JP2003519462A - Regulatory DNA sequence of the human catalytic telomerase subunit gene, diagnostic and therapeutic uses thereof - Google Patents

Abstract

(57) SUMMARY The present invention relates to a regulatory DNA sequence comprising a promoter sequence for a human catalytic telomerase subunit gene in addition to the intervening sequence for that gene. The invention further relates to the use of said DNA sequences for pharmacological, diagnostic and therapeutic purposes, especially in the treatment of cancer and aging.

Description

Detailed Description of the Invention

Structure and Function of Chromosomal Ends The genetic material of eukaryotic cells is distributed on linear chromosomes. The ends of the genetic unit are called telomeres, which are derived from the Greek words talos (terminal) and meros (partial, segment). Most telomeres are composed of short sequence repeats consisting mainly of thymidine and guanine (Zak).
ian, 1995). In vertebrates that have been investigated so far, telomeres are all made up of the sequence TTAGGG (Meyne et al., 1989).

Telomeres have a wide variety of important functions. These prevent fusion of chromosomes (
McClintock, 1941), and thus avoids the formation of dicentric genetic units. Such chromosomes, which have two centromeres, can lead to the development of cancer due to loss of heterozygosity or replication, or loss of genes.

In addition, telomeres also serve the purpose of distinguishing between damaged and intact genetic units. Therefore, yeast cells stop cell division when they contain telomere-free chromosomes (Sandell and Zakian, 1993).

Telomeres also play another important role in the replication of eukaryotic cell DNA. In contrast to the prokaryotic circular genome, eukaryotic linear chromosomes are not completely replicated by the DNA polymerase complex. RNA primers are required to initiate DNA replication. After removal of the RNA primer, extension of the Okazaki fragment, and subsequent ligation, the newly synthesized DNA strand lacks the 5'end because the RNA primer cannot replace DNA at that point. Thus, without special protective mechanisms, chromosomes shrink at each cell division (the "end replication problem"; Harley et al., 1990). The non-coding telomeric sequences are probably building a buffer region to avoid gene loss (Sandell and Zakian, 1993).

In addition to this, telomeres also play an important role in regulating cell senescence (Olovnikov, 1973). Human somatic cells display a limited capacity for replication in culture; after a certain period of time somatic cells enter senescence. In this state, cells no longer divide, even after stimulation with growth factors; however, such cells do not die and remain metabolically active (Goldstein, 1990). Various findings support the hypothesis that cells determine how many more divisions they can make based on their telomere length (Alls
opp et al., 1992).

Taken together, therefore telomeres have a major function in cellular senescence, as well as genetic material stabilization and cancer prevention.

Telomerase, an enzyme that synthesizes telomeres As described above, an organism having a linear chromosome only incompletely replicates its own genome in the absence of a special protective mechanism. Most eukaryotes use a special enzyme, telomerase, to regenerate telomeric sequences. Telomerase is constitutively expressed in the single cell organisms investigated to date. On the other hand, telomerase activity was only measured in human germ cells and tumor cells, while nearby body tissues did not contain telomerase at all (Kim et al., 1994).
.

Telomerase can also be functionally referred to as terminal telomere transferase, which is located in the cell nucleus as a multiprotein complex. While the RNA portion of human telomerase has been known for a relatively long time (Feng et al., 1995), the catalytic subunits of this group of enzymes have recently been identified in a wide variety of organisms (Lingne.
r et al., 1997; our PCT / EP98 / 03468, which is also pending). These catalytic subunits of telomerase show significant homology both between them and in comparison to all previously known reverse transcriptases.

WO98 / 14592 also describes the nucleic acid and amino acid sequences of catalytic telomerase subunits.

[0010]   Activation of telomerase in human tumors   In humans, it was initially possible to demonstrate telomerase activity only in germ cells,
Telomerase activity was not demonstrated in normal somatic cells (Hastie et al., 199).
0; Kim et al., 1994). With the development of more sensitive detection methods (Kim et al.,
1994), low telomerase activity was also detected in hematopoietic cells (Brocco).
Li et al., 1995; Counter et al., 1995; Hiyama et al., 1995).
. However, these cells may nevertheless exhibit telomere shrinkage.
Is true (Vaziri et al., 1994; Counter et al., 1995).
Is Enzyme Level in These Cells Insufficient to Complement Telomere Loss?
, Or the measured telomerase activity is, for example, incompletely differentiated CD34 ⁺ 38⁺Whether it comes from a subpopulation such as precursor cells has not been resolved (
Hiyama et al., 1995). To solve this, telomers within a single cell
It is necessary to detect the zeal activity.

Interestingly, however, significant telomerase activity was detected in numerous tumor tissues examined so far (1734/2031, 85%; Shay, 19
97) On the other hand, no activity was detected in normal body tissues (1/196, <
1%, Shay, 1997). In addition, various researchers have shown that telomeres shrink even in senescent cells transformed with viral oncoproteins, and that telomerase can be detected only in a subpopulation that survives growth crisis. Shown (Counter et al., 1992)
. Telomeres were stable in immortalized cells (Counter et al., 199).
2). Similar findings from studies in mice (Blasco et al., 1996) showed that
Supports the hypothesis that telomerase reactivation is a late phenomenon of tumorigenesis.

Based on these results, the “telomerase hypothesis” has been created that links the loss of telomere sequences and cellular aging with telomerase activity and the development of cancer. In long-lived species such as humans, telomere shrinkage can be viewed as a mechanism for controlling tumors. Differentiated cells that do not contain any telomerase arrest cell division with a characteristic telomere length. When these cells mutate, they can only form tumors if they can extend their telomeres. Otherwise, the cell will continue to lose telomere sequences until the chromosome becomes unstable and eventually destroyed. Telomerase reactivation is probably the major mechanism used by tumor cells to stabilize telomeres.

From these findings and considerations, it follows that the treatment of tumors is made possible by the inhibition of telomerase. Conventional cancer treatments using cytostatics or shortwave radiation damage not only tumor cells but all dividing cells in the body. However, apart from tumor cells, only germ line cells contain significant telomerase activity, so that telomerase inhibitors will attack tumor cells more specifically and, as a result, will induce less undesired side effects. Telomerase activity has been detected in all tumor tissues investigated to date, meaning that these therapeutic agents can be used for all types of cancer. The effects of telomerase inhibitors therefore begin to appear when the cell's telomeres have shrunk to the point of genomic instability. Tumor cells usually have shorter telomeres than normal somatic cells, so cancer cells will be the first to be cleared by telomerase inhibitors. In contrast, cells with long telomeres, such as germ cells, are only damaged much later. As a result, telomerase inhibitors represent a potentially advanced method in the treatment of cancer.

Once the manner in which the expression of the telomerase gene is regulated has been identified, it becomes possible to get a clear answer to the question of the nature and point of attack of physiological telomerase inhibitors.

Regulation of Gene Expression in Eukaryotes In eukaryotic gene expression, the cellular flow of information from DNA to protein via RNA, there are numerous points at which regulatory mechanisms can exert their effects. .
Examples of discrete control steps are gene amplification, locus recombination, chromatin structure, DNA methylation, transcription, mRNA post-transcriptional modification, mRNA transport, protein translation and post-translational modification. Studies carried out to date show that regulation at the level of transcription initiation is of paramount importance (Latchman, 1991).

The region that is responsible for the regulation of transcription and is designated as the promoter region is RNA
It is located immediately upstream of the start of transcription of the gene transcribed by Polymerase II. Comparison of the nucleotide sequences of the promoter region from a number of known genes shows that a special sequence motif always occurs in this region. These elements include, among others, the TATA box, CCAAT box, and GC box, which are recognized by specific proteins. The TATA box located approximately 30 nucleotides upstream from the start of transcription is, for example, the TFIID subunit TBP (“
While being recognized by the TATA box binding protein "), the transcription factor Sp1 (" specificity protein 1 ") specifically binds to a particular high GC sequence segment.

Promoters can be functionally subdivided into regulatory and constitutive segments (Latchman, 1991). This constitutive control region contains a so-called core promoter that correctly initiates transcription. This promoter contains sequence elements described as UPE (upstream promoter element), which are essential for efficient transcription. Regulatory control segments that can be combined with UPE have sequence elements that can be involved in signal-dependent regulation of transcription by hormones, growth factors and the like. These sequence elements confer tissue-specific or cell-specific promoter properties.

DNA segments that are capable of affecting gene expression over relatively long distances are a characteristic feature of eukaryotic genes. These elements can be located upstream or downstream of the transcriptional structural unit, or within the structural unit, and can perform their respective functions regardless of their orientation. These sequence segments may enhance (enhancer) or reduce (silencer) promoter activity. Enhancers and silencers also provide a number of binding sites for transcription factors in a manner similar to the promoter region.

The present invention relates to the DNA sequence from the 5 ′ flanking region of the gene for the catalytically active human telomerase subunit and the intron sequence of this gene.

The present invention specifically relates to a 5 ′ flanking regulatory DNA sequence comprising the promoter DNA sequence of the gene for the human catalytic telomerase subunit set forth in FIG. 10 (SEQ ID NO: 3).

The present invention further relates to a partial region of the 5 ′ flanking regulatory DNA sequence shown in FIG. 4 (SEQ ID NO: 1) having a regulatory effect.

Intron sequences of the gene for the human catalytic telomerase subunit, especially sequences having a regulatory effect, are also part of the subject of the invention. The intron sequence according to the present invention is described in detail in the content of Example 5 (SEQ ID NO: 4, 5, 6, 7, 8,
9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, and 2
0).

The invention further relates to a recombinant construct comprising a DNA sequence according to the invention, in particular the 5 ′ flanking DNA sequence of the gene for the human catalytic telomerase subunit, or a partial region thereof.

The recombinant construct comprises, in addition to the DNA sequence according to the invention, in particular the 5 ′ flanking DNA sequence of the gene for the human catalytic telomerase subunit or a subregion thereof, one or more additional DNA coding for a polypeptide or protein. It is also preferred to include sequences.

According to a particularly preferred embodiment, these additional DNA sequences code for antineoplastic proteins.

Particularly preferred are anti-neoplastic proteins that directly or indirectly inhibit angiogenesis. Examples of these proteins are: Plasminogen activator inhibitor (PAI-1), PAI-2, PAI-3,
Angiostatin, endostatin, platelet factor 4, TIMP-1, TIMP-
2, TIMP-3, and leukemia inhibitory factor (LIF).

Anti-neoplastic proteins which have a direct or indirect cytostatic effect on tumors are likewise particularly preferred. These proteins are specifically: perforin, granzyme, IL-2, IL-4, IL-12, eg IF.
Interferons such as N-α, INF-β, and IFN-γ, TNF, T
NF-α, TNF-β, oncostatin M; tumor suppressor genes such as p53, retinoblastoma.

Furthermore, anti-neoplastic proteins which, in addition to their anti-neoplastic effect, stimulate inflammation when appropriate and thereby contribute to the elimination of tumor cells are particularly preferred. Examples of such proteins are: PANTES, monocyte migration and activator (MCAF), IL-8, macrophage inflammatory protein (MIP-1α, -β), neutrophil activating protein-2 (NAP).
-2), IL-3, IL-5, human leukemia inhibitory factor (LIF), IL-7, IL
-11, IL-13, GM-CSF, G-CSF, and M-CSF.

Furthermore, anti-neoplastic proteins, which are able to convert the precursor of the anti-neoplastic active compound into the anti-neoplastic active compound for action as an enzyme, are particularly preferred. Examples of these enzymes: herpes simplex virus thymidine kinase, varicella - zoster virus thymidine kinase, bacterial nitroreductase, bacterial β- glucuronidase, plant β- glucuronidase from Sekare Kereare (Secale cereale), human glucuronidase, human Carboxypeptidase, bacterial carboxypeptidase, bacterial β-lactamase, bacterial cytosine deaminase, human catalase and / or phosphatase, human alkaline phosphatase, type 5 acid phosphatase, human lysooxidase, human acid D-aminooxidase, human glutathione peroxidase , Human eosinophil peroxidase, and human thyroid peroxidase.

The recombinant constructs described above may further comprise a DNA sequence encoding Factor VIII or Factor IX, or a subfragment thereof. Such DNA sequences also include other blood coagulation factors.

The recombinant constructs described above can further include a DNA sequence encoding a reporter protein. Examples of such reporter proteins are: chloramphenicol acetyltransferase (CAT), firefly luciferase (LUC), β-galactosidase (β-Gal), secreted alkaline phosphatase (SEAP), human growth hormone (hGH), β. -Glucuronidase (GUS), green fluorescent protein (GFP), and all variants derived from them, aquarin and obelin.

Recombinant constructs according to the invention are further oriented in DNA encoding the human catalytic telomerase subunit and variants thereof and in an antisense orientation.
ation) fragments. If appropriate, these constructs may further comprise other protein subunits of human telomerase and an antisense-oriented telomerase RNA component.

In addition to the DNA and fragments encoding the human catalytic telomerase subunit and variants thereof, such recombinant constructs may also include other protein subunits of human telomerase and telomerase RNA components.

The present invention relates to a vector comprising a DNA sequence as described above according to the invention, in particular a 5'flank DNA sequence, as well as one or more other DNA sequences as described above.

Preferred vectors for these constructs include, for example, retrovirus, adenovirus, adeno-associated virus, herpes simplex virus, vaccinia virus, lentiviral virus, Sindbis virus, and semliki (
Semiki) viruses such as forest fever virus.

[0036]   It is also preferable to use a plasmid as the vector.

The invention further relates to pharmaceutical preparations comprising the recombinant constructs or vectors according to the invention; for example preparations in colloidal dispersions.

[0038]   Examples of suitable colloidal dispersions are liposomes or polylysine ligands.

The preparation of the constructs or vectors according to the invention in colloidal dispersion can be supplemented with a ligand that binds to the membrane structure of tumor cells. Such a ligand can, for example, be linked to the construct or vector or otherwise be a component of the liposome structure.

Suitable ligands are specifically polyclonal or monoclonal antibodies, or antibody fragments thereof which bind to the membrane structure of tumor cells by variable domains, or substances with terminal mannose, cytokines or growth factors, or on tumor cells Those fragments or partial sequences that bind to the receptor.

Examples of corresponding membrane structures are eg IL-1, EGF, PDGF, VEGF, TG
Fβ, cytokines or growth factors such as insulin or insulin-like growth factor (ILGF), or eg SLeX, LFA-1, MAC-1, L
It is a receptor for adhesion molecules such as ECAM-1 or VLA-4, or a mannose-6-phosphate receptor.

The present invention comprises a pharmaceutical preparation which, in addition to the vector construct according to the invention, may also contain non-toxic, inert pharmaceutically suitable excipients. Administering these preparations to the site of a tumor (for example, intravenous administration, intraarterial administration, intramuscular administration, subcutaneous administration, intradermal administration, transanal administration, vaginal administration, nasal administration, transdermal administration, Intraperitoneal administration, administration as an aerosol, or oral administration), or their systemic administration can be envisioned.

[0043]   The vector construct according to the invention can be used in gene therapy.

The present invention further relates to recombinant host cells, in particular recombinant eukaryotic host cells, which harbor the constructs or vectors described above.

The present invention further relates to a method for identifying a substance that affects the promoter activity, silencer activity, or enhancer activity of a catalytic telomerase subunit, which method comprises the following: A regulatory DNA sequence according to the invention, in particular the 5 ′ flanking regulatory DNA sequence of a gene for the human catalytic telomerase subunit or a partial region thereof having a regulatory effect, which sequence or partial region is functionally linked to a reporter gene. A candidate substance is added to a host cell harboring a); Measuring the effect of the substance on the expression of the reporter gene.

This method can be used to identify substances that increase the promoter activity, silencer activity, or enhancer activity of catalytic telomerase subunits.

Furthermore, this method can be used to identify substances that inhibit the promoter activity, silencer activity, or enhancer activity of catalytic telomerase subunits.

The invention further relates to a method for identifying a DNA fragment according to the invention, in particular a factor which specifically binds to the 5 ′ flanking regulatory DNA sequence of the catalytic telomerase subunit. This method involves screening an expressed cDNA library using the previously described DNA sequences or subfragments of widely varying lengths as probes.

The constructs or vectors described above can further be used to prepare transgenic animals.

The present invention further relates to a method for detecting a telomerase-related condition in a patient, which method comprises: A DNA sequence according to the invention, in particular a 5'flank-regulatory DNA sequence of a gene for the human catalytic telomerase subunit or a partial region thereof having a regulatory effect, and a construct or vector containing a reporter gene is incubated with a body fluid or a cell sample. Step B. Detecting the activity of the reporter gene to obtain a diagnostic value; and C. Comparing the diagnostic value with a standard value for a reporter gene construct in a normalized normal cell or body fluid of the same type as the test sample.

When a diagnostic value higher or lower than the standard comparison value is detected, it means a telomerase-related condition, ie a pathological condition.

[0052]

[Table 1]

[0053]

[Table 2]

[0054] Example A catalyst telomerase subunit relates located 5 'and 3' of the human gene (ghTC) and this gene region was cloned to determine the transcription initiation point on the other hand, a potential DNA binding protein The binding site was identified and the active promoter fragment was illuminated. The sequence of this hTC cDNA (Figure 6) was reported in our application PCT / EP98 / 03468, which is also pending. All data refer to the position of the cDNA in this sequence unless otherwise stated.

Example 1 Using Southern blot analysis of the genome, whether ghTC constitutes a single gene in the human genome, or whether the hTC gene and possibly also the ghTC
It was determined if there were several loci for the pseudogene.

For this purpose, a commercially available zoo blot from Clontech was subjected to Southern blot analysis. This blot contains 4 μg EcoRI digested genomic DNA from 9 different species (human, monkey, rat, mouse, dog, cow, rabbit, chicken, and yeast). With the exception of yeast, chicken, and human, DNA was isolated from kidney tissue. Human genomic DNA
Was isolated from placenta and chicken genomic DNA was purified from liver tissue. hT
C cDNA, mutant De12 (positions 1685-2349 and 253 in FIG. 6)
1-2590 [Deletion 2; see FIG. 8 of Example 5]), about 7
The 20 bp long hTC cDNA fragment was used as a radiolabeled probe in the autoradiogram of FIG. Experimental conditions for blot hybridization and wash steps were adapted from Ausubel et al. (1987).

In the case of human DNA, the probe recognizes two specific DNA fragments. About 1.
The smaller EcoRI fragment, 5-1.8 kb in length, probably results from two EcoRI cleavage sites in an intron within the ghTC DNA. Based on this result, it is hypothesized that only a single ghTC gene is present in this human genome.

Example 2 Human genomic placenta gene library (EMBL 3 SP6 / T7 from Clontech, order no. H to isolate the 5'flank hTC gene sequence)
About 1.5 × 10 ⁶ phages from L1067j) were nitrocellulose-filtered according to the manufacturer's instructions with a radiolabeled 5′-hTC cDNA fragment of about 500 bp in length (positions 839-1345 in FIG. 6). (0.45 μm; Sc
(from Hleicher and Schuell). This nitrocellulose filter was first treated at 42 ° C. for 2 hours with 2 × SSC (0.3M
NaCl; 0.5 M Tris-HCl, pH 8.0) and then pre-hybridization solution (50% formamide; 5 × SSPE, pH 7.4).
5 x Denhard's solution; 0.25%
SDS; 100 μg herring sperm DNA / ml). For pre-hybridization solution 1.5 times for overnight hybridization.
It was supplemented with × 10 ⁶ cpm of denatured radiolabeled probe / ml (solution). Non-specifically bound radioactive DNA is treated under stringent conditions, ie 2 × SSC; 0
． Removed by 3 wash steps of 1% SDS, 55-65 ° C for 5 minutes. These filters were evaluated by autoradiography.

The phage clones identified in this first study were purified (Ausubel et al. (1987)). Subsequent analysis showed that one phage clone, P1
There is a possibility that 2 is positive. A lambda DNA preparation was performed on this phage (Ausubel et al., (1987)) and subsequent restriction digestion with an enzyme that released the genomic insert as a fragment resulted in the phage clone containing an approximately 15 kb insert in the vector. Was shown (FIG. 2).

1 to 1.5 × 10 ⁶ in each case for the purpose of isolating the complete hTC gene sequence
Phages were screened in individual experiments with different radiolabeled probes as described previously in each case.

Phage clones identified in the first study and positive for the corresponding probe were purified. The phage clone P17 has an h of about 250 bp.
It was found to contain a TC cDNA fragment (positions 1787-2040 in FIG. 6).
). Phage clone P2 was identified as containing an hTC cDNA fragment of approximately 740 bp in length (positions 1685-2349 and 2531-2607 in Figure 6 [deletion 2; see Example 5]). 420b for phage clones P3 and P5
It was found to contain a p-length 3'hTC cDNA fragment (position 3 in Figure 6).
047-3470). After the lambda DNA was prepared from these phages and subsequently subjected to restriction digestion with the enzyme releasing the genomic insert as a fragment, these inserts were subcloned into a plasmid (Example 4).

Example 3 To investigate whether the 5'end of the hTC cDNA was also present in the insert of recombinant phage clone P12, λDNA from this clone was subjected to Southern blot analysis to determine the tip. Was hybridized with a radiolabeled hTC cDNA fragment of about 440 bp in length from the 5'region (Fig. 6, positions 1 to 440) (Fig. 3).

Since the isolated λ DNA from the positive clones hybridizes to the leading 5 ′ end of the hTC cDNA, this phage probably also contains a 5 ′ sequence region flanking the ATG start codon.

Example 4 For the purpose of subcloning the entire 15 kb insert in the positive phage clone P12 in the form of subfragments and subsequently sequencing these fragments, on the one hand EMBL3 Sp6 / T17 (Example Restriction endonucleases that release the entire insert from (see 2) and additionally cleave within this insert were chosen for the purpose of digesting their DNA.

In total, two XhoI subfragments of about 8.3 and about 6.5 kb in length, respectively, and three Sa of about 8.5, about 3.5, and about 3 kb, respectively.
The cI fragment was added to pBluescript KS (+) vector (Stratagen).
(from Company e). The 5123 bp 5'flank nucleotide sequence of the ghTC gene region starting at the ATG start codon was determined by analyzing the sequences of these fragments (Fig. 4; corresponding to SEQ ID NO: 1). Figure 4 shows the first 5123 bp (starting with the ATG start codon). Figure 10 shows the entire cloned 5'sequence (corresponding to SEQ ID NO: 3).

For the purpose of subcloning the total insert of approximately 14.6 kb in the phage clone P17 in the form of subfragments, on the one hand the whole insert from EMLB3 Sp6 / T7 was released and in addition it A restriction endonuclease that cuts several times within the insert was chosen for DNA digestion. 7.1 kb and 4.2, respectively
The three XhoI / BamHI fragments of size kb and 1.5 kb, and the single BamHI fragment of size 1.8 kb were digested with the enzymes XhoI and BamHI.
Subcloned by using combinatorial digestion with. The combined restriction digestion with the enzymes XhoI and XbaI resulted in a 6.5 kb size of XhoI / X.
The baI fragment and two XhoI fragments of sizes 6.5 kb and 1.5 kb were cloned respectively.

Approximately 17.9 kb within phage clone P2 using digestion with the restriction enzyme XhoI
Inserts of size were subcloned in the form of subfragments. In total, three XhoI subfragments were cloned, 7.5 kb, 6.4 kb, and 1.6 kb in length, respectively. Four SacI fragments of sizes 4.8 kb, 3 kb, 2 kb and 1.8 kb respectively were additionally subcloned by digestion with the restriction enzyme SacI.

The insert fragment of about 13.5 kb in phage clone P3 was digested with restriction enzyme S
Subcloned by digestion with acI and / or XhoI. In this regard, six SacI subfragments of lengths 3.2 kb, 2 kb, 0.9 kb, 0.8 kb, 0.65 kb and 0.5 kb respectively, and 6.5 kb and 4.3 kb respectively. Two XhoI subfragments were obtained.

The insert fragment having a size of about 13.2 kb in the phage clone P5 was digested with the restriction enzyme S.
Subcloned by digestion with acI and / or XhoI. In total, a SacI fragment of size 6.5 kb, 3.3 kb, 3.2 kb, 0.8 kb, and 0.3 kb, respectively, and a XhoI fragment of size 7 kb and 3.2 kb were subcloned.

For the purpose of cloning the hTC genomic sequence region located 3 ′ of phage clone P17 and 5 ′ of phage clone P2, three rounds of genomic walking were Clo.
ntech GenomeWalker ^™ Kit (Cat. No. K1803-1
) And various combinations of primers. For a final volume of 50 μl, 10 pmol of dNTP mix was added to 1 μl of human Genome Walk.
er Library HDL (from Clontech), and P
The CR reaction was performed using 1 × Klen Taq PCR reaction buffer and 1 × Advant.
Performed in age Klen Taq polymerase mix (from Clontech). 10 pmol of the internal gene-specific primer and 10 pmol of the adapter primer AP1 (5'-GTAATACGACTCACTATAGG.
GC-3 '; from Clontech) was added as a primer. This PC
R was performed as touchdown PCR in three steps. First, denaturation was performed at 94 ° C for 20 seconds, and then the primer was annealed and the DNA strand was extended at 72 ° C for 4 minutes, which was repeated 7 cycles. Thereafter, the DNA was denatured at 94 ° C. for 20 seconds, and the subsequent primer extension was carried out at 67 ° C. for 4 minutes for 37 cycles. Finally, it was followed by chain extension at 67 ° C. for 4 minutes. After this first PCR, the PCR product was diluted 1:50.
1 μl of this dilution was added to 10 pmoles dNTR and 1 × Advantage Klen Taq polymerase mix in 1 × Klen Taq PCR reaction buffer, plus an additional 10 pmoles of nested gene-specific primer, and 10 pmoles of nested Marathon Adopter primer AP2.
(5'-ACTATAGGGCACGCGTGGT-3 '; from Clontech) was used for the second nested PCR. The PCR conditions corresponded to the parameters selected in the first PCR. The only exception is the first PCR
Only 5 cycles were chosen instead of 7 cycles in the steps and only 24 cycles were performed in the second PCR step instead of 37 cycles. The product of this nested genomic walking PCR is TA Cloning Ve from InVitrogen.
It was cloned into ctor pCRII.

In the first genome walk, gene-specific primer C3K2-GSP1 (5′-GA
CGTGGCTCTTGAAGGCCTTG-3 ′) and a nested gene-specific primer C3K2-GSP2 (5′-GCCTTCTGGACCACGG
CATACC-3 ') with HDL library 4 and 1639b
A p-length PCR fragment was obtained. 685 bp long PC for second genome walking
R fragment from HDL library 4 with gene-specific primer C3F2 (5'-
CGTAGTTGAGCACCGCTGAACAGTG-3 ′) and a nested gene-specific primer CF3 (5′-CCTCACCACCTCGAGGGTGA)
It was amplified using GACGCT-3). Gene-specific primer DEL5-GS
P1 (5′-GGTGGATGTGGACGGGCGCGTACG-3 ′) and a nested gene-specific primer C5K-GSP1 (5′-GGTATGCC
A 924 bp PCR fragment was cloned from HDL library 1 with the Third Genome Walking Mix using GTGGTCCAGAAGGC-3 '). In total, 2100b of genomic hTC region located 3'of phage clone P17
p was identified using this genome walking method (see Figure 7).

The subcloned fragments and genomic walking products were sequenced in single-stranded form. Lasergene Biocomputing Software (DN
ASTAR Inc. Co., Madison, Wisconsin, USA) to identify overlapping regions and form contigs. A total of two giant contigs were assembled from the phage clones P12, P17, P2, P3, and P5, and sequence data from the genomic walk. Contig 1 is made up of sequences from phage clones P12 and P17, as well as sequence data from the genomic walk. Contig 2 was a confluence of sequences from the phage clones P2, P3, and P5. The overlapping phage clone regions are shown graphically in FIG. Sequence data from two contigs is shown below. The ATG start codon of contig 1 is underlined. In Contig 2, the TGA stop codon is underlined. Contig 1:

[0073]

[Table 3]

[0074]

[Table 4]

[0075]

[Table 5]

[0076]

[Table 6]

[0077]

[Table 7]

[0078]

[Table 8]

[0079]

[Table 9]

[0080]

[Table 10]

[0081]

[Table 11]

[0082]

[Table 12]

Example 5 Comparison of the previously described genomic hTC sequence and hTC cDNA sequence (FIG. 6; corresponding to SEQ ID NO: 2) made it possible to elucidate the exon-intron structure of the hTC gene. The genomic organization of the hTC gene is illustrated graphically in Figure 7. h
The coding region of the TC gene is made up of 16 exons that vary in size between 62bp and 1354bp (see Table 1). Exon 1 contains the translation initiation codon ATG. The translation stop codon TGA and the 3'untranslated region are present on exon 16 (Figure 8). Possible polyadenylation signals (
AATAAA) is 3'flank region 31 in or after exon 16
It was not found at all within 95 bp. Exon-intron transition is a consensus sequence 5'-exon intron 3'-exon pre-mRNA A / CAG | GTA / GA ... NCAG | G Frequency (%) 70 60 80 100 100 95 70 80 100 100 60 Determined on the basis of, and listed in Table 1. All exon-intro transitions were published with the exception of the 5'splice site between exon 15 and intron 15 (Shapiro and Senapathy, 1987).
Matches the splice consensus sequence. Intron size is 104bp and 8
Between 616 bp. Since only part of intron 6 was isolated, hT
The exact length of the C gene cannot be determined. Based on the partial sequence of about 4660 bp obtained from intron 6, the minimum size of the hTERT gene is 37 kb.

The introns 1-5 and the 5'region of intron 6 are contained within contig 1: intron 1: bp 11493-11596 (SEQ ID NO: 4); intron 2: bp 12951-21566 (SEQ ID NO: 5); intron 3 : Bp 21763-23851 (SEQ ID NO: 6); intron 4: bp 24033-24719 (SEQ ID NO: 7); intron 5: bp 24900-25393 (SEQ ID NO: 8); 5'region of intron 6: bp 25550-26414 (sequence Number 9).

The 3'region of intron 6 and introns 7-15 are located within contig 2 at the following positions: 3'region of intron 6: bp 1-3782 (SEQ ID NO: 10); intron 7: bp 3879- 4858 (SEQ ID NO: 11); Intron 8: bp 4945-7429 (SEQ ID NO: 12); Intron 9: bp 7544-9527 (SEQ ID NO: 13); Intron 10: bp 9600-11470 (SEQ ID NO: 14); Intron 11: bp 11660-15460 (SEQ ID NO: 15); Intron 12: bp 15588-16467 (SEQ ID NO: 16); Intron 13: bp 16530-19715 (SEQ ID NO: 17); Intron 14: bp 19841-20621 (SEQ ID NO: 18); Intron 15 : Bp 20760-21295 (SEQ ID NO: 19).

The 3'untranslated region is also located within contig 2 at positions 21960-25138 (
SEQ ID NO: 20).

[0087]   The individual sequences of the described introns are as follows:

[0088]

[Table 13]

[0089]

[Table 14]

[0090]

[Table 15]

[0091]

[Table 16]

[0092]

[Table 17]

[0093]

[Table 18]

[0094]

[Table 19]

[0095]

[Table 20]

[0096]

[Table 21]

[0097]

[Table 22]

[0098]

[Table 23]

[0099]

[Table 24]

[0100]

[Table 25]

Interestingly, by exon characterization, our patent application PCT / EP98
It was shown that the functionally important hTC protein domain described in / 0303469 is located on a separate exon. The T motif characteristic of telomerase is located on exon 3. RT (reverse transcriptase) motifs 1-7, which are important for the catalytic function of telomerase, are located in the following exons: RT motifs 1 and 2 on exon 4, RT motif 4 on exon 9, RT motif 5 on exon 10 Above, and RT motifs 6 and 7 are on exon 11. RT motif 3 is divided into exons 5 and 6 (see Figure 8).

Elucidation of the exon-intron structure of the hTC gene is also described in our patent application PC
The four deletion or insertion mutants of the hTC cDNA described in T / EP98 / 03469, as well as the three additional hTC insertion mutants described in the publication (Killian et al., 1997) probably yielded alternative splicing products. It is also shown.
As shown in FIG. 8, splicing variants can be classified into two groups: deletion variants and insertion variants.

The deletion group hTC variants lack specific sequence segments. Mutant DEL1
A 36 bp in-frame deletion of P. coli was probably caused by the use of another 3'splice acceptor sequence in intron 6, which results in the loss of part of RT motif 3. Intron 6 in mutant DEL2
, 7 and 8 normal 5'splice donor and 3'splice acceptor sequences were not used. Instead, exon 6 is fused directly to exon 9, movement in reading frame occurs, and a stop codon appears in exon 10. Mutant De13 is a combination of Mutants 1 and 2.

The group of insertion mutants is characterized by the insertion of intron sequences leading to premature termination of translation. Instead of the commonly used 5'splice donor sequence of intron 5, the variant INSI uses a splice site located at another 3 ', which allows the first intron 4 from exon 4 to be located between exon 4 and exon 5. This results in a 38 bp insertion. Insertion of a region of the intron 11 sequence in mutant ISN2 likewise results from the use of another 5'splice donor sequence within intron 11. Since this variant is poorly described in the publication (Killian et al., 1997), it is not possible to determine the exact alternative 5'splice donor sequence for this variant. Insertion of the intron 14 sequence between exon 14 and exon 15 of variant INS3 was brought about by using another 3'splice acceptor sequence, which ensures that the 3'portion of intron 14 is not spliced. become.

HTC Variant I described in our patent application PCT / EP98 / 03469
NS4 (variant 4) is characterized in that the 5'partial regions of exon 15 and exon 16 are replaced by the first 600 bp of intron 14. This variant contains another internal 5'splice donor sequence at intron 14 and exon 16
Due to the use of another 3'splice acceptor sequence in
A terminal change is brought about.

In vivo production of hTC protein variants is thought to be possible to regulate hTC protein function in addition to transcriptional regulation, which is likely to have no function and interfere with the function of the complete hTC protein. Build a mechanism. The function of the hTC splice variant has not yet been elucidated. Most of these variants probably encode proteins that do not have reverse transcriptase activity, but nevertheless trans-dominantly-for example by competing for interactions with key binding partners.
It may play an important role as a negative telomerase regulator.

A survey of possible transcription factor binding sites was made by Genetics Co.
mputer Group (Madison, USA) GCG Sequence
e "Find pattern (fi
nd pattern) ”algorithm. This identified a wide variety of possible binding sites for transcription factors within the nucleotide sequence of intron 2 whose binding sites are listed in Table 2. In addition, a Sp1 binding site was found in intron 1 (position 43) and a c-Myc binding site was found within the 5'untranslated region (cDNA positions 29-34, see Figure 6).

Example 6 In order to confirm the initiation position (one or more) of hTC transcription in HL60 cells, the 5'end of hTC mRNA was determined by the method of primer extension analysis.

2 μg of poly A ⁺ RNA from HL-60 cells was denatured for 10 minutes at 65 ° C. 1 μl RNasin (30-40 U / ml) and 0.3-1 pmol radiolabeled primer (5′GTTAAGTTTGTAGCTTACACTGGTTC
TC3 ′; 2.5-8 × 10 ⁵ cmp) was added for primer annealing and the whole was incubated for 30 minutes at 37 ° C. in a total volume of 20 μl. 10 μl of 5 × reverse transcription buffer (from Gibco-BRL), 2 μl of 10
mM dNTPs, 2 μl RNasin (see above), 5 μl 0.1
MDTT (from Gibco-BRL), 2 μl of ThermoScript
RT (15 U / μl; from Gibco-BRL), and 9 μl DEPC
After adding treated water, primer extension was performed at 58 ° C. for 1 hour in total volume. The reaction was stopped by the addition of 4 μl 0.5 M EDTA, pH 8.0, and RNA was degraded for 30 minutes at 37 ° C. after the addition of 1 μl RNaseA (10 mg / ml). 2.5 μg sheared calf thymus DNA and 1
00 μl TE was then added and the mixture was extracted once with 150 μl phenol / chloroform (1: 1). After addition of 15μ of 3M Na acetate and 450μl of ethanol, the DNA was sedimented at -70 ° C for 45min and then centrifuged at 14,000rpm for 15min. The pellet was washed once with 70% ethanol, air dried, and dissolved in 8 μL of Sequencing Stop Solution. After denaturing at 80 ° C for 5 minutes, the sample was run on a 6% polyacrylamide gel and separated electrophoretically (Ausubel et al.
1987) (Fig. 5).

[0110]   The major transcription start site was thus identified, which is the ATG of the hTC cDNA sequence.
It is located 1767 bp 5'to the start codon (nucleotide position 3 in Figure 4).
346). In addition to this, this major transcription initiation (TTA₊₁Nucleus around TTGT)
The octide sequence represents the initiator element (Inr), which contains 7 nucleotides.
Six of them are consensus motifs of certain initiator elements (PyPyA ₊₁ Na / tPyPy) (Smale, 1997).

No obvious TATA box could be identified in the immediate vicinity of the experimentally identified major transcriptional start, which probably required the hTC promoter to be classified into a family of TATA-less promoters. Is meant (
Small, 1997). However, a possible TATA box from nucleotide position 1306 to nucleotide position 1311 (FIG. 4) was found by the approach of bioinformatics analysis. An additional observed auxiliary transcriptional start around the major transcriptional start has also been described in the case of another TATA-less promoter (Geng and Johnson, 1993), an example of which is strongly associated with several cell cycle genes. Found in regulated promoters (Wick et al., 19
95).

Example 7 In addition to the origin of hTC transcription described in Example 6 and identified in HL60 cells, additional transcription initiation regions were also identified in HL60 cells. RT-PCR
According to the analysis, the region of hTC gene transcription initiation in HL60 cells was bp-60-bp-
It was located at 105.

The cDNA for this is prepared by using the First Stra according to the manufacturer's instructions.
using the nd cDNA Synthesis kit (Clontech) and 0.4 μg of HL60 cell poly A RNA (Clontech) and the gene-specific primer GSP13 (5′-CCTCCAAAAGAGGTGGCT).
TCTTCGGC-3 ', cDNA positions 920-897) were used for synthesis.
In a final volume of 50 μl, 10 pmol of dNTP mix was added to 1 μl of cDNA, and the PCR reaction was with 1 × PCR reaction buffer F (PCR-Optimizer kit from InVitrogen) and 1 unit of platinum Ta.
q DNA polymerase (from Gibco / BRL) was used. 10 pmol of each of the 5'and 3'primers specified below were added as primers. PCR was performed in 3 steps. After 2 minutes of denaturation at 94 ° C, the DNA was first denatured at 94 ° C for 45 seconds, and then the primers were annealed, and 36 cycles of PCR were performed at which the DNA strand was extended at 68 ° C for 5 minutes. This cycle is 6
It was terminated by chain extension for 10 minutes at 8 ° C. 6 different 5'PCRs in total
Primer (primer HTRT5B: 5'-CGCAGCCAACTACCGC
GAGGTGC-3 ', cDNA positions 105-126; primer C5S: 5'
-CTGCGTCCTGCTGCCGCACGTGGGGAAGC-3 ', 5'flank region -49 to -23; primer PRO-TEST-1: 5'-CTCGC
GGCGCGAGTTTTCAGGGCAG-3 ', 5'-flank region-74 to-
52; Primer PRO-TEST2: 5'-CCAGCCCCTCCCCTT
CCTTTCC-3 ', 5'-flank region -112 to -91; primer PR
O-TEST 4: 5'-CCAGCTCCGCCCTCCTCCGCGC-3 ',
5'-flank region -191 to -171; primer RP-3A: 5'-CTA
GGCCGATTCGACCTCTCTCC-3 ', 5'-flank region-42
7-405) to the 3'PCR primer C5Rback (5'-GTCCCAG
GGCACGCACACCAG-3 ', cDNA positions 245-225). In addition to Oligo dT- and GSP13-primed cDNA, genomic DNA was also used as a control for this PCR. As shown in FIG. 9, the PCR products were the primer combinations HTRT5B-C5Rback, C5S.
-C5Rback and PRO-TEST1-C5RbacK were only obtained, which gives the starting points for hTC transcription to bp-60 and bp.
It is shown to exist in the region between −105.

Example 8 Some extremely high GC content regions, which are so-called CpG islands, have hT
It is located in an isolated 5'flank region of the C gene that is approximately 11.2 kb in length. One CpG island with a GC content of> 70% extends from bp-1214 into intron 2. The other two high GC regions with> 60% GC content are bp-3872 to bp-3113 and bp-5363 to bp-39, respectively.
It extends to 41. The location of CpG islands is shown graphically in FIG.

An investigation of potential transcription factor binding sites was performed by Genetics Co.
mputer Group (Madison, USA) GCG Sequence
e "Find pattern (Fi
nd Pattern) ”algorithm. This identified a wide variety of possible binding sites within the region up to -900 bp upstream of the transcription initiation codon ATG, which were: 5 Sp1 binding sites, 1 c-Myc.
There was a binding site and one CCAC box (Fig. 10). In addition to that CC
The AAT box and the second c-Myc binding site are each located in the 5'flank region-
Found at 1788 and -3995.

Example 9 For the purpose of analyzing the activity of the hTC promoter, PCR amplification was used to create four hTC promoter sequence segments of different lengths, and these segments were labeled with P
It was cloned before the luciferase reporter gene in the romega vector pGL2 5 '. 8.5 subcloned from phage clone P12
The kb SacI fragment was chosen as the source of DNA for PCR amplification. In a final volume of 50 μl, 10 pmol of dNTP mix was added to 35 ng of this DNA, and the PCR reaction was carried out in 1x PCR reaction buffer (PCR-from InVitrogen).
Optimizer kit) and with 1 unit of platinum Taq DNA polymerase (from Gibco / BRL). In each case 20 pmol of the 5'and 3'primers specified below were added as primers. This PCR was performed in three steps. After 2 minutes of denaturation at 94 ° C, the DNA was first denatured at 94 ° C for 45 seconds, then the primers were annealed, and 30 PCR cycles were carried out to extend the DNA strand at 68 ° C for 5 minutes. . The cycle was terminated by chain extension at 68 ° C for 10 minutes. The 3'primer selected in each case is the primer PK-3A (5'-GCAAGCTTGACGCAGCGCGC).
TGCCTGAAACTCG-3 ', positions -43 to -65), and this primer recognizes a sequence region 42 bp upstream of the ATG start (START) codon.
A promoter fragment (NPK8) having a size of 4051 bp was added to PK-3A primer and 5'PCR primer PK-5B (5'-CCAGATCTCTGGAAC).
ACAGATGGGCAGTTTCC-3 ', positions -4093 to -4070) and amplified. Primers PK-3A and PK-5C (5'-
CCAGATCTGCATGAAGTGTGTGGGGGATTTGCAG-3 '
, Positions -3120 to -3096) resulted in amplification of a promoter fragment (NPK15) with a size of 3078 bp. PK-3A and PK
-5D (5'-GGAGATCTGATCTTGGCTTACTGGCAGCT
A promoter fragment (NPK22) with a size of 2068 bp was amplified by using the combination of the primers of CTG-3 ′, positions 2110-2087).
Finally, PK-3A and PK-5E (5'-GGAGATCTGTCTGGATT)
The primer combination of CCTGGGAAGTCCTCA-3 ', positions -11125 to -1102) allows a promoter fragment (NPK2) having a size of 1083 bp.
Amplification of 7) resulted.

The PK-3A primer contains a HindIII recognition sequence. Another 5'primer contains a BglII recognition sequence.

The resulting PCR product is Qiagen QIA according to the manufacturer's instructions.
Purified using the quick spin PCR purification kit from the company and subsequently digested with the restriction enzymes BglII and HindIII. pGL
The two promoter vector was digested with the same restriction enzymes and the SV40 promoter contained within this vector was released and removed. This PCR promoter fragment was ligated into a vector that was subsequently used to compete with DH5α bacteria (Gib.
co / BRL) was transformed. DNA for promoter activity analysis described below was isolated from transformed bacterial clones using the Qiagen plasmid kit.

Example 10 The activity of the hTC promoter was analyzed by transient transfection in eukaryotic cells.

All work with eukaryotic cells was performed in a sterile working environment. CHO-K1
And HEK293 cells were transferred to the American Type Culture Co.
Obtained from reflection.

CHO-K1 cells contained 0.15% streptomycin / penicillin, 2 mM.
DM with 10% FCS (from Gibco / BRL)
It was maintained in EM Nut Mix F-12 cell culture medium (Gibco / BRL, order number: 21331-020).

HEK293 cells contained 0.15% streptomycin / penicillin, 2 mM.
DM with 10% FCS (from Gibco / BRL)
OD cell culture medium (Gibco / BRL, order no .: 41965-039
).

CHO-K1 and HEK293 cells were treated with 5% C at 37 ° C. in a water saturated atmosphere.
The culture was performed while supplying a gas of O ₂ . When the cell layer became confluent, the medium was sucked out, and then the cells were washed with PBS (100 mM KH ₂ PO ₄ pH 7.2; 150 mM).
NaCl) and trypsin-EDTA solution (Gibco-BRL
It was peeled off. The trypsin is inactivated by the addition of medium and Neubau for the purpose of plating cells at the desired density.
Cell number was determined using an er counting chamber.

In each case for transfection, 2 × 10 ⁵ HE per well
K293 cells were plated in a 24-well cell culture plate. This HEK
The 293 medium was taken out after 3 hours. Up to 2. for transfection
Up to 5 μg of plasmid DNA, 1 μg of CMV β-Gal plasmid construct (from Stratagene, order number: 200388), 200 μl of serum-free medium, and 10 μl of transfection reagent (Boehringer).
DOTAP from Mannheim) was incubated at room temperature for 15 minutes and then evenly spotted onto HEK293 cells. 1.5 ml of medium was added after 3 hours. This medium was changed after 20 hours. After an additional 24 hours, cells were harvested to determine luciferase activity and β-Gal activity. To determine the activity, the cells were incubated at room temperature for 15 minutes with a cell culture lysis reagent (H ₃ PO ₄ ;
CDTA; 2 mM DTT; 10% glycerol; 1% Triton X-
Dissolved in 25 mM Tris [pH 7.8] containing 100). 20 μl of this cell lysate was added to 100 μl of luciferase assay buffer (20 mM Tricin; 1.07 mM (MgCO ₃ ) ₄ Mg (OH) ₂ .5H ₂ O
2.67 mM MgSO ₄ ; 0.1 mM EDTA; 33.3 mM DTT;
270 μM Coenzyme A; 470 μM luciferin, 530 μM ATP
) And measured the light produced by luciferase.

To measure β-galactosidase activity, equal amounts of cell lysate and β-galactosidase assay buffer (100 mM sodium phosphate buffer, pH 7.3) were used.
1 mM MgCl ₂ ; 50 mM β-mercaptoethanol; 0.665 mg
ONPG / ml) was incubated at 37 ° C. for at least 30 minutes or until the appearance of a pale yellow color. This reaction was performed with 100 μl of 1M Na ₂ C
It was stopped by the addition of O ₃ and the absorbance was determined at 420 nm.

To analyze the hTC promoter, four hTC promoter sequence segments of different lengths were cloned 5'to the front of the luciferase reporter gene (see Example 9).

HE with the constructs NPK8, NPK15, NPK22, and NPK27
The luciferase specific activity of two separate transfections in K293 cells was plotted in FIG. Each experiment was performed by the double assay method. The standard deviation was also given. The construct NPK27 is a promoterless luciferase control construct (p
It exhibits luciferase activity that is 40-fold higher than the basal activity of GL2-basic) and 2-3-fold higher than that of the SV40 promoter control construct (pGL2PRO). Interestingly, 2 to more than that obtained with the NPK27 construct.
A 3-fold lower luciferase activity has a longer hTC promoter construct (NPK8, N
Obtained in cells transfected with PK15, NPK22). Similar results were obtained for CHO cells (data not shown).

[0128]

[Table 26]

[0129]

[Table 27]

[0130]

[Table 28]

[0131]

[Table 29]

[0132]

[Table 30]

[0133]

[Table 31]

[0134]

[Table 32]

[0135]

[Table 33]

[0136]

[Table 34]

[0137]

[Table 35]

[0138]

[Table 36]

[0139]

[Table 37]

[0140]

[Table 38]

[0141]

[Table 39]

[0142]

[Table 40]

[0143]

[Table 41]

[0144]

[Table 42]

[0145]

[Table 43]

[0146]

[Table 44]

[0147]

[Table 45]

[0148]

[Table 46]

[Sequence list]

[Brief description of drawings]

BRIEF DESCRIPTION OF THE FIGURES Figure 1: Southern blot analysis with various species of genomic DNA A: Photograph of an ethidium bromide stained 0.7% agarose gel containing approximately 4 μg EcoRI digested genomic DNA. Track 1 is used as a size marker (23
． 5, 9.4, 6.7, 4.4, 2.3, 2.0, and 0.6 kb) Hind
Includes lambda DNA cut with III. Tracks 2-10 are human, rhesus monkey, S
prague Dawley rats, including BALB / c mice, dogs, cows, rabbits, chickens, and the genomic DNA of the yeast (Saccharomyces cerevisiae (Saccharom yces cerevisiae)). B: Autoradiogram corresponding to FIG. 1A of Southern blot analysis using radiolabeled hTC-cDNA probe of about 720 bp length for hybridization.

Figure 2. Restriction analysis of recombinant lambda DNA of phage clone P12 hybridizing with a probe from the 5'region of hTC cDNA. The figure shows a photograph of a 0.4% agarose gel stained with ethidium bromide. Tracks 1 and 2 contain EcoRI / HindIII cut lambda DNA and a 1 kb ladder from Gibco as a size marker. Tracks 3-7 are each 250 ng of DNA from the recombinant phage cut with BamHI (track 3), EcoRI (track 4), SalI (track 5), XhoI (track 6), and SacI (track 7). including. The arrow indicates the vector EMBL3
It refers to the two λ arms of Sp6 / T7.

FIG. 3. Restriction analysis and Southern blot analysis of recombinant λ DNA of phage clones that hybridize with a probe from the 5 ′ region of hTC cDNA. A: The figure shows a photograph of a 0.8% agarose gel stained with ethidium bromide. Tracks 1 and 15 contain a 1 kb ladder from Gibco as size marker. Tracks 2-14 are each cleaved λDN from recombinant phage clones
Contains 250 ng of A. The following enzymes were used: Track 2: SacI, Track 3: XhoI, Track 4: XhoI, XbaI, Track 5: SacI, X.
hoI, track 6: SalI, XhoI, XbaI, track 7: SacI,
XhoI, XbaI, track 8: SacI, SalI, XbaI, track 9
: SacI, SalI, BamHI, Track 10: SacI, SalI, Xh
oI, track 11: NotI, track 12: SmaI, track 13: empty,
Track 14: Not digested. B: Autoradiogram corresponding to Figure 3A of Southern blot analysis. A 5'-hTC cDNA fragment of about 420 bp in length was used as a probe for hybridization.

FIG. 4 Partial DNA sequence of the 5 ′ flanking region of the gene and promoter for the human catalytic telomerase subunit. The ATG start codon in this sequence is printed in bold. The sequence shown corresponds to SEQ ID NO: 1.

FIG. 5. Use of primer extension analysis to identify transcription initiation. This figure shows an autoradiogram of denaturing polyacrylamide gels selected to show primer extension analysis. Sequence 5'GTTAAGTTTGTAGCTT
An oligonucleotide having ACACTGGTTTCC3 'was used as a primer. This primer extension reaction was run on Track 1. Tracks G, A, T
, And C consist of sequence reactions with the same primers and the corresponding dideoxynucleotides. Thick arrows mark the major transcription start, while thin arrows indicate the three auxiliary transcription start sites.

FIG. 6: cDNA sequence of the human catalytic telomerase subunit (hTC; see our pending application PCT / EP98 / 03468). The sequence shown corresponds to SEQ ID NO: 2.

FIG. 7: Structural organization and restriction map of the human hTC gene and its 5 ′ and 3 ′ flanking regions. Exons are shown as black squares and sequentially numbered elongated squares, and introns are shown as unfilled regions. The untranslated sequence segment in the exon is shaded. The translation starts at exon 1 and ends at exon 16. Restriction enzyme cleavage sites are marked with the following symbols: S, SacI; X, XhoI. Five phage clones (P2, P3, P5,
(P12, P17), and the relative arrangement of the products from the genomic walk is indicated by the thin lines. The sequence of intron 16, as indicated by the dots, is only partially read.

FIG. 8. HTL splice variants. A: Schematic structure of hTC mRNA splice variants. Complete hTC mRNA
Is drawn on the upper side of the figure as a rectangular box with a gray background. 16 exons are shown according to size. Translation initiation (ATG) and stop codons, as well as telomerase-specific T motifs, as well as seven RT motifs are shown. hTC variants are subdivided into deletion and insertion variants. Missing exon sequences are noted in the deletion. Inserts are indicated by additional open squares. The size and origin of the inserted sequences are indicated. The newly formed stop codon is noted. The size of the insertion of mutant INS2 has not been clarified. B: Exon-intron transition in hTC splice variant. Unspliced 5'flank sequences and 3'flank sequences are shown as open long squares. The origin of exon and intron sequences are indicated. Intron and exon sequences are shown in lower and upper case, respectively. The donor and acceptor sequences in the splice site are populated as gray rectangles and the origin of their exons and introns is also indicated.

FIG. 9. Identification of transcription start by RT-PCR analysis. RT-PCR was performed using a cDNA library prepared from HL60 cells and genomic DNA as a positive control. The common 3'primer hybridizes to a region of the exon 1 sequence. The positions of the different 5'primers within the coding region or 5'flank region are indicated. In the negative control, no template DNA was added to the PCR reaction. M: D
NA size marker.

FIG. 10: Nucleotide sequence and structural characteristics of the hTC promoter. This figure shows the 11273 bp 5'starting at the translation initiation codon ATG (+1).
The flanking hTC gene sequence is shown. The region presumed to start transcription is underlined. The possible regulatory sequence segments contained within 4000 bp upstream of the start of transcription are boxed. The sequence shown corresponds to SEQ ID NO: 3.

FIG. 11: Activity of the hTC promoter in HEK-293 cells. The first 5000 bp of the 5'flank hTC gene region is shown schematically at the top of the figure. The ATG start codon is highlighted. High CpG islands are marked with gray squares. The size of the hTC promoter-luciferase construct is shown in the left half of the figure. Promoter-free pGL2 basic construct and S
The V40 promoter construct pGL2-Pro was used as a control during each transfection. The luciferase specific activity of the different promoter constructs in HEK cells is shown as continuous bars in the right half of the figure. The standard deviation is shown. The numbers are
Shown are the averages of 2 separate experiments performed as duplicate tests. Table 1: Exon-Intron Transitions in the hTC Gene The table lists the nucleotide sequences at the 3'and 5'splice transitions of the hTC gene. The consensus sequences for the donor and acceptor sequences (AG and GT) are boxed in gray squares. The table shows intron sequences (lowercase) and exon sequences (uppercase) flanking the splice acceptor and donor sites. The size of this exon and intron is indicated by bp. Table 2: Possible binding sites for DNA binding factors within the nucleotide sequence of intron 2. A search for possible DNA-binding factors (eg, transcription factors) was performed using Ge
netics Computer Group (Madison, USA) GC
"Find pattern" of the G sequence analysis program package
tern) "algorithm. The table lists the abbreviations of the identified DNA binding factors and their position within intron 2.

─────────────────────────────────────────────────── ─── Continued front page    (81) Designated countries EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, I T, LU, MC, NL, PT, SE), OA (BF, BJ , CF, CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, GM, K E, LS, MW, SD, SZ, UG, ZW), EA (AM , AZ, BY, KG, KZ, MD, RU, TJ, TM) , AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, CA, CH, CN, CU, CZ, DE, D K, EE, ES, FI, GB, GD, GE, GH, GM , HR, HU, ID, IL, IN, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, L T, LU, LV, MD, MG, MK, MN, MW, MX , NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, U A, UG, US, UZ, VN, YU, ZW (72) Inventor Tsubofu, Dmitri             German Day-51061 Cologne Rogendl             Fushiyu Trace 59 F-term (reference) 4B024 BA11 CA04 DA02 EA04 FA02                       FA06 GA11 GA18 HA12                 4B050 CC03 DD11 LL03                 4B063 QA01 QA19 QQ02 QQ22 QR57                       QR59 QR69 QS05 QS24 QS28                       QS36 QX02                 4B065 AA91X AA93X AA93Y AB01                       AC14 BA02 BA25 CA27 CA46

Claims (12)

[Claims] 1. A regulatory DNA sequence for a gene for the human catalytic telomerase subunit. 2. The sequence is SEQ ID NO: 4, 5, 6, 7, 8, 9, 10, 11.
DNA according to claim 1, characterized in that it is an intron sequence according to 12, 12, 13, 14, 15, 16, 17, 18, 19 and / or 20 or a fragment of these sequences having a regulatory effect. Array. 3. The sequence is a 5'-flank regulatory DNA sequence of the human catalytic telomerase subunit gene shown in FIG. 10 (SEQ ID NO: 3) or a fragment of that DNA sequence having a regulatory effect. DN according to claim 1, characterized in that
A array. 4. A recombinant construct comprising a DNA sequence according to one of claims 1-3. 5. Recombinant construct according to claim 4, characterized in that it additionally comprises one or more DNA sequences coding for a polypeptide or a protein. 6. A vector comprising the recombinant construct according to claims 4-5. 7. Use of a recombinant construct or vector according to one of claims 4 to 6 for the preparation of a medicament. 8. A recombinant host cell harboring the recombinant construct or vector according to one of claims 4-6. 9. A method for identifying a substance which affects the promoter activity, silencer activity, or enhancer activity of a human catalytic telomerase subunit, which comprises the following: A DNA sequence according to one of claims 1 to 3, wherein the candidate substance is added to a host cell harboring the sequence, which is operably linked to a reporter gene,
And B. Measuring the effect of the substance on the expression of the reporter gene. 10. A method for identifying a factor that specifically binds to the DNA according to any one of claims 1 to 3, or a fragment thereof, which is one of claims 1 to 3. DNA sequences of, or subfragments of significantly different lengths as probes to screen an expressed cDNA library. 11. A transgenic animal harboring the recombinant construct or vector according to claim 4. 12. A method for detecting telomerase-related symptoms in a patient, comprising the steps of: Incubating the recombinant construct or vector according to claims 4-6 additionally with a reporter gene with a body fluid or cell sample, B. Detecting the activity of the reporter gene for the purpose of obtaining a diagnostic value, and C. Comparing the diagnostic value with a standard value for a reporter gene construct in a standardized normal cell or body fluid of the same type as the test sample.