JP2003520786A - Polynucleotide vaccines expressing codon-optimized and modified HIV-1 POL - Google Patents

Abstract

  (57) [Summary] Pharmaceutical compositions comprising HIV Pol DNA vaccines and the manufacture and use of these DNA vaccines are disclosed. The pol-based DNA vaccines of the invention are administered directly into living vertebrate tissue, preferably directly to humans, and are preferably administered to the HIV Pol lacking protease, reverse transcriptase, RNase H and integrase activities. Expresses an inactive form of the protein to induce a cellular immune response that specifically recognizes human immunodeficiency virus-1 (HIV-1). DNA molecules containing the open reading frame of these DNA vaccines are synthetic DNA molecules encoding codon-optimized HIV-1 Pol and codon-optimized inactive derivatives of optimized HIV-1 Pol (amino-terminal leader peptide, Including an inactive Pol protein-containing DNA molecule).

Description

Detailed Description of the Invention

FIELD OF THE INVENTION The invention relates to HIV when introduced directly into living vertebrate tissue, preferably a mammalian host, such as a human or non-human mammal of commercial or veterinary veterinary importance.
An HIV Pol polynucleotide pharmaceutical that induces a cellular immune response that specifically expresses human immunodeficiency virus-1 (HIV-1) by expressing Pol protein or a biologically relevant portion thereof in the animal, and Regarding its manufacture and use. The polynucleotide of the present invention is a synthetic DNA molecule (HIV-1 Pol protease, reverse transcriptase) encoding a codon-optimized (that is, codon-optimized) HIV-1 Pol and a derivative of the optimized HIV-1 Pol. , R
Nase H and integrase activity inactivated constructs).
The polynucleotide vaccine of the present invention provides a prophylactic benefit to uninfected individuals,
And / or it should provide a therapeutic effect by reducing the viral load level within the infected individual and prolonging the asymptomatic period of HIV-1 infection.

BACKGROUND OF THE INVENTION Human immunodeficiency virus-1 (HIV-1) is the pathogen of acquired human immunodeficiency syndrome (AIDS) and related disorders. HIV-1 is an RN of the retroviridae family
A virus and 5'-LTR-gag-pol- of all retroviruses.
The env-LTR3 'system is shown. An integrated form of HIV known as a provirus
-1 is about 9.8 Kb long. Each end of the viral genome contains flanking sequences known as long terminal repeats (LTRs). The HIV gene encodes at least 9 proteins and is divided into three classes: major structural proteins (Gag, Pol and Env), regulatory proteins (Tat and Rev) and accessory proteins (Vpu, Vpr, Vif and Nef). .

The gag gene is expressed in HI from unspliced viral mRNA.
It encodes a 55 kilodalton (kDa) precursor protein (p55) that is processed by proteolysis by V protease (the product of the pol gene). The mature p55 protein product is p17 (matrix), p24 (capsid)
, P9 (nucleocapsid) and p6.

The pol gene encodes proteins required for viral replication, namely reverse transcriptase, protease, integrase and RNase H. These viral proteins are 160 kDa produced by ribosomal frameshifting.
Is expressed as a Gag-Pol fusion protein, which is a precursor protein of. The virus-encoded protease cleaves the Pol polypeptide by proteolysis into a mature protein, which is a protease (Pro, P10
), Reverse transcriptase (RT, P50), integrase (IN, p31) and RN
It results in ase H (RNase, p15) activity.

The nef gene encodes the early accessory HIV protein (Nef), which has been shown to have several activities such as down-regulation of CD4 expression, inhibition of T cell activation and promotion of HIV infectivity. .

The env gene encodes a viral envelope glycoprotein that is translated as a 160 kilodalton (kDa) precursor (gp160), which is then cleaved by cellular proteases to give an extracellular 120 kDa envelope. Glycoprotein (gp120) and transmembrane 41 kDa envelope glycoprotein (gp41) are provided. Gp120 and gp41 remain associated and displayed on viral particles and on the surface of HIV infected cells.

The tat gene is an RNA that is a transcriptional activator essential for HIV-1 replication.
It encodes the long and short forms of the binding protein Tat protein.

The rev gene encodes a 13 kDa Rev protein that is an RNA binding protein. Rev proteins bind to a region of viral RNA called the Rev response element (RRE). Rev proteins facilitate the transport of unspliced viral RNA from the nucleus to the cytoplasm. Rev protein is HI
Required for V late gene expression and for HIV replication.

Gp120, as an adjunct to other coreceptor molecules, binds to the CD4 / chemokine receptor present on the surface of helper T lymphocytes, macrophages and other target cells. X4 (macrophage tropic) virus shows tropism for CD4 / CXCR4 complex, R5 (T cell line tropic) virus shows CD4 / CCR5
It interacts with the receptor complex. After gp120 binds to CD4, gp41
It mediates fusion events that lead to the entry of viruses. The virus fuses with the target cell and invades it, and then the RNA-dependent DNA polymerase allows its single-stranded R
Reverse transcription occurs from the NA genome to double-stranded DNA. Known as a provirus, the viral DNA enters the cell nucleus where it produces new viral RNA in the nucleus, expresses early and late HIV viral proteins,
And directs the production of new viral particles and cell release. The primary infection gives a very high production and tissue distribution of the virus and subsequent steady-state level of virus, which is due to continuous virus production and turnover in this phase, and finally Have been shown to result in additional viral shedding leading to clinical AIDS development from recent advances in viral load detectability. Productive infected cells have a half-life of several days, whereas chronic or latent infected cells have a half-life of 3 weeks, followed by non-productive infected cells with a long half-life (
100 days or more), but does not contribute significantly to the daily viral load seen throughout the course of the disease.

Destruction of CD4 helper T lymphocytes, crucial for immune defense, is a major cause of the progressive immune dysfunction characteristic of HIV infection. Loss of CD4 T cells significantly impairs the body's ability to fight most invaders, but it has a particularly severe impact on protection against viruses, fungi, parasites and certain bacteria, including mycobacteria.

Recently, effective treatments for HIV-1 infected individuals have become available. However, these drugs have no significant effect on the disease in many parts of the world, and they will have minimal effects that prevent the spread of infection within the human population. As with many other infectious diseases, a significant epidemiological effect on the spread of HIV-1 infection would only be found after the development and introduction of an effective vaccine. Many factors have contributed to the failure of vaccine development to date. As noted above, chronic virus production occurs in chronically infected individuals despite the presence of anti-HIV-1 humoral and cellular immune responses and destruction of virus-infected cells. As with other infectious diseases, the outcome of the disease depends on how the kinetics and magnitude of the immune response balances the pathogen replication rate and susceptibility of the immune response. Pre-existing immunity in acute infections may be more effective than the productive immune response in established infections. The second factor is the prominent genetic variability of the virus. Although there are anti-HIV-1 antibodies that neutralize HIV-1 infectivity in cell culture, these antibodies are generally specific for viral isolates in their activity. It has proven impossible to define the serological classification of HIV-1 using traditional methods. Rather, the virus appears to characterize the serological "continuum", so that individual neutralizing antibody responses are, at best, effective against a small number of viral variants. In light of this latter view, it would be useful to identify immunogens and associated delivery technologies that could elicit an anti-HIV-1 cellular immune response. To obtain a CTL response, the antigen is either synthesized intracellularly or introduced intracellularly and then processed by the proteasome complex into small peptides, which are associated with major histocompatibility complex (MHC) class I proteins. ER for final assembly /
It is known that it must be transported to the Golgi complex secretory pathway. CD8 ⁺ T lymphocytes recognize antigens associated with class I MHC via the T cell receptor (TCR) and CD8 cell surface proteins. Activation of naive CD8 ⁺ T cells to activating effectors or memory cells generally requires both TCR engagement of the antigen and co-stimulatory protein engagement as described above. Optimal induction of CTL responses usually requires “help” in the form of cytokines from CD4 ⁺ T lymphocytes that recognize antigens associated with MHC class II molecules via TCR and CD4 engagement.

Larder et al. (1987, Nature 327: 716-717) and Larder et al. (1989, Proc. Natl. Acad. Sci. 86: 4).
803-4807) discloses site-directed mutagenesis of HIV-1 RT and the effect of such changes on in vitro activity and infectivity associated with interaction of RT with known inhibitors. Is disclosed.

Davies et al. (1991, Science 252 :, 88-95) reported H.
Disclosed is the crystal structure of the RNase H domain of IV-1 Pol.

Schatz et al. (1989, FEBS Lett. 257-311-314).
Mutated Glu4 within the complete HIV-1 RT / RNase H DNA fragment.
It is disclosed that 78Gln and His539Phe confer defective RNase activity without affecting RT activity.

Mizura et al. (1990, Nucl. Acids. Res. 18: pp.
5359-5353) is the R of the pol gene that also confers defective RNase activity.
Additional mutations in the Nase region Asp443Asn and Asp498Asn
Is disclosed. The authors describe that characterization of the Asp498Asn mutant was difficult due to the instability of this mutant protein.

Leavitt et al. (1993, J. Biol. Chem. 268: 2113-).
2119) disclose several mutations, including the Asp64Val mutation, which show different effects on HIV-1 integrase (IN) activity.

Wiskerchen et al. (1995, J. Virol. 69: 376-386.
), Disclose single and double mutants containing mutations in HIV-1 IN and aspartic acid residues that affect viral replication function.

Obtaining a HIV vaccine based on prophylaxis and / or treatment that produces a strong cellular immune response against HIV infection would be of great importance in the fight against AIDS. The present invention addresses and satisfies this need by disclosing a class of DNA vaccines based on host delivery and expression of modified HIV-1 gene pol.

SUMMARY OF THE INVENTION The present invention is directed to cellular immunity and humoral when administered to a host, including primates, especially humans, and also non-human mammals of commercial or veterinary importance. It relates to synthetic DNA molecules (also referred to herein as "polynucleotide") that elicit a response and related DNA vaccines (also referred to herein as "polynucleotide vaccines"). The effect of the cell-mediated immunity-inducing vaccine of the present invention is that the viral load within infected individuals increases the transmission rate to previously uninfected individuals and / or prolongs the asymptomatic period of HIV-1 infection. There should be a decrease in the level of. In particular, the present invention relates to DNA vaccines encoding various forms of HIV-1 Pol, in which administration, intracellular delivery and expression of the HIV-1 Pol gene of interest induces host CTL and Th responses. Provoke. Preferred synthetic DNA molecules of the invention include, but are not limited to, pol modifications involving pol modifications involving residues within the catalytic region that result in RT, RNase and IN activity in host cells. Of the HIV-1 Pol fusion protein and codon-optimized forms of the HIV-1 Pol protein and fusion protein.

A particular embodiment of the present invention is the deletion of the DNA sequence encoding the protease (PR) activity, resulting in codon optimized “RT (reverse transcriptase and RNase activities) and IN integrase activities. Codon optimized wt, giving "wild type" sequences
-For pol DNA constructs. The nucleotide sequence of the DNA molecule encoding this protein is disclosed herein as SEQ ID NO: 1 and the corresponding amino acid sequence of the expressed protein is disclosed herein as SEQ ID NO: 2.

The present invention preferably comprises an H sequence lacking a DNA sequence encoding any PR activity.
IV-1 DNA pol construct comprising RT, RNase and / or I
HIV-1 DNA pol constructs containing mutations that at least partially, and preferably substantially, abolish N activity. One type of HIV-1 pol mutant is the RT, RNase and / or of the expressed protein to confer at least substantially reduced enzymatic activity on HIV-1 Pol RT, RNase H and / or IN function. It may include, but is not limited to, a mutated DNA molecule containing at least one nucleotide substitution that causes a point mutation that effectively modifies the active site within the IN region. In a preferred embodiment of this aspect of the invention, the HIV-1 DNA pol construct is RT, RNase H
And a mutation in the Pol coding region that effectively abolishes IN activity.
A particularly preferred HIV-1 DNA pol construct is a DNA molecule containing at least one point mutation that modifies the active site of the RT, RNase H and IN domains of Pol to at least substantially abolish each activity. . Such HIV-1 Pol mutations will include at least one point mutation within or around each catalytic domain that results in RT, RNase H and IN activity, respectively. For this purpose, a particularly preferred HIV-1 DNA p
The ol construct is exemplified in the present invention, which is a 9-codon substitution mutation that results in an inactivated Pol protein (IA Pol: SEQ ID NO: 4, FIGS. 2A-C) without PR, RT, RNase or IN activity. Containing mutations, in which case three such point mutations are present in each of the RT, RNase and IN catalytic domains. Any combination of the mutations disclosed herein may be suitable and therefore can be utilized as an IA-Pol based vaccine of the invention. Although addition and deletion mutations are expected and within the scope of the invention, preferred mutations are point mutations that result in the substitution of a wild-type amino acid for another amino acid residue.

Another aspect of the invention relates to the production of HIV-1 Pol-based vaccine constructs containing a eukaryotic trafficking signal peptide, such as the leader peptide from human tPA. To this end, the present invention relates to a DNA molecule encoding a codon-optimized wt-pol DNA construct, wherein the protease (PR) activity is deleted and the human tPA leader sequence is at the 5'end of the coding region. To a DNA molecule characterized by being fused to The DNA molecule encoding this protein is disclosed herein as SEQ ID NO: 5, and the open reading frame is disclosed herein as SEQ ID NO: 6.

The invention especially relates to HIV-1 Pol mutants, such as IA-Pol (SEQ ID NO: 4), which comprise in the amino-terminal part a leader peptide such as the human tPA leader, which leader peptide comprises HIV-1 P characterized by being able to influence the cellular trafficking of said expressed protein in said host cell and thus its immunogenicity
ol mutants. Any such HIV-1 disclosed in the preceding paragraph
Pol mutants are suitable for downstream fusion of leader peptides that include (but are not limited to) the human tPA leader sequence. Thus, an HIV-1 pol mutant construct based on any such leader peptide confers at least a substantially reduced enzymatic activity on one or more of the RT, RNase H and / or IN functions of HIV-1 Pol. As such, it may include, but is not limited to, mutant DNA molecules that effectively modify the catalytic activity of the RT, RNase and / or IN regions of the expressed protein. In a preferred embodiment of this aspect of the invention, the leader peptide / HIV-1 DN
The A pol construct contains mutations within the Pol coding region that effectively abolish RT, RNase H and IN activities. Particularly preferred HIV-1 DNA
The pol construct comprises at least one point that modifies the active site and catalytic activity within the RT, RNase H and IN domains of Pol so as to at least substantially (and preferably completely) abolish each activity. A DNA molecule containing a mutation. Such HIV-1 Pol mutations are reported in 10 out of 89, respectively RT
, RNase H and IN activities will contain at least one point mutation in or around each catalytic domain. A particularly preferred embodiment of this aspect of the invention relates to a human tPA leader fused to an IA-Pol protein containing the 9 mutations shown in Table 1. The DNA molecule is disclosed herein as SEQ ID NO: 7 and the expressed tPA-IA Pol protein comprises a fusion junction as shown in FIG. The complete amino acid sequence of the expressed protein is shown in SEQ ID NO: 8.

The present invention also relates to the substantially purified proteins expressed from the DNA polynucleotide vaccines of the present invention, in particular the purified proteins shown below as SEQ ID NOs: 2, 4, 6 and 8. These purified proteins may be useful as protein-based HIV vaccines.

The present invention also relates to the various wild-type and modified forms of HIV P disclosed herein.
Non-codon optimized forms of DNA molecules and related polynucleotides encoding ol proteins and related DNA vaccines. Although partially or completely codon optimized DNA vaccine expression vector constructs are preferred, "non-codon optimized" forms of the constructs disclosed herein, particularly substantial cellular immunity and humoral fluids following host administration. It is within the scope of the invention to use modified forms of HIV Pol that have been shown to enhance the sexual immune response.

The DNA backbone of the DNA vaccine of the present invention is preferably a DNA plasmid expression vector. The DNA plasmid expression vector used in the present invention is
Includes, but is not limited to, a construct containing a cytomegalovirus promoter (CMV-intA) containing a bovine growth hormone transcription termination sequence and an intron A sequence. In addition, the DNA plasmid vector of the present invention preferably includes, but is not limited to, an ampicillin resistance gene, a neomycin resistance gene, or any other pharmaceutically acceptable antibiotic resistance marker. including. Also suitable are suitable polylinker cloning sites and prokaryotic origins of replication sequences. The specific DNA vectors exemplified herein are V
1, V1J (SEQ ID NO: 13), V1Jneo (SEQ ID NO: 14), V1Jns (FIG. 1A, SEQ ID NO: 15), V1R (SEQ ID NO: 26) and any of the above vectors (wherein a leader peptide, preferably human tPA). The nucleotide sequence encoding the leader includes directly fused to the CMV-intA promoter, including but not limited to V1Jns-tpa shown in Figure 1B and SEQ ID NO: 28.

The present invention particularly relates to a DNA vaccine, and a pharmaceutically active vaccine composition containing this DNA vaccine, and for immunization of a host (preferably a human host) against HIV infection or against existing HIV conditions, It relates to the use of prophylactic and / or therapeutic vaccines. These DNA vaccines use codon optimized HIV-1 P
ol (eg, SEQ ID NO: 2), a codon-optimized HIV-1 Pol fused to an amino terminal localization leader sequence (eg, SEQ ID NO: 6), a codon-optimized DNA molecule, and the particularly preferred core of the present invention is , Significant P associated with wild-type Pol
A biologically inactive Pol protein lacking R, RT, RNase or IN activity (IA Pol, eg SEQ ID NO: 4), and ancillary constructs containing a leader peptide in the amino-terminal region of the IA Pol protein. These constructs are ligated in a suitable DNA plasmid vector with or without a nucleotide sequence encoding a functional leader peptide. Preferred D of the present invention
The NA vaccine comprises a codon-optimized DNA molecule encoding a codon-optimized HIV-1 Pol and an inactivated form of Pol, ligated in the DNA vector disclosed herein or any of the aforementioned vectors. In this case, the nucleotide sequence encoding the leader peptide (preferably the human tPA leader) is directly downstream of the CMV-intA promoter, including (but not limited to) V1Jns-tpa shown in Figure 1B and SEQ ID NO: 28. Are fused together.

Therefore, the present invention provides V1Jns-WTPol (WT set forth in SEQ ID NO: 2).
(Including a DNA molecule encoding Pol), V1Jns-tPA-WTpol (including a DNA molecule encoding tPA Pol shown in SEQ ID NO: 6), V1Jns
-IAPol (including the DNA molecule encoding IA Pol set forth in SEQ ID NO: 4) and V1Jns-tPA-IAPol (tPA-IA set forth in SEQ ID NO: 8)
DNA vaccines, including (but not limited to) DNA molecules that encode Pol). Particularly preferred is V shown in Example 2.
1Jns-IAPol and V1Jns-tPA-IAPol.

The present invention also relates to HIV Pol polynucleotide pharmaceutical products and their manufacture and uses. Here, the DNA vaccine may enhance the immunogenicity of the DNA polynucleotide vaccine of the present invention (ie, enhance it by promoting an enhanced cellular and / or humoral response after inoculation. ) Formulated with an adjuvant. Preferred adjuvants are aluminum phosphate-based or calcium phosphate-based adjuvants, with aluminum phosphate adjuvants being particularly preferred. Another preferred adjuvant is a nonionic block copolymer, preferably polyoxyethylene (POE).
) And polyoxypropylene (POP) blocks, eg POE
-POP-POE block copolymer. These adjuvant forms, including the DNA vaccines disclosed herein, are useful in enhancing the cellular response to DNA vaccines.

The DNA vaccine or DNA polynucleotide vaccine used in the present invention, when introduced into a living vertebrate cell, instructs the cell device to produce a translation product encoded by each pol gene of the present invention. A DNA molecule (ie, "nucleic acid", "polynucleotide") that contains the possible essential regulatory elements.

BRIEF DESCRIPTION OF THE FIGURES FIGS. 1A-B show DNA vaccine expression vectors V1Jns (A) and V1Jns-tPA used for HIV-1 pol and HIV-1 modified pol constructs.
The schematic diagram of (B) is shown.

2A-C show the nucleotide (SEQ ID NO: 3) and amino acid sequence (SEQ ID NO: 4) of IA-Pol. Underlined codons and amino acids indicate the mutations listed in Table 1.

FIG. 3 shows the codon-optimized nucleotide and amino acid sequences (included within SEQ ID NOS: 7 and 8, respectively) through the fusion junction of tPA-IA-Pol. With lower line portion represents the NH ₂ -terminal region of the IA-Pol.

FIG. 4 shows 1 or 2 doses of codon optimized V1Jns-IApol and V1J.
Production of humoral response from mice immunized with ns-tpa-IApol (anti-RT
(Measured as the geometric mean of endpoint titers). Groups of mice dosed with 30 ug of each plasmid were boosted at T = 8 weeks and sera from all mice were collected 4 weeks after 2 doses.

FIG. 5: Increasing single dose codon optimized V1Jns-IApol or 30 ug
CD of splenocytes (pool of 5 spleens / cohort) from control mice vaccinated with codon-optimized V1Jns-tpa-IApol (13 weeks after dose 1 administration) of
4 ⁺ (aa641-660, aa731-750) or CD8 ⁺ (aa201
-220, aa311-330, aa571-590, aa781-800) shows the number of IFNγ secreting cells per 10 ⁶ cells after stimulation with a pool of specific peptides. Mice vaccinated with a second dose of 30 ng of either plasmid (n = 5) were analyzed in the Elispot assay 6 weeks after dose 2 administration. The total number of spots stimulated with each individual CD8 ⁺ peptide is shown. This is because the spots in the wells to which the pool is added are too dense to get an accurate count. The CD4 ⁺ cell count is obtained from the response to the peptide pool. Error bars represent standard deviation from triplicate wells (triplicate) per sample per antigen.

6A-C show 3 mg of 5 mg codon optimized HIV-1 Pol expression plasmid.
ELIsp of peripheral blood cells collected from rhesus monkeys immunized once (T = 0, 4, 8 weeks)
ot analysis is shown. Two pools of 20-mer peptides derived from the vaccine sequence (
Antigen-specific IFNγ secretion was stimulated by the addition of one of mpo-1, aa1-420; mpol-2, aa411-805). (A) V1Jns-IA
3 monkeys vaccinated with pol (Tag No. 94R008, 94R0
13,94R033) spot forming cells (SFC) as a function of time
Frequency. Values shown are corrected for background response without peptide restimulation. (B) Three monkeys vaccinated with 5 mg of V1Jns-tpa-IApol (Tag No. 920078, 920073, 94R).
Frequency of spot forming cells (SFC) as a function of time for 028). (C
) ELIspot responses from monkeys (920072) not receiving any immunization were also measured.

7A-B shows codon optimized V1Jns- 8 weeks after the third vaccination.
Figure 7 shows bulk CTL killing from rhesus monkeys immunized with IApol (A) or codon optimized VlJns-tpa-IApol (B). Recombinant vaccinia virus expressing pol was used to restimulate the peptide pool mp
Target cells were prepared by pulsing with ol-1 and mpol-2.

FIG. 8 shows detection of in vitro pol expression from cell lysates of 293 cells transfected with 10 ug of various pol constructs. Bands were detected using antisera from HIV-1 seropositive human subjects. Equal amounts of total protein were loaded for each lane. The lane contains lysates from cells transfected with: 1: mimic; 2: V1Jns-wt-pol.
3: V1Jns-IApol (codon optimized); 4: V1Jns-tpa-I
Apol (codon optimization); 5: V1Jns-tpa-pol (codon optimization)
6: V1R-wt-pol (codon optimized); 7: blank; and 8:80
ng RT.

FIG. 9 shows one dose (white circles) or two doses (black circles) of 1, 10, 100 μg V1.
Shown are the geometric mean anti-RT titers (GMT) and standard error of the geometric means for a cohort of 5 mice dosed with R-wt-pol (codon optimized) or V1Jns-wt-pol. Sera from all animals were collected 2 weeks after Dose 2 (or 7 weeks after Dose 1) and assayed simultaneously. Statistical analysis was performed to compare cohorts that received the same amount and number of immunizations of either plasmid. A p-value of less than 5% (two-sided test) is shown on the bar and is associated with the correlation cohort to reflect statistically significant differences.

FIG. 10 shows various doses of wt-po, one dose (pd1) or two doses (pd2).
1 shows the cellular immune response in BALB / c mice vaccinated (im) with 1 (virus derived) or wt-pol (codon optimized) plasmids. Three weeks after dose 2 administration, CD4 ⁺ peptides (aa 21-40, aa 411-430, aa 531-550, aa 641-6) at a final concentration of 4 μg / mL per peptide.
60, aa731-750, aa771-790) or CD8 ⁺ peptide (a
a201-220, aa311-330) for a mixture of 5 per cohort.
The frequency of IFN-γ-secreting splenocytes is determined from a pool of individual spleens.

DETAILED DESCRIPTION OF THE INVENTION The present invention is directed to CTL and Th when administered to a host, including primates, especially humans.
It relates to synthetic DNA molecules and related DNA vaccines that elicit a cellular immune response.
The effect of the cell-mediated immunity-inducing vaccine of the present invention is that the viral load within infected individuals increases the transmission rate to previously uninfected individuals and / or prolongs the asymptomatic period of HIV-1 infection. There should be a decrease in the level of. In particular, the present invention relates to DNA vaccines encoding various forms of HIV-1 Pol, in which administration, intracellular delivery and expression of the HIV-1 Pol gene of interest induces host CTL and Th responses. Provoke. Preferred Synthetic DNs of the Invention
The A molecule encodes codon-optimized wild-type Pol (without Pro activity) and various codon-optimized inactivated HIV-1 Pol proteins. The HIV-1 pol constructs disclosed herein are particularly preferred for pharmaceutical use, especially for human administration as a DNA vaccine. The HIV-1 genome preferentially utilizes uncommon codons as compared to highly expressed human genes. Thus, the pol open reading frame has been synthetically engineered with optimal codons for human expression. As mentioned above, a preferred embodiment of the invention is that HIV-1 p with codon usage optimized for expression in mammals, especially humans.
ol open reading frame.

The synthetic pol gene disclosed herein comprises coding sequences for reverse transcriptase (or RT consisting of polymerase and RNase H activity) and integrase (IN). The protein sequence is based on the sequence of Hxb2r, a clonal isolate of IIB. This sequence is the closest to the consensus cognate B sequence and has been shown to have only 16 mismatch residues out of 848 residues (Kor.
ber et al., 1998, Human retroviruses and AID
S, Los Alamos National Laboratory, Los
Alamos, New Mexico). One of ordinary skill in the art, after reviewing the specification,
Any available HIV-1 or HIV-2 strain may be the HIV disclosed herein.
It will be appreciated that it provides a potential template for the pol DNA vaccine construct. It is further noted that, despite mutational inactivation, the protease gene has been removed from the DNA vaccine construct of the present invention to ensure safety from any residual protease activity. Let's do it. In order to maximize mammalian expression in vivo, the design of both wild-type (wt-pol) and inactivated pol (IA-pol) gene sequences is preferred for humans for each amino acid residue within the sequence ( "Humanized") codon usage has been added (Lathe, 1
985, J. Mol. Biol. 183-12). SEQ ID NOs: 1, 3, 5 and 7
The following codon usages are preferred for optimization in mammals, as can be seen by examining the codon usage in Met (ATG), Gly.
(GGC), Lys (AAG), Trp (TGG), Ser (TCC), Arg
(AGG), Val (GTG), Pro (CCC), Thr (ACC), Glu
(GAG); Leu (CTG), His (CAC), Ile (ATC), Asn
(AAC), Cys (TGC), Ala (GCC), Gln (CAG), Phe
(TTC) and Tyr (TAC). To further discuss codon optimization in mammals (humans), see WO 97/31115 (PCT / US97 / 0).
2294), which is hereby incorporated by reference. Those skilled in the art may use other forms of codon optimization, or use H within the scope of the invention.
It is anticipated that this step may be omitted when making the IV pol vaccine construct. Accordingly, the present invention also relates to non-codon-optimized forms (ie, non-codon-optimized forms) of DNA molecules and related DNA vaccines encoding various wild-type and modified forms of the HIV Pol proteins disclosed herein. ) Concerning. However, codon optimization of these constructs is a preferred embodiment of the invention.

A particularly preferred embodiment of the present invention is a D encoding a protease (PR) activity.
NA sequence deleted, RT (reverse transcriptase and RNase activity) and IN
A codon-optimized wt-pol DNA construct (referred to herein as "wt-pol" or "wt-pol (codon-optimized)") that provides a codon-optimized "wild-type" sequence encoding integrase activity. Regarding). A DNA molecule encoding this protein is disclosed herein as SEQ ID NO: 1, and the open reading frame is contained from the starting Met residue at nucleotides 10-12 to the stop codon at nucleotides 2560-2562. . Sequence number 1
Is as follows.

[0044]

[Chemical 1]

The open reading frame of the wild-type pol construct disclosed as SEQ ID NO: 1 contains 850 amino acids disclosed herein as SEQ ID NO: 2 as follows.

[0046]

[Chemical 2]

In particular, the present invention relates to the deletion of the wild-type sequence part encoding the protease activity, as well as the active site residue mutation deleterious to the HIV-1 pol (RT-RH-IN) activity of the expressed protein. Optimized HIV-1 DNA in which the combination of
pol constructs. Accordingly, the invention preferably provides an HIV-1 DNA pol construct lacking a DNA sequence encoding any PR activity, comprising:
HIV-1 DNA pol constructs containing mutations that at least partially, and preferably substantially, abolish RT, RNase and / or IN activity. One type of HIV-1 pol mutant is HIV-1 Pol RT,
At least one point mutation that effectively modifies the active site within the RT, RNase and / or IN region of the expressed protein to confer at least substantially reduced enzymatic activity on RNase H and / or IN function It can include, but is not limited to, mutant DNA molecules that include nucleotide substitutions. In a preferred embodiment of this aspect of the invention, HIV-1 DNA
The pol construct effectively reverses RT, RNase H and IN activities.
Contains mutations within the coding region. Particularly preferred HIV-1 DNA pol
The construct is a DNA molecule containing at least one point mutation that modifies the active sites of the RT, RNase H and IN domains of Pol to at least substantially abolish each activity. Such HIV-1 Pol mutations will include at least one point mutation within or around each catalytic domain that results in RT, RNase H and IN activity, respectively. For this purpose,
A particularly preferred HIV-1 DNA pol construct is exemplified in the present invention, which gives an inactivated Pol protein without RP, RT, RNase or IN activity (IA Pol: SEQ ID NO: 4, FIGS. 2A-C). It contains 9 codon substitution mutations, in which case 3 such point mutations are present in each of the RT, RNase and IN catalytic domains. Thus, a particularly preferred example is the DNA molecule encoding IA-pol, which contains all 9 mutations shown in Table 1 below. Additional preferred amino acid residues for substitution are P
is Asp551 located in the RNase domain of ol. Any combination of the mutations disclosed herein may be suitable and is therefore suitable for the I of the present invention.
It can be used as a vaccine based on A-Pol. Although addition and deletion mutations are expected and within the scope of the invention, preferred mutations are point mutations that result in the substitution of a wild-type amino acid for another amino acid residue.

[0048]

[Table 1]

Point mutations are preferably incorporated into the IApol mutant vaccines of the present invention to reduce the possibility of altering epitopes within or around the active site of HIV-1 Pol.

To this end, SEQ ID NO: 3 discloses a nucleotide sequence encoding a codon-optimized pol containing the 9 mutations shown in Table 1, which is disclosed below and in the present invention: It is called "IApol".

[0051]

[Chemical 3]

To produce the IA-pol DNA vaccine construct, inactivation of enzyme function was performed by replacing all 9 active site residues from the enzyme subunit with alanine side chains. As shown in Table 1, all catalytic residues of the polymerase, including Asp112, Asp187 and Asp188, were replaced with alanine (Ala) residues (Larder et al., Nature 1987,
327: 716-717; Larder et al., 1989, Proc. Natl. A
cad. Sci. 1989, 86: 4803-4807). Three additional mutations were introduced into Asp445, Glu480 and Asp500 to abolish RNase H activity (Asp551 remained unchanged in this IA Pol construct), where each residue was , Each was replaced with an Ala residue (Dav
ies et al., 1991, Science 252 :, 88-95; Schatz et al., 1989, FEBS Lett. 257: 311-314; Mizurahi et al., 1990, Nucl. Acids. Res. 18: pp. 5359-5353
). HIV pol integrase function was abolished by three mutations in Asp626, Asp678 and Glu714. Again, each of these residues was replaced with an Ala residue (Wiskerchen et al 1995,
J. Virol. 69: 376-386; Leavitt et al., 1993, J. Am. B
iol. Chem. 268: 2113-2119). Amino acid residue Pro3 of SEQ ID NO: 4 represents the start site of the RT gene. The complete amino acid sequence of IA-Pol is disclosed herein as SEQ ID NO: 4 as follows.

[0053]

[Chemical 4]

As mentioned above, any combination of the above-disclosed mutations may be suitable and thus can be used as an IA-pol based vaccine according to the invention. For example, it may be possible to mutate only two of the three residues within the respective reverse transcriptase, RNase H and integrase coding regions, yet abolish these enzymatic activities. . However, above and SEQ ID NO: 3
The IA-pol construct disclosed as well as the expressed protein (SEQ ID NO: 4) are preferred. At least one in each of those three catalytic domains
It is also preferred that there are two mutations.

Another aspect of the invention is a eukaryotic trafficking signal peptide [eg, from tPA (tissue plasminogen activator)] or leader peptide (eg, an immunoglobulin leader peptide). HIV-1 Po, including those found within highly expressed mammalian proteins)
It relates to the production of 1-based vaccine constructs. Any functional leader peptide can be tested for efficacy. However, a preferred embodiment of the invention is to provide the HIV-1 Pol mutant vaccine constructs disclosed herein that also include a leader peptide, preferably a leader peptide derived from human tPA. That is, a codon-optimized HIV-1 Pol mutant, such as IA-Pol (SEQ ID NO: 4), may also contain a leader peptide at the amino-terminal portion of the protein, which is present in the host cell. Can affect the cellular trafficking of the expressed protein and thus its immunogenicity. As shown in FIGS. 1A-B for DNA vector V1Jns, a DNA vector that can be used to practice the invention has been modified by known recombinant DNA methods to contain a leader signal peptide of interest to provide the modifications of interest. It is possible that downstream cloning of the HIV-1 protein will provide a nucleotide sequence encoding the modified HIV-1 tPA / Pol protein. Alternatively, as described above, the insertion of the nucleotide sequence encoding the leader peptide may be performed by
l protein can be inserted into a DNA vector containing the open reading frame. Regardless of the cloning method, the final product is the modified HIV-1 Pol protein of interest (HIV-containing a leader peptide.
1 Pol protein, including, but not limited to) a nucleotide sequence encoding a vector sequence for effective gene expression. The amino acid sequence of the human tPA leader used in the present invention is as follows: MDAMKRGLCCVLLLCGAVFVSPSEI.
SS (SEQ ID NO: 28). Therefore, another aspect of the invention is to produce an HIV-1 Pol-based vaccine construct that includes a eukaryotic transport signal peptide (eg, from tPA). To this end, the present invention provides a DNA molecule encoding a codon optimized wt-pol DNA construct comprising:
It relates to a DNA molecule characterized in that the protease (PR) activity is deleted and a human tPA leader sequence is fused to the 5'end of the coding region. The DNA molecule encoding this protein is disclosed herein as SEQ ID NO: 5, and the open reading frame is disclosed herein as SEQ ID NO: 6.

To this end, the present invention provides a DNA molecule encoding a codon-optimized wt-pol DNA construct, wherein the protease (PR) activity is deleted and the human tPA leader sequence is of the coding region. It relates to a DNA molecule (referred to as "tPA-wt-pol" in the present invention) characterized by being fused to the 5'end. A DNA molecule encoding this protein is disclosed herein as SEQ ID NO: 5, and the open reading frame includes nucleotides 8-10.
From the start Met residue to the stop codon at nucleotides 2633-2635. SEQ ID NO: 5 is as follows.

[0057]

[Chemical 5]

The open reading frame of the wild type pol construct disclosed as SEQ ID NO: 5 contains 875 amino acids disclosed herein as SEQ ID NO: 6.

[0059]

[Chemical 6]

The present invention also includes codon-optimized HIV-1 Po, such as IA-Pol (SEQ ID NO: 4), which includes a leader peptide, such as the human tPA leader, in the amino terminal portion.
1. A codon-optimized HIV-1 Pol mutant, characterized in that the leader peptide can influence the cellular trafficking of the expressed protein in the host cell and thus its immunogenicity. Regarding Any such HIV-1 DNA pol mutant disclosed in the preceding paragraph is suitable for downstream fusion of a leader peptide that includes (but is not limited to) a human tPA leader sequence. Therefore, H based on any such leader peptide
The IV-1 pol mutant construct provides the RT, RNase and / or of the expressed protein to confer at least substantially reduced enzymatic activity on one or more of the RT, RNase H and / or IN functions of HIV-1 Pol. Alternatively, it may include, but is not limited to, a mutant DNA molecule that effectively modifies the catalytic activity of the IN region. In a preferred embodiment of this aspect of the invention, the leader peptide / HIV-1 DNA pol construct comprises RT, RNase H and IN.
It contains a mutation within the Pol coding region that effectively abolishes activity. A particularly preferred HIV-1 DNA pol construct has active site and catalytic activity within the RT, RNase H and IN domains of Pol to at least substantially abolish (preferably to completely abolish) each activity. A DNA molecule containing at least one modifying point mutation. Such HIV-1 Pol mutants will contain at least one point mutation within or around each catalytic domain that results in RT, RNase H and IN activity, respectively. Particularly preferred embodiments of this aspect of the invention include IA-comprising the 9 mutations shown in Table 1.
Human tPA leader fused to Pol protein. The DNA molecule is disclosed herein as SEQ ID NO: 7 and the expressed tPA-IA Pol protein comprises a fusion junction as shown in FIG. The complete amino acid sequence of the expressed protein is shown in SEQ ID NO: 8. To this end, SEQ ID NO: 7 is a nucleotide sequence encoding the human tPA leader fused to an IA Pol protein containing the 9 mutations shown in Table 1 (in the present invention "rPA-opt-IApo.
"l"). The open reading frame starts with Met
Beginning with (nucleotides 8-10), nucleotides 2633-2635 "TA
It ends with the "A" codon. The nucleotide sequence encoding tPA-IAPol is also disclosed as follows.

[0061]

[Chemical 7]

The open reading frame of the tPA-IA-pol construct disclosed as SEQ ID NO: 7 contains tPA-IA-Pol and 875 amino acids disclosed herein as SEQ ID NO: 8 as follows.

[0063]

[Chemical 8]

The present invention also relates to the substantially purified proteins expressed from the DNA polynucleotide vaccines of the present invention, in particular the purified proteins shown below as SEQ ID NOs: 2, 4, 6 and 8. These purified proteins may be useful as protein-based HIV vaccines.

The DNA backbone of the DNA vaccine of the present invention is preferably a DNA plasmid expression vector. DNA plasmid expression vectors are well known in the art and the DNA vector vaccine contains at least one promoter for transcription of RNA polymerase and a transcription terminator 3'to the HIV pol coding sequence. It can be composed of any such expression backbone. In one preferred embodiment, the promoter is Rous sarcoma virus (RSV) long terminal repeat (LTR), a strong transcriptional promoter. A more preferred promoter is the cytomegalovirus promoter containing the intron A sequence (CMV-intA). A preferred transcription terminator is the bovine growth hormone terminator. An antibiotic resistance marker is also preferably included in the expression vector to aid in large-scale production of the HIV pol DNA vector vaccine. The ampicillin resistance gene, neomycin resistance gene or any other pharmaceutically acceptable antibiotic resistance marker can be used. In a preferred embodiment of the invention said antibiotic resistance gene is
Encodes the gene product for neomycin resistance. Furthermore, in order to assist in the high level production of the drug by fermentation in prokaryotes, it is advantageous that the vector contains an origin of replication and is of high copy number. Any of a number of commercially available prokaryotic cloning vectors provide these advantages. In a preferred embodiment of the invention, these functions are provided by the commercially available vector known as pUC. It is desirable to remove non-essential DNA sequences.
Therefore, in one embodiment of the invention, pUC lacZ and la
Remove the cI coding sequence.

A DNA expression vector exemplifying (but not limited to) the present invention is P
CT international application number PCT / US94 / 02751, international publication number WO 94/2
1797, which are hereby incorporated by reference. The first DNA expression vector is the expression vector pnRSV in which Rous sarcoma virus (RSV) long terminal repeat (LTR) is used as a promoter.
Another embodiment relates to plasmid V1 which is a mutant pBR322 vector in which the CMV promoter and BGH transcription terminator have been cloned. Another embodiment for the DNA vector backbone is plasmid V1.
Regarding J. Plasmid V1J is derived from plasmid V1 and removes the promoter and transcription termination element to create a more defined environment (con).
Place them in the text) to obtain smaller vectors and improve plasmid purification yield. Thus, V1J also contains the CMVintA promoter and BGH transcription termination element that control the expression of the HIV pol-based genes disclosed herein. The V1J backbone is provided by pUC18. It is known to give high yields of plasmid, is well characterized by sequence and function, and has a minimal size. The entire lac operon was removed and the remaining plasmid was purified from an agarose electrophoresis gel, blunt-ended with T4 DNA polymerase, treated with calf intestinal alkaline phosphatase, and CMVin
It was linked to the tA / BGH element. In a preferred DNA expression vector, the ampicillin resistance gene is removed from V1J and replaced with the neomycin resistance gene to produce V1.
Get Jneo. A particularly preferred DNA expression vector is J1Jns, which is the same as V1J except that the unique Sfi1 restriction site has been engineered into a single Kpn1 site at position 2114 of V1J-neo. The frequency of Sfi1 sites in human genomic DNA is very low (about 1 site per 100,000 bases). Therefore, this vector allows careful monitoring of the integration of the expression vector into the host DNA by simple Sfi1 digestion of the extracted genomic DNA. Yet another preferred DNA expression vector for use as a backbone to the HIV-1 pol-based DNA vaccines of the present invention is V1R.
Is. In this vector, as much non-essential DNA as possible has been "trimmed" from the vector in order to obtain a very small vector. This vector is a derivative of V1Jns. This vector allows the use of larger inserts, reducing the risk of coding unwanted sequences and optimizing cellular uptake when constructs encoding specific influenza virus genes are introduced into surrounding tissues. Turn into. Specific DNA vectors of the present invention include V1, V1J (SEQ ID NO: 13), V1Jneo (SEQ ID NO: 14), V1Jn.
s (FIG. 1A, SEQ ID NO: 15), V1R (SEQ ID NO: 26) and any of the above vectors, wherein the nucleotide sequence encoding the leader peptide, preferably the human tPA leader, is shown in FIG. V1Jns-tpa
Including, but not limited to, directly fused downstream of the CMV-intA promoter.

The present invention particularly relates to a DNA vaccine, and a pharmaceutically active vaccine composition containing this DNA vaccine, and for immunization of a host (preferably a human host) against HIV infection or against existing HIV conditions, It relates to the use of prophylactic and / or therapeutic vaccines. These DNA vaccines contain HIV-1 Pol or biologically active Pol modifications or Pol, linked in a suitable DNA plasmid vector with or without a nucleotide sequence encoding a functional leader peptide. It is represented by a codon-optimized DNA molecule that encodes a fusion protein. The DNA vaccine of the present invention comprises DNA vectors V1, V1J (SEQ ID NO: 14), V1Jneo (SEQ ID NO: 15), V1Jns (FIG. 1A, SEQ ID NO: 16), V1R (SEQ ID NO: 26) and any of the above vectors (here And the nucleotide sequence encoding the leader peptide, preferably the human tPA leader, is directly downstream of the CMV-intA promoter, including (but not limited to) V1Jns-tpa shown in FIG. 1B and SEQ ID NO: 28. Fused to a codon-optimized DNA molecule encoding HIV-1 Pol or a biologically active Pol modification or Pol-containing fusion protein. To this end, the polynucleotide vaccine construct is V1Jns-wt.
pol and V1R-wtpol (including the DNA molecule encoding WT Pol described in SEQ ID NO: 2), V1Jns-tPA-WTTPol (including the DNA molecule encoding tPA Pol described in SEQ ID NO: 6), V1Jns-IAPol ( (Including a DNA molecule encoding IA Pol set forth in SEQ ID NO: 4) and V1Jn
s-tPA-IAPol (including the DNA molecule encoding tPA-IA Pol set forth in SEQ ID NO: 8). Polynucleotide vaccine construct V1R-wtp
ol, V1Jns-IAPol and V1Jns-tPA-IAPol are illustrated in Examples 3-5.

Upon review of the teachings herein, it will be apparent that numerous vector / Pol antigen constructs can be made. Although the exemplified constructs are preferred, a large number of vector / Pol antigen combinations are within the scope of the invention, in particular at least one, preferably 5 or more, and especially all 9 of the mutations shown in Table 1. , Wild-type or modified / inactivated Pol protein with or without the inclusion of a leader sequence, such as human tPA.

The DNA vector vaccine of the present invention can be formulated in any pharmaceutically effective formulation for host administration. Any such formulation can be, for example, a salt solution such as phosphate buffered saline (PBS). It would be useful to use pharmaceutically acceptable formulations that also provide long term stability of the DNA vector vaccines of the present invention. During storage as a medicinal substance, DNA plasmid vaccines undergo physiochemical changes that convert the supercoiled plasmid into open circular and linear forms.
Various storage conditions (low pH, high temperature, low ionic strength) can facilitate this process. Therefore, removal and / or chelation of trace metal ions from the DNA plasmid solution or from the formulation buffer or from the vials and sealed containers (
With succinic acid or malic acid or with chelating agents containing multiple phosphate ligands) stabilizes the DNA plasmid from this degradation pathway during storage. Also, non-reducing free-radical scavengers such as ethanol or glycerol are useful in preventing damage to the DNA plasmid from free-radical formation that can still occur even in apparently demetallated solutions. . In addition, the type of buffer in the formulation, pH, salt concentration, exposure to light, and the type of sterilization method used to prepare the vial can be controlled to optimize the stability of the DNA vaccine. Therefore, the formulation that yields the highest stability of the DNA vaccine should be a buffer having a pH in the range of 7-8 (
Phosphate (phosphate) or hydrogen carbonate (bicarbonate)), 100 to 2
Salts in the range of 00 mM (NaCl, KCl or LiCl), metal ion chelating agents (eg EDTA, diethylenetriaminepentaacetic acid (DTPA), malate,
Inositol hexaphosphate, tripolyphosphate or polyphosphoric acid),
Non-reducing free radical scavengers (eg ethanol, glycerol,
Methionine or dimethylsulfoxide) and a suitable maximum DNA concentration in a demetallation solution in a sterile glass vial packaged to protect nuclease-free highly purified DNA from light. .
Particularly preferred formulations that enhance the long term stability of the DNA vector vaccines of the invention are:
Tris-HCl buffer at a pH of about 8.0 to about 9.0; about 3% w / v ethanol or glycerol; EDTA or DT in a concentration range up to about 5 mM.
PA; and NaCl at a concentration of about 50 mM to about 500 mM. The use of such stabilized DNA vector vaccines and various alternatives to this preferred formulation range is described in PCT International Application No. PCT / US97 / 06655 and PCT International Publication No. WO 97/40839, both of which are incorporated herein by reference. Will be incorporated into the above).

Further, the DNA vector vaccine of the present invention can be formulated with an adjuvant capable of enhancing the immunogenicity of the DNA polynucleotide vaccine of the present invention.
Many of these adjuvants are known in the art and are available for use in DNA vaccines, including particle bombardment using DNA-coated gold beads,
D with plasmid DNA expressing cytokines, chemokines or costimulatory molecules
Including but not limited to co-administration of NA vaccines, cationic lipids or experimental adjuvants such as saponin, monophosphoryl lipid A or other compounds that enhance the immunogenicity of the DNA vaccine. Not something.
Another adjuvant for use in the DNA vector vaccines of the present invention is one or more forms of aluminum phosphate-based adjuvant (wherein the aluminum phosphate-based adjuvant is about 0.9 mole PO ₄ / (Having an Al ratio). Further mineral-based adjuvants can be obtained from one or more forms of calcium phosphate. These mineral-based adjuvants are useful in enhancing cellular and humoral responses to DNA vaccines. Compounds based on these minerals for use as DNA vaccine adjuvants are disclosed in PCT International Application No. PCT / US98 / 02414, PCT International Publication No. WO 98/35562, which is hereby incorporated by reference. Has been done. Another preferred adjuvant is a nonionic block copolymer that exhibits adjuvant activity with DNA vaccines. The basic structure includes a block of polyoxyethylene (POE) and polyoxypropylene (POP), for example, a POE-POP-POE block copolymer. Newma
n et al. (1998, Critical Reviews in Therapeu
tic Drug Carrier Systems 15 (2): 89-14
2) outlines a class of nonionic block copolymers that exhibit adjuvant activity. The basic structure includes a block of polyoxyethylene (POE) and polyoxypropylene (POP), for example, a POE-POP-POE block copolymer. Newman et al. (Ibid.) Reported that some POE-POP-POE block copolymers (ie, a central POP block having a molecular weight of about 9000 daltons to about 20,000 daltons and up to about 20% of the total molecular weight of the copolymer). It has been disclosed that higher molecular weight POE-POP-POE block copolymers containing adjacent POE blocks, including H. -POP-POE block copolymers are all US Reissue Patent No. 36,665, US Patent No. 5,567,859, US Patent No. 5,69, issued to Emanuel et al.
1,387, US Pat. No. 5,696,298 and US Pat. No. 5,990,
See also No. 241). WO 96/04932 also has higher molecular weight POEs which have surfactant properties and exhibit biological efficacy as vaccine adjuvants.
/ POP block copolymers are disclosed. The entire cited references within this paragraph are hereby incorporated by reference. Therefore, it is within the purview of those skilled in the art to utilize available adjuvants that can enhance the immune response of the polynucleotide vaccines of the invention as compared to administration of non-adjuvanted polynucleotide vaccines.

The DNA vector vaccine of the present invention is administered to the host by any means known in the art (eg, enteral and parenteral routes). These transportation routes are
Intramuscular injection, intraperitoneal injection, intravenous injection, inhalation or intranasal delivery, oral delivery, sublingual administration, subcutaneous administration, transdermal administration, transcutaneous (transcu)
Taneous administration, percutaneous administration or any form of particle shooting, eg biolostic device, eg "
The present invention includes, but is not limited to, by a “gene gun” or any needle-free injection device available. HI disclosed herein
Preferred methods of delivering V-1 Pol-based DNA vaccines are intramuscular injection, subcutaneous administration and needle-free injection. A particularly preferred method is intramuscular delivery.

The amount of expressible DNA to be introduced into the vaccine recipient will depend on the strength of the transcriptional and translational promoters used in the DNA vector, and the immunogenicity of the expressed gene product. Generally, an immunologically or prophylactically effective dose of about 1 μg to about 20 mg or more, preferably about 1 mg to about 5 mg is administered directly into muscle tissue. As mentioned above, subcutaneous injection, intracutaneous injection, press-in through the skin (impr
session) and other modes of administration such as intraperitoneal, intravenous, inhalation and oral delivery. Booster vaccination is based on Pol of the invention D
It is intended that this should be done in a manner that optimizes the overall immune response of the NA vector vaccine.

The polynucleotide, when introduced directly into a vertebrate in vivo, expresses the respective HIV-1 Pol protein in the animal, and the expressed Po.
Induces a cell-mediated immune response within the host to the 1 antigen. To this end, the invention also has a lower, for obtaining effective immune protection, or for preventing the establishment of HIV-1 infection after exposure to the HIV-1 virus, or with beneficial long-term consequences. It relates to a method of using the HIV-1 Pol-based polynucleotide vaccines of the invention as a therapeutic vaccine after HIV infection to mitigate acute HIV-1 infection so as to bring about the establishment of viral load. As mentioned above, the present invention provides methods of administering or using the DNA pol-based vaccines of the present invention using any of the known routes of introducing polynucleotides into living tissue to induce protein expression. Including.

Accordingly, the present invention is a method of using a DNA pol-based vaccine with various parameters disclosed herein and additional parameters known in the art, which are used in mammalian tissues. Introduced into these DNA
Provided is a method characterized by inducing intracellular expression of a pol-based vaccine. This intracellular expression of its Pol-based immunogens is associated with the existing HIV
-1 Induces a cellular immune response that provides a significant level of protection against infection or a future protection in presently uninfected hosts.

The following examples are provided to illustrate the invention, but not to limit the invention.

Example 1 Vaccine Vector V1: Vaccine vector V1 is pCMVIE-AKI-DHFR (Whang et al.,
1987, J. Virol. 61: 1796). The vector is Ec
The AKI and DHFR genes were removed by cutting with oRI and self-ligation. This vector does not contain intron A in the CMV promoter. Therefore, it was added as a PCR fragment with a deleted internal SacI site (Chapman et al., 1991, Nuc. Acids Res. 19:39.
No. 79 numbered 1855). The template used for the PCR reaction is hCM
PCMV6a1 containing V-IE1 enhancer / promoter and intron A
HindIII and N from 20 (Chapman et al., Ibid.)
The heI fragment was ligated into the HindIII and XbaI sites of pBL3 to create pCM
It was pCMVintA-Lux prepared by obtaining VIntBL. R
SV-Lux (de Wet et al., 1987, Mol. Cell Biol. 7:
725) 1881 base pair luciferase gene fragment (HindIII-
The SmaI Klenow fillin) was ligated into the Kalnow fillin (ie, buried) phosphatase treated pCMVIntBL within the SalI site. The primer extending to intron A is 5'primer: 5'-CTATATA.
AGCAGAGCTCGTTTTAG-3 ′ (SEQ ID NO: 10); 3 ′ primer:
5'-GTAGCAAAGATCTAAGGACGGTGACTGCAG-3 '
(SEQ ID NO: 11). The primer used to remove the SacI site was the sense primer: 5'-GTATGTGTCTGAAAATGAGC GT G.
GAGATTGGGCTCCGCAC-3 ′ (SEQ ID NO: 12) and antisense primer: 5′-GTGCGAGCCCAATCTCC AC GCTCATTTT
It is TCAGACACATAC-3 '(sequence number 13). The PCR fragment is Sa
It was cut with cI and Bal II and inserted into a vector cut with the same enzymes.

V1J: Remove the promoter and transcription termination elements from vector V1 to
Vaccine vector V1J was constructed in order to place it in a more restricted environment, obtain a smaller vector and improve plasmid purification yield. V1J is derived from the vectors V1 and pUC18 (a commercially available plasmid). V1
Was digested with SspI and EcoRI restriction enzymes to obtain two DNA fragments. C
The smaller of these fragments, containing the MVintA promoter and the bovine growth hormone (BGH) transcription termination element, which controls expression of heterologous genes, was purified from an agarose electrophoresis gel. The ends of this DNA fragment were then "blunted" using the T4 DNA polymerase enzyme to facilitate its ligation to another "blunt ended" DNA fragment. PUC18 was chosen to obtain the "backbone" of the expression vector. It is known to give high plasmid yields, is well characterized by sequence and function, and has a small size. The entire lac operon was removed from this vector by partial digestion with HaeII restriction enzyme. The remaining plasmid was purified from an agarose electrophoresis gel, blunt ended with T4 DNA polymerase, treated with calf intestinal alkaline phosphatase and ligated to the CMVintA / BGH element described above. Plasmids were obtained that exhibited either of two possible orientations of promoter elements within the pUC backbone. One of these plasmids gave a much higher DNA yield in E. coli and was designated V1J. The structure of this vector was confirmed by sequence analysis of the binding region and was then shown to confer a heterologous gene expression comparable to or higher than V1. The nucleotide sequence of V1J is as follows.

[0078]

[Chemical 9]

V1Jneo: Construction of vaccine vector V1Jneo expression vector involved removal of amp ^r gene and insertion of kan ^r gene (neomycin phosphotransferase). The amp ^r gene from the V1J pUC backbone was labeled with SspI.
And was removed by digestion with Eam1105I restriction enzyme. The remaining plasmid was purified by agarose gel electrophoresis, blunt ended with T4 DNA polymerase, and then treated with calf intestinal alkaline phosphatase. The commercially available kan ^r gene derived from transposon 903 and contained within the pUC4K plasmid was excised using PstI restriction enzyme, purified by agarose gel electrophoresis and blunt ended with T4 DNA polymerase. This fragment was ligated into the V1J backbone to induce plasmids with the kan ^r gene in either orientation, designated V1Jneo # 1 and 3. Each of these plasmids was confirmed by restriction enzyme digestion analysis, DNA sequencing of the binding region and was shown to give similar amounts of plasmid as V1J. Also, these V1
In the Jnep vector, the expression of the heterologous gene product was comparable to V1J. V1Jneo # 3 (contains the kan ^r gene in the same orientation as the amp ^r gene in V1J as an expression construct and confers resistance to neomycin, kanamycin and G418 (
Hereinafter referred to as V1Jneo). The nucleotide sequence of V1Jneo is as follows.

[0080]

[Chemical 10]

V1Jns: To facilitate integration studies, the expression vector V1Jns was created by adding an SfiI site to V1Jneo. A commercially available 13 base pair SfiI linker (New England BioLabs) was added to the KpnI site within the BGH sequence of the vector. V1Jneo was linearized with KpnI, gel purified, blunted with T4 DNA polymerase and ligated to the blunt SfiI linker. Clonal isolates were selected by restriction mapping and confirmed by sequencing over the linker. The new vector was named V1Jns. Expression of a heterologous gene in V1Jns (having SfiI) is V1Jneo
Comparing the expression of the same gene (with KpnI).

[0082]   The nucleotide sequence of V1Jns is as follows.

[0083]

[Chemical 11]

The underlined nucleotides in SEQ ID NO: 16 represent the Sfi1 site introduced within the Kpn1 site of V1Jneo.

V1Jns-tPA: The vaccine vector V1Jns-tPA was constructed in order to fuse the heterologous leader peptide sequence to the pol DNA constructs of the invention. More specifically, vaccine vector V1Jns was modified to include a human tissue-specific plasminogen activator (tPA) leader. Pol DN containing amino terminal leader sequence
As an illustration of the construction of the A construct, without any limitation thereto, plasmid V1Jneo was modified to contain a human tissue-specific plasminogen activator (tPA) leader. The two synthetic complementary oligomers were annealed and then ligated into BglII digested V1Jn. The sense and antisense oligomers are 5'-GATC ACCATGG ATGCAATGAAGAGAG
GGCTCTGCTGTGTGCTGCTGCTGTGTGGAGCAGCTCT
TCGTTTCGCCCAGCGA-3 '(SEQ ID NO: 17) and 5'-GAT
CTCGCTGGGGCGAAACGAAGACTGCTCCCACACAGCAG
CAGCACACAGCAGAGCCCTCTCTTCATTGCATCCAT
It was GGT-3 '(SEQ ID NO: 18). The Kozak sequence in the sense oligomer is underlined. These oligomers have overhanging bases adapted for ligation to the BglII cleaved sequence. After ligation, the upstream BglII site was destroyed, while the downstream BglII was retained for subsequent ligation. Both the binding site and the entire tPA leader sequence were confirmed by DNA sequencing. Also, V1
To adapt to Jns (= V1Jneo with SfiI site), KpnI
The sites were blunted with T4 DNA polymerase and then ligated with SfiI linker (catalog # 1138, New England Biolabs) to V1J.
By obtaining ns-tPA, the SfiI restriction site was transferred to B1 of V1Jneo-tPA.
It was placed at the KpnI site within the GH terminator region. This modification was confirmed by restriction digest and agarose gel electrophoresis. The V1Jns-tpa vector nucleotide sequence is as follows.

[0086]

[Chemical 12]

V1R: Minimal size vaccine vector (ie, containing no unnecessary DNA sequences,
In order to obtain the overall optimized heterologous gene expression characteristics conferred by V1J and V1Jns and high plasmid yield)
1R was constructed. (1) the region within the pUC backbone containing the E. coli origin of replication can be removed without affecting plasmid production from bacteria, (2) 3 of the kan ^r gene following the kanamycin open reading frame. The'region can be removed by inserting a bacterial terminator instead, and (3) ~ 300 bp from the 3'half of the BGH terminator (BG
It was confirmed that (after the original KpnI restriction enzyme site within the H element) could be removed without affecting its regulatory function. CMVintA promoter / BGH terminator, origin of replication and V1J corresponding to kanamycin resistance element, respectively
V1R was constructed by using PCR to synthesize three DNA segments from ns. The PCR oligomers were used to add the following unique restriction enzyme sites to each segment end in each segment: CMVi
SspI and XhoI for ntA / BGH; EcoRV and BamHI for kan ^r gene; and BclI and SalI for ori ^r . These enzymatic sites were chosen because they allow the unidirectional ligation of each of the PCR-derived DNA segments followed by the loss of each site. That is, EcoRV and SspI leave blunt-ended DNA suitable for ligation, while BamHI and BclI leave complementary overhangs as in SalI and XhoI. After obtaining these segments by PCR, each segment was digested with the appropriate restriction enzymes described above and then ligated together in a single reaction mixture containing all three DNA segments. 5 'end of the ori ^r is designed to contain normal T2 rho independent terminator sequence present in this region, it has to be granted termination information to the kanamycin resistance gene. The ligation product was confirmed by restriction enzyme digestion (more than 8 enzymes) and by DNA sequencing of the ligation junction. DNA plasmid yields and heterologous expression using viral genes within V1R appear to be similar to V1Jns. The resulting net reduction in vector size was 1346 bp (V1Jns = 4.86 kb; V1R = 3.52 kb). The PCR oligomer sequence used to synthesize V1R is as follows (restriction enzyme sites are underlined and restriction enzyme names are shown in brackets after the sequence): (1) 5 '-GGTACA AATTATT GGCTATTG
GCCATTGCATACG-3 ′ (SEQ ID NO: 19) [SspI]; (2) 5 ′
-CCACAT CTCGAG GAACCGGGTCAATTTCTCCAGCAC
C-3 '(SEQ ID NO: 20) [XhoI] (for CMVintA / BGH segment); (3) 5'-GGTACA GATATC GGAAAGCCACGTTGTG
TCTCAAAATC-3 ′ (SEQ ID NO: 21) [EcoRV]; (4) 5′-C
ACAT GGATCC GTAATGCTCTGCCAGTGTTACAACC-
3 '(SEQ ID NO: 2) [BamHI] (for kanamycin resistance gene segment);
(5) 5'-GGTACA TGATCA CGTAGAAAAGATCCAAAGG
ATCTTTTG-3 '(SEQ ID NO: 23) [BclI]; (6) 5'-CCA
CAT GTCGAC CCGTAAAAAGGCCGCGTTGCTGGG-3 '(
SEQ ID NO: 24): [SalI] (for E. coli origin of replication). The nucleotide sequence of vector V1R is as follows.

[0088]

[Chemical 13]

Example 2 Codon Optimized HIV-1 Pol and HI as DNA Vector Vaccines
V-1 IA Pol Derivatives Synthesis of WT-optol and IA-opt-pol genes: Both genes were constructed according to established methods, Midland Certify.
d Reagent Company (Midland, TX). Double-stranded oligonucleotides ranging from 159 to 340 bases in length containing the entire pol gene were synthesized by the solid phase method and cloned separately into pUC18. The wt-
In the case of the pol gene, the fragment is: BglII # 1-Ecl136II half site (position 282) = pJS6A1-7
. PmlI half site # 285-Ecl136II half site # 597 = pJS6
B2-5. SspI half site # 600-Ecl136II half site # 866 = PJS6
C1-4. SmaI half site # 869-ApaI # 1095 = pJS6D1-4. ApaI # 1095-KpnI # 1296 = pJS6E1-4. KpanI # 1296-XcmI # 1636 = pJS6F1-5. XcmI # 1636-NsiI # 1847 = pJS6G1-2. NsiI # 1847-BacI half site # 2174 = pJS6H1-14. BclI half site # 2174-SacI # 2333 = pJS6I1-2. SacI # 2333-BglII # 2577 = pJS6J1-1. EcoRI and HindIII sequences were added upstream of each 5'end and downstream of each 3'end, respectively, to allow cloning of pUC18 into the EcoRI-HindIII site.

The next step in the synthesis was to combine these cassettes into three approximately equal fragments (alpha, beta, gamma), which were performed as follows.

Alpha: The SspI-HindIII small fragment of pJS6C1-4 was transformed into E of pJS6B2-5.
Introduced into the cl136II-HindIII site to obtain pJS6BC1-1. In the EcoRI-PmlI site of this plasmid, Eco of pJS6A1-7.
The RI-Ecl136II small fragment was inserted to obtain pJS6α1-8.

Beta: The small EcoRI-ApaI fragment of pJS6D1-4 was inserted into the corresponding site of pJS6E1-2, resulting in pJS6DE1-2. In addition, Eco of pJS6F1-5
The RI-XcmI small fragment was inserted into the corresponding site of pJS6G1-2 to generate pJS6F.
G1-1 was obtained. Then, a small EcoRI-KpnI fragment of pJS6DE1-2 was inserted into the corresponding site of pJS6FG1-1 to obtain pJS6β1-1.

Gamma: The SacI-HindIII small fragment of pJS6J1-1 was inserted into the corresponding site of pJS6I1-2, resulting in pJS6IJ1-1. This plasmid was cloned into E. coli SCS110 (d) to allow subsequent cleavage at the BclI site.
Am − / dcm −). Bc of the unmethylated pJS6IJ1-1
lII-HindIII small fragment was added to BglII-HindI of pJS6H1-14.
It was inserted into the II site to obtain pJS6χ1-1.

The wt-pol alpha, beta, gamma were linked to the entire sequence as follows. The EcoRI-Ecl136II small fragment of pJS6α1-8 was added to pJS6β1-1.
Was inserted into the EcoRI-SmaI site of pJS6αβ2-1. Within the NsiI-HindIII site of this plasmid, Ns of pJS6χ1-1
The iI-HindIII small fragment was inserted to obtain pUC18-wt-pol. This final plasmid was completely resequenced on both strands.

To construct the entire IA-pol gene, only three new small fragments were synthesized. PmlI half site # 285-Ecl136II half site = pJS7B1-1
. KpnI # 1296-XcmI # 1636 = pJS7F1-2. NsiI # 1847-BglII half site # 2174 = pJS7H1-5. These were then used in the same reconstruction method as above to generate pUC18-IA-p
I got ol.

Construction of Expression Vector: To isolate the fragment containing the entire pol gene, pUC18-wt-pol
And pUC18-IA-pol were digested with BglII. V1R, V1Jns
, V1Jns-tpa (Shiver et al., 1995, Immuno response).
nsses to HIV gp120 elicited by DNA va
ccination. In Vaccines 95 (Chanock, RM
． , Brown, F .; Ginsberg, H .; S. , & Norrby, E .; Ed.), Pp. 95-98; Cold Spring Harbpr Labora
tory Press, Cold Spring Harbor, New Yo
rk; see also Example 1) was digested with BglII. The cut vector was then treated with calf intestinal alkaline phosphatase. Both wt-pol and IA-pol genes were ligated into the truncated V1R using T4 DNA ligase (16 ° C., overnight). Competent DH5α cells were transformed with an aliquot of the ligation mixture. Colonies were screened by restriction digest of amplified plasmid isolates. According to a similar method, BglII containing the IA-pol
The fragment was subcloned into the BglII site of V1Jns. The IA-pol
The IA-pol gene was PCR amplified from V1R-IA-pol using pfu polymerase and the following primer pair to ligate the gene into V1Jns-tpa: 5′-GGTACAAGATCTCCGCCCCCATCT.
CCCCCATTGGAGA-3 '(SEQ ID NO: 26), and 5'-CCACAT
AGATCTGCCCGGGCTTTAGTCTCCATC-3 ′ (SEQ ID NO: 2
7). The upstream primer was designed such that the start met codon was removed and the pol gene was placed in frame with the tpa leader coding sequence from V1Jns-tpa. The PCR products were purified from agarose gel slabs using a Sigma DNA Purification centrifugation column. Bg of the purified product
It was digested with II and subcloned into the BglII site of V1Jns-tpa.

Results: The codon humanized wt- and IA-pol genes contain 10 synthetic dsDNAs.
Constructed by stepwise ligation of fragments (Ferretti et al., 1986, Proc
． Natl. Acad. Sci. USA 83: 599-603). For expression in mammalian systems, the IA-pol gene was cloned into V1R, V1Jns and V1Jn.
Subcloned into s-tpa. All these vectors use the gene for the human cytomegalovirus / intron A hybrid promoter (hCM
VIA). The DNA sequence of the IA-pol gene and the expressed protein product are shown in Figures 2A-B. Subcloning into V1Jns-tpa involves ligation of the leader sequence from human tissue-specific plasminogen activator (tpa) to the N-terminus of the IA-pol (Penica et al., 1983,
Nature 301: 214-221), allowing secretion of the protein.
The sequences of the tpa leader and the fusion junction are shown in Figure 3.

Example 3 HIV-1 POL Vaccine-Rodent Studies Materials: E. coli DH5α strain, penicillin, streptomycin, AC
K cell lysis buffer, Hepes, L-glutamine, RPM1640 and ultrapure CsCl were obtained from Gibco / BRL (Grand Island, NY). Fetal bovine serum (FBS) was purchased from Hyclone. Kanamycin, T
ween 20, bovine serum albumin, hydrogen peroxide (30%), concentrated sulfuric acid, β-mercaptoethanol (β-ME) and concanavalin A were added to Sigma (St.
Louis, MO). 4 to 6-week-old female balb / c mice were subjected to Tac
Obtained from onic Farms (Germantown, NY). 0.3 m
L insulin syringe was purchased from Myoderm. 96-well flat bottom Max
Isorp plates were obtained from NUNC (Rochester, NY). H
IV-1 _IIIB RT p66 recombinant protein was added to Advanced Bio
technologies, Inc. (Columbia, MD). The 20-mer peptide is derived from Research Genetics (Huntsvi).
Ile, AL). Horseradish Peroxidase (HR
P) conjugated rabbit anti-mouse IgG1 was added to ZYMED (San Francisco,
Obtained from CA). 1,2-phenylenediamine dihydrochloric acid (OPD) tablets for DA
Obtained from KO (Norway). Purified rat anti-mouse IFN-gamma (IgG1, clone R4-6A2), biotin conjugated rat anti-mouse IFN-gamma (IgG1, clone XMG1.2) and streptavidin-alkaline phosphatase conjugate were added to PharMingen (San Diego, CA). Purchased from. 1-STEP NBT / BCIP dyes with Pierce Chemi
Obtained from cals (Rockford, IL). 96-well Multisc
Reen membrane plates were purchased from Millipore (France). Replace the cell strainer with Becton-Dickinson (Franklin Lakes,
NJ).

Plasmid preparation: E. coli DH5α cells expressing the pol plasmid were treated with 10
Grow to saturation in LB broth supplemented with 0 ug / mL kanamycin. The plasmid was purified by standard CsCl method, 5 mg / until further use
Solubilized in saline at concentrations greater than mL.

Vaccination: The plasmid was prepared in phosphate buffered saline and administered by bolus / c intramuscular square in balb / c by needle injection (50-1 / 2G insulin syringe) in 50 uL aliquots. V1Jns-IApol was administered at a dose of 0.3, 3, 30 ug, and V1Jns-tpa-IApol was administered at a dose of 30 ug for comparison. T = 0
And T = 8 weeks of immunization (relative to selected animals from the 30 ug dose cohort).

ELISA assay: At T = 12 weeks, blood samples were collected by dissecting the tail vein and the sera were separated. Anti-RT titers were obtained according to a standard secondary antibody-based ELISA. Briefly, Maxisorp plates were coated by overnight incubation with 100 ul of 1 ug / mL HIV-1 RT protein in PBS. The plate was washed with PBS / 0.05% Tween 20
200 ul / well blocking solution (PBS / 0.05% tween / 1
% BSA) for about 2 hours. The blocking solution was decanted. A 100 uL aliquot of serially diluted serum sample was added per well,
Incubated at room temperature for 2 hours. Wash the plate, 100 uL 1/10
00 diluted HRP rabbit anti-mouse IgG was added with 1 hour incubation. The plate was washed thoroughly and immersed in 100 uL of OPD / H ₂ O solution for 15 minutes. The reaction was quenched by adding 100 uL of 0.5 MH ₂ SO ₄ / well. The OD ₄₉₂ reading was recorded.

[0102]   ELIspot:   Spleens were collected from 5 mice / cohort at T = 13-14 weeks and 8 mL R1
0 medium (RPM1640, 10% FBS, 2 mM L-glutamine, 100 U
/ ML penicillin, 100u / mL streptomycin, 10mM Hep
es, 50 uM β-ME) in a tube. Multiscreen
100 μl / well of capture mAb (5 μg / ml in PBS)
Coated with purified R4-6A2) diluted to 4 ° C. overnight. Hood the plate
Wash with PBS / Pen / Strep in 200 μl / well complete R10 medium
Blocked at 37 ° C for at least 2 hours in the field. Steel mesh of the mouse spleen
Grind above, collect in a 15 ml tube and centrifuge at 1200 rpm for 10 minutes
did. In the pellet ACK buffer (4 ml / spleen cell lysis buffer),
Red blood cells were lysed by treatment at room temperature for 5 minutes. The cell pellet was treated as above.
Cell suspension, resuspended in K-medium (5 ml / mouse spleen), and cell strainer
Filtered and counted using a hemocytometer. Blocking medium from the plate
Decant and 100 μ / well cell sample (5.0 × 10e5 cells / well
) + Antigen was added. Two previously identified epitope-containing peptides (aa6
41-660, aa731-750), and used for Pol-specific CD4. ⁺ The cells were stimulated. Four peptide epitope-containing peptides (aa201-22
0, aa311-330, aa571-aa590, aa781-800).
Antigen-specific CD8⁺The cells were stimulated. Four
A final concentration of ug / mL / peptide was used. Mitogen Concanavalin
Each splenocyte sample was tested for IFN-gamma secretion by adding A
. Plate at 37 ° C, 5% CO_TwoAnd incubated for 20-24 hours. The
Wash rate with PBS / 0.05% Tween 20, 100 uL / well
5 ug / mL biotin-conjugated rat anti-mouse IFN-mAb (clone XMG
It was immersed in 1.2) at 4 ° C. overnight. The plate is washed and 100 uL / well of 1 /
Streptavidin-AP at 2500 dilution (PBS / 0.005% Twee
Dipping in n / 5% FCS) at 37 ° C for 30 minutes. After washing, 100 μl / well
Incubation with 1-step NBT / BCIP for 6-10 minutes
To develop the spot. The plate was washed with water and air dried.
The number of spots in each well was measured using a dissecting microscope and 10⁶For cells
And normalized.

[0103]   result:   Single vaccination of balb / c mice with V1Jns-IApol was antigenic
Can induce specific antibody (Figure 4) and T cell (Figure 5) responses in a dose-responsive manner
It was Noh. CD4⁺And CD8⁺Peptides containing T-cell epitopes
IFN gamma from splenocytes from 3 and 30 ug cohorts after stimulation with
Secretion can be detected. These epitopes include (1) 10 including the entire pol sequence.
A 20-mer peptide that overlaps with an amino acid was added to the IFN
By screening for the ability to stimulate human secretion, and (2)
Depleting either population in the Elispot assay to T cell type (CD4 ⁺ Or CD8⁺) Was determined. T to the pool gene
The addition of the pa leader sequence has a comparable frequency of pol-specific C if not slightly higher.
D4⁺And CD8⁺Can induce cells. V1Jns-IApol and V1J
A second immunization with either ns-tpa-IApol was effective against the immune response.
A boost was produced.

Example 4 HIV-1 Pol Vaccine-Study in Non-human Primates Materials: E. coli DH5α strain, penicillin, streptomycin and ultrapure CsCl were obtained from Gibco / BRL (Grand Island, NY). . Kanamycin and phytohemagglutinin (PHA-M) were treated with Sigma.
a (St. Louis, MO). The 20-mer peptide is SynPe
p (Dublin, CA) and Research Genetics (Hun
tsville, AL). 96-well Multiscreen
Membrane plates were purchased from Millipore (France). Streptavidin-alkaline phosphatase conjugate was added to Pharmingen (San Di
ego, CA). 1-Step NBT / BCIP dye is Pier
Ce Chemicals (Rockford, IL). R & d rat anti-human IFN-gamma mAb and biotin conjugated anti-human IFN-gamma reagent.
Obtained from D Systems (Minneapolis, MN). Dyna
Beads M-450 anti-human CD4 was obtained from Dynal (Norway). The HIV p24 antigen assay was tested by Coulter Corporation (M
ami, FL). The HIVI _IIIB RT p66 recombinant protein was purchased from Advanced Biotechnologies, Inc. (Col
Umbia, MD). Plastic 8-well strips / plates, flat bottom, Maxisorp were obtained from NUNC (Rochester, NY). HIV + Human Serum 9711234 Biological Special
ty Corp. Obtained from.

Plasmid preparation: E. coli DH5α cells expressing the pol plasmid were treated with 10
Grow to saturation in LB supplemented with 0 ug / mL kanamycin. The plasmid was purified by standard CsCl method and solubilized in saline at concentrations greater than 5 mg / mL until further use.

Vaccination: A cohort of 3 rhesus monkeys (approximately 5-10 kg) was dosed with a dose of 5 mg of V1Jns.
Vaccinated with -IApol or V1Jns-tpa-IApol. The vaccine was administered by needle injection of two 0.5 mL aliquots of 5 mg / mL plasmid solution (phosphate buffered saline, pH 7.2) into both deltoids.
Prior to vaccination, the monkeys were treated with 10 mg / kg ketamine i.v. m. Chemically restrained by injection. The animals were immunized three times at 4-week intervals (T = 0, 4, 8 weeks).

Sample Collection: Blood was collected at T = 0, 4, 8, 12, 16, 18 weeks and serum and PBMC were isolated using established protocols.

ELIspot Assay: Immobilon-IP plates at 100 uL / well of rat anti-human IF.
Coated with N-gamma mAb at 15 ug / mL at 4 ° C overnight. The plate is then washed with PBS and blocked by the addition of 200 uL / well R10 medium. 4 × 10e5 peripheral blood cells were plated per well. Each well contained either medium or one of the pol peptide pools (4 per peptide
final concentration of ug / mL) or a known mitogen PHA in a final volume of 100
Add up to uL. Prepare duplicate wells per sample per antigen and duplicate at 37 ° C.
The stimulation was performed for 0 to 24 hours. The plate was then washed and biotinylated anti-human IFN-gamma reagent was added (0.1 ug / mL, 100 uL / well), 4
Incubate overnight at ° C. Again, the plate was washed and 100 uL of the 1: 2500 dilution of the streptavidin-alkaline phosphatase reagent (PB
S / 0.005% Tween / 5% FCS) and incubate for 2 hours at ambient room temperature. After washing once again, 100 uL / well of one step (1
-Step) Develop spots by incubating with NBT / BCIP for 6-10 minutes. Dynabeads M450 pre-washed with PBS
Add 1 bead particle per 10 cells of anti-human CD4 and
CD4-T cell depletion was performed by incubating at 30 ° C. for 30 minutes.
The beads are magnetically fractionated, unbound cells are collected, quantified and then plated on ELISpot assay plates (4 x 10e5 cells / well).

CTL Assay: The method for establishing bulk CTL cultures on fresh or cryopreserved peripheral blood mononuclear cells (PBMC) is as follows. 0.5 ml to 20% total PBMC
Of the recombinant vaccine virus, Vac-tpaPol, at a multiplicity of infection (moi) of 5 for 1 hour at 37 ° C., respectively, and then combined with the remaining PBMC samples. The cells were washed once in 10 ml R-10 medium and plated at approximately 5-10 x 10 < ⁶ > cells / well in 4 ml R-10 medium in 12-well plates. Recombinant human IL-7 was added to the culture at a concentration of 330 U / ml. Two
Or after 3 days, R-10 (1 containing recombinant human IL-2 (100 U / ml)
ml) was added to each well. Then, twice a week, 2 ml of the culture medium was added to the rh
The medium was replaced with 2 ml of fresh R-10 medium containing IL-2 (100 U / ml).
The lymphocytes in the presence of 5% CO _2, and cultured for about 2 weeks at 37 ° C., were used in cytotoxicity assays as described below. Effector cells harvested from bulk CTL cultures were tested against a peptide pool-sensitized autologous B lymphoid cell line (BLCL). To prepare the peptide-sensitized target, the BLCL cells were subjected to R-
Washed once with 10 media, counted and pulsed with peptide pool (concentration of about 4-8 μg / ml for each peptide) in a volume of 1 ml overnight. Mock targets were prepared by pulsing the cells with DMSO diluent without peptide to match the DMSO concentration in the peptide-pulsed target. next morning,
The cells were counted and 1 × 10 ⁶ cells were resuspended in 0.5 ml R-10 medium. 5-10 μl of Na ⁵¹ CrO ₄ was added simultaneously to the tube and the cells were added to 3
Incubated at 7 ° C for 1-2 hours. The cells were then washed 3 times and resuspended at 5 × 10 ⁴ cells / ml (in R-10 medium) used as target cells. The cultured lymphocytes with target cells at the effector: target (E: T) ratios shown were 9
Plate in triplicate in a 6-well plate, 37 ° C in the presence of 5% CO _2.
And incubated for 4 hours. A sample of 30 μl of supernatant from each well of the cell mixture was taken from Lumaplate-96 (Packard Instrument).
, Meriden, CT) and the plates were allowed to air dry overnight. The amount of ⁵¹ Cr in the wells was measured by β-particle release using a plate counter from Packard Instrument. The percentage of specific cell lysis was calculated using the formula:% specific cell lysis = (ES) / (MS). The symbol E represents the mean cpm released from target cells in the presence of effector cells, S is the spontaneous cpm released in the presence of medium alone, M is the presence of 2% Triton X-100. Maximum cpm released below.

ELISA assay: Pol-specific antibodies in the monkey were measured in a competitive RT EIA assay. In this case, the activity of the sample is measured by the ability to block the RT antigen from binding to the coat antibody on the plate wells. Briefly, Maxisorp
Plates were coated with saturating amounts of pol positive human serum (9711234). Two
50 uL of each sample was added to 15 uL of 266 ng / mL RT recombinant protein (
RCM 563, 1% BSA, 0.1% tween, 0.1% NaN ₃ ) and 20 uL of cell lysis buffer (Coulter p24 antigen assay kit) are incubated for 15 minutes at room temperature. A similar mixture is prepared using negative controls and standard serially diluted samples that define maximum RT binding. 20
0 uL / well of each sample and standard was added to the wash plate and the plate was incubated at room temperature for 16-24 hours. Combine RT with Coulter p2
Quantified according to the method described in the 4-antigen assay kit and expressed in milliMerck units / mL arbitrarily defined by the selected standard.

Results: Repeated vaccination with V1Jns-IApol resulted in 1 out of 3 monkeys (94R).
033) induced significant levels of antigen-specific T cell activation (FIGS. 6A-C and Table 2) and CTL killing of peptide-pulsed autologous cells (FIGS. 7A-B).
Peptide stimulation of CD4-depleted PBMCs in the ELIspot assay confirmed a significant CD8 + component to the T cell response in this animal (Table 2).
.

Immunization with V1Jns-tpa-IApol resulted in T cell responses from all three vaccines (FIGS. 6A-C, FIGS. 7A-B; Table 2). 2 pieces (920078, 9
4R028) showed bulk CTL activity and a detectable CD8 + component as measured by Elispot analysis of CD4-depleted PBMCs. Third monkey (920
In 073), activated T cells were predominantly CD4 + (Table 2). Table 3 shows V
Shows time course data on the frequency of IFN-gamma secreting cells (SFC per million cells) upon antigen-specific stimulation of monkeys vaccinated three times with 1Jns-IApol or V1Jns-tpa-IApol (5 mg dose). . T
= At the 18th week, CD4 cell depletion was performed. Values shown are for fractionated cells 100
The number of spots per million is not corrected for the resulting CD8 + T cell enrichment. IA pol protein (mpo-1, mpol-2) or w
P in the peptide pool corresponding to t Pol (wtpol-1, wtpol-2)
BMC was stimulated.

[0113]

[Table 2]

For the Elispot assay, antigen-specific stimulation was performed by using a pool of 20mer peptide pools based on the vaccine sequence. The vaccine p
The ol sequence differs from the wild-type HIV-1 sequence by 9 point mutations, thereby affecting 16 of the 20-mer peptides of the pool. A comparable response was observed in the vaccine when these peptides were replaced with those using the wild type sequence.

Four of the vaccines gave anti-RT titers above background after three doses of the plasmid (Table 2).

[0116]

[Table 3]

[0117]   Example 5   Effect of codon optimization on in vivo expression of wt-pol and cellular immune response
Fruit   Materials and methods:   Extraction of virus-derived pol gene:   RT-IN gene (wt-pol; directly derived from the HIV IIIB genome)
Derived non-codon optimized wild type pol gene) and extracted two primers: 5
'-CAG GCG AGA TCT ACC ATG GCC CCC AT
TAGC CCT ATT GAG ACT GTA-3 '(SEQ ID NO: 29)
And 5'-CAG GCG AGA TCT GCC CGG GCT TT
A ATC CTC ATC CTG TCT ACT TGC CAC-3 '
(SEQ ID NO: 30) (containing the BglII site) was used to
Amplified from Nome. The reaction was performed with 10 mM KCl, 10 mM (NH_Four)_TwoSO _Four , 20 mM Tris-HCl (pH 8.75), 2 mM MgSO_Four, 0.
1% Triton X-100, 0.1 mg / ml bovine serum albumin (BS
200 nmol of each primer in A), 2.5 U of pfu Turbo DN
A polymerase (Stratagene, La Jolla, CA), 0.2 m
It contained M individual dNTPs and the template DNA. The heating cycle conditions are as follows
Were: 20 cycles of 95 ° C for 1 minute, 56 ° C for 1 minute and 72 cycles.
20 cycles of 4 minutes at 72 ° C (15 minutes cap formation at 72 ° C). Digested P
The CR fragment was treated with the expression plasmid V1Jns (Shive) according to the same method as described above.
r et al., 1995, Immuno responses to HIV to g.
p120 elicited by DNA vacation. In
Chanock, R.M. M. , Brown, F .; Ginsberg, H .; S. Oh
And Norrby, E .; (Edit) Vaccines 95. Cold Spring
g Harbor Laboratory Press, Cold Spring
g Harbor, New York, pp 95-98; Example 1 herein.
(See also)) in the BglII site. Then the connection mixture
The mixture was used to transform competent E. coli DH5 cells.
, Screened by PCR amplification of individual colonies. The whole gene inserter
The sequence of the gut was confirmed. All plasmid constructs for immunization of animals with CsCl
Method (Sambrook et al., 1989, Fritsch and Maniatis,
T. (Ed) Molecular cloning: a laboratory
manual. Cold Spring Harbor Laboratory
  Purified by Press, Cold Spring Harbor).

In Vitro Expression in Mammalian Cells: 1.5 × 10 ⁶ 293 cells, 1 using the Cell Phect kit
Or 10 μg of V1R-wt-pol (codon optimized) and V1Jns-w
Transfection with t-pol (derived from virus), 37 ° C., 5% CO ₂ , 9
Incubated for 48 hours at 0% humidity. Prepare supernatant and cell lysate and use Pierce Protein Assay reagent (Rockford, IL)
Was used to assay for protein content. Aliquots containing equal amounts of total protein were loaded on a 10-20% Tris glycine gel (Novex, San Diego, CA) with appropriate molecular weight markers. 1: 1
000 diluted seropositive patients (Scripts Clinic, San Di
anti-serum from Ego, CA) was used to detect the pol product, 1: 2000
Diluted goat anti-human IgG-HRP (Bethyl, Montgomery, TX
) And a standard ECL reagent kit (Pharmacia LKB Biote).
The band was developed using chnology, Uppsala, Sweden).

Ultrasensitive RT activity assay of pol constructs: RT activity from codon optimized wt-pol and IA pol plasmids was tested.
Perkin Elmer 7700, Taqman technology (Arnold et al., 1
999, One-step fluorescent probe produ
ct-enhanced reverse transcriptase as
say. In McClelland, M .; Pardee, A .; (Edit). Exp
region genetics: accelerated and high
h-throughput methods. Biotechniques B
books, Natick, MA, pp. 201-210)
t-Enhanced Reverse Transcriptase (PER
T) Analyzed by assay. Background levels of this assay were measured using a 1: 100,000 dilution of lysate from mock (chemical treatment only; no vector) transfected 293 cells. This background range is 0 chosen from the mean of 13.80 +/- 3 standard deviations (sd = 14.16).
． Set as RT / reaction tube of 00-56.28. Any individual value above 56.28 would be considered positive for the PERT assay.
Cell lysates were similarly prepared for the following samples: mock transfection with empty V1Jns vector, no vector control, V1Jns-tpa-p.
transfection with ol (codon optimized), and V1Jns-IApo
Transfection with l (codon optimized). Samples were serially diluted 1: 100,000 in PERT buffer and 24 duplicates for each sample at this dilution were assayed for RT activity.

Optimization and Immunization of Rodents with Virus-Derived Pol Plasmids: To compare the immunogenicity of wt-pol (codon optimized) and virus-derived pol genes, a cohort of BALB / c mice ( N = 10) 1 μg, 10 μg
And V1R-wt-pol (codon optimized) and V1J at a dose of 100 μg
Vaccinated with ns-wt-pol plasmid (virus derived). Five weeks after the administration of dose 1, 5 out of 10 mice per cohort were boosted with the same dose of the plasmid to which they were initially administered. In all cases, the vaccine was treated with 6 mM sodium phosphate, 150 mM sodium chloride (pH 7.2)
Suspended or dissolved in a 0.3 mL insulin syringe with 28-1 / 2G needle (Becton-Dickinson, Franklin Lakes, NJ)
The entire dose was injected into both square muscles in 50 μM aliquots using.

Anti-RT ELISA Anti-RT titers were obtained by standard secondary antibody-based ELISA. 100 μL of 1 μg / mL HIV-1 RT protein (Advanced) in PBS
Maxisorp plates (NUNC Roches) by overnight incubation with Biotechnologies, Columbia, MD).
ter, NY). The plate was mounted on a Titertek MAP device (
PBS / 0.05% Tween 2 using Hunstville, AL)
Wash with 0, 200 μL / well blocking solution (PBS / 0.05% t
Incubated with ween / 1% BSA) for about 2 hours. The blocking solution was decanted and 100 μL aliquots of serially diluted serum samples were added per well and incubated for 2 hours at room temperature. A 100-fold initial dilution was performed, followed by a 4-fold serial dilution. The plate was washed and 100 μL of 1/1000 diluted HRP rabbit anti-mouse IgG (ZYMED, San Francisco, C.
A) was added with incubation for 1 hour. Wash the plate thoroughly,
00 μL 1,2-phenylenediamine dihydrochloride / hydrogen peroxide (DAKO, No
rway) solution for 15 minutes. 100 μL 0.5 MH ₂ S per well
The reaction was quenched by adding O ₄ . Tit with S20 stacker
An ertek Multiskan MCC / 340 was used to record the OD ₄₉₂ readings. The endpoint titer was defined as the highest serum dilution that gave an absorbance value of 0.1 OD ₄₉₂ (2.5 times the background value) or higher.

ELIspot Assay: Antigen-specific INFλ secreting cells from mouse spleen were tested for ELIspot assay (
Miyahira et al., 1995, Quantification of ant.
igen specific CD8 ⁺ T cells using ELIS
POT assay. J. Immunol. Methods 1995,181
, 45-54). Typically, spleens were collected from 3-5 / cohort of mice and 8 mL of complete RPMI medium (RPMI1640, 10% FBS.
, 2 mM L-glutamine, 100 U / mL penicillin, 100 u / mL streptomycin, 10 mM Hepes, 50 uM β-ME). Multiscreen opaque plate (Millipore,
France) at 100 μL / well in PBS at 5 μg / mL purified rat anti-mouse IFN-γ IgG1, clone R4-6A2 (Pharmingen,
San Diego, CA) at 4 ° C overnight. The plates were washed with PBS / penicillin / streptomycin in the hood and blocked with 200 μL / well complete RPMI medium at 37 ° C. for at least 2 hours.
The mouse spleen was crushed on steel mesh and collected in a 15 ml tube,
Centrifuge for 10 minutes at 0 rpm. The pellet was added to 4 mL ACK buffer (G
red blood cells were lysed by treatment with ibco / BRL) for 5 minutes at room temperature. The cell pellet was centrifuged as above and complete RPMI medium (5 ml / mouse spleen).
Resuspended in, filtered through a cell strainer and counted using a hemocytometer. Blocking medium was decanted from the plate and to each well was added 100 μL of cell sample (5 × 10 ⁵ cells / well) and 100 μL of the antigen solution. To the control wells, 100 μL of the medium was added and peptide pools containing CD4 ⁺ or CD8 ⁺ epitopes were added for specific response. In all cases a final concentration of 4 μg / mL per peptide was used. Each sample / antigen mixture was run in triplicate wells. The plates were incubated at 37 ° C., 5% CO ₂ , 90% humidity for 20-24 hours. Plate the plate with PBS / 0.05% Tw
washed with een 20 and 100 μL / well of 1.25 μg / mL biotin conjugated rat anti-mouse IFN-γ mAb, clone XMG1.2 (Pharming).
en) and incubated overnight at 4 ° C. The plate is washed and PBS / 0
． 1/2500 of 100 μL / well in 005% Tween / 5% FBS
Diluted streptavidin-alkaline phosphatase conjugate (Pharmin
gen) and incubated at 37 ° C. for 30 minutes. After washing, 100 μl / well of one step (1-step) NBT / BCIP (Pierce Chemical)
Spots were developed by incubation with als) for 6-10 minutes. The plate was washed with water and air dried. The number of spots in each well was measured using a dissecting microscope and the data was normalized to an input of 10 ⁶ cells.

Results: In vitro expression of Pol in mammalian cells: The optimized wt or IA pol gene (V1R-wt-p in 293 cells.
ol (codon optimization), V1Jns-IApol (codon optimization), V1Jns
-Tpa-IApol (codon-optimized)) heterologous expression (Fig. 8) was detected in the RT-IN.
A single polypeptide of the correct approximate molecular size (90-kDa) for the fusion product was given. In contrast, 1 and 10 giving pol from the virus
No expression could be detected when cells were transfected with μg of V1Jns-wt-pol.

Ultrasensitive RT assay of cells transfected with Pol constructs: Table 4 shows mock (vector only) controls, IApol (codon optimized) and w.
Polymerase activity levels from the t-pol plasmid (codon optimized) are summarized. The results show that wild type POL-transfected cells contained RT activity about 4-5 log higher than the baseline value of 293 cells alone. Mock-transfected cells contained activity below the baseline value. It was also found that RT activity from opt-IApol transfected cells did not differ from baseline values. None of the individual reaction tubes gave RT activity above the established cut-off value of 56.

[0125]

[Table 4]

Comparison of optimization and immunogenicity of virus-derived pol plasmids: To compare the in vivo efficacy of both constructs, BALB / c mice (N = 1.
0 / group) were vaccinated with increasing doses (1,10,100 μg) of V1Jns-wt-pol (virus derived) or V1R-wt-pol (codon optimized). Five weeks after the administration of dose 1, 5 out of 10 animals were randomly boosted with the same vaccine and dose they received initially. FIG. 9 shows the geometric mean titers of the BALB / c cohort measured 2 weeks after boosting. No significant anti-RT titers can be observed from animals immunized with 1 or 2 doses of the wt-pol plasmid (virus-derived). In contrast, animals vaccinated with the humanized gene constructs gave cohort anti-RT titers (> 1000) significantly above background levels at doses above 10 ug. 10 and 100u
The response observed with the g dose of V1R-wt-pol (codon optimized) was enhanced about 10-fold by the second immunization, reaching titers as high as 10 ⁶ . Spleens from all mice in each of the cohorts were collected and analyzed for IFN-γ secretion after stimulation with a mixture of CD4 + peptide epitopes or CD8 + peptide epitopes. The result is shown in FIG. All wt-pol vaccines showed no significant cellular response above the background control. In contrast, strong antigen-stimulated IFN-γ secretion was observed in a dose-responsive manner from animals vaccinated with 1 or 2 doses of 10 μg or more of the wt-pol (codon optimized) construct. .

The scope of the invention is not limited to the particular embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description. Such modifications are intended to fall within the scope of the claims.

[Sequence list]

[Brief description of drawings]

FIG. 1A shows a schematic of the DNA vaccine expression vector V1Jns (A) used for HIV-1 pol and HIV-1 modified pol constructs.

FIG. 1B shows a schematic diagram of the DNA vaccine expression vector V1Jns-tPA (B) used for HIV-1 pol and HIV-1 modified pol constructs.

2A-C depict the nucleotide (SEQ ID NO: 3) and amino acid sequence (SEQ ID NO: 4) of IA-Pol.

2A-C depict the nucleotide (SEQ ID NO: 3) and amino acid sequence (SEQ ID NO: 4) of IA-Pol.

2A-C depict the nucleotide (SEQ ID NO: 3) and amino acid sequence (SEQ ID NO: 4) of IA-Pol.

FIG. 3 shows the codon-optimized nucleotide and amino acid sequences (included within SEQ ID NOS: 7 and 8, respectively) through the fusion junction of tPA-IA-Pol. With lower line portion represents the NH ₂ -terminal region of the IA-Pol.

FIG. 4 shows 1 or 2 doses of codon optimized V1Jns-IApol and V1J.
Production of humoral response from mice immunized with ns-tpa-IApol (anti-RT
(Measured as the geometric mean of endpoint titers).

FIG. 5: Increasing single dose codon optimized V1Jns-IApol or 30 ug.
CD of splenocytes (pool of 5 spleens / cohort) from control mice vaccinated with codon-optimized V1Jns-tpa-IApol (13 weeks after dose 1 administration) of
4 ⁺ (aa641-660, aa731-750) or CD8 ⁺ (aa201
-220, aa311-330, aa571-590, aa781-800) shows the number of IFNγ secreting cells per 10 ⁶ cells after stimulation with a pool of specific peptides.

FIG. 6A shows 5 mg of codon-optimized HIV-1 Pol expression plasmid three times (
T = 0, 4, 8 weeks) ELIspot of peripheral blood cells collected from immunized rhesus monkeys
Show analysis. Two pools of 20-mer peptides derived from the vaccine sequence (mp
o-1, aa1-420; mpol-2, aa411-805) was added to stimulate antigen-specific IFNγ secretion. (A) V1Jns-IApo
3 monkeys vaccinated with 1 (Tag No. 94R008, 94R013
, 94R033) as a function of time for spot forming cells (SFC). Values shown are corrected for background response without peptide restimulation.

FIG. 6B shows 5 mg of codon-optimized HIV-1 Pol expression plasmid three times (
T = 0, 4, 8 weeks) ELIspot of peripheral blood cells collected from immunized rhesus monkeys
Show analysis. (B) Frequency of spot forming cells (SFC) as a function of time for 3 monkeys (Tag No. 920078, 920073, 94R028) vaccinated with 5 mg of V1Jns-tpa-IApol.

FIG. 6C shows 5 mg of codon-optimized HIV-1 Pol expression plasmid three times (
T = 0, 4, 8 weeks) ELIspot of peripheral blood cells collected from immunized rhesus monkeys
Show analysis. (C) E from a monkey (920072) who has not received any immunity
The LIspot response was also measured.

FIG. 7A shows codon optimized V1Jns-IA 8 weeks after the third vaccination.
10 shows bulk CTL killing from rhesus monkeys immunized with pol.

FIG. 7B shows codon optimized V1Jns-tp 8 weeks after the third vaccination.
Figure 7 shows bulk CTL killing from rhesus macaques immunized with a-IApol.

FIG. 8 shows detection of in vitro pol expression from cell lysates of 293 cells transfected with 10 ug of various pol constructs.

FIG. 9 shows 1 dose (white circles) or 2 doses (black circles) of 1, 10, 100 μg V1.
Shown are the geometric mean anti-RT titers (GMT) and standard error of the geometric means for a cohort of 5 mice dosed with R-wt-pol (codon optimized) or V1Jns-wt-pol.

FIG. 10 shows various doses of wt-po, one dose (pd1) or two doses (pd2).
1 shows the cellular immune response in BALB / c mice vaccinated (im) with 1 (virus derived) or wt-pol (codon optimized) plasmids.

─────────────────────────────────────────────────── ─── Continued front page    (81) Designated countries EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, I T, LU, MC, NL, PT, SE, TR), OA (BF , BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, G M, KE, LS, MW, MZ, SD, SL, SZ, TZ , UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AE, AG, AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, B Z, CA, CH, CN, CR, CU, CZ, DE, DK , DM, DZ, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, J P, KE, KG, KR, KZ, LC, LK, LR, LS , LT, LU, LV, MA, MD, MG, MK, MN, MW, MX, MZ, NO, NZ, PL, PT, RO, R U, SD, SE, SG, SI, SK, SL, TJ, TM , TR, TT, TZ, UA, UG, US, UZ, VN, YU, ZA, ZW (72) Inventor Perry, Helen Sea             United States, New Jersey             07065-0907, Lowway, East Re             Nkan Avenyu 126 (72) Inventors Casimiro and Danilo Earl             United States, New Jersey             07065-0907, Lowway, East Re             Nkan Avenyu 126 (72) Inventor Fu, Dong-min             United States, New Jersey             07065-0907, Lowway, East Re             Nkan Avenyu 126 F-term (reference) 4B024 AA01 BA35 CA03 DA03 EA04                 4C084 AA07 AA13 NA14 ZB332                       ZC552                 4C085 AA03 BA69 BB23                 4H045 AA10 AA30 BA10 CA05 EA22                       EA31 EA34 FA74

Claims (17)

[Claims] 1. A pharmaceutically acceptable DNA comprising (a) a DNA expression vector and (b) a DNA molecule containing a codon-optimized open reading frame encoding a Pol protein or an inactivated Pol derivative thereof. A vaccine composition, wherein the Pol protein or inactivated Pol derivative is expressed when the DNA vaccine is administered to a host, and the HIV-
1. A DNA vaccine composition characterized by eliciting a cellular immune response against infection. 2. The DNA vaccine according to claim 1, wherein the DNA molecule encodes wild-type Pol. 3. The DNA vaccine of claim 2, wherein the DNA molecule comprises the nucleotide sequence set forth in SEQ ID NO: 1. 4. The DNA according to claim 3, which is V1Jns-wt-pol.
vaccine. 5. The DNA vaccine according to claim 1, wherein the DNA molecule contains a nucleotide sequence encoding a human tissue plasminogen activator leader peptide and encodes an inactivated Pol derivative. 6. The DNA vaccine of claim 5, wherein the DNA molecule comprises the nucleotide sequence set forth in SEQ ID NO: 5. 7. The DNA vaccine according to claim 6, which is V1Jns-tPA-wt-pol. 8. The inactivated Pol protein has a substantial reverse transcriptase activity, R
The inactivated Pol protein contains at least one amino acid modification within each region of the Pol protein that results in reverse transcription activity, RNase H activity and integrase activity, such that it does not exhibit Nase H activity and integrase activity. To do
The DNA vaccine according to claim 1. 9. The DNA vaccine of claim 8, wherein the DNA molecule comprises the nucleotide sequence set forth in SEQ ID NO: 3. 10. The DNA according to claim 9, which is V1Jns-IAPol.
vaccine. 11. The DNA vaccine according to claim 8, wherein the DNA molecule contains a nucleotide sequence encoding a human tissue plasminogen activator leader peptide and encodes an inactivated Pol derivative. 12. The DNA vaccine of claim 11, wherein the DNA molecule comprises the nucleotide sequence set forth in SEQ ID NO: 7. 13. The DNA vaccine according to claim 7, which is V1Jns-tPA-IAPol. 14. A DNA molecule containing a codon-optimized open reading frame encoding a Pol protein or an inactivated Pol derivative thereof, and DN.
A method for inducing an immune response against an infection or disease caused by a virulent strain of HIV comprising administering into a tissue of a mammalian host a pharmaceutically acceptable DNA vaccine composition comprising an A expression vector. When the DNA vaccine is administered to the vertebrate host, the Pol protein or inactivated Po
A method wherein the 1 derivative is expressed and elicits the immune response. 15. The method of claim 16, wherein the mammalian host is human. 16. The DNA vaccine comprises V1Jns-WTpol, V1Jn
s-tPA-WTol, V1Jns-IAPol and V1Jns-tPA-
18. The method of claim 17, selected from the group consisting of IAPol. 17. A substantially purified protein comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 6 and SEQ ID NO: 8.