly-histidine-glycine (poly-his-gly) tags; flu HA tag polypeptide and its antibody 12CA5 [Field et al., Mol. Cell. Biol., 8: 2159. -2165 (1988)]; c
-myc tag and its corresponding 8F9, 3C7, 6E10, G4, B7 and 9E10
Antibody [Evan et al., Molecular and Cellular Biology, 5: 3610-3616 (1985)]; and herpes simplex virus glycoprotein D (gD) tag and its antibody [Paborsky et al., Pr.
otein Engineering, 3 (6): 547-553 (1990)]. Other tag polypeptides are
Flag-Peptide [Hopp et al., BioTechnology, 6: 1204-1210 (1988)]; K
T3 epitope peptide [Martin et al., Science, 255: 192-194 (1992)]; α-tubulin epitope peptide [Skinner et al., J. Biol. Chem., 266: 15163-15166 (
1991)]; and T7 gene 10 protein peptide tag [Lutz-Freyermuth et al., Pr.
oc. Natl. Acad. Sci. USA, 87: 6393-6397 (1990)]. In an alternative embodiment, the chimeric molecule may comprise a fusion of the polypeptide of the invention with an immunoglobulin or a particular region of an immunoglobulin. For the bivalent form of the chimeric molecule (also called "immunoadhesin"), such a fusion may be the Fc region of an IgG molecule. The Ig fusion preferably comprises a soluble (transmembrane domain deleted or inactivated) form of the polypeptide of the invention in place of at least one variable region within the Ig molecule. In a particularly preferred embodiment, the immunoglobulin fusion comprises the hinge, CH2 and CH3, or hinge, CH1, CH of an IgG1 molecule.
2 and CH3 region. For the production of immunoglobulin fusions, June 2, 1995
See U.S. Pat. No. 5,428,130, issued 7th.

I. Isolation of DNA Encoding the Polypeptide of the Present Invention DNA encoding the polypeptide of the present invention is a cDNA prepared from a tissue that possesses the polypeptide mRNA and is considered to express it at a detectable level.
It can be obtained from the library. Therefore, human DNA can be conveniently obtained from a cDNA library prepared from human tissue, as described in the Examples. The gene encoding the polypeptide of the present invention may also be obtained from a genomic library or by oligonucleotide synthesis. Libraries can be screened with probes (such as antibodies to the polypeptides of the invention or oligonucleotides of at least about 20-80 bases) designed to identify the gene of interest or the protein encoded by the gene. Screening of cDNA or genomic libraries with selected probes is described, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual.
(New York: Cold Spring Harbor Laboratory Press, 1989) can be performed using standard procedures. Another method for isolating the gene encoding the polypeptide of the present invention is to use the PCR method [Sambrook et al., Supra; Dieffenbach et al., PCR Primer: A Laboratory Manual (Cold Spring Harbor La.
boratory Press, 1995)]. The examples below describe techniques for screening a cDNA library.
The oligonucleotide sequence selected as a probe should be of sufficient length and sufficiently unambiguous that false positives are minimized. The oligonucleotide is preferably detectably labeled upon hybridisation with the DNA in the library to be screened. Methods of labeling are well known in the art and include the use of radiolabels such as ³² P labeled ATP, biotinylation or enzyme labeling. Hybridization conditions, including moderate and high stringency, are given in Sambrook et al., Supra. Sequences identified in such library screening methods are Genban
It can be compared and aligned with known sequences that have been deposited in public databases such as k or private sequence databases and are available to the public. Sequence identity (either at the amino acid or nucleic acid level) within a given region or over the entire length of the molecule can be determined using methods known in the art and described herein. A nucleic acid having a protein-encoding sequence was first used in Sambrook et al. It can be obtained by screening selected cDNA or genomic libraries by using conventional primer extension methods as described.

Ii. Selection and Transformation of Host Cells Host cells are transfected or transformed with the expression or cloning vectors for producing the polypeptides of the invention described herein, inducing a promoter, selecting for transformants, or desired. The cells are cultured in a conventional nutrient medium appropriately modified to amplify the gene encoding the sequence. Culture conditions such as medium, temperature, pH, etc. can be selected by those skilled in the art without undue experimentation. In general, the principles, protocols, and practical techniques for maximizing cell culture productivity are described in Mammalian Cell Bio
technology: a Practical Approach, edited by M. Butler (IRL Press, 1991) and Sambro
ok etc. can be found above. Methods of transfection, for example, CaPO ₄ and electroporation are known to those skilled in the art. Depending on the host cell used, transformation is done using standard methods appropriate to the cell. Calcium treatment with calcium chloride or electroporation as described in Sambrook et al., Supra, is used for prokaryotes or other cells containing substantial cell wall barriers. Infection with Agrobacterium tumefaciens has been demonstrated in some plant cells as described in Shaw et al., Gene, 23: 315 (1983) and WO 89/05859 published June 29, 1989. Used for transformation. For mammalian cells without such cell walls, Graham and van der
The calcium phosphate precipitation method of Eb, Virology, 52: 456-457 (1978) is preferred. General aspects of mammalian cell host system transformations have been described in US Pat. No. 4,399,216. Transformation into yeast is typically performed by Van solingen et al., J. Bact., 13
0: 946 (1977) and Hsiao et al., Proc. Natl. Acad. Sci. USA, 76: 3829 (1979). However, other methods of introducing DNA into cells, such as nuclear microinjection, electroporation, intact cells, or bacterial protoplast fusion using polycations such as polybrene, polyornithine, etc., can also be used. For various techniques for transforming mammalian cells, see Keown et al., Methods in Enzymology, 185: 527-537 (1990) and M.
See ansour et al., Nature, 336: 348-352 (1988).

Suitable host cells for cloning or expressing the DNA in the vectors described herein are prokaryote, yeast, or higher eukaryote cells. Suitable prokaryotes include, but are not limited to, eubacteria, such as Gram-negative or Gram-positive organisms, for example, Enterobacteriaceae such as E. coli. Various E. coli strains are available to the public, for example E. coli K12 strain MM294 (ATCC31,446); E. coli X1776 (ATCC31,537); E. coli strains W3110 (ATCC27,325) and K5772 (ATCC53,635). In addition to prokaryotes, eukaryotic microbes such as filamentous fungi or yeast are suitable cloning or expression hosts for polypeptides encoding vectors of the invention. Saccharomyces cerevisiae is a commonly used lower eukaryotic host microorganism. Suitable host cells for the expression of glycosylated polypeptide of the invention are derived from multicellular organisms. Examples of invertebrate organism cells include insect cells such as Drosophila S2 and Spodaspera Sf9, as well as plant cells. Examples of useful mammalian host cell lines include Chinese Hamster Ovary (CHO) and COS cells. A more detailed example is the SV40 transformed monkey kidney CV1 strain (COS-7,
ATCC CRL 1651); human embryonic kidney line (293 or 293 cells subcloned for growth in suspension culture, Graham et al., J. Gen Virol., 36:59 (1977)); Chinese hamster ovary cells. ／ -DHFR (CHO), (Urlaub and Chasin, Proc. Natl. Acad
Sci. USA, 77: 4216 (1980)); mouse Sertoli cells (TM4, Mather, Biol. Re
prod., 23: 243-251 (1980)); human lung cells (W138, ATCC CCL 75); human hepatocytes (
Hep G2, HB 8065); and mouse breast tumor cells (MMT 060562, ATTC CCL51). Selection of the appropriate host cell is within the skill of the art.

Iii. Selection and use of replicable vectors Nucleic acid encoding a polypeptide of the invention (eg, cDNA or genomic DNA)
Is inserted into a replicable vector for cloning (amplification of DNA) or expression. Various vectors are publicly available. The vector can be in the form of, for example, a plasmid, cosmid, viral particle, or phage. The appropriate nucleic acid sequence may be inserted into the vector by a variety of procedures. Generally, the DNA is inserted into the appropriate restriction endonuclease sites using techniques well known in the art.
Vector components generally include, but are not limited to, one or more signal sequences, origins of replication, one or more marker genes, enhancer elements, promoters, and transcription termination sequences. Construction of suitable vectors containing one or more of these components employs standard ligation techniques known to those of ordinary skill in the art. The polypeptide of the present invention is not only directly recombinantly produced, but also fused to a heterologous polypeptide which is a signal sequence or a mature protein or another polypeptide having a specific cleavage site at the N-terminus of the polypeptide. It is also produced as a peptide. Generally, the signal sequence is a component of the vector or part of the DNA encoding the polypeptide of the invention that is inserted into the vector. The signal sequence may be, for example, a prokaryotic signal sequence selected from the group of alkaline phosphatase, penicillinase, lpp or thermostable enterotoxin II leaders.
For yeast secretion, the signal sequence may be, for example, the yeast invertase leader,
Alpha factor leaders (Yeast (Saccharomyces) and Kluyveromysis (Kluyv
eromyces) α-factor leader, the latter of which is described in U.S. Pat. ), Or the signal described in International Patent Application No. WO 90/13646, published Nov. 15, 1990. For expression in mammalian cells, signal sequences from secreted polypeptides of the same or related species, other mammalian signal sequences such as viral secretory leaders may be used for direct secretion of the protein.

Both expression and cloning vectors contain a nucleic acid sequence that enables the vector to replicate in one or more selected host cells. Such sequences are common to many bacteria,
It is well known for yeasts and viruses. The origin of replication derived from plasmid pBR322 is suitable for most Gram-negative bacteria, the 2μ plasmid origin is suitable for yeast, and various viral origins (SV40, polyoma, adenovirus, VSV or BPV) It is useful as a cloning vector in mammalian cells. Expression and cloning vectors typically contain a selection gene, also termed a selectable marker. Typical selection genes are (a) ampicillin, neomycin,
Not resistant to antibiotics or other toxins such as methotrexate or tetracycline, (b) supplementing auxotrophic defects, or (c) obtained from complex media such as the gene code D-alanine racemase for Bacillus It encodes a protein that supplies important nutrients. Another example of a selectable marker suitable for mammalian cells is that which can identify cellular components capable of incorporating nucleic acid encoding a polypeptide of the invention, such as DHFR or thymidine kinase. Suitable host cells using wild-type DHFR are described by Urlaub et al., Proc. Natl. Acad. Sci. USA, 77: 4216 (
A CHO cell line deficient in DHFR activity, prepared and expanded as described in 1980). A preferred selection gene for use in yeast is the trp1 gene present in the yeast plasmid YRp7 [Stinchcomb et al., Nature, 282: 39 (
1979); Kingman et al., Gene, 7: 141 (1979); Tschemper et al., Gene, 10: 157 (1980)]
. The trp1 gene provides a selectable marker for mutant strains of yeast lacking the ability to grow in tryptophan, such as ATCC 44076 or PEP4-1 [Jones, Genetics, 85:12 (1977)]. Expression and cloning vectors usually contain a promoter operably linked to the nucleic acid sequence encoding the polypeptide of the invention to direct mRNA synthesis. Suitable promoters recognized by a variety of potential host cells are known. Suitable promoters for use in prokaryotic hosts are the β-lactamase and lactose promoter systems [Cahng et al., Nature, 275: 615 (1978); Goeddel et al., Nature, 281: 544.
(1979)], alkaline phosphatase, tryptophan (trp) promoter system [Go
eddel, Nucleic Acids Res., 8: 4057 (1980); EP 36,776], and hybrid promoters such as tac promoter [deBoer et al., Proc. Natl. Acad. Sci.
USA, 80: 21-25 (1983)]. Promoters used in bacterial systems also have a Shine-Dalgarno (SD) sequence operably linked to the DNA encoding PRO.

Examples of suitable promoter sequences for use with yeast hosts include 3-phosphoglycerate kinase [Hitzeman et al., J. Biol. Chem., 255: 2073 (1980)] or other glycolytic enzymes [Hess. Et al., J. Adv. Enzyme Reg., 7: 149 (1968); Holland, Bioch.
emistry, 17: 4900 (1978)], for example, enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, Pyruvate kinase, trioselate isomerase, phosphoglucose isomerase, and glucokinase are included. Other yeast promoters are inducible promoters that have the additional effect of transcription being regulated by growth conditions, such as alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, metallothionein, and glycine. There are promoter regions for cellaldehyde-3-phosphate dehydrogenase and enzymes that govern the utilization of maltose and galactose. Vectors and promoters suitable for expression in yeast are further described in EP 73,657. PRO transcription from a vector in mammalian host cells can be performed, for example, by polyomavirus, infectious epithelioma virus (UK 2,211,504 published July 5, 1989), adenovirus (eg adenovirus 2), bovine papilloma virus, avian virus. Sarcoma virus,
Cytomegalovirus, retrovirus, hepatitis B virus and simian virus 4
0 (SV40), a promoter derived from the genome of a virus, a promoter derived from a heterologous mammal, such as an actin promoter or an immunoglobulin promoter, and a promoter derived from a heat shock promoter, such a promoter may be used in a host cell system. Is controlled as long as it conforms to. Transcription of the DNA encoding the polypeptides of the present invention by higher eukaryotes can be enhanced by inserting an enhancer sequence into the vector. Enhancers, usually about 10 to 300 base pairs, are cis-acting elements of DNA that act on promoters to enhance their transcription. Many enhancer sequences from mammalian genes are currently known (globin, elastase, albumin, α-fetoprotein and insulin). However, typically enhancers from eukaryotic viruses will be used. For example, SV on the late side of the replication origin
40 enhancers (100-270 base pairs), cytomegalovirus early promoter enhancer, polyoma enhancer on the late side of the replication origin, and adenovirus enhancers. The enhancer may be spliced into the vector at the 5'or 3'positions of the PRO coding sequence, but is preferably located 5'from the promoter. Expression vectors used in eukaryotic host cells (yeast, fungi, insects, plants, animals, humans, or nucleated cells derived from other multicellular organisms) also include termination of transcription and mRN.
It also contains the sequences required for the stabilization of A. Such a sequence may be used in eukaryotic or viral D
It can be obtained from the untranslated region, usually 5'and sometimes 3 ', of NA or cDNA. These regions contain nucleotide segments transcribed as polyadenylated fragments in the untranslated portion of the mRNA encoding the polypeptides of the present invention. Still other methods, vectors and host cells suitable for adapting the synthesis of polypeptides of the invention in recombinant cell culture are described in Gething et al., Nature, 293: 620-625 (1981).
); Mantei et al., Nature, 281: 40-46 (1979); EP 117,060; and EP 117,058.

Iii. Detection of Gene Expression Amplification or expression of a gene is carried out based on the sequence provided herein, using an appropriately labeled probe, for example, conventional Southern blotting, Northern blotting quantifying mRNA transcription [Thomas , Proc. Natl. Acad. Sci. USA, 77: 5201-520
5 (1980)], dot blotting (DNA analysis), or in situ hybridization, and can be directly measured in the sample. Alternatively, an antibody capable of recognizing a specific duplex including a DNA duplex, an RNA duplex and a DNA-RNA hybrid duplex or a DNA-protein duplex can also be used. The antibody can then be labeled and the assay performed, wherein the duplex is surface bound, such that at the time of formation of the duplex on the surface, the antibody bound to the duplex is Presence can be detected. Alternatively, gene expression can also be measured by immunological methods that directly quantitate the expression of the gene product, such as immunohistochemical staining of cells or tissue sections and cell culture or body fluid assays. Antibodies useful for immunohistochemical staining or assay of sample fluids may be monoclonal or polyclonal and can be prepared in any mammal. Conveniently, the antibody is directed against the native sequence of a polypeptide of the invention, or against a synthetic peptide based on the DNA sequences provided herein, or fused to a polypeptide of the invention to produce a specific antibody epitope. Can be prepared for an exogenous sequence encoding

Iv. Purification of Polypeptides Polypeptide forms of the invention can be recovered from culture medium or host cell lysates. If membrane-bound, it can be detached from the membrane using a suitable wash (eg Triton-X100) or enzymatic cleavage. The cells used to express the polypeptides of the invention can be disrupted by various chemical or physical means such as freeze-thaw cycling, sonication, mechanical disruption, or cell lysing agents. It may be desirable to purify the polypeptides of the invention from recombinant cell proteins or polypeptides. Purified by the following procedure, which is an example of a suitable purification procedure: fractionation on an ion exchange column; ethanol precipitation; reverse phase HPLC; chromatography on silica or cation exchange resins such as DEAE; chromatofocusing; SDS-. PAGE; ammonium sulfate precipitation; eg Sephadex G-75
Gel filtration using; a protein A sepharose column to remove contaminants such as IgG; and a metal chelation column that binds the epitope-tagged form of the polypeptides of the invention. Known in the art, eg Deutcher, Methodes in Enzymolo
gy, 182 (1990) ； Scopes, Protein Purification: Principles and Practice, S
Various protein purification methods described in pringer-Verlag, New York (1982) can be used. The purification process chosen depends, for example, on the production method used and on the nature of the polypeptide of the invention produced in particular.

2. Tissue distribution The location of tissues expressing the polypeptide of the present invention is determined by the mR in various human tissues.
It can be identified by detection of NA expression. The location of such genes provides information about the tissues most likely to be affected by stimulating and inhibiting the activity of the polypeptides of the invention. The location of the gene in a particular tissue also provides the sample tissue for the activity inhibition assay described below. As mentioned above, gene amplification or gene expression in various tissues is associated with mRNA
Conventional Southern and Northern blots (Thomas, Pr
oc. Natl. Acad. Sci. USA, 77: 5201-5205 [1980]), dot blot (DNA
Analysis), or in situ hybridization, and can be measured using a suitable labeled probe based on the sequences provided herein. Alternatively, DNA duplex, RNA
Antibodies that recognize duplexes and specific duplexes including DNA-RNA hybrid duplexes or DNA-protein duplexes may be used. Alternatively, gene expression in various tissues can also be measured by immunological methods such as immunohistological staining of tissue fragments and cell culture medium or body fluids for direct quantification of gene products. Antibodies useful for immunohistological staining or assay of sample fluids, whether monoclonal or polyclonal, are prepared from any animal. Conveniently, the antibody is directed against the native sequence of a polypeptide of the invention, or the DN provided herein.
Prepared against synthetic peptides based on the A sequence or against extracellular sequences fused to a DNA sequence encoding a polypeptide of the invention and encoding a specific antibody epitope. General techniques for producing antibodies, as well as Northern blot and in situ hybridization protocols are provided below.

3. Antibody Binding Experiment The activity of the polypeptide of the present invention was determined by anti-PRO245, PRO217 and PRO3.
01, PRO266, PRO335, PRO331 or PRO326 antibody in tissue cells produces PRO245, PRO217, PRO301, PRO266, PR
The ability to inhibit the effects of O335, PRO331 or PRO326 polypeptides can be further confirmed by antibody binding experiments in which the ability to be tested is tested. Exemplary antibodies include polyclonal, monoclonal, humanized, bispecific, and heteroconjugate antibodies, the preparation of which is described below. Antibody binding experiments may be performed with known assay methods such as competitive binding assays, direct and indirect sandwich assays, and immunoprecipitation assays. Zola, Monocl
onal Antibodies: A Manual of Techniques, pp.147-158 (CRC Press, Inc., 19
87). Competitive binding assays rely on the ability of a labeled standard to compete with a test analyte for binding a limited amount of antibody. The amount of target protein in the test sample is inversely proportional to the amount of standard that begins to bind antibody. To facilitate the determination of the amount of standard that begins to bind, the antibody is preferably immobilized before or after competition, and the standard and analyte bound to the antibody are easily separated from the standard and analyte that remain unbound. To be able to separate. The sandwich assay involves the use of two antibodies, each capable of binding a different immunogenic portion, or epitope, of the protein to be detected. The test sample analyte binds to the first antibody immobilized on a solid support in a sandwich assay,
The second antibody then binds to the analyte, thus forming an insoluble ternary complex. See, for example, U.S. Pat. No. 4,376,110. The second antibody is labeled with a detectable moiety (
(Direct sandwich assay) or using an anti-immunoglobulin antibody labeled with a detectable moiety (indirect sandwich assay). For example, one form of sandwich assay is an ELISA assay, where the detectable moiety is an enzyme. For immunohistology, tissue samples may be fresh or frozen, may be embedded in paraffin and fixed with preservatives such as formalin.

4. Cell-Based Assays To further understand the relationship between the genes and polypeptides identified herein and the progression and pathogenesis of immune-related disorders, cell-based assays and animal models of immune-related disorders can be used. In a different approach, cells of cell types known to be involved in certain immune-related disorders are transfected with the cDNAs described herein and the ability of these cDNAs to stimulate or inhibit immune function is analyzed. Appropriate cells can be transfected with the desired gene and monitored for immune function activity. Such transfected cell lines can then be used to test the ability of the polypeptide- or monoclonal antibody or antibody composition to inhibit or stimulate immune function, eg, modulate T cell proliferation or inflammatory cell infiltration. . Cells transfected with the coding sequences of the genes identified here are:
It can also be used to identify candidate agents for the treatment of immune related disorders. Furthermore, primary media derived from transgenic animals (as described below) can be used in the cell-based assays herein, although stable cell lines are preferred. Techniques for deriving continuous cell lines from transgenic animals are well known in the art (see Small et al., Mol. Cell. Biol. 5, 642-648 [1985]). One suitable cell-based assay is the mixed lymphocyte reaction (MLR). Curr
ent Protocols in Immunology, unit 3.12; .E. Coligan, AM Kruisbeek, DH
Marglies, EM Shevach, W. Strober, National Institutes of Health,
Published by John Wiley and Sons, Inc. In this assay, the ability of a test compound to stimulate the proliferation of activated T cells is assayed. Responder T cell suspensions are cultured with allogeneic stimulator cells and T cell proliferation is measured by tritiated thymidine incorporation. This assay is a general means of T cell reactivity. The difference in reactivity in this assay partially reflected the difference in IL-2 production by the reactive cells, as the majority of T cells responded upon activation to produce IL-2. MLR results can be confirmed by standard lymphokine (IL-2) detection assays. Current Protocols in Immunology, 3.15, 6 above.
.3.

The proliferative T cell response in the MLR assay is due to the direct mitogenic properties of the assayed molecule or external antigen-induced activation. Further validation of the T cell stimulating activity of the polypeptides of the invention can be obtained by costimulation assays. T cell activation is the result of an antigen-specific signal mediated through the T cell receptor (TCR) and a second
Require a co-stimulatory signal mediated through a ligand-binding interaction of, eg, (CD80, CD86) / CD28 binding interaction. CD28 cross-linking increases lymphokine secretion by activated T cells. T cell activation has both negative and positive regulation through the binding of ligands with negative or positive effects. CD28 and CTLA-4 are associated with Ig superfamily glycoproteins that bind B7. Binding of CD28 to B7 has a positive costimulatory effect on T cell activation, and conversely, binding of CTLA-4 to B7 has a negative T cell inactivating effect. Chambers, CA and Allison, JP,
Curr. Opin. Immunol. (1997) 9: 396; Schwartz, RH, Cell (1992) 71: 106.
5; Linsey, PS and Ledbetter, JA, Annu. Rev. Immunol. (1993) 11: 191;
June, CH et al., Immunol. Today (1994) 15: 321; Jenkins, MK, Immunity (19
94) 1: 405. In a costimulation assay, the polypeptides of the invention are assayed for T cell costimulatory or inhibitory activity. The polypeptides of the invention, as well as other compounds of the invention, are stimulators of T cell proliferation (costimulators) and agonists thereto, eg agonist antibodies, as determined by eg MLR and costimulatory assays, poor, optimal. It is useful in the treatment of immune-related diseases characterized by the following or insufficient immune functions. These diseases are treated by stimulating the proliferation and activation of T cells (and T cell-mediated immunity) and promoting an immune response in mammals through the administration of stimulatory compounds such as the stimulatory polypeptides of the invention. To be done. Stimulatory polypeptides include, for example, PRO245, P
RO217, PRO301, PRO266, PRO335, PRO331 or P
It may be a RO326 polypeptide or an agonist antibody thereto. Direct use of stimulatory compounds as in the present invention is a tumor necrosis factor that binds to a ligand expressed on primed T cells (4-1BBL) to signal T cell activation and growth. Members of the receptor family 4-1
Confirmed in experiments with BB glycoprotein.

The use of agonist-stimulating compounds has also been experimentally validated. Agonist anti-4-1B
Activation of 4-1BB by treatment with B antibody promotes tumor eradication. Hellstrom
, I. and Hellstrom, KE, Crit. Rev. Immunol. (1998) 18: 1. Immunoadjuvant therapy for the treatment of tumors, which is described in more detail below, is another example of the use of the stimulatory compounds of the invention. Immunostimulatory or stimulatory effects can also be achieved by antagonizing or blocking the activity of proteins found to be inhibited in the MLR assay. By eliminating the inhibitory activity of the compound, an overall stimulating effect is produced.
Preferred antagonist / blocking compounds are antibodies or fragments thereof that recognize and bind to the inhibitory protein, thereby blocking the effective interaction of the protein with its receptor and inhibiting signal transduction through the receptor. . This effect is
It was confirmed in experiments with anti-CTLA-4 antibodies that promote T cell proliferation, possibly by removing the inhibitory signal generated by CTLA-4 binding. Walunas,
TL et al., Immunity (1994) 1: 405. On the other hand, the polypeptides of the invention, which are direct inhibitors of T cell proliferation / activation and / or lymphokine secretion, as well as other compounds of the invention, can be used directly to suppress the immune response. These compounds are useful for reducing the extent of immune response and for treating immune related disorders characterized by hyperreactivity, suboptimal, or autoimmune responses. This use of the compounds of the invention was corroborated by the above experiments in which binding of CTLA-4 to B7 inactivates T cells. The direct inhibitory compounds of the present invention function in a similar manner. Alternatively, compounds that bind to the stimulatory polypeptides of the invention and block the stimulatory effects of these molecules, such as antibodies, produce an overall inhibitory effect and inhibit T cell proliferation / activation and / or lymphokine secretion. Can be used to suppress T cell-mediated immune responses. Blocking the stimulatory effect of the polypeptide suppresses the immune response in mammals. This use has been validated in experiments with anti-IL-2 antibodies. In these experiments, the antibody binds IL2 and blocks the binding of IL2 to its receptor, thereby achieving a T cell inhibitory effect.

51. Animal Models The results of cell-based in vitro assays can be further confirmed using in vivo animal models and assays for T cell function. To further understand the role of the genes identified herein in the progression and pathogenesis of immune related diseases, and to test the efficacy of candidate therapeutic agents including antibodies and other agonists of natural polypeptides, including small molecule agonists For this purpose, various well-known animal models can be used. The in vivo nature of these models can predict response in human patients. Animal models of immune related disorders include both non-recombinant and recombinant (transgenic) animals. Non-recombinant animal models include, for example, rodent, eg mouse models. Such a model is prepared by introducing cells into syngeneic mice by standard techniques such as subcutaneous injection, tail vein injection, spleen transplantation, intraperitoneal transplantation, and subrenal capsule transplantation. Graft-versus-host disease occurs when immunocompetent cells are transplanted into immunosuppressed or tolerant patients. Donor cells recognize and react with host antigens. The response can vary from severe life threatening inflammation to mild diarrhea or weight loss. The graft-versus-host disease model provides a means to assess T cell responsiveness to MHC antigens and small numbers of transplant antigens. Suitable techniques are described in detail in Current Protocols in Immunology, unit 4.3 above. Animal models of skin graft rejection are a means of testing the ability of T cells to mediate in vivo tissue destruction and are a measure of their role in graft rejection. The most common and accepted model is mouse tail skin grafts. Repeated experiments have shown that skin allograft rejection is mediated by T cells, helper T cell tail killer effect T cells and not antibodies. Auchincloss, H. Jr. and Sachs, DH, Fundamenta
Immunology, 2nd edition, edited by WE Paul, Raven Press, NY, 1989, 889-992. Suitable techniques are described in detail in Current Protocols in Immunology, unit 4.4 above. Other graft rejection models that can be used to test the compounds of the invention are Tanabe, M. et al.
Et al., Transplantation (1994) 58:23 and Tinubu, SA et al., J. Immunol. (1994).
It is an allograft heart transplant model described in 4330-4338. Animal models of delayed type hypersensitivity also provide assays for cell-mediated immune function. A detailed type of hypersensitivity reaction is a T cell-mediated immune response characterized by inflammation that does not peak until time after antigen challenge. These reactions also affect tissue-specific autoimmune diseases such as multiple sclerosis (MS) and experimental autoimmune encephalomyelitis (E).
AE, MS model). The preferred method is Current Protocols in I above.
Details are described in mmunology, unit 4.5.

EAE is a T cell mediated autoimmune disease characterized by T cell and mononuclear cell inflammation and subsequent demyelination of axons in the central nervous system. EAE is generally MS in humans
Is considered to be a related animal model of. Bolton, C., Multiple Sclerosis (
1995) 1: 143. Both acute and relapsing remission models have been developed. The compounds of the invention can be tested for T cell stimulatory or inhibitory activity against immune-mediated demyelinating diseases using the protocols described in Current Protocols in Immunology, units 15.1 and 15.2 above. See also Duncan, I. et al., Molec. Med. Today (1997) 554.
See also models for myelin disease in which oligodendroglial or Schwann cells are transplanted into the central nervous system as described in US Pat. Contact hypersensitivity is a type of hypersensitivity that is readily manifested in in vivo assays of cell-mediated immune function. In this approach, the skin is exposed to exogenous haptens, which causes a delayed type hypersensitivity reaction, which is measured and quantified. Contact hypersensitivity involves an initial sensitization phase followed by an induction phase. The induction phase occurs when the T lymphocyte encounters an antigen with which it was previously contacted. Swelling and inflammation occur, which is an excellent model for human allergic contact dermatitis. The preferred method is Current Protocols in Immunolog
Edited by y, E. Coligan, AM Kruisbeek, DH Marglies, EM Shevach, W. Strober
, John Wiley and Sons, Inc., 1994, unit 4.2. See also Grabbe, S. and Schwarz, T., Immun. Today 19 (1): 37-44 (1998). An animal model for arthritis is collagen-induced arthritis. This model shares clinical, histological and immunological features with human autoimmune rheumatoid arthritis and is an acceptable model for human autoimmune arthritis. The mouse and rat models are characterized by synovitis, erosion of cartilage and subchondral bone. The compounds of the present invention are the above-mentioned Curr
The protocol described in ent Protocols in Immunology, unit 15.5 can be used to test for activity against autoimmune arthritis. Also, Issekutz, AC
See also the model using monoclonal antibodies against CD18 and VLA-4 integrin described in et al., Immunology (1996) 88: 569.

A model of asthma has been described in which antigen-induced airway hyperreactivity, pulmonary eosinophilia and inflammation sensitize animals with ovalbumin and then load the animals with the same proteins that are delivered by aerosol. Is triggered by doing. Several animal models (guinea pig, rat, non-human primate) show symptoms similar to human atopic asthma when challenged with aerosol antigens. The mouse model has many features of human asthma. Suitable methods for testing the activity and efficacy of the compounds of the invention in the treatment of asthma are described by Wolyniec, WW et al., Am. J. Respir. Cell Mol. Biol., (1998) 18: 777.
And its references. Furthermore, the compounds of the invention can be tested in animal models of psoriasis-like diseases. Evidence suggests a T cell pathogenesis for psoriasis. The compounds of the invention are Schon, MP
It can also be tested in the scid / scid mouse model, in which mice exhibit a histopathological skin disease similar to psoriasis, described by Nat. Med. (1997) 3: 183. Another suitable model is the human skin / scid mouse chimera prepared as described by Nickoloff, BJ et al., Am. J. Path. (1995) 146: 580. Recombinant (transgenic) animal models can be engineered by introducing the coding portion of the genes identified herein into the genome of the animal of interest using standard techniques for making transgenic animals. Animals that can serve as targets for transgenic manipulation include, but are not limited to, mice, rats, rabbits, guinea pigs, sheep, goats, pigs, and non-human primates such as baboons, chimpanzees and monkeys. Techniques known in the art for introducing transgenes into these animals include whole nuclear microinjection (Hoppe and Wanger, US Pat. No. 4,873,191).
No.); retrovirus-mediated gene transfer to the embryonic line (eg, Van der Putten et al.,
Proc. Natl. Acad. Sci. USA 82, 6148-615 [1985]); gene targeting in embryonic hepatocytes (Thompson et al., Cell 56, 313-321 [1989]); embryo electroporation (Lo , Mol. Cel. Biol. 3, 1803-1814 [1983]); sperm-mediated gene transfer (Lavitra
No et al., Cell 57, 717-73 [1989]). For a review, see, for example, US Pat.
See No. 4,736,866.

For the purposes of the present invention, transgenic animals include those which carry the transgene only in part thereof (“mosaic animals”). The transgene is integrated as a single transgene or as a concatemer, eg, head-to-head or head-to-tail tandem. Selective introduction of transgenes into specific cell types is also described, for example, in Lasko et al., P.
It is possible according to the technique of roc. Natl. Acad. Sci. USA 89, 6232-636 (1992). Expression of the transgene in transgenic animals can be monitored by standard techniques. For example, Southern blot analysis or PC for confirmation of transgene integration.
R amplification is used. The level of mRNA expression can then be analyzed using techniques such as in situ hybridization, Northern blot analysis, PCR, or immunohistochemistry. Animals may be further tested for signs of immune disease pathology, for example by histological examination to determine the infiltration of inflammatory cells into specific tissues. It is also possible to perform a blocking experiment in which transgenic mice are treated with a compound of the invention and the degree of T cell proliferation stimulation or inhibition of the compound is measured. In these experiments, blocking antibodies that bind to the polypeptides of the invention are prepared as described above and administered to animals to determine their effect on immune function. Alternatively, a defect encoding a polypeptide identified herein by homologous recombination between a modified genomic DNA encoding the polypeptide introduced into an embryonic cell of an animal and an endogenous gene encoding the same polypeptide. Alternatively, "knockout" animals with altered genes can be created. For example, a cDNA encoding a particular polypeptide can be used to clone genomic DNA encoding the polypeptide according to established techniques. A portion of the genomic DNA encoding a particular polypeptide can be deleted or replaced with another gene, such as the gene encoding a selectable marker used to monitor integration. Typically, the vector contains a few kilobases of unchanged flanking DNA (both the 5'and 3'ends) [eg, for homologous recombination vectors, Thomas and Capecchi, Cell,
51: 503 (1987)]. The vector is introduced into embryonic stem cells (eg, by electroporation) and cells are selected in which the introduced DNA is homologously recombined with the endogenous DNA [eg, Li et al., Cell, 69: 915 (1992). reference]. The selected cells are then injected into the blastocyst of an animal (eg mouse or rat) to form an assembled chimera [eg Bradley, Teratocarcinomas and Embryonic Stem Cells:
A Practical Approach, EJ Robertson, ed. (IRL, Oxford, 1987), pp. 113-
152]. The chimeric embryos are then said to be transplanted into a suitable pseudopregnant female nanny to create a "knockout" animal. Offspring with DNA that has been homologously recombined into germ cells are identified by standard techniques and can be used to breed animals in which all cells of the animal contain homologously recombined DNA. . Knockout animals are characterized by the ability to protect against certain pathological conditions and the progression of pathological conditions due to the absence of the polypeptide.

6. Immunoadjuvant Therapy In one embodiment, the immunostimulatory compounds of the invention can be used in immunoadjuvant therapy for the treatment of tumors (cancer). It is now well established that T cells recognize human tumor-specific antigens. A group of tumor antigens is MAGE
It is encoded by the BAGE and GAGE family of genes and is asymptomatic in all adult normal tissues, but is expressed in significant amounts in tumors such as melanoma, lung tumors, head and neck tumors, and bladder cancer. DeSmet, C. et al. (1996) Proc. Natl. Acad. Sci. U
SA, 93: 7149. Co-stimulation of T cells has been shown to induce tumor regression and anti-tumor responses in vitro and in vivo. Melero, I. et al., Nature Medicine (1997)
3: 682; Kwon, ED et al., Proc. Natl. Acad. Sci. USA (1997) 94: 8099; Lynch
, DH et al., Nature Medicine (1997) 3: 625; Finn, OJ and Lotze, MT, J. I.
mmunol. (1998) 21: 114. The stimulatory compounds of the invention can be administered alone or in combination with growth regulators, cytotoxic or chemotherapeutic agents as adjuvants to stimulate T cell proliferation / activation and anti-tumor responses to tumor antigens. Growth regulation, cytotoxicity,
Alternatively, the chemotherapeutic agent may be administered in conventional amounts using known dosing regimens. The immunostimulatory activity of the compounds of the invention may reduce the amount of growth-regulating, cytotoxic, or chemotherapeutic agents, thus reducing toxicity to the patient.

7. Screening Assays for Candidate Drugs Screening assays for candidate drugs include compounds or biologically active fragments thereof that bind or complex with the polypeptide encoded by the gene identified herein,
Alternatively, it is designed to identify compounds that inhibit the interaction of the encoded polypeptide with other cellular proteins. Such screening assays include those that follow high-throughput screening of chemical libraries, making them particularly suitable for identifying small molecule drug candidates. Small molecules are considered to include synthetic organic or inorganic compounds, which include peptides, preferably soluble peptides, (poly) peptide-immunoglobulin fusions, including but not limited to poly- and monoclonal antibodies and antibody fragments, It includes single chain antibodies, anti-idiotype antibodies, and chimeric or humanized forms of those antibodies or fragments, as well as antibodies, including human antibodies and antibody fragments. Assays can be performed in a variety of formats and include protein-protein binding assays, biochemical screening assays, immunoassays and cell-based assays that are well characterized in the art. All assays are common in that they contact a candidate drug with a polypeptide encoded by the nucleic acid identified herein under conditions and for a time sufficient for the two components to interact.

In binding assays, the interaction is binding and the complex formed is either isolated or detected in the reaction mixture. In a particular embodiment, the polypeptides encoded by the genes identified herein or the drug candidate are covalently or non-covalently immobilized to a solid phase, eg, a microtiter plate. Non-covalent attachment generally is accomplished by coating the solid surface with a solution of the polypeptide and drying. Alternatively, an immobilized antibody specific for the peptide to be immobilized, eg a monoclonal antibody, can be used to anchor the peptide to a solid surface. The assay is performed by adding the non-immobilized component, which may be labeled with a detectable label, to the immobilized component, eg, the coated surface containing the anchored component. When the reaction is complete, unreacted components are removed, for example by washing, and the complex adhered to the solid surface is detected. When the first non-immobilized component carries a detectable label, detection of the label immobilized on the surface indicates that complex formation has occurred. If the first non-immobilized component has no label, complex formation can be detected, for example, by a labeled antibody that specifically binds to the immobilized complex. If the candidate compound interacts with, but does not bind, the particular polypeptide encoded by the gene identified herein, that interaction should be assayed by well-known methods for detecting protein-protein interactions. You can Such assays include traditional techniques such as cross-linking, co-immunoprecipitation, and co-purification through gradients or chromatographic columns. Furthermore, protein-protein interactions have been reported by Fields and coworkers [Fiels and Song, Nature (London) 340, 245-246.
(1989); Chien et al., Proc. Natl. Acad. Sci. USA 88, 9578-9582 (1991)].
.Natl. Acad. Sci. USA 89, 5789-5793 (1991)]. Many transcriptional activators, such as yeast GAL4, consist of two physically distinct modular domains, one acting as a DNA binding domain,
The other functions as a transcription activation domain. The yeast expression system described in the previous literature (generally referred to as the "2-hybrid system") takes advantage of this property and uses two hybrid proteins, while the target protein is the GAL4 DNA binding domain. On the other hand, the candidate activating protein is fused to the activation domain. Expression of the GAL1-lacZ reporter gene under the control of the GAL4-activating promoter depends on the reconstitution of GAL4 activity via protein-protein interactions. Colonies containing interacting polypeptides are detected with a chromogenic substance for β-galactosidase. A complete kit (MATCHMAKER®) for identifying protein-protein interactions between two specific proteins using 2-hybrid technology is commercially available from Clontech. This system can be extended to the mapping of protein domains involved in a particular protein interaction, as well as the identification of amino acid residues important for this interaction. Compounds that inhibit the interaction of the genes identified herein with other intracellular or extracellular components can be tested as follows: usually the product of the amplified gene and intracellular or extracellular components. Is prepared under conditions and for a time period during which the two products interact and bind. To test the ability of a test compound to inhibit binding, the reaction is performed with or without the test compound. In addition, placebo may be added to the third reaction mixture as a positive control. The binding (complex formation) of the test compound present in the mixture with intracellular or extracellular components is monitored as described above. The formation of the complex in the control reaction, not the reaction mixture containing the test compound, indicates that the test compound interferes with the interaction of the test compound with its reaction partner.

8. Compositions and Methods for the Treatment of Immune Related Diseases Compositions useful in the treatment of immune related diseases include, but are not limited to, antibodies, small organic and inorganic molecules, peptides, phosphopeptides, antisense and ribozyme molecules, triple helix molecules, etc. Immune functions such as T cell proliferation / activation, lymphokine release,
Alternatively, it inhibits or stimulates immune cell infiltration. For example, antisense RNA and RNA molecules directly block translation of mRNA by hybridizing to a target mRNA and preventing protein translation.
If antisense DNA is used, oligodeoxyribonucleotides derived from the translation initiation site, eg, between the -10 and +10 positions of the target gene nucleotide sequence, are preferred. Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. Ribozymes act by sequence-specific hybridization to complementary target RNA, followed by endonucleolytic cleavage. Specific ribozyme cleavage sites within potential RNA targets can be identified by known techniques. Further details can be found in, for example, Rossi, Current B
See Biology 4: 469-471 (1994) and PCT publication, number WO 97/33551 (published September 18, 1997). Nucleic acid molecules in triple helix formation used to inhibit transcription are single-stranded and composed of deoxynucleotides. The basic composition of these oligonucleotides is designed to promote triple helix formation via the Hoogsteen base pairing rule, which generally requires resizable extension of purines or pyrimidines on one strand of the duplex. . For further details, see, for example, PCT publication, number WO 97/33551, supra. These molecules can be identified by any or any combination of the above screening assays, or by other screening techniques known to those of skill in the art.

9. Antibodies Some of the most promising candidate agents of the present invention are antibodies and antibody fragments that can inhibit (antagonist) or stimulate (agonist) T cell proliferation, eosinophil infiltration, and the like. i. Polyclonal Antibodies Methods of preparing polyclonal antibodies are known to those of skill in the art. Polyclonal antibodies in mammals can be generated by one or more injections of, for example, an immunizing agent and, if desired, an adjuvant. Typically, the immunizing agent or adjuvant will be injected in the mammal by multiple subcutaneous or intraperitoneal injections. The immunizing agent may include the polypeptide of the present invention or a fusion protein thereof. It is useful to conjugate the immunizing agent to a protein known to be immunogenic in the immunized mammal. Examples of such immunogenic proteins include, but are not limited to, keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin and soybean trypsin inhibitor. Examples of adjuvants that may be used include Freund's complete adjuvant and MPL-TDM adjuvant (monophosphoryl lipid A, synthetic trehalose dicorynomycolate). The immunization protocol will be selected by one of ordinary skill in the art without undue experimentation.

Ii. Monoclonal antibody Alternatively, the antibody that recognizes and binds to the polypeptide of the present invention or acts as an agonist thereof may be a monoclonal antibody. Monoclonal antibodies can be prepared using the hybridoma method as described by Kohler and Milstein, Nature, 256: 495 (1975). In the hybridoma method, mice, hamsters or other suitable host animals are typically immunized with an immunizing agent to produce lymphocytes that produce or are capable of producing antibodies that specifically bind to the immunizing agent. Induce. The lymphocytes can also be immunized in vitro. The immunizing agent will typically include the polypeptide or fusion protein of the invention. Generally, peripheral blood lymphocytes ("PBLs") are used when cells of human origin are desired, or spleen cells or lymph node cells are used when non-human mammalian sources are desired. . The lymphocytes are then fused with an immortalized cell line using a suitable fusing agent such as polyethylene glycol to form hybridoma cells [Goding,
Monoclonal Antibodies: Principles and Practice, Academic Press, (1986) p
p. 59-103]. Immortalized cell lines are usually transformed mammalian cells, particularly myeloma cells of rodent, bovine, and human origin. Usually, rat or mouse myeloma cell lines are used. The hybridoma cells are preferably cultured in a suitable medium that contains one or more substances that inhibit the survival or growth of the unfused, immortalized cells. For example, when the parental cell lacks the enzyme hypoxanthine guanine phosphoribosyl transferase (HGPRT or HPRT), the hybridoma's medium typically contains hypoxatin, aminoputilin and thymidine ("HAT medium"). , This substance blocks the growth of HGPRT-deficient cells. Preferred immortalized cell lines are those that fuse efficiently, support stable high level expression of antibody by the selected antibody-producing cells, and are sensitive to a medium such as HAT medium. A more preferred immortalized cell line is the mouse myeloma line, which is available, for example, from the Salk Institute Cell Distribution Center in San Diego, Calif. And the American Type Culture Collection in Rockville, Md. Human myeloma and mouse-human xenomyeloma cell lines for producing human monoclonal antibodies have also been disclosed [Kozbor, J. Immunol., 133: 30.
01 (1984), Brodeur et al., Monoclonal Antibody Production Techniques and Appl
ications, Marcel Dekker, Inc., New York, (1987) pp. 51-63]. The culture medium in which the hybridoma cells are cultured is then assayed for the presence of monoclonal antibodies to the polypeptides of the invention. Preferably, the binding specificity of the monoclonal antibody produced by the hybridoma cells is measured by immunoprecipitation or an in vitro binding assay such as radioimmunoassay (RIA) or enzyme-linked immunoassay (ELISA). Such techniques and assays are known in the art. The binding affinity of a monoclonal antibody can be determined, for example, by Munson and Pollard, A
nal. Biochem., 107: 220 (1980).

After the desired hybridoma cells have been identified, clones can be subcloned by a limiting dilution step and grown by standard methods [Goding, supra].
Suitable culture media for this purpose include, for example, Dulbecco's Modified Eagle's Medium and RPMI-1640 medium. Alternatively, the hybridoma cells can be grown in vivo as ascites in a mammal. The monoclonal antibody secreted by the subclone is, for example, protein A
-Isolated or purified from culture medium or ascites fluid by conventional immunoglobulin purification methods such as Sepharose method, hydroxylapatite chromatography method, gel electrophoresis method, dialysis method or affinity chromatography. Monoclonal antibodies are also prepared by recombinant DNA methods, such as US Pat. No. 4,816,567.
It can be prepared by the method described in No. The DNA encoding the monoclonal antibody of the present invention can be easily prepared using a conventional method (for example, using an oligonucleotide probe capable of specifically binding to the genes encoding the heavy and light chains of mouse antibody). Can be isolated and sequenced. The hybridoma cells of the invention are a preferred source of such DNA. Once isolated, DNA
Can be placed in an expression vector, which is transfected into a host cell, such as monkey COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not produce immunoglobulin proteins, in a recombinant host cell. Monoclonal antibody can be synthesized with. In addition, DNA can be prepared, for example, by substituting the coding sequences for human heavy and light chain constant domains in place of homologous mouse sequences [US
Patent No. 4,816,567; Morrison et al., Supra], or by covalently linking a part or all of the coding sequence of the non-immunoglobulin polypeptide to the immunoglobulin coding sequence. Such a non-immunoglobulin polypeptide is
Substitution in place of the constant domain of the antibody of the present invention or in place of the variable domain of one antigen binding site of the antibody of the present invention can produce a chimeric bivalent antibody. Such non-immunoglobulin polypeptides can be substituted for the constant domain of the antibodies of the invention or for the variable domain of one of the antigen binding sites of the antibodies of the invention to produce chimeric, bivalent antibodies. The antibody is preferably a monovalent antibody. Methods for preparing monovalent antibodies are well known in the art. For example, one method involves recombinant expression of immunoglobulin light chain and modified heavy chain. The heavy chain is truncated generally at any point in the Fc region so as to prevent heavy chain crosslinking. Alternatively, the relevant cysteine residue is replaced or deleted with another amino acid residue to prevent cross-linking. In vitro methods are also suitable for preparing monovalent antibodies. Generation of fragments thereof, particularly Fab fragments, by digestion of the antibody can be accomplished using conventional techniques known in the art.

Iii. Human and Humanized Antibodies The antibodies of the present invention further include humanized antibodies or human antibodies. Humanized forms of non-human (eg, murine) antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (eg, Fv, Fab, Fab ′, F (ab ′) 2 or other antigen-binding subsequences of antibodies). It contains a minimal sequence derived from non-human immunoglobulin. The humanized antibody has a residue of the complementarity determining region (CDR) of the mouse,
It includes human immunoglobulins (recipient antibodies) replaced by residues in the CDRs of a non-human species (donor antibody) that has the desired specificity, affinity and potency, such as rat or rabbit. In some examples, human immunoglobulin Fv framework residues are replaced by corresponding non-human residues. Humanized antibodies may also contain residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. Generally, a humanized antibody has at least one, and typically no, at least one, where all or almost all CDR regions correspond to those of a non-human immunoglobulin and all or almost all FR regions are of human immunoglobulin consensus sequences. Contains substantially all of the two variable domains. The humanized antibody optimally comprises at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin [Jones et al., Nature, 321: 522-525 (1986); R
iechmann et al., Nature, 332: 323-329 (1988); and Presta, Curr. Op Struct. Bio.
l., 2: 593-596 (1992)]. Methods for humanizing non-human antibodies are well known in the art. Generally, a humanized antibody has one or more amino acid residues of non-human origin introduced. These non-human amino acid residues are often referred to as "import" residues, which typically result from an "import" variable domain. Humanization is basically done by replacing the corresponding sequence of the human antibody with a rodent CDR or CDR sequences by winter and coworkers [
Jones et al., Nature, 321: 522-525 (1986); Riechmann et al., Nature, 332: 323-327 (1).
988); Verhoeyen et al., Science, 239: 1534-1536 (1988)] by replacing the rodent CDRs or CDR sequences with the corresponding sequences of human antibodies. Thus, such "humanized" antibodies are chimeric antibodies in which substantially less than the intact human variable domain has been replaced with the corresponding sequence from a non-human species (US Pat.
, 816, 567). In fact, humanized antibodies are typically human antibodies in which some CDR residues and optionally some FR residues have been replaced by residues from similar sites in rodent antibodies. Human antibodies are also available in phage display libraries [Hoogenboom and Winter, J. Mol.
Biol., 227: 381 (1992); Marks et al., J. Mol. Biol., 222: 581 (1991)], and can be prepared using various methods known in the art. Further, techniques such as Cole et al. And Boerner et al. Can also be used for the preparation of human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss. P. 77 (1
985; Boerner et al., J. Immunol., 147 (1): 86-95 (1991); US Pat. No. 5,750,373). Similarly, human antibodies can be produced by introducing human immunoglobulin loci into transgenic animals, eg, mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon loading, production of human antibodies is observed that is very similar to that found in humans in all respects, including gene rearrangement, assembly, and antibody repertoire. This approach is described, for example, in US Pat.
5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,63.
No. 3,425; No. 5,661,016 and the following scientific literature: Marks et al., Bio / Technology 10,
779-783 (1992); Lonberg et al., Nature 368 856-859 (1994); Morrison, Nature 3
68, 812-13 (1994); Fishwild et al., Nature Biotechnology 14, 845-51 (1996); N
euberger, Nature Biotechnology 14, 826 (1996); Lonberg and Huszar, Intern
Rev. Immunol. 13 65-93 (1995).

Iv. Bispecific Antibodies Bispecific antibodies are monoclonal antibodies, preferably human or humanized antibodies, that have binding specificities for at least two different antigens. In the present case, one of the binding specificities is for a polypeptide of the invention, the other one is for any other antigen, preferably a cell surface protein or receptor or receptor subunit. Methods of making bispecific antibodies are well known in the art. Traditionally, recombinant production of bispecific antibodies is based on the co-expression of two immunoglobulin heavy chain / light chain pairs with two heavy chains having different specificities (Milstein and Cuello, Nature,
305: 537-539 (1983)). Due to the random assortment of immunoglobulin heavy and light chains, these hybridomas (quadromas) produce a potential mixture of 10 different antibody molecules, of which only one has the correct bispecific structure. Purification of the correct molecule is usually accomplished by affinity chromatography steps. A similar procedure is WO 93/08829 published May 13, 1993, and Traunecker et al., EMBO J., 10: 3655-.
3656 (1991). Antibody variable domains with the desired binding specificities (antibody-antigen combining sites) can be fused to immunoglobulin constant domain sequences. The fusion is preferably with an immunoglobulin heavy chain constant domain, comprising at least the hinge region, and portions of the CH2 and CH3 regions. It is preferred to have the first heavy-chain constant region (CH1) containing the site necessary for light-chain binding present in at least one of the fusions. The DNA encoding the immunoglobulin heavy chain fusion and, if desired, the immunoglobulin light chain are inserted into separate expression vectors and cotransfected into a suitable host organism. For more details on making bispecific antibodies, see, for example, Suresh et al., Methods in Enzymology, 121: 210 (1986).
Please refer to.

V. Heteroconjugate Antibodies Heteroconjugate antibodies consist of two covalently joined antibodies. Such antibodies are used, for example, to target cells of the immune system to unwanted cells [US Pat.
676,980] and for the treatment of HIV infection [WO 91/00360; WO 92/200373; EP 0
3089] Proposed. It is believed that this antibody can be prepared in vitro using known methods in synthetic protein chemistry, including those associated with cross-linking agents. For example, immunotoxins can be made using a disulfide exchange reaction or by forming a thioether bond. Examples of suitable reagents for this purpose include iminothiolate and methyl-4-mercaptobutyrimidate, and those disclosed, for example, in US Pat. No. 4,6767,980. vi. Effector Function Design It may be desirable to modify the antibody of the invention with respect to effector function, eg to enhance the efficacy of the antibody in treating cancer. For example, cysteine residue (s) are introduced in the Fc region to allow interchain disulphide bond formation in this region. The homodimeric antibody thus produced may have improved internalization capacity and / or increased complement-mediated cell killing and antibody-dependent cellular cytotoxicity (ADCC).
Caron et al., J. Exp. Med. 176: 1191-1195 (1992) and Shopes, BJ Immunol. 148.
: 2918-2922 (1992). Homodimeric antibodies with enhanced antitumor activity can also be prepared using a heterobifunctional crosslinker as described by Wolff et al., Cancer Research 53: 2560-2565 (1993). Alternatively, antibodies can be designed that have dual Fc regions and thus have enhanced complement lysis and ADCC capabilities. See Stevenson et al., Anti-cancer Drug Design 3: 219-230 (1989).

Vii. Immune Conjugates The present invention also relates to chemotherapeutic agents, cytotoxic agents such as toxins (eg, enzymatically active toxins of bacterial, fungal, plant or animal origin, or fragments thereof) or radioisotopes (ie, radioconjugates). It also relates to an immunoconjugate comprising the conjugated antibody. Chemotherapeutic agents useful in the formation of such immune complexes have been described above. Enzymatically active toxins and fragments thereof that can be used are diphtheria A chain, non-binding active fragments of diphtheria toxin, cholera toxin, botulinum toxin, exotoxin A chain (from Pseudomonas aeruginosa), ricin A.
Chain, abrin A chain, modeccin A chain, alpha-sarcin, Aleurites fordii protein, dianthin protein, Phytolaca americana protein (PAPI)
, PAPII, and PAP-S), momordica charancia (momordica char
antia inhibitor, curcin, crotin, sapaonaria oficinalis inhibitor, gelonin, mitogellin, restrictocin, phenomycin
mycin), enomycin and trichothecene. Various radionucleotides are available for the production of radioconjugated antibodies. Examples include ^{2 12} Bi, ¹³¹ I, ¹³¹ In, ⁹⁰ Y and ¹⁸⁶ Re. Conjugates of antibodies and cytotoxic drugs include various bifunctional protein coupling agents,
For example, N-succinimidyl-3- (2-pyridyldithiol) propionate (S
PDP), iminothiolane (IT), bifunctional derivative of imide ester (dimethyl adipimidate HCL, etc.), active ester (disuccinimidyl suberate, etc.), aldehyde (glutaraldehyde, etc.), bis-azide compound (bis (p-azidobenzoyl) hexanediamine, etc., bis-diazonium derivative (bis- (p-diazoniumbenzoyl) -ethylenediamine, etc.), diisocyanate (triene 2)
, 6-diisocyanate, etc.) and bis-active fluorine compounds (1,5-difluoro-
2,4-dinitrobenzene etc.). For example, a ricin immunotoxin can be prepared as described in Vitetta et al., Science 238: 1098 (1987). Carbon-14-labeled 1-isothiocyanatobenzyl-3-methyldiethylenetriaminepentaacetic acid (MX-DTPA) is an example of a chelating agent for conjugation of radionucleotide to the antibody. See WO 94/11026. In another embodiment, the antibody may be conjugated to a "receptor" (such as streptavidin) for use in tumor pre-targeting, and the antibody-receptor complex is administered to a patient, followed by a clarifier. It is used to remove unbound complex from the circulation and then administer a "ligand" (eg, avidin) conjugated to a cytotoxic drug (eg, a radionucleotide).

Viii. Immunoliposomes Also, the proteins, antibodies, etc. disclosed herein may be prepared as immunoliposomes. Liposomes containing antibodies are described by Epstein et al., Proc. Natl. Acad. Sci. USA, 8
2: 3688 (1985); Hwang et al., Proc. Natl. Acad. Sci. USA, 77: 4030 (1980); and known in the art as described in U.S. Pat. Prepared by the method. Liposomes with improved circulation time are described in US Pat.
No. 013,556. Particularly useful liposomes are phosphatidylcholine, cholesterol and PEG.
-Produced by the reverse phase evaporation method with a lipid composition containing derivatized phosphatidylethanolamine (PEG-PE). The liposomes are extruded through a filter of a given size to produce liposomes with the desired size. Fab of the antibody of the present invention
The'fragment can be conjugated to liposomes via a disulfide exchange reaction as described by Martin et al., J. Biol. Chem. 257: 286-288 (1982). Chemotherapy (
Doxorubicin, etc.) is optionally contained within the liposome. Gabizon etc.,
See J. National Cancer Inst. 81 (19) 1484 (1989).

10. Pharmaceutical Compositions The active molecules, polypeptides and antibodies of the invention, as well as other molecules identified in the screening assays disclosed above, can be administered in the form of pharmaceutical compositions for the treatment of immune related disorders. . A therapeutic formulation of an active molecule, preferably a polypeptide or antibody of the invention, comprises the active molecule having the desired degree of purity, in the form of a lipophilic formulation or an aqueous solution, in any pharmaceutically acceptable carrier, excipient. Prepared and stored by mixing with a excipient or stabilizer (Remington's Pharmaceutical Science 16th edition, Osol, A. Ed. [198
0]). Acceptable carriers, excipients, or stabilizers are non-toxic to recipients at the doses and concentrations used and include buffers such as phosphoric acid, citric acid, and other organic acids; including ascorbic acid and methionine. Antioxidants; preservatives (octadecyldimethylbenzylammonium chloride; hexamethonium chloride; benzalkonium chloride; benzethonium chloride; phenol; butyl or benzyl alcohol; alkylparabens such as methyl or propylparaben; catechol; resorcinol; cyclohexanol 3-pentanol; and m-cresol, etc.); low molecular weight (less than about 10 residues) polypeptides; proteins such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; glycine, glutamic acid , Asparagine, histidine, arginine, or amino acids such as lysine; monosaccharides, including glucose, mannose, or dextrin,
Disaccharides and other carbohydrates, chelating agents such as EDTA, sugars such as sucrose, mannitol, trehalose or sorbitol; salt forming counterions such as sodium; metal complexes (eg Zn-protein complexes) or TWEEN (commodity) Name)
, PLURONICS (trade name), and polyethylene glycol (PEG
) And other nonionic surfactants. The compounds identified in the screening assays of the invention are formulated in a similar fashion, using standard techniques known in the art. Lipofections or liposomes can also be used to deliver polypeptides, antibodies, or antibody fragments to cells. When antibody fragments are used, the smallest inhibitory fragment that specifically binds to the binding domain of the target protein is preferred. For example, based on the variable region sequences of antibodies, peptide molecules can be designed to retain the ability to bind target protein sequences. Such peptides can be chemically synthesized and / or produced by recombinant DNA technology (Marasco et al., Proc. Natl. Acad. Sci. USA 90.
. 7889-7893 [1993]). The formulation herein comprises one or more active compounds as necessary for the particular indication being treated,
Those having complementary activities that preferably do not adversely affect each other may also be included. Alternatively, or in addition, the composition may include a cytotoxic drug, cytokine or growth inhibitor. These molecules are suitably present in combination in amounts that are effective for the purpose intended.

The active molecules may also be colloidal drug delivery in microcapsules prepared eg by coacervation techniques or by interfacial polymerization, eg hydroxymethylcellulose or gelatin-microcapsules and poly (methylmethacrylate) microcapsules, respectively. It may be entrapped in the system <BR (eg liposomes, albumin globules, microemulsions, nanoparticles and nanocapsules) or in microemulsions. These technologies are based on Remington's Pharmaceutical Science.
16th edition, Osol, A. Ed. [1980]. The formulations used for in vivo administration must be sterile. This is easily accomplished by filtration through a sterile filtration membrane. Sustained-release preparations may be prepared. Suitable examples of sustained release formulations include semipermeable matrices of solid hydrophobic polymers containing the antibody, which matrices are shaped articles,
For example, in the form of a film or microcapsules. Examples of sustained release matrices are polyester hydrogels (eg poly (2-hydroxyethyl-methacrylate) or poly (vinyl alcohol)), polyactides (US Pat. No. 3,773,919).
L-glutamic acid and γ-ethyl-L-glutamate, non-degradable ethylene-vinyl acetate, LUPRON DEPOT (trade name) (injectable globules of lactic acid-glycolic acid copolymer and leuprolide acetate) Acid Copolymer, Poly- (D)
Contains 3-hydroxybutyric acid. While polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid enable release of molecules for over 100 days, certain hydrogels release proteins for shorter time periods. When the encapsulated antibodies remain in the body for a long time, they are denatured or aggregated by exposure to water at 37 ° C, resulting in reduced biological activity and possible altered immunogenicity. . Rational methods can be devised for stabilization depending on the mechanism involved. For example, if the aggregation mechanism was found to be intermolecular SS bond formation through thio-disulfide exchange, stabilization could be modification of sulfhydryl residues, lyophilization from acidic solutions, control of water content, appropriate Can be achieved by the addition of various additives and the development of specific polymer matrix compositions.

11. Therapeutic Methods The polypeptides, antibodies and other compounds of the present invention are useful in a variety of immune related diseases and conditions, such as infiltration of inflammatory sperm cells into tissues, stimulation of T cell proliferation, inhibition of T cell proliferation, and defect permeability. It is believed that it can be used to treat T cell mediated diseases, including those characterized by an increase or decrease or their inhibition. Examples of conditions or diseases treated with the polypeptides, antibodies and other compounds of the invention include, but are not limited to, systemic lupus erythematosus, rheumatoid arthritis, juvenile chronic arthritis, osteoarthritis, myeloarthritis. , Systemic sclerosis (scleroderma), idiopathic inflammatory myopathy (dermatomyositis, polymyositis), Sjogren's syndrome, systemic vasculitis,
Sarcoidosis, autoimmune hemolytic anemia (immune pancytopenia, paroxysmal nocturnal hemoglobinuria), autoimmune thrombocytopenia (idiopathic thrombocytopenic purpura, immune-mediated thrombocytopenia), thyroiditis (Graves) Disease, Hashimoto thyroiditis, juvenile lymphocytic thyroiditis, atrophic thyroiditis), diabetes mellitus, immune-mediated renal disease (glomerulonephritis, tubular interstitial nephritis), multiple sclerosis, idiopathic demyelinating polyp Demyelinating diseases of the central and peripheral nervous system, such as infectious neuropathy or Guyan-Barre syndrome and chronic inflammatory demyelinating polyneuropathy, infectious hepatitis (A, B, C, D, E and other non-hepatotrophic) Virus), autoimmune chronic active hepatitis, primary biliary cirrhosis, granulomatous hepatitis, hepatobiliary diseases such as sclerosing cholangitis, inflammatory bowel disease (ulcerative colitis: Crohn's disease), gluten-sensitive enteritis, And howie Inflammatory and fibrotic lung disease pull diseases such as bullous dermatoses,
Autoimmune or immune-mediated skin diseases including erythema multiforme and contact dermatitis, psoriasis, asthma, allergic rhinitis, atopic dermatitis, allergic diseases such as food sensitivity and urticaria, eosinophilic pneumonia , Pulmonary immune disorders such as idiopathic pulmonary fibrosis and hypersensitivity pneumonia,
Includes transplantation-related diseases, including transplant rejection and graft-versus-host disease.

In systemic lupus erythematosus, the central mediator of the disease is the production of autoreactive antibodies to self proteins / tissues and the subsequent development of immune-mediated inflammation. Antibodies directly or indirectly mediate tissue injury. Although T lymphocytes have not been shown to be directly involved in tissue damage, T lymphocytes are required for the development of autoreactive antibodies. Thus, disease development is T cell dependent. Many organs and systems are clinically affected, including the kidneys, lungs, skeletal musculature, cutaneous mucous membranes, eyes, central nervous system, cardiovascular system, gastrointestinal tract, bone marrow and blood. Rheumatoid arthritis (RA) is a chronic systemic autoimmune inflammatory disease that mainly involves the synovium of many joints and is ultimately associated with damage to articular cartilage. The etiology is T cell dependent and is associated with the production of autoantibodies against self IgG, rheumatoid factor, which results in the formation of immune complexes, which reach high levels in synovial fluid and blood. These complexes in the joints induce a marked infiltration of lymphocytes and monocytes into the synovium and subsequent changes in the synovium, and when infiltrated by similar cells with the addition of many neutrophils. Joint space / liquid. The tissues affected are mainly joints, often in a symmetrical pattern. However, extra-articular disease also occurs in two major forms.
One form is the progression of extra-articular damage due to the progression of progressive joint disease, typically low damage is pulmonary fibrosis, vasculitis, and skin ulcers. The second form of extra-articular disease is the so-called Felty syndrome, which occurs late in RA disease but sometimes after the onset of sedation of joint disease, including neutropenia, thrombocytopenia and splenomegaly. It can be associated with vasculitis with infarction in multiple organs, skin ulcers and gangrene. Also, the patient
Rheumatoid arthritis nodules often develop in the subcutaneous tissue overlying the affected joints; later stages of the nodules have a necrotic core surrounded by mixed inflammatory cell infiltrates. Other possible manifestations of RA include: pericarditis, pleurisy, coronary arteritis, interstitial pneumonia with pulmonary fibrosis, keratoconjunctivitis sicca, and rheumatoid arthritis nodules. Juvenile chronic arthritis is a chronic idiopathic verifiable disease, often beginning at the age of less than 16 years. Its phenotype has some similarities to RA: some rheumatoid factor-positive patients are also classified as juvenile chronic arthritis. The disease is subdivided into three major categories: pauciarticular, polyarticular, and systemic. Arthritis can be severe, typically destructive, leading to joint ankylosis and growth retardation. Other signs may include chronic anterior uveitis and systemic amyloidosis.

Myeloarthritis is a group of diseases associated with some common clinical features and the expression of the HLA-B27 gene product in common. The disease includes: ankylosing spondylitis, Reiter's syndrome (reactive arthritis), arthritis associated with inflammatory bladder disease, myelitis with psoriasis, juvenile onset of myeloarthritis and undifferentiated myelodystrophy. Distinct features are sacroiliacitis with or without myelitis; inflammatory asymmetric arthritis; HLA-B27 (Class I M
Includes a serologically determined allele of the HLA-B position of HC) association; ocular inflammation; and lack of autoantigens associated with other rheumatic diseases. The cells most likely to be the key to the induction of disease are CD8 + T lymphocytes, cells that target antigens presented by class I MHC molecules. CD8 + T cells respond to the class I MHC allele HLA-B27 as if they were foreign peptides expressed by MHC class I molecules. The HLA-B27 epitope resembles a bacterial or other microbial antigenic epitope, thus eliciting a CD8 + T cell response. The etiology of systemic sclerosis (scleroderma) is known. The hallmark of the disease is induration of the skin; it appears to be triggered by active inflammatory processes. Scleroderma is local or systemic, vascular damage is prevalent, and capillary epithelial cell damage is an important early event in the development of systemic scleroderma; vascular damage can be immune-mediated. The immunological basis is the presence of mononuclear cell infiltrates in skin lesions, and anti-infection in many patients.
Indicated by the presence of nuclear antibodies. ICAM-1 is often upregulated on the cell surface of fibroblasts in skin lesions, suggesting that T-cell interactions with these cells play a role in the pathology of this disease. Other organs are: gastrointestinal tract: smooth muscle atrophy and fibrosis resulting in abnormal peristalsis / motility; kidney: affecting the arcuate and interlobular arteries, resulting in decreased renal cortical blood flow, proteinuria, Afferent Subcutaneous Intimal Hyperplasia that Leads to Hypernitrogenemia and Hypertension; Skeletal Muscle: Atrophy, Intestinal Fibrosis, Inflammation; Lung: Interstitial Pneumonia and Interstitial Fibrosis; and Heart: Contraction Zone Necrosis, Scarring / Fibrosis Including illness.

Idiopathic inflammatory myopathy, including dermatomyositis, polymyositis and others, is a chronic muscle inflammation of unknown etiology that results in muscle weakness. Muscle damage / inflammation is often symmetrical and progressive. Autoantibodies are associated with the greatest form. These myositis-specific autoantibodies are detected against and inhibit the function of components involved in protein synthesis, proteins and RNA. Sjogren's syndrome is due to immune-mediated inflammation and subsequent functional destruction of the lacrimal and salivary glands. This disease is associated with and may be associated with inflammatory joint tissue disease. The disease is associated with autoantibody production against the Ro and La antigens, both small RNA-protein complexes. Injuries result in keratoconjunctivitis sicca, dry mouth, and proteins and signs or associations include viral cirrhosis, peripheral or sensory neuropathy, and overt purpura. Systemic vasculitis is the main injury is inflammation and subsequent damage to blood vessels, ischemia / necrosis / degeneration and in some cases the ultimate end tissue of the tissue supplied by the affected blood vessels. Cause functional impairment. In addition, pulse hepatitis causes, as a second injury or sequelae, other immune-inflammatory-mediated diseases such as rheumatoid arthritis, systemic sclerosis, etc., and is associated with the formation of immune complexes, especially in the disease. The groups of primary systemic vasculitis are: systemic necrotizing vasculitis: polyarteritis nodule, allergic vasculitis and granulomatosis, polyangiitis; Wegener's granulomatosis; lymphomatous granulomatosis; and Includes giant cell arteritis. Other vasculitis includes: mucocutaneous lymph node syndrome (MLNS or Kawasaki disease), solitary CNS vasculitis, Behcet's disease, thromboangiitis obliterans (Burger's disease) and cutaneous necrotizing vasculitis. The pathogenic mechanism for most types of vasculitis listed is primarily due to the deposition of immunoglobulin complexes in the vessel wall and subsequent induction of inflammatory responses via ADCC, either complex formation, or both. Sarcoidosis is a condition of unknown etiology, characterized by the presence of epithelioid granulomas near any tissue in the body; it is most commonly involved in the lungs. Pathogens include the persistence of activated macrophages and lymphocytes at the site of disease, with chronic sequelae resulting from the release of local or systemic products released by these cell types. Autoimmune hemolytic anemia, including autoimmune hemolytic anemia, immune pancytopenia, and paroxysmal nocturnal hemoglobinuria, is the surface of red blood cells (and in some cases other blood cells, including platelets). Is a result of the production of antibodies that react with the antigens expressed in Figure 3 and reflects the removal of cells coated with these antibodies via complement-mediated lysis and / or ADCC / Fc-receptor-mediated mechanisms.

Idiopathic thrombocytopenic purpura and in other clinical settings immune-mediated thrombocytopenia, autoimmune thrombocytopenia including platelet destruction / removal, is the adherence of antibodies or complement to platelets and subsequent complementation. It occurs as a result of somatic lysis, removal by ADCC or Fc-receptor mediated mechanisms. Thyroiditis, including Graves' disease, Hashimoto's thyroiditis, juvenile lymphocytic thyroiditis, and atrophic thyroiditis, is the result of an autoimmune reaction to thyroid antigens, with proteins that are present in the thyroid, and often specific for it. It involves the production of reactive antibodies. The experimental models that exist include the spontaneous model: rats (BUF and BB rats) and chicken (obese chicken strain); the provocative model: thyroglobulin, immunization of animals with thyroid microsomal antigen (thyroid peroxidase). Type I diabetes mellitus or insulin-dependent diabetes mellitus is an autoimmune destruction of islet β cells; this destruction is mediated by autoantibodies and autoreactive T cells. Insulin or insulin receptor antibodies can also produce an insulin-non-reactive phenotype. Immune-mediated renal disease, including glomerulonephritis and renal tubular interstitial nephritis, is an autoreactive antibody to renal antigens or an antibody that is either direct as a result of T cell production or reactive to other non-renal antigens. And / or is the result of antibody or T lymphocyte mediated injury to indirect kidney tissue as a result of deposition of immune complexes within the kidney. Thus, other immune-mediated diseases that result in the formation of immune complexes may also induce immune-mediated renal disease as a sequela. Both direct and indirect immune mechanisms result in immune responses that result in / provide lesion progression, resulting in impaired organ function and in some cases progression of renal failure. Both humoral and cellular immune mechanisms are involved in the pathogenesis of injury.

Demyelinating disorders of the central and peripheral nervous system, including multiple sclerosis; idiopathic demyelinating polyneuropathy or Guian-Barre syndrome; and chronic inflammatory demyelinating polyneuropathy, are autoimmune. Underlying and results in neural demyelination as a result of damage directly caused to oligodendroglia or myelin. In MS, there is evidence to suggest that disease induction and progression is T lymphocyte dependent. Multiple sclerosis is a demyelinating disease, T lymphocyte dependent, with a relapsing-mitigating or chronic progressive pathway. The etiology is unknown; viral infection, genetic predisposition, environment, and autoimmunity all contribute. Lesions mainly contain T lymphocyte mediated infiltration, microglial cells and infiltrating macrophages; CD4 + T lymphocytes are the major cell type of the lesion. The mechanism of oligodendroglial cell death and subsequent demyelination is unknown, but appears to be T lymphocyte driven. Inflammatory and fibrotic lung diseases, including eosinophilic pneumonia, idiopathic pulmonary fibrosis, and hypersensitivity pneumonia can include uncontrolled immune responses. Inhibition of that response would be therapeutically beneficial. Autoimmune or immune-mediated skin diseases, including bullous skin diseases, erythema multiforme and contact dermatitis, are mediated by autoantibodies, the etiology of which is T lymphocyte dependent. Psoriasis is a T lymphocyte-mediated inflammatory disease. The lesion contains infiltration of T lymphocytes, macrophages and antigen-treated cells, and some antineutrophils. Allergic diseases including asthma, allergic rhinitis, atopic dermatitis, food hypersensitivity and urticaria are T lymphocyte dependent. These diseases are primarily mediated by T cell-induced inflammation, IgE-mediated inflammation, or a combination of both. Transplantation-related diseases, including transplant rejection and graft-versus-host disease (GVHD) are T lymphocyte dependent; inhibition of T lymphocyte function is ameliorating.

Other diseases in which intervention of the immune and / or inflammatory response would be beneficial include, but are not limited to, viral infections (including but not limited to AIDS, hepatitis A, B, C, D, E and herpes). , Bacterial infections, fungal infections, and protist and parasite infections (MLRs)
Molecules (or derivatives / agonists) that can be used therapeutically to promote an immune response to infectious agents, immunodeficiency disorders (molecules / derivatives / agonists that stimulate MLR are innate, acquired, In infectious diseases, including provocative (such as HIV infection), or iatrogenic (eg, from chemotherapeutic agents) that can be used therapeutically to promote an immune response to immunodeficient conditions, and tumorigenesis is there. In some human cancer patients, antibodies and / or T lymphocyte responses to antigens on tumorigenic cells have been shown to develop. It has also been shown that promoting an immune response in an animal model of tumor formation can result in rejection or regression of that particular tumor. M
Molecules that promote the T lymphocyte response in the LR have utility in promoting the immune response to tumorigenesis in vivo. Molecules that promote the T lymphocyte proliferative response (or small molecule agonists or antibodies that affect the same receptor in a repulsive fashion) can be used therapeutically for the treatment of cancer. Molecules that inhibit lymphocyte responses in MLR also function to suppress the immune response to tumors during tumorigenesis in vivo; such molecules are expressed by the tumor cells themselves or their expression is It can be induced by tumors of other cells. Antagonism of such inhibitory molecules (by antibodies, small molecule antagonists or other means) promotes immune-mediated tumor rejection. Furthermore, inhibition of molecules with pro-inflammatory properties includes trauma; stroke; myocardial infarction; atherosclerosis, acute lung injury, hemorrhagic shock; burns; sepsis / septic diet; acute renal tubular necrosis; endometriosis. With therapeutic benefit in reperfusion of degenerative joint disease and pancreatitis. A compound of the invention, such as a polypeptide or antibody, is administered to a mammal, preferably a human, by well known methods, such as intravenous administration as a bolus or by continuous infusion over a period of time, intramuscular, intraperitoneal, intracerebrospinal, It is administered by subcutaneous, intra-articular, intrasynovial, intrathecal, oral, topical, or inhalation (intranasal or intrapulmonary) route. Intravenous or inhaled administration of polypeptides and antibodies is preferred.

In immunoadjuvant therapy, other therapeutic regimens, eg, administration of anti-cancer agents, may be combined with administration of the proteins, antibodies or compounds of the invention. For example, patients treated with the immunoadjuvants of the invention may also receive anti-cancer agents (chemotherapeutic agents) or radiation therapy. The method of preparation and dose schedule for such chemotherapeutic agents will be used according to the manufacturer's instructions or empirically determined by the skilled practitioner.
Preparations and dose schedules for such chemotherapy are also described in Chemotherapy S.
ervice MC Perry, Williams and Wilkins, Baltimore, MD (1992). The chemotherapeutic agent may be administered prior to, subsequent to, or concomitant with the administration of the immunoadjuvant. Furthermore, anti-estrogen compounds such as tamoxifen or anti-progesterone such as onapristone (EP 6
Compounds such as 16812) may be given at known doses for those molecules. Also, antibodies against other immune disease or tumor associated antigens such as CD20, CD1
It is also preferred to administer an antibody that binds to 1a, CD18, ErbB2, EGFR, ErbB3, ErbB4, or vascular endothelial factor (VEGF). Alternatively, or additionally, two or more antibodies that bind the same or two or more different antigens disclosed herein may be co-administered to the patient. Sometimes it is also advantageous to administer one or more cytokines to the patient. In one embodiment, the polypeptides of the invention are co-administered with a growth inhibitor. For example, the growth inhibitor is administered first, followed by the polypeptide of the invention. However, concomitant administration, first administration is also conceivable. Suitable dosages for growth inhibitors are those currently used, but combinations of growth inhibitors with a polypeptide of the invention (synergistic).
It can be reduced by action. For the treatment or reduction of the severity of immune related disorders, a suitable dose of a compound of the invention will be as defined above, the type of disorder being treated, the severity and course of the disorder, the prevention of the drug or It will be administered for therapeutic purposes or will depend on prior treatment, the patient's clinical history and response to the compound, and the discretion of the attending physician. The compound is suitably administered to the patient at one time or over a series of treatments. For example, depending on the type and severity of the disease, about 1 μg / kg to 15 mg / kg (
For example, 0.1-20 mg / kg of the polypeptide or antibody is the first candidate dose for administration to a patient, eg, in one or more separate doses or continuous infusion. A typical daily dosage might be about 1μ, depending on the factors mentioned above.
It may be from g / kg to 100 mg / kg or higher. For repeated administrations over several days or longer, depending on the condition, the treatment is continued until the desired suppression of symptoms of the disease appears. However, other dosage regimens may be useful. The progress of this therapy is easily monitored by conventional techniques and assays.

12. Articles of Manufacture In another embodiment of the invention, an article of manufacture containing materials useful for the diagnosis or treatment of the above immune related disorders is provided. This article of manufacture comprises a container and a label. Suitable containers include, for example, bottles, vials, syringes, and test tubes. The container may be formed from a material such as glass or plastic. The container holds a composition effective for diagnosing and treating the condition and may have a sterile access port (eg,
The container may be an intravenous solution bag or vial with a stopper pierceable by a hypodermic needle). The active agent in the composition is usually a polypeptide or antibody of the invention. The label on or on the container indicates that the composition is used for diagnosing or treating the condition of choice. The article of manufacture may further comprise a second container containing a pharmaceutically acceptable buffer such as phosphate buffered saline, Ringer's solution and dextrose solution. In addition, it may include other buffers, diluents, filters, needles, syringes, and other materials desirable from a commercial and user standpoint, including package inserts with instructions for use.

13. Diagnosis and Prognosis of Immune-Related Diseases Cell surface proteins such as proteins that are overexpressed in certain immune-related diseases are excellent targets for candidate drugs or disease treatments. The same proteins, with secreted proteins encoded by genes amplified in immune related disease states, find further use in the diagnosis and prognosis of these diseases. For example, antibodies to the protein products of genes amplified in multiple sclerosis, rheumatoid arthritis, or other immune related disorders can be used as diagnostics or prognosis. For example, antibodies, including antibody fragments, can be used for qualitative or quantitative detection of the expression of the protein encoded by the amplified gene (“marker gene product”). The antibody is preferably provided with a detectable, eg fluorescent, label and binding can be monitored by light microscopy, flow cytometry, fluorometry, or other techniques known in the art. These techniques are particularly preferred when the amplified gene encodes a cell surface protein. Such binding assays are performed substantially as described above. In situ detection of antibodies that bind to the marker gene product can be performed, for example, by immunofluorescence or immunoelectron microscopy. For this purpose, a labeled antibody is applied to it by removing a histological sample from the patient and preferably overlaying the biological sample with the antibody. This approach also allows the distribution of the marker gene product in the tissues tested to be determined. It will be apparent to those skilled in the art that a wide range of histological methods are readily available for in situ detection.

The following examples are provided by way of illustration only and are not intended to limit the scope of the invention in any way. The entirety of all patents and literature references cited in this specification are hereby incorporated by reference. EXAMPLES All other commercial reagents referred to in the examples were used according to manufacturer's instructions unless otherwise indicated. Sources of cells identified throughout the specification and examples below by ATCC accession number are American Type Culture Collection, 10801 University Building, Manassas, VA2.
0110-2209. Unless otherwise noted, the present invention employed standard techniques of recombinant DNA technology, such as those described above and in the following textbooks: Sambrook.
Et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press NY
., 1989; Ausubel et al., Current Protocols in Molecular Biology, Green Publis
hing Associates and Wiley Interscience, NY, 1989; Innis et al., PCR Protoco
ls: A Guide to Methods and Applications, Academic Press, Inc., NY., 19
90; Harlow et al., Antibodies: A Laboratory Manual, Cold Spring Harbor Press,
Cold Spring Harbor, 1988; Gait, Oligonucleotide synthesis, IRL Press, O
xford, 1984; RI Freshney, Animal Cell Culture, 1987; Coligan et al., Curren
t Protocols in Immunology, 1991.

Example 1 Human PROPRO245, PRO217, PRO301, PRO266, PRO
Isolation of cDNA clones encoding 335, PRO331 or PRO326 I. Isolation of cDNA encoding human PRO245 clone Isolation of cDNA clone encoding human PRO245 Extracellular domain (ECD) sequences from approximately 950 known secreted proteins from the Swiss-Prot database (secretion signal sequence, if present) Were used to search the expressed sequence tag (EST) database. The EST database is a public EST
Includes databases (eg GenBank) and personal EST databases (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, CA). The search is performed by the computer program BLAST or BLAST2 [Altschul et al., Methods in Enzymology, 266: 460.
-480 (1996)] as a comparison of ECD protein sequences for 6-frame translation of EST sequences. It does not encode a known protein and has a BLAST score of 70 (9
Comparisons with a value of 0 or more) or higher are assigned to the program "phrap" (Phil Gre
en, University of Washington, Seattle, Washington)
Constructed by grouping into sequences. A consensus DNA sequence encoding PRO245 was constructed against another EST sequence, which was designated herein as DNA30954, and the polypeptide showed some structural integrity with the membrane protein receptor tyrosine kinase protein. Oligonucleotides were synthesized based on the DNA30954 consensus sequence to identify a cDNA library containing the sequence of interest by PCR and to be used as a probe to isolate clones of the PRO245 full-length coding sequence. A pair of PCR primers (forward and reverse) was synthesized: Forward PCR primer: 5'-ATCGTTGTGAAGTTAGTGCCCC-3 '(SEQ ID NO: 15) Reverse PCR primer: 5'-ACCTGCGATATCCAACAGAATTG-3' (SEQ ID NO: 16) ) Furthermore, a synthetic oligonucleotide hybridization probe having the following nucleotide sequence was constructed from the consensus DNA30954 sequence: Hybridization probe: 5'-GGAAGAGGATACAGTCACTCTGGAAGTATTAGTGGCTCCAGCAGTTCC-3 '(SEQ ID NO: 17)

To screen several libraries for a source of full-length clones, DNA from the libraries was digested with P with identified PCR primer pairs as described above.
Screened by CR amplification. The positive library was then used to isolate clones encoding PRO245 with one of the probe oligonucleotides and the primer pair. RNA for the construction of a cDNA library was isolated from human fetal liver tissue. The cDNA library used to isolate the cDNA clone was Invitrog
Formed by standard methods using commercially available reagents such as those from En, San Diego, CA. The cDNA was primed with an oligo dT containing a NotI site, ligated at the blunt end of the SalI hemikinase adapter, cut with NotI, roughly size-resolved by gel electrophoresis, and cloned into the appropriate cloning vector in the determined orientation ( pRK
B or pRKD, etc .; pRK5B is a precursor of pRK5D that does not have an SfiI site; Holmes et al., Science, 253: 1278-1280 (1991).
It was cloned at the otI site. The DNA sequence of the clone isolated as described above gave the full-length DNA sequence for the full-length PRO245 polypeptide [herein designated as UNQ219 (DNA35638)] and the derived protein sequence of the PRO245 polypeptide. The full-length nucleotide sequence of UNQ219 (DNA35638) is shown in Fig3 (SEQ ID NO: 1). Clone UNQ219 (DNA35638) contains a single open reading frame reading frame at nucleotide position 89.
It has an apparent translational initiation site at -91 [Kozak et al., Supra], nucleotide position 1
It terminates at the stop codon at 025-1027 (Fig3). The predicted polypeptide precursor is 312 amino acids long (Fig4: PRO245; SEQ ID NO: 2).
. Clone UNQ219 (DNA35638) was deposited with the ATCC on September 17, 1997 and is assigned ATCC deposit no. Amino acid sequence analysis of the full-length PRO245 sequence suggested that it has 60% amino acid identity with the human c-myb protein and is thus a novel member of the transmembrane protein receptor tyrosine kinase family.

II. Isolation of a cDNA clone encoding human PRO217. Extracellular domain (ECD) sequences (including the secretory signal sequence, if any) from about 950 known secreted proteins from the Swiss-Prot database were used to search the EST database. did. The EST database is a public EST database (eg GenBank) and a personal EST database (LIFESEQ (trade name), Incyte Pha
rmaceuticals, Palo Alto, CA). Search the computer program BLAST
Or BLAST2 (Altschul et al., Methods in Enzymology, 266: 460-480 (1996); thhp:
//blast.wustl/edu/blast/README.html) as a comparison of the ECD protein sequence to the 6-frame translation of the EST sequence. A comparison that does not encode a known protein and has a BLAST score of 70 (sometimes 90) or higher is the program "phrap" (Phil Green, University of Washington, Seattle, Washingt
on; http://bozeman.mbt.washington.edu/phrap/docs/phrap.html) and assembled into a consensus DNA sequence. Consensus DNA sequences encoding EGF-like homologues were constructed using phrap (DNA28726, DNA28730 and DNA28760). In some cases, the consensus sequence was extended using repeated cycles of blast and phrap, and the consensus sequence was extended as much as possible using the source of the three EST sequences. Based on this consensus sequence, 1) c containing the sequence of interest by PCR
Oligonucleotides were synthesized to identify a DNA library and 2) to be used as a probe to isolate clones of the PRO240 full-length coding sequence. Two pairs of forward and reverse PCR primers (represented by * .f and * .r, respectively)
Ranges from 0 to 30 (typically 24) nucleotides, 100-1000 bp
Designed to give long PCR products. The probe sequence (denoted by * .p) is typically 40-55 (typically 50) bp long. In some cases, additional oligonucleotides are synthesized when the consensus sequence is greater than about 1-1.5 kbp. To screen several libraries for sources of full-length clones, DNA from the libraries was analyzed by Ausubel et al., Current Protocols in Mo.
Screened by PCR amplification with a pair of PCR primers as in lecular Biology. The positive library was then used to isolate clones encoding the gene of interest by the in vivo cloning method using one of the probe oligonucleotides and primer pairs. This library is DNA32279, DN
Used for isolation of A32292 and DNA33094, fetal kidney, fetal lung and fetal lung, respectively.

RNA for the construction of a cDNA library can be prepared using standard methods such as Ausube.
l et al., Current Protocols in Molecular Biology, was used to isolate from tissue or cell line sources or purchased from commercial sources (eg Clontech). cDN
The cDNA library used to isolate the A clone is a commercially available reagent (eg,
Invitrogen) by standard methods (eg Ausbel et al.). cDN
A is primed with an oligo dT containing a NotI site, ligated at the blunt end of the SalI hemikinase adapter, cut with NotI, roughly size-resolved by gel electrophoresis, and cloned into a suitable cloning vector in the determined orientation ( pRK5B or p
RK5D, etc.) and cloned at the unique Xhol and NotI sites. The entire cDNA clone was sequenced. The entire nucleotide sequence of the EGF-like homolog PRO217 is shown in Figure 5 (SEQ ID NO: 3). The predicted polypeptide is 379 amino acids long (PRO217: Fig6 (SEQ ID NO: 4) and is approximately 41.52.
It has a molecular weight of kDa. The oligonucleotide sequences used in the above method are as follows: 28726.p (OLI500) (SEQ ID NO: 18) GGGTACACCTGCTCCTGCACCGACGGATATTGGCTTCTGGAAGGCC 28726.f (OLI502) (SEQ ID NO: 19) ACAGATTCCCACCAGTGCAACC 28726.r (OLI: 503) (SEQ ID NO: 503). 20) CACACTCGTTCACATCTTGGC 28730.p (OLI516) (SEQ ID NO: 21) AGGGAGCACGGACAGTGTGCAGATGTGGACGAGTGCTCACTAGCA 28730.f (OLI517) (SEQ ID NO: 22) AGAGTGTATCTCTGGCTACGC 28730.r (OLI518) (SEQ ID NO: 23) TAAGTCCGGCACATTACAGGTC 28730.p (OLI617) (SEQ No .: 24) CCCACGATGTATGAATGGTGGACTTTGTGTGACTCCTGGTTTCTGCATC 28730.f (OLI618) (SEQ ID NO: 25) AAAGACGCATCTGCGAGTGTCC 28730.r (OLI619) (SEQ ID NO: 26) TGCTGATTTCACACTGCTCTCCCCC

III. Isolation of cDNA clones encoding human PRO301 Extracellular domain (ECD) sequences (including secretory signal sequences, if any) from about 950 known secreted proteins from the Swiss-Prot database were used to search the EST database. did. The EST database is a public EST database (eg GenBank) and a personal EST database (LIFESEQ (trade name), Incyte Pha
rmaceuticals, Palo Alto, CA). Search the computer program BLAST
Or BLAST2 [Altschul et al., Methods in Enzymology, 266: 460-480 (1996); thhp:
//blast.wustl/edu/blast/README.html] was used as a comparison of the ECD protein sequence for 6-frame translation of the EST sequence. A comparison that does not encode a known protein and has a BLAST score of 70 (sometimes 90) or higher is the program "phrap" (Phil Green, University of Washington, Seattle, Washingt
on; http://bozeman.mbt.washington.edu/phrap/docs/phrap.html) and assembled into a consensus DNA sequence. The consensus DNA sequence encoding DNA35936 was constructed using phrap. In some cases, the consensus sequence was extended using repeated cycles of blast and phrap, and the consensus sequence was extended as much as possible using the three sources of EST sequences described above. Based on this consensus sequence, 1) c containing the sequence of interest by PCR
Oligonucleotides were synthesized to identify a DNA library and 2) to be used as a probe to isolate clones of the full length coding sequence. The pair of forward and reverse PCR primers (represented by * .f and * .r, respectively) ranged from 20 to 30 (typically 24) nucleotides, giving 100-1000 bp long PCR products. Designed. The probe sequence (* .p) is typically 40-55
It is (typically 50) bp long. In some cases the consensus sequence is about 1
Additional oligonucleotides are synthesized if greater than -1.5 kbp. To screen several libraries for sources of full-length clones, DNA from the libraries was analyzed by Ausubel et al., Current Protocols in Molecular Biology.
Were screened by PCR amplification with PCR primer pairs. The positive library was then used to isolate clones encoding the gene of interest by the in vivo cloning method using one of the probe oligonucleotides and primer pairs. To screen several libraries for a source of full-length clones, DNA from the libraries was digested with P with the PCR primer pairs identified above.
Screened by CR amplification. The positive library was then used to isolate clones encoding PRO301 using the probe oligonucleotide and one of the primer pairs.

RNA for the construction of the cDNA library was isolated from human fetal kidney. c
The cDNA library used to isolate the DNA clones was formed by standard methods using commercially available reagents (eg, Invitrogen, San Diego, CA; Clontech). The cDNA was primed with an oligo dT containing a NotI site, ligated at the blunt end of the SalI hemikinase adapter, cut with NotI, roughly size-resolved by gel electrophoresis, and cloned into the appropriate cloning vector in the determined orientation ( p
RKB or pRKD, etc .; pRK5B is a precursor of pRK5D that does not have an SfiI site; Holmes et al., Science, 253: 1278-1280 (1991)) was cloned at the unique Xhol and NotI sites. The entire cDNA clone was sequenced. The full-length nucleotide sequence of native sequence PRO301 is shown in Figure 7 (SEQ ID NO: 5). Clone DNA40628 is
Contains a single open reading frame with an apparent translational initiation site at nucleotide positions 52-54 [Kozak et al., Supra] (Fig 7
). The predicted polypeptide (PRO301: Fig8; SEQ ID NO: 6) is 29
It is 9 amino acids and has a predicted molecular weight of 32583 and a pI of 8.29. Clone DNA40628 has been deposited with ATCC and is assigned ATCC deposit no. Based on BLAST and FastA sequence alignment analysis of full length sequences, PRO301
Showed amino acid sequence identity with the A33 antigen precursor (30%) and the Coxsackie and adenovirus receptor proteins (29%). The oligonucleotide sequences used in the above method are as follows: OLI2162 (35936.f1) (SEQ ID NO: 27) TCGCGGAGCTGTGTTCTGTTTCCC OLI2163 (35936.p1) (SEQ ID NO: 28) TGATCGCGATGGGGACAAAGGCGCAAGCTCGAGAGGAAACTGTTGTGCCT OLI.2164 (35) sequence. 29) ACACCTGGTTCAAAGATGGG OLI2165 (35936.r1) (SEQ ID NO: 30) TAGGAAGAGTTGCTGAAGGCACGG OLI2166 (35936.f3) (SEQ ID NO: 31) TTGCCTTACTCAGGTGCTAC OLI2167 (35936.r2) (SEQ ID NO: 32) ACTCAGCA

IV. Isolation of cDNA clones encoding human PRO266 Expression sequence tags (including the secretory signal sequence, if any) of the extracellular domain (ECD) sequences from about 950 known secreted proteins from the Swiss-Prot public database ( EST) used to search the database. The EST database is a public E
ST databases (eg GenBank) and personal EST DNA databases (L
IFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, CA). Search is
Computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology
, 266: 460-480 (1996)) as a comparison of ECD protein sequence to 6-frame translation of EST sequence. Comparisons that do not encode a known protein and have a BLAST score of 70 (sometimes 90) or higher are designated as the program "phrap.
(Phil Green, University of Washington, Seattle, Washington; http: // bo
zeman.mbt.washington.edu/phrap/docs/phrap.html) and assembled into consensus DNA sequences. Synthesize oligonucleotides based on expressed sequence tags to 1) identify a cDNA library containing the sequence of interest by PCR, and 2) use as a probe to isolate clones of the PRO266 full-length coding sequence. did. Forward and reverse PCR primers generally range from 20-30 nucleotides and are often designed to give PCR products of about 100-1000 bp in length. The probe sequence is typically 40-55 bp long. In some cases, additional oligonucleotides are synthesized when the consensus sequence is greater than about 1-1.5 kbp. To screen several libraries for full-length clones, DNA from the libraries was analyzed by Ausubel et al., Current Protocols in Molecula.
r Biology, screened by PCR amplification with PCR primer pairs. The positive library was then used to isolate clones encoding the gene of interest by the in vivo cloning method using one of the probe oligonucleotides and primer pairs. A pair of PCR primers (forward and reverse) was synthesized: Forward PCR primer: 5'-GTTGGATCTGGGCAACAATAAC-3 '(SEQ ID NO: 33) Reverse PCR primer: 5'-ATTGTTGTGTGCAGGCTGAGTTTAAG-3' (SEQ ID NO: 34) ) In addition, a synthetic oligonucleotide hybridization probe having the following nucleotide sequence was constructed: Hybridization probe: 5'-GGTGGCTATACATGGATAGCAATTACCTGGACACGCTGTCCCGGG-3 '(SEQ ID NO: 35) Library to screen several libraries for full length clones. Was screened by PCR amplification with a PCR primer pair. The positive library was then used to isolate clones encoding the PRO266 gene using the probe oligonucleotide and one of the primer pairs.

RNA for the construction of the cDNA library was isolated from human fetal brain tissue.
The cDNA library used to isolate the cDNA clone was Invitrogen
And standard reagents using commercially available reagents such as those from San Diego, CA. The cDNA was primed with an oligo dT containing a NotI site, ligated at the blunt end of the SalI hemikinase adapter, cut with NotI, roughly size-resolved by gel electrophoresis, and cloned into a suitable cloning vector in the determined orientation ( pRKB
Or pRKD and the like; pRK5B is a precursor of pRK5D that does not have an SfiI site; Xhol and No unique to Holmes et al., Science, 253: 1278-1280 (1991)).
It was cloned at the tI site. The DNA sequence of the clone isolated as described above is the full-length DNA of PRO266.
Sequence (herein designated UNQ233 (DNA37150)) and PRO266
Of the derived protein sequence. The full-length nucleotide sequence of UNQ233 (DNA37150) is shown in Figure 9 (SEQ ID NO: 7). Clone UNQ233 (DNA37150) contains a single open reading frame reading frame with nucleotide positions 1-
It has an apparent translational initiation site at 3 [Kozak et al., Supra], nucleotide position 208
It ends with a stop codon after 8. The predicted polypeptide precursor is 696 amino acids long (Fig10; PRO266; SEQ ID NO: 8). Clone UNQ23
3 (DNA37150) has been deposited with the ATCC, ATCC deposit no.
Is given. Amino acid sequence analysis of the full-length PRO266 polypeptide suggests that some of it has significant homology with the SLIT protein, thus making PRO266 a novel leucine-rich repeat protein.

V. Isolation of cDNA clones encoding human PRO335, PRO331 or PRO326 containing extracellular domain (ECD) sequences (including the secretory signal sequence, if any) from about 950 known secreted proteins from the Swiss-Prot public database. Used to search the expressed sequence tag (EST) database. The EST database is a public E
ST databases (eg GenBank) and personal EST databases (LIFESEQ
(Trade name), Incyte Pharmaceuticals, Palo Alto, CA). The search is performed by the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology, 266:
460-480 (1996)) as a comparison of ECD protein sequences for 6-frame translation of EST sequences. Does not encode a known protein and has a BLAST score of 7
Comparisons that are 0 (sometimes 90) or more can be found in the program "phrap" (Phil
Green, University of Washington, Seattle, Washington; http: //bozeman.mb
t. washington.edu/phrap/docs/phrap.html) and assembled into consensus DNA sequences. Consensus DNA sequences were constructed using phrap against other EST sequences. Based on the consensus sequence, 1) cDNA containing the sequence of interest by PCR
To identify A libraries, and 2) PRO335, PRO331 or PRO
Oligonucleotides were synthesized for use as probes to isolate clones of 326 full length coding sequences. Forward and reverse PCR primers generally range from 20-30 nucleotides and are often designed to give PCR products of about 100-1000 bp in length. The probe sequence is typically 40-55b
It is p-long. In some cases, additional oligonucleotides are synthesized when the consensus sequence is greater than about 1-1.5 kbp. To screen several libraries for full-length clones, use DNA from the libraries with Ausube
Screened by PCR amplification with PCR primer pairs as in I. et al., Current Protocols in Molecular Biology. The positive library was then used to isolate clones encoding the gene of interest by the in vivo cloning method using one of the probe oligonucleotides and primer pairs. To screen several libraries for a source of full length clones, DNA from the libraries was screened by PCR amplification with PCR primer pairs. The positive library was then used to isolate clones encoding the PRO335, PRO331 or PRO326 genes using one of the probe oligonucleotides and the primer pair.

RNA for the construction of a cDNA library was prepared from human fetal kidney tissue (PRO3
35 and PRO326) and human fetal brain (PRO331). cDN
The cDNA library used to isolate the A clone is Invitrogen, San
Formed by standard methods using commercially available reagents such as those from Diego, CA. cd
NA was primed with an oligo dT containing a NotI site, ligated at the blunt end of the SalI hemikinase adapter, cut with NotI, roughly size-resolved by gel electrophoresis, and cloned into the appropriate cloning vector in the determined orientation ( pRKB or p
RKD et al .; pRK5B is a precursor of pRK5D that does not have an SfiI site;
Holmes et al., Science, 253: 1278-1280 (1991)) cloned at the unique Xhol and NotI sites. The DNA sequence of the clone isolated as described above is PRO335 (Fig11
SEQ ID NO: 9), PRO331 (Fig13; SEQ ID NO: 11) or PRO3
26 (Fig15; SEQ ID NO: 13) full-length DNA sequence and PRO335 (Fi
g12; SEQ ID NO: 10), PRO331 (Fig14; SEQ ID NO: 12) or PRO326 (Fig16; SEQ ID NO: 14) derived protein sequences were given.
The nucleic acid encoding PRO335 was deposited with the ATCC on June 2, 1998
Deposited No. 209927; nucleic acid encoding PRO331, November 1997
Deposited with ATCC on 7th, assigned ATCC deposit number 209439; PRO
The nucleic acid encoding 326 was deposited with the ATCC on November 21, 1997 and is assigned ATCC deposit no. 209489. Analysis of the amino acid sequence of the full-length PRO335, PRO331 or PRO326 polypeptide showed that it had significant homology to the LIG-1 protein and thus PR
It suggests that O335, PRO331 and PRO326 are novel LIG-1 related proteins.

Example 2 Stimulatory activity in mixed lymphocyte reaction (MLR) assay (# 24) This example demonstrates that the polypeptides of the invention are active as stimulators of stimulated T lymphocyte proliferation. Show. Compounds that stimulate the proliferation of lymphocytes are therapeutically useful where promoting an immune response is beneficial. Compounds that inhibit lymphocyte proliferation are therapeutically useful where suppression of the immune response is beneficial. The therapeutic agent may be in the form of an antagonist of the polypeptide of the invention, eg, a mouse-human chimera, humanized or human antibody against the polypeptide. The basic protocol for this assay is JE Coligan, AM Kruisbeek, DH.
Marglies, EM Shevach, W. Stober, National Institutes of Health, J
Current Protocols in Immunology, unit by ohn Wiley and Sons, Inc.
It is described in 3.12. More specifically, peripheral blood mononuclear cells (PBMC) are isolated by leukopheresis from a mammalian individual, eg, a human volunteer (one donor is a stimulatory PBMC).
, And the other donor supplies the responder PBMC). If necessary, cells are frozen in fetal bovine serum and DMSO after isolation. Frozen cells were thawed overnight in assay buffer (37 ° C., 5% CO ₂ ), then washed and assay medium (RPMI: 10% fetal calf serum, 1% penicillin / streptavidin, 1% glutamine, 1%). 3x10 ⁶ cells in% HEPES, 1% non-essential amino acids, 1% pyruvate)
/ ml.

Stimulatory PBMCs are prepared by irradiating cells (about 3000 Rads). The assay was prepared by plating 3 times the following mixture: 100 μl test sample diluted to 1% or 0.1% 50 μl irradiated stimulator cells and 50 μl responder PBMC cells. 100 micrograms of cell culture medium or 100 microliters of CD4-IgG was used as a control. Wells were then incubated for 4 days at 37 ° C., 5% CO ₂ . On day 5, wells were pulsed with tritiated thymidine (i.0mC / well; Amersham). After 6 hours the cells were washed 3 times and the uptake level was estimated. In another variation of this assay, PBMCs are isolated from Balb / c and C57B6 mice. Cells were assayed from freshly harvested spleen (RPMI;
10% fetal bovine serum, 1% penicillin / streptavidin, 1% glutamine, 1% HE
PES, 1% non-essential amino acids, 1% pyruvate) (teased), overlay these cells on lymphocytes M (Organon Teknika), centrifuge at 2000 rpm for 20 minutes, and place in the assay medium. Nuclear cells are collected and washed, and the cells are used as an assay medium for 1 × 10 ⁷ cells.
PBMCs are isolated by resuspending in / ml. The assay is then performed as described above with the sample having the PRO concentration obtained on dilution of the stock solution. The results of this assay are shown below for compounds of the invention. A positive increase over the control is considered positive and a positive with an increase of 180% or more is preferred. However, all values greater than the control show a stimulatory effect on the test protein.

[0092]

Example 3 Skin Vascular Permeability Assay (# 64) This assay demonstrates that certain polypeptides of the invention elicit an immune response at the injection site in animals, resulting in mononuclear cells, eosinophils and PMNs. It is shown to induce inflammation by inducing infiltration. This skin vascular permeability assay is performed as follows. 35
Hairless guinea pigs weighing 0 grams or more are anesthetized intramuscularly (IM) with ketamine (75-80 mg / Kg) and 5 mg / Kg xylazine. The purified polypeptide of the invention or conditioned medium test sample is injected transdermally into the back of test animals at 100 μL per injection site. About per animal
It can have 10-30, preferably about 16-24 injection sites. Inject 1 mL of Evans Blue dye (1% in saline) intracardiac. The spots at the injection site are then measured 1 and 6 hours after injection (mm diameter). Animals are sacrificed 6 hours after injection. Each skin injection site is taken as a biopsy and fixed in formalin. The skin was then prepared for histopathological evaluation. Each site was evaluated for skin infiltration of inflammatory cells. Sites with visible inflammatory cell infiltration were scored as positive. Inflammatory cells can be neutrophils, eosinophils, monocytes or lymphocytes. The results of this test for the compounds of the invention are shown below. In the table below, at least minimal perivascular infiltration at the injection site was scored as positive and injection sites without invasion were scored as negative.

Example 4 Human Co-stimulation Assay In addition to T cell receptor-mediated signal activation, T cell activation requires a co-stimulatory signal. One costimulatory signal is B7 (CD3) and CD
Generated by interaction with 28. In this assay, 96-well plates are coated with CD3 with or without CD28, then human peripheral blood lymphocytes are added, followed by test protein. Lymphocyte proliferation is determined by tritiated thymidine incorporation. A positive assay indicates that the test protein provided a stimulatory signal for lymphocyte proliferation. Materials: 1) Calcium- and magnesium-free Hyclone D-PBS 2) Nunc 96-well certified plate # 4-39454 3) Good-human CD3Amac 0178 200 μg / ml stock 4) Good-human CD28 Biodesgn P42235M 5) Medium: GibcoRPMI1640 + Intergen # 1020-90FBS, 1% Glu, 1% P / S
, 50 μg / ml gentamicin, 10 mM Hepes. Fresh for each assay. 6) Tritiated thymidine 7) Frozen human peripheral blood lymphocytes (PBL) collected via leukopheresis method
). The plate was a 96-well flat-bottomed plate containing anti-CD3 antibody (Amac) or anti-CD28 antibody (Bio
design) or both. Anti-CD-3 antibody at 10 ng / well (200 ng / ml 50 μl), anti-CD28 antibody at 25 ng / well (0.5 μg / ml 50 μl) 1
Used in a total volume of 00 μl. PBLs were isolated from human donors using standard leukopheresis methods.
Cell preparations were frozen in 50% fetal bovine serum and 50% DMSO until the assay was performed. Cells were thawed in medium, washed with PBL, PBL resuspended in 25 ml of medium and incubated overnight at 37 ° C, 5% CO ₂ . In the assay, the coated plate was washed twice with PBS and the PBL was washed 1
Resuspend at 1x10 ⁶ cells / ml using 00 μL / well. 100 μl of test protein or control medium was added to the plate to give a total volume of 200 μl per well. The plate was incubated for 72 hours. The plate is then tritiated thymidine (1 mC /
Wells; Amersham) were pulsed for 6 hours and PBLs were harvested from the plates to estimate tritiated thymidine incorporation.

Example 5 In Situ Hybridization In situ hybridization is a powerful and versatile technique for the detection and localization of nucleic acid sequences within cell or tissue preparations. It includes, for example, identification of gene expression sites, analysis of tissue distribution of transcripts, identification and localization of viral infections, specific m
Useful for tracking changes in RNA synthesis and chromosome mapping. In situ hybridization was performed by Lu and Gillett, Cell Vision 1: 169-176 (1
PCR is performed with ³³ P-labeled riboprobes according to an optimal modification of the protocol of 994). Briefly, formalin-fixed, paraffin-embedded human tissues were sectioned, deparaffinized, deproteinized with proteinase K (20 g / ml) for 15 minutes at 37 ° C. and further as described by Lu and Gillett supra. In-situ hybridize. A [ ^33- P] UTP-labeled antisense riboprobe is generated from the PCR product and hybridized at 55 ° C overnight. Immerse slides in Kodak NTB2 nuclear track emulsion and expose for 4 weeks. ³³ P-riboprobe synthesis 6.0 μl (125 mCi) of ³³ P-UTP (Amersham BF 1002, SA <2000 Ci / mmol)
Was speed vacuum dried. The following components were added to a tube containing dry ³³ P-UTP: 2.0 μl 5x transcription buffer 1.0 μl DTT (100 mM) 2.0 μl NTP mixture (2.5 mM: 10 μl; 10 mM GTP, CTP and ATP + 10 μl H ₂ O) 1.0 μl UTP (50 μM) 1.0 μl Rnasin 1.0 μl DNA template (1 μg) 1.0 μl H ₂ O tubes were incubated for 1 hour at 37 ° C., 1.0 μL RQ1 DNase was added, then 37 Incubated at 15 ° C for 15 minutes. 90 μL TE (10 mM Tris pH 7.6 / 1 mM E
DTA pH8.0) was added and the mixture was pipetted onto DE81 paper. The remaining solution is Microco
The n-50 ultrafiltration unit was loaded and spun using program 10 (6 minutes). The filtration unit was converted to a second tube and spun using program 2 (3
Minutes). After the final recovery spin, 100 μl TE was added. DE 1 μl final product
Pipetted onto 81 paper and counted with 6 ml Biofluor II. The probe was run on a TBE / urea gel. 1-3 μL probe or 5 μL RN
A Mrk III was added to 3 μL of loading buffer. 95 ° C on heating block
After heating for 3 minutes, the gel was immediately placed on ice. The gel wells were flushed, loaded with sample, and run at 180-250 volts for 45 minutes. The gel was wrapped in Saran wrap and exposed to XAR film with a reinforcing screen in a -70 ° C freezer for 1 hour to overnight.

³³ P-Hybridization Pretreatment of frozen sections: The slides were removed from the freezer, placed in aluminum trays and thawed for 5 minutes at room temperature. The trays were placed in a 55 ° C. incubator for 5 minutes to reduce condensation. Slides in steam hood in 4% paraformaldehyde
Fix for 10 minutes, wash with 0.5xSSC for 5 minutes at room temperature (25ml 20xSSC + 975ml SQ
H ₂ O). After deproteinization for 10 minutes at 37 ℃ in 0.5 μg / ml proteinase K (250
12.5 μL of 10 mg / ml stock in ml pre-warmed RNase buffer without RNase
), And the sections were washed with 0.5 × SSC for 10 minutes at room temperature. The sections were dehydrated in 70%, 95%, 100% ethanol for 2 minutes each. Pretreatment paraffin-embedded sections The slides were deparaffinized, placed in SQ H 2 _O, and rinsed twice for 5 minutes each at room temperature 2 × SSC. 20 μg / ml section
Proteinase K (10 mg / ml in 250 ml RNase-free RNase buffer)
500 μl; 37 ° C., 15 min) -human embryo or 8x proteinase K (250 ml RNas
e) 100 μL in buffer, 37 ° C., 30 minutes) -deproteinized with formalin tissue. Subsequent rinsing with 0.5 × SSC and dehydration were performed as described above. Prehybridization: Slides were placed in plastic boxes lined with Box buffer (4xSSC, 50% formamide) -saturated filter paper. 50 μl tissue
Of the hybridization buffer (3.75 g dextran sulfate + 6 ml SQ H ₂ O), vortexed, uncapped and heated in microwave for 2 minutes. After cooling on ice, 18.75 ml formamide, 3.75 ml 20xSSC and 9 ml SQ.
H ₂ O was added, the tissue vortexed well and incubated at 42 ° C. for 1-4 hours. Hybridization: 1.0 × 10 ⁶ cpm probe per slide and 1.0 μL t
RNA (50 mg / ml stock) was heated at 95 ° C for 3 minutes. Cool slides on ice,
48 μl of hybridization buffer was added per slide. After vortexing, 50 μl of ³³ P mixture was added to 50 μl of prehybridized on slide. Slides were incubated overnight at 55 ° C. Washing: Washing was carried out for 2 x 10 minutes in 2 x SSC, EDTA at room temperature (400 ml of 2
0xSSC + 16ml 0.25M EDTA, Vf = 4L), then RNase A treatment at 37 ° C for 30
For 10 minutes (500 μL of 10 mg / ml in 250 ml RNase buffer = 20 μg / ml). The slides were washed 2 x 10 minutes with EDTA at room temperature. Stringent washing conditions are as follows: 55 ° C. for 2 hours, 0.1 × SSC, EDTA (20 ml 20 × SSC + 16 ml EDTA, Vf
= 4 L).

DNA35638 (1 TM receptor) expression was observed in endothelium lining and placental blood vessels of fetal subsets. Endothelial expression was restricted to these tissue blocks. Expression was also observed across placental trophoblast cells. Oligo C-120N: (SEQ ID NO: 36) GGA TTC TAA TAC GAC TCA CTA TAG GGC TGC GGC GGC TCA GGT CTT CAG TT Oligo c-120P: (SEQ ID NO: 37) CTA TGA AAT TAA CCC TCA CTA AAG GGA GCA TGG GAT GGG GAG GGA TAC GG DNA33094 (EGF homolog) A highly discriminative expression pattern was observed. In human embryos, expression was observed in the outer smooth muscle layer of the GI tract, respiratory cartilage, branched respiratory endothelium, osteoblasts, tendons, gonads, optic nerve head and developing dermis. In adults, the expression is epidermal pegs (p
egs), placental and bladder basal endothelium / myoepithelial cells. Expression was also found in alveolar lining cells of the adult lung, mesenchymal cells juxtaposed to the erectile tissue of the penis, and cerebral cortex (probably glial cells). In the kidney, expression was found in the cells surrounding the thyroid tubule only in the disease. Oligo D-200V: (SEQ ID NO: 38) CTA TGA AAT TAA CCC TCA CTA AAG GGA ATA GCA GGC CAT CCC AGG ACA Oligo D-200Z: (SEQ ID NO: 39) CTA TGA AAT TAA CCC TCA CTA AAG GGA TGT CTT CCA TGC CAA CCT TC

Example 6 In Situ Hybridization in Cells and Diseased Tissues The in situ hybridization method of the Examples is used to determine gene expression, tissue distribution of transcripts, and diseased tissue isolated from human individuals suffering from a particular disease. Used to track changes in specific mRNAs for the synthesis of the genes / DNAs and proteins of the invention. These results indicate where in the diseased tissue the gene of the present invention is more specifically expressed, and the specific position of the therapeutic effect of the inhibitory or stimulatory compound of the present invention (and its agonist or antagonist) in the disease. More predictive. Hybridization was performed according to the method of Example 5 using one or more of the following tissue and cell samples. (A) lymphocytes and antigen-presenting cells (dendritic cells, Langerhans cells, macrophages and monocytes, NK cells); (b) lymphoid tissues: normal and reactive lymph nodes, thymus, bronchus-related lymphoid tissues (
BALT), mucosa associated lymphoid tissue (MALT); (c) Human diseased tissue-Synovial membranes and joints of patients with arthritis and degenerative joint disease-From patients with inflammatory bowel disease including ulcerative colitis and Crohn's disease Large intestine-Skin lesions from psoriasis and other forms of dermatitis-Lung tissue and tissue lymph nodes including BALT from chronic and acute bronchitis, pneumonia, lungs, pleurisy-Lung tissue and tissue lymph including BALT from asthma Nodules-nasal and sinus tissue from patients with rhinitis or sinusitis-brain and spinal cord from multiple sclerosis, Alzheimer's disease and stroke-kidney from nephritis, glomerulonephritis and systemic lupus erythematosus-infectious and non-infectious Liver from infectious hepatitis Tissue expression from tumor / cancer is observed in one or more cells or tissue samples, and the invention in diseases associated with these cells or tissue samples. It indicates the position of the therapeutic effect of the compound (and agonists or antagonists). DNA35638 (PRO245) is an inflamed human tissue (psoriasis, inflammatory bowel disease (
IBD), inflamed kidneys, inflamed lungs, hepatitis (liver block), normal tonsils, adults and chimpanzees (multiblock). Expression was present in the endothelium / intima of the lungs affected by chronic inflammation, the epidermal vascular surface of psoriatic skin, samples of chronic sclerosing nephritis, and capillaries including the perifollicular sinus of the tonsils. These results indicate that PRO245 is immunostimulatory (promotes T lymphocyte proliferation with MLR and costimulation) and has pro-inflammatory properties (inducing neutrophil infiltration in vivo).

Example 7 PRO245, PRO217, PRO301, PRO266, PRO335, P
Use of RO331 or PRO326 as a Hybridization Probe The following method was performed using PRO245, PRO217, PRO301, PRO266,
The use of nucleotide sequences encoding PRO335, PRO331 or PRO326 as hybridization probes is described. Full length or mature PRO245, PRO217, PRO301, PRO266, P
RO335, PRO331 or PRO326 (Figs. 4, 6, 8, 10, 12,
DNAs containing the coding sequences of 14 and 16 are designated as homologous DNAs (PRO24
5, PRO217, PRO301, PRO266, PRO335, PRO331
Or a naturally occurring variant of PRO326) as a probe for screening in a human tissue cDNA library or a human tissue genomic library. Hybridization and washing of filters containing either library DNA is performed under the following high stringency conditions. Radiolabeled PRO245, PRO21
7, PRO301, PRO266, PRO335, PRO331 or PRO32
Hybridization of the 6-derivative probe to the filter was performed with 50% formamide, 5xS.
It was carried out at 42 ° C. for 20 hours in a solution of Sc, 0.1% sodium pyrophosphate, 50 mM sodium phosphate, pH 6.8, 2 × Denhard's solution, and 10% dextran sulfate. The filter was washed at 42 ° C. in 0.1 × SSC and 0.1% SDS aqueous solution. Full length native sequence PRO245, PRO217, PRO301, PRO266, P
DNAs with the desired identity with DNA encoding RO335, PRO331 or PRO326 can then be identified using standard techniques known in the art.

Example 8 PRO245, PRO217, PRO301, PRO266, P in E. coli
Expression of RO335, PRO331 or PRO326 This example demonstrates the non-glycosylated form of PRO24 by recombinant expression in E. coli.
5, PRO217, PRO301, PRO266, PRO335, PRO331
Alternatively, the preparation of PRO326 is exemplified. PRO245, PRO217, PRO301, PRO266, PRO335,
The DNA sequence encoding PRO331 or PRO326 was first amplified using selected PCR primers. The primer must have a restriction enzyme site corresponding to the restriction enzyme site of the selected expression vector. Various expression vectors are used. An example of a suitable vector is pBR322 (derived from E. coli; see Bolivar et al., Gene, 2:95 (1977)), which contains genes for ampicillin and tetracycline resistance. The vector is digested with restriction enzymes and dephosphorylated. The PCR amplified sequence is then ligated into the vector. The vector is preferably an antibiotic resistance gene, trp promoter, poly his leader (including the first 6 STII codons, poly his sequences and enterokinase cleavage sites), PRO245, PRO217, PRO301, PRO266, PRO33.
5, PRO331 or PRO326 coding region, lambda transcription terminator, and ar
Contains the gU gene. The ligation mixture is then used to transform selected E. coli using the method described by Sambrook et al., Supra. Transformants are identified by their ability to grow on LB plates and then antibiotic resistant clones are selected.
Plasmid DNA is isolated and confirmed by restriction analysis and DNA sequencing. Selected clones can be grown overnight in liquid media such as LB broth supplemented with antibiotics. The overnight medium is subsequently used to seed large-scale medium.
The cells are then grown at optimal density during which the expression promoter operates. After culturing for a few more hours, the cells can be harvested and centrifuged. The cell pellet obtained by centrifugation was solubilized using various reagents known in the art, and solubilized P
RO245, PRO217, PRO301, PRO266, PRO335, PR
The O331 or PRO326 proteins were purified using metal chelation columns under conditions that allow tight binding of the proteins.

PRO245, PRO217, PRO301 and PRO266 were expressed in Escherichia coli in the poly-His tagged form using the following procedure. PRO245, P
PC selected with DNA encoding RO217, PRO301 and PRO266
It was first amplified with the R primer. The primer is a restriction enzyme site corresponding to the restriction enzyme site of the selected expression vector, and an efficient and reliable translation initiation,
Includes other useful sequences that provide rapid purification on metal chelate columns and proteolytic removal with enterokinase. PCR-amplified, poly-His
The tag sequence was ligated to an expression vector, which was used for strain 52 (W3110 fuhA (tonA) lon gal
E rpoHts (htpRts) cllpP (lacIq)) based transformation of E. coli host.
Transformants were first grown in LB containing 50 mg / ml carbenicillin at 30 ° C. with shaking until an OD 600 of 3-5 was reached. The medium was then CRAP medium (3.57 g (NH ₄ ) ₂ SO ₄ , 0.71 g sodium citrate 2H ₂ O, 1.07 g K
Cl, Difco yeast extract 5.36g, Shefield hycase SF of 5.36g of 500mL water, and 110mM of MPOS, in pH7.3,0.55% (w / v) prepared by mixing MgSO ₄ the glucose and 7mM of) It was diluted 50 to 100 times and grown at 30 ° C. for about 20 to 30 hours while shaking. A sample was taken out, the expression was confirmed by SDS-PAGE, and the bulk medium was centrifuged to pellet the cells. Cells Cell pellets were frozen before purification and refolding. E. coli paste from 0.5 to 1 L of fermentation (6-10 g pellets) was resuspended at 10 volumes (w / v) in 7M guanidine, 20 mM Tris, pH 8 buffer. Solid sodium sulfate and sodium tetrathionate were added to give final concentrations of 0.1M and 0.02, respectively.
M and the solution was stirred at 4 ° C. overnight. This step resulted in a denatured protein with cysteine residues blocked by sulfite. Beckman Ultr
Concentrate in acentrifuge at 40,000 rpm for 30 minutes. The supernatant was diluted with 3-5 volumes of metal chelate column buffer (6M guanidine, 20 mM Tris, pH 7.4) and clarified by filtration through a 0.22 micron filter. The clarified extract was loaded onto a 5 ml Qiagen Ni-NTA metal chelate column equilibrated with the metal chelate column buffer. The column was washed with additional buffer containing 50 mM imidazole (Calbiochem, Utrol grade), pH 7.4. The protein was eluted with a buffer containing 250 mM imidazole. Fractions containing the desired protein were pooled and stored at 4 ° C. The protein concentration was determined using the extinction coefficient calculated based on its amino acid sequence.
It was estimated by its absorption at 0 nm.

The sample is gradually diluted in a freshly prepared refolding buffer consisting of 20 mM Tris, pH 8.6, 0.3 M NaCl, 2.5 M urea, 5 mM cysteine, 20 mM glycine and 1 mM EDTA. This caused the protein to refold. The refolding volume was chosen to give a final protein concentration of 50-100 micrograms / ml. The refolding solution was gently stirred at 4 ° C for 12-36 hours. The refolding reaction was stopped by adding TFA at a harvest concentration of 0.4% (pH of about 3). Before further purifying the protein, the solution was filtered through a 0.22 micron filter and acetonitrile was added at a final concentration of 2-10%. The refolded protein was chromatographed on a Poros R1 / H reverse phase column using a migration buffer of 0.1% TFA and elution with a 10-80% acetonitrile gradient. Aliquots of fractions with A ₂₈₀ absorption were analyzed on SDS polyacrylamide gels and fractions containing homologous refolded proteins were pooled. In general, the correctly refolded species of most proteins elute at the lowest concentration of acetonitrile because these species are the most compact and their hydrophobic inner surface is shielded from interaction with reverse phase resin. To be done. Aggregated species are usually eluted at higher acetonitrile concentrations. In addition to removing the misfolded form of the protein from the desired form, the reverse phase step also removes endotoxin from the sample. Desired folded PRO245, PRO217, PRO301 and PRO
Fractions containing each of the 266 proteins were pooled and the acetonitrile removed using a gentle stream of nitrogen directed at the solution. The protein was dialyzed or gel filtered through G25 Superfine (Pharmacia) resin equilibrated with preparation buffer and sterile filtered,
Prepared to 20 mM HEPES pH 6.8 containing 0.14 M sodium chloride and 4% mannitol.

Example 9 PRO245, PRO217, PRO301, PRO26 in mammalian cells
6, Expression of PRO335, PRO331 or PRO326 This example demonstrates the recombinant glycosylated form of PRO in mammalian cells.
245, PRO217, PRO301, PRO266, PRO335, PRO3
31 illustrates the preparation of 31 or PRO326. The vector pRK5 (see EP 307,247 published on Mar. 15, 1989) was used as an expression vector. In some cases, PRO245, PRO217, PRO301, P
RO266, PRO335, PRO331 or PRO326 DNA is ligated to pRK5 with a selected restriction enzyme and PRO245, PRO217, PRO301, PRO266, PRO33 is ligated using the ligation method described in Sambrook et al.
5. Insert PRO331 or PRO326 DNA. The resulting vector is
pRK5-PRO245, PRO217, PRO301, PRO266, PRO
335, PRO331 or PRO326. In one embodiment, the host cell selected can be 293 cells. Human 293 cells (ATCC CCL 1573) were grown to confluence in tissue culture plates in media such as DMEM supplemented with fetal bovine serum and optionally nutrients or antibiotics. About 10 μg of pRK5-PRO245, PRO217, PRO30
1, PRO266, PRO335, PRO331 or PRO326 DNA to about 1
DNA encoding μg of VA RNA gene [Thimmappaya et al., Cell, 31: 543 (
1982))] and mixed with 500 μL of 1 mM Tris-HCl, 0.1 mM EDTA, 0.227 M C.
It was dissolved in aCl ₂ . To this mixture, drop-wise, 500 μL of 50 mM HEPES (pH
7.35), 280 mM NaCl, 1.5 mM NaPO ₄ was added to form a precipitate at 25 ° C. for 10 minutes. The precipitate was suspended, added to 293 cells, and fixed at 37 ° C. for about 4 hours.
The culture medium was aspirated and 2 ml of 20% glycerol in PBS was added for 30 seconds. The 293 cells were then washed with serum free medium, fresh medium was added and the cells were incubated for about 5 days. Approximately 24 hours after transfection, remove the culture medium and culture medium (only) or 200 μCi / ml
Of the culture medium containing ³⁵ S-cysteine and 200 μCi / ml of ³⁵ S-methionine. After a 12 hour incubation, the conditioned medium was harvested, concentrated on a spin filter and loaded on a 15% SDS gel. The treated gel is dried and subjected to PRO245
, PRO217, PRO301, PRO266, PRO335, PRO331 or PRO326 polypeptide was exposed for a selected time period. The medium containing the transformed cells is further incubated (
The medium was tested in selected bioassays (in serum-free medium).

In an alternative technique, PRO245, PRO217, PRO301, P
RO 266, PRO 335, PRO 331 or PRO 326 are Somparyac et al., P
Transfected into 293 cells using the dextran sulfate method described in roc. Natl. Acad. Sci., 12: 7575 (1981). 293 cells were grown to maximum density in spinner flasks and 700 μg of pRK5-PRO245, PRO217, PRO
Add 301, PRO266, PRO335, PRO331 or PRO326 DNA. The cells are first concentrated from the spinner flask by centrifugation and
Washed with. The DNA-dextran precipitate was incubated on the cell pellet for 4 hours. Cells were treated with 20% glycerol for 90 seconds, washed with tissue culture medium and reintroduced into spinner flasks containing tissue culture medium, 5 μg / ml bovine insulin and 0.1 μg / ml bovine transferrin. After about 4 days, the conditioned medium was centrifuged and filtered to remove cells and cell debris. Then expressed PRO245, PRO21
7, PRO301, PRO266, PRO335, PRO331 or PRO32
The sample containing 6 was concentrated and purified by a selected method such as dialysis or column chromatography. In other embodiments, PRO245, PRO217, PRO301, PRO26.
6, PRO335, PRO331 or PRO326 can be expressed in CHO cells. pRK5-PRO245, PRO217, PRO301, PRO2
66, PRO335, PRO331 or PRO326 is CaPO ₄ or DEA
CHO cells can be transfected with known reagents such as E-dextran. Incubate cell culture medium and culture medium (only) as described above.
Alternatively, the medium can be replaced with a medium containing a radiolabel such as ³⁵ S-methionine. P
RO245, PRO217, PRO301, PRO266, PRO335, PR
After identifying the presence of O331 or PRO326 polypeptide, the culture medium may be replaced with serum free medium. Preferably, the medium is incubated for about 6 days and then the conditioned medium is collected. Then, the expressed PRO245, PRO217, PRO
Media containing 301, PRO266, PRO335, PRO331 or PRO326 can be concentrated and purified for the method of choice.

In addition, the epitope tags PRO245, PRO217, PRO301, PRO2
66, PRO335, PRO331 or PRO326 may be expressed in host CHO cells. PRO245, PRO217, PRO301, PRO26
6, PRO335, PRO331 or PRO326 were subcloned from the pRK5 vector. The subclone insert can then be subjected to PCR to fuse in frame with a selected epitope tag such as a poly-his tag in a baculovirus expression vector. Poly-his tag PRO245, PRO217, PRO301
, PRO266, PRO335, PRO331 or PRO326 insert can then be subcloned into an SV40 inducible vector containing a selectable marker such as DHFR for selection of stable clones. Finally, CHO cells were transfected with the SV40 inducible vector (as above). Labeling may be performed as described above to confirm expression. Expressed poly-his tag PRO245, PRO217
, PRO301, PRO266, PRO335, PRO331 or PRO326
The culture medium containing the can be then concentrated and purified by a selected method such as Ni ²⁺ -chelate affinity chromatography. PRO245, PRO217 and PRO301 were expressed in CHO cells by both transient and stable expression methods. Stable expression in CHO cells was performed using the following method. A protein is a hinge of IgG1 where the coding sequence (eg, extracellular domain) of the soluble and / or poly-His tagged form of the corresponding protein is IgG1, CH2 and CH.
It was expressed as an IgG construct (immunoadhesin) fused to a constant region sequence containing 2 domains. Following PCR amplification, the corresponding DNA was prepared using Ausubel et al., Current Protocols of
Subcloned into CHO expression vector using standard techniques as described in Molecular Biology, Unit 3.26, John Wiley and Sons (1997). The CHO expression vector has restriction sites compatible with the 5'and 3'of the DNA of interest, and has a cD
It is created so that NA can be conveniently shuttled. Vectors are Lucas et al., Nuc
cDNAs of interest and dihydrofolate reductase (DHFR) using expression in CHO cells as described in L. Acids res. 24: 9, 1774-1779 (1996).
The SV40 early promoter / enhancer is used to control the expression of (1). DHFR
Expression allows selection for stable maintenance of the plasmid following transfection. Twelve micrograms of the desired plasmid DNA is transferred to the commercial transfection reagent Superfec
t (Quiagen), Dosper and Fugene (Boehringer Mannheim) were introduced into about 10 million CHO cells. Cells were grown as described in Lucas et al., Supra. About 3x
10 ⁻⁷ cells were frozen in ampoules for further growth and production as described below.

Ampoules containing plasmid DNA were placed in a water bath, thawed and mixed by vortexing. The contents were pipetted into a centrifuge tube containing 10 mL of medium and centrifuged at 1000 rpm for 5 minutes. The supernatant is aspirated and the cells are mixed with 10 mL of selective medium (0.2 μm filtered PS20, 5%
0.2 μm diafiltered fetal bovine serum) was added). The cells were then split into a 100 ml spinner containing 90 ml of selective medium for 1-2 days, then the cells were transferred to a 250 ml spinner filled with 150 ml of selective medium and incubated at 37 ° C. After another 2-3 days, 250 mL
, 500 mL and 2000 mL spinner were seeded at 3 × 10 ⁵ cells / mL. The cell medium was replaced with fresh medium by centrifugation and resuspended in production medium. Although any suitable CHO medium may be used, in practice the production medium described in US Pat. No. 5,122,469 issued Jun. 16, 1992 was used. A 3 L production spinner was seeded at 1.2 × 10 ⁶ cells / mL. On day 0, cell number and pH were measured. On day 1, spinners were sampled and sprayed with filtered air. On the second day, sample the spinner, change the temperature to 33 ° C, and
30 mL of 00 g / L glucose and 0.6 mL of 10% antifoaming agent (eg 35% polydimethylsiloxane emulsion, Dow Corning 365 Medical Grade Emulsion) was used. The pH was adjusted and maintained at around 7.2 throughout the production. After 10 days, or until viability was below 70%, cell culture medium was collected by centrifugation and filtered through a 0.22 μm filter. The filtrate was either stored at 4 ° C or immediately loaded on a purification column. For poly-His tagged constructs, proteins were purified using Ni-NTA columns (Qiagen). Prior to purification, imidazole was added to the conditioned medium to a concentration of 5 mM.
Conditioned medium containing 20 mM Hepes, pH 7 containing 0.3 M NaCl and 5 mM imidazole.
A 6 ml Ni-NTA column equilibrated with 0.4 buffer was pumped at 4 ° C. at a flow rate of 4-5 ml / min. After loading, the column was further washed with equilibration buffer and the protein was eluted with equilibration buffer containing 0.25M imidazole. The highly purified protein was subsequently desalted with 25 ml G25 Superfine (Pharmacia) in a storage buffer containing 10 mM Hepes, 0.14 M NaCl and 4% mannitol, -8
Stored at 0 ° C. The immunoadhesin (Fc containing) construct was purified from conditioned medium as follows. Conditioned medium was loaded onto a 5 ml protein A column (Pharmacia) equilibrated with 20 mM sodium phosphate buffer, pH 6.8. After loading, the column was washed extensively with equilibration buffer and then eluted with 100 mM citric acid, pH 3.5. The eluted protein was immediately neutralized by collecting 1 ml fractions in a tube containing 275 μl of 1 M Tris buffer, pH 9. The highly purified protein was subsequently desalted in storage buffer as described above for poly-His tagged proteins. Homogeneity was tested on SDS polyacrylamide gels and N-terminal amino acid sequenced by Edman degradation. PRO326 was also produced by transient expression in COS cells.

Example 10 PRO245, PRO217, PRO301, PRO266, PRO in yeast
Expression of 335, PRO331 or PRO326 The following method is used to determine PRO245, PRO217, PRO301, P in yeast.
Recombinant expression of RO266, PRO335, PRO331 or PRO326 is described. First, PRO245, PRO21 from the ADH2 / GAPDH promoter.
7, PRO301, PRO266, PRO335, PRO331 or PRO32
A yeast expression vector for intracellular production or secretion of 6 is prepared. PRO245
, PRO217, PRO301, PRO266, PRO335, PRO331 or PRO326 are inserted into appropriate restriction enzyme sites of a selected plasmid to obtain PRO245, PRO217, PRO301, PR.
Directs intracellular expression of O266, PRO335, PRO331 or PRO326. For secretion, PRO245, PRO217, PRO301, PRO266
, PRO335, PRO331, or PRO326-encoding DNA in a selected plasmid containing ADH2 / GAPDH promoter, native PRO245, PRO
217, PRO301, PRO266, PRO335, PRO331 or PRO
DNs encoding 326 signal polypeptides or other mammalian signal peptides
A or, for example, yeast alpha factor secretion signal / leader sequence and (if necessary) PRO245, PRO217, PRO301, PRO266, PRO3
35, PRO331 or PRO326 with a linker sequence for expression. Yeast cells, such as yeast strain AB110, can then be transformed with the expression plasmids described above and cultured in selected fermentation media. The transformed yeast supernatant can be analyzed by precipitation with 10% trichloroacetic acid and separation by SDS-PAGE, followed by staining of the gel with Coomassie blue stain. Subsequently, recombinant PRO245, PRO217, PRO301, PRO266, P
RO335, PRO331 or PRO326 can be isolated and purified by removing yeast cells from the fermentation medium by centrifugation and then concentrating the medium using selected cartridge filters. PRO245, PRO217, PRO
The concentrate containing 301, PRO266, PRO335, PRO331 or PRO326 may be further purified using the selected column chromatography resin.

Example 11 PRO245, PRO217, PRO301 in Baculovirus-Infected Insect Cells
, PRO266, PRO335, PRO331 or PRO326 expression The following method was used to determine the expression of PRO245, PR in baculovirus infected insect cells.
O217, PRO301, PRO266, PRO335, PRO331 or PR
The recombinant expression of O326 is described. PRO245, PRO217, PRO301, PRO266, PRO335,
The sequence encoding PRO331 or PRO326 was fused upstream of the epitope tag contained in the baculovirus expression vector. Such epitope tags include poly-his tags and immunoglobulin tags (such as the Fc region of IgG). Various plasmids can be used, including plasmids derived from commercially available plasmids such as pVL1393 (Navogen). Simply put, PRO2
45, PRO217, PRO301, PRO266, PRO335, PRO33
1 or PRO326 coding sequence or PRO245, PRO217, PRO30
1, a predetermined portion of PRO266, PRO335, PRO331 or PRO326 coding sequence (such as a sequence encoding the extracellular domain of a transmembrane protein) is 5
Amplified by PCR with primers complementary to the'and 3'regions. The 5'primer may include flanking (selected) restriction enzyme sites. The product is
It is then digested with the selected restriction enzymes and subcloned into the expression vector. Recombinant baculovirus was obtained by using Spodoptera frugiperda (“Sf9”) cells (ATC) containing the above-mentioned plasmid and BaculoGold (trade name) viral DNA (Pharmingen).
C CRL 1711) by co-transfection with lipofectin (commercially available from GIBCO-BRL). After incubation at 28 ° C for 4-5 days, released virus was collected and used for further amplification. Viral infection and protein expression are described by O'Reilley et al., Baculovirus expression vectors: A laboratory Manual, Oxfo.
rd: Performed as described in Oxford University Press (1994). Then the expressed poly-his tag PRO245, PRO217, PRO3
01, PRO266, PRO335, PRO331 or PRO326 is purified as follows, for example, by Ni ²⁺ -chelate affinity chromatography. Extracts were prepared from virus infected recombinant Sf9 cells as described in Rupert et al., Nature, 362: 175-179 (1993). Briefly, Sf9 cells were washed and sonicated buffer (25 ml Hepes, pH 7.9; 12.5 mM M).
gCl ₂ ; 0.1 mM EDTA; 10% glycerol; 0.1% NP-40; 0.4 M K
Cl) and sonicated twice on ice for 20 seconds. The sonicate was clarified by centrifugation, the supernatant was diluted 50-fold with loading buffer (50 mM phosphate, 300 mM NaCl, 10% glycerol, pH 7.8) and filtered through a 0.45 μm filter. Ni 2 ⁺ -
An NTA agarose column (commercially available from Qiagen) was prepared with a total volume of 5 ml, washed with 25 ml water and equilibrated with 25 ml loading buffer. The filtered cell extract is 0 per minute.
The column was loaded with 5 ml. The column was washed with loading buffer to the baseline of A ₂₈₀ , which is the point where fraction collection begins. The column is then loaded with a secondary wash buffer (50 mM phosphate; 300 mM NaCl, 10%) that elutes the bound protein nonspecifically.
Glycerol, pH 6.0). After reaching the A ₂₈₀ baseline again, the column was developed with a 0 to 500 mM imidazole gradient in secondary wash buffer. Fractions of 1 ml were collected and analyzed by SDS-PAGE and silver staining or Western blot with Ni ²⁺ -NTA conjugated to alkaline phosphatase (Qiagen). Eluted _{His 10} - tag PRO245, PRO217, PRO301, PRO2
Fractions containing 66, PRO335, PRO331 or PRO326 were pooled and dialyzed against loading buffer. Alternatively, IgG tag (or Fc tag) PRO245, PRO217, PRO
Purification of 301, PRO266, PRO335, PRO331 or PRO326 can be carried out using known chromatographic techniques including, for example, protein A or protein G column chromatography.

PRO245, PRO301 and PRO266 were expressed in baculovirus infected Sf9 insect cells. Expression was actually on the 0.5-2L scale, but can easily be scaled up to larger (eg 8L) preparations. Protein is IgG
Ig expressed as a construct (immunoadhesin), in which the protein extracellular region comprises hinge, CH2 and CH3 domains and / or poly-His tagged forms
It is fused to the G1 constant region sequence. Following PCR amplification, the corresponding coding sequences were labeled with a baculovirus expression vector (pb.PH.IgG for IgG fusion and pb.PH for polyHis tag protein).
.His.c), and the vector and Baculogold (registered trademark) baculovirus DNA (Pharmingen) were added to 105 Spodoptera gruhyperda (Spodopte
ra frugiperda) (“Sf9”) cells (ATCC CRL 1711) were treated with lipofectin (Gibc
o BRL) and co-transfected. pb.PH.IgG and PH.His.c are modifications of the commercially available baculovirus expression vector pVL1393 (Pharmingen) and have a polylinker region modified to contain a His or Fc tag sequence. Cells, 10%
Was grown in Hink's TNM-FM medium supplemented with FBS (Hyclone). Cells
Incubated at 28 ° C for 5 days. The supernatant was collected and subsequently Hi supplemented with 10% FBS was added.
Infection efficiency (MOI) of about 10 due to Sf9 cell infection in NK TNM-FH medium
Used for the first virus amplification in. Cells were incubated at 28 ° C for 3 days.
The supernatant was collected and the expression of the construct in the baculovirus expression vector was expressed by 25 mL of 1 ml of supernatant of Ni-NTA beads (QIAGEN) for histidine tag protein or Protein A Sepharose CL-4B beads for IgG tag protein ( Pharmacia)
Was determined by SDS-PAGE analysis comparing known concentrations of protein standard by batch binding to Coomassie blue staining. The first amplified viral supernatant was used to infect Sf9 cells grown in ESF-921 medium (Expression System LLC) with a spinner medium (500 ml) at an MOI of about 0.1. Cells were incubated at 28 ° C for 3 days. The supernatant was collected and filtered. Batch binding and SDS-PAGE analysis were repeated as needed until expression of spinner medium was confirmed.

Conditioned medium (0.5-3 L) from the transfected cells is centrifuged to remove the cells and 0.2
Recovered by filtration through a 2 micron filter. For poly-His tagged constructs, the protein containing sequence was purified using a Ni-NTA column (Qiagen). Before purification, imidazole was added to the conditioned medium to a concentration of 5 mM. Conditioned medium is 20 mM Hepes, pH 7.4 containing 0.3 M NaCl and 5 mM imidazole.
A 6 ml Ni-NTA column equilibrated with buffer was pumped at 4 ° C at a flow rate of 4-5 ml / min. After loading, the column is washed with additional equilibration buffer to remove protein.
Elution was done with equilibration buffer containing 25M imidazole. The highly purified protein was subsequently desalted with 25 ml G25 Superfine (Pharmacia) in a storage buffer containing 10 mM Hepes, 0.14 M NaCl and 4% mannitol, pH 6.8 and -80 ° C. Stored in. The immunoadhesin (Fc-containing) construct of the protein was purified from conditioned medium as follows. Conditioned medium was loaded onto a 5 ml protein A column (Pharmacia) equilibrated with 20 mM sodium phosphate buffer, pH 6.8. After loading, the column was washed extensively with equilibration buffer and then eluted with 100 mM citric acid, pH 3.5. The eluted protein was immediately neutralized by collecting 1 ml fractions in a tube containing 275 ml 1 M Tris buffer, pH 9. The highly purified protein is then
-Desalted in storage buffer as described above for His-tagged proteins. Protein homogeneity was determined by SDS polyacrylamide gel (PEG) electrophoresis and Edman
It can be evaluated by N-terminal amino acid sequencing by (Edman) degradation. PRO245, PRO217, PRO301, PRO266, PRO335,
PRO331 or PRO326 was also expressed in baculovirus-infected high5 cells using a similar procedure.

Example 12 PRO245, PRO217, PRO301, PRO266, PRO335, P
Preparation of Antibodies that Bind RO331 or PRO326 This example describes PRO245, PRO217, PRO301, PRO266,
6 illustrates the preparation of a monoclonal antibody that can specifically bind to PRO335, PRO331 or PRO326. Techniques for the production of monoclonal antibodies are known in the art and are described, for example, in Goding, supra. Immunogens that can be used are purified PRO245,
PRO217, PRO301, PRO266, PRO335, PRO331 or PRO326, PRO245, PRO217, PRO301, PRO266, P
Fusion protein containing RO335, PRO331 or PRO326, recombinant PRO245, PRO217, PRO301, PRO266, PRO33 on cell surface
5, cells expressing PRO331 or PRO326. The choice of immunogen can be made by one of ordinary skill in the art without undue experimentation. Balb / c and other mice were emulsified in complete Freund's adjuvant and injected subcutaneously or intraperitoneally at 1-100 micrograms PRO245, PRO217, PRO.
Immunize with 301, PRO266, PRO335, PRO331 or PRO326 immunogen. Alternatively, the immunogen is replaced with MPL-TDM adjuvant (Ribi Immunochem
ical Researh, Hamilton, MT) and injected into the hind footpads of animals. The immunized mice are then boosted 10-12 days later with an additional immunogen emulsified in the selected adjuvant. The mice are then boosted with additional immunization injections for several weeks. Anti-PRO245, PRO217, PRO301, PRO266,
Serum samples from retro-orbital bleeds may be taken periodically from mice for testing in an ELISA assay for detection of PRO335, PRO331 or PRO326 antibodies.

After a suitable antibody titer has been detected, animals that are “positive” for the antibody are given PRO24
5, PRO217, PRO301, PRO266, PRO335, PRO331
Alternatively, the final infusion of PRO326 intravenous injection can be given. Three to four days later,
The mouse was sacrificed and the spleen was removed. The spleen cells were then (using 35% polyethylene glycol) P3X63A available from the ATCC under the number CRL1597.
gU. Fused to selected mouse myeloma cell lines such as 1. Hybridoma cells were generated by the fusion and then plated on 96-well tissue culture plates containing HAT (hypoxanthine, aminopterin, and thymidine) medium to inhibit the growth of unfused cells, myeloma hybrids, and spleen cell hybrids. The hybridoma cells are PRO245, PRO217, PRO301, PRO.
Screened in an ELISA for reactivity to 266, PRO335, PRO331 or PRO326. PRO245, PRO217, PRO3
The determination of "positive" hybridoma cells secreting the desired monoclonal antibody against 01, PRO266, PRO335, PRO331 or PRO326 is within the ordinary skill in the art. Positive hybridoma cells were injected intraperitoneally into syngeneic Balb / c mice,
Anti-PRO245, PRO217, PRO301, PRO266, PRO335
, PRO331 or PRO326 monoclonal antibody is generated.
Alternatively, hybridoma cells can be grown in tissue culture flasks or roller bottles. Purification of the monoclonal antibody produced in the ascites can be performed using ammonium sulfate precipitation followed by gel exclusion chromatography. Alternatively, affinity chromatography based on the affinity of the antibody for protein A or protein G can be used.

Deposit of Materials The following cell lines were used for American Type Culture Collection, 10801
University Boulevard Manassas, Virginia, 20110-2209
Deposited in the United States (ATCC): Material ATCC Deposit Number Deposit Date DNA40981 209439 November 7, 1997 DNA37140 209489 November 21, 1997 DNA41388 209927 June 2, 1997 DNA35638 209265 September 17, 1997 DNA37150 209401 1997 October 17 DNA33094 209256 September 16, 1997 DNA32292 209258 September 16, 1997 DNA32279 209259 September 16, 1997 DNA40628 209432 November 7, 1997

This deposit was made in accordance with the provisions of the Budapest Treaty and its Regulations (Budapest Treaty) on the international recognition of deposits of microorganisms under the patent procedure. This guarantees that the viable culture of the deposit will be maintained for 30 years from the date of deposit.
Deposits may be obtained from the ATCC in accordance with the terms of the Budapest Treaty and in accordance with the agreement between Genentech and ATCC, whichever is first, at the time of issuance of the relevant U.S. patent or at any time. At the time of publication of a U.S. or foreign patent application, it is guaranteed that the progeny of the deposited culture will be permanently and unrestrictedly available, and will be subject to United States Patent Law Section 122 and the Patent Office Commissioner Regulations accordingly (especially reference numeral 886OG638).
It guarantees that the descendants will be available to those who have been determined by the US Patent Office Commissioner to have rights in accordance with 7 CFR Article 1.14). The assignee of the present application agrees that if the deposited culture dies or is lost or destroyed if cultured under the proper conditions, the material will be replaced immediately with the same at the time of notification. To do. The availability of deposited material is not to be construed as a license to practice the invention in breach of any rights recognized under any governmental authority under patent law. The written specification given above is considered sufficient to enable one skilled in the art to practice the invention. The deposited embodiment is intended as an illustration of one of the aspects of the invention and any functionally equivalent construct is within the scope of the invention, so that the deposited deposits may It is not limited. No deposit of material herein is admitted that the written description contained therein is sufficient to enable the practice of any aspect of the invention, including its best mode. It is not to be construed as limiting the scope of the claims to the particular illustrations presented. Indeed, various modifications of the invention in addition to those shown and described herein will be apparent to those skilled in the art from the foregoing description and fall within the scope of the appended claims.

[0115]

[0116]

[0117]

[0118]

[0119]

[0120]

[0121]

[0122]

[0123]

[0124]

[0125]

[0126]

[0127]

[0128]

[0129]

[0130]

[0131]

[0132]

[0133]

[0134]

[0135]

[0136]

[0137]

[0138]

[0139]

[Brief description of drawings]

[Fig1A-D] A hypothetical illustration using the following method to determine% amino acid sequence identity (Fig1A-B) and% nucleic acid sequence identity (Fig1C-D) using the ALIGN-2 sequence comparison computer program: And “PRO” shows the amino acid sequence of the hypothetical PRO polypeptide of interest, “Comparative protein” shows the amino acid sequence of the polypeptide to which the “PRO” polypeptide of interest is compared, and "PRO-DNA" indicates a hypothetical PRO polypeptide-encoding nucleic acid sequence of interest, "comparative DNA" indicates the nucleotide sequence of the nucleic acid molecule to which the "PRO-DNA" nucleic acid molecule of interest is compared, and "X" , "Y" and "Z" represent different hypothetical amino acid residues, and "N", "L" and "V" represent different hypothetical nucleotides.

FIG. 2A-P provides the complete source code for the ALIGN-2 sequence comparison computer program. This source code can be routinely compiled for use with the UNIX operating system and gives the ALIGN-2 sequence comparison computer program.

[Fig3] Fig. 3 is a diagram showing a nucleotide sequence of a cDNA containing a nucleotide sequence encoding a native sequence PRO245 (UNQ219), and the nucleotide sequence (SEQ ID NO: 1) is a clone herein designated "DNA35638". Also, bold and underlined fonts are the start and stop codons, respectively.

Figure 4 Native sequence PRO24 derived from the coding sequence of Figure3
FIG. 5 shows the amino acid sequence of 5 polypeptide (SEQ ID NO: 2). Also, the positions of various other important domains are indicated when known.

FIG. 5 is a diagram showing the nucleotide sequence of a cDNA containing the nucleotide sequence encoding native sequence PRO217 (UNQ191), which is herein the clone designated “DNA33094”. Also, bold and underlined fonts are the start and stop codons, respectively.

Figure 6 Native sequence PRO21 derived from the coding sequence of Figure 5
FIG. 8 shows the amino acid sequence of 7 polypeptide (SEQ ID NO: 4). Also, the positions of various other important domains are indicated when known.

FIG. 7 is a diagram showing the nucleotide sequence of a cDNA containing the nucleotide sequence encoding native sequence PRO301 (UNQ264), which is the clone designated herein as "DNA40628". Also, bold and underlined fonts are the start and stop codons, respectively.

Figure 8 Native sequence PRO30 derived from the coding sequence of Figure 7.
FIG. 3 shows the amino acid sequence of 1 polypeptide (SEQ ID NO: 6). Also, the positions of various other important domains are indicated when known.

FIG. 9 is a diagram showing the nucleotide sequence of a cDNA containing the nucleotide sequence encoding native sequence PRO266 (UNQ233), which is the clone designated herein as “DNA37150”. Also, bold and underlined fonts are the start and stop codons, respectively.

Figure 10 Native sequence PRO2 derived from the coding sequence of Figure 9.
FIG. 9 shows the amino acid sequence of 66 polypeptide (SEQ ID NO: 8). Also, the positions of various other important domains are indicated when known.

FIG. 11 is a diagram showing the nucleotide sequence of cDNA containing the nucleotide sequence encoding native sequence PRO335 (UNQ287V), and the nucleotide sequence (SEQ ID NO: 9) is the clone designated as “DNA41388” here. Also, bold and underlined fonts are the start and stop codons, respectively.

Figure 12 Native sequence PRO derived from the coding sequence of Figure 11
FIG. 9 shows the amino acid sequence of 335 polypeptide (SEQ ID NO: 10). Also,
The positions of various other important domains are also indicated when known.

FIG. 13 is a diagram showing the nucleotide sequence of a cDNA containing the nucleotide sequence encoding native sequence PRO331 (UNQ292), which is the clone designated herein as “DNA40981”. Also, bold and underlined fonts are the start and stop codons, respectively.

Figure 14 Native sequence PRO derived from the coding sequence of Figure 13.
FIG. 9 shows the amino acid sequence of 331 polypeptide (SEQ ID NO: 12). Also,
The positions of various other important domains are also indicated when known.

[FIG. 15] A diagram showing the nucleotide sequence of a cDNA containing the nucleotide sequence encoding native sequence PRO326 (UNQ287), which is the clone designated herein as "DNA37140". Also, bold and underlined fonts are the start and stop codons, respectively.

Figure 16 Native sequence PRO derived from the coding sequence of Figure 15
FIG. 8 shows the amino acid sequence of 326 polypeptide (SEQ ID NO: 14). Also,
The positions of various other important domains are also indicated when known.

[Sequence list]

─────────────────────────────────────────────────── ─── Continued Front Page (51) Int.Cl. ⁷ Identification Code FI Theme Coat (Reference) A61P 1/04 A61P 1/16 4H045 1/16 5/14 5/14 5/18 5/18 7/04 7/04 7/06 7/06 9/00 9/00 11/00 11/00 11/06 11/06 13/12 13/12 17/04 17/04 17/06 17/06 19/02 19 / 02 21/02 21/02 21/04 21/04 25/02 25/02 25/14 25/14 27/14 27/14 29/00 101 29/00 101 37/06 37/06 37/08 37 / 08 C12Q 1/68 A C12N 15/09 ZNA G01N 33/15 Z C12Q 1/68 33/50 Z G01N 33/15 33/53 D 33/50 33/577 B 33/53 33/68 33/577 C07K 16 / 18 33/68 A61K 37/02 // C07K 16/18 C12N 15/00 ZNAA (81) Designated countries EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE , IT, LU, MC, NL, PT, SE) OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, SD, SL, SZ, TZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AE, AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, CA, CH, CN, CR, CU, CZ, DE, DK, DM, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP , KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MD, MG, MK, MN, MW, MX, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, UA, UG, US UZ, VN, YU, ZA, ZW (72) inventor Goddard, Audrey United States California 94131, San Francisco, Congo Street 110 (72) inventor Gurnee, Austin, El. Debbie Lane, Belmont, California 94002, USA 1 (72) Inventor Tamas, Daniel Bee. United States California 94563, Olinda, Ray Avenue 3 (72) Inventor Wood, William, Eye. United States California 94010, Hillsborough, Southdown Court 35F Term (Reference) 2G045 AA40 BA13 BB20 BB22 CB01 CB02 CB17 CB21 CB26 DA12 DA13 DA14 DA36 FB02 FB03 FB04 FB05 FB06 FB08 JA12 CA02 DA12 CA02 CA12 CA12 CA12 CA02 CA12 CA12 CA12 CA12 CA12 CA12 CA12 CA12 CA12 CA12 CA12 CA12 CA12 QQ43 QR32. NA14 ZA201 ZA221 ZA331 ZA341 ZA361 ZA531 ZA551 ZA681 ZA751 ZA911 ZA941 ZA961 ZB022 ZB072 ZB082 ZB092 ZB112 ZB132 ZB152 ZB261 ZC54 4C085 AA08 AA14 AA15 AA16 AA17 AA19 AA26 AA27 AA33 AA34 AA37 AA38 BA42 BA43 BB11 BB17 BB23 BB31 CC05 CC13 CC22 CC23 CC29 DD22 DD23 DD24 DD33 DD35 DD37 DD62 DD63 DD86 DD88 EE01 EE06 FF03 FF17 FF20 GG01 HH15 JJ02 JJ03 JJ05 KA01 KA04 KA05 KA16 4H045 AA30 CA40 DA76 EA22 EA50 FA74

Claims (19)

[Claims] 1. PRO245, PRO217, PRO301, PRO266
, PRO335, PRO331 or PRO326 polypeptide, agonist or fragment thereof and a carrier or excipient in response to an antigen (a) infiltration of inflammatory cells into mammalian tissue in need thereof. A composition useful for increasing, (b) stimulating or promoting an immune response in a mammal in need thereof, or (c) increasing the proliferation of T lymphocytes in a mammal in need thereof. 2. PRO245, PRO217, PRO301, PRO266
, PRO335, PRO331 or PRO326 polypeptides, agonists or fragments thereof in response to an antigen (a) increase the infiltration of inflammatory cells into the tissues of a mammal in need thereof, and (b) require it Use for preparing a composition useful for stimulating or promoting an immune response in a mammal, or (c) increasing the proliferation of T lymphocytes in a mammal in need thereof. 3. PRO245, PRO217, PRO301, PRO266
, PRO335, PRO331 or PRO326 polypeptides, antagonists or fragments thereof and a carrier or excipient in response to an antigen (a) infiltration of inflammatory cells into a tissue of a mammal in need thereof. A composition useful for reducing, (b) inhibiting or reducing an immune response in a mammal in need thereof, or (c) reducing T lymphocyte proliferation in a mammal in need thereof. 4. PRO245, PRO217, PRO301, PRO266
, PRO335, PRO331 or PRO326 polypeptides, antagonists or fragments thereof in response to an antigen, (a) reducing the infiltration of inflammatory cells into the tissues of a mammal in need thereof, (b) requiring it A method of preparing a composition useful for inhibiting or reducing an immune response in a mammal, or (c) reducing the proliferation of T lymphocytes in a mammal in need thereof. 5. PRO245, PRO217, PRO301, PRO266
, A PRO335, PRO331 or PRO326 polypeptide, an antibody thereof, an antagonist thereto, or a fragment thereof is administered to a mammal in need of an immune-related disease such as a T cell mediated disease. A method of treating in a mammal. 6. The disease is systemic lupus erythematosus, rheumatoid arthritis, juvenile chronic arthritis, myeloarthritis, systemic sclerosis (scleroderma), idiopathic inflammatory myopathy (dermatomyositis, polymyositis), Sjogren. Syndrome, systemic vasculitis, sarcoidosis, autoimmune hemolytic anemia (immune pancytopenia, paroxysmal nocturnal hemoglobinuria),
Thyroiditis (Graves disease, Hashimoto thyroiditis juvenile lymphocytic thyroiditis, atrophic thyroiditis), diabetes mellitus, immune-mediated kidney disease (glomerular nephritis, renal tubular interstitial nephritis), multiple sclerosis, idiopathic prolapse Demyelinating diseases such as myelinated polyneuropathy or Guyan-Barre syndrome and chronic inflammatory polyneuropathy, infectious hepatitis (A, B, C, D, E
And other non-hepatotrophic viruses), autoimmune chronic active hepatitis, primary biliary cirrhosis,
Hepatobiliary diseases such as granulomatous hepatitis and sclerosing cholangitis, inflammatory bowel disease (ulcerative colitis: Crohn's disease), gluten-sensitive enteritis, and inflammatory and fibrotic lung diseases such as Whipple's disease, bullous Skin diseases, autoimmune or immune-mediated skin diseases including erythema multiforme and contact dermatitis, psoriasis, asthma, allergic rhinitis, atopic dermatitis, allergic diseases such as food hypersensitivity and urticaria, eosinic acid 6. The method of claim 5, wherein the method is selected from immune-related diseases of the lung such as spherical pneumonia, idiopathic pulmonary fibrosis and hypersensitivity pneumonia, transplantation-related diseases including transplant rejection and graft-versus-host disease. 7. The composition according to claim 1 or 3 or the use according to claim 2 or 4, wherein the antibody is a monoclonal antibody. 8. The composition according to claim 1 or 3 or the use according to claim 2 or 4, wherein the antibody is an antibody fragment or a single chain antibody. 9. The composition according to claim 1 or 3 or claim 2 or 4, wherein the antibody has non-human complementarity determining region (CDR) residues and human framework region (FR) residues. Use of. 10. PRO245, PRO217, PRO301, PRO26
Cells suspected of containing the 6, PRO335, PRO331 or PRO326 polypeptide were treated with anti-PRO245, PRO217, PRO301, PRO26.
6, PRO335, PRO331 or PRO326 antibody, and measuring the binding of the antibody to cells PRO245, PRO217, PRO30.
A method of determining the presence of 1, PRO266, PRO335, PRO331 or PRO326 polypeptide. 11. A method of diagnosing an immune related disease in a mammal, comprising:
PRO245, PRO217, PRO30 in (a) a test sample of tissue cells from the mammal and (b) a control sample of known normal cells of the same cell type.
1, comprising detecting the expression level of a gene encoding PRO266, PRO335, PRO331 or PRO326 polypeptide, wherein the high expression level in the test sample results in an immune-related disease in the mammal from which the test tissue cells were obtained. How to indicate the presence of. 12. A method of diagnosing an immune related disease in a mammal, comprising:
(A) Anti-PRO245, PRO217, PRO301, PRO266, PRO
Contacting a 335, PRO331 or PRO326 antibody with a sample of tissue cells obtained from the mammal, and (b) detecting complex formation between the antibody and the polypeptide in the test sample. . 13. Anti-PRO245, PRO217, PRO301, PRO
A diagnostic kit for immune-related diseases, which comprises the 266, PRO335, PRO331 or PRO326 antibody or fragment thereof and a carrier in an appropriate package. 14. An antibody is used as PRO245, PRO217, PRO301, PR.
14. The kit of claim 13, further comprising instructions for use in detecting O266, PRO335, PRO331 or PRO326 polypeptide. 15. A container; a label on the container; and a composition containing an active agent contained in the container, the composition being effective for stimulating or promoting an immune response in a mammal. And the label on the container indicates that the composition can be used for the treatment of immune related diseases, and the active agent in the composition is PRO245, PRO217, PRO301, PRO266, PRO335, P
An article of manufacture which is a drug that inhibits the expression and / or activity of RO331 or PRO326 polypeptide. 16. The drug is anti-PRO245, PRO217, PRO30.
22. The article of manufacture according to claim 21, which is 1, PRO266, PRO335, PRO331 or PRO326 antibody. 17. A candidate compound is defined as PRO245, PRO217, PRO301.
, PRO266, PRO335, PRO331 or PRO326 polypeptide, and a method for identifying a compound capable of inhibiting the expression or activity of PRO245 polypeptide, which comprises contacting these two components under conditions and for a sufficient time to interact with each other. . 18. A candidate compound or PRO245, PRO217, PRO
18. The method of claim 17, wherein the 301, PRO266, PRO335, PRO331 or PRO326 polypeptide is immobilized on a solid support. 19. The method of claim 18, wherein the non-immobilized component carries a detectable label.