JP2003518361A - Additional PRO polypeptides and their sequences - Google Patents

Abstract

(57) SUMMARY Membrane-bound proteins and receptor molecules have a variety of industrial uses, including as pharmaceuticals and diagnostics. Receptor immunoadhesins are used, for example, as therapeutics to block receptor-ligand interactions. Membrane-bound proteins can also be used to screen for potential peptide or small molecule inhibitors of the relevant receptor / ligand interaction. Both industrial and academic efforts are currently being made to identify and characterize novel natural receptors or membrane-bound proteins. Many of these efforts have focused on screening recombinant mammalian DNA libraries to identify coding sequences for novel receptors or membrane-bound proteins. The present invention relates to novel polypeptides and nucleic acid molecules encoding these polypeptides. Also herein, vectors and host cells containing these nucleic acid sequences, chimeric polypeptide molecules containing the polypeptide of the present invention fused to a heterologous polypeptide, antibodies that bind to the polypeptide of the present invention, and polypeptides of the present invention Manufacturing methods are also provided.

Description

Detailed Description of the Invention

FIELD OF THE INVENTION The present invention relates generally to the identification and isolation of novel DNAs and the recombinant production of novel polypeptides.

BACKGROUND OF THE INVENTION Extracellular proteins play a particularly important role in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, such as proliferation, migration, differentiation or interaction with other cells, is typically governed by information received from other cells and / or their immediate environment. This information is often transmitted by secreted polypeptides, such as mitogens, survival factors, cytotoxic factors, differentiation factors, neuropeptides, and hormones, which in turn are received by a variety of cellular receptors or membrane-bound proteins. Will be interpreted. These secreted polypeptides or signaling molecules normally pass through the cell secretory pathway to reach their site of action in the extracellular milieu. Secreted proteins have a variety of industrial applications including pharmaceuticals, diagnostics, biosensors and bioreactors. Most protein drugs currently available, such as thrombolytic agents, interferons, interleukins, erythropoietin, colony stimulating factors, and various other cytokines, are secreted proteins. Efforts are being made by both industry and academia to identify new native secreted proteins. Much effort has been devoted to the screening of mammalian recombinant DNA libraries to identify the coding sequences of novel secreted proteins. Examples of screening methods and techniques are described in the literature [eg Klein et al., Proc. Natl.
Acad. Sci. 93; 7108-7113 (1996); US Pat. No. 5,536,637].
. Membrane-bound proteins and receptors play important roles in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, such as proliferation, migration, differentiation or interaction with other cells, is typically governed by information received from other cells and / or the immediate environment. This information is often transmitted by secreted polypeptides (eg, mitogens, survival factors, cytotoxic factors, differentiation factors, neuropeptides, and hormones), which in turn are received by various cellular receptors or membrane-bound proteins. Be interpreted. Such membrane-bound proteins and cellular receptors include, but are not limited to, cytokine receptors, receptor kinases, receptor phosphatases, receptors involved in cell-cell interactions, and cell adhesion such as selectins and integrins. Contains molecules. For example, the transduction of signals that regulate cell growth and differentiation are regulated in part by phosphorylation of various cellular proteins. Protein tyrosine kinase, the enzyme that catalyzes that process, also acts as a growth factor receptor. For example,
Includes fibroblast growth factor and nerve growth factor receptors. Membrane-bound proteins and receptor molecules have various industrial applications, including pharmaceuticals and diagnostics. For example, the receptor immunoadhesin is a receptor-
It can be used as a therapeutic agent that blocks ligand-ligand interactions. Membrane-bound proteins can also be used to screen peptides or small molecule inhibitors for potential related receptor / ligand interactions. Efforts are being made by both industry and academia to identify novel native receptors or membrane-bound proteins. Much effort has been devoted to screening mammalian recombinant DNA libraries to identify coding sequences for novel receptors or membrane-bound proteins.

1. The PRO1560 tetraspan family of proteins grows and encompasses approximately 20 known genes from various species, including Drosophila. Tetraspan is also known as the transmembrane 4 (TM4) superfamily and is proposed to have a forming function in the cell membrane. Their ability to interact with other molecules and functions in diverse activities such as cell adhesion, activation and differentiation implicates a role in integrating large molecular complexes. Skubitz et al., J. Immunology, 157: 3
617-3626 (1996). The tetraspan group is also considered to be a set of proteins having remarkable functions in Schwann cell biology. Mirsky and Jessen, Curr. Opin.
Neurobiol., 6 (1): 89-96 (1996). Tetraspanin
)) Is further described in Maecker et al., FASEB, 11: 428-442 (1997). Therefore, members of the Tetraspan family are of interest. 2. PRO444 Both industrial and academic efforts are currently underway to identify and characterize novel natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted polypeptide designated herein as the PRO444 polypeptide. 3. PRO1018 Both industrial and academic efforts are currently underway to identify and characterize novel natural transmembrane and receptor proteins. Many of these efforts have focused on mammalian recombinant DN to identify coding sequences for novel transmembrane proteins.
Concentrate on screening the A library. Here we are here PRO1
The identification and characterization of a novel transmembrane polypeptide designated as 018 is described. 4. The first rate-limiting step in PRO1773 retinoic acid biosynthesis requires the conversion of retinol to retinal. The retinol dehydrogenase protein is an enzyme that functions to recognize the holo-cellular retinol binding protein as a substrate, thereby catalyzing the first step of retinoic acid biosynthesis from that substrate. Various retinol dehydrogenase genes have been cloned and further characterized, and the products of these genes have been suggested to be potentially useful in the treatment of retinitis pigmentosa, psoriasis, acne and various cancers (Chai et al. , J. Biol. Chem. 270: 28408-28412 (1995) and C.
Hai et al., Gene 169: 219-222 (1996)). Given the clear importance of retinol dehydrogenase, the identification and characterization of novel polypeptides with homology to retinol dehydrogenase is of great interest. Here we are here PRO1
The identification and characterization of a novel polypeptide homologous to the retinol dehydrogenase protein, designated 773 polypeptide, is described. 5. PRO1477 glycosylation is an important mechanism for the regulation of protein physicochemical and biological properties in a step- and tissue-specific manner. One of the key enzymes involved in glycosylation in Saccharomyces cerevisiae is alpha 1,2
-Man9GlcNAc2 during the formation of an N-linked oligosaccharide called mannosidase
It is an enzyme that converts into. The Saccharomyces cerevisiae alpha 1,2-mannosidase enzyme is a member of the class I alpha 1,2-mannosidase that is conserved in yeast from mammals. Given the important role played by alpha 1,2-mannosidase in glycosylation and physicochemical activity regulated by glycosylation, the identification of novel polypeptides with homology to one or more mannosidases is highly discriminatory. Interesting to. Here we are here PRO1477
The identification and characterization of a novel polypeptide homologous to the mannosidase protein, termed the polypeptide, is described.

6. PRO1478 Recently, a new subfamily of galactosyltransferase genes encoding type II transmembrane proteins was identified from a mouse genomic library (henn
et al., (1998) J. Biol. Chem. 273 (1): 58-65). Galactosyltransferases are generally all of interest. Beta-1,4-galactosyltransferase is found in two subcellular components and is believed to exert two different functions. Evans et al., Ioessays, 17 (3): 261-268 (1995). Beta-1,4-galactosyltransferase is described by Dubois and Shur, Adv. Exp. Med. Biol., 376: 1.
05-114 (1995) as a possible transducing receptor and further reported in Shur, Glycobiology, 1 (6): 563-575 (1991). The expression and function of cell surface galactosyltransferases is described by Shur, Biochim. Biophys.
Acta., 988 (3): 389-409 (1989). Furthermore, the receptor function of galactosyltransferase during mammalian fertilization has been demonstrated by Shur, Adv. Exp. Biol.
., 207: 79-93 (1986), the receptor function during cellular interactions is described by Shur,
Mol. Cell Biochem., 6l (2): 143-158 (1984). Thus, it is understood that galactosyltransferase and its related proteins are interesting. 7. PRO831 Both industrial and academic efforts are currently underway to identify and characterize novel natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted polypeptide designated herein as the PRO831 polypeptide. 8. PRO1113 protein-protein interactions include those involved in receptor and antigen complexes and signaling mechanisms. As is well known for the structural and functional mechanisms underlying protein-protein interactions, protein-protein interactions are more easily engineered to regulate specific outcomes of protein-protein interactions. be able to. Therefore, the underlying mechanisms of protein-protein interactions are of interest to the scientific and medical community. All proteins, including leucine-rich repeats, are believed to be involved in protein-protein interactions. Leucine-rich repeats are short sequence motifs that are present in many proteins and cell locations with diverse functions. The crystal structure of the ribonucleic acid inhibitor protein revealed that leucine-rich repeats correspond to β-α structural units. These units consist of parallel βs with one surface exposed to solvent.
Arranged to form a sheet, the protein acquires an unusual non-spherical shape. These two features have been shown to be responsible for the protein binding function of proteins containing leucine rich repeats. Kobe and Deisenhofer, Trends Biochem.
Sci., 19 (10): 415-421 (Oct. 1994). Studies have been reported on leucine-rich proteoglycans, which become tissue organizers that orient and direct collagen fibrils during ontogeny and are involved in pathological processes such as wound healing, tissue repair, and tumor stroma formation. Iozzo, RV
., Crit. Rev. Biochem. Mol. Biol., 32 (2): 141-174 (1997). Other studies showing the involvement of leucine-rich proteins in wound healing and tissue repair have been reviewed by De La Salle, C.
Et al., Vouv. Rev. Fr. Hematol. (Germany), 37 (4): 215-222 (1995), who have reported a mutation in the leucine-rich motif in the complex associated with the bleeding disorder Bernard-Soulier syndrome. , Chlemetson, KJ, Thromb. Haemost. (Germany), 74 (1):
111-116 (July 1995) reported that platelets have leucine-rich repeats, WO 9110 of Ruoslahti, EI et al. Of La Jolla Cancer Research Foundation.
727-A is a cancer treatment that decorin, which binds to transforming growth factor β,
It is reported to be involved in wound healing and scarring. Useful in wound healing and associated treatments related to regrowth of tissues such as connective tissue, skin and bone; in promoting body growth in humans and animals; and in stimulating other growth-related processes In one regard, it is insulin-like growth factor (IGF) that is functionally associated with this group of proteins. The acid-labile subunit of IGF (ALS) is also interesting in that it increases the half-life of IGF and is part of the IGF complex in vivo. Other proteins reported to have leucine-rich repeats have been reported to be useful in the treatment of neurodegenerative diseases such as Alzheimer's disease, nerve damage such as Parkinson's disease, and for the diagnosis of cancer. SLIT protein. Artavanistsakonas, S. of Yale University and WO9210518 of Rothberg, JM
-See A1. Also of interest is LIG-1, a membrane glycoprotein that is specifically expressed in glial cells of mouse brain and has leucine-rich repeats and immunoglobulin-like domains. Suzuki et al., J. Biol. Chem. (US), 271 (37): 22522 (1996). Other studies reporting the biological function of proteins with leucine-rich repeats include: Tayar, N. et al., Mol. Cell Endocrinol., (Ireland), 125 (1-2): 65-70 (Dec .19
96) (Gonadotropin receptor related); Miura, Y. et al., Nippon Rinsho (Japan), 54 (
7): 1784-1789 (July 1996) (apoptosis related); Harris, PC et al., J. Am. Soc. Neph.
rol., 6 (4): 1125-1133 (Oct. 1995) (related to renal disease).

9. The PRO1194 nuclear genes PET117 and PET119 are S. It is necessary and therefore interesting for the assembly of active cytochrome c oxidase in S. cerevisiae. Also of interest are nucleic acids that have sequence identity with these genes. The PET gene is Mc
Ewen et al., Curr. Genet., 23 (1): 9-14 (1993). 10. PRO1110 bone marrow plays many important roles in mammals. One of these roles is
It provides a source of various progenitor cells that differentiate into important cells and other components of the blood and immune system. Thus, myeloid function is of great interest. Here we describe the identification and characterization of a novel polypeptide homologous to the bone marrow upregulating protein, designated herein as PRO1110 polypeptide. PRO1378 Both industrial and academic efforts are currently underway to identify and characterize novel natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted protein, designated herein as PRO1378 polypeptide. 12. PRO1481 Both industrial and academic efforts are currently underway to identify and characterize novel native proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel proteins. Here we describe the identification and characterization of a novel protein, designated herein as PRO1481 polypeptide.

13. There is great interest in receptor proteins on stem and progenitor cells that may be involved in triggering PRO1189 proliferation or differentiation. A type II transmembrane protein was identified in proliferative progenitor cells in the lateral perichondrium border of postnatal mandibular condylar growth. The experimenters concluded that E25 could be a useful marker of cartilage-osteogenic differentiation (Deleer
snijder et al., J. Biol. Chem. 271 (32): 19475-19482 (1996)). 14. PRO1415 Both industrial and academic efforts are currently underway to identify and characterize novel natural transmembrane proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel transmembrane proteins. Here we describe the identification and characterization of a novel transmembrane polypeptide, designated herein as the PRO1415 polypeptide. 15. PRO1411 Both industrial and academic efforts are currently underway to identify and characterize novel natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted protein, herein designated as PRO1411 polypeptide. 16. PRO1295 Both industrial and academic efforts are currently underway to identify and characterize novel naturally occurring secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted protein, herein designated the PRO1295 polypeptide.

17. Enzymes such as PRO1359 hyaluronidase, sialyltransferase, urokinase-type plasminogen activator, plasmin, and matrix metalloprotease are
It plays a central role in the catabolism of extracellular matrix molecules. Thus, these enzymes and their inhibitors may play a role in metastatic cancer and its treatment. Va
n Aswegen and du Plessis, Med. Hypotheses, 48 (5): 443-447 (1997). Sialyltransferases are of particular interest because of the above reasons, and their diversity in substrate specificity cases. For example, the peptides of interest are Kurosawa et al.,
GalNA as described in J. Biol. Chem., 269 (2): 1402-1409 (1994).
calpha2,6-sialyltransferase. This peptide is composed and secreted and retains its catalytic activity. The expressed enzyme is asiaromucin (asi
alomucin) and asialofetuin, but other glycoproteins have not been tested. Sialylation is an important function and such sialyltransferases and peptides related by sequence identity are of interest.
Sialyltransferases are further described in the literature, for example Sjoberg et al.,
J. Biol. Chem., 271 (13): 7450-7459 (1996), Tsuji, J. Biochem., 120 (1):
See 1-13 (1996) and Harduin-Lepers et al., Glycobiology, 5 (8): 741-758 (1995). 18. PRO1190 Kang et al. Reported the identification of a novel cell surface glycoprotein of the Ig superfamily (J. Cell biol. (1997) 138 (1): 203-213). The Ig superfamily of cell adhesion molecules are involved in a wide range of biological processes including cell migration, growth regulation, and tumorigenesis. Studies by Kang et al. Suggest that loss of CDO function plays a role in carcinogenesis. Therefore, additional CDO-like molecules, more commonly I
The identification of cell adhesion molecules of the g superfamily is of interest. 19. PRO1772 peptidase is an enzymatic protein that functions to cleave peptide substrates in a specific or non-specific manner. Peptidases are generally involved in many vital biological processes in mammalian and non-mammalian organisms. Many different peptidase enzymes from a variety of different mammalian and non-mammalian organisms have been identified and characterized. Mammalian peptidase enzymes play important roles in many different biological processes including, for example, protein digestion, activation, inactivation, or modulation of peptide hormone activity, and alteration of physiological properties of proteins and enzymes. Given the important physiological role played by peptidase enzymes, both industrial and academic efforts are currently underway to identify and characterize novel natural peptidase homologs. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel transmembrane proteins. Examples of screening methods and techniques are described in the literature [
See, eg, Klein et al., Proc. Natl. Acad. Sci., 93: 7108-7113 (1996); US Pat. No. 5,536,637]. Here we describe the identification of a novel polypeptide with homology to various peptidase enzymes, designated herein as PRO1772 polypeptide.

20. PRO1248 putative protein-2 (PUT-2) is a homologue of the human disease genes L1CAM, G6PD and P55 (Riboldi Tunnicliffe et al., G.
enome Analysis, posted). Thus, the identification of a polypeptide encoding a DNA with homology to the PUT-2 reversal is of interest. Here we are here PRO
The identification and characterization of a novel polypeptide homologous to the PUT-2 antisense, designated 1248 polypeptide, is described. 21. PRO1316 Dickkopf (dkk) is highly homologous to cysteine-rich domains (
Ie, 80-90%) and members of the family of secreted proteins.
The first-discovered member of this family, Dkk-1, has potential head-inducgin activity on the Spemann organizer. Glinka et al., Nature, 391 (6665): 357-362 (1998). Amphibian embryonic Speman organizers can be subdivided into two distinct activities: trunk organizers and head organizers. Dkk-1 was found to be sufficient and necessary for head induction in Xenopus embryos, and is a potential antagonist of Wnt signaling.
It is suggested that the gene encodes the entire family of secreted Wnt inhibitors. Members of the Wnt gene family function in normal development and differentiation as well as tumorigenesis. Wnt is encoded by the large IDE family, members of which are found in roundworms, insects, cartilaginous fish, and vertebrates. Holland et al., D
ev. Suppl., 125-133 (1994). The Wnt genes encode a family of secreted glycoproteins that modulate cell fate and behavior in the embryo through activation of receptor-mediated pathways. Studies of mutations in the Wnt gene have shown a role for Wnt in growth regulation and tissue patterning. In Drosophila, no feathers (wg) are Wnt
It encodes a related gene (Rijsewik et al., Cell, 50: 649-657 (1987)) and wg mutations altered the pattern of embryonic ectoderm, neurogenesis, and imaginal disc growth. Morata and La
werence, Dev. Biol., 56: 227-240 (1977); Baker, Dev. Biol., 125: 96-108
(1988); Klingensmith and Nusse, Dev. Biol., 166: 396--414 (1994). In C. elegans, lin-44 encodes a Wnt homolog required for asymmetric cell division. Herman and Horvitz, Development, 120: 1035-1047 (1994). Knockout mutations in mice resulted from Wnt brain development (McMahon and Bradley, Cell, 62:
1073-1085 (1990); Thomas and Cappechi, Nature, 346: 847-850 (1990)), kidney (Stark et al., Nature, 372: 679-683 (1994)), tail bud (Takada et al., Genes Ce).
v., 8: 174-189 (1994)), and showed that they are essential for the growth of embryo primordia on limb buds. Wnt overexpression in mammalian glands is associated with mammalian hyperplasia and tumors (McMahon, supra (1992); Nusse and Varmus, HE, Cell 69: 1073-1087 (1992).
), And precocious alveolar development. Bradley et al., Dev. Biol., 170: 553-563 (1
995). Furthermore, constitutive expression of Wnt-4 in the progenitor host of the transplanted mammalian epithelium results in highly divergent tissues that resemble a pregnancy-like growth pattern. Bradley
Et al., Dev. Biol., 170: 553-563 (1995). The Wnt / Wg signaling pathway plays an important role in the biological development of organisms and is associated with several human cancers. This pathway is also a tumor suppressor gene AP
C is also included. Mutations in the APC gene are associated with the development of sporadic and genetic forms of human colorectal cancer. For example, increased Wnt-2 levels have been observed in colorectal cancer. Vider, BZ. Et al., Oncogene 12: 153-158 (1996).

22. PRO1197 Both industrial and academic efforts are currently underway to identify and characterize novel natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted protein, designated herein as the PRO1197 polypeptide. 23. PRO1293 immunoglobulins are proteins that function as both antibody molecules, receptors for antigens on B cell membranes and secreted products of plasma cells. Immunoglobulins, like all antibody molecules, serve two major functions: they specifically bind antigens and they participate in a limited number of biological effector functions.
Therefore, novel members of the Ig superfamily and fragments thereof are also of interest. Molecules that act as receptors by various viruses and those that regulate immune function are of particular interest. Also of particular interest are molecules that have homology to known Ig family members that act as viral receptors or regulate immune function. Therefore, members of the Ig superfamily or fragments thereof (
That is, molecules with homology to heavy and light chain fragments) are of particular interest. Here we describe the identification and characterization of a novel polypeptide homologous to an immunoglobulin heavy chain variable region protein, designated herein as PRO1293 polypeptide. 24. PRO1380 Both industrial and academic efforts are currently underway to identify and characterize novel natural transmembrane proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel transmembrane proteins. Here we describe the identification and characterization of a novel transmembrane polypeptide, designated herein as the PRO1380 polypeptide.

25. Identification of secreted proteins novel to the PRO1265 physiological and metabolic pathways is of interest due to their potential use as pharmaceutical agents. Of particular interest is the identification of novel polypeptides potentially involved in immune response and inflammatory mechanisms. A novel polypeptide expressed in mouse B cells against IL-4 was recently identified. The gene encoding this polypeptide is an interleukin-4 inducible gene, or "F
ig1 ”(Chu et al., Proc. Natl. Acad. Sci. (1997) 94 (6): 2507.
-2512). 26. PRO1250 long-chain fatty acid CoA ligase is an enzyme protein that functions to bind long-chain fatty acids to each other, a function that plays an important role in a variety of different physiological processes. Therefore, efforts are currently underway to identify and characterize novel long chain fatty acid CoA ligase homologs. Here we describe the identification and characterization of a novel polypeptide homologous to the long chain fatty acid CoA ligase, designated herein as the PRO1250 polypeptide. 27. The PRO1475 N-acetylglucosaminyltransferase protein comprises a family of enzymes that confers a variety of important biological functions in mammalian organisms. As an example, U
DP-N-acetylglucosamine: alpha-3-D-mannoside beet-1,2-N-
Acetylglucosaminyltransferase I is an enzymatic protein that catalyzes the first step essential for the conversion of higher-mannose-N-glycans into hybrid and complex N-glycans (Sarkar et al., Proc. Natl. Acad. Sci. USA. 88: 234-238 (1
991)). Given the clear importance of the N-acetylglucosaminyl transferase enzyme, the identification and characterization of novel polypeptides with homology to the N-acetylglucosaminyl transferase protein is of great interest. Here we describe the identification and characterization of a novel polypeptide homologous to the N-acetylglucosaminyl transferase protein, designated herein as the PRO1475 polypeptide. 28. PRO1377 Both industrial and academic efforts are currently underway to identify and characterize novel natural transmembrane proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel transmembrane proteins. Here we describe the identification and characterization of a novel transmembrane polypeptide, designated herein as the PRO1377 polypeptide.

29. PRO1326 Both industrial and academic efforts are currently underway to identify and characterize novel naturally occurring secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted protein, designated herein as the PRO1326 polypeptide. 30. PRO1249 Both industrial and academic efforts are currently underway to identify and characterize novel natural transmembrane proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel transmembrane proteins. Here we describe the identification and characterization of a novel transmembrane polypeptide, designated herein as the PRO1249 polypeptide. 31. PRO1315 Many key cytokine proteins have been identified, characterized, and signals have been shown through specific cell surface receptor complexes. For example, the class II cytokine receptor family (CRF2) is an interferon receptor,
Contains interleukin-10 receptor and tissue factor CRFB4 (Spencer et al.
J. Exp. Med. 187: 571-578 (1998) and Kotenko et al., Embo J. 16: 5894-5903 (19).
97)). Thus, many of the biological activities exerted by various cytokine proteins are completely dependent on the presence of target cell surface cytokine receptor proteins. Therefore, the identification and characterization of novel polypeptides with homology to one or more cytokine receptor families is of great interest. Here we describe the identification and characterization of a novel polypeptide homologous to the cytokine receptor family-4 proteins, designated herein as PRO1315 polypeptide. 32. PRO1599 Granzyme M is a natural killer cell serine protease. The human gene is 7.5 kilobases, has an exon-intron structure similar to other serine proteases, and is closely linked to the serine protease gene raster on chromosome 19p13.3 (Pilat et al., Genomics, 24 : 445-450 (1994)). Granzyme M has been found in human natural killer leukemia cell line, unstimulated human peripheral blood monocytes and untreated purified CD3-DC56 ⁺ large granule lymphocytes (Smyth et al., J.
Immunol. 151: 6195-6205 (1993)).

33. PRO1430 reductase forms a large class of enzymatic proteins found in various mammalian tissues and plays an important role for the correct functional expression of these tissues. These are antioxidant enzymes that catalyze the conversion of reactive oxygen species into water. Abnormal levels and functional expression of reductase have been implicated in several diseases and disorders including stroke, heart attack, oxidative stress, hypertension, and benign and malignant tumor progression. For example, malignant prostate epithelium is associated with reduced expression of such antioxidant enzymes [Baker et al., Prostat.
e 32 (4): 229-233 (1997)]. International Patent Application No. WO9622360-A1 describes prostate specific reductases useful in the diagnosis and treatment of prostate cancer and the screening of novel antagonists. Inhibitors of alpha-reductase have been used to treat benign prostatic hyperplasia (Anderson, Drugs Aging (1996) 6 (5): 388-396). For these reasons, the identification of novel members of the reductase family is of interest for the treatment and diagnosis of cancer and other diseases and disorders. 34. PRO1374 prolyl 4-hydroxylase (P4HA) catalyzes the formation of 4-hydroxyproline in collagen. Annunen et al., J. Biol. Chem., 272 (28): 17342-17.
348 (1997); Helaakoski et al., PNAS USA, 92 (10): 4427-4431 (1995); and Hopki.
Nson et al., Gene, 149 (2): 391-392 (1994). This enzyme and its related molecules are of interest. 35. The proteins of the tetraspan family, also called PRO1311 "transmembrane 4 (TM4) superfamily", have been proposed to have a forming function in the cell membrane. They interact with large molecular complexes and are thought to function in diverse activities such as cell adhesion, activation and differentiation (Maecker et al. FASEB.
(1997) 11: 428-442). Therefore, the identification of novel members of the tetraspan family of proteins is of interest. Both industrial and academic efforts are currently underway to identify novel natural transmembrane proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel receptor proteins. 36. PRO1357 Ebnerin is a cell surface protein associated with the Ebner's gland in mammals. Both industrial and academic efforts have been made to identify and characterize novel proteins, especially those with sequence homology to Ebnerin or other salivary gland associated proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel receptor proteins. Here we describe the identification of a novel protein, herein designated PRO1357 polypeptide, with significant homology to the von Ebner minor salivary gland-related protein.

37. PRO1244 One type of transmembrane protein that has received attention is the implantation-related uterine protein. Deficiency or abnormalities in this protein can induce miscarriage. Therefore, the identification and characterization of implantation-related proteins is of interest. 38. PRO1246 bone-related sulfatase is an enzymatic protein that has been shown to degrade the sulfate groups of proteoglycan sugar chains in bone tissue (Australian Patent Publication No. AU).
93 / 44921-A, March 3, 1994). Due to its specific sulfatase activity, bone-related sulfatase may find use in the treatment of bone metabolic disorders. Thus, the identification and characterization of novel polypeptides with sequence similarity to bone-associated sulfatase is of great interest. Here we describe the identification and characterization of a novel polypeptide with homology to bone-associated sulfatase, designated herein as PRO1246 polypeptide. 39. PRO1356 Clostridium perfringens enterotoxin (CPE) is a C.I. It is considered to be a virulence factor that causes symptoms of food poisoning of Perfringens type A, and may be associated with other human and veterinary diseases (McClane, Toxicon. 34: 1335-1343 ( 1996)). CPE is referred to as Clostridium perfringens enterotoxin receptor (CPE-R), and is approximately 50
Approximately 90,000k on cell surface by binding to cell surface receptor protein of kD
By forming a complex of D, it exerts its harmful cell function. CPE-R
The cDNA encoding the protein has been identified and characterized in both human and mouse (Katahira et al., J. Cell. Biol. 136: 1239-1247 (1997) and Kat.
ahira et al., J. Biol. Chem. 272: 26652-26658 (1997)). CPE toxins have been reported to be responsible for various diseases in the mammalian host, and these diseases are initiated by the binding of CPE toxins to CPE-R, thus identifying novel CPE-R homologues. Is quite interested. We call it PRO1356, CPE
Described herein is the identification and characterization of novel polypeptides with homology to -R.

40. PRO1275 Both industrial and academic efforts are currently underway to identify and characterize novel natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted protein, designated herein as PRO1275 polypeptide. 41. PRO1274 Both industrial and academic efforts are currently underway to identify and characterize novel naturally occurring secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted protein, designated herein as PRO1274 polypeptide. 42. PRO1412 Both industrial and academic efforts are currently underway to identify and characterize novel natural transmembrane proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel transmembrane proteins. Here we describe the identification and characterization of a novel transmembrane polypeptide, designated herein as the PRO1412 polypeptide. 43. The identification of secretory Yangs that play a role in PRO1557 neural development is of interest. Proteins such as tissue factor find use in understanding and potential treatment of neurological diseases and disorders. The chordin protein isolated from Xenopus is a cell-type protein in the center of development of the Xenopus head, limb and caudal limbs.
It is a potential dorsalizing factor that regulates cell interactions (Sakai et al. (1994) Cell 79 (5
): 779-790; also Mullins, (1998) Trends Genet. 14 (4): 127-129; and Kasse.
l et al. (1998) Trends Genet. 14 (5): 169-171). It can be used as a component of culture medium for nerve and muscle cell culture and may have applications in the treatment of neurodegenerative diseases and nerve damage (US Pat. No. 5,679,783). 44. PRO1286 Both industrial and academic efforts are currently underway to identify and characterize novel naturally occurring secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted protein, designated herein as PRO1286 polypeptide.

45. The extracellular mucosal matrix of PRO1294 olfactory neuroepithelium is a highly organized structure in intimate contact with the chemoreceptive cilia that house the olfactory transmitters. The major protein component of this extracellular matrix is olfactomedin, a glycoprotein expressed in the olfactory neuroepithelium, which forms intermolecular disulfide bonds to form macromolecules (Yokoe
Et al., Proc. Natl. Acad. Sci. USA 90: 4655-4659 (1993), Bal et al., Biochemistry.
32: 1047-1053 (1993) and Snyder et al., Biochemistry 30: 9143-9153 (1991)).
Olfactomedin has been suggested to affect the maintenance, growth or differentiation of chemoreceptive cilia on the apical dendrites of olfactory neurons. Given this important role, there is great interest in identifying and characterizing novel polypeptides with homology to olfactomedin. Here we describe the identity and characterization of a novel polypeptide with homology to the olfactomedin protein. We describe here the identity and characterization of a novel polypeptide with homology to the olfactomedin protein, herein designated PRO1294 polypeptide. 46. PRO1347 Butyrophilin is a lactose glycoprotein that constitutes over 40% of all proteins bound to the fat globule membrane of mammalian milk. Butyrophilin mRN
Expression of A correlates with the onset of milk fat production at the end of pregnancy and has been shown to be maintained throughout the lactation phase. Butyrophilin has been identified in cattle, mice and humans (Taylor et al., Biochim. Biophys. Acta 1306: 1-4 (1996).
, Ishii et al., Biochim. Biophys. Acta 1245: 285-292 (1995), Mather et al., J. Dairy.
Sci. 76: 3832-3850 (1993), Sato et al., J. Biochem., 117 (1): 147-157 (! 995) and Banghart et al., J. Biol. Chem. 273: 4171-4179 (1998). ), A type I transmembrane protein that is incorporated into the fat globulin membrane. Butyrophilin may serve as a major scaffold for an assembly of complexes with xanthine dehydrogenase / oxidase and other proteins that function in germination and release of milk fat globule from the apical surface during lactation (Banghart et al., Supra). Butyrophilin plays an apparently important role in mammalian milk production, so
There is considerable interest in identifying novel butyrophilin homologs. 47. PRO1305 Both industrial and academic efforts are currently underway to identify and characterize novel natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted protein, designated herein as the PRO1305 polypeptide.

48. The PRO1273 lipocalin protein family is a large group of small extracellular proteins. This family shows great diversity at the sequence level; however,
Most lipocalins share characteristically conserved sequence motifs. Lipocalins are known to be involved in retinol transport, latent coloration in invertebrates, olfactory and pheromone transport, and prostaglandin synthesis. Lipocalin is also involved in the regulation of cell homeostasis and modulation of immune responses and acts as a carrier protein in the general cleansing of endogenous and exogenous compounds. Flower, Biochem. J., 318 (Pt 1)
: 1-14 (1996): Flower, FEBS Lett., 354 (1): 7-11 (1994). Thus, members of the lipocalin protein family are of interest. 49. PRO1302 CD33 is a cell surface protein that is a member of the sialoadhesin family of proteins capable of mediating sialic acid-dependent binding with different specificities for both sialic acid type and its binding to near-terminal sugars. is there. CD
33 is specifically expressed in the early spinal cord and in several monocytic cell lines and has been shown to be strongly associated with various spinal cord tumors including, for example, acute non-lymphocytic leukemia (ANLL) . Thus, CD33 has been suggested as a potential target for the treatment of cancers associated with high level expression of proteins. CD33 One homologue is Takei
Et al., Cytogenet. Cell Genet. 78: 295-300 (1997). Other studies have described the use of CD33 monoclonal antibodies in acute bone marrow leukemia in bone marrow transplantation. Robertson et al., Prog. Clin. Biol. Res., 389: 47-63 (1994).
. In addition, studies have reported that members of the sialoadhesin contribute to a range of macrophage function both under normal conditions as well as during the inflammatory response. Crocker et al., G
lycoconj. J., 14 (5): 601-609 (1997). Furthermore, these proteins are involved in various biological processes such as hematopoiesis, neural development and immunity.
Kelm et al., Glycoconj. J., 13 (6): 913-926 (1996). Thus, due to sequence identity, C
Novel polypeptides related to D33 are of interest.

50. PRO1283 olfactory reception occurs by the interaction between odorants and chemoreceptive villi of olfactory receptor cells located in the nasal epithelium. Based on the diversity of nasal epithelium-associated odorant binding proteins, the mammalian olfactory system is able to recognize and distinguish many different odorant molecules. In this regard, a number of different odorant binding proteins and their encoding DNAs have recently been identified and characterized (Dear et al., Biochemistry 30: 10376-10382 (1991),
Pevsner et al., Science 241: 336-339 (1988), Buck et al., Cell 65: 175-187 (1991).
And Breer et al., J. Recept. Res., 13: 527-540 (1993)). Since the study of the mechanism of odorant detection by the mammalian olfactory system is of interest, the identification of odorant binding proteins is of considerable interest. Here we describe the identification and characterization of a novel polypeptide with homology to odorant binding proteins, designated herein as PRO1283 polypeptide. 51. PRO1279 protease is an enzymatic protein involved in many very important biological processes in mammalian and non-mammalian organisms. Many different protease enzymes from a variety of different mammalian and non-mammalian organisms have been identified and characterized, including serine proteases that exhibit specific activity against various serine-containing proteins. Mammalian protease enzymes play an important role in biological processes such as digestion, activation, inactivation of proteins, or modulation of peptide hormone activity, and modification of physical properties of proteins and enzymes. Neuropsin is a novel serine protease whose mRNA is expressed in the central nervous system. Mouse neuropsin has been cloned and studies have shown that it is involved in hippocampal plasticity. It has also been shown that neuropsin is associated with extracellular matrix modulation and cell migration. In general, Chen et al., Neurosci., 7 (2):
5088-5097 (1995) and Chen et al., J. Histochem. Cytochem., 46: 313-320 (1998).
See. We describe here the identification and characterization of a novel polypeptide with homology to the neuropsin protein, herein designated as PRO1279 polypeptide. 52. PRO1304 immunophilins are a family of proteins that function as receptors for immunosuppressive agents such as cyclosporin A, FK506 and rapamycin. Immunophilins occur in two distinct classes: (1) FK506-binding protein (FKBP), which binds FK506 and rapamycin, and (2) cyclophilin, which binds cyclosporin A. Regarding the FK506-binding protein, the FK506 / FKBP complex has been reported to have the function of inhibiting the activity of serine / threonine protein phosphatase 2B (calcineurin), thus leading to immunosuppressive activity. In addition, FKBP immunophilin has been found in the mammalian nervous system and has been reported to be involved in axon regeneration in the central nervous system through a mechanism independent of the process of immunosuppression (Gold, supra). Posted). Therefore, there is considerable interest in identifying novel polypeptides with homology to FKBP immunophilins. We describe here the identification and characterization of a novel polypeptide with homology to the FK506 binding protein, designated herein as PRO1304.

53. Identification of molecules whose expression is increased upon stimulation of leukocyte populations is of considerable interest, as insights into the structure and function of these molecules lead to a better understanding of intracellular and intercellular events associated with activation. . One such molecule, CD97, is a cell surface antigen that is immediately upregulated upon lymphocyte activation and has been the subject of several recent publications (Eicher et al., Tissue Antigens. (1997) 50 (5)
: 429-438; Aust et al., Cancer Res. (1997) 57 (9): 1798-1806). Leukocytes strongly positive for CD97 concentrate at sites of inflammation for CD97 expression in normal lymphoid tissue. CD97 alpha, a soluble subunit of CD97, was found in body fluids from inflamed tissues (Gray et al., J. Immunol. (1996) 157 (12): 5438.
-5447). 54. PRO1303 protease is an enzymatic protein involved in a number of very important biological processes in mammalian and non-mammalian organisms. Many different protease enzymes from a variety of different mammalian and non-mammalian organisms have been identified and characterized, including serine proteases that exhibit specific activity against various serine-containing proteins. Mammalian protease enzymes play an important role in biological processes such as digestion, activation, inactivation of proteins, or modulation of peptide hormone activity, and modification of physical properties of proteins and enzymes. Neuropsin is a novel serine protease whose mRNA is expressed in the central nervous system. Mouse neuropsin has been cloned and studies have shown that it is involved in hippocampal plasticity. It has also been shown that neuropsin is associated with extracellular matrix modulation and cell migration. In general, Chen et al., Neurosci., 7 (2):
5088-5097 (1995) and Chen et al., J. Histochem. Cytochem., 46: 313-320 (1998).
See. Other studies have shown that kindling affects neuropsin mRNA in the mouse brain.
It was reported to induce. Okabe et al. Brain Res., 728 (1): 116-120 (1996). In addition, studies have reported that reactive oxygen species generation plays an important role in neuropsin transcription in limbic regions associated with impairments in avoidance learning. Akita
Et al, Brain Res., 769 (1): 86-96 (1997). Thus, neuropsin and related proteins and drugs, including agonists and antagonists, are of interest.

55. The identification of proteins that play a role in PRO1306 mammalian diseases and disorders and lead to new therapeutic modalities is of great interest. Macrophage polypeptide, deintein (dai
ntain) / allogenic inflammatory factor 1 (deintein / AIF1) was identified in the pancreas of diabetic rats and was identified to directly influence insulin secretion. Deintein / AIF1 inhibits glucose-stimulated insulin secretion as well as the associated dysfunction of glucose clearance when injected intravenously at low doses in mice. At higher doses, deintein / AIF1 enhances glucose-stimulated insulin secretion and promotes glucose clearance. Therefore, Daintein / AIF1
Plays a role in the pathogenesis of insulin-dependent diabetes mellitus (Chen et al., Proc.
Natl. Acad. Sci. (1997) 94 (25): 13879-13884). AIF-1 is also involved in rat and human allogenic heart transplant rejection (Utans et al., Transplantation (
1996) 61 (9): 1387-1392), and may play a role in macrophage activation and functional expression (Utans et al., J. Clin. Invest. (1995) 95 (6): 2954-2962). 56. PRO1113 protein-protein interactions include those involved in receptor and antigen complexes and signaling mechanisms. As is well known for the structural and functional mechanisms underlying protein-protein interactions, protein-protein interactions are more easily engineered to regulate specific outcomes of protein-protein interactions. be able to. Therefore, the underlying mechanisms of protein-protein interactions are of interest to the scientific and medical community. All proteins, including leucine-rich repeats, are believed to be involved in protein-protein interactions. Studies have been reported on leucine-rich proteoglycans, which become tissue organizers that orient and direct collagen fibrils during ontogeny and are involved in pathological processes such as wound healing, tissue repair, and tumor stroma formation. Iozzo, RV, Crit. Rev. Biochem. Mol. Biol., 32 (2): 141
-174 (1997). Other studies showing the involvement of leucine-rich proteins in wound healing and tissue repair have been reviewed by De La Salle, C. et al., Vouv. Rev. Fr. Hematol. (Germany), 37 (4):
215-222 (1995) and reported a mutation in the leucine-rich motif in a complex associated with the bleeding disorder Bernard-Soulier syndrome, Chlemetson, KJ, Thr.
omb. Haemost. (Germany), 74 (1): 111-116 (July 1995), report that platelets have leucine-rich repeats. Other proteins reported to have leucine-rich repeats have been reported to be useful in the treatment of neurodegenerative diseases such as Alzheimer's disease, nerve damage such as Parkinson's disease, and for the diagnosis of cancer. SLIT protein. Artavanistsakonas, S. of Yale University and WO9210518 of Rothberg, JM
-See A1. The slit protein has been characterized, secreted by glial cells, and reported to be involved in the formation of the Drosophila axon pathway as well as in mediating extracellular protein interactions. Wharton and Crews, Mech. Dev., 40 (3): 141-154 9
1993; Rothberg and Artavanis-Tsakonas, J. Mol. Biol., 227 (2): 367-370 (19.
92); Rothberg et al., Genes Dev., 4 (12A): 2169-2187 (1990); and Rothberg et al., C.
ell, 55 (6): 1047-1059 (1988).

57. PRO1278 lysozyme is a secreted protein that mainly hydrolyzes [beta] 1,4-glucoside bonds between N-acetylmuramic acid and N-acetylglucosamine, which occur in the mucopeptide cell wall structure of certain microorganisms. Disassemble. Lysozyme is widely distributed in animals and plants. It is mammalian secretion and saliva, tears, milk, cervical mucus,
Found in tissues including white blood cells, kidneys, etc. The identification of novel members of the lysozyme family of proteins is of interest due to the various roles lysozyme plays in metabolic function and dysfunction. Abnormal levels of lysozyme are implicated in various disease states. Lysozyme is reported to have anti-microbial, analgesic, and anti-nociceptive properties.
Additional features and possible uses of lysozyme are described in US Pat. No. 5,618,712. 58. PRO1298 glycosylation can determine the fate of a protein, eg, whether it is secreted. Glycoproteins also play many structural and functional roles, especially as part of the cell membrane. Therefore, glycosylation is of interest. Studies on growth-related orientational regulation of early N-glycosylation genes in yeast have been reported. K
ukuruzinska and Lennon, Glycobiology, 4 (4): 437-443 (1994). Furthermore, the relationship between protein glycosylation and fatty acylation of glycoproteins was investigated in wild-type asparagine-associated glycosylation deletion mutations in yeast. Appukutt
an, FEBS Lett., 255 (1): 139-142 (1989). The biosynthesis of asparagine-related oligosaccharides in yeast was also studied using mutations. Jackson et al., Glycobiology, 3 (4):
357-364 (1993). Yeast mutants lacking protein glycosylation also show Huffacker and
Robbins, PNAS, 80 (24): 7466-7470 (1983).

59. PRO1301 cytochrome P450 proteins are a large class of monooxygenase enzymes involved in hydroxylation. The hydroxylation reaction is important in the synthesis of cholesterol and steroid hormones. Enzymes of the cytochrome P450 family play important roles in metabolic endogenous compounds such as arachidonic acid. These enzymes are also important in metabolism of foreign substances, for example, removal of drugs from the body [see, eg, Peterson, Aliment. Pharmacol. Ther., 9: 1-9 (1995)]. Furthermore, metabolites produced via the cytochrome P450 pathway also play a role in carcinogenesis, blood pressure regulation and renal function [eg, Rahman et al., Am. J. Hypertens., 10: 3.
56-365 (1997)]. 60. PRO1268 Both industrial and academic efforts are currently underway to identify and characterize novel natural transmembrane proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel transmembrane proteins. Here we describe the identification and characterization of a novel transmembrane polypeptide, designated herein as the PRO1268 polypeptide. 61. PRO1269 The most common type of white blood cell, granulocytes, is capable of mediating immune cytotoxicity against tumor cells and microorganisms. Therefore, identifying the various factors produced by these cells is of interest because of their potential use as pharmaceutical agents. Selsted patent application number WO9729765-A1 describes the identification of granulocyte peptide A isolated from bovine and mouse granulocytes. Several uses of these peptides have been identified, including therapeutic uses, agricultural uses, food preservatives, water treatments. 62. PRO1327 neurexophilin is a protein discovered as a neuronal glycoprotein that was purified with neurexin I during affinity chromatography on immobilized alpha-latrotoxin (Missle
R et al., J. Neurosci. 18: 3630-3638 (1998)). Recent data indicate that the mammalian brain contains four genes for neurexophyllin, the products of which are five domains: (1) N-terminal signal peptide, (2) variable N-terminal domain, (3) highly It was shown to have a common structure consisting of a conserved N-glycosylated central domain, (4) a short linker domain and (5) a conserved cysteine-rich C-terminal domain (Missler et al., Supra). . Furthermore, these data showed that neurexophyllin is proteolytically processed after synthesis and binding to alpha-neurexin. The structure and characteristics of neurexophylline are
It has been shown that they function as neuropeptides capable of signaling via alpha-neurexin. Therefore, the identification and characterization of novel polypeptides with homology to neuroxophyrin is of considerable interest. Here we describe the identification and characterization of a novel polypeptide with homology to neurexophyllin, designated herein as PRO1327 polypeptide.

63. PRO1382 cereverin is a secreted post-synaptic neuropeptide found throughout the brain.
The highest concentration of this protein was found in the cerebellum. It was also detected in the pituitary gland, spinal cord, and adrenal gland (Satoh et al., J. Endocrinol. (1997) 15491: 27-34). The possibility of using cereverin as a quantitative marker for experiments on maturation of Purkinje cells in the cerebellum and to chart neural development was reported (Slemmon et al., Pro
c Natl Acad. Sci. (1985) 82 (20): 7145-7148). Significant reductions in levels of cereverin were associated with spinocerebellar aggravation, olive pontine cerebellar atrophy (OPCAQ) and shy-
It was found in postmortem human brains from patients with Dräger syndrome, suggesting that cerberine plays an important pathophysiological role in these cerebellar diseases (Mizu.
No et al., Brain Res. (1995) 686 (1): 115-118; Mizuno et al., No To Shinkei (195) 4
7 (11): 1069-1074). In view of the importance of cerberine in neurodevelopment and neurological diseases and disorders, identification and characterization of members of this protein family are of interest (Yiangou et al., J. Neurochem (1989) 53 (3): 886-889 and Mugnaini et al. Synapse
(1988) 2 (2): 125-138). 64. PRO1328 Both industrial and academic efforts are currently underway to identify and characterize novel natural transmembrane proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel transmembrane proteins. Here we describe the identification and characterization of a novel transmembrane polypeptide, designated herein as the PRO1328 polypeptide. 65. PRO1325 Both industrial and academic efforts are currently underway to identify and characterize novel natural transmembrane proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel transmembrane proteins. Here we describe the identification and characterization of a novel transmembrane polypeptide, designated herein as the PRO1325 polypeptide.

66. PRO1340 cadherin is a major mediator of homotypic cellular recognition and is known to play a prominent role in the morphogenic detection of tissue development. Cadherins are a diverse family of proteins that have been identified in a variety of tissues, including neural tissue (Suzuki et al., Cell Regul., 2: 261-270 (1991)). Ksp-cadherin is a kidney-specific member of the cadherin polygene family (Thomson et al., Bio
L. Chem., 270: 17594-17601 (1995)). Cadherin is thought to play an important role in human cancer (Yap, Cancer Invest., 16: 252-261 (1998)).
. 67. The PRO1339 carboxypeptidase is of interest. Carboxypeptidase E was found to be involved in the biosynthesis of a wide range of peptide hormones. Fricker, Annu. Rev. Physio
L., 50: 309-321 (1988). This carboxypeptidase was associated with obesity.
Leiter, J. Endocrinol., 155 (2): 211-214 (1997). Carboxypeptidase M
Was reported as a marker for macrophage mutations. Krause et al., Immunol. R
ev., 161: 119-127 (1998). Human mast cell carboxypeptidase was reported to be associated with allergies. Goldstein et al., Monogr. Allergy, 27: 132-145 (1990).
. Carboxypeptidase A2 is also available in Faming et al., J. Biol. Chem, 266 (36): 24606-.
24612 (1991). Other carboxypeptidases of particular interest known in the art include human pancreatic carboxypeptidase 2, carboxypeptidase a1 and carboxypeptidase B. Therefore, new members of the carboxypeptidase family are of interest. 68. PRO1337 Of particular interest is the identification of blood-related proteins that have potential therapeutic applications or are useful in the diagnosis of blood-related disorders. Thyroxine-binding globulin (TBG) is synthesized by the liver and secreted into the bloodstream. It is the major thyroid hormone transport protein in human serum (Refetoff et al., Horm. Res. (1996) 45 (3-5): 1
28-138). It has been found that high serum levels of TBG cause hyperthyroxemia (Leahy et al., Postgrad Med. J. (1984) 60 (703): 324-327). Therefore, TB
The identification and characterization of G proteins is of interest (Flink et al. Proc. Natl. Ac
ad. Sci. USA (1986) 83 (20): 7708-7712; Bartalena et al., Acta Med. Austriaca,
(1988) 15 Suppl 1: 12-15), including identification of abnormal TBG proteins (R
efetoff, Endocr Rev. (1989) 10 (3): 275-293). Much effort has focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Examples of screening methods and techniques are described in the literature (eg Klein et al., Proc. Natl. Acad. Sci., 93: 7108-7113.
(1996); U.S. Pat. No. 5,536,637).

69. Both industrial and academic efforts are currently underway to identify and characterize novel natural transmembrane proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel transmembrane proteins. Here we describe the identification and characterization of a novel transmembrane polypeptide, designated herein as the PRO1342 polypeptide. 70. PRO1343 Both industrial and academic efforts are currently underway to identify and characterize novel natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted protein, herein designated as PRO1343 polypeptide. 71. PRO1480 semaphorins are a large family of transmembrane and secreted proteins, many of which are expressed in the nervous system. Members of the semaphorin family contain both ligands and receptors (Eckhardt et al., Mol. Cell. Neurosci., 9: 409-419 (1997).
)). Studies have revealed a role for semaphorins in embryonic movement and central nervous system axon guidance and synapse formation (Catalano et al., Mol. Cell. Neurosci., 11: 17).
3-182 (1998); Kitsukawa et al., Neuron, 19: 995-1005 (1997); Yu et al., Neuron, 20.
: 207-220 (1998)). Semaphorins have been shown to induce neuronal growth cone collapse and alter their in vivo pathway (Shoji et al., Development, 125: 1275-12.
83 (1998)). Members of the semaphorin family have been shown to be immunologically active and include the production of cytokines in human monocytes (Comeau et al., Immunity, 8:
473-482 (1998)). Semaphorins also play a role in cancer. Expression of the mouse semaphorin gene is known to be associated with translocation of mouse tumor cell lines (
Christensen et al., Cancer Res., 58: 1238-1244 (1998)).

72. PRO1487 is a protein that inhibits serrate-mediated activation of Notch in the dorsal compartment of the adult primordia of Drosophila wings (Fleming et al., Dev
elopment, 124 (15): 2973-81 (1997); Wu et al., Science (1996) 272 (5273): 355-3.
58). Fringe proteins are also involved in vertebrate development, where ectodermal apical thickening, which is essential for limb bud growth, involves interactions between dorsal cells that express fringe and those that do not (Wolpert, L .Philos Trans R Lond B Biol Sci (1998) 35
3 (1370): 871-857; Kengaku et al., Science (1998) 280 (5367 ': 1274-1277; Cohen.
Et al., Nat. Genet. (1997) 16 (3): 283-288; Johnson et al., Development (1997) 124.
(11): 2245-2254; Laufer et al., Nature (1997) 386 (6623): 366-373; Rodriguez-
See Esteban et al., Nature (1997) 386 (6623): 360-366). Fringe proteins are therefore of interest both for their role in development as well as for their ability to regulate the signaling capacity of serates, especially serates. Also of interest are novel polypeptides that play a role in the regulation of development and / or serate-like molecules. Of particular interest are novel polypeptides with fringe homology. 73. PRO1418 Both industrial and academic efforts are currently underway to identify and characterize novel, naturally occurring secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted protein, herein designated as PRO1418 polypeptide. 74. PRO1472 butyrophilin is a lactose glycoprotein that constitutes 40% or more of the total proteins bound to the fat globule membrane of mammalian milk. Butyrophilin mRNA expression correlates with the onset of milk fat production at the end of pregnancy and has been shown to be maintained throughout the lactation phase. Butyrophilin has been identified in bovine, mouse and human (Taylor et al., Biochim. Biophys. Acta 1306: 1-4 (1996), Ishii et al., Bio
Chim. Biophys. Acta 1245: 285-292 (1995), Mather et al., J. Dairy Sci. 76: 3832-
3850 (1993), Sato et al., J. Biochem., 117 (1): 147-157 (! 995) and Banghart et al., J.
Biol. Chem. 273: 4171-4179 (1998)), a type I transmembrane protein that is incorporated into fat globulin membranes. Butyrophilin may serve as a major scaffold for an assembly of complexes with xanthine dehydrogenase / oxidase and other proteins that function in germination and release of milk fat globule from the apical surface during lactation (Banghart et al., Supra). There is considerable interest in identifying novel butyrophilin homologues, since butyrophilin plays an apparently important role in mammalian milk production. Members of the butyrophilin family are Tazi-Ahnini et al., Immunogenetics, 47 (1): 55-63 (1997); Davey et al., Gene,
199 (1-2): 57-62 (1997); and Mather and Jack, J. Dairy Sci., 76 (12): 3832.
-3850 (1993).

75. PRO1461 protease is an enzymatic protein involved in numerous biological processes in mammalian and non-mammalian organisms, including digestion, protein activation and inactivation, peptide hormone modulation, and alteration of physical properties of proteins and enzymes. Is. Serine proteases comprise a large class of enzymes that show specific activity on various serine-containing proteins. Trypsin is a well-characterized serine protease that is synthesized in the pancreas and secreted in the small intestine, but hydrolyzes ingested proteins to tide bonds. Trypsin-like proteins have been characterized as cell surface proteins (Farley et al., Biochim Biophys Acta (1993) 1173 (3): 350-352; and Leyt.
et al., Biochemistry (1988) 27 (3): 1067-1074). These trypsin-like proteins are synthesized as membrane-bound precursors that mature into soluble and active proteases (Yamaoka et al., J. Biol. Chem. (1998) 273 (19): 11895-11901). Due to their importance in metabolism and other enzymatic processes, both industrial and academic efforts are currently underway to identify novel natural trypsin-like proteases. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel receptor proteins. 76. PRO1410 Both industrial and academic efforts are currently underway to identify and characterize novel natural transmembrane proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel transmembrane proteins. Here we describe the identification and characterization of a novel transmembrane polypeptide, designated herein as the PRO1410 polypeptide. 77. The PRO1568 tetraspanin (or tetraspan) family of proteins has grown to include approximately 20 known genes from various species. Tetraspanins are four transmembrane domain membrane-bound molecules, eg CD81, CD82, CD9, CD63, C.
D37 and CD53. Many of these proteins have the discriminative power of promiscuous binding with other molecules, including lineage-specific proteins, integrins, and other transpanins. In terms of function, they are involved in diverse processes such as cell activation and proliferation, adhesion and motility, differentiation and canceration. Some studies have implicated all these functions in the possibility that they act as "molecular facilitators", grouping-specific cell surface proteins, thus improving the formation and stabilization of functional signaling complexes. I advocate that. Maecker et al., FASEB, 11 (6): 428-4
2 (1997). Other studies have concluded that they are responsible for changes in cell morphology, cell-ECM adhesion and cell signaling. Skubitz et al., J. Immunology, 15
7: 3617-3626 (1996). Therefore, new members of this family are of interest.

78. PRO1570 protease is an enzymatic protein involved in numerous biological processes in mammalian and non-mammalian organisms, including digestion, protein activation and inactivation, peptide hormone modulation, and alteration of physical properties of proteins and enzymes. Is. Serine proteases comprise a large class of enzymes that show specific activity on various serine-containing proteins. Trypsin is a well-characterized serine protease that is synthesized in the pancreas and secreted in the small intestine, but hydrolyzes ingested proteins to tide bonds. Trypsin-like proteins have been characterized as cell surface proteins (Farley et al., Biochim Biophys Acta (1993) 1173 (3): 350-352; and Leyt.
et al., Biochemistry (1988) 27 (3): 1067-1074). Some of these trypsin-like proteins are synthesized as membrane-bound precursors that mature into soluble and active proteases (Yamaoka et al., J. Biol. Chem. (1998) 273 (19): 11895-11901). Of particular interest are the human colon cancer-derived serine proteases SP59, SP60 and SP67, which are useful in screening for specific inhibitors or modulators for use in the treatment of associated disease states and diseases related to these proteins. is there. In Japanese patent J 09149790-A, SP60 was identified and reported to have accession numbers P_W22986 and 233 amino acids. 79. The PRO1317 semaphorin family of glycoproteins plays an important role in nervous system development, particularly in axonal guidance. Semaphorins have been identified in the human immune system and are believed to play functional roles including B cell signaling (Hall et al., Proc. Natl. Acad. Sci. (19
96) 93 (21): 11780-50). The human semaphorin gene is disclosed in Japanese Patent J10155490-A, issued June 16, 1998, as being useful in the diagnosis of nervous system immune diseases. The identification of additional members of the semaphorin family is of interest. 80. Of particular interest are enzyme proteins involved in PRO1780 metabolic diseases or disorders. Enzymatic addition of sugars to fat-soluble chemicals is an important process that enhances their solubility in water and promotes their excretion. In mammals, glucuronic acid is the major sugar used to prevent metabolites and fat-soluble chemicals from reaching toxic levels in the body. The UDP glucuronosyl transferase that performs this reaction is
It is part of the superfamily of UDP glycosyltransferases found in animals, plants and bacteria. In the liver, UDP-glucuronosyltransferase is complexed with bilirubin. There are many conditions that affect UDP-glucuronosyl transferase activity resulting in uncomplexed hyperbilirubinemia.
These conditions are associated with Kriegler-Najjar syndrome (Jurgen et al., Biochem. J. (199
6) 314: 477-483) and genetic disorders such as Gilbert's syndrome, and acquired conditions such as Lucy-Driscoll syndrome. Therefore, the identification of novel members of the glucuronosyltransferase family is of interest (Tukey et al.,
J. Biol. Chem. (1993) 268 (20): 15260-6; and WO9212987-A).

81. PRO1486 cerebellum contains a hexadecapeptide called cereverin, which is conserved in the human-to-chicken lineage. Three independent overlapping cDNA clones were isolated in the human cerebellum library, which encode the cereverin sequence. The longest clone is 193, commonly referred to as pre-cerebrine or cereverin precursor
It encodes a protein of amino acids. This protein has significant similarity to the globular domain of the B chain of human complement component C1q. The region of relevance extends over approximately 145 amino acids located at the carboxyl terminus of both proteins. Unlike the C1qB chain, there is no collagen-like motif at the amino terminus of precereverin. Celeberine is believed not to be liberated from pre-cereverin by the classical dibasic amino acid proteolytic mechanism found in many neuropeptide precursors.
Cereberine precursors are involved in synaptic physiology. Urade et al., PNAS, USA, 83
(3): 1069-1073 (1991). Therefore, cereverin, its precursors, and related molecules, especially those having sequence identity with cereverin, are of interest. 82. PRO1433 Both industrial and academic efforts are currently underway to identify and characterize novel natural transmembrane proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel transmembrane proteins. Here we describe the identification and characterization of a novel transmembrane polypeptide, designated herein as the PRO1433 polypeptide.

83. The PRO1490 enzyme protein plays an important role in chemical reactions involved in food digestion, macromolecular biosynthesis, controlled release and utilization of chemical energy, and other processes required for life support. Acyltransferases are enzymes that acylate sites.
For example, an acyl-glycerol-phosphate acyltransferase can act on lysophosphatidic acid as a substrate. Lysophosphatidic acid is converted to phosphatidic acid and thus plays a role in the formation of phosphatidylethanolamine found in the membrane. In addition, 1-acyl-sn-glycerol-3-phosphate acyltransferase (LPAAT) is the preferred enzyme protein for medium length fatty acyl-coenzyme A substrates. Knutson et al., Plant Physiol., 1
09: 999-1006 (1995). Thus, acyltransferases play an important role in the biosynthesis of the molecules required for acylation. Here we name the PRO1490 polypeptide 1-acyl-s
The identification and characterization of a novel polypeptide homologous to the n-glycerol-3-phosphate acyltransferase protein is described. 84. PRO1482 Both industrial and academic efforts are currently underway to identify and characterize novel natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted protein, designated herein as the PRO1482 polypeptide. 85. PRO1446 Currently, both industrial and academic efforts are underway to identify and characterize novel natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted protein, designated herein as PRO14446 polypeptide.

86. The PRO1558 methyltransferase enzyme catalyzes the transfer of a methyl group from a donor molecule to an acceptor molecule. Methyltransferase enzymes play crucial roles in many different biological processes including, for example, electron transport chains in the prokaryotic plasma membrane and in the inner mitochondrial membrane of eukaryotic cells (eg Barkovich et al., J. .
Biol. Chem. 272: 9182-9188 (1997), Dibrov et al., J. Biol. Chem. 272: 9175-91.
81 (1997), Lee et al., J. Bacteriol., 179: 1748-1754 (1997), and Marbiois et al., A.
rch. Biochem. Biophys. 313: 83-88 (1994)). Methyltransferase enzymes have been shown to be essential for the biosynthesis of ubiquinone (coenzyme Q) and menaquinone (vitamin K2), both of which are required for the isoprenoid quinone component of the respiratory electron transport chain. Given the clear importance of the methyltransferase enzyme, the identification of a novel homologue of methyltransferase is of great interest. Here we describe the identification and characterization of a novel polypeptide homologous to the methyltransferase enzyme, designated herein as the PRO1558 polypeptide. 87. PRO1604 The identification of novel growth factors is of particular interest due to their role in inducing cell growth, proliferation and differentiation in both normal and abnormal states. Identification of growth factors that are over- or under-expressed in abnormal tissues (eg tumors) may lead to the development of diagnostic tools and therapeutics. Growth factors have been isolated from cell lines derived from liver cancer. The growth factor derived from liver cancer was isolated from the tissues of mouse (Japanese patent J09313185-A issued on Dec. 9, 1997) and human (Japanese patent J06343470-A issued on Dec. 20, 1994). Hepatoma-derived growth factors isolated from human hepatoma-derived cell lines have several tumor-derived cell lines,
And ubiquitously expressed in normal tissues (Nakamura et al., J.
Biol. Chem. (1994) 269 (40): 25143-9). Growth factors have been determined to be novel heparin-binding proteins that are mitogenic for fibroblasts.

88. The PRO1491 neuronal cell body is usually round like other cells. However, these cells also have structures called "processes" that grow from them to form synaptic connections. Some of these processes carry information from the cell body; sometimes over long distances. These long thin processes are axons.
Axons are thin, static tubes. Other processes carry information to or from the cell body. These short, usually thick processes are called dendrites. Both axons and dendrites are called neurites. During the developmental and developmental stages of neurons, neurites are formed by the growth cone. The growth cone is the growing tip of the neurite. The growth cone is flat and highly mobile. A new substance is added there, and further extension of axons begins. The control that the growth cone crawls the control establishes the axon and is therefore present. The growth cone has several identifiable parts. A thin, flat veil-like process that projects and degenerates from the leading edge is called lamellipodia. Needle-like processes that project and retract from the leading edge are called microprotrusions or filopodia. These are the structures involved in pushing the leading edge of the growth cone forward. Accurate route decisions of growth cones to their appropriate targets need to recognize and reflect the route decision cues in which they are in their immediate environment. Some of these cues promote extension to one region and others block extension to the other. Well-characterized molecules that promote neurite outgrowth in vitro include the extracellular matrix molecule laminin and the neuronal cell surface molecule L1 / G4 / 8D9. These molecules that promote neurite outgrowth are generally widely distributed in the body. Laminin immunoreactivity is reasonably spread to the developing central and peripheral nervous system. Similarly, L1 / G4 / 8D
9 is ubiquitous in the neuronal processes in the developing central nervous system, especially in long, protruding axons. Therefore, it is unclear whether known growth-promoting molecules play an important role in the self-specific selection that the growth cone determines between possible pathways. Nevertheless, their function is believed to provide a generally acceptable environment in which the growth cone extends and responds to more specific navigational cues. Among these more specific navigational cues are molecules that inhibit the motility of specific growth cones. Growth cones were observed to lose their motile morphology and cease to advance (frustrate) upon contact with other neurites of different types. In vitro territory formation may mean the emergence of processes leading to selective bundling in vivo. It has been observed that some growth cones crawl along specific axonal pathways or axon stereotypic sequences in the developing embryo. The specific motile inhibitory effect determines which of several alternative pathways elongates the growth cone. Growth cones are expected to grow preferentially in axons that do not induce their setbacks and avoid those that do. For example, it has been observed that sympathetic growth cones are inhibited or crushed when they come into contact with retinal neurites. Similarly, the growth cone of the retinal neurites will fail when it contacts the sympathetic neurites. Such cellular activity is achieved through the presence of receptors that are specifically responsive to specific growth inhibition cues by molecules that transmit specific growth cues. The cues are believed to be on the cell surface, especially the axon surface. When nerve damage occurs, repair is hampered or impossible because there are no neurites to replace the damaged axons or dendrites. If an elongating neurite is damaged, torn or destroyed, new neurites cannot grow out of the cell body to replace it. The presence of molecules that inhibit neurite outgrowth is thought to be responsible for the difficulty in neurite regeneration. Collapsin is a protein that functions to alter the activity of molecules that modulate growth cone elongation. Here we describe the identification and characterization of a novel polypeptide homologous to the collapsin protein, designated herein as PRO1491 polypeptide.

89. Transduction of PRO1431 intercellular signals is crucial for cellular processes such as differentiation, motility and division. Such signaling is thought to occur through cells in the form of complex interactions between proteins. Such protein-protein interactions are often mediated by modular domains within signaling proteins. As a result, signaling is currently modeled as a system by which the combined molecules, and the composition of the combination, determine the signal. Src homology domains (eg SH2 and SH3) are two domains found in the region of sequence similarity for proteins involved in signal transduction. Early work on the oncogenic tyrosine kinase Src identified the SH2 domain. Then
The SH2 and SH3 domains have been found in many diverse proteins, making them the most common form of structural motif. The SH2 and SH3 domains are modular, independently folding proteins that contain them, their secondary structure arranging the N- and C-termini spatially close to each other, allowing for the divergence of one protein to the next. At any of the N- to C-termini (Cohen et al., Cell, 80: 237).
-348, 1995). Earlier studies of mutating SH2 or SH3 showed that these two domains were important for function, but cloning of an unrelated family of signaling proteins such as RAS-GAP, and these domains Up to the Crk oncogene, which reveals a modular nature of. These latter experiments
It was shown that AS-GAP and Crk bind strongly to receptor tyrosine kinase upon ligand stimulation. Follow-up studies have shown that the mechanism of this binding is through the SH2 domain and that receptor autophosphorylation is required. These findings suggest that activation of receptor tyrosine kinases is a means of altering the binding mode of the intercellular domain, implying that receptor-SH2-containing protein interactions initiate a signaling cascade. The SH3 domain has a more general function than that intended for SH2. SH3
Binding proteins were isolated by screening a bacteriophage expression library with labeled SH3 domains. The results of these experiments showed that the SH3 domain binds short proline-rich polypeptides, especially the motif PxxP. Based on the knowledge at the time this patent application was prepared, the identified S
All H3 binding sites have the property of being proline rich. Binding of the SH3 domain is independent of covalent modifications of the binding site such as phosphorylation as occurred in the SH2 domain. As a result, SH3-ligand interactions are usually constitutive and not inducible, but there are exceptions. In general, the SH3 domain is less likely to act as a signal “switch” than as a means of assembly of protein complexes via intermediate affinity interactions. Also, such moderate affinity interactions mean that SH3 mediated interactions are of relatively short duration and are remodeled in response to changes in the concentration of the binding partner. Analysis of the binding properties of the SH2 and SH3 domains led to the proposal of compounds that block signal transduction. Peptidomimetic ligands based on the target protein sequences of the SH2 and Sh3 domains represent new lead compounds for the treatment of proliferative disorders that depend on constitutively activated tyrosine kinases (
For example, BCR / ABL in chronic myelogenous and acute leukemia or HER-2 / Neu in breast and ovarian cancer).

90. PRO1563 cellular disintegrins and metalloproteinases (ADAMs) are a family of genes with sequence similarities to those of snake venom metalloproteinases and disintegrins. The ADAMTS-1 gene is thrombospondin (TSP
) Encodes a novel ADAM protein in that it has a type I motif, and its expression is associated with inflammatory processes (Kuno et al., J. Biol. Chem. 273: 13912-13917 (1998),
Kuno et al., Genomics 46: 466-471 (1997) and Kuno et al., J. Biol. Chem. 272: 556-5.
62 (1997)). Expression of the ADAMTS-1 gene is induced by in vivo administration of lipopolysaccharide in the kidney and heart, suggesting a possible role in the inflammatory response. In this regard, it was suggested that the ADAMTS-1 protein may play a role in the progression of various inflammatory processes and cancer cachexia (Kuno et al., 1998, supra). Here we name the PRO1563 polypeptide, ADAM
The identification and characterization of a novel polypeptide homologous to the TS-1 protein is described. 91. PRO1565 chondromodulin is a chondrogenic matrix component that synergistically stimulates chondrocyte growth and differentiation (Suzuki, Connect. Tissue Res. 35: 3).
03-307 (1996)). More particularly, chondromodulin-I acts to inhibit vascular endothelial cell proliferation and tube formation, thereby stimulating cartilage growth and functioning to inhibit cartilage replacement by bone in the early stages of bone. To do. Chondromodulin-II
It cannot inhibit angiogenesis like chondromodulin-I, but also functions to stimulate osteoclast differentiation and cartilage growth. Thus, these two polypeptides are essential for the regulation of cartilage and endochondral bone structure formation. Given the crucial physiological role played by chondromodulin proteins, there is considerable interest in identifying and characterizing novel polypeptides homologous to gills. We name here PRO1565, chondromodulin-
Described herein is the identification and characterization of novel polypeptides having homology to I.

92. PRO1571 Clostridium perfringens enterotoxin (CPE) is a C.I. It is considered to be a virulence factor that causes the symptoms of food poisoning of Perfringens type A,
It may also be associated with other human and veterinary diseases (McClane, Toxicon.
34: 1335-1343 (1996)). CPE binds to a cell surface receptor protein of about 50 kD called Clostridium perfringens enterotoxin receptor (CPE-R), and forms a complex of about 90,000 kD on the cell surface, thereby damaging the harmful cells. Exert function. C that encodes the CPE-R protein
DNA has been identified and characterized in both humans and mice (Katahir
a et al., J. Cell. Biol. 136: 1239-1247 (1997) and Katahira et al., J. Biol. Chem.
272: 26652-26658 (1997)). CPE toxins have been reported to be responsible for various diseases in the mammalian host, and these diseases are initiated by the binding of CPE toxins to CPE-R, thus identifying novel CPE-R homologues. Is quite interested. We describe here the identification and characterization of a novel polypeptide with homology to CPE-R, designated herein as PRO1571. 93. PRO1572 Clostridium perfringens enterotoxin utilizes two structurally related membrane proteins as functional receptors in vivo. Human and mouse cDNAs homologous to the Clostridium perfringens enterotoxin receptor (CPE-R) were identified by Katahira et al., J. Cell. Biol. 136: 1239-1247 (1
997) and Katahira et al., J. Biol. Chem. 272: 26652-26658 (1997). They have been classified into two groups, the Vero cell CPE receptor homolog and the rat androgen withdrawal apoptosis protein (RVP1). Therefore, these receptors are of interest as related molecules. Of particular interest is the use of these receptors and related molecules in identifying modulators of these receptors. Also of interest are members of the Claudin family and related molecules. Claudin is a complete membrane protein located in the tight junction and has no sequence similarity to occludin. Furuse et al., J. Cell Biol., 141 (7
): 1539-50 (1998).

94. PRO1573 Clostridium perfringens enterotoxin utilizes two structurally related membrane proteins as functional receptors in vivo. Human and mouse cDNAs homologous to the Clostridium perfringens enterotoxin receptor (CPE-R) were identified by Katahira et al., J. Cell. Biol. 136: 1239-1247 (1
997) and Katahira et al., J. Biol. Chem. 272: 26652-26658 (1997). They have been classified into two groups, the Vero cell CPE receptor homolog and the rat androgen withdrawal apoptosis protein (RVP1). Therefore, these receptors are of interest as related molecules. Of particular interest is the use of these receptors and related molecules in identifying modulators of these receptors. Also interesting is the ventral prostate. 1 protein (RVP.1), which is transcriptionally induced in the regressing rat prostate after castration. This protein is further described in Peacock et al., Genomics, 46 (3): 443-9 (1997). 95. PRO1488 Clostridium perfringens enterotoxin utilizes two structurally related membrane proteins as functional receptors in vivo. Human and mouse cDNAs homologous to the Clostridium perfringens enterotoxin receptor (CPE-R) were identified by Katahira et al., J. Cell. Biol. 136: 1239-1247 (1
997) and Katahira et al., J. Biol. Chem. 272: 26652-26658 (1997). They have been classified into two groups, the Vero cell CPE receptor homolog and the rat androgen withdrawal apoptosis protein (RVP1). Therefore, these receptors are of interest as related molecules. Of particular interest is the use of these receptors and related molecules in identifying modulators of these receptors. Both industrial and academic efforts are currently underway to identify and characterize novel natural receptor proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. 96. PRO1489 Clostridium perfringens enterotoxin (CPE) is a C.I. It is considered to be a virulence factor that causes the symptoms of food poisoning of Perfringens type A,
It may also be associated with other human and veterinary diseases (McClane, Toxicon.
34: 1335-1343 (1996)). CPE binds to a cell surface receptor protein of about 50 kD called Clostridium perfringens enterotoxin receptor (CPE-R), and forms a complex of about 90,000 kD on the cell surface, thereby damaging the harmful cells. Exert function. C that encodes the CPE-R protein
DNA has been identified and characterized in both humans and mice (Katahir
a et al., J. Cell. Biol. 136: 1239-1247 (1997) and Katahira et al., J. Biol. Chem.
272: 26652-26658 (1997)). CPE toxins have been reported to be responsible for various diseases in the mammalian host, and these diseases are initiated by the binding of CPE toxins to CPE-R, thus identifying novel CPE-R homologues. Is quite interested. We describe here the identification and characterization of a novel polypeptide with homology to CPE-R, designated herein as PRO1489.

97. PRO1474 avian egg white is a rich source of protein inhibitors of proteinases belonging to all four mechanistic classes. Ovomucoids and ovo-inhibitors are multi-domain casal-type inhibitors, each domain having an actual or putative reaction site for serine proteinases. Cystatin is a cysteine proteinase inhibitor, whereas ovostatin inhibits proteinases in all four mechanistic classes. For a review of these inhibitors, see Saxena and Tayyab, Cell Mol. Life Sci., 53 (1).
: See 13-23 (1997). Novel members of proteinase protein inhibitors,
Of particular interest are those that have sequence identity with known inhibitors such as ovomucoid. Serine protease inhibitors are of general interest. Serine proteases such as neuropsin have been shown to be associated with extracellular matrix modifications and cell migration. Generally, Chen et al., Neurosci., 7 (2): 5088-5097 (1995) and Chen et al., J.
See Histochem. Cytochem., 46: 313-320 (1998). Another serine protease, enamel matrix serine proteinase, is involved in the decomposition of tooth organic matter. Smith et al., J. Dent. Res., 77 (2): 377-386 (1998), Overall and Limeback, Bi.
ochem J., 256 (3): 965-972 (1988), and Moradian-Oldak, Connect. Tissue Re.
s., 35 (1-4): 231-238 (1996). Therefore, inhibitors of these proteinases are
It is interesting when these mechanisms require control. 98. PRO1508 Both industrial and academic efforts are currently underway to identify and characterize novel natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted protein, designated herein as the PRO1508 polypeptide. 99. PRO1555 Both industrial and academic efforts are currently underway to identify and characterize novel natural transmembrane proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel transmembrane proteins. Here we describe the identification and characterization of a novel transmembrane polypeptide, designated herein as the PRO1555 polypeptide.

100. PRO1485 lysozyme is a secreted protein, and [beta] 1 of N-acetylmuramic acid and N-acetylglucosamine that occurs in the mucopeptide cell wall structure of certain microorganisms.
It mainly hydrolyzes 4,4-glucosidic bonds. Lysozyme is widely distributed in animals and plants. It has been found in tissues including mammalian secretions and saliva, tears, milk, cervical mucus, white blood cells, kidneys and the like. The identification of novel members of the lysozyme family of proteins is of interest due to the various roles lysozyme plays in metabolic function and dysfunction. Abnormal levels of lysozyme are implicated in various disease states. Lysozyme is reported to have anti-microbial, analgesic, and anti-nociceptive properties. Additional features and possible uses of lysozyme are described in US Pat. No. 5,618,712. Of particular interest is lysozyme C, which is employed as a digestive enzyme in the stomach of organisms in need of recovering nutrients from the microorganisms of fermented foods. For the history of lysozyme C and related proteins, see Qasba and Kumar, Crit. Rev. Biochem. Mo.
l. Biol., 32 (4): 255-306 (1997); Irwin, EXS, 75: 347-361 (1996). 101. PRO1564 glycosylation is a common and complex form of post-translational protein modification. Many of the unique structures that exist are known, and their number is increasing, but most arise from a series of common synthetic intermediates that differ in their terminal glycosyltransferases, oligosaccharide acceptors and present. Recognize both protein features.
UDP-N-acetyl-alpha-D-galactosamine: polypeptide N-acetylgalactosaminyltransferase is an O-glycosyl specific for serine and threonine amino acids in proteins by the addition of N-acetylgalactosamine to the hydroxyl group of amino acids. It is an enzyme protein that initiates oxidization. Since many important biological and physiological events are regulated by glycosylation, there is considerable interest in identifying and characterizing novel polypeptides with homology to known glycosylated proteins. Here we describe the identification and characterization of a novel polypeptide homologous to the N-acetylgalactosaminyltransferase protein, designated herein as PRO1564 polypeptide. 102. PRO1755 Both industrial and academic efforts are currently underway to identify and characterize novel natural transmembrane proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel transmembrane proteins. Here we describe the identification and characterization of a novel transmembrane protein, designated herein as PRO1755 polypeptide.

103. PRO1757 Both industrial and academic efforts are currently underway to identify and characterize novel natural transmembrane proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel transmembrane proteins. Here we describe the identification and characterization of a novel transmembrane protein, designated herein as PRO1757 polypeptide. 104. PRO1758 Both industrial and academic efforts are currently underway to identify and characterize novel natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we describe the identification and characterization of a novel secreted protein, designated herein as the PRO1758 polypeptide. 105. PRO1575 protein disulfide isomerase (PDI) is a human serum albumin (HS
It is an enzyme that promotes the formation of disulfide bonds in A). Therefore, PDI helps to form the overall structure of human serum albumin. Co-expression of PDI and human serum albumin increases HSA secretion by reducing the chance of degradation by HSA structural destabilizing cellular proteases. Co-expression of PDI and HSA improved localization in the prokaryotic endoplasmic reticulum (Hayano et al., EP-50941-A (1992)).
The beta-units of PDI and human prolyl 4-hydroxylase have been shown to be products of the same gene (Pihlajaniemi et al., EMBO J., 6: 643-49 (1987).
). Furthermore, the CGHC-containing active site sequence of PDI was found in many luminal endoplasmic reticulum proteins, Erp72 (Mazzarella et al., J. Biol. Chem., 2: 1094-1101 (19
90)). Both industrial and academic efforts are currently underway to identify and characterize novel natural receptor proteins. Much of the effort has focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel receptor proteins. 106. PRO1787 Multiple novel MPZ (P0) point mutations cause sporadic dujurine-sotta (DD)
S) Specified in the case. Warner et al., Hum. Mutat., 10 (1): 21-4 (1997). DD
S is a severe demyelinating peripheral nerve disease that develops in infancy, with mutations in either PMP22 or MPZ. In addition, a mutational analysis of the MPZ, PMP22 and Cx32 genes in Spanish ancestors with Charcot-Marie-Tooth disease and patients with pressure-paralysis-dependent genetic neuropathies has been reported. Bort et al., Hum. Genet., 99 (6): 746-54 (1997). Myelin glycoprotein P0 has also been reported in other studies (Blanquet-Grossard
Et al, Clin. Genet., 48 (6): 281-3 (1995), Hayasaka et al., Nat. Genet., 5 (1): 31
04 (1993) and Saavedra et al., J. Mol. Evol., 29 (2): 149-56 (! 989)). Therefore, proteins belonging to the myelin p0 family are of interest.

107. PRO1781 Both industrial and academic efforts are currently underway to identify and characterize novel natural transmembrane proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel transmembrane proteins. Here we describe the identification and characterization of a novel transmembrane protein, designated herein as PRO1781 polypeptide. 108. PRO1556 Both industrial and academic efforts are currently underway to identify and characterize novel natural transmembrane proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel transmembrane proteins. Here we describe the identification and characterization of a novel transmembrane protein, designated herein as the PRO1556 polypeptide. 109. PRO1759 Both industrial and academic efforts are currently underway to identify and characterize novel natural transmembrane proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel transmembrane proteins. Here we describe the identification and characterization of a novel transmembrane protein, designated herein as PRO1759 polypeptide. 110. PRO1760 Both industrial and academic efforts are currently underway to identify and characterize novel natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we name it PRO1760,
The identification and characterization of a novel secreted protein is described.

111. PRO1561 phospholipase A2 (PLA2) is a protein that hydrolyzes 2-acyl ester bonds of phospholipids, an example of which includes cytosolic PLA2 secreting PLA2, which are clearly distinguishable. Cytosolic PLA2 (cPLA2) is known to selectively hydrolyze phospholipids containing arachidonic acid esterified at the 2-position. Given these important biological activities, phospholipase A
The identification and characterization of novel polypeptides with homology to the two proteins is of great interest. Here we name the PRO1561 phospholipase A
The identification and characterization of a novel polypeptide homologous to 2 is described. 112. PRO1567 colon-specific genes (CSG) and their expression products are described in published international application WO
9639419. They are useful as diagnostic markers for colon cancer and metastases to colon cancer and can also be used for screening potential pharmaceuticals and diagnostic agents. CSG
The identification of new members of the family is of interest. 113. PRO1693 insulin-like growth factor has both growth promoting and insulin-like activity. There are two well characterized plasma IGF binding proteins in humans. The larger proteins are 53K acid-labile proteins that are thought to constitute IGF-I or IGF-II, mostly circulating in a 125-150 kD complex, the binding protein itself and a molecular weight of approximately 100 kD. It is an acid-labile non-IGF binding protein. The smaller protein is 28 in its non-reduced form.
K, has an apparent molecular weight of 34K in the reduced state. These IGF binding proteins have been shown to play an important role in the physiological activity carried by insulin-like or growth factor proteins. Thus, the identification and characterization of novel polypeptides with homology to insulin-like growth factor binding proteins is of great interest. Here we describe the identification and characterization of a novel polypeptide homologous to the insulin-like growth factor binding protein, designated herein as PRO1693. 114. PRO1784 Both industrial and academic efforts are currently underway to identify and characterize novel natural transmembrane proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel transmembrane proteins. Here we describe the identification and characterization of a novel transmembrane protein, designated herein as PRO1784 polypeptide. 115. The PRO1605 N-acetylglucosaminyl transferase protein comprises a family of enzymes that confers a variety of important biological functions in mammalian organisms. As an example, U
DP-N-acetylglucosamine: alpha-3-D-mannoside beet-1,2-N-
Acetylglucosaminyltransferase I is an enzymatic protein that catalyzes the first step essential for the conversion of higher-mannose-N-glycans into hybrid and complex N-glycans (Sarkar et al., Proc. Natl. Acad. Sci. USA. 88: 234-238 (1
991)). Given the clear importance of the N-acetylglucosaminyl transferase enzyme, the identification and characterization of novel polypeptides with homology to the N-acetylglucosaminyl transferase protein is of great interest. Here we describe the identification and characterization of a novel polypeptide homologous to the N-acetylglucosaminyl transferase protein, designated herein as the PRO1605 polypeptide.

116. PRO1788 protein-protein interactions include those involved in receptor and antigen complexes and signaling mechanisms. As is well known for the structural and functional mechanisms underlying protein-protein interactions, protein-protein interactions are more easily engineered to regulate specific outcomes of protein-protein interactions. be able to. Therefore, the underlying mechanisms of protein-protein interactions are of interest to the scientific and medical community. All proteins, including leucine-rich repeats, are believed to be involved in protein-protein interactions. Leucine-rich repeats are short sequence motifs that are present in many proteins and cell locations with diverse functions. The crystal structure of the ribonucleic acid inhibitor protein revealed that leucine-rich repeats correspond to beta-alpha structural units. These units are arranged so that one side forms a parallel beta sheet that is exposed to the solvent and the protein acquires an unusual non-spherical shape. These two features have been shown to be responsible for the protein binding function of proteins containing leucine rich repeats. Kobe and Deisenhofer, T
See rends Biochem. Sci., 19 (10): 415-421 (Oct. 1994). Studies have been reported on leucine-rich proteoglycans, which become tissue organizers that orient and direct collagen fibrils during ontogeny and are involved in pathological processes such as wound healing, tissue repair, and tumor stroma formation. Iozzo, RV
., Crit. Rev. Biochem. Mol. Biol., 32 (2): 141-174 (1997). Other studies showing the involvement of leucine-rich proteins in wound healing and tissue repair have been reviewed by De La Salle, C.
Et al., Vouv. Rev. Fr. Hematol. (Germany), 37 (4): 215-222 (1995), who have reported a mutation in the leucine-rich motif in the complex associated with the bleeding disorder Bernard-Soulier syndrome. , Chlemetson, KJ, Thromb. Haemost. (Germany), 74 (1):
111-116 (July 1995) reported that platelets have leucine-rich repeats, WO 9110 of Ruoslahti, EI et al. Of La Jolla Cancer Research Foundation.
727-A reports that decorin, which binds to transforming growth factor β, is involved in cancer treatment, wound healing and scarring. Useful in wound healing and associated treatments related to regrowth of tissues such as connective tissue, skin and bone; in promoting body growth in humans and animals; and in stimulating other growth-related processes In one regard, it is insulin-like growth factor (IGF) that is functionally associated with this group of proteins. The acid-labile subunit of IGF (ALS) is also interesting in that it increases the half-life of IGF and is part of the IGF complex in vivo.
Ollendorff, V., et al., Cell Growth Differ., 5 (2): 213-219 (February 1994), G
The ARP gene was identified, which encodes human GP Ib alpha and GP V platelet proteins and a leucine-rich repeat-containing protein with structural similarities to the Drosophila Chaoptin, Toll, and offspring nectin adhesion molecules. Other proteins reported to have leucine-rich repeats have been reported to be useful in the treatment of neurodegenerative diseases such as Alzheimer's disease, nerve damage such as Parkinson's disease, and for the diagnosis of cancer. SLIT protein. WO 9210518-A from Artavanistsakonas, S. of Yale University and Rothberg, JM
See 1. Of particular interest is LIG-1, a membrane glycoprotein that is specifically expressed in glial cells of mouse brain and has leucine-rich repeats and immunoglobulin-like domains. Suzuki et al., J. Biol. Chem. (US), 271 (37): 22522 (1996). Other studies reporting the biological function of proteins with leucine-rich repeats include: Tayar, N. et al., Mol. Cell Endocrinol., (Ireland), 125 (1-2): 65-70 (Dec .1996
) (Gonadotropin receptor related); Miura, Y. et al., Nippon Rinsho (Japan), 54 (7)
: 1784-1789 (July 1996) (apoptosis related); Harris, PC et al., J. Am. Soc. Nephro
l., 6 (4): 1125-1133 (Oct. 1995) (related to renal disease); and Almeida, A., et al., Oncogene.
16 (23): 2997-3002 (June 1998) (related to malignant glioma).

117. PRO1801 interleukin-10 (IL-10) is a pleiotropic immunosuppressive cytokine and has been implicated as an important regulator of bone marrow and lymphoid cell function. IL-
10 has been shown to function as a potent inhibitor of synthetic activation of various inflammatory cytokines including, for example, IL-1, IL-6, IFN- and TNF- (Ge.
Sser et al., Proc. Natl. Acad. Sci. USA 94: 14620-14625 (1997)). Furthermore, I
L-10 was shown to strongly inhibit some of the accessory activities of macrophages, thereby functioning as a potent suppressor of effector function of macrophages, T cells and NK cells (Kuhn et al., Cell 75: 263-. 274 (1993)). Furthermore, IL-
10 is strongly associated with the regulation of B cell, mast cell and thymocyte differentiation. IL-10 was independently identified from two separate experimental systems. First, mouse IL-1
A cDNA clone encoding 0 was identified based on the expression of a cytokine synthesis inhibitor (Moore et al., Science 248: 1230-1234 (1990)), followed by human IL-10-corresponding cDNA followed by a crossover with mouse IL-10 cDNA. It was identified by hybridization (Viera et al., Proc. Natl. Acad. Sci. USA 88: 1172-1176 (1991)).
Furthermore, IL-10 was independently identified as a B cell-derived mediator that functions to co-stimulate the active thymus (Suda et al., Cell Immunol., 129: 228 (1990)).
. Recently, a novel cytokine polypeptide that is a member of the IL-10-related cytokine family has been identified and characterized. This novel secretory cytokine is named IL-19 and is a 177 amino acid polypeptide having a molecular weight of approximately 20.4 kD (see WO 98/08870 issued Mar. 5, 1998). IL-19 is specifically expressed by activated monocytes, and increased and / or decreased levels of IL-19 are associated with one or more physiological disorders associated with increased or decreased levels of cytokine production ( See WO 98/08870). In particular, it has been suggested that IL-19 can inhibit the synthesis of inflammatory cytokines by cells of the immune system. Various cytokine polypeptides, more particularly IL-10 and potentially IL-
Given the apparent importance of immunosuppressive cytokines such as 19, IL-1
Identification and Characterization of Novel Cytokine Polypeptides with Homology to 0 and / or IL-19 Teeth Of Great Interest. Here we describe the identification and characterization of a novel polypeptide with homology to IL-19, designated herein as PRO801 polypeptide.

118. UCP4 unbinding proteins or "UCPs" are believed to play a role in metabolic processes and have been reported in the literature. UCP was first found and described in brown adipocytes of hibernating animals such as bears. UCP aids in such hibernation and other cold climate-adapted animals maintain core body temperature in cold climates by increasing their body's dormant metabolic rate. Since humans have relatively little brown adipose tissue, UCP was initially thought to play a secondary role in human metabolism. Several different human non-binding proteins have been described to date [see generally Gura, Science, 280: 1369-1370 (1998)]. A human non-binding protein called UCP1 was identified by Nicholls et al. In Nicholls et al., The inner membrane of brown adipocyte mitochondria is highly protein permeable, and the experimenter followed the protein permeability called UCP1 observed in the mitochondrial membrane. Nicholls et al. Have shown that UCP1 has a large number of A that are made from food sources due to its permeability like tissue factor.
They reported that TP was reduced and body metabolism was increased to generate heat [Nichols et al., P.
hysiol. Rev., 64: 1-64 (1984)]. It was later found that UCP1 is expressed only in brown adipose tissue [Bouillaud
Et al., Proc. Natl. Acad. Sci., 82: 445-448 (1985); Jacobsson et al., J. Biol. Ch.
em., 260: 16250-16254 (1985)]. Gene mapping studies show that human UCP1
The gene has been shown to be located on chromosome 4 [Cassard et al., J. Cell. Biochem.,
43: 255-264 (1990)]. Another human UCP called UCPH or UCP2 has also been described. [Gimeno
Et al., Diaberes, 46: 900-906 (1997); Fleury et al., Nat. Genet., 15: 269-272 (19
97); Boss et al., FEBS Letters, 408-: 39-42 (1997); See also Wolf, Nutr. Rev., 55:
178-179 (1997)]. In Fleury et al., UCP2 protein is UCP1 and 59
With a% amino acid sequence identity, UCP2 was taught to map to a region of human chromosome 11 associated with hyperinsulinemia and obesity [Fleury et al., Supra]. It was also reported that UCP2 is expressed in various adult tissues such as brain and muscle and adipocytes [Gimeno et al., Supra, and Fleury et al., Supra]. UCP3, the third human UCP, is described by Boss, supra; Vidal-Puig et al., Biochem. B.
iophys. Res. Comm., 235: 79-82 (1997); solanes et al., J. Biol. Chem., 272: 2
5433-25436 (1997); and Gong et al., J. Biol. Chem., 272: 24129-24132 (1997).
[See also British Patent No. 9716886]. Solanes etc. are UCP1 and UCP
Unlike 2, UCP3 was expressed predominantly in human skeletal muscle, and the UCP3 gene was mapped to and on chromosome 11 adjacent to UCP2. Gong is U
It has been described that CP3 expression can be regulated by known pyrogenic stimuli such as thyroid hormone, beta 3-andrenergic agonists and leptin [Gong et al., Supra].

119. PRO193 Both industrial and academic efforts are currently underway to identify and characterize novel natural transmembrane proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel transmembrane proteins. Here we describe the identification and characterization of a novel transmembrane protein, designated PRO193 here. 120. Polypeptides such as PRO1130 human 2-19 protein function as cytokines. Cytokines are low molecular weight proteins that stimulate or inhibit differentiation, proliferation or immune cell function. Cytokine proteins act as intercellular messengers and often have multiple physiological effects. Given the physiological heavy oiliness of the immune system in vivo, efforts are currently underway to identify new and naturally occurring proteins involved in the effects on the immune system. We describe here the identification of novel polypeptides with sequence similarity to the human 2-19 protein. 121. PRO1335 decarboxylase is an enzymatic protein whose purpose is the transport and release of carbon dioxide in the mammalian blood system by catalyzing the synthesis (and dehydration) of carbonic acid from (and to) carbon dioxide and water. Thus, the action of decarboxylase is required for various important physiological responses in mammals. Thus, the identification and characterization of novel polypeptides homologous to decarboxylase is of great interest. Here we describe the identification and characterization of a novel polypeptide homologous to decarboxylase, designated herein as PRO1335.

122. PRO1329 Both industrial and academic efforts are currently underway to identify and characterize novel natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we name it PRO1329,
The identification and characterization of a novel secreted protein is described. 123. PRO1550 Both industrial and academic efforts are currently underway to identify and characterize novel natural secreted proteins. Many of these efforts have focused on screening mammalian recombinant DNA libraries to identify coding sequences for novel secreted proteins. Here we name it PRO1550,
The identification and characterization of a novel secreted protein is described.

(Outline of the Invention) 1. PRO1560 A cDNA encoding a novel polypeptide named "PRO1560" in this application and considered to be a novel member of the tetraspan family.
A clone (DNA19902-1669) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1560 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1560 polypeptide having amino acid residue 1 of Fig2 (SEQ ID NO: 4) or a sequence of about 43 to about 245, or (b) ( At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% to the complement of the DNA molecule of a). It comprises DNA with% sequence identity. In another aspect, the invention features residues 167 to about 77 of Figure 1 (SEQ ID NO: 3).
5 relates to an isolated nucleic acid molecule encoding a PRO1560 polypeptide that comprises DNA that hybridizes to the complement of 5 nucleic acids. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA19902-1669) of ATCC Deposit No. 203454, or (b) the complement of the DNA molecule of (a). Against
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203454 (DNA19902-1669). In a yet further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence with amino acid residue 1 of Fig2 (SEQ ID NO: 4) or the sequence from about 43 to about 245. DNA comprising a polypeptide having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) complement of DNA of (a). To an isolated nucleic acid molecule. In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO156 having the sequence of amino acid residues from about 1 or from about 43 to about 245 of Fig2 (SEQ ID NO: 4).
At least about 80 relative to (a) or (b) by hybridizing under stringent conditions with a DNA molecule encoding the 0 polypeptide, or (b) the complement of the DNA molecule of (a). Isolate a test DNA molecule if it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. At least about 50 nucleotides, preferably at least about 10 nucleotides produced by
It relates to an isolated nucleic acid molecule having 0 nucleotides.

In a particular embodiment, the invention provides an isolated nucleic acid molecule comprising a DNA encoding a PRO1560 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and its soluble, ie A variant is provided in which the transmembrane domain has been deleted or inactivated, or is complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 42 in the sequence of Figure 2 (SEQ ID NO: 4). The transmembrane domain has been tentatively identified as being located at about amino acid positions 19-42, 61-83, 92-114, and 209-230 of the PRO1560 amino acid sequence (Fig2, SEQ ID NO: 4). In another aspect, the invention provides (a) residue 1 or about 43 of Fig2 (SEQ ID NO: 4).
To at least about 80% positive when compared to about 245 amino acid sequences,
Preferably at least about 85% positive, more preferably at least about 90%
A DNA molecule encoding a polypeptide positive, most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising (b) (a) the complement of the DNA molecule. Another embodiment is a PR that finds use as a hybridization probe.
It relates to fragments of the O1560 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long. In another embodiment, the invention provides an isolated PRO1560 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1560 polypeptide, which in certain embodiments comprises residue 1 of Fig2 (SEQ ID NO: 4) or an amino acid comprising from about 43 to about 245. Contains an array. In another aspect, the invention features amino acid residue 1 or about 4 of Fig2 (SEQ ID NO: 4).
3 to about 245 sequences, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%. It relates to an isolated PRO1560 polypeptide comprising an amino acid sequence having sequence identity. In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to the amino acid sequence of residue 1 or about 43 to about 245 of Fig2 (SEQ ID NO: 4), more preferably It relates to an isolated PRO1560 polypeptide which comprises an amino acid sequence with a score of at least about 90% positive, and most preferably at least about 95% positive.

In yet another aspect, the invention provides amino acid residue 1 of Fig2 (SEQ ID NO: 4) or the sequence from about 43 to about 245, or sufficient thereof to provide a binding site for an anti-PRO1560 antibody. It relates to an isolated PRO1560 polypeptide comprising a fragment. Preferably, the PRO1560 fragment retains the qualitative biological activity of the native PRO1560 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig2
PR having a sequence of about 1 or about 43 to about 245 amino acid residues of (SEQ ID NO: 4)
A DNA molecule encoding the O1560 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule is at least about about the same as (a) or (b). (Ii) test if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. DNA
A host cell containing the molecule is cultured under conditions suitable for expression of the polypeptide, and (i
ii) Providing the polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1560 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1560 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1560 polypeptide by contacting the native PRO1560 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising a PRO1560 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier. 2. PRO444 A cDNA clone (DNA26846-1393) has been identified that encodes a novel secreted polypeptide designated "PRO444" in this application. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO444 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO444 polypeptide having the sequence from about amino acid residue 1 or about 17 to about 117 of Fig4 (SEQ ID NO: 6), or (b) At least about 80% sequence identity to the complement of the DNA molecule of (a), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about. It comprises DNA with 95% sequence identity.

In another aspect, the invention features residues from about 656 to about 95 of Fig3 (SEQ ID NO: 5).
8 nucleic acid molecule encoding a PRO444 polypeptide containing DNA that hybridizes to the complement of 8 nucleic acids. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA26846-1397) of ATCC Deposit No. 203406, or (b) the complement of the DNA molecule of (a). Against
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203406 (DNA26846-1397). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of about 1 or about 17 to about 117 amino acid residues of Fig4 (SEQ ID NO: 6). Sequence identity, more preferably at least about 90%
To a DNA encoding a polypeptide having sequence identity of, most preferably at least about 95% sequence identity, or (b) an isolated nucleic acid molecule comprising the complement of DNA of (a). In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO444 having the sequence of about amino acid residues 1 or about 17 to about 117 of Fig4 (SEQ ID NO: 6).
Hybridizing with a DNA molecule encoding a polypeptide or (b) the complement of a DNA molecule of (a) under stringent conditions, wherein the DNA molecule is at least about 80% relative to (a) or (b) A test DNA molecule is isolated if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Produced by at least about 10 nucleotides, more preferably at least about 20 nucleotides
It relates to an isolated nucleic acid molecule having nucleotides, most preferably about 40 nucleotides. In a particular aspect, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO444 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, or such a code. A complementary nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 16 of Figure 4 (SEQ ID NO: 6). In another aspect, the invention provides (a) residue 1 or about 17 of Fig4 (SEQ ID NO: 6).
To at least about 80% positive when compared to about 117 amino acid sequences,
Preferably at least about 85% positive, more preferably at least about 90%
A DNA encoding a polypeptide positive, most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising the complement of (b) (a) DNA.

In another embodiment, PR finds use as a hybridization probe.
It relates to a fragment of the O444 polypeptide coding sequence. Such a nucleic acid fragment has about 2
0 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 4 nucleotides.
It is 0 nucleotides long. In another embodiment, the invention provides an isolated PRO444 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO444 polypeptide, which in certain embodiments is residue 1 or about 1 of Fig4 (SEQ ID NO: 6).
It contains an amino acid sequence containing from 7 to about 117. In another aspect, the invention features amino acid residue 1 or about 1 of Fig4 (SEQ ID NO: 6).
7 to about 117 sequences, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. It relates to an isolated PRO444 polypeptide comprising an amino acid sequence having sequence identity. In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to the amino acid sequence of residue 1 or about 17 to about 117 of Figure 4 (SEQ ID NO: 6), more preferably It relates to an isolated PRO444 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, and most preferably at least about 95% positive. In a still further aspect, the invention provides amino acid residue 1 of Fig4 (SEQ ID NO: 6).
Or about 17 to about 117 sequences, or a fragment thereof sufficient to provide a binding site for an anti-PRO444 antibody. Preferably, the PRO444 fragment retains the qualitative biological activity of the native PRO444 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig4
PR having a sequence of about 1 or about 17 to about 117 amino acid residues of (SEQ ID NO: 6)
A DNA molecule encoding the O444 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule is at least about 80% sequence identity, preferably at least about 8
(Ii) expressing a host cell containing a test DNA molecule into a polypeptide if it has 5% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Under conditions suitable for and (ii
i) providing a polypeptide produced by recovering the polypeptide from the cell culture medium.

3. PRO1018 A novel transmembrane domain-encoding cDNA clone (DNA56107-1415), designated "PRO1018" in this application, was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1018 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1018 polypeptide having a sequence from about 1 or about 25 to about 189 amino acid residues of Fig6 (SEQ ID NO: 8), or (b) At least about 80% sequence identity to the complement of the DNA molecule of (a), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about. 95%
DNA having the sequence identity of In another aspect, the invention provides a PR comprising a DNA that hybridizes to the complement of a nucleic acid from about nucleotide 129 or about 201 to about 695 of Fig5 (SEQ ID NO: 7).
It relates to an isolated nucleic acid molecule encoding an O1018 polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA56107-1415) of ATCC Deposit No. 203405, or (b) the complement of a nucleic acid molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity,
More preferably it relates to an isolated nucleic acid molecule comprising DNA having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203405 (DNA56107-1415). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, to amino acid residue 1 of Fig62 (SEQ ID NO: 8) or the sequence from about 25 to about 189. Of a polypeptide having sequence identity of, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) (a) the complement of DNA. Relates to an isolated nucleic acid molecule comprising. In a further aspect, the invention provides a test DNA molecule comprising (a) PRO1018 having amino acid residue 1 of Fig6 (SEQ ID NO: 8) or a sequence of about 25 to about 189.
Hybridizing with a DNA molecule encoding a polypeptide, or (b) the complement of a DNA molecule of (a) under stringent conditions, wherein the DNA molecule is at least about 80% relative to (a) or (b) A test DNA molecule is isolated if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. And an isolated nucleic acid molecule having at least 10 nucleotides produced thereby.

In a particular embodiment, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1018 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and its soluble, ie A transmembrane domain is either deleted or inactivated to provide a variant or is complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 24 in the sequence of Figure 6 (SEQ ID NO: 8). The transmembrane domain has been tentatively identified as extending from about amino acid position 86 to about amino acid position 103 and from about amino acid position 60 to about amino acid position 75 of the PRO1018 amino acid sequence (Fig6, SEQ ID NO: 8). In another aspect, the invention features (a) residue 1 or about 25 of Fig6 (SEQ ID NO: 8).
To at least about 80% positive when compared to the amino acid sequence of about 189,
Preferably at least about 85% positive, more preferably at least about 90%
A DNA encoding a polypeptide positive, most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising the complement of (b) (a) DNA. Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1018 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides long, most preferably about 20 to about 40 nucleotides long and can be derived from the nucleotide sequence shown in Figure 5 (SEQ ID NO: 7). In another embodiment, the invention provides an isolated PRO1018 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1018 polypeptide, which in certain embodiments comprises residue 1 of Fig6 (SEQ ID NO: 8) or an amino acid comprising from about 25 to about 189. Contains an array. In another aspect, the invention features amino acid residue 1 or about 2 of Figure 6 (SEQ ID NO: 8).
8 to about 189 sequences, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated PRO1018 polypeptide comprising an amino acid sequence having sequence identity. In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to the amino acid sequence of residue 1 or about 25 to about 189 of Fig6 (SEQ ID NO: 8), more preferably It relates to an isolated PRO1018 polypeptide comprising an amino acid sequence with a score of at least about 90% positive, most preferably at least about 95% positive.

In yet another aspect, the invention provides amino acid residue 1 of FIG. 6 (SEQ ID NO: 8) or the sequence from about 25 to about 189, or sufficient binding site for an anti-PRO1018 antibody. Relates to an isolated PRO1018 polypeptide comprising the fragment. Preferably, the PRO1018 fragment is the native PRO1018.
Retains the qualitative biological activity of the polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig6
PR having a sequence of about 1 or about 25 to about 189 amino acid residues of (SEQ ID NO: 8)
A DNA molecule encoding the O1018 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule is at least about (Ii) testing if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. DNA
A host cell containing the molecule is cultured under conditions suitable for expression of the polypeptide, and (i
ii) Providing the polypeptide produced by recovering the polypeptide from the cell culture medium. 4. PRO1773 In the present application, a cDNA clone (DNA56406-1704) has been identified, designated "PRO1773", which encodes a novel polypeptide and has homology with a nucleic acid encoding a retinol dehydrogenase protein. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1773 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule that encodes a PRO1773 polypeptide having a sequence from about 1 or about 18 to about 319 amino acid residues of Figure 8 (SEQ ID NO: 10), or (b) At least about 80% sequence identity to the complement of the DNA molecule of (a), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about. 95
It comprises DNA with% sequence identity. In another aspect, the invention provides a P comprising a DNA that hybridizes to the complement of a nucleic acid from about 111 or about 162 to about 1067 nucleotides of Figure 7 (SEQ ID NO: 9).
It relates to an isolated nucleic acid molecule encoding a RO1773 polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA56406-1704) of ATCC Deposit No. 203478, or (b) the complement of a nucleic acid molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity,
More preferably it relates to an isolated nucleic acid molecule comprising DNA having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203478 (DNA56406-1704).

In yet a further aspect, the invention provides (a) at least about 80% sequence identity with amino acid residue 1 of Fig8 (SEQ ID NO: 10) or the sequence from about 18 to about 319, preferably at least about 85%. % Sequence identity, more preferably at least about 90%
To a DNA encoding a polypeptide having sequence identity of, most preferably at least about 95% sequence identity, or (b) an isolated nucleic acid molecule comprising the complement of DNA of (a). In a further aspect, the invention provides a test DNA molecule comprising (a) PRO177 having amino acid residue 1 of Fig8 (SEQ ID NO: 10) or a sequence from about 18 to about 319.
Hybridizing with a DNA molecule encoding the 3 polypeptide or (b) the complement of the DNA molecule of (a) under stringent conditions, wherein the DNA molecule has at least about 80 relative to (a) or (b). Isolating a test DNA molecule when it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule having at least 525 nucleotides produced by. In a particular aspect, the invention provides an isolated nucleic acid molecule comprising a DNA encoding a PRO1773 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and a soluble or transmembrane domain thereof. Are deleted or inactivated variants, or are complementary to such encoding nucleic acid molecules. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 17 in the sequence of Figure 8 (SEQ ID NO: 10). The transmembrane domain has been tentatively identified as extending from about amino acid position 136 to about amino acid position 152 of the PRO1773 amino acid sequence (Fig8, SEQ ID NO: 10). In another aspect, the invention provides (a) residue 1 or about 1 of Fig8 (SEQ ID NO: 10).
At least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to the amino acid sequence of 8 to about 319.
% Nucleic acid, and most preferably at least about 95% positive DNA that encodes a polypeptide, or an isolated nucleic acid molecule comprising the complement of (b) (a) DNA. Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1773 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides in length, preferably about 20 to about 60 nucleotides in length, more preferably about 20 to about 50 nucleotides in length, most preferably about 20 to about 40 nucleotides in length, as shown in FIG. 7 (SEQ ID NO: 9). It can be derived from the indicated nucleotide sequence.

In another embodiment, the invention provides an isolated PRO1773 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a specific aspect, the invention provides an isolated native sequence PRO1773 polypeptide, which in certain embodiments comprises amino acid residues 1 or about 18 to about 319 of FIG8 (SEQ ID NO: 10). Contains an array. In another aspect, the invention features at least about 80% sequence identity, preferably at least about 85% sequence identity to amino acid residue 1 of Fig8 (SEQ ID NO: 10) or the sequence from about 18 to about 319. It relates to an isolated PRO1773 polypeptide comprising an amino acid sequence having identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In a further aspect, the invention features residue 1 or about 18 of Figure 8 (SEQ ID NO: 10).
To at least about 80% positive when compared to the about 319 amino acid sequence,
Preferably at least about 85% positive, more preferably at least about 90%
It relates to an isolated PRO1773 polypeptide which comprises an amino acid sequence with a positive, most preferably at least about 95% positive score. In yet another aspect, the invention includes amino acid residue 1 of Fig8 (SEQ ID NO: 10) or the sequence from about 18 to about 319, or a fragment thereof sufficient to provide a binding site for an anti-PRO1773 antibody. To an isolated PRO1773 polypeptide consisting of Preferably, the PRO1773 fragment retains the qualitative biological activity of the native PRO1773 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig8
P having the sequence of about 1 or about 18 to about 319 amino acid residues of (SEQ ID NO: 10)
DNA molecule encoding RO1773 polypeptide, or DNA of (b) (a)
The test DNA molecule is hybridized to the complement of the molecule under stringent conditions,
Or to (b) at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. (Ii) test DN if
A host cell containing the A molecule is cultured under conditions suitable for expression of the polypeptide, and (
iii) providing a polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1773 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1773 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1773 polypeptide by contacting the native PRO1773 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.

In yet a further embodiment, the invention relates to a composition comprising a PRO1773 polypeptide, or agonist or antagonist as above, together with a pharmaceutically acceptable carrier. 5. PRO1477 A cDNA clone (DNA56529-1647) has been identified in this application, designated "PRO1477", that encodes a novel polypeptide and has homology to a nucleic acid that encodes a mannosidase protein. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1447 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule that encodes a PRO1477 polypeptide having a sequence from about 1 to about 699 amino acid residues of Figure 10 (SEQ ID NO: 12), or (b) (a). About 8 to the complement of the DNA molecule of
It comprises DNA having 0% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In another aspect, the invention features a PRO1477 that comprises a DNA that hybridizes to the complement of the nucleic acid from about nucleotides 23 to 2119 of FIG. 9 (SEQ ID NO: 11).
It relates to an isolated nucleic acid molecule encoding a polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203293 (DNA56529-1647), or (b) the complement of a nucleic acid molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity,
More preferably it relates to an isolated nucleic acid molecule comprising DNA having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203293 (DNA56529-1647). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of amino acid residues 1 to about 699 of Figure 10 (SEQ ID NO: 12), More preferably an isolation comprising DNA encoding a polypeptide having at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) (a) the complement of the DNA. Nucleic acid molecule. In a further aspect, the invention provides a test DNA molecule, (a) a DNA molecule encoding a PRO1477 polypeptide having a sequence from amino acid residue 1 to about 699 of Fig10 (SEQ ID NO: 12), or (b) (a ) Hybridizing to the complement of a DNA molecule under stringent conditions, the DNA molecule having at least about 80% sequence identity to (a) or (b), preferably at least about 85% sequence identity. sex,
More preferably, an isolated nucleic acid having at least 540 nucleotides produced by isolating a test DNA molecule when having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Regarding the molecule.

In a particular aspect, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1477 polypeptide with and / or without an initiating methionine, and a soluble, ie lacking, transmembrane domain. It provides a lost or inactivated variant, or is complementary to such an encoding nucleic acid molecule. The transmembrane domain has been tentatively identified as extending from about amino acid position 21 to about amino acid position 40, and from about amino acid position 84 to about amino acid position 105 of the PRO1477 amino acid sequence (Fig10, SEQ ID NO: 12). In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residues 1 to about 699 of Figure 10 (SEQ ID NO: 12), more preferably at least about 85% positive. Relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or the complement of DNA of (b) (a). Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1477 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides in length, preferably about 20 to about 60 nucleotides in length, more preferably about 20 to about 50 nucleotides in length, most preferably about 20 to about 40 nucleotides in length and shown in FIG. 9 (SEQ ID NO: 11). It can be derived from the indicated nucleotide sequence. In another embodiment, the invention provides an isolated PRO1477 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1477 polypeptide, which in certain embodiments comprises an amino acid sequence comprising residues 1 to about 699 of Figure 10 (SEQ ID NO: 12). I'm out. In another aspect, the invention features at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence of amino acid residues 1 to about 699 of Figure 10 (SEQ ID NO: 12), More preferably at least about 90% sequence identity,
Most preferably it relates to an isolated PRO1477 polypeptide which comprises an amino acid sequence having at least about 95% sequence identity. In a further aspect, the invention features residues 1 to about 6 of Figure 10 (SEQ ID NO: 12).
Comprising at least about 80% positive amino acid sequence, preferably at least about 85% positive, more preferably at least about 90% positive, most preferably at least about 95% positive, as compared to the 99 amino acid sequence. It relates to an isolated PRO1477 polypeptide.

In yet another aspect, the invention features amino acid residue 1 of Figure 10 (SEQ ID NO: 12).
To about 699 sequence, or a fragment thereof sufficient to provide a binding site for an anti-PRO1477 antibody. Preferably, the PRO1477 fragment retains the qualitative biological activity of the native PRO1477 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
PRO14 having a sequence of about 1 to about 699 amino acid residues of 0 (SEQ ID NO: 12)
A DNA molecule encoding a 77 polypeptide, or (b) a complement of the DNA molecule of (a), is hybridized under stringent conditions and the test DNA molecule is (a) or (b).
) To at least about 80% sequence identity, preferably at least about 85%
(Ii) a host cell containing the test DNA molecule is suitable for expression of the polypeptide if it has at least about 90% sequence identity, more preferably at least about 95% sequence identity. Under different conditions, and (iii)
Provided is a polypeptide produced by recovering the polypeptide from a cell culture medium. In yet another embodiment, the present invention relates to agonists and antagonists of native PRO1477 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1477 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1477 polypeptide by contacting the native PRO1477 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising a PRO1477 polypeptide, or agonist or antagonist as above, together with a pharmaceutically acceptable carrier. 6. It has sequence identity with PRO1478 galactosyl transferase and in the present application "PR
A cDNA clone (DNA56531-1648) has been identified which encodes a novel polypeptide designated "O1478". In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1478 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule that encodes a PRO1478 polypeptide having a sequence from about 1 to about 327 amino acid residues of Figure 12 (SEQ ID NO: 17), or (b) (a). About 8 to the complement of the DNA molecule of
It comprises DNA having 0% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity.

In another aspect, the invention features residues 77 to about 1 of Figure 11 (SEQ ID NO: 16).
It relates to an isolated nucleic acid molecule encoding a PRO1478 polypeptide containing DNA which hybridizes to the complement of 057 nucleic acid. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA56531-1648) of ATCC Deposit No. 203286, or (b) the complement of a nucleic acid molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity,
More preferably it relates to an isolated nucleic acid molecule comprising DNA having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203286 (DNA56531-1648). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 1 to about 327 amino acid residues of Figure 12 (SEQ ID NO: 17). , More preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity, or a DNA encoding a polypeptide of (b) (a). Relates to separated nucleic acid molecules. In a further aspect, the invention provides a test DNA molecule, (a) a DNA molecule encoding a PRO1478 polypeptide having a sequence from about amino acid residue 1 to about 327 of Fig12 (SEQ ID NO: 17), or (b) ( hybridizing with the complement of the DNA molecule of a) under stringent conditions, wherein the DNA molecule is relative to (a) or (b),
A test DNA molecule having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule having at least about 50 nucleotides, preferably at least about 100 nucleotides. In a particular aspect, the invention provides an isolated nucleic acid molecule comprising a soluble form of a DNA encoding a PRO1478 polypeptide, ie, a variant in which the transmembrane domain has been deleted or inactivated, or A complementary nucleic acid molecule. The transmembrane domain (type II) has a PRO1478 amino acid sequence (Fig12).
It has been tentatively identified as extending from about amino acid position 29 to about amino acid position 49 of SEQ ID NO: 17). Thus, herein, particular embodies are peptides that include amino acids 50-327 with or without amino acids 1-28, as well as nucleic acids that encode such peptides.

In another aspect, the invention features (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residues 1 to about 327 of Figure 12 (SEQ ID NO: 17). , More preferably at least about 90% positive, most preferably at least about 95% positive, DNA encoding a polypeptide, or (b) an isolated nucleic acid molecule comprising the complement of DNA of (a). Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1478 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long. In another embodiment, the invention provides an isolated PRO1478 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1478 polypeptide, which in certain embodiments comprises an amino acid sequence comprising residues 1 to about 327 of Figure 12 (SEQ ID NO: 17). I'm out. In another aspect, the invention features at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence of amino acid residues 1 to about 327 of Figure 12 (SEQ ID NO: 17), More preferably at least about 90% sequence identity,
Most preferably it relates to an isolated PRO1478 polypeptide which comprises an amino acid sequence having at least about 95% sequence identity. In a further aspect, the invention features residues 1 to about 3 of Figure 12 (SEQ ID NO: 17).
Comprising at least about 80% positive amino acid sequence, preferably at least about 85% positive, more preferably at least about 90% positive, most preferably at least about 95% positive, when compared to the 27 amino acid sequence. It relates to an isolated PRO1478 polypeptide. In yet another aspect, the invention provides amino acid residue 1 of Figure 12 (SEQ ID NO: 17).
To about 327 sequence, or a fragment thereof sufficient to provide a binding site for an anti-PRO1478 antibody. Preferably, the PRO1478 fragment retains the qualitative biological activity of the native PRO1478 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
PRO14 having the sequence of about 1 to about 327 amino acid residues of SEQ ID NO: 2 (SEQ ID NO: 17)
A DNA molecule encoding the 78 polypeptide or (b) a complement of the DNA molecule of (a) is hybridized under stringent conditions, and the test DNA molecule is (a) or (b).
) To at least about 80% sequence identity, preferably at least about 85%
(Ii) a host cell containing the test DNA molecule is suitable for expression of the polypeptide if it has at least about 90% sequence identity, more preferably at least about 95% sequence identity. Under different conditions, and (iii)
Provided is a polypeptide produced by recovering the polypeptide from a cell culture medium.

In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1478 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1478 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1478 polypeptide by contacting the native PRO1478 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the present invention relates to a composition comprising the PRO1478 polypeptide, or the above agonist or antagonist together with a pharmaceutically acceptable carrier. 7. PRO831 A cDNA clone (DNA56862-1343) encoding a novel secreted polypeptide designated "PRO831" in this application was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO831 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO831 polypeptide having a sequence from about 1 or about 16 to about 73 amino acid residues of Figure 14 (SEQ ID NO: 22), or (b) At least about 80% sequence identity to the complement of the DNA molecule of (a), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about. 95%
DNA having the sequence identity of In another aspect, the invention features about 40 nucleotides of Figure 13 (SEQ ID NO: 21).
Or a PR containing DNA that hybridizes to the complement of about 85 to about 258 nucleic acids
It relates to an isolated nucleic acid molecule encoding the O831 polypeptide. Preferably,
Hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA56862-1343) of ATCC Deposit No. 203174, or (b) the complement of a nucleic acid molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity,
More preferably it relates to an isolated nucleic acid molecule comprising DNA having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203174 (DNA56862-1343).

In a still further aspect, the invention features (a) at least about 80% sequence identity with amino acid residue 1 of Figure 14 (SEQ ID NO: 22) or the sequence from about 16 to about 73, preferably at least about 85%. % Sequence identity, more preferably at least about 90%
To a DNA encoding a polypeptide having sequence identity of, most preferably at least about 95% sequence identity, or (b) an isolated nucleic acid molecule comprising the complement of DNA of (a). In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO831 having the sequence of amino acid residue 1 of Fig14 (SEQ ID NO: 22) or about 16 to about 73.
Hybridizing with a DNA molecule encoding a polypeptide, or (b) the complement of a DNA molecule of (a) under stringent conditions, wherein the DNA molecule is at least about 80% relative to (a) or (b) A test DNA molecule is isolated if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. And an isolated nucleic acid molecule having at least about 470 nucleotides. In a particular aspect, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO831 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, or such a code. A complementary nucleic acid molecule. The signal peptide is at about amino acid position 1 in Fig14 (SEQ ID NO: 22).
Has been tentatively identified as extending from to about amino acid position 15. In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residue 1 or about 16 to about 73 of Figure 14 (SEQ ID NO: 22). , More preferably at least about 90
% Nucleic acid, and most preferably at least about 95% positive DNA that encodes a polypeptide, or an isolated nucleic acid molecule comprising the complement of (b) (a) DNA. Another embodiment is a PR that finds use as a hybridization probe.
It relates to a fragment of the O831 polypeptide coding sequence. Such a nucleic acid fragment has about 2
0 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 4 nucleotides.
It is 0 nucleotides long and can be derived from the nucleotide sequence shown in Figure 13 (SEQ ID NO: 21). In another embodiment, the invention provides an isolated PRO831 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO831 polypeptide which, in certain embodiments, comprises residue 1 of Figure 14 (SEQ ID NO: 22) or an amino acid comprising from about 16 to about 73. Contains an array.

In another aspect, the invention features at least about 80% sequence identity, preferably at least about 85, to amino acid residue 1 of Figure 14 (SEQ ID NO: 22) or the sequence from about 16 to about 73. It relates to an isolated PRO831 polypeptide comprising an amino acid sequence having a% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In a further aspect, the invention features residue 1 or about 1 of Figure 14 (SEQ ID NO: 22).
At least about 80% positive when compared to the 6 to about 73 amino acid sequence,
Preferably at least about 85% positive, more preferably at least about 90%
It relates to an isolated PRO831 polypeptide which comprises an amino acid sequence that scores positive, most preferably at least about 95% positive. In yet another aspect, the invention provides amino acid residue 1 of Figure 14 (SEQ ID NO: 22).
Or about 16 to about 73 sequences, or a fragment of the PRO831 sufficient to provide a binding site for an anti-PRO831 antibody. Preferably, the PRO831 fragment retains the qualitative biological activity of the native PRO831 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
P having the sequence of about 1 or about 16 to about 73 amino acid residues of 4 (SEQ ID NO: 22)
A RO831 polypeptide-encoding DNA molecule, or (b) a hybrid of the DNA molecule complement of (a) under stringent conditions, wherein the test DNA molecule is at least about (Ii) testing if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. DNA
A host cell containing the molecule is cultured under conditions suitable for expression of the polypeptide, and (i
ii) Providing the polypeptide produced by recovering the polypeptide from the cell culture medium. 8. It has sequence identity to the PRO1113 leucine rich repeat protein and is referred to in the present application as "PRO.
A cDNA clone (1113 ”encoding a novel polypeptide named
DNA57254-1477) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1113 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule that encodes a PRO1113 polypeptide having a sequence from about 1 to about 616 amino acid residues of Figure 16 (SEQ ID NO: 24), or (b) (a). About 8 to the complement of the DNA molecule of
It comprises DNA having 0% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity.

In another aspect, the invention features an isolated nucleic acid that encodes a PRO1113 polypeptide that comprises a DNA that hybridizes to the complement of the nucleic acid at residues 214 to about 2061 of Figure 15 (SEQ ID NO: 23). Regarding the molecule. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203289 (DNA57254-1477), or (b) the complement of the DNA molecule of (a). Against
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203289 (DNA57254-1477). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about amino acid residue 1 to about 616 of Figure 16 (SEQ ID NO: 24). , More preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity, or a DNA encoding a polypeptide, or (a) a complement of DNA isolated. Relates to nucleic acid molecules. In a further aspect, the invention provides a test DNA molecule, (a) a DNA molecule encoding a PRO1113 polypeptide having a sequence from about amino acid residue 1 to about 616 of Fig16 (SEQ ID NO: 24), or (b) ( hybridizing with the complement of the DNA molecule of a) under stringent conditions, wherein the DNA molecule is relative to (a) or (b),
A test DNA molecule having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule having at least about 50 nucleotides, preferably at least about 100 nucleotides. In a particular aspect, the invention provides a DNA encoding a PRO1113 polypeptide.
Is provided as a soluble, ie, transmembrane domain-deleted or inactivated variant thereof, or is complementary to such an encoding nucleic acid molecule. The transmembrane domain has been tentatively identified as extending from about amino acid position 13 to about amino acid position 40 of the PRO1113 amino acid sequence (Fig16, SEQ ID NO: 24). Thus, also provided herein is a peptide comprising amino acids 41-616 of SEQ ID NO: 24, optionally 1-12, and a nucleic acid encoding same.

In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residues 1 to about 616 of Figure 16 (SEQ ID NO: 24). , More preferably at least about 90% positive, most preferably at least about 95% positive, DNA encoding a polypeptide, or (b) an isolated nucleic acid molecule comprising the complement of DNA of (a). Another embodiment is a PR that finds use as a hybridization probe.
It concerns a fragment of the O1113 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides in length, and most preferably about 20 to about 40 nucleotides in length. In another embodiment, the invention provides an isolated PRO1113 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1113 polypeptide, which in certain embodiments comprises an amino acid sequence comprising residues 1 to 616 of Fig16 (SEQ ID NO: 24). There is. In another aspect, the invention features at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence of amino acid residues 1 to about 616 of Figure 16 (SEQ ID NO: 24), More preferably at least about 90% sequence identity,
Most preferably it relates to an isolated PRO1113 polypeptide which comprises an amino acid sequence having at least about 95% sequence identity. In a further aspect, the invention features residues 1 to about 6 of Figure 16 (SEQ ID NO: 24).
Comprising at least about 80% positive amino acid sequence, preferably at least about 85% positive, more preferably at least about 90% positive, most preferably at least about 95% positive, when compared to the 16 amino acid sequence. It relates to an isolated PRO1113 polypeptide. In a still further aspect, the invention comprises a sequence of amino acid residues 1 to about 616 of Figure 16 (SEQ ID NO: 24), or a fragment thereof sufficient to provide a binding site for an anti-PRO1113 antibody. Isolated PRO1113 polypeptide. Preferably, the PRO1113 fragment retains the qualitative biological activity of the native PRO1113 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
PRO11 having the sequence of about 1 to about 616 amino acid residues of SEQ ID NO: 6 (SEQ ID NO: 24)
The test DNA molecule (a) or (b) is hybridized under stringent conditions with a DNA molecule encoding the 13 polypeptide or (b) the complement of the DNA molecule of (a).
) To at least about 80% sequence identity, preferably at least about 85%
(Ii) a host cell containing the test DNA molecule is suitable for expression of the polypeptide if it has at least about 90% sequence identity, more preferably at least about 95% sequence identity. Under different conditions, and (iii)
Provided is a polypeptide produced by recovering the polypeptide from a cell culture medium.

In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1113 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1113 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1113 polypeptide by contacting the native PRO1113 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the present invention relates to a composition comprising the PRO1113 polypeptide, or the above agonist or antagonist together with a pharmaceutically acceptable carrier. 9. PRO1194 A cDNA clone (DNA57841-1522) encoding a novel secreted polypeptide named "PRO1194" was identified in this application. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1194 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule that encodes a PRO1194 polypeptide having amino acid residue 1 of Figure 18 (SEQ ID NO: 29) or a sequence of about 22 to about 81, or (b) ( At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% to the complement of the DNA molecule of a). %
DNA having the sequence identity of In another aspect, the invention features residues 72 to about 2 of Figure 17 (SEQ ID NO: 28).
It relates to an isolated nucleic acid molecule encoding a PRO1194 polypeptide which comprises DNA hybridizing to the complement of 51 nucleic acids. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA57841-1522) of ATCC Deposit No. 203458, or (b) the complement of the DNA molecule of (a). Against
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203458 (DNA57841-1522).

In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with a sequence from about 22 to about 81 amino acid residues of Figure 18 (SEQ ID NO: 29). Comprising a DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) (a) the complement of DNA. To an isolated nucleic acid molecule consisting of In a further aspect, the invention provides a test DNA molecule, (a) a DNA molecule encoding a PRO1194 polypeptide having a sequence from about 22 to about 81 amino acid residues of Figure 18 (SEQ ID NO: 29), or (b) ( hybridizing with the complement of the DNA molecule of a) under stringent conditions, wherein the DNA molecule is relative to (a) or (b),
A test DNA molecule having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule having at least about 50 nucleotides, preferably at least about 100 nucleotides. In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive, and more preferably when compared to the amino acid sequence of residues 22 to about 81 of Figure 18 (SEQ ID NO: 29). Relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or the complement of DNA of (b) (a). Another embodiment is a PR that finds use as a hybridization probe.
It relates to a fragment of the O1194 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides in length, and most preferably about 20 to about 40 nucleotides in length. In another embodiment, the invention provides an isolated PRO1194 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1194 polypeptide, which in certain embodiments is residue 22 of Figure 18 (SEQ ID NO: 29).
To about 81 amino acid sequences. In another aspect, the invention features at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from amino acid residue 22 to about 81 of Figure 18 (SEQ ID NO: 29), More preferably at least about 90% sequence identity,
Most preferably it relates to an isolated PRO1194 polypeptide which comprises an amino acid sequence having at least about 95% sequence identity.

In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, and more preferably, when compared to the amino acid sequence of residues 22 to about 81 of Figure 18 (SEQ ID NO: 29). It relates to an isolated PRO1194 polypeptide comprising an amino acid sequence that scores at least about 90% positive, and most preferably at least about 95% positive. In yet another aspect, the invention provides amino acid residue 2 of Figure 18 (SEQ ID NO: 29).
Relates to an isolated PRO1194 polypeptide comprising from 2 to about 81 sequences, or a fragment thereof sufficient to provide a binding site for an anti-PRO1194 antibody. Preferably, the PRO1194 fragment retains the qualitative biological activity of the native PRO1194 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
PRO11 having a sequence of about 22 to about 81 amino acid residues of 8 (SEQ ID NO: 29)
A DNA molecule encoding a 94 polypeptide, or (b) a complement of the DNA molecule of (a), is hybridized under stringent conditions, and the test DNA molecule is (a) or (b).
) To at least about 80% sequence identity, preferably at least about 85%
(Ii) a host cell containing the test DNA molecule is suitable for expression of the polypeptide if it has at least about 90% sequence identity, more preferably at least about 95% sequence identity. Under different conditions, and (iii)
Provided is a polypeptide produced by recovering the polypeptide from a cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1194 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1194 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1194 polypeptide by contacting the native PRO1194 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In yet a further embodiment, the invention relates to a composition comprising a PRO1194 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier. 10. PRO1110 In the present application, a cDNA clone (DNA58727-1474) has been identified, designated “PRO1110” and having homology to a nucleic acid encoding a myelocytic upregulation protein encoding a novel polypeptide. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1110 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule that encodes a PRO1110 polypeptide having a sequence from about 1 to about 322 amino acid residues of Figure 20 (SEQ ID NO: 31), or (b) (a). About 8 to the complement of the DNA molecule of
It comprises DNA having 0% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity.

In another aspect, the invention features about 13 nucleotides of Figure 19 (SEQ ID NO: 30).
PRO11 containing DNA hybridizing to the complement of 1 to about 1096 nucleic acids
10 polypeptide isolated nucleic acid molecule. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA58727-1474) of ATCC Deposit No. 203171, or (b) the complement of a nucleic acid molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity,
More preferably it relates to an isolated nucleic acid molecule comprising DNA having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203171 (DNA58727-1474). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of amino acid residues 1 to about 322 of Figure 20 (SEQ ID NO: 31), More preferably an isolation comprising DNA encoding a polypeptide having at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) (a) the complement of the DNA. Nucleic acid molecule. In a further aspect, the invention provides that a test DNA molecule is (a) a DNA molecule encoding a PRO1110 polypeptide having a sequence from amino acid residue 1 to about 322 of Fig20 (SEQ ID NO: 31), or (b) (a). ) Hybridizing to the complement of a DNA molecule under stringent conditions, the DNA molecule having at least about 80% sequence identity to (a) or (b), preferably at least about 85% sequence identity. sex,
More preferably, an isolated nucleic acid having at least 10 nucleotides produced by isolating a test DNA molecule when having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Regarding the molecule. In a particular embodiment, the present invention relates to PR with or without initiation methionine.
Providing an isolated nucleic acid molecule comprising a DNA encoding an O1110 polypeptide, and a soluble or transmembrane domain-deleted or inactivated variant thereof,
Alternatively, it is complementary to such an encoding nucleic acid molecule. The transmembrane domain is PR
About 41 amino acid positions of the O1110 amino acid sequence (Fig 20, SEQ ID NO: 31)
To amino acid position 60, amino acid position 66 to amino acid position 85, amino acid position 101 to amino acid position 120, amino acid position 137 to amino acid position 153, amino acid position 171 to amino acid position 192, amino acid position 205. To amino acid position 226, amino acid position 235 to amino acid position 255, and amino acid position 294 to amino acid position 312.

In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residues 1 to about 322 of Figure 20 (SEQ ID NO: 31). , More preferably at least about 90% positive, most preferably at least about 95% positive, DNA encoding a polypeptide, or (b) an isolated nucleic acid molecule comprising the complement of DNA of (a). Another embodiment is a PR that finds use as a hybridization probe.
It concerns a fragment of the O1110 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides in length, most preferably about 20 to about 40 nucleotides in length, and can be derived from the nucleotide sequence shown in Figure 19 (SEQ ID NO: 30). In another embodiment, the invention provides an isolated PRO1110 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1110 polypeptide, which, in certain embodiments, comprises an amino acid sequence comprising residues 1 to about 322 of Figure 20 (SEQ ID NO: 31). I'm out. In another aspect, the invention features at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from amino acid residue 1 to about 322 of Figure 20 (SEQ ID NO: 31), More preferably at least about 90% sequence identity,
Most preferably it relates to an isolated PRO1110 polypeptide which comprises an amino acid sequence having at least about 95% sequence identity. In a further aspect, the invention features residues 1 to about 3 of Figure 20 (SEQ ID NO: 31).
Comprising at least about 80% positive amino acid sequence, preferably at least about 85% positive, more preferably at least about 90% positive, most preferably at least about 95% positive, when compared to the 22 amino acid sequence. It relates to an isolated PRO1110 polypeptide. In yet another aspect, the invention provides amino acid residue 1 of Figure 20 (SEQ ID NO: 31).
From about 322 to about 322, or a fragment thereof sufficient to provide a binding site for an anti-PRO1110 antibody. Preferably, the PRO1110 fragment retains the qualitative biological activity of the native PRO1110 polypeptide.

In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig2.
PRO11 having a sequence of about 1 to about 322 amino acid residues of 0 (SEQ ID NO: 31)
The test DNA molecule is hybridized with a DNA molecule encoding 10 polypeptide or (b) the complement of the DNA molecule of (a) under stringent conditions, and the test DNA molecule is (a) or (b).
) To at least about 80% sequence identity, preferably at least about 85%
(Ii) a host cell containing the test DNA molecule is suitable for expression of the polypeptide if it has at least about 90% sequence identity, more preferably at least about 95% sequence identity. Under different conditions, and (iii)
Provided is a polypeptide produced by recovering the polypeptide from a cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1110 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1110 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1110 polypeptide by contacting the native PRO1110 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising a PRO1110 polypeptide, or an agonist or antagonist identified above, together with a pharmaceutically acceptable carrier. 11. PRO1378 A cDNA clone (DNA58730-1607) encoding a novel secreted polypeptide designated "PRO1378" in this application was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1378 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1378 polypeptide having amino acid residue 1 of Fig22 (SEQ ID NO: 33) or a sequence of about 16 to about 335, or (b) ( At least about 80% sequence identity to the complement of the DNA molecule of a), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%.
It comprises DNA with% sequence identity. In another aspect, the invention pertains to an isolated nucleic acid molecule encoding a PRO1378 polypeptide that comprises DNA that hybridizes to the complement of a nucleic acid from residues about 1365 to about 2369 of Figure 21 (SEQ ID NO: 32). Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA58730-1607) of ATCC Deposit No. 203221, or (b) the complement of the DNA molecule of (a). Against
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203221 (DNA58730-1607).

In a still further aspect, the invention provides (a) at least about 80% sequence identity with amino acid residue 1 of Fig22 (SEQ ID NO: 33) or the sequence from about 16 to about 335,
Preferably at least about 85% sequence identity, more preferably at least about 90.
It relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide having a% sequence identity, most preferably at least about 95% sequence identity, or the complement of the DNA of (a). In a further aspect, the invention provides a test DNA molecule, (a) a DNA molecule encoding a PRO1378 polypeptide having the sequence of amino acid residues from about 16 to about 335 of Fig22 (SEQ ID NO: 33), or (b) ( a) the complement of the DNA molecule,
Hybridized under stringent conditions, the DNA molecule has at least about 80% sequence identity to (a) or (b), preferably at least about 85% sequence identity, more preferably at least about 90%. Of at least about 20 nucleotides, preferably at least about 50 nucleotides, more preferably about 100 nucleotides prepared by isolating a test DNA molecule having at least about 95% sequence identity. It relates to an isolated nucleic acid molecule having nucleotides. In a particular aspect, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1378 polypeptide with or without an N-terminal signal sequence, or complementary to such an encoding nucleic acid molecule. Target. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 15 of Figure 22 (SEQ ID NO: 33). In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive, and more preferably when compared to the amino acid sequence of residues 16 to about 335 of Figure 22 (SEQ ID NO: 33). Relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or the complement of DNA of (b) (a). Another embodiment is a PR that finds use as a hybridization probe.
It relates to a fragment of the O1378 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides in length, and most preferably about 20 to about 40 nucleotides in length.

In another embodiment, the invention provides an isolated PRO1378 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1378 polypeptide, which in certain embodiments is residue 16 of Figure 22 (SEQ ID NO: 33).
To 335 are included. In another aspect, the invention features at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from amino acid residue 16 to about 335 of Figure 22 (SEQ ID NO: 33), More preferably it relates to an isolated PRO1378 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity. In a further aspect, the invention features residues 16 to 3 of Fig22 (SEQ ID NO: 33).
Comprising a score of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, and most preferably at least about 95% positive when compared to the 35 amino acid sequence. It relates to an isolated PRO1378 polypeptide. In a still further aspect, the invention comprises a sequence from amino acid residue 16 to about 335 of Figure 22 (SEQ ID NO: 33), or a fragment thereof sufficient to provide a binding site for an anti-PRO1378 antibody. Isolated PRO1378 polypeptide. Preferably, the PRO1378 fragment retains the qualitative biological activity of the native PRO1378 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig2
PRO1 having a sequence of about 16 to about 335 amino acid residues of SEQ ID NO: 33 (SEQ ID NO: 33)
The test DNA molecule is hybridized under stringent conditions with a DNA molecule encoding the 378 polypeptide or (b) the complement of the DNA molecule of (a), and the test DNA molecule is (a) or (
at least about 80% sequence identity to b), preferably at least about 85
(Ii) a host cell containing the test DNA molecule for expression of the polypeptide if it has a sequence identity of%, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Culture under suitable conditions, and (iii
) Providing a polypeptide produced by recovering the polypeptide from a cell culture medium. 12. PRO1481 In the present application, a cDNA clone (DNA58732-1650) encoding a novel polypeptide named "PRO1481" was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1481 polypeptide.

In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1481 polypeptide having amino acid residue 1 of FIG. 24 (SEQ ID NO: 41) or a sequence from about 24 to about 334, or ( b) at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably to the complement of the DNA molecule of (a). At least about 95
It comprises DNA with% sequence identity. In another aspect, the invention features residues 88 to about 1 of Figure 23 (SEQ ID NO: 40).
An isolated nucleic acid molecule encoding a PRO1481 polypeptide that comprises DNA that hybridizes to the complement of the 321 nucleic acid. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203290 (DNA58732-1650), or (b) the complement of the DNA molecule of (a). Against
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203290 (DNA58732-1650). In a still further aspect, the invention provides (a) at least 80% sequence identity, preferably at least about 85% sequence identity to the sequence of about amino acid residues 24 to about 334 of Fig24 (SEQ ID NO: 41). , More preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity, or a DNA encoding a polypeptide of (b) (a). Relates to separated nucleic acid molecules. In a further aspect, the invention provides a test DNA molecule, (a) a DNA molecule encoding a PRO1481 polypeptide having a sequence from about 24 to about 334 amino acid residues of Fig24 (SEQ ID NO: 41), or (b) ( a) the complement of the DNA molecule,
Hybridized under stringent conditions, the DNA molecule has at least about 80% sequence identity to (a) or (b), preferably at least about 85% sequence identity, more preferably at least about 90%. Of at least about 50 nucleotides, preferably at least about 100 nucleotides, prepared by isolating a test DNA molecule having at least about 95% sequence identity. Relates to nucleic acid molecules. In a particular aspect, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1481 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and its soluble or transmembrane domain. Provide deletions, truncations or inactivated variants, or are complementary to such encoding nucleic acid molecules. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 23 in the sequence of Figure 24 (SEQ ID NO: 41).
The transmembrane domain has a PRO1481 amino acid sequence (Fig24, SEQ ID NO: 41).
) From amino acid position 235 to amino acid position 262.

In another aspect, the invention features residues 24 to about 33 of Figure 24 (SEQ ID NO: 41).
DNA encoding a polypeptide that scores at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, and most preferably at least about 95% positive when compared to the amino acid sequence of 4. It relates to an isolated nucleic acid molecule comprising the encoding DNA or the complement of (b) (a) DNA. Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1481 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides in length, and most preferably about 20 to about 40 nucleotides in length. In another embodiment, the invention provides an isolated PRO1481 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1481 polypeptide, which in certain embodiments is residue 24 of Figure 24 (SEQ ID NO: 41).
To 334 are included. In another aspect, the invention features at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from amino acid residue 24 to about 334 of Figure 24 (SEQ ID NO: 41), More preferably it relates to an isolated PRO1481 polypeptide which comprises an amino acid sequence having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In a further aspect, the invention features residues 24 to 3 of Fig24 (SEQ ID NO: 41).
Comprising at least about 80% positive amino acid sequence, preferably at least about 85% positive, more preferably at least about 90% positive, most preferably at least about 95% positive, when compared to the 34 amino acid sequence. It relates to an isolated PRO1481 polypeptide. In yet another aspect, the invention provides amino acid residue 2 of Fig24 (SEQ ID NO: 41).
An isolated PRO1481 polypeptide comprising a sequence of 4 to about 334, or a fragment thereof sufficient to provide a binding site for an anti-PRO1481 antibody. Preferably, the 1481 fragment retains the qualitative biological activity of the native PRO1481 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig2
PRO1 having the sequence of about 24 to about 334 amino acid residues of SEQ ID NO: 4 (SEQ ID NO: 41)
A DNA molecule encoding the 481 polypeptide or (b) a complement of the DNA molecule of (a) is hybridized under stringent conditions, and the test DNA molecule is (a) or (
at least about 80% sequence identity to b), preferably at least about 85
(Ii) a host cell containing the test DNA molecule for expression of the polypeptide if it has a sequence identity of%, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Culture under suitable conditions, and (iii
) Providing a polypeptide produced by recovering the polypeptide from a cell culture medium.

In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1481 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1481 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1481 polypeptide by contacting the native PRO1481 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising a PRO1481 polypeptide, or an agonist or antagonist specified above, together with a pharmaceutically acceptable carrier. 13. PRO1189 A cDNA clone named "PRO1189" in the present application and encoding a novel polypeptide having homology with E25 (DNA58828-1519).
Was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1189 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1189 polypeptide having a sequence from about 1 to about 263 amino acid residues of Figure 26 (SEQ ID NO: 43), or (b) (a). About 8 to the complement of the DNA molecule of
It comprises DNA having 0% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In another aspect, the invention features residues 79 to about 8 of Figure 25 (SEQ ID NO: 42).
An isolated nucleic acid molecule encoding a PRO1189 polypeptide that comprises DNA that hybridizes to the complement of 67 nucleic acids. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203172 (DNA58828-1519), or (b) the complement of the DNA molecule of (a). Against
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203172 (DNA58828-1519).

In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence of amino acid residues about 1 to about 263 of Figure 26 (SEQ ID NO: 43). DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) (a) the complement of the DNA molecule. Relates to an isolated nucleic acid molecule comprising. In a further aspect, the invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1189 polypeptide having a sequence from about amino acid residue 1 to about 263 of Fig26 (SEQ ID NO: 43), or (b) ( hybridizing with the complement of the DNA molecule of a) under stringent conditions, wherein the DNA molecule is relative to (a) or (b),
A test DNA molecule having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule having at least about 50 nucleotides, preferably at least about 100 nucleotides. In a particular embodiment, PRO1189 has its transmembrane domain deleted or inactivated.
An isolated nucleic acid molecule is provided that comprises DNA encoding a polypeptide, or is complementary to such an encoding nucleic acid molecule. The transmembrane domain is PRO118
It has been tentatively identified as extending from about amino acid position 53 to about amino acid position 75 in the 9 amino acid sequence (Figure 26, SEQ ID NO: 43). In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive, and more preferably when compared to the amino acid sequence of residues 1 to about 263 of Figure 26 (SEQ ID NO: 43). Relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or the complement of DNA of (b) (a). Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1189 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides in length, and most preferably about 20 to about 40 nucleotides in length. In another embodiment, the invention provides an isolated PRO1189 polypeptide encoded by any of the isolated nucleic acid sequences identified above.

In a particular aspect, the invention provides an isolated native sequence PRO1189 polypeptide, which in certain embodiments comprises an amino acid comprising residues 1 to about 263 of Fig26 (SEQ ID NO: 43). Contains an array. In another aspect, the invention features at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from amino acid residue 1 to about 263 of Figure 26 (SEQ ID NO: 43), More preferably at least about 90% sequence identity,
Most preferably it relates to an isolated PRO1189 polypeptide which comprises an amino acid sequence having at least about 95% sequence identity. In a further aspect, the invention features residues 1 to about 2 of Figure 26 (SEQ ID NO: 43).
Comprising 63 amino acid sequences that score at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, and most preferably at least about 95% positive. It relates to an isolated PRO1189 polypeptide. In a still further aspect, the invention comprises a sequence of amino acid residues 1 to about 263 of Figure 26 (SEQ ID NO: 43), or a fragment thereof sufficient to provide a binding site for an anti-PRO1189 antibody. Isolated PRO1189 polypeptide. Preferably, the PRO1189 fragment retains the qualitative biological activity of the native PRO1189 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig2
PRO11 having the sequence of about 1 to about 263 amino acid residues of SEQ ID NO: 6 (SEQ ID NO: 43)
89. A DNA molecule encoding the 89 polypeptide or (b) a complement of the DNA molecule of (a) is hybridized under stringent conditions, and the test DNA molecule is (a) or (b).
) To at least about 80% sequence identity, preferably at least about 85%
(Ii) a host cell containing the test DNA molecule is suitable for expression of the polypeptide if it has at least about 90% sequence identity, more preferably at least about 95% sequence identity. Under different conditions, and (iii)
Provided is a polypeptide produced by recovering the polypeptide from a cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1189 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1189 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1189 polypeptide by contacting the native PRO1189 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In yet a further embodiment, the invention relates to a composition comprising a PRO1189 polypeptide, or an agonist or antagonist specified above, together with a pharmaceutically acceptable carrier.

14. PRO1415 A cDNA clone (DNA58852-1637) encoding a novel polypeptide designated "PRO1415" in this application was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1415 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1415 polypeptide having a sequence from about 1 or about 26 to about 283 amino acid residues of Figure 28 (SEQ ID NO: 50), or (b) At least about 80% sequence identity to the complement of the DNA molecule of (a), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about. 95
It comprises DNA with% sequence identity. In another aspect, the invention features about 14 nucleotides of Figure 27 (SEQ ID NO: 49).
8 or an isolated nucleic acid molecule encoding a PRO1415 polypeptide comprising DNA that hybridizes to the complement of about 223 to about 996 nucleic acids. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA58852-1637) of ATCC Deposit No. 203271, or (b) the complement of the DNA molecule of (a). Against
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203271 (DNA58852-1637). In a still further aspect, the invention provides (a) at least about 80% sequence identity with amino acid residue 1 of Figure 28 (SEQ ID NO: 50) or the sequence from about 26 to about 283,
Preferably at least about 85% sequence identity, more preferably at least about 90.
Isolated nucleic acid molecule comprising a DNA encoding a polypeptide having a% sequence identity, most preferably at least about 95% sequence identity, or (b) a complement of the DNA molecule of (a). . In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO14 having amino acid residue 1 of Fig28 (SEQ ID NO: 50) or a sequence from about 26 to about 283.
Hybridizing with a DNA molecule encoding 15 polypeptide, or (b) the complement of the DNA molecule of (a) under stringent conditions, wherein the DNA molecule has at least about 80 relative to (a) or (b). Isolate a test DNA molecule if it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule having at least 100 nucleotides produced by.

In a particular aspect, the invention provides an isolated nucleic acid molecule comprising a DNA encoding a PRO1415 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and its soluble, ie A variant is provided in which the transmembrane domain has been deleted or inactivated, or is complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 25 in the sequence of Figure 28 (SEQ ID NO: 50). The transmembrane domain has been tentatively identified as extending from about amino acid position 94 to about amino acid position 118 of the PRO1415 amino acid sequence (Fig28, SEQ ID NO: 50). In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residue 1 or about 26 to about 283 of Figure 28 (SEQ ID NO: 50). , More preferably at least about 9
It relates to an isolated nucleic acid molecule comprising 0% positive, most preferably at least about 95% positive score DNA encoding a polypeptide, or (b) (a) the complement of DNA. Another embodiment is a PR that finds use as a hybridization probe.
O1415 polypeptide coding sequence fragment. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides long, most preferably about 20 to about 40 nucleotides long and can be derived from the nucleotide sequence shown in Figure 27 (SEQ ID NO: 49). In another embodiment, the invention provides an isolated PRO1415 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1415 polypeptide, which in certain embodiments comprises residue 1 of Figure 28 (SEQ ID NO: 50) or an amino acid comprising from about 26 to about 283. Contains an array. In another aspect, the invention features at least about 80% sequence identity, preferably at least about 85% sequence, to amino acid residue 1 of Figure 28 (SEQ ID NO: 50) or the sequence from about 26 to about 283. It relates to an isolated PRO1415 polypeptide comprising an amino acid sequence having identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In a further aspect, the invention features residue 1 or about 2 of Figure 28 (SEQ ID NO: 50).
At least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to the 6 to about 283 amino acid sequence.
% PROPOSITIVE, most preferably at least about 95% positive score, with respect to an isolated PRO1415 polypeptide.

In a still further aspect, the invention features amino acid residue 1 of Figure 28 (SEQ ID NO: 50) or the sequence from about 26 to about 283, or a fragment thereof sufficient to provide a binding site for an anti-PRO1415 antibody. To an isolated PRO1415 polypeptide comprising: Preferably, the PRO1415 fragment is the native PRO1415.
Retains the qualitative biological activity of the polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig2
8 (SEQ ID NO: 50), a DNA molecule encoding a PRO1415 polypeptide having a sequence of about 1 or about 26 to about 283 amino acid residues, or (b) (a) DN
Hybridization with the complement of the A molecule under stringent conditions results in the test DNA molecule (a
) Or (b), at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. If there is identity, then (ii) test D
A polypeptide produced by culturing a host cell containing an NA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture medium is provided. In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1415 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1415 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1415 polypeptide by contacting the native PRO1415 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In yet a further embodiment, the invention relates to a composition comprising a PRO1415 polypeptide, or an agonist or antagonist specified above, together with a pharmaceutically acceptable carrier. 15. PRO1411 A cDNA clone (DNA59212-1627) encoding a novel secreted polypeptide designated "PRO1411" in the present application was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1411 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1411 polypeptide having amino acid residue 1 of Figure 30 (SEQ ID NO: 52) or a sequence of about 22 to about 440, or (b) ( At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% to the complement of the DNA molecule of a).
It comprises DNA with% sequence identity. In another aspect, the invention features an isolated nucleic acid molecule that encodes a PRO1411 polypeptide that includes DNA that hybridizes to the complement of the nucleic acid from residues 247 to about 1503 of Figure 29 (SEQ ID NO: 51). Preferably, hybridization occurs under stringent hybridization and wash conditions.

In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203245 (DNA59212-1627), or (b) the DNA molecule of (a). For complement of
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203245 (DNA59212-1627). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 22 to about 440 amino acid residues of Figure 30 (SEQ ID NO: 52). , More preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity, or a DNA encoding a polypeptide of (a) the complement of the isolated DNA. Relates to nucleic acid molecules. In a further aspect, the invention provides a test DNA molecule, (a) a DNA molecule encoding a PRO1411 polypeptide having a sequence from about 22 to about 440 amino acid residues of Fig30 (SEQ ID NO: 52), or (b) ( a) the complement of the DNA molecule,
Hybridized under stringent conditions, the DNA molecule has at least about 80% sequence identity to (a) or (b), preferably at least about 85% sequence identity, more preferably at least about 90%. Of at least about 50 nucleotides, preferably at least about 100 nucleotides, prepared by isolating a test DNA molecule having at least about 95% sequence identity. Relates to nucleic acid molecules. In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive, and more preferably when compared to the amino acid sequence of residues 22 to about 440 of Fig30 (SEQ ID NO: 52). Relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or the complement of DNA of (b) (a). Another embodiment is a PR that finds use as a hybridization probe.
O1411 polypeptide coding sequence fragment. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides in length, and most preferably about 20 to about 40 nucleotides in length.

In another embodiment, the invention provides an isolated PRO1411 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1411 polypeptide, which in certain embodiments is residue 22 of Figure 30 (SEQ ID NO: 52).
To 440 are included. In another aspect, the invention features at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from amino acid residue 22 to about 440 of Figure 30 (SEQ ID NO: 52), More preferably, it relates to an isolated PRO1411 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In a further aspect, the invention features residues 22 to 4 of Figure 30 (SEQ ID NO: 52).
Comprising 40 amino acid sequences that score at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, and most preferably at least about 95% positive. It relates to an isolated PRO1411 polypeptide. In a still further aspect, the invention comprises a sequence of amino acid residues 22 to about 440 of Figure 30 (SEQ ID NO: 52), or a fragment thereof sufficient to provide a binding site for an anti-PRO1411 antibody. Isolated PRO1411 polypeptide. Preferably, the PRO1411 fragment retains the qualitative biological activity of the native PRO1411 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig3
PRO1 having a sequence of about 22 to about 440 amino acid residues of 0 (SEQ ID NO: 52)
The test DNA molecule is hybridized with a DNA molecule encoding the 411 polypeptide or (b) the complement of the DNA molecule of (a) under stringent conditions, and the test DNA molecule is (a) or (
at least about 80% sequence identity to b), preferably at least about 85
(Ii) a host cell containing the test DNA molecule for expression of the polypeptide if it has a sequence identity of%, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Culture under suitable conditions, and (iii
) Providing a polypeptide produced by recovering the polypeptide from a cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1411 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1411 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1411 polypeptide by contacting the native PRO1411 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In yet a further embodiment, the invention relates to a composition comprising a PRO1411 polypeptide, or an agonist or antagonist specified above, together with a pharmaceutically acceptable carrier.

16. PRO1295 A cDNA clone (DNA59218-1559) encoding a novel secreted polypeptide designated "PRO1295" in this application was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1295 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1295 polypeptide having amino acid residue 1 of Figure 32 (SEQ ID NO: 54) or a sequence from about 19 to about 280, or (b) ( At least about 80% sequence identity to the complement of the DNA molecule of a), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%.
It comprises DNA with% sequence identity. In another aspect, the invention features an isolated nucleic acid molecule that encodes a PRO1295 polypeptide that comprises DNA that hybridizes to the complement of the nucleic acid from residues 261 to about 1046 of Figure 31 (SEQ ID NO: 53). Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203287 (DNA59218-1559), or (b) the complement of the DNA molecule of (a). Against
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203287 (DNA59218-1559). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of about amino acid residues 19 to about 280 of Figure 32 (SEQ ID NO: 54). , More preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity, or a DNA encoding a polypeptide, or (a) a complement of DNA isolated. Relates to nucleic acid molecules. In a further aspect, the invention provides that a test DNA molecule is (a) a DNA molecule encoding a PRO1295 polypeptide having a sequence from about 19 to about 280 amino acid residues of Figure 32 (SEQ ID NO: 54), or (b) ( a) the complement of the DNA molecule,
Hybridized under stringent conditions, the DNA molecule has at least about 80% sequence identity to (a) or (b), preferably at least about 85% sequence identity, more preferably at least about 90%. Of at least about 50 nucleotides, preferably at least about 100 nucleotides, prepared by isolating a test DNA molecule having at least about 95% sequence identity. Relates to nucleic acid molecules.

In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residues 19 to about 280 of Figure 32 (SEQ ID NO: 54). , More preferably at least about 90% positive, most preferably at least about 95% positive, DNA encoding a polypeptide, or (b) an isolated nucleic acid molecule comprising the complement of DNA of (a). Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1295 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides in length, and most preferably about 20 to about 40 nucleotides in length. In another embodiment, the invention provides an isolated PRO1295 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1295 polypeptide, which in certain embodiments is residue 19 of Figure 32 (SEQ ID NO: 54).
To 280 are included. In another aspect, the invention features at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from amino acid residue 19 to about 280 of Figure 32 (SEQ ID NO: 54), More preferably it relates to an isolated PRO1295 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity. In a further aspect, the invention features residues 19 to 2 of Figure 32 (SEQ ID NO: 54).
Comprising at least about 80% positive amino acid sequence, preferably at least about 85% positive, more preferably at least about 90% positive, most preferably at least about 95% positive, when compared to the 80 amino acid sequence. It relates to an isolated PRO1295 polypeptide. In a still further aspect, the invention comprises a sequence of amino acid residues 19 to about 280 of Figure 32 (SEQ ID NO: 54), or a fragment thereof sufficient to provide a binding site for an anti-PRO1295 antibody. Isolated PRO1295 polypeptide. Preferably, the PRO1295 fragment retains the qualitative biological activity of the native PRO1295 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig3
PRO1 having a sequence of about 19 to about 280 amino acid residues of SEQ ID NO: 2 (SEQ ID NO: 54)
295 polypeptide, or (b) hybridized with the complement of the DNA molecule of (a) under stringent conditions, and the test DNA molecule is (a) or (
at least about 80% sequence identity to b), preferably at least about 85
(Ii) a host cell containing the test DNA molecule for expression of the polypeptide if it has a sequence identity of%, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Culture under suitable conditions, and (iii
) Providing a polypeptide produced by recovering the polypeptide from a cell culture medium.

In yet another embodiment, the invention relates to agonists and antagonists of native PRO1295 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1295 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1295 polypeptide by contacting the native PRO1295 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising a PRO1295 polypeptide, or an agonist or antagonist specified above, together with a pharmaceutically acceptable carrier. 17. PRO1359 In the present application, a cDNA clone (DNA59219-1613) has been identified, which was designated as "PRO1359" polypeptide and which encodes a novel polypeptide having sequence identity with sialytransferases. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1359 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1359 polypeptide having amino acid residue 1 of Figure 34 (SEQ ID NO: 56) or a sequence from about 32 to about 299, or (b) ( At least about 80% sequence identity to the complement of the DNA molecule of a), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%.
It comprises DNA with% sequence identity. In another aspect, the invention features an isolated nucleic acid molecule that encodes a PRO1359 polypeptide that comprises a DNA that hybridizes to the complement of a nucleic acid from residues 277 to 1080 of Figure 33 (SEQ ID NO: 55). Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention relates to (a) a DNA molecule encoding the same mature polypeptide encoded by ATCC Deposit No. 203220 human protein cDNA (DNA59219-1613), or (b) a complement of the DNA molecule of (a). For at least about 80% sequence identity, preferably at least about 85% sequence identity,
More preferably it relates to an isolated nucleic acid molecule comprising DNA having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203220 (DNA59219-1613).

In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about amino acid residue 32 to about 299 of Figure 34 (SEQ ID NO: 56). A DNA comprising a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (a) the complement of DNA. Relates to separated nucleic acid molecules. In a further aspect, the invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1359 polypeptide having a sequence from about amino acid residue 32 to about 299 of Fig34 (SEQ ID NO: 56), or (b) ( a) the complement of the DNA molecule,
Hybridized under stringent conditions, the DNA molecule has at least about 80% sequence identity to (a) or (b), preferably at least about 85% sequence identity, more preferably at least about 90%. Of at least about 50 nucleotides, preferably at least about 100 nucleotides, prepared by isolating a test DNA molecule having at least about 95% sequence identity. Relates to nucleic acid molecules. In a particular aspect, the invention provides a DNA encoding a PRO1359 polypeptide.
Isolated nucleic acid molecule comprising a soluble, ie, a variant in which the transmembrane domain has been deleted or inactivated, or is complementary to such an encoding nucleic acid molecule. The transmembrane domain (type II) has a PRO1359 amino acid sequence (Fig3
4, SEQ ID NO: 56) has been tentatively identified as extending from about amino acid position 9 to about amino acid position 31. In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive, and more preferably when compared to the amino acid sequence of residues 32 to about 299 of Figure 34 (SEQ ID NO: 56). Relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or the complement of DNA of (b) (a). Another embodiment is a PR that finds use as a hybridization probe.
It relates to a fragment of the O1359 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides in length, and most preferably about 20 to about 40 nucleotides in length.

In another embodiment, the invention provides an isolated PRO1359 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1359 polypeptide, which in certain embodiments is residue 32 of Figure 34 (SEQ ID NO: 56).
To 299 are included. In another aspect, the invention features at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from amino acid residue 32 to about 299 of Figure 34 (SEQ ID NO: 56), More preferably it relates to an isolated PRO1359 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, most preferably at least about 95% sequence identity. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 32 to about 299 of Figure 34 (SEQ ID NO: 56). It relates to an isolated PRO1359 polypeptide which comprises an amino acid sequence with a score of% positive, most preferably at least about 95% positive. In yet another aspect, the invention features amino acid residue 3 of Figure 34 (SEQ ID NO: 56).
Relates to an isolated PRO1359 polypeptide comprising from 2 to about 299 sequences, or a fragment thereof sufficient to provide a binding site for an anti-PRO1359 antibody. Preferably, the PRO1359 fragment retains the qualitative biological activity of the native PRO1359 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig3
PRO1 having the sequence of about amino acid residues 32 to about 299 of 4 (SEQ ID NO: 56)
359 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions and the test DNA molecule is (a) or (
at least about 80% sequence identity to b), preferably at least about 85
(Ii) a host cell containing the test DNA molecule for expression of the polypeptide if it has a sequence identity of%, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Culture under suitable conditions, and (iii
) Providing a polypeptide produced by recovering the polypeptide from a cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1359 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1359 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1359 polypeptide by contacting the native PRO1359 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.

In yet a further embodiment, the invention relates to a composition comprising a PRO1359 polypeptide, or an agonist or antagonist identified above, together with a pharmaceutically acceptable carrier. 18. A cDNA clone (DNA59586-) having homology with the PRO1190 CDO protein and encoding a novel polypeptide named "PRO1190" in the present application.
1520) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1190 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1190 polypeptide having a sequence from about 1 to about 1115 amino acid residues of Figure 36 (SEQ ID NO: 58), or (b) (a). At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity to the complement of the DNA molecule of It comprises DNA having sequence identity. In another aspect, the invention features an isolated nucleic acid molecule that encodes a PRO1190 polypeptide that comprises a DNA that hybridizes to the complement of the nucleic acid at residues 340 to about 3684 of Figure 35 (SEQ ID NO: 58). Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA59586-1520) of ATCC Deposit No. 203288, or (b) the complement of the DNA molecule of (a). Against
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203288 (DNA59586-1520). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about amino acid residue 1 to about 1115 of Figure 36 (SEQ ID NO: 58). , More preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity, or a DNA encoding a polypeptide, or (b) (a) the complement of the DNA. Relates to separated nucleic acid molecules. In a further aspect, the invention provides a test DNA molecule, (a) a DNA molecule encoding a PRO1190 polypeptide having the sequence from about 1 to about 1115 amino acid residues of Figure 36 (SEQ ID NO: 58), or (b) ( a) the complement of the DNA molecule,
Hybridized under stringent conditions, the DNA molecule has at least about 80% sequence identity to (a) or (b), preferably at least about 85% sequence identity, more preferably at least about 90%. Of at least about 50 nucleotides, preferably at least about 100 nucleotides, prepared by isolating a test DNA molecule having at least about 95% sequence identity. Relates to nucleic acid molecules.

In a particular aspect, the invention provides a DNA encoding a PRO1190 polypeptide.
An isolated nucleic acid molecule comprising one or more of its transmembrane domains deleted or inactivated, or complementary to such an encoding nucleic acid molecule. The transmembrane domain is tentatively identified as extending from about amino acid position 16 to about amino acid position 30 and from about amino acid position 854 to about amino acid position 879 in the PRO1190 amino acid sequence shown in Figure 36 (SEQ ID NO: 58). The present invention provides (a) at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to the amino acid sequence of residues 1 to about 1115 of Fig36 (SEQ ID NO: 58). % Nucleic acid, and most preferably at least about 95% positive score DNA encoding a polypeptide, or (b) an isolated nucleic acid molecule comprising the complement of the DNA of (a). Another embodiment is a PR that finds use as a hybridization probe.
It concerns a fragment of the O1190 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides in length, and most preferably about 20 to about 40 nucleotides in length. In another embodiment, the invention provides an isolated PRO1190 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1190 polypeptide, which in certain embodiments comprises an amino acid sequence comprising residues 1 to 1115 of Fig36 (SEQ ID NO: 58). There is. In another aspect, the invention features at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence of amino acid residues 1 to about 1115 of Figure 36 (SEQ ID NO: 58), More preferably, it relates to an isolated PRO1190 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In a further aspect, the invention features residues 1 to 11 of Figure 36 (SEQ ID NO: 58).
Comprising at least about 80% positive amino acid sequence, preferably at least about 85% positive, more preferably at least about 90% positive, most preferably at least about 95% positive, when compared to the 15 amino acid sequence. It relates to an isolated PRO1190 polypeptide.

In yet another aspect, the invention features amino acid residue 1 of Figure 36 (SEQ ID NO: 58).
To about 1115, or an isolated PRO1190 polypeptide comprising sufficient sequence to provide a binding site for an anti-PRO1190 antibody. Preferably, the PRO1190 fragment retains the qualitative biological activity of the native PRO1190 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig3
PRO1 having a sequence of about 1 to about 1115 amino acid residues of SEQ ID NO: 6 (SEQ ID NO: 58)
A 190-polypeptide-encoding DNA molecule, or (b) a complement of the DNA molecule of (a), is hybridized under stringent conditions, and the test DNA molecule is (a) or (
at least about 80% sequence identity to b), preferably at least about 85
(Ii) a host cell containing the test DNA molecule for expression of the polypeptide if it has a sequence identity of%, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Culture under suitable conditions, and (iii
) Providing a polypeptide produced by recovering the polypeptide from a cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1190 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1190 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1190 polypeptide by contacting the native PRO1190 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising a PRO1190 polypeptide, or an agonist or antagonist specified above, together with a pharmaceutically acceptable carrier. 19. PRO1772 In the present application, a cDNA clone (“PRO1772”), which encodes a novel polypeptide and has homology to a nucleic acid encoding a peptidase enzyme (
DNA59817-1703) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1772 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1772 polypeptide having the sequence of amino acid residues about 1 or about 37 to about 487 of Figure 38 (SEQ ID NO: 63), or (b) At least about 80% sequence identity to the complement of the DNA molecule of (a), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about. 9
It comprises DNA with 5% sequence identity.

In another aspect, the invention features nucleotides about 93 of Figure 37 (SEQ ID NO: 62).
Or an isolated nucleic acid molecule encoding a PRO1772 polypeptide that comprises DNA that hybridizes to the complement of about 201 to about 1553 nucleic acids. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA59817-1703) of ATCC Deposit No. 203470, or (b) the complement of a nucleic acid molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity,
More preferably it relates to an isolated nucleic acid molecule comprising DNA having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203470 (DNA59817-1703). In yet a further aspect, the invention provides (a) at least about 80% sequence identity with amino acid residue 1 of Fig38 (SEQ ID NO: 63) or the sequence from about 37 to about 487,
Preferably at least about 85% sequence identity, more preferably at least about 90.
It relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide having a% sequence identity, most preferably at least about 95% sequence identity, or (b) the complement of the DNA of (a). In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO17 having amino acid residue 1 of Fig38 (SEQ ID NO: 63) or a sequence from about 37 to about 487.
72 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, wherein the DNA molecule is at least about 80 relative to (a) or (b). Isolating a test DNA molecule when it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule having at least 415 nucleotides produced by. In a particular aspect, the invention provides an isolated nucleic acid molecule comprising a DNA encoding a PRO1772 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and a soluble or transmembrane domain thereof. Are deleted or inactivated variants, or are complementary to such encoding nucleic acid molecules. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 36 in the sequence of Figure 38 (SEQ ID NO: 63). The transmembrane domain has been tentatively identified as extending from about amino acid position 313 to about amino acid position 331 of the PRO1772 amino acid sequence (Fig38, SEQ ID NO: 63). In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residue 38 of Figure 38 (SEQ ID NO: 63) or about 37 to about 487. , More preferably at least about 9
It relates to an isolated nucleic acid molecule comprising 0% positive, most preferably at least about 95% positive score DNA encoding a polypeptide, or (b) (a) the complement of DNA.

Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1772 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides long, most preferably about 20 to about 40 nucleotides long and can be derived from the nucleotide sequence shown in Figure 37 (SEQ ID NO: 62). In another embodiment, the invention provides an isolated PRO1772 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1772 polypeptide, which in certain embodiments comprises residue 1 of Figure 38 (SEQ ID NO: 63) or an amino acid comprising from about 37 to about 487. Contains an array. In another aspect, the invention features at least about 80% sequence identity, preferably at least about 85% sequence identity to amino acid residue 1 of Fig38 (SEQ ID NO: 63) or the sequence from about 37 to about 487. It relates to an isolated PRO1772 polypeptide comprising an amino acid sequence having identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In a further aspect, the invention features residue 1 or about 3 of Figure 38 (SEQ ID NO: 63).
At least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to the amino acid sequence from 7 to about 487.
It relates to an isolated PRO1772 polypeptide which comprises an amino acid sequence with a score of% positive, most preferably at least about 95% positive. In yet another aspect, the invention features amino acid residue 1 of Figure 38 (SEQ ID NO: 63).
Or a sequence of about 37 to about 487, or an isolated PRO1772 polypeptide comprising sufficient fragment thereof to provide a binding site for an anti-PRO1772 antibody. Preferably, the PRO1772 fragment retains the qualitative biological activity of the native PRO1772 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig3
DNA molecule encoding a PRO1772 polypeptide having the sequence of about 1 or about 37 to about 487 amino acid residues of SEQ ID NO: 8 (SEQ ID NO: 63), or (b) (a) DN
Hybridization with the complement of the A molecule under stringent conditions results in the test DNA molecule (a
) Or (b), at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. If there is identity, then (ii) test D
A polypeptide produced by culturing a host cell containing an NA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture medium is provided.

In yet another embodiment, the invention relates to agonists and antagonists of native PRO1772 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1772 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1772 polypeptide by contacting the native PRO1772 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising a PRO1772 polypeptide, or an agonist or antagonist specified above, together with a pharmaceutically acceptable carrier. 20. PRO1248 In the present application, a cDNA clone (DNA) designated as "PRO1248", which encodes a novel polypeptide and has homology with a nucleic acid encoding PUT-2.
60278-1530) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1248 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule that encodes a PRO1248 polypeptide having a sequence from about 1 or about 21 to about 183 amino acid residues of Fig40 (SEQ ID NO: 68), or (b). At least about 80% sequence identity to the complement of the DNA molecule of (a), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about. 9
It comprises DNA with 5% sequence identity. In another aspect, the invention features about nucleotide 12 of Figure 39 (SEQ ID NO: 67).
2 or an isolated nucleic acid molecule encoding a PRO1248 polypeptide comprising DNA that hybridizes to the complement of about 182 to about 670 nucleic acids. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA60278-1530) of ATCC Deposit No. 203170, or (b) the complement of a nucleic acid molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity,
More preferably it relates to an isolated nucleic acid molecule comprising DNA having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203170 (DNA60278-1530).

In yet a further aspect, the invention provides (a) at least about 80% sequence identity with amino acid residue 1 of Figure 40 (SEQ ID NO: 68) or the sequence from about 21 to about 183,
Preferably at least about 85% sequence identity, more preferably at least about 90.
It relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide having a% sequence identity, most preferably at least about 95% sequence identity, or (b) the complement of the DNA of (a). In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO12 having amino acid residue 1 of Fig40 (SEQ ID NO: 68) or a sequence from about 21 to about 183.
At least about 80 DNA molecules relative to (a) or (b), which hybridizes under stringent conditions with a DNA molecule encoding a 48 polypeptide, or (b) the complement of the DNA molecule of (a). Isolating a test DNA molecule when it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule having at least 10 nucleotides. In a particular aspect, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1248 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and its soluble or transmembrane domain. Are deleted or inactivated variants, or are complementary to such encoding nucleic acid molecules. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 20 in the sequence of Figure 40 (SEQ ID NO: 68). The transmembrane domain has been tentatively identified as extending from about amino acid position 90 to about amino acid position 112 of the PRO1248 amino acid sequence (Fig40, SEQ ID NO: 68). In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residue 1 or about 21 to about 183 of Fig40 (SEQ ID NO: 68). , More preferably at least about 9
It relates to an isolated nucleic acid molecule comprising 0% positive, most preferably at least about 95% positive score DNA encoding a polypeptide, or (b) (a) the complement of DNA. Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1248 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides long, most preferably about 20 to about 40 nucleotides long and can be derived from the nucleotide sequence shown in Figure 39 (SEQ ID NO: 67). In another embodiment, the invention provides an isolated PRO1248 polypeptide encoded by any of the isolated nucleic acid sequences identified above.

In a particular aspect, the invention provides an isolated native sequence PRO1248 polypeptide, which in certain embodiments is residue 1 or about 21 to about 183 of Figure 40 (SEQ ID NO: 68). It contains an amino acid sequence containing. In another aspect, the invention features at least about 80% sequence identity, preferably at least about 85% sequence, to amino acid residue 1 of Fig40 (SEQ ID NO: 68) or the sequence from about 21 to about 183. It relates to an isolated PRO1248 polypeptide comprising an amino acid sequence having identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In a further aspect, the invention features residue 1 or about 2 of Figure 40 (SEQ ID NO: 68).
At least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to the 1 to about 183 amino acid sequence.
It relates to an isolated PRO1248 polypeptide which comprises an amino acid sequence with a score of% positive, most preferably at least about 95% positive. In yet another aspect, the invention features amino acid residue 1 of Fig40 (SEQ ID NO: 68).
Or about 21 to about 183, or an isolated PRO1248 polypeptide comprising sufficient of a fragment thereof to provide a binding site for an anti-PRO1248 antibody. Preferably, the PRO1248 fragment retains the qualitative biological activity of the native PRO1248 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig4
A DNA molecule encoding a PRO1248 polypeptide having a sequence of about 1 or about 21 to about 183 amino acid residues of 0 (SEQ ID NO: 68), or (b) (a) DN
Hybridization with the complement of the A molecule under stringent conditions results in the test DNA molecule (a
) Or (b), at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. If there is identity, then (ii) test D
A polypeptide produced by culturing a host cell containing an NA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture medium is provided. In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1248 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1248 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1248 polypeptide by contacting the native PRO1248 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising a PRO1248 polypeptide, or an agonist or antagonist identified above, together with a pharmaceutically acceptable carrier.

21. PRO1316 A cDNA clone (DNA60608-157) named "PRO1316" in the present application, encoding a novel polypeptide and having homology with Dickkopf.
7) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1316 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1316 polypeptide having amino acid residue 1 of Figure 42 (SEQ ID NO: 70) or a sequence of about 26 to about 259, or (b) ( At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% to the complement of the DNA molecule of a).
It comprises DNA with% sequence identity. In another aspect, the invention features an isolated nucleic acid molecule that encodes a PRO1316 polypeptide that includes DNA that hybridizes to the complement of a nucleic acid from residues 281 to 987 of Figure 41 (SEQ ID NO: 69). Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA60608-1577) of ATCC Deposit No. 203126, or (b) the complement of a nucleic acid molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity,
More preferably it relates to an isolated nucleic acid molecule comprising DNA having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203126 (DNA60608-1577). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of amino acid residues about 26 to about 259 of Fig42 (SEQ ID NO: 70). , More preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity, or a DNA encoding a polypeptide of (b) (a). Relates to separated nucleic acid molecules. In a further aspect, the invention provides (a) residue 1 of Fig41 (SEQ ID NO: 69).
-454 or at least 15 nucleotides that hybridize under stringent conditions with a DNA molecule having identity with a region spanning either residue 1095-3130 or (b) (a). Isolated nucleic acid molecule having: Also, an isolated nucleic acid molecule having at least 15 nucleotides is (
a) Residues 1 to 454 or 1095 to 313 of Fig41 (SEQ ID NO: 69)
A DNA molecule having identity with a region spanning any of 0, or (b) (a)
At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity to the complement of a DNA molecule of Have identity.

In a particular embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1316 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and its soluble, ie A variant is provided in which the transmembrane domain has been deleted or inactivated, or is complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 25 in the sequence of Figure 42 (SEQ ID NO: 70). The N-glucosylation site has been identified at position 52 and the mold Zn (2) -Cys (6) binuclear cluster at position 99. In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residues 26 to about 259 of Fig42 (SEQ ID NO: 70), more preferably at least about 85% positive. Relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or the complement of DNA of (b) (a). In another embodiment, the invention provides an isolated PRO1316 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1316 polypeptide, which in certain embodiments is residue 26 of Figure 42 (SEQ ID NO: 70).
To 259 are included. In another aspect, the invention features at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from amino acid residue 26 to about 259 of Figure 42 (SEQ ID NO: 70), More preferably, it relates to an isolated PRO1316 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In a further aspect, the invention features residues 26 to 2 of Figure 42 (SEQ ID NO: 70).
Comprising a score of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, and most preferably at least about 95% positive when compared to the 59 amino acid sequence. It relates to an isolated PRO1316 polypeptide. In yet another aspect, the invention features amino acid residue 2 of Figure 42 (SEQ ID NO: 70).
Relates to an isolated PRO1316 polypeptide comprising 6 to about 259 sequences, or a fragment thereof sufficient to provide a binding site for an anti-PRO1316 antibody. Preferably, the PRO1316 fragment retains the qualitative biological activity of the native PRO1316 polypeptide.

In yet a further aspect, the invention provides (i) a test DNA molecule, (a) Fig4
PRO1 having the sequence of about 26 to about 259 amino acid residues of SEQ ID NO: 2 (SEQ ID NO: 70)
A DNA molecule encoding a 316 polypeptide or (b) a complement of the DNA molecule of (a) is hybridized under stringent conditions, and the test DNA molecule is (a) or (
at least about 80% sequence identity to b), preferably at least about 85
(Ii) a host cell containing the test DNA molecule for expression of the polypeptide if it has a sequence identity of%, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Culture under suitable conditions, and (iii
) Providing a polypeptide produced by recovering the polypeptide from a cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1316 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1316 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1316 polypeptide by contacting the native PRO1316 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising a PRO1316 polypeptide, or an agonist or antagonist identified above, together with a pharmaceutically acceptable carrier. 22. PRO1197 A cDNA clone (DNA60611-1524) encoding a novel secreted polypeptide designated "PRO1197" in this application was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1197 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1197 polypeptide having amino acid residue 1 of Fig44 (SEQ ID NO: 72) or a sequence of about 25 to about 363, or (b) ( At least about 80% sequence identity to the complement of the DNA molecule of a), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%.
It comprises DNA with% sequence identity. In another aspect, the invention features an isolated nucleic acid molecule that encodes a PRO1197 polypeptide that comprises a DNA that hybridizes to the complement of a nucleic acid from residues about 383 to about 1399 of Figure 43 (SEQ ID NO: 71). Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA60611-1524) of ATCC Deposit No. 203175, or (b) the complement of the DNA molecule of (a). Against
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203175 (DNA60611-1524).

In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of about amino acid residues 25 to about 363 of Fig44 (SEQ ID NO: 72). Comprising a DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) (a) the complement of DNA. To an isolated nucleic acid molecule consisting of In a further aspect, the invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1197 polypeptide having the sequence of about amino acid residues 25 to about 363 of Fig44 (SEQ ID NO: 72), or (b) ( a) the complement of the DNA molecule,
Hybridized under stringent conditions, the DNA molecule has at least about 80% sequence identity to (a) or (b), preferably at least about 85% sequence identity, more preferably at least about 90%. Of at least about 50 nucleotides, preferably at least about 100 nucleotides, prepared by isolating a test DNA molecule having at least about 95% sequence identity. Relates to nucleic acid molecules. In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive, when compared to the amino acid sequence of residues about 25 to about 363 of Fig44 (SEQ ID NO: 72), Preferably, it relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or the complement of DNA of (b) (a). Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1197 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides in length, and most preferably about 20 to about 40 nucleotides in length. In another embodiment, the invention provides an isolated PRO1197 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1197 polypeptide, which in certain embodiments contains about 2 residues of Fig44 (SEQ ID NO: 72).
It contains an amino acid sequence containing from 5 to about 363.

In another aspect, the invention features at least about 80% sequence identity, preferably at least about 85% sequence, to the sequence of amino acid residues 25 to about 363 of Figure 44 (SEQ ID NO: 72). An isolated PRO1197 polypeptide comprising an amino acid sequence having identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In a further aspect, the invention features residues 25 to 3 of Fig44 (SEQ ID NO: 72).
Comprising 63 amino acid sequences that score at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, and most preferably at least about 95% positive, as compared to the 63 amino acid sequence. It relates to an isolated PRO1197 polypeptide. In yet another aspect, the invention features amino acid residue 2 of Figure 44 (SEQ ID NO: 72).
Relates to an isolated PRO1197 polypeptide comprising from 5 to about 363 sequences, or a fragment thereof sufficient to provide a binding site for an anti-PRO1197 antibody. Preferably, the PRO1197 fragment retains the qualitative biological activity of the native PRO1197 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig4
PRO1 having the sequence of about 25 to about 363 amino acid residues of SEQ ID NO: 4 (SEQ ID NO: 72)
The test DNA molecule is hybridized with a DNA molecule encoding the 197 polypeptide or (b) the complement of the DNA molecule of (a) under stringent conditions, and the test DNA molecule is (a) or (
at least about 80% sequence identity to b), preferably at least about 85
(Ii) a host cell containing the test DNA molecule for expression of the polypeptide if it has a sequence identity of%, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Culture under suitable conditions, and (iii
) Providing a polypeptide produced by recovering the polypeptide from a cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1197 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1197 antibody. 23. PRO1293 In the present application, a cDNA clone (DNA60618-1557) has been identified, designated "PRO1293", which encodes a novel polypeptide and has homology to a nucleic acid encoding an immunoglobulin heavy chain variable region protein. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1293 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule that encodes a PRO1293 polypeptide having a sequence from about 1 or about 20 to about 341 amino acid residues of Figure 46 (SEQ ID NO: 77), or (b) At least about 80% sequence identity to the complement of the DNA molecule of (a), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about. 9
It comprises DNA with 5% sequence identity.

In another aspect, the invention features about nucleotide 37 of Figure 45 (SEQ ID NO: 76).
Or P containing DNA that hybridizes to the complement of about 94 to about 1059 nucleic acids
It relates to an isolated nucleic acid molecule encoding a RO1293 polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA60618-1557) of ATCC Deposit No. 203292, or (b) the complement of a nucleic acid molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity,
More preferably it relates to an isolated nucleic acid molecule comprising DNA having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203292 (DNA60618-1557). In a still further aspect, the invention provides (a) at least about 80% sequence identity with amino acid residue 1 of Figure 46 (SEQ ID NO: 77) or the sequence from about 20 to about 341,
Preferably at least about 85% sequence identity, more preferably at least about 90.
It relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide having a% sequence identity, most preferably at least about 95% sequence identity, or (b) the complement of the DNA of (a). In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO12 having amino acid residue 1 of Figure 46 (SEQ ID NO: 77) or a sequence of about 20 to about 341.
93 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, wherein the DNA molecule has at least about 80 relative to (a) or (b). Isolate a test DNA molecule if it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule having at least 100 nucleotides produced by. In a particular aspect, the invention provides an isolated nucleic acid molecule comprising a DNA encoding a PRO1293 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and a soluble or transmembrane domain thereof. Are deleted or inactivated variants, or are complementary to such encoding nucleic acid molecules. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 19 in the sequence of Figure 46 (SEQ ID NO: 77). The transmembrane domain has been tentatively identified as extending from about amino acid position 237 to about amino acid position 262 of the PRO1293 amino acid sequence (Figure 46, SEQ ID NO: 77).

In another aspect, the invention features (a) at least about 80% positive, preferably at least about 80% positive when compared to the amino acid sequence of residue 1 or about 20 to about 341 of Figure 46 (SEQ ID NO: 77). 85% positive, more preferably at least about 9
It relates to an isolated nucleic acid molecule comprising 0% positive, most preferably at least about 95% positive score DNA encoding a polypeptide, or (b) (a) the complement of DNA. Another embodiment is a PR that finds use as a hybridization probe.
It relates to a fragment of the O1293 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides long, most preferably about 20 to about 40 nucleotides long and can be derived from the nucleotide sequence shown in Figure 45 (SEQ ID NO: 76). In another embodiment, the invention provides an isolated PRO1293 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1293 polypeptide, which in certain embodiments comprises residue 1 of Figure 46 (SEQ ID NO: 77) or an amino acid comprising from about 20 to about 341. Contains an array. In another aspect, the invention features at least about 80% sequence identity, preferably at least about 85% sequence identity to amino acid residue 1 of Figure 46 (SEQ ID NO: 77) or the sequence from about 20 to about 341. It relates to an isolated PRO1293 polypeptide comprising an amino acid sequence having identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In a further aspect, the invention features residue 1 or about 2 of Figure 46 (SEQ ID NO: 77).
At least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to the amino acid sequence from 0 to about 341.
It relates to an isolated PRO1293 polypeptide which comprises an amino acid sequence with a score of% positive, most preferably at least about 95% positive. In yet another aspect, the invention features amino acid residue 1 of Figure 46 (SEQ ID NO: 77).
Or about 20 to about 341 sequences, or a fragment thereof sufficient to provide a binding site for an anti-PRO1293 antibody. Preferably, the PRO1293 fragment retains the qualitative biological activity of the native PRO1293 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig4
6 (SEQ ID NO: 77), a DNA molecule encoding a PRO1293 polypeptide having a sequence of about 1 or about 20 to about 341 amino acid residues, or (b) (a) DN
Hybridization with the complement of the A molecule under stringent conditions results in the test DNA molecule (a
) Or (b), at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. If there is identity, then (ii) test D
A polypeptide produced by culturing a host cell containing an NA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture medium is provided.

In yet another embodiment, the invention relates to agonists and antagonists of native PRO1293 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1293 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1293 polypeptide by contacting the native PRO1293 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising a PRO1293 polypeptide, or an agonist or antagonist specified above, together with a pharmaceutically acceptable carrier. 24. PRO1380 In this application, a cDNA clone (DNA60740-1615) has been identified, designated "PRO1380" and encoding a novel multi-span transmembrane polypeptide. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1380 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1380 polypeptide having the sequence of amino acid residues from about 1 to about 470 of Figure 48 (SEQ ID NO: 79), or (b) (a). About 8 to the complement of the DNA molecule of
It comprises DNA having 0% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In another aspect, the invention features residues 47 to about 1 of Figure 47 (SEQ ID NO: 78).
It relates to an isolated nucleic acid molecule encoding a PRO1380 polypeptide containing DNA which hybridizes to the complement of 460 nucleic acids. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA60740-1615) of ATCC Deposit No. 203456, or (b) the complement of the DNA molecule of (a). Against
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203456 (DNA60740-1615).

In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of amino acid residues about 1 to about 470 of Figure 48 (SEQ ID NO: 79). A DNA comprising a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (a) the complement of DNA. Relates to separated nucleic acid molecules. In a further aspect, the invention provides a test DNA molecule, (a) a DNA molecule encoding a PRO1380 polypeptide having a sequence of from about 1 to about 470 amino acid residues of Fig48 (SEQ ID NO: 79), or (b) ( hybridizing with the complement of the DNA molecule of a) under stringent conditions, wherein the DNA molecule is relative to (a) or (b),
A test DNA molecule having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule having at least about 50 nucleotides, preferably at least about 100 nucleotides. In a particular aspect, the invention provides a DNA encoding a PRO1380 polypeptide.
Providing an isolated nucleic acid molecule comprising: and a soluble variant thereof (ie, one or more transmembrane domains deleted or inactivated), or complementary to such an encoding nucleic acid molecule. . The transmembrane domain has a PRO1380 amino acid sequence (
Fig 48, SEQ ID NO: 79) at the next amino acid position: about 50-74, 105-1
27, 135-153, 163-183, 228-252, 305-330, and 448-472. In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive, more preferably when compared to the amino acid sequence of residues 1 to about 470 of Fig48 (SEQ ID NO: 79), more preferably Relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or the complement of DNA of (b) (a). Another embodiment is a PR that finds use as a hybridization probe.
It relates to a fragment of the O1380 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides in length, and most preferably about 20 to about 40 nucleotides in length. In another embodiment, the invention provides an isolated PRO1380 polypeptide encoded by any of the isolated nucleic acid sequences identified above.

In a particular aspect, the invention provides an isolated native sequence PRO1380 polypeptide, which in certain embodiments comprises an amino acid sequence comprising residues 1 to 470 of Fig48 (SEQ ID NO: 79). Is included. In another aspect, the invention features at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence of amino acid residues 1 to about 470 of Figure 48 (SEQ ID NO: 79), More preferably at least about 90% sequence identity,
Most preferably it relates to an isolated PRO1380 polypeptide which comprises an amino acid sequence having at least about 95% sequence identity. In a further aspect, the invention features residues 1 to 47 of Figure 48 (SEQ ID NO: 79).
Comprising at least about 80% positive amino acid sequence, preferably at least about 85% positive, more preferably at least about 90% positive, most preferably at least about 95% positive, when compared to 0 amino acid sequence, It relates to an isolated PRO1380 polypeptide. In yet another aspect, the invention provides amino acid residue 1 of Figure 48 (SEQ ID NO: 79).
To about 470 sequences, or a fragment thereof sufficient to provide a binding site for an anti-PRO1380 antibody. Preferably, the PRO1380 fragment retains the qualitative biological activity of the native PRO1380 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig4
PRO13 having a sequence of about 1 to about 470 amino acid residues of 8 (SEQ ID NO: 79)
A DNA molecule encoding the 80 polypeptide, or (b) a complement of the DNA molecule of (a), is hybridized under stringent conditions and the test DNA molecule is (a) or (b).
) To at least about 80% sequence identity, preferably at least about 85%
(Ii) a host cell containing the test DNA molecule is suitable for expression of the polypeptide if it has at least about 90% sequence identity, more preferably at least about 95% sequence identity. Under different conditions, and (iii)
Provided is a polypeptide produced by recovering the polypeptide from a cell culture medium. 25. PRO1265 A cDNA clone (DNA60, which is named “PRO1265” in the present application, and which encodes a novel polypeptide having homology with the polypeptide of FIG1.
764-1533) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1265 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1265 polypeptide having amino acid residue 1 of Figure 50 (SEQ ID NO: 84) or a sequence of about 22 to about 567, or (b) ( At least about 80% sequence identity to the complement of the DNA molecule of a), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%.
It comprises DNA with% sequence identity.

In another aspect, the invention features an isolated nucleic acid encoding a PRO1265 polypeptide that comprises a DNA that hybridizes to the complement of the nucleic acid from residues 142 to 1779 of Figure 49 (SEQ ID NO: 83). Regarding the molecule. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA60764-1533) of ATCC Deposit No. 203452, or (b) the complement of the DNA molecule of (a). Against
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203452 (DNA60764-1533). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of about amino acid residues 22 to about 567 of Figure 50 (SEQ ID NO: 84). , More preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity, or a DNA encoding a polypeptide of (a) the complement of the isolated DNA. Relates to nucleic acid molecules. In a further aspect, the invention provides that a test DNA molecule is (a) a DNA molecule encoding a PRO1265 polypeptide having a sequence from about 22 to about 567 amino acid residues of Fig50 (SEQ ID NO: 84), or (b) ( a) the complement of the DNA molecule,
Hybridized under stringent conditions, the DNA molecule has at least about 80% sequence identity to (a) or (b), preferably at least about 85% sequence identity, more preferably at least about 90%. An isolated nucleic acid having at least about 50 nucleotides, preferably about 100 nucleotides, prepared by isolating a test DNA molecule when having sequence identity of, most preferably at least about 95% sequence identity. Regarding the molecule. In a particular aspect, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1265 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, or such a code. A complementary nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 21 in the sequence of Figure 50 (SEQ ID NO: 84). In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive, more preferably when compared to the amino acid sequence of residues 22 to about 567 of Figure 50 (SEQ ID NO: 84), more preferably at least about 85% positive. Relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or the complement of DNA of (b) (a).

Another embodiment is a PR that finds use as a hybridization probe.
It concerns a fragment of the O1265 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides in length, and most preferably about 20 to about 40 nucleotides in length. In another embodiment, the invention provides an isolated PRO1265 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1265 polypeptide, which in certain embodiments comprises an amino acid sequence comprising residue 1 of Figure 50 (SEQ ID NO: 84) or about 22 to 567. Is included. In another aspect, the invention features at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from amino acid residue 22 to about 567 of Figure 50 (SEQ ID NO: 84), More preferably it relates to an isolated PRO1265 polypeptide comprising an amino acid sequence having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In a further aspect, the invention features residues 22 to 5 of Figure 50 (SEQ ID NO: 84).
Comprising a score of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, most preferably at least about 95% positive when compared to the 67 amino acid sequence. It relates to an isolated PRO1265 polypeptide. In yet another aspect, the invention provides amino acid residue 2 of Figure 50 (SEQ ID NO: 84).
An isolated PRO1265 polypeptide comprising from 2 to about 567 sequences, or a fragment thereof sufficient to provide a binding site for an anti-PRO1265 antibody. Preferably, the PRO1265 fragment retains the qualitative biological activity of the native PRO1265 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig5
PRO1 having a sequence of about 22 to about 567 amino acid residues of 0 (SEQ ID NO: 84)
265 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions and the test DNA molecule is (a) or (
at least about 80% sequence identity to b), preferably at least about 85
(Ii) a host cell containing the test DNA molecule for expression of the polypeptide if it has a sequence identity of%, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Culture under suitable conditions, and (iii
) Providing a polypeptide produced by recovering the polypeptide from a cell culture medium.

26. PRO1250 In the present application, designated as “PRO1250”, a cDNA encoding a novel polypeptide and having homology with a nucleic acid encoding a long-chain fatty acid CoA ligase.
A clone (DNA60775-1532) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1250 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1250 polypeptide having the sequence of amino acid residues from about 1 to about 739 of Fig52 (SEQ ID NO: 86), or (b) (a). About 8 to the complement of the DNA molecule of
It comprises DNA having 0% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In another aspect, the invention features about 74 nucleotides of Figure 51 (SEQ ID NO: 85).
To PRO125 containing DNA that hybridizes to the complement of about 2290 nucleic acids from
0 polypeptide encoding an isolated nucleic acid molecule. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA60775-1532) of ATCC Deposit No. 203173, or (b) the complement of a nucleic acid molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity,
More preferably it relates to an isolated nucleic acid molecule comprising DNA having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203173 (DNA60775-1532). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of amino acid residues 1 to about 739 of Figure 52 (SEQ ID NO: 86), More preferably an isolation comprising a DNA encoding a polypeptide having at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) (a) the complement of the DNA. Nucleic acid molecule. In a further aspect, the invention provides a test DNA molecule, (a) a DNA molecule encoding a PRO1250 polypeptide having a sequence from amino acid residue 1 to about 739 of Fig52 (SEQ ID NO: 86), or (b) (a). ) Hybridizing to the complement of a DNA molecule under stringent conditions, wherein the DNA molecule has at least about 80% sequence identity to (a) or (b), preferably at least about 85% sequence identity. sex,
More preferably, an isolated nucleic acid having at least 10 nucleotides produced by isolating a test DNA molecule when having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Regarding the molecule.

In a particular embodiment, the present invention provides PR with or without an initiation methionine.
Providing an isolated nucleic acid molecule comprising a DNA encoding an O1250 polypeptide, and a soluble, ie, transmembrane domain-deleted or inactivated variant thereof,
Alternatively, it is complementary to such an encoding nucleic acid molecule. The type II transmembrane domain has been tentatively identified as extending from about amino acid position 61 to about amino acid position 80 of the PRO1250 amino acid sequence (Fig52, SEQ ID NO: 86). In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive, and more preferably when compared to the amino acid sequence of residues 1 to about 739 of Figure 52 (SEQ ID NO: 86). Relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or the complement of DNA of (b) (a). Another embodiment is a PR that finds use as a hybridization probe.
It relates to a fragment of the O1250 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides in length, most preferably about 20 to about 40 nucleotides in length, and can be derived from the nucleotide sequence shown in Figure 51 (SEQ ID NO: 85). In another embodiment, the invention provides an isolated PRO1250 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1250 polypeptide, which, in certain embodiments, comprises an amino acid sequence comprising residues 1 to about 739 of Fig52 (SEQ ID NO: 86). I'm out. In another aspect, the invention features at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence of amino acid residues 1 to about 739 of Figure 52 (SEQ ID NO: 86), More preferably at least about 90% sequence identity,
Most preferably it relates to an isolated PRO1250 polypeptide which comprises an amino acid sequence having at least about 95% sequence identity. In a further aspect, the invention features residues 1 to about 7 of Figure 52 (SEQ ID NO: 86).
Comprising at least about 80% positive amino acid sequence, preferably at least about 85% positive, more preferably at least about 90% positive, most preferably at least about 95% positive, when compared to the 39 amino acid sequence. It relates to an isolated PRO1250 polypeptide.

In yet another aspect, the invention features amino acid residue 1 of Figure 52 (SEQ ID NO: 86).
To about 739, or an isolated PRO1250 polypeptide comprising sufficient of a fragment thereof to provide a binding site for an anti-PRO1250 antibody. Preferably, the PRO1250 fragment retains the qualitative biological activity of the native PRO1250 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig5
PRO12 having the sequence of about 1 to about 739 amino acid residues of SEQ ID NO: 2 (SEQ ID NO: 86)
A DNA molecule encoding the 50 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions and the test DNA molecule is (a) or (b).
) To at least about 80% sequence identity, preferably at least about 85%
(Ii) a host cell containing the test DNA molecule is suitable for expression of the polypeptide if it has at least about 90% sequence identity, more preferably at least about 95% sequence identity. Under different conditions, and (iii)
Provided is a polypeptide produced by recovering the polypeptide from a cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1250 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1250 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1250 polypeptide by contacting the native PRO1250 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising a PRO1250 polypeptide, or an agonist or antagonist specified above, together with a pharmaceutically acceptable carrier. 27. PRO1475 In the present application, a cDNA clone (DNA61185-1646) has been identified, designated "PRO1475", which encodes a novel polypeptide and has homology with a nucleic acid encoding N-acetylglucosaminyl transferase. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1475 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1475 polypeptide having a sequence from about 1 to about 660 amino acid residues of Figure 54 (SEQ ID NO: 88), or (b) (a). About 8 to the complement of the DNA molecule of
It comprises DNA having 0% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity.

In another aspect, the invention features about nucleotide 13 of Figure 53 (SEQ ID NO: 87).
PRO14 containing DNA that hybridizes to the complement of 0 to about 2109 nucleic acids
An isolated nucleic acid molecule that encodes a 75 polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA611185-1646) of ATCC Deposit No. 203464, or (b) the complement of a nucleic acid molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity,
More preferably it relates to an isolated nucleic acid molecule comprising DNA having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203464 (DNA61185-1646). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of amino acid residues 1 to about 660 of Figure 54 (SEQ ID NO: 88), More preferably an isolation comprising DNA encoding a polypeptide having at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) (a) the complement of the DNA. Nucleic acid molecule. In a further aspect, the invention provides a test DNA molecule, (a) a DNA molecule encoding a PRO1475 polypeptide having a sequence from amino acid residue 1 to about 660 of Fig54 (SEQ ID NO: 88), or (b) (a). ) Hybridizing to the complement of a DNA molecule under stringent conditions, the DNA molecule having at least about 80% sequence identity to (a) or (b), preferably at least about 85% sequence identity. sex,
More preferably, an isolated nucleic acid having at least 180 nucleotides produced by isolating a test DNA molecule when having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Regarding the molecule. In a particular embodiment, the present invention relates to PR with or without initiation methionine.
Providing an isolated nucleic acid molecule comprising a DNA encoding an O1475 polypeptide and a soluble, ie, transmembrane domain-deleted or inactivated variant thereof,
Alternatively, it is complementary to such an encoding nucleic acid molecule. The transmembrane domain is PR
O1475 amino acid sequence (Figure 54, SEQ ID NO: 88) at about amino acid position 38
Has been tentatively identified as extending from to amino acid position 55. In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive, and more preferably when compared to the amino acid sequence of residues 1 to about 660 of Figure 54 (SEQ ID NO: 88). Relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or the complement of DNA of (b) (a).

In another embodiment, PR finds use as a hybridization probe.
A fragment of the O1475 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides long, most preferably about 20 to about 40 nucleotides long and can be derived from the nucleotide sequence shown in Figure 53 (SEQ ID NO: 87). In another embodiment, the invention provides an isolated PRO1475 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1475 polypeptide, which, in certain embodiments, comprises an amino acid sequence comprising residues 1 to about 660 of Figure 54 (SEQ ID NO: 88). I'm out. In another aspect, the invention features at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence of amino acid residues 1 to about 660 of Figure 54 (SEQ ID NO: 88), More preferably at least about 90% sequence identity,
Most preferably it relates to an isolated PRO1475 polypeptide which comprises an amino acid sequence having at least about 95% sequence identity. In a further aspect, the invention features residues 1 to about 6 of Figure 54 (SEQ ID NO: 88).
Comprising at least about 80% positive amino acid sequence, preferably at least about 85% positive, more preferably at least about 90% positive, most preferably at least about 95% positive, when compared to the 60 amino acid sequence. It relates to an isolated PRO1475 polypeptide. In yet another aspect, the invention features amino acid residue 1 of Figure 54 (SEQ ID NO: 88).
To about 660 sequence, or an isolated PRO1475 polypeptide comprising sufficient of its fragments to provide a binding site for an anti-PRO1475 antibody. Preferably, the PRO1475 fragment retains the qualitative biological activity of the native PRO1475 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig5
PRO14 having the sequence of about 1 to about 660 amino acid residues of SEQ ID NO: 4 (SEQ ID NO: 88).
75 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions and the test DNA molecule is (a) or (b).
) To at least about 80% sequence identity, preferably at least about 85%
(Ii) a host cell containing the test DNA molecule is suitable for expression of the polypeptide if it has at least about 90% sequence identity, more preferably at least about 95% sequence identity. Under different conditions, and (iii)
Provided is a polypeptide produced by recovering the polypeptide from a cell culture medium.

In yet another embodiment, the invention relates to agonists and antagonists of native PRO1475 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1475 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1475 polypeptide by contacting the native PRO1475 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In yet a further embodiment, the invention relates to a composition comprising a PRO1475 polypeptide, or an agonist or antagonist specified above, together with a pharmaceutically acceptable carrier. 28. PRO1377 In this application, a cDNA clone (DNA61608-1606) has been identified, designated "PRO1377" and encoding a novel multi-span transmembrane polypeptide. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1377 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1377 polypeptide having the sequence of amino acid residues about 1 or about 19 to about 307 of Figure 56 (SEQ ID NO: 95), or (b) At least about 80% sequence identity to the complement of the DNA molecule of (a), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about. 9
It comprises DNA with 5% sequence identity. In another aspect, the invention pertains to an isolated nucleic acid molecule encoding a PRO1377 polypeptide comprising a DNA that hybridizes to the complement of a nucleic acid from residues 203 to 1069 of Figure 55 (SEQ ID NO: 94). Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA61608-1606) of ATCC Deposit No. 203239, or (b) the complement of the DNA molecule of (a). Against
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203239 (DNA61608-1606). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about amino acid residue 19 to about 307 of Figure 56 (SEQ ID NO: 95). , More preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity, or a DNA encoding a polypeptide of (a) the complement of the isolated DNA. Relates to nucleic acid molecules.

In a further aspect, the invention provides a test DNA molecule comprising: (a) a DNA molecule encoding a PRO1377 polypeptide having a sequence from about 19 to about 307 amino acid residues of Figure 56 (SEQ ID NO: 95), or ( b) the complement of the DNA molecule of (a),
Hybridized under stringent conditions, the DNA molecule has at least about 80% sequence identity to (a) or (b), preferably at least about 85% sequence identity, more preferably at least about 90%. Of at least about 50 nucleotides, preferably at least about 100 nucleotides, prepared by isolating a test DNA molecule having at least about 95% sequence identity. Relates to nucleic acid molecules. In a particular aspect, the invention provides a PRO1377 polypeptide having or not having an N-terminal signal sequence and / or an initiation methionine, wherein one or more of its transmembrane domains has been deleted or inactivated. An isolated nucleic acid molecule containing the encoding DNA is provided, or is complementary to such an encoding nucleic acid molecule. The signal peptide is at amino acid position 1 in the sequence of Figure 56 (SEQ ID NO: 95).
Has been tentatively identified as extending from to about amino acid position 18. The transmembrane domain is
Amino acid positions approximately 37-56, 106-122, 211-20, 240-260, and 288-3 of the PRO1377 amino acid sequence (Fig56, SEQ ID NO: 95).
It has been tentatively identified as extending to 04. In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive, and more preferably when compared to the amino acid sequence of residues 19 to about 307 of Figure 56 (SEQ ID NO: 95). Relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or the complement of DNA of (b) (a). Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1377 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides in length, and most preferably about 20 to about 40 nucleotides in length. In another embodiment, the invention provides an isolated PRO1377 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1377 polypeptide, which in certain embodiments is residue 19 of Figure 56 (SEQ ID NO: 95).
To 307 are included.

In another aspect, the invention features at least about 80% sequence identity, preferably at least about 85% sequence to the sequence from amino acid residue 19 to about 307 of Figure 56 (SEQ ID NO: 95). It relates to an isolated PRO1377 polypeptide comprising an amino acid sequence having identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In a further aspect, the invention features residues 19 to 3 of Figure 56 (SEQ ID NO: 95).
The amino acid sequence of at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, most preferably at least about 95% positive, when compared to the 07 amino acid sequence. It relates to an isolated PRO1377 polypeptide. In yet another aspect, the invention features amino acid residue 1 of Figure 56 (SEQ ID NO: 95).
An isolated PRO1377 polypeptide comprising a sequence from 9 to about 307, or a fragment thereof sufficient to provide a binding site for an anti-PRO1377 antibody. Preferably, the PRO1377 fragment retains the qualitative biological activity of the native PRO1377 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig5
PRO1 having the sequence of about 19 to about 307 amino acid residues of SEQ ID NO: 6 (SEQ ID NO: 95)
A DNA molecule encoding a 377 polypeptide or (b) a complement of the DNA molecule of (a) is hybridized under stringent conditions, and the test DNA molecule is (a) or (
at least about 80% sequence identity to b), preferably at least about 85
(Ii) a host cell containing the test DNA molecule for expression of the polypeptide if it has a sequence identity of%, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Culture under suitable conditions, and (iii
) Providing a polypeptide produced by recovering the polypeptide from a cell culture medium. 29. PRO1326 A cDNA clone (DNA62808-1528) has been identified that encodes a novel secreted polypeptide designated "PRO1326" in this application. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1326 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1326 polypeptide having amino acid residue 1 of Figure 58 (SEQ ID NO: 100) or a sequence from about 30 to about 401, or (b) ( At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 9 to the complement of the DNA molecule of a).
It comprises DNA with 5% sequence identity.

In another aspect, the invention features an isolated nucleic acid encoding a PRO1326 polypeptide that comprises a DNA that hybridizes to the complement of the nucleic acid from about residues 199 to about 1314 of Figure 57 (SEQ ID NO: 99). Regarding the molecule. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203358 (DNA62808-1582), or (b) the complement of the DNA molecule of (a). Against
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203358 (DNA62808-1582). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 30 to about 401 amino acid residues of Figure 58 (SEQ ID NO: 100). , More preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity, or a DNA encoding a polypeptide of (a) the complement of the isolated DNA. Relates to nucleic acid molecules. In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO1326 having a sequence from about 30 to about 401 amino acid residues of Figure 58 (SEQ ID NO: 100).
Hybridizing with a DNA molecule encoding a polypeptide, or (b) the complement of a DNA molecule of (a) under stringent conditions, wherein the DNA molecule is at least about 80% relative to (a) or (b) A test DNA molecule is isolated if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. And an isolated nucleic acid molecule having at least about 50 nucleotides, preferably at least about 100 nucleotides. In a particular aspect, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1326 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, or such a code. A complementary nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 29 of Figure 58 (SEQ ID NO: 100). In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residues 30 to about 401 of Figure 58 (SEQ ID NO: 100), more preferably at least about 85% positive. Relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or the complement of DNA of (b) (a).

In another embodiment, PR finds use as a hybridization probe.
O1326 polypeptide coding sequence fragment. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides in length, and most preferably about 20 to about 40 nucleotides in length. In another embodiment, the invention provides an isolated PRO1326 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1326 polypeptide, which in certain embodiments is residue 3 of Figure 58 (SEQ ID NO: 100).
It contains an amino acid sequence containing 0 to 401. In another aspect, the invention features amino acid residue 30 of Figure 58 (SEQ ID NO: 100).
To about 401 sequences, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. It relates to an isolated PRO1326 polypeptide which comprises an amino acid sequence having identity. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 30 to 401 of Figure 58 (SEQ ID NO: 100). It relates to an isolated PRO1326 polypeptide which comprises an amino acid sequence that scores positive, most preferably at least about 95% positive. In a still further aspect, the invention comprises a sequence of amino acid residues 30 to about 401 of Figure 58 (SEQ ID NO: 100), or a fragment thereof sufficient to provide a binding site for an anti-PRO1326 antibody. Isolated PRO1326 polypeptide. Preferably, the PRO1326 fragment retains the qualitative biological activity of the native PRO1326 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig5
PRO having the sequence of about 30 to about 401 amino acid residues of SEQ ID NO: 100 (SEQ ID NO: 100)
A DNA molecule encoding the 1326 polypeptide, or (b) a complement of the DNA molecule of (a), under hybridizing conditions, wherein the test DNA molecule is at least about 80% sequence identity, preferably at least about 8
(Ii) expressing a host cell containing a test DNA molecule into a polypeptide if it has 5% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Under conditions suitable for and (ii
i) providing a polypeptide produced by recovering the polypeptide from the cell culture medium.

30. PRO1249 In the present application, a cDNA clone (DNA62809-1531) encoding a novel transmembrane polypeptide designated as "PRO1249" was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1249 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule that encodes a PRO1249 polypeptide having a sequence from about 1 or about 17 to about 1089 amino acid residues of Figure 60 (SEQ ID NO: 102), or (b) For the complement of the DNA molecule of (a),
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. . In another aspect, the invention features about 3 nucleotides of Figure 59 (SEQ ID NO: 101).
Or P containing DNA that hybridizes to the complement of about 51 to about 3269 nucleic acids
It relates to an isolated nucleic acid molecule encoding a RO1249 polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA62809-1531) of ATCC Deposit No. 203237, or (b) the complement of the DNA molecule of (a). Against
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203237 (DNA62809-1531). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, to amino acid residue 1 of Fig60 (SEQ ID NO: 102) or the sequence from about 17 to about 1089. Of a polypeptide having sequence identity of, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) (a) the complement of DNA. Relates to an isolated nucleic acid molecule comprising. In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO having the amino acid residue 1 of Fig60 (SEQ ID NO: 102) or the sequence from about 17 to about 1089.
Hybridized with a DNA molecule encoding the 1249 polypeptide, or (b) the complement of the DNA molecule of (a), under stringent conditions such that the DNA molecule (a) or (b)
) To at least about 80% sequence identity, preferably at least about 85%
Having at least 10 nucleotides, prepared by isolating a test DNA molecule when having sequence identity of, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule.

In a particular embodiment, the invention provides an isolated nucleic acid molecule comprising a DNA encoding a PRO1249 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and its soluble, ie A variant is provided in which the transmembrane domain has been deleted or inactivated, or is complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 16 of Figure 60 (SEQ ID NO: 102). The transmembrane domain is the amino acid position from about amino acid position 317 to about amino acid position 341, from amino acid position about 451 to about amino acid position 470, from about amino acid position about 481 to about amino acid position about 500, amino acid position about PRO1249 amino acid sequence (FIG. 60, SEQ ID NO: 102). 510 to amino acid position 527, amino acid position 538 to amino acid position 5
55, about amino acid position 831 to about amino acid position 850, about amino acid position 101
It has been tentatively identified as extending from 6 to about amino acid position 1034 and from about amino acid position 1052 to about amino acid position 1070. In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residue 1 or about 17 to about 1089 of Figure 60 (SEQ ID NO: 102). , More preferably at least about 90% positive, most preferably at least about 95% positive, DNA encoding a polypeptide, or (b) an isolated nucleic acid molecule comprising the complement of DNA of (a). Another embodiment is a PR that finds use as a hybridization probe.
It concerns a fragment of the O1249 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides long, most preferably about 20 to about 40 nucleotides long and can be derived from the nucleotide sequence shown in Figure 59 (SEQ ID NO: 101). In another embodiment, the invention provides an isolated PRO1249 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1249 polypeptide, which in certain embodiments is residue 1 of Figure 60 (SEQ ID NO: 102).
Or an amino acid sequence comprising about 17 to about 1089. In another aspect, the invention features at least about 80% sequence identity, preferably at least about 85% sequence, to amino acid residue 1 of Figure 60 (SEQ ID NO: 102) or the sequence from about 17 to about 1089. Identity, more preferably at least about 90%
Of sequence identity, most preferably at least about 95% sequence identity, to an isolated PRO1249 polypeptide.

In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residue 1 or about 17 to about 1089 of Fig60 (SEQ ID NO: 102), More preferably, it relates to an isolated PRO1249 polypeptide comprising an amino acid sequence that scores at least about 90% positive, and most preferably at least about 95% positive. In a still further aspect, the invention comprises a sequence of amino acid residue 1 of Figure 60 (SEQ ID NO: 102) or about 17 to about 1089, or a fragment thereof sufficient to provide a binding site for an anti-PRO1249 antibody. Isolated PRO124
9 polypeptides. Preferably, the PRO1249 fragment is the native PRO12.
It retains the qualitative biological activity of the 49 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig6
0 (SEQ ID NO: 102), a DNA molecule encoding a PRO1249 polypeptide having the sequence of about 1 or about 17 to about 1089 of amino acid residues, or (b) the complement of the DNA molecule of (a) and stringent conditions. Hybridized below, the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably at least about 85% sequence identity, and more preferably at least about 90% sequence identity. If there is identity, most preferably at least about 95% sequence identity, (ii) the host cell containing the test DNA molecule is cultured under conditions suitable for expression of the polypeptide, and (iii) from the cell culture medium. Provided is a polypeptide produced by recovering the polypeptide. provide. 31. PRO1315 In the present application, a cDNA clone (DNA62815-1576) named "PRO1315", which encodes a novel polypeptide and has homology to a nucleic acid encoding a cytokine receptor family-4 protein, has been identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1315 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule that encodes a PRO1315 polypeptide having the sequence from about amino acid residue 1 or about 29 to about 442 of Figure 62 (SEQ ID NO: 104), or (b) At least about 80% sequence identity to the complement of the DNA molecule of (a), preferably at least about 85% sequence identity,
More preferably it comprises DNA having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In another aspect, the invention features about 1 nucleotide of Figure 61 (SEQ ID NO: 103).
21 or an isolated nucleic acid molecule encoding a PRO1315 polypeptide that comprises DNA that hybridizes to the complement of about 205 to about 1446 nucleic acids. Preferably, hybridization occurs under stringent hybridization and wash conditions.

In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA62815-1576) of ATCC Deposit No. 203247, or (b) a nucleic acid molecule of (a). At least about 80% sequence identity to complement, preferably at least about 85% sequence identity,
More preferably it relates to an isolated nucleic acid molecule comprising DNA having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203247 (DNA62815-1576). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence with amino acid residue 1 of Figure 62 (SEQ ID NO: 104) or the sequence from about 29 to about 442. Identity, more preferably at least about 9
An isolated nucleic acid molecule comprising a DNA encoding a polypeptide having 0% sequence identity, most preferably at least about 95% sequence identity, or (b) a complement of the DNA of (a). . In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO1 having amino acid residue 1 of Figure 62 (SEQ ID NO: 104) or a sequence from about 29 to about 442.
315 polypeptide, or (b) hybridized with the complement of the DNA molecule of (a) under stringent conditions such that the DNA molecule (a) or (b)
To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule having at least 500 nucleotides produced by isolating a test DNA molecule. In a particular aspect, the invention provides an isolated nucleic acid molecule comprising a DNA encoding a PRO1315 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and a soluble or transmembrane domain thereof. Are deleted or inactivated variants, or are complementary to such encoding nucleic acid molecules. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 28 in the sequence of Figure 62 (SEQ ID NO: 104). The transmembrane domain has a PRO1315 amino acid sequence (Fig62, SEQ ID NO: 104).
) From amino acid position 140 to amino acid position 163. In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residue 1 or about 29 to about 442 of Figure 62 (SEQ ID NO: 104). , More preferably at least about 90% positive, most preferably at least about 95% positive, DNA encoding a polypeptide, or (b) an isolated nucleic acid molecule comprising the complement of DNA of (a).

Another embodiment is a PR that finds use as a hybridization probe.
It concerns a fragment of the O1315 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
It is more preferably about 20 to about 50 nucleotides in length, most preferably about 20 to about 40 nucleotides in length, and can be derived from the nucleotide sequence shown in Figure 61 (SEQ ID NO: 103). In another embodiment, the invention provides an isolated PRO1315 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a specific aspect, the invention provides an isolated native sequence PRO1315 polypeptide, which in certain embodiments is residue 1 of Figure 62 (SEQ ID NO: 104).
Or an amino acid sequence comprising about 29 to about 442. In another aspect, the invention features at least about 80% sequence identity, preferably at least about 85% sequence, to amino acid residue 1 of Figure 62 (SEQ ID NO: 104) or the sequence from about 29 to about 442. It relates to an isolated PRO1315 polypeptide comprising an amino acid sequence having identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to the amino acid sequence of residue 1 or about 29 to about 442 of Figure 62 (SEQ ID NO: 104), more preferably At least about 9
It relates to an isolated PRO1315 polypeptide comprising an amino acid sequence with a score of 0% positive, most preferably at least about 95% positive. In a still further aspect, the invention comprises amino acid residue 1 of Figure 62 (SEQ ID NO: 104) or the sequence from about 29 to about 442, or a fragment thereof sufficient to provide a binding site for an anti-PRO1315 antibody. Isolated PRO1315
Relates to polypeptides. Preferably, the PRO1315 fragment is the native PRO131.
5 retains the qualitative biological activity of the polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig6
2 (SEQ ID NO: 104), a DNA molecule encoding a PRO1315 polypeptide having a sequence of about 1 or about 29 to about 442 of amino acid residues, or (b) (a) D
Hybridization with the complement of the NA molecule under stringent conditions allows the test DNA molecule to
at least about 80% sequence identity to a) or (b), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity,
Most preferably, (ii) culturing a host cell containing a test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) culturing the polypeptide from the cell culture medium, provided that it has at least about 95% sequence identity. A polypeptide produced by recovering is provided. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1315 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1315 antibody.

In a further embodiment, the invention provides the identification of an agonist or antagonist of a native PRO1315 polypeptide by contacting the native PRO1315 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. Regarding the method. In a still further embodiment, the invention relates to a composition comprising a PRO1315 polypeptide, or an agonist or antagonist specified above, together with a pharmaceutically acceptable carrier. 32. PRO1599 A cDNA clone (DNA62845-1) named "PRO1599" in the present application and encoding a novel polypeptide having homology with Galanzyme M.
684) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1599 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule that encodes a PRO1599 polypeptide having a sequence from about amino acid residue 1 or about 31 to about 283 of Fig64 (SEQ ID NO: 111), or (b) At least about 80% sequence identity to the complement of the DNA molecule of (a), preferably at least about 85% sequence identity,
More preferably it comprises DNA having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In another aspect, the invention features an isolated nucleic acid molecule that encodes a PRO1599 polypeptide that comprises DNA that hybridizes to the complement of a nucleic acid from residues 159 to 917 of Figure 63 (SEQ ID NO: 110). Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA62845-1684) of ATCC Deposit No. 203361, or (b) the complement of a nucleic acid molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity,
More preferably it relates to an isolated nucleic acid molecule comprising DNA having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203361 (DNA62845-1684). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about amino acid residue 31 to about 283 of Fig64 (SEQ ID NO: 111). , More preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity, or a DNA encoding a polypeptide of (a) the complement of the isolated DNA. Relates to nucleic acid molecules.

In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO1599 having a sequence from about 31 to about 283 amino acid residues of Fig64 (SEQ ID NO: 111).
Hybridizing with a DNA molecule encoding a polypeptide, or (b) the complement of a DNA molecule of (a) under stringent conditions, wherein the DNA molecule is at least about 80% relative to (a) or (b) A test DNA molecule is isolated if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. And an isolated nucleic acid molecule having at least about 50 nucleotides, preferably at least about 100 nucleotides. In a particular aspect, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1599 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, or such a code. A complementary nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 30 in the sequence of Figure 64 (SEQ ID NO: 111). In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive, and more preferably when compared to the amino acid sequence of residues 31 to about 283 of Fig64 (SEQ ID NO: 111). Relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or the complement of DNA of (b) (a). Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1599 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides in length, and most preferably about 20 to about 40 nucleotides in length. In another embodiment, the invention provides an isolated PRO1599 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1599 polypeptide, which in certain embodiments is residue 3 of Fig64 (SEQ ID NO: 111).
It contains an amino acid sequence containing from 1 to 283. In another aspect, the invention features amino acid residue 31 of Figure 64 (SEQ ID NO: 111).
To about 283 sequences, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated PRO1599 polypeptide comprising an amino acid sequence having identity.

In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least at least 80% positive when compared to the amino acid sequence of residues 31 to 283 of Fig64 (SEQ ID NO: 111). It relates to an isolated PRO1599 polypeptide which comprises an amino acid sequence with a score of about 90% positive, most preferably at least about 95% positive. In a still further aspect, the invention comprises a sequence of amino acid residues 31 to about 283 of Figure 64 (SEQ ID NO: 111), or a fragment thereof sufficient to provide a binding site for an anti-PRO1599 antibody. Isolated PRO1599 polypeptide. Preferably, the PRO1599 fragment retains the qualitative biological activity of the native PRO1599 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig6
PRO having the sequence of about 31 to about 283 amino acid residues of SEQ ID NO: 4 (SEQ ID NO: 111)
A DNA molecule encoding a 1599 polypeptide or (b) a complement of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule is at least about 80% sequence identity, preferably at least about 8
(Ii) expressing a host cell containing a test DNA molecule into a polypeptide if it has 5% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Under conditions suitable for and (ii
i) providing a polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1599 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1599 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1599 polypeptide by contacting the native PRO1599 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising a PRO1599 polypeptide, or an agonist or antagonist specified above, together with a pharmaceutically acceptable carrier. 33. PRO1430 A cDNA clone (DNA648) designated as "PRO1430" in the present application and encoding a novel polypeptide having homology with a reductase protein.
42-1632) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1430 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1430 polypeptide having the sequence of amino acid residues about 1 or about 18 to about 331 of Figure 66 (SEQ ID NO: 116), or (b) At least about 80% sequence identity to the complement of the DNA molecule of (a), preferably at least about 85% sequence identity,
More preferably it comprises DNA having at least about 90% sequence identity, and most preferably at least about 95% sequence identity.

In another aspect, the invention features an isolated nucleic acid encoding a PRO1430 polypeptide that comprises a DNA that hybridizes to the complement of a nucleic acid from residues 33 to 1074 of Figure 65 (SEQ ID NO: 115). Regarding the molecule. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA64842-1632) of ATCC Deposit No. 203278, or (b) the complement of a nucleic acid molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity,
More preferably it relates to an isolated nucleic acid molecule comprising DNA having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203278 (DNA64842-1632). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 18 to about 331 amino acid residues of Figure 66 (SEQ ID NO: 116). , More preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity, or a DNA encoding a polypeptide, or (a) a complement of DNA isolated. Relates to nucleic acid molecules. In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO1430 having a sequence from about 18 to about 331 amino acid residues of Figure 66 (SEQ ID NO: 116).
Hybridizing with a DNA molecule encoding a polypeptide or (b) the complement of a DNA molecule of (a) under stringent conditions, wherein the DNA molecule is at least about 80% relative to (a) or (b) A test DNA molecule is isolated if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. An isolated nucleic acid molecule having at least about 50 nucleotides, preferably at least about 100, produced by. In a specific aspect, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1430 polypeptide with or without an N-terminal signal sequence, or complementary to such an encoding nucleic acid molecule. Target. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 17 in the sequence of Figure 66 (SEQ ID NO: 116). In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive, and more preferably when compared to the amino acid sequence of residues 18 to about 331 of Figure 66 (SEQ ID NO: 116). Relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or the complement of DNA of (b) (a).

In another embodiment, PR finds use as a hybridization probe.
It relates to a fragment of the O1430 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides in length, and most preferably about 20 to about 40 nucleotides in length. In another embodiment, the invention provides an isolated PRO1430 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1430 polypeptide, which in certain embodiments is residue 1 of Figure 66 (SEQ ID NO: 116).
It contains an amino acid sequence containing 8 to 331. In another aspect, the invention features amino acid residue 18 of Figure 66 (SEQ ID NO: 116).
To about 331 sequences, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated PRO1430 polypeptide comprising an amino acid sequence having identity. In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive amino acid sequence when compared to the amino acid sequence of residues 18 to about 331 of Figure 66 (SEQ ID NO: 116). % PROPOSITIVE, most preferably at least about 95% positive score, with respect to an isolated PRO1430 polypeptide. In a still further aspect, the invention comprises a sequence of amino acid residues 18 to about 331 of Figure 66 (SEQ ID NO: 116), or a fragment thereof sufficient to provide a binding site for an anti-PRO1430 antibody. Isolated PRO1430 polypeptide. Preferably, the PRO1430 fragment retains the qualitative biological activity of the native PRO1430 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig6
PRO having the sequence of about 18 to about 331 amino acid residues of SEQ ID NO: 6 (SEQ ID NO: 116)
1430 polypeptide-encoding DNA molecule, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule is at least about 80% sequence identity, preferably at least about 8
(Ii) expressing a host cell containing a test DNA molecule into a polypeptide if it has 5% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Under conditions suitable for and (ii
i) providing a polypeptide produced by recovering the polypeptide from the cell culture medium.

In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1430 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1430 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1430 polypeptide by contacting the native PRO1430 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In yet a further embodiment, the invention relates to a composition comprising a PRO1430 polypeptide, or an agonist or antagonist specified above, together with a pharmaceutically acceptable carrier. 34. PRO1374 In the present application, a cDNA clone (DNA64848-16, which is named “PRO1374” and encodes a novel polypeptide having sequence identity with P4HA.
04) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1374 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1374 polypeptide having amino acid residue 1 of Figure 68 (SEQ ID NO: 118) or a sequence of about 20 to about 544, or (b) ( At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 9 to the complement of the DNA molecule of a).
It comprises DNA with 5% sequence identity. In another aspect, the invention pertains to an isolated nucleic acid molecule encoding a PRO1374 polypeptide comprising DNA that hybridizes to the complement of a nucleic acid from residues 78 to 1652 of Figure 67 (SEQ ID NO: 117). Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA64849-1604) of ATCC Deposit No. 203468, or (b) the complement of the DNA molecule of (a). Against
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203468 (DNA64849-1604). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 20 to about 544 amino acid residues of Figure 68 (SEQ ID NO: 118). , More preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity, or a DNA encoding a polypeptide, or (a) a complement of DNA isolated. Relates to nucleic acid molecules.

In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO1374 having a sequence from about 20 to about 544 amino acid residues of Figure 68 (SEQ ID NO: 118).
Hybridizing with a DNA molecule encoding a polypeptide, or (b) the complement of a DNA molecule of (a) under stringent conditions, wherein the DNA molecule is at least about 80% relative to (a) or (b) A test DNA molecule is isolated if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. And an isolated nucleic acid molecule having at least about 50 nucleotides, preferably at least about 100 nucleotides. In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residues 20 to about 544 of Figure 68 (SEQ ID NO: 118), more preferably at least about 85% positive. Relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or the complement of DNA of (b) (a). Another embodiment is a PR that finds use as a hybridization probe.
It relates to a fragment of the O1374 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides in length, and most preferably about 20 to about 40 nucleotides in length. In another embodiment, the invention provides an isolated PRO1374 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1374 polypeptide, which in certain embodiments is residue 2 of Figure 68 (SEQ ID NO: 118).
It contains an amino acid sequence containing 0 to 544. In another aspect, the invention features amino acid residue 20 of Figure 68 (SEQ ID NO: 118).
To about 544 sequences, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated PRO1374 polypeptide comprising an amino acid sequence having identity. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 20 to 544 of Figure 68 (SEQ ID NO: 118). It relates to an isolated PRO1374 polypeptide which comprises an amino acid sequence with a positive, most preferably at least about 95% positive, score.

In yet a further aspect, the invention comprises a sequence of amino acid residues 20 to about 544 of Figure 68 (SEQ ID NO: 118), or a fragment thereof sufficient to provide a binding site for an anti-PRO1374 antibody. Of isolated PRO1374 polypeptides. Preferably, the PRO1374 fragment retains the qualitative biological activity of the native PRO1374 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig6
PRO having the sequence of about 20 to about 544 amino acid residues of SEQ ID NO: 118 (SEQ ID NO: 118)
A DNA molecule encoding a 1374 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a), under stringent conditions, wherein the test DNA molecule is at least about relative to (a) or (b). 80% sequence identity, preferably at least about 8
(Ii) expressing a host cell containing a test DNA molecule into a polypeptide if it has 5% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Under conditions suitable for and (ii
i) providing a polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1374 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1374 antibody. In a further embodiment, the present invention relates to a method of identifying an agonist or antagonist of a native PRO1374 polypeptide by contacting the native PRO1374 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In yet a further embodiment, the invention relates to a composition comprising a PRO1374 polypeptide, or an agonist or antagonist specified above, together with a pharmaceutically acceptable carrier. 35. PRO1311 In the present application, a cDNA clone (DNA64863-1573), which is named "PRO1311" and which encodes a novel tetraspan polypeptide, was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1311 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1311 polypeptide having amino acid residue 1 of Fig70 (SEQ ID NO: 123) or a sequence of about 45 to about 294, or (b) ( At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 9 to the complement of the DNA molecule of a).
It comprises DNA with 5% sequence identity.

In another aspect, the invention features an isolated nucleic acid that encodes a PRO1311 polypeptide that comprises a DNA that hybridizes to the complement of the nucleic acid from residues 327 to 1076 of FIG. 69 (SEQ ID NO: 122). Regarding the molecule. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203251 (DNA64863-1573), or (b) the complement of the DNA molecule of (a). Against
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203251 (DNA64863-1573). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of amino acid residues about 45 to about 294 of Fig70 (SEQ ID NO: 123). , More preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity, or a DNA encoding a polypeptide, or (a) a complement of DNA isolated. Relates to nucleic acid molecules. In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO1311 having a sequence from about 45 to about 294 amino acid residues of Fig70 (SEQ ID NO: 123).
Hybridizing with a DNA molecule encoding a polypeptide or (b) the complement of a DNA molecule of (a) under stringent conditions, wherein the DNA molecule is at least about 80% relative to (a) or (b) A test DNA molecule is isolated if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. An isolated nucleic acid molecule having at least about 50 nucleotides, preferably at least about 100, produced by. In a particular aspect, the invention provides an isolated nucleic acid molecule comprising a DNA encoding a PRO1311 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and a soluble or transmembrane domain thereof. Are deleted or inactivated variants, or are complementary to such encoding nucleic acid molecules. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 44 in the sequence of Figure 70 (SEQ ID NO: 123). The four transmembrane domains are represented by the PRO1311 amino acid sequence (Fig70, SEQ ID NO: 1).
It has been tentatively identified as extending to amino acids 22-42, 57-85, 94-116 and 230-257 of 23).

In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residues 45 to about 294 of Figure 70 (SEQ ID NO: 123). , More preferably at least about 90% positive, most preferably at least about 95% positive, DNA encoding a polypeptide, or (b) an isolated nucleic acid molecule comprising the complement of DNA of (a). Another embodiment is a PR that finds use as a hybridization probe.
It concerns a fragment of the O1311 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides in length, and most preferably about 20 to about 40 nucleotides in length. In another embodiment, the invention provides an isolated PRO1311 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1311 polypeptide, which in certain embodiments is residue 4 of Figure 70 (SEQ ID NO: 123).
It contains an amino acid sequence containing 5 to 294. In another aspect, the invention features amino acid residue 45 of Figure 70 (SEQ ID NO: 123).
To about 294 sequences, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. It relates to an isolated PRO1311 polypeptide comprising an amino acid sequence having identity. In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive as compared to the amino acid sequence of residues 45 to 294 of Figure 70 (SEQ ID NO: 123). It relates to an isolated PRO1311 polypeptide comprising an amino acid sequence with a positive score, most preferably at least about 95% positive. In yet another aspect, the invention comprises a sequence of amino acid residues 45 to about 294 of Figure 70 (SEQ ID NO: 123), or a fragment thereof sufficient to provide a binding site for an anti-PRO1311 antibody, It relates to an isolated PRO1311 polypeptide. Preferably, the PRO1311 fragment retains the qualitative biological activity of the native PRO1311 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig7
PRO having a sequence of about 45 to about 294 amino acid residues of 0 (SEQ ID NO: 123)
1311 polypeptide-encoding DNA molecule, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule is at least about 80% sequence identity, preferably at least about 8
(Ii) expressing a host cell containing a test DNA molecule into a polypeptide if it has 5% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Under conditions suitable for and (ii
i) providing a polypeptide produced by recovering the polypeptide from the cell culture medium.

36. PRO1357 In this application, a cDNA designated "PRO1357", which encodes a novel polypeptide and has homology with a nucleic acid encoding a von Ebner minor salivary gland protein.
A clone (DNA64881-1602) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1357 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule that encodes a PRO1357 polypeptide having the sequence of about 1 or about 22 to about 484 amino acid residues of Figure 72 (SEQ ID NO: 128), or (b) At least about 80% sequence identity to the complement of the DNA molecule of (a), preferably at least about 85% sequence identity,
More preferably it comprises DNA having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In another aspect, the invention features about 7 nucleotides of Fig71 (SEQ ID NO: 127).
4 or an isolated nucleic acid molecule encoding a PRO1357 polypeptide containing DNA that hybridizes to the complement of about 137 to about 1525 nucleic acids. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203240 (DNA64881-1602), or (b) the complement of a nucleic acid molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity,
More preferably it relates to an isolated nucleic acid molecule comprising DNA having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203240 (DNA64881-1602). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence with amino acid residue 1 of Fig72 (SEQ ID NO: 128) or the sequence from about 22 to about 484. Identity, more preferably at least about 9
An isolated nucleic acid molecule comprising a DNA encoding a polypeptide having 0% sequence identity, most preferably at least about 95% sequence identity, or (b) a complement of the DNA of (a). . In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO1 having amino acid residue 1 of Figure 72 (SEQ ID NO: 128) or a sequence from about 22 to about 484.
357 polypeptide-encoding DNA molecule, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, whereby the DNA molecule (a) or (b)
To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule having at least 40 nucleotides produced by isolating a test DNA molecule.

In a particular embodiment, the invention provides an isolated nucleic acid molecule comprising a DNA encoding a PRO1357 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, or Is complementary to such an encoded nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 21 in the sequence of Figure 72 (SEQ ID NO: 128). In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residue 1 or about 22 to about 484 of Figure 72 (SEQ ID NO: 128). , More preferably at least about 90% positive, most preferably at least about 95% positive, DNA encoding a polypeptide, or (b) an isolated nucleic acid molecule comprising the complement of DNA of (a). Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1357 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides long, most preferably about 20 to about 40 nucleotides long and can be derived from the nucleotide sequence shown in Figure 71 (SEQ ID NO: 127). In another embodiment, the invention provides an isolated PRO1357 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1357 polypeptide, which in certain embodiments is residue 1 of Figure 72 (SEQ ID NO: 128).
Or an amino acid sequence comprising about 22 to about 484. In another aspect, the invention features at least about 80% sequence identity, preferably at least about 85% sequence, to amino acid residue 1 of Figure 72 (SEQ ID NO: 128) or the sequence from about 22 to about 484. It relates to an isolated PRO1357 polypeptide comprising an amino acid sequence having identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to the amino acid sequence of residue 1 or about 22 to about 484 of Figure 72 (SEQ ID NO: 128), more preferably At least about 9
It relates to an isolated PRO1357 polypeptide comprising an amino acid sequence with a score of 0% positive, most preferably at least about 95% positive.

In a still further aspect, the invention features amino acid residue 1 of Figure 72 (SEQ ID NO: 128) or the sequence from about 22 to about 484, or a fragment thereof sufficient to provide a binding site for an anti-PRO1357 antibody. An isolated PRO1357 comprising
Relates to polypeptides. Preferably, the PRO1357 fragment is the native PRO135.
Retains the qualitative biological activity of the 7 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig7
2 (SEQ ID NO: 128), a DNA molecule encoding a PRO1357 polypeptide having a sequence of about 1 or about 22 to about 484 amino acid residues, or (b) (a) D
Hybridization with the complement of the NA molecule under stringent conditions allows the test DNA molecule to
at least about 80% sequence identity to a) or (b), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity,
Most preferably, (ii) culturing a host cell containing a test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) culturing the polypeptide from the cell culture medium, provided that it has at least about 95% sequence identity. A polypeptide produced by recovering is provided. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1357 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1357 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1357 polypeptide by contacting the native PRO1357 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising a PRO1357 polypeptide, or an agonist or antagonist specified above, together with a pharmaceutically acceptable carrier. 37. PRO1244 In the present application, it is designated as “PRO1244” and designated as a transplant-related protein (Implan).
cDNA clone (DNA64883-1526) has been identified, which encodes a novel polypeptide having homology to tation-Associated Protein). In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1244 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1244 polypeptide having amino acid residue 1 of Figure 74 (SEQ ID NO: 130) or a sequence of about 30 to about 335, or (b) ( At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 9 to the complement of the DNA molecule of a).
It comprises DNA with 5% sequence identity.

In another aspect, the invention features an isolated nucleic acid encoding a PRO1244 polypeptide that comprises a DNA that hybridizes to the complement of the nucleic acid from about 96 to about 1013 residues of Figure 73 (SEQ ID NO: 129). Regarding the molecule. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA64883-1526) of ATCC Deposit No. 203253, or (b) the complement of the DNA molecule of (a). Against
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203253 (DNA64883-1526). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of amino acid residues about 30 to about 335 of Figure 74 (SEQ ID NO: 130). , More preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity, or a DNA encoding a polypeptide of (a) the complement of the isolated DNA. Relates to nucleic acid molecules. In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO1244 having a sequence from about 30 to about 335 amino acid residues of Figure 74 (SEQ ID NO: 130).
Hybridizing with a DNA molecule encoding a polypeptide, or (b) the complement of a DNA molecule of (a) under stringent conditions, wherein the DNA molecule is at least about 80% relative to (a) or (b) A test DNA molecule is isolated if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. And an isolated nucleic acid molecule having at least about 50 nucleotides, preferably at least about 100 nucleotides. In a particular aspect, the invention provides an isolated nucleic acid molecule comprising a DNA encoding a PRO1244 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and a soluble or transmembrane domain thereof. Are deleted or inactivated variants, or are complementary to such encoding nucleic acid molecules. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 29 in the sequence of Figure 74 (SEQ ID NO: 130). The transmembrane domain is located at the following amino acid region of the PRO1244 amino acid sequence: 183-20.
5, 217-137, 271-287, and 301-321.

In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residues 30 to about 335 of Figure 74 (SEQ ID NO: 130). , More preferably at least about 90% positive, most preferably at least about 95% positive, DNA encoding a polypeptide, or (b) an isolated nucleic acid molecule comprising the complement of DNA of (a). Another embodiment is a PR that finds use as a hybridization probe.
It relates to a fragment of the O1244 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides in length, and most preferably about 20 to about 40 nucleotides in length. In another embodiment, the invention provides an isolated PRO1244 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1244 polypeptide, which in certain embodiments is residue 3 of Figure 74 (SEQ ID NO: 130).
It contains an amino acid sequence containing 0 to 335. In another aspect, the invention features amino acid residue 30 of Figure 74 (SEQ ID NO: 130).
To about 335 sequences, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. It relates to an isolated PRO1244 polypeptide comprising an amino acid sequence having identity. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 30 to 335 of Figure 74 (SEQ ID NO: 130). It relates to an isolated PRO1244 polypeptide comprising an amino acid sequence with a positive, most preferably at least about 95% positive score. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig7
PRO having the sequence of about 30 to about 335 amino acid residues of SEQ ID NO: 4 (SEQ ID NO: 130)
A DNA molecule encoding a 1244 polypeptide, or (b) a complement of a DNA molecule of (a), under hybridization conditions under test conditions, wherein the test DNA molecule is at least about relative to (a) or (b). 80% sequence identity, preferably at least about 8
(Ii) expressing a host cell containing a test DNA molecule into a polypeptide if it has 5% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Under conditions suitable for and (ii
i) providing a polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1244 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1244 antibody.

In a further embodiment, the present invention provides the identification of an agonist or antagonist of a native PRO1244 polypeptide by contacting the native PRO1244 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. Regarding the method. In a still further embodiment, the invention relates to a composition comprising a PRO1244 polypeptide, or an agonist or antagonist specified above, together with a pharmaceutically acceptable carrier. 38. PRO1246 In this application, a cDNA clone (DNA64885-1529) has been identified, designated "PRO1246", which encodes a novel polypeptide and has homology to a nucleic acid encoding bone-associated sulfatase. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1246 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1246 polypeptide having a sequence from about 1 or about 16 to about 536 amino acid residues of Figure 76 (SEQ ID NO: 132), or (b) At least about 80% sequence identity to the complement of the DNA molecule of (a), preferably at least about 85% sequence identity,
More preferably it comprises DNA having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In another aspect, the invention features about 1 nucleotide of Figure 75 (SEQ ID NO: 131).
19 or an isolated nucleic acid molecule encoding a PRO1246 polypeptide comprising DNA that hybridizes to the complement of about 164 to about 1726 nucleic acids. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203457 (DNA64885-1529), or (b) the complement of a nucleic acid molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity,
More preferably it relates to an isolated nucleic acid molecule comprising DNA having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203457 (DNA64885-1529). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence with amino acid residue 1 of Figure 76 (SEQ ID NO: 132) or the sequence from about 16 to about 536. Identity, more preferably at least about 9
It relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide having 0% sequence identity, most preferably at least about 95% sequence identity, or the complement of DNA of (a).

In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO1 having amino acid residue 1 of FIG. 76 (SEQ ID NO: 132) or a sequence from about 16 to about 536.
246 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, whereby the DNA molecule (a) or (b)
To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule having at least 100 nucleotides produced by isolating a test DNA molecule. In a particular aspect, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1246 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, or such a code. A complementary nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 16 in the sequence of Figure 76 (SEQ ID NO: 132). In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residue 1 or about 16 to about 536 of Figure 76 (SEQ ID NO: 132). , More preferably at least about 90% positive, most preferably at least about 95% positive, DNA encoding a polypeptide, or (b) an isolated nucleic acid molecule comprising the complement of DNA of (a). Another embodiment is a PR that finds use as a hybridization probe.
It concerns a fragment of the O1246 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides long, most preferably about 20 to about 40 nucleotides long and can be derived from the nucleotide sequence shown in Figure 75 (SEQ ID NO: 131). In another embodiment, the invention provides an isolated PRO1246 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1246 polypeptide, which in certain embodiments is residue 1 of Figure 76 (SEQ ID NO: 132).
Or an amino acid sequence comprising about 16 to about 536. In another aspect, the invention features at least about 80% sequence identity, preferably at least about 85% sequence, to amino acid residue 1 of Figure 76 (SEQ ID NO: 132) or the sequence from about 16 to about 536. It relates to an isolated PRO1246 polypeptide comprising an amino acid sequence having identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity.

In a further aspect, the invention features residues 1 or 1 of FIG. 76 (SEQ ID NO: 132).
At least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to the 6 to about 536 amino acid sequence.
It relates to an isolated PRO1246 polypeptide comprising an amino acid sequence with a score of% positive, most preferably at least about 95% positive. In yet another aspect, the invention includes amino acid residue 1 of Figure 76 (SEQ ID NO: 132) or the sequence from about 16 to about 536, or a fragment thereof sufficient to provide a binding site for an anti-PRO1246 antibody. To an isolated PRO1246 polypeptide consisting of Preferably, the PRO1246 fragment retains the qualitative biological activity of the native PRO1246 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig7
6 (SEQ ID NO: 132) or a DNA molecule encoding a PRO1246 polypeptide having amino acid residue 1 or a sequence from about 16 to about 536, or (b) (a) DN
Hybridization with the complement of the A molecule under stringent conditions results in the test DNA molecule (a
) Or (b), at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. If there is identity, then (ii) test D
A polypeptide produced by culturing a host cell containing an NA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture medium is provided. In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1246 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1246 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1246 polypeptide by contacting the native PRO1246 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising a PRO1246 polypeptide, or an agonist or antagonist specified above, together with a pharmaceutically acceptable carrier. 39. PRO1356 In the present application, a cDNA clone (DNA64886-1601) has been identified, which has been named "PRO1356" and which encodes a novel polypeptide and has homology with a nucleic acid encoding a Clostridium perfringens enterotoxin receptor. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1356 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1356 polypeptide having a sequence from about 1 or about 25 to about 230 amino acid residues of Figure 78 (SEQ ID NO: 134), or (b) At least about 80% sequence identity to the complement of the DNA molecule of (a), preferably at least about 85% sequence identity,
More preferably it comprises DNA having at least about 90% sequence identity, and most preferably at least about 95% sequence identity.

In another aspect, the invention features about 1 nucleotide of Fig77 (SEQ ID NO: 133).
22 or an isolated nucleic acid molecule encoding a PRO1356 polypeptide comprising DNA that hybridizes to the complement of about 194 to about 811 nucleic acids. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA64886-1601) of ATCC Deposit No. 203241, or (b) the complement of a nucleic acid molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity,
More preferably it relates to an isolated nucleic acid molecule comprising DNA having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203241 (DNA64886-1601). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence with amino acid residue 1 of Fig78 (SEQ ID NO: 134) or the sequence from about 25 to about 230. Identity, more preferably at least about 9
An isolated nucleic acid molecule comprising a DNA encoding a polypeptide having 0% sequence identity, most preferably at least about 95% sequence identity, or (b) a complement of the DNA of (a). . In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO1 having amino acid residue 1 of Fig78 (SEQ ID NO: 134) or a sequence from about 25 to about 230.
Hybridizing with a DNA molecule encoding a 356 polypeptide, or (b) the complement of the DNA molecule of (a) under stringent conditions, whereby the DNA molecule (a) or (b)
To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule having at least 20 nucleotides produced by isolating a test DNA molecule. In a particular aspect, the invention provides an isolated nucleic acid molecule comprising a DNA encoding a PRO1356 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and a soluble or transmembrane domain thereof. Are deleted or inactivated variants, or are complementary to such encoding nucleic acid molecules. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 24 in the sequence of Figure 78 (SEQ ID NO: 134). The transmembrane domain is a PRO1356 amino acid sequence (Fig78, SEQ ID NO: 134).
From about amino acid position about 82 to about amino acid position about 102, about amino acid position about 117 to about amino acid position about 140, and from about amino acid position about 163 to about amino acid position 182.

In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 80% positive when compared to the amino acid sequence of residue 1 or about 25 to about 230 of Fig78 (SEQ ID NO: 134). An isolated nucleic acid comprising a DNA encoding a polypeptide with a score of 85% positive, more preferably at least about 90% positive, most preferably at least about 95% positive, or the complement of DNA of (b) (a). Regarding the molecule. Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1356 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides long, most preferably about 20 to about 40 nucleotides long and can be derived from the nucleotide sequence shown in Figure 77 (SEQ ID NO: 133). In another embodiment, the invention provides an isolated PRO1356 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a specific aspect, the invention provides an isolated native sequence PRO1356 polypeptide, which in certain embodiments is residue 1 of Figure 78 (SEQ ID NO: 134).
Or an amino acid sequence comprising about 25 to about 230. In another aspect, the invention features at least about 80% sequence identity, preferably at least about 85% sequence, to amino acid residue 1 of Fig78 (SEQ ID NO: 134) or the sequence from about 25 to about 230. It relates to an isolated PRO1356 polypeptide comprising an amino acid sequence having identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably when compared to the amino acid sequence of residue 1 or about 25 to about 230 of Figure 78 (SEQ ID NO: 134), more preferably At least about 9
It relates to an isolated PRO1356 polypeptide comprising an amino acid sequence with a score of 0% positive, most preferably at least about 95% positive. In yet another aspect, the invention includes amino acid residue 1 of Figure 78 (SEQ ID NO: 134) or the sequence from about 25 to about 230, or a fragment thereof sufficient to provide a binding site for an anti-PRO1356 antibody. To an isolated PRO1356 polypeptide consisting of Preferably, the PRO1356 fragment retains the qualitative biological activity of the native PRO1356 polypeptide.

In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig7.
8 (SEQ ID NO: 134), a DNA molecule encoding a PRO1356 polypeptide having a sequence of about 1 or about 25 to about 230 amino acid residues, or (b) (a) D
Hybridization with the complement of the NA molecule under stringent conditions allows the test DNA molecule to
at least about 80% sequence identity to a) or (b), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity,
Most preferably, (ii) culturing a host cell containing a test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) culturing the polypeptide from the cell culture medium, provided that it has at least about 95% sequence identity. A polypeptide produced by recovering is provided. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1356 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1356 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1356 polypeptide by contacting the native PRO1356 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In yet a further embodiment, the invention relates to a composition comprising a PRO1356 polypeptide, or an agonist or antagonist specified above, together with a pharmaceutically acceptable carrier. 40. PRO1275 A cDNA clone (DNA64888-1542) encoding a novel secreted polypeptide designated "PRO1275" in this application was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1275 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1275 polypeptide having the sequence of amino acid residues from about 26 to about 119 of Figure 80 (SEQ ID NO: 136), or (b) (a). At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity to the complement of the DNA molecule of It comprises DNA having sequence identity. In another aspect, the invention features an isolated nucleic acid molecule that encodes a PRO1275 polypeptide that comprises DNA that hybridizes to the complement of the nucleic acid from residues 112 to 393 of Figure 79 (SEQ ID NO: 135). Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA64888-1542) of ATCC Deposit No. 203249, or (b) the complement of the DNA molecule of (a). Against
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203249 (DNA64888-1542).

In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about amino acid residue 26 to about 119 of Fig80 (SEQ ID NO: 136). A DNA comprising a polypeptide having sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (a) the complement of DNA. Relates to separated nucleic acid molecules. In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO1275 having a sequence from about 26 to about 119 amino acid residues of Fig80 (SEQ ID NO: 136).
Hybridizing with a DNA molecule encoding a polypeptide, or (b) the complement of a DNA molecule of (a) under stringent conditions, wherein the DNA molecule is at least about 80% relative to (a) or (b) A test DNA molecule is isolated if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. And an isolated nucleic acid molecule having at least about 50 nucleotides, preferably at least about 100 nucleotides. In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive, more preferably when compared to the amino acid sequence of residues 26 to about 119 of Fig80 (SEQ ID NO: 136). Relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or the complement of DNA of (b) (a). Another embodiment is a PR that finds use as a hybridization probe.
It concerns a fragment of the O1275 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides in length, and most preferably about 20 to about 40 nucleotides in length. In another embodiment, the invention provides an isolated PRO1275 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1275 polypeptide, which in certain embodiments is residue 2 of Figure 80 (SEQ ID NO: 136).
It contains an amino acid sequence containing 6 to 119. In another aspect, the invention features amino acid residue 26 of Figure 80 (SEQ ID NO: 136).
To about 119 sequences, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated PRO1275 polypeptide comprising an amino acid sequence with identity.

In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 80% positive when compared to the amino acid sequence of residues 26 to 119 of Fig80 (SEQ ID NO: 136). It relates to an isolated PRO1275 polypeptide which comprises an amino acid sequence with a score of about 90% positive, most preferably at least about 95% positive. In yet another aspect, the invention comprises a sequence of amino acid residues 26 to about 119 of Figure 80 (SEQ ID NO: 136), or a fragment thereof sufficient to provide a binding site for an anti-PRO1275 antibody, It relates to an isolated PRO1275 polypeptide. Preferably, the PRO1275 fragment retains the qualitative biological activity of the native PRO1275 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig8
PRO having a sequence of about 25 to about 119 amino acid residues of 0 (SEQ ID NO: 136)
A DNA molecule encoding a 1275 polypeptide, or (b) a complement of the DNA molecule of (a), under hybridizing conditions, wherein the test DNA molecule is at least about 80% sequence identity, preferably at least about 8
(Ii) expressing a host cell containing a test DNA molecule into a polypeptide if it has 5% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Under conditions suitable for and (ii
i) providing a polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1275 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1275 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1275 polypeptide by contacting the native PRO1275 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising a PRO1275 polypeptide, or an agonist or antagonist specified above, together with a pharmaceutically acceptable carrier. 41. PRO1274 A cDNA clone (DNA64889-1541) encoding a novel secreted polypeptide designated "PRO1274" in this application was identified.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1274 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1274 polypeptide having amino acid residue 1 of Figure 82 (SEQ ID NO: 138) or a sequence of about 25 to about 110, or (b) ( At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 9 to the complement of the DNA molecule of a).
It comprises DNA with 5% sequence identity. In another aspect, the invention features an isolated nucleic acid molecule that encodes a PRO1274 polypeptide that comprises DNA that hybridizes to the complement of the nucleic acid at residues 96 to 353 of Figure 81 (SEQ ID NO: 137). Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA64889-1541) of ATCC Deposit No. 203250, or (b) the complement of a nucleic acid molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity,
More preferably it relates to an isolated nucleic acid molecule comprising DNA having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203250 (DNA64889-1541). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 25 to about 110 amino acid residues of Figure 82 (SEQ ID NO: 138). , More preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity, or a DNA encoding a polypeptide, or (a) a complement of DNA isolated. Relates to nucleic acid molecules. In a further aspect, the invention provides a test DNA molecule, (a) PRO1274 having a sequence from about 25 to about 110 amino acid residues of Figure 82 (SEQ ID NO: 138).
Hybridizing with a DNA molecule encoding a polypeptide, or (b) the complement of a DNA molecule of (a) under stringent conditions, wherein the DNA molecule is at least about 80% relative to (a) or (b) A test DNA molecule is isolated if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. And an isolated nucleic acid molecule having at least about 50 nucleotides, preferably at least about 100 nucleotides. In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residues 25 to about 110 of Figure 82 (SEQ ID NO: 138), more preferably at least about 85% positive. Relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or the complement of DNA of (b) (a).

Other embodiments find PR find use as hybridization probes.
A fragment of the O1274 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides in length, and most preferably about 20 to about 40 nucleotides in length. In another embodiment, the invention provides an isolated PRO1274 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1274 polypeptide, which in certain embodiments is residue 2 of Figure 82 (SEQ ID NO: 138).
It contains an amino acid sequence containing 5 to 110. In another aspect, the invention features amino acid residue 25 of Figure 82 (SEQ ID NO: 138).
To about 110 sequences, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated PRO1274 polypeptide comprising an amino acid sequence having identity. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 25 to 110 of Figure 82 (SEQ ID NO: 138). It relates to an isolated PRO1274 polypeptide which comprises an amino acid sequence with a positive, most preferably at least about 95% positive score. In yet another aspect, the invention comprises a sequence of amino acid residues 25 to about 110 of Figure 82 (SEQ ID NO: 138), or a fragment thereof sufficient to provide a binding site for an anti-PRO1274 antibody, It relates to an isolated PRO1274 polypeptide. Preferably, the PRO1274 fragment retains the qualitative biological activity of the native PRO1274 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig8
PRO having the sequence of about 25 to about 110 amino acid residues of SEQ ID NO: 2 (SEQ ID NO: 138)
A DNA molecule encoding a 1274 polypeptide, or (b) a complement of the DNA molecule of (a), is hybridized under stringent conditions such that the test DNA molecule is at least about 80% sequence identity, preferably at least about 8
(Ii) expressing a host cell containing a test DNA molecule into a polypeptide if it has 5% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Under conditions suitable for and (ii
i) providing a polypeptide produced by recovering the polypeptide from the cell culture medium.

In yet another embodiment, the invention relates to agonists and antagonists of native PRO1274 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1274 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1274 polypeptide by contacting the native PRO1274 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising a PRO1274 polypeptide, or an agonist or antagonist specified above, together with a pharmaceutically acceptable carrier. 42. PRO1412 In the present application, a cDNA clone (DNA64897-1628) has been identified, which is named "PRO1412" and encodes a novel transmembrane polypeptide. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1412 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1412 polypeptide having amino acid residue 1 of Figure 84 (SEQ ID NO: 140) or a sequence of about 29 to about 311; or (b) ( At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 9 to the complement of the DNA molecule of a).
It comprises DNA with 5% sequence identity. In another aspect, the invention features an isolated nucleic acid molecule that encodes a PRO1412 polypeptide that comprises DNA that hybridizes to the complement of the nucleic acid from residues 226 to 1074 of Figure 83 (SEQ ID NO: 139). Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203216 (DNA64897-1628), or (b) the complement of the DNA molecule of (a). Against
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203216 (DNA64897-1628). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about amino acid residue 29 to about 311 of Figure 84 (SEQ ID NO: 140). , More preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity, or a DNA encoding a polypeptide of (a) the complement of the isolated DNA. Relates to nucleic acid molecules.

In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO1412 having a sequence of about amino acid residues 29 to about 311 of Fig84 (SEQ ID NO: 140).
Hybridizing with a DNA molecule encoding a polypeptide, or (b) the complement of a DNA molecule of (a) under stringent conditions, wherein the DNA molecule is at least about 80% relative to (a) or (b) A test DNA molecule is isolated if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. And an isolated nucleic acid molecule having at least about 50 nucleotides, preferably at least about 100 nucleotides. In a particular aspect, the invention provides an isolated nucleic acid molecule comprising a DNA encoding a PRO1412 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and a soluble or transmembrane domain thereof. Are deleted or inactivated variants, or are complementary to such encoding nucleic acid molecules. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 28 in the sequence of Figure 84 (SEQ ID NO: 140). The transmembrane domain has a PRO1412 amino acid sequence (Fig84, SEQ ID NO: 140).
Has been tentatively identified as extending from about amino acid position 190 to about amino acid position 216. In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive, and more preferably when compared to the amino acid sequence of residues 29 to about 311 of Figure 84 (SEQ ID NO: 140). Relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or the complement of DNA of (b) (a). Another embodiment is a PR that finds use as a hybridization probe.
O1412 polypeptide coding sequence fragment. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides in length, and most preferably about 20 to about 40 nucleotides in length. In another embodiment, the invention provides an isolated PRO1412 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1412 polypeptide, which in certain embodiments is residue 2 of Figure 84 (SEQ ID NO: 140).
It contains an amino acid sequence containing 9 to 311.

In another aspect, the invention features amino acid residue 29 of Figure 84 (SEQ ID NO: 140).
To about 311 sequences, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated PRO1412 polypeptide comprising an amino acid sequence having identity. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 29 to 311 of Figure 84 (SEQ ID NO: 140). It relates to an isolated PRO1412 polypeptide which comprises an amino acid sequence that scores positive, most preferably at least about 95% positive. In yet another aspect, the invention comprises a sequence from amino acid residue 29 to about 311 of Figure 84 (SEQ ID NO: 140), or a fragment thereof sufficient to provide a binding site for an anti-PRO1412 antibody, It relates to an isolated PRO1412 polypeptide. Preferably, the PRO1412 fragment retains the qualitative biological activity of the native PRO1412 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig8
PRO having the sequence of about 25 to about 311 amino acid residues of SEQ ID NO: 4 (SEQ ID NO: 140)
1412 polypeptide-encoding DNA molecule, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule is at least about 80% sequence identity, preferably at least about 8
(Ii) expressing a host cell containing a test DNA molecule into a polypeptide if it has 5% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Under conditions suitable for and (ii
i) providing a polypeptide produced by recovering the polypeptide from the cell culture medium. 43. PRO1557 A cDNA clone (DNA6490), which is named "PRO1557" in the present application, and which encodes a novel polypeptide having homology with chordin.
2-1667) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1557 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1557 polypeptide having amino acid residue 1 of Figure 86 (SEQ ID NO: 142) or a sequence from about 26 to about 451; or (b) ( At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 9 to the complement of the DNA molecule of a).
It comprises DNA with 5% sequence identity.

In another aspect, the invention features an isolated nucleic acid encoding a PRO1557 polypeptide that comprises a DNA that hybridizes to the complement of the nucleic acid at residues 362 to about 1639 of Figure 85 (SEQ ID NO: 141). Regarding the molecule. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203317 (DNA64902-1667), or (b) the complement of the DNA molecule of (a). Against
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203317 (DNA64902-1667). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of amino acid residues about 26 to about 451 of Figure 86 (SEQ ID NO: 142). , More preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity, or a DNA encoding a polypeptide, or (a) a complement of DNA isolated. Relates to nucleic acid molecules. In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO1557 having a sequence from about amino acid residue 26 to about 451 of Fig86 (SEQ ID NO: 142).
Hybridizing with a DNA molecule encoding a polypeptide, or (b) the complement of a DNA molecule of (a) under stringent conditions, wherein the DNA molecule is at least about 80% relative to (a) or (b) A test DNA molecule is isolated if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. And an isolated nucleic acid molecule having at least about 50 nucleotides, preferably at least about 100 nucleotides. In a particular embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1557 polypeptide with or without an N-terminal signal sequence, or complementary to such an encoding nucleic acid molecule. Target. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 25 in the sequence of Figure 86 (SEQ ID NO: 142). In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residues 26 to about 451 of Fig86 (SEQ ID NO: 142), more preferably at least about 85% positive. Relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or the complement of DNA of (b) (a).

In another embodiment, PR finds use as a hybridization probe.
It concerns a fragment of the O1557 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides in length, and most preferably about 20 to about 40 nucleotides in length. In another embodiment, the invention provides an isolated PRO1557 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1557 polypeptide, which in certain embodiments is residue 2 of Figure 86 (SEQ ID NO: 142).
It contains an amino acid sequence containing 6 to 451. In another aspect, the invention features amino acid residue 26 of Figure 86 (SEQ ID NO: 142).
To about 451 sequences, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. It relates to an isolated PRO1557 polypeptide comprising an amino acid sequence having identity. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 26 to 451 of Figure 86 (SEQ ID NO: 142). Relates to an isolated PRO1557 polypeptide comprising an amino acid sequence with a positive, most preferably at least about 95% positive score. In yet another aspect, the invention comprises a sequence from amino acid residue 26 to about 451 of Figure 86 (SEQ ID NO: 142), or a fragment thereof sufficient to provide a binding site for an anti-PRO1557 antibody, It relates to an isolated PRO1557 polypeptide. Preferably, the PRO1557 fragment retains the qualitative biological activity of the native PRO1557 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig8
PRO having the sequence from about 26 to about 451 amino acid residues of SEQ ID NO: 6 (SEQ ID NO: 142)
A DNA molecule encoding a 1557 polypeptide, or (b) a complement of the DNA molecule of (a), under hybridizing conditions, wherein the test DNA molecule is at least about 80% sequence identity, preferably at least about 8
(Ii) expressing a host cell containing a test DNA molecule into a polypeptide if it has 5% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Under conditions suitable for and (ii
i) providing a polypeptide produced by recovering the polypeptide from the cell culture medium.

In yet another embodiment, the invention relates to agonists and antagonists of native PRO1557 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1557 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1557 polypeptide by contacting the native PRO1557 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising a PRO1557 polypeptide, or an agonist or antagonist specified above, together with a pharmaceutically acceptable carrier. 44. PRO1286 A cDNA clone (DNA64903-1553) encoding a novel secreted polypeptide designated "PRO1286" in this application was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1286 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1286 polypeptide having amino acid residue 1 of Figure 88 (SEQ ID NO: 144) or a sequence from about 19 to about 93, or (b) ( At least about 80% sequence identity to the complement of the DNA molecule of a), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%.
It comprises DNA with% sequence identity. In another aspect, the invention features an isolated nucleic acid molecule that encodes a PRO1286 polypeptide that comprises DNA that hybridizes to the complement of the nucleic acid from residues 147 to 371 of Figure 87 (SEQ ID NO: 143). Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA64903-1553) of ATCC Deposit No. 203223, or (b) the complement of the DNA molecule of (a). Against
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203223 (DNA64903-1553). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of about amino acid residues 19 to about 93 of Fig88 (SEQ ID NO: 144). , More preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity, or a DNA encoding a polypeptide, or (a) a complement of DNA isolated. Relates to nucleic acid molecules.

In a further aspect, the invention provides a test DNA molecule, which comprises (a) a DNA molecule encoding a PRO1286 polypeptide having a sequence from about 19 to about 93 amino acid residues of Figure 88 (SEQ ID NO: 144), or ( b) the complement of the DNA molecule of (a),
Hybridized under stringent conditions, the DNA molecule has at least about 80% sequence identity to (a) or (b), preferably at least about 85% sequence identity, more preferably at least about 90%. Of at least about 50 nucleotides, preferably at least about 100 nucleotides, prepared by isolating a test DNA molecule having at least about 95% sequence identity. Relates to nucleic acid molecules. In a particular aspect, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1286 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, or such a code. A complementary nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 18 in the sequence of Figure 88 (SEQ ID NO: 144). In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive, more preferably when compared to the amino acid sequence of residues 19 to about 93 of Fig88 (SEQ ID NO: 144). Relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or the complement of DNA of (b) (a). Another embodiment is a PR that finds use as a hybridization probe.
It concerns a fragment of the O1286 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides in length, and most preferably about 20 to about 40 nucleotides in length. In another embodiment, the invention provides an isolated PRO1286 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular embodiment, the invention provides an isolated native sequence PRO1286 polypeptide, which in certain embodiments is residue 1 of Figure 88 (SEQ ID NO: 144).
It contains an amino acid sequence containing 9 to 93. In another aspect, the invention features amino acid residue 19 of Figure 88 (SEQ ID NO: 144).
To about 93 sequences to at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated PRO1286 polypeptide comprising amino acid sequences having identity.

In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 80% positive when compared to the amino acid sequence of residues 19 to 93 of Figure 88 (SEQ ID NO: 144). It relates to an isolated PRO1286 polypeptide which comprises an amino acid sequence with a score of about 90% positive, most preferably at least about 95% positive. In yet another aspect, the invention comprises a sequence of amino acid residues 19 to about 93 of Figure 88 (SEQ ID NO: 144), or a fragment thereof sufficient to provide a binding site for an anti-PRO1286 antibody, It relates to an isolated PRO1286 polypeptide. Preferably, the PRO1286 fragment retains the qualitative biological activity of the native PRO1286 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig8
PRO1 having a sequence of about 19 to about 93 amino acid residues of 8 (SEQ ID NO: 144)
286 polypeptide, or (b) hybridized with the complement of the DNA molecule of (a) under stringent conditions, and the test DNA molecule is (a) or (
at least about 80% sequence identity to b), preferably at least about 85
(Ii) a host cell containing the test DNA molecule for expression of the polypeptide if it has a sequence identity of%, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Culture under suitable conditions, and (iii
) Providing a polypeptide produced by recovering the polypeptide from a cell culture medium. 45. PRO1294 Named “PRO1294” in the present application, which encodes a novel polypeptide and has homology with a nucleic acid encoding olfactomedin, c
A DNA clone (DNA64905-1558) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1294 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1294 polypeptide having a sequence from about 1 or about 22 to about 406 amino acid residues of Fig90 (SEQ ID NO: 146), or (b) At least about 80% sequence identity to the complement of the DNA molecule of (a), preferably at least about 85% sequence identity,
More preferably it comprises DNA having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In another aspect, the invention features about 1 nucleotide of FIG. 89 of SEQ ID NO: 145.
It relates to an isolated nucleic acid molecule encoding a PRO1294 polypeptide that comprises DNA that hybridizes to the complement of 10 or about 173 to about 1327 nucleic acids. Preferably, hybridization occurs under stringent hybridization and wash conditions.

In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203233 (DNA64905-1588), or (b) a nucleic acid molecule of (a). At least about 80% sequence identity to complement, preferably at least about 85% sequence identity,
More preferably it relates to an isolated nucleic acid molecule comprising DNA having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203233 (DNA64905-1558). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence with amino acid residue 1 of Fig90 (SEQ ID NO: 146) or the sequence from about 22 to about 406. Identity, more preferably at least about 9
An isolated nucleic acid molecule comprising a DNA encoding a polypeptide having 0% sequence identity, most preferably at least about 95% sequence identity, or (b) a complement of the DNA of (a). . In a further aspect, the invention provides a test DNA molecule comprising (a) PRO1 having amino acid residue 1 of Fig90 (SEQ ID NO: 146) or a sequence of about 22 to about 406.
A DNA molecule encoding a 294 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, whereby the DNA molecule (a) or (b)
To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule having at least 10 nucleotides produced by isolating a test DNA molecule. In a particular aspect, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1294 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, or such a code. A complementary nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 21 in the sequence of Figure 90 (SEQ ID NO: 146). In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residue 1 or about 22 to about 406 of Fig90 (SEQ ID NO: 146). , More preferably at least about 90% positive, most preferably at least about 95% positive, DNA encoding a polypeptide, or (b) an isolated nucleic acid molecule comprising the complement of DNA of (a). Another embodiment is a PR that finds use as a hybridization probe.
It relates to a fragment of the O1294 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides long, most preferably about 20 to about 40 nucleotides long and can be derived from the nucleotide sequence shown in Figure 89 (SEQ ID NO: 145).

In another embodiment, the invention provides an isolated PRO1294 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1294 polypeptide, which in certain embodiments is residue 1 of Figure 90 (SEQ ID NO: 146).
Or an amino acid sequence comprising about 22 to about 406. In another aspect, the invention features at least about 80% sequence identity, preferably at least about 85% sequence, to amino acid residue 1 of Fig90 (SEQ ID NO: 46) or the sequence from about 22 to about 406. It relates to an isolated PRO1294 polypeptide comprising an amino acid sequence having identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, and more preferably when compared to the amino acid sequence of residue 1 or about 22 to about 406 of Fig90 (SEQ ID NO: 146). At least about 9
It relates to an isolated PRO1294 polypeptide comprising an amino acid sequence with a score of 0% positive, most preferably at least about 95% positive. In yet another aspect, the invention includes amino acid residue 1 of Figure 90 (SEQ ID NO: 146) or the sequence from about 22 to about 406, or a fragment thereof sufficient to provide a binding site for an anti-PRO1294 antibody. To an isolated PRO1294 polypeptide consisting of Preferably, the PRO1294 fragment retains the qualitative biological activity of the native PRO1294 polypeptide. In yet a further aspect, the invention provides (i) a test DNA molecule, (a) Fig9
0 (SEQ ID NO: 146), a DNA molecule encoding a PRO1294 polypeptide having the sequence of about 1 or about 22 to about 406 of amino acid residues, or (b) (a) D
Hybridization with the complement of the NA molecule under stringent conditions allows the test DNA molecule to
at least about 80% sequence identity to a) or (b), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity,
Most preferably, (ii) culturing a host cell containing a test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) culturing the polypeptide from the cell culture medium, provided that it has at least about 95% sequence identity. A polypeptide produced by recovering is provided. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1294 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1294 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1294 polypeptide by contacting the native PRO1294 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.

In a yet further embodiment, the invention relates to a composition comprising a PRO1294 polypeptide, or an agonist or antagonist specified above, together with a pharmaceutically acceptable carrier. 46. PRO1347 A cDNA clone (DNA64950) named "PRO1347" in the present application, which encodes a novel polypeptide having sequence identity with butyrophilin.
-1590) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1347 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1347 polypeptide having amino acid residue 1 of Fig92 (SEQ ID NO: 148) or a sequence of about 18 to about 500, or (b) ( At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 9 to the complement of the DNA molecule of a).
It comprises DNA with 5% sequence identity. In another aspect, the invention pertains to an isolated nucleic acid molecule encoding a PRO1347 polypeptide that comprises DNA that hybridizes to the complement of a nucleic acid from about residue 234 to about 1682 of Figure 91 (SEQ ID NO: 147). Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203224 (DNA64950-1590), or (b) the complement of the DNA molecule of (a). Against
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203224 (DNA64950-1590). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 18 to about 500 amino acid residues of Figure 92 (SEQ ID NO: 148). , More preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity, or a DNA encoding a polypeptide of (a) the complement of the isolated DNA. Relates to nucleic acid molecules.

In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO1347 having a sequence from about 18 to about 500 amino acid residues of Figure 92 (SEQ ID NO: 148).
Hybridizing with a DNA molecule encoding a polypeptide, or (b) the complement of a DNA molecule of (a) under stringent conditions, wherein the DNA molecule is at least about 80% relative to (a) or (b) A test DNA molecule is isolated if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. And an isolated nucleic acid molecule having at least about 50 nucleotides, preferably at least about 100 nucleotides. In a particular aspect, the invention provides an isolated nucleic acid molecule comprising a DNA encoding a PRO1347 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and a soluble or transmembrane domain thereof. Are deletions (or truncated at their ends) or inactivated variants, or are complementary to such encoding nucleic acid molecules. The signal peptide is Fig92 (
It has been tentatively identified as extending from amino acid position 1 to about amino acid position 17 of SEQ ID NO: 148). The transmembrane domain has a PRO1347 amino acid sequence (Fig92
, SEQ ID NO: 148) and extends from about amino acid position 239 to about amino acid position 255, which is tentatively identified. In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residues 18 to about 500 of Figure 92 (SEQ ID NO: 148), more preferably at least about 85% positive. Relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or the complement of DNA of (b) (a). Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1347 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long. In another embodiment, the invention provides an isolated PRO1347 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1347 polypeptide, which in certain embodiments is residue 1 of Figure 92 (SEQ ID NO: 148).
It contains an amino acid sequence containing from 8 to about 500. In another aspect, the invention features amino acid residue 18 of Figure 92 (SEQ ID NO: 148).
To about 500 sequences, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated PRO1347 polypeptide which comprises an amino acid sequence having identity.

In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 80% positive when compared to the amino acid sequence of residues 18 to 500 of Figure 92 (SEQ ID NO: 148). It relates to an isolated PRO1347 polypeptide which comprises an amino acid sequence with a score of about 90% positive, most preferably at least about 95% positive. In a still further aspect, the invention comprises a sequence of amino acid residues 18 to about 500 of Figure 92 (SEQ ID NO: 148), or a fragment thereof sufficient to provide a binding site for an anti-PRO1347 antibody. Isolated PRO1347 polypeptide. Preferably, the PRO1347 fragment retains the qualitative biological activity of the native PRO1347 polypeptide. In yet a further aspect, the invention provides (i) a test DNA molecule, (a) Fig9
PRO having the sequence of about 18 to about 500 amino acid residues of SEQ ID NO: 2 (SEQ ID NO: 148)
A DNA molecule encoding a 1347 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule is at least about 80% sequence identity, preferably at least about 8
(Ii) expressing a host cell containing a test DNA molecule into a polypeptide if it has 5% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Under conditions suitable for and (ii
i) providing a polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1347 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1347 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1347 polypeptide by contacting the native PRO1347 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising a PRO1347 polypeptide, or an agonist or antagonist identified above, together with a pharmaceutically acceptable carrier. 47. PRO1305 A cDNA clone (DNA64952-1568) encoding a novel secreted polypeptide designated "PRO1305" in this application was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1305 polypeptide.

In one aspect, the isolated nucleic acid comprises: (a) a DNA molecule encoding a PRO1305 polypeptide having a sequence from about 1 or about 26 to about 258 amino acid residues of Figure 94 (SEQ ID NO: 153), or (B) at least about 80% sequence identity to the complement of the DNA molecule of (a), preferably at least about 85% sequence identity,
More preferably it comprises DNA having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In another aspect, the invention features about 1 nucleotide of FIG. 93 (SEQ ID NO: 152).
26 or an isolated nucleic acid molecule encoding a PRO1305 polypeptide that comprises DNA that hybridizes to the complement of about 201 to about 899 nucleic acids. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA64952-1568) of ATCC Deposit No. 203222, or (b) the complement of a nucleic acid molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity,
More preferably it relates to an isolated nucleic acid molecule comprising DNA having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203222 (DNA64952-1568). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence with amino acid residue 1 of Fig94 (SEQ ID NO: 153) or the sequence from about 26 to about 258. Identity, more preferably at least about 9
It relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide having 0% sequence identity, most preferably at least about 95% sequence identity, or the complement of DNA of (a). In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO1 having amino acid residue 1 of FIG.
305 polypeptide, or (b) hybridized with the complement of the DNA molecule of (a) under stringent conditions, whereby the DNA molecule (a) or (b)
To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule having at least about 10 nucleotides produced by isolating a test DNA molecule. In a particular aspect, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1305 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, or such a code. A complementary nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 25 in the sequence of Figure 94 (SEQ ID NO: 153).

In another aspect, the invention features (a) at least about 80% positive, preferably at least about 80% positive when compared to the amino acid sequence of residue 1 or about 26 to about 258 of Figure 94 (SEQ ID NO: 153). An isolated nucleic acid comprising a DNA encoding a polypeptide with a score of 85% positive, more preferably at least about 90% positive, most preferably at least about 95% positive, or the complement of (b) (a) DNA. Regarding the molecule. Another embodiment is a PR that finds use as a hybridization probe.
O1305 polypeptide encoding sequence fragment. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides long, most preferably about 20 to about 40 nucleotides long and can be derived from the nucleotide sequence shown in Figure 93 (SEQ ID NO: 152). In another embodiment, the invention provides an isolated PRO1305 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1305 polypeptide, which in certain embodiments is residue 1 of Figure 94 (SEQ ID NO: 153).
Or an amino acid sequence comprising about 26 to about 258. In another aspect, the invention features at least about 80% sequence identity, preferably at least about 85% sequence identity to amino acid residue 1 of Figure 94 (SEQ ID NO: 153) or the sequence from about 26 to about 258. It relates to an isolated PRO1305 polypeptide comprising an amino acid sequence having identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, and more preferably when compared to the amino acid sequence of residue 1 or about 26 to about 258 of Figure 94 (SEQ ID NO: 153). At least about 9
It relates to an isolated PRO1305 polypeptide comprising an amino acid sequence with a score of 0% positive, most preferably at least about 95% positive. In yet another aspect, the invention includes amino acid residue 1 of Figure 94 (SEQ ID NO: 153) or the sequence from about 26 to about 258, or a fragment thereof sufficient to provide a binding site for an anti-PRO1305 antibody. To an isolated PRO1305 polypeptide consisting of Preferably, the PRO1305 fragment retains the qualitative biological activity of the native PRO1305 polypeptide. In yet a further aspect, the invention provides (i) a test DNA molecule, (a) Fig9
DNA molecule encoding a PRO1305 polypeptide having the sequence of about 1 or about 26 to about 258 amino acid residues of SEQ ID NO: 4 (SEQ ID NO: 153), or D of (b) (a)
Hybridization with the complement of the NA molecule under stringent conditions allows the test DNA molecule to
at least about 80% sequence identity to a) or (b), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity,
Most preferably, (ii) culturing a host cell containing a test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) culturing the polypeptide from the cell culture medium, provided that it has at least about 95% sequence identity. A polypeptide produced by recovering is provided.

48. PRO1273 In the present application, a cDNA clone (DNA65402-1) named "PRO1273", which encodes a novel polypeptide having sequence identity with lipocalin.
540) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1273 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1273 polypeptide having amino acid residue 1 of Figure 96 (SEQ ID NO: 158) or a sequence of about 21 to about 163, or (b) ( At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 9 to the complement of the DNA molecule of a).
It comprises DNA with 5% sequence identity. In another aspect, the invention pertains to an isolated nucleic acid molecule encoding a PRO1273 polypeptide that comprises a DNA that hybridizes to the complement of a nucleic acid from about 86 to about 514 residues of Figure 95 (SEQ ID NO: 157). Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203252 (DNA65402-1540), or (b) the complement of the DNA molecule of (a). Against
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203252 (DNA65402-1540). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of amino acid residues about 21 to about 163 of Figure 96 (SEQ ID NO: 158). , More preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity, or a DNA encoding a polypeptide, or (a) a complement of DNA isolated. Relates to nucleic acid molecules.

In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO1273 having a sequence from about 21 to about 163 amino acid residues of Figure 96 (SEQ ID NO: 158).
Hybridizing with a DNA molecule encoding a polypeptide, or (b) the complement of a DNA molecule of (a) under stringent conditions, wherein the DNA molecule is at least about 80% relative to (a) or (b) A test DNA molecule is isolated if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. And an isolated nucleic acid molecule having at least about 50 nucleotides, preferably at least about 100 nucleotides. In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residues 21 to about 163 of Figure 96 (SEQ ID NO: 158), more preferably at least about 85% positive. Relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or the complement of DNA of (b) (a). Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1273 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides in length, and most preferably about 20 to about 40 nucleotides in length. In another embodiment, the invention provides an isolated PRO1273 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1273 polypeptide, which in certain embodiments is residue 2 of Figure 96 (SEQ ID NO: 158).
It contains an amino acid sequence containing 1 to 163. In another aspect, the invention features amino acid residue 21 of Figure 96 (SEQ ID NO: 158).
To about 163 sequences, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated PRO1273 polypeptide comprising an amino acid sequence having identity. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 21 to 163 of Figure 96 (SEQ ID NO: 158). It relates to an isolated PRO1273 polypeptide which comprises an amino acid sequence with a positive, most preferably at least about 95% positive, score. In yet another aspect, the invention comprises a sequence from amino acid residue 21 to about 163 of Figure 96 (SEQ ID NO: 158), or a fragment thereof sufficient to provide a binding site for an anti-PRO1273 antibody, It relates to an isolated PRO1273 polypeptide. Preferably, the PRO1273 fragment retains the qualitative biological activity of the native PRO1273 polypeptide.

In a still further aspect, the invention provides (a) a test DNA molecule, (a) Fig9.
PRO having a sequence of about 21 to about 163 amino acid residues of SEQ ID NO: 6 (SEQ ID NO: 158)
A DNA molecule encoding a 1273 polypeptide, or (b) a complement of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule is at least about 80% sequence identity, preferably at least about 8
(Ii) expressing a host cell containing a test DNA molecule into a polypeptide if it has 5% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Under conditions suitable for and (ii
i) providing a polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1273 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1273 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1273 polypeptide by contacting the native PRO1273 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising a PRO1273 polypeptide, or an agonist or antagonist specified above, together with a pharmaceutically acceptable carrier. 49. PRO1302 In the present application, a cDNA clone (DNA65403-15), which is named "PRO1302" and which encodes a novel polypeptide having sequence identity with CD33.
65) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1302 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule that encodes a PRO1302 polypeptide having amino acid residue 1 of Figure 98 (SEQ ID NO: 160) or a sequence of about 16 to about 463, or (b) ( At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 9 to the complement of the DNA molecule of a).
It comprises DNA with 5% sequence identity. In another aspect, the invention features an isolated nucleic acid molecule that encodes a PRO1302 polypeptide that comprises a DNA that hybridizes to the complement of a nucleic acid from residues 88 to 1431 of Figure 97 (SEQ ID NO: 159). Preferably, hybridization occurs under stringent hybridization and wash conditions.

In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203230 (DNA65403-1565), or (b) (a). For complement of
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203230 (DNA65403-1565). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 16 to about 463 amino acid residues of Figure 98 (SEQ ID NO: 160). , More preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity, or a DNA encoding a polypeptide, or (a) a complement of DNA isolated. Relates to nucleic acid molecules. In a further aspect, the invention provides a test DNA molecule, (a) PRO1302 having a sequence from about 16 to about 463 amino acid residues of Figure 98 (SEQ ID NO: 160).
Hybridizing with a DNA molecule encoding a polypeptide, or (b) the complement of a DNA molecule of (a) under stringent conditions, wherein the DNA molecule is at least about 80% relative to (a) or (b) A test DNA molecule is isolated if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. And an isolated nucleic acid molecule having at least about 50 nucleotides, preferably at least about 100 nucleotides. In a particular aspect, the invention provides an isolated nucleic acid molecule comprising a DNA encoding a PRO1302 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and a soluble or transmembrane domain thereof. Are deletions (or truncated forms) or inactivated variants, or are complementary to such encoding nucleic acid molecules. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 15 in the sequence of Figure 98 (SEQ ID NO: 160). The transmembrane domain has a PRO1302 amino acid sequence (F
ig98, SEQ ID NO: 160) from about amino acid position 351 to about amino acid position 37.
It has been tentatively identified as extending to zero. In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive, more preferably when compared to the amino acid sequence of residues 16 to about 463 of Fig98 (SEQ ID NO: 160). Relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or the complement of DNA of (b) (a).

In another embodiment, PR finds use as a hybridization probe.
It relates to a fragment of the O1302 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides in length, and most preferably about 20 to about 40 nucleotides in length. In another embodiment, the invention provides an isolated PRO1302 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a specific aspect, the invention provides an isolated native sequence PRO1302 polypeptide, which in certain embodiments is residue 1 of Figure 98 (SEQ ID NO: 160).
It contains an amino acid sequence containing 6 to 463. In another aspect, the invention features amino acid residue 16 of Figure 98 (SEQ ID NO: 160).
To about 463 sequences, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated PRO1302 polypeptide which comprises an amino acid sequence having identity. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 16-463 of Figure 98 (SEQ ID NO: 160). It relates to an isolated PRO1302 polypeptide comprising an amino acid sequence with a positive, most preferably at least about 95% positive score. In yet another aspect, the invention comprises a sequence from amino acid residue 16 to about 463 of Figure 98 (SEQ ID NO: 160), or a fragment thereof sufficient to provide a binding site for an anti-PRO1302 antibody, It relates to an isolated PRO1302 polypeptide. Preferably, the PRO1302 fragment retains the qualitative biological activity of the native PRO1302 polypeptide. In yet a further aspect, the invention provides (i) a test DNA molecule, (a) Fig9
PRO having the sequence of about 16 to about 463 amino acid residues of SEQ ID NO: 8 (SEQ ID NO: 160)
1302 polypeptide-encoding DNA molecule, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule is at least about 80% sequence identity, preferably at least about 8
(Ii) expressing a host cell containing a test DNA molecule into a polypeptide if it has 5% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Under conditions suitable for and (ii
i) providing a polypeptide produced by recovering the polypeptide from the cell culture medium.

In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1302 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1302 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1302 polypeptide by contacting the native PRO1302 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising a PRO1302 polypeptide, or an agonist or antagonist specified above, together with a pharmaceutically acceptable carrier. 50. PRO1283 Named “PRO1283” in the present application, and encodes a novel transmembrane polypeptide and has homology with a nucleic acid encoding an odorant binding protein.
The A clone (DNA65404-1551) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1283 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1283 polypeptide having amino acid residue 1 of Figure 100 (SEQ ID NO: 162) or a sequence of about 18 to about 170, or (b) ( at least about 80% sequence identity, preferably at least about 85% sequence identity to the complement of the DNA molecule of a),
More preferably it comprises DNA having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In another aspect, the invention features about 4 nucleotides of Fig99 (SEQ ID NO: 161).
P containing DNA that hybridizes to the complement of 5 or about 96 to about 554 nucleic acids
It relates to an isolated nucleic acid molecule encoding a RO1283 polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA65404-1551) of ATCC Deposit No. 203244, or (b) the complement of a nucleic acid molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity,
More preferably it relates to an isolated nucleic acid molecule comprising DNA having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203244 (DNA65404-1551). In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence with amino acid residue 1 of Fig100 (SEQ ID NO: 162) or the sequence from about 18 to about 170. An isolation comprising DNA encoding a polypeptide having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or the complement of DNA of (a). Nucleic acid molecule.

In a further aspect, the invention provides a test DNA molecule comprising: (a) a PRO having the amino acid residue 1 of Fig100 (SEQ ID NO: 162) or the sequence from about 18 to about 170.
A DNA molecule encoding the 1283 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, whereby the DNA molecule (a) or (b)
) To at least about 80% sequence identity, preferably at least about 85%
Having at least 10 nucleotides, prepared by isolating a test DNA molecule when having sequence identity of, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a particular aspect, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1283 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, or such a code. A complementary nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 17 in the sequence of Figure 100 (SEQ ID NO: 162). In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residue 1 or about 18 to about 170 of Fig100 (SEQ ID NO: 162). , More preferably at least about 90% positive, most preferably at least about 95% positive, DNA encoding a polypeptide, or (b) an isolated nucleic acid molecule comprising the complement of DNA of (a). Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1283 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides long, most preferably about 20 to about 40 nucleotides long and can be derived from the nucleotide sequence shown in Figure 99 (SEQ ID NO: 161). In another embodiment, the invention provides an isolated PRO1283 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1283 polypeptide, which in certain embodiments comprises residue 1 of Figure 100 (SEQ ID NO: 162) or an amino acid comprising from about 18 to about 170. Contains an array. In another aspect, the invention features amino acid residue 1 of Figure 100 (SEQ ID NO: 162).
Or at least about 80% sequence identity, preferably at least about 85% sequence identity, and more preferably at least about 90% to about 18 to about 170 sequences.
Of sequence identity, most preferably at least about 95% sequence identity, to an isolated PRO1283 polypeptide.

In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residue 1 or about 18 to about 170 of Figure 100 (SEQ ID NO: 162), preferably at least about 85% positive, More preferably, it relates to an isolated PRO1283 polypeptide comprising an amino acid sequence that scores at least about 90% positive, and most preferably at least about 95% positive. In yet another aspect, the invention includes amino acid residue 1 of Figure 100 (SEQ ID NO: 162) or the sequence from about 18 to about 170, or a fragment thereof sufficient to provide a binding site for an anti-PRO1283 antibody. To an isolated PRO1283 polypeptide consisting of Preferably, the PRO1283 fragment is the native PRO1283 fragment.
Retains the qualitative biological activity of the polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
00 (SEQ ID NO: 162), a DNA molecule encoding a PRO1283 polypeptide having a sequence of about 1 or about 18 to about 170 amino acid residues, or (b) a complement of the DNA molecule of (a) and stringent conditions. Hybridized below, the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably at least about 85% sequence identity, and more preferably at least about 90% sequence identity. If there is identity, most preferably at least about 95% sequence identity, (ii) the host cell containing the test DNA molecule is cultured under conditions suitable for expression of the polypeptide, and (iii) from the cell culture medium. Provided is a polypeptide produced by recovering the polypeptide. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1283 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1283 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1283 polypeptide by contacting the native PRO1283 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising a PRO1283 polypeptide, or an agonist or antagonist identified above, together with a pharmaceutically acceptable carrier. 51. PRO1279 In the present application, designated as “PRO1279”, a cDNA clone (D) encoding a novel polypeptide and having homology with a nucleic acid encoding neuropsin (D
NA65405-1547) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1279 polypeptide.

In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1279 polypeptide having a sequence of from about 1 or about 19 to about 250 amino acid residues of Figure 102 (SEQ ID NO: 170), or (B) For the complement of the DNA molecule of (a),
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. . In another aspect, the invention features an isolated nucleic acid molecule encoding a PRO1279 polypeptide comprising a DNA that hybridizes to the complement of a nucleic acid from about 106 or about 160 to about 855 nucleotides of Figure 101 (SEQ ID NO: 169). Regarding Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA65405-1547) of ATCC Deposit No. 203476, or (b) the complement of a nucleic acid molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity,
More preferably it relates to an isolated nucleic acid molecule comprising DNA having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203476 (DNA65405-1547). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence with amino acid residue 1 of Fig102 (SEQ ID NO: 170) or the sequence from about 19 to about 250. An isolation comprising DNA encoding a polypeptide having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or the complement of DNA of (a). Nucleic acid molecule. In a further aspect, the invention provides a test DNA molecule comprising (a) a PRO having the amino acid residue 1 of Figure 102 (SEQ ID NO: 170) or the sequence from about 19 to about 250.
A DNA molecule encoding a 1279 polypeptide, or (b) a complement of the DNA molecule of (a), is hybridized under stringent conditions, and the DNA molecule is (a) or (b).
) To at least about 80% sequence identity, preferably at least about 85%
At least about 100 nucleotides prepared by isolating a test DNA molecule having sequence identity of, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Having an isolated nucleic acid molecule. In a particular aspect, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1279 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, or such a code. A complementary nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 18 in the sequence of Figure 102 (SEQ ID NO: 170).

In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 80% positive, when compared to the amino acid sequence of residue 1 or about 19 to about 250 of Figure 102 (SEQ ID NO: 170). An isolated nucleic acid comprising a DNA encoding a polypeptide with a score of 85% positive, more preferably at least about 90% positive, most preferably at least about 95% positive, or the complement of (b) (a) DNA. Regarding the molecule. Another embodiment is a PR that finds use as a hybridization probe.
O1279 polypeptide encoding sequence fragment. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides in length, most preferably about 20 to about 40 nucleotides in length, and can be derived from the nucleotide sequence shown in Figure 101 (SEQ ID NO: 169). In another embodiment, the invention provides an isolated PRO1279 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1279 polypeptide, which in certain embodiments comprises residue 1 of Figure 102 (SEQ ID NO: 170) or an amino acid comprising from about 19 to about 250. Contains an array. In another aspect, the invention features amino acid residue 1 of Figure 102 (SEQ ID NO: 170).
Or at least about 80% sequence identity, preferably at least about 85% sequence identity, and more preferably at least about 90% sequence to about 19 to about 250 sequences.
To an isolated PRO1279 polypeptide comprising an amino acid sequence having sequence identity of, most preferably at least about 95% sequence identity. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably when compared to the amino acid sequence of residue 1 or about 19 to about 250 of Figure 102 (SEQ ID NO: 170), more preferably It relates to an isolated PRO1279 polypeptide which comprises an amino acid sequence with a score of at least about 90% positive, and most preferably at least about 95% positive. In yet another aspect, the invention includes amino acid residue 1 of Figure 102 (SEQ ID NO: 170) or the sequence from about 19 to about 250, or a fragment thereof sufficient to provide a binding site for an anti-PRO1279 antibody. To an isolated PRO1279 polypeptide consisting of Preferably, the PRO1279 fragment is the native PRO1279.
Retains the qualitative biological activity of the polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
A DNA molecule encoding a PRO1279 polypeptide having the sequence of about 1 or about 19 to about 250 amino acid residues of SEQ ID NO: 02 (SEQ ID NO: 170), or (b) the complement of the DNA molecule of (a) and stringent conditions. Hybridized below, the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity. If there is identity, most preferably at least about 95% sequence identity, (ii) the host cell containing the test DNA molecule is cultured under conditions suitable for expression of the polypeptide, and (iii) from the cell culture medium. Provided is a polypeptide produced by recovering the polypeptide.

In yet another embodiment, the invention relates to agonists and antagonists of native PRO1279 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1279 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1279 polypeptide by contacting the native PRO1279 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising a PRO1279 polypeptide, or an agonist or antagonist identified above, together with a pharmaceutically acceptable carrier. 52. PRO1304 In the present application, a cDNA clone (DNA65406-1567) has been identified, designated "PRO1304", which encodes a novel polypeptide and has homology to a nucleic acid encoding an FK506 binding protein. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1304 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1304 polypeptide having a sequence from about 1 to about 222 amino acid residues of Figure 104 (SEQ ID NO: 180), or (b) (a). At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity to the complement of the DNA molecule of It comprises DNA having sequence identity. In another aspect, the invention provides PRO13 that comprises DNA that hybridizes to the complement of the nucleic acid from about 23 to about 688 nucleotides of Figure 103 (SEQ ID NO: 179).
04 polypeptide is isolated nucleic acid molecule. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA65406-1567) of ATCC Deposit No. 203219, or (b) the complement of a nucleic acid molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity,
More preferably it relates to an isolated nucleic acid molecule comprising DNA having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203219 (DNA65406-1567).

In a still further aspect, the invention features (a) at least about 80% sequence identity, preferably at least about 85% sequence with the sequence from amino acid residue 1 to about 222 of Figure 104 (SEQ ID NO: 180). An isolation comprising DNA encoding a polypeptide having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or the complement of DNA of (a). Nucleic acid molecule. In a further aspect, the invention provides a test DNA molecule, (a) a DNA molecule encoding a PRO1304 polypeptide having a sequence from amino acid residue 1 to about 222 of Figure 104 (SEQ ID NO: 180), or (b) (a). ) DNA molecule complement,
Hybridized under stringent conditions, the DNA molecule has at least about 80% sequence identity to (a) or (b), preferably at least about 85% sequence identity, more preferably at least about 90%. Of a nucleic acid molecule having at least 10 nucleotides produced by isolating a test DNA molecule having sequence identity of, most preferably at least about 95%. In a particular embodiment, the present invention relates to PR with or without initiation methionine.
An isolated nucleic acid molecule comprising DNA encoding an O1304 polypeptide is provided, or is complementary to such an encoding nucleic acid molecule. In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive, more preferably when compared to the amino acid sequence of residues 1 to about 222 of Fig104 (SEQ ID NO: 180). Relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or the complement of DNA of (b) (a). Another embodiment is a PR that finds use as a hybridization probe.
It concerns a fragment of the O1304 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides long, most preferably about 20 to about 40 nucleotides long and can be derived from the nucleotide sequence shown in Figure 103 (SEQ ID NO: 179). In another embodiment, the invention provides an isolated PRO1304 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1304 polypeptide, which in certain embodiments comprises an amino acid sequence comprising residues 1 to about 222 of Figure 104 (SEQ ID NO: 180). I'm out.

In another aspect, the invention features amino acid residue 1 of Figure 104 (SEQ ID NO: 180).
To about 222 sequences, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated PRO1304 polypeptide which comprises an amino acid sequence having identity. In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 1 to 222 of Figure 104 (SEQ ID NO: 180). It relates to an isolated PRO1304 polypeptide which comprises an amino acid sequence with a score of% positive, most preferably at least about 95% positive. In yet another aspect, the invention comprises a sequence of amino acid residues 1 to about 222 of Figure 104 (SEQ ID NO: 180), or a fragment thereof sufficient to provide a binding site for an anti-PRO1304 antibody, It relates to an isolated PRO1304 polypeptide. Preferably, the PRO1304 fragment retains the qualitative biological activity of the native PRO1304 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
PRO having a sequence of about 1 to about 222 amino acid residues of SEQ ID NO: 04 (SEQ ID NO: 180)
1304 polypeptide-encoding DNA molecule, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule is at least about 80% sequence identity, preferably at least about 8
(Ii) expressing a host cell containing a test DNA molecule into a polypeptide if it has 5% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Under conditions suitable for and (ii
i) providing a polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1304 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1304 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1304 polypeptide by contacting the native PRO1304 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising a PRO1304 polypeptide, or an agonist or antagonist specified above, together with a pharmaceutically acceptable carrier.

53. PRO1317 cDNA encoding a novel secreted polypeptide sharing homology with human CD97
The A clone (DNA65408-1578) was identified. The novel polypeptide was named "PRO1317" in this application. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1317 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1317 polypeptide having amino acid residue 1 of Figure 106 (SEQ ID NO: 189) or a sequence of about 19 to about 74, or (b) ( At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 9 to the complement of the DNA molecule of a).
It comprises DNA with 5% sequence identity. In another aspect, the invention pertains to an isolated nucleic acid molecule encoding a PRO1317 polypeptide that comprises DNA that hybridizes to the complement of a nucleic acid from about 60 to about 227 residues of Figure 105 (SEQ ID NO: 188). Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203217 (DNA65408-1578), or (b) the complement of the DNA molecule of (a). Against
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203217 (DNA65408-1578). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 19 to about 74 amino acid residues of Figure 106 (SEQ ID NO: 189). , More preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity, or a DNA encoding a polypeptide, or (a) a complement of DNA isolated. Relates to nucleic acid molecules. In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO1317 having a sequence from about 19 to about 74 amino acid residues of Figure 106 (SEQ ID NO: 189).
Hybridizing with a DNA molecule encoding a polypeptide, or (b) the complement of a DNA molecule of (a) under stringent conditions, wherein the DNA molecule is at least about 80% relative to (a) or (b) A test DNA molecule is isolated if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. And an isolated nucleic acid molecule having at least about 50 nucleotides, preferably at least about 100 nucleotides.

In a particular embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1317 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, or Is complementary to such an encoded nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 18 in the sequence of Figure 106 (SEQ ID NO: 189). In another aspect, the invention provides (a) residue 1 of Figure 106 (SEQ ID NO: 189).
At least about 80% positive when compared to the amino acid sequence of 9 to about 74,
Preferably at least about 85% positive, more preferably at least about 90%
A DNA encoding a polypeptide positive, most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising the complement of (b) (a) DNA. Another embodiment is a PR that finds use as a hybridization probe.
It concerns a fragment of the O1317 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides in length, and most preferably about 20 to about 40 nucleotides in length. In another embodiment, the invention provides an isolated PRO1317 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1317 polypeptide, which in certain embodiments comprises an amino acid sequence comprising residues 19 to 74 of Figure 106 (SEQ ID NO: 189). There is. In another aspect, the invention features amino acid residue 1 of Figure 106 (SEQ ID NO: 189).
At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity to 9 to about 74 sequences. It relates to an isolated PRO1317 polypeptide comprising an amino acid sequence having sequence identity. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 19 to 74 of Figure 106 (SEQ ID NO: 189). It relates to an isolated PRO1317 polypeptide comprising an amino acid sequence with a positive score, most preferably at least about 95% positive. In yet another aspect, the invention comprises a sequence of amino acid residues 19 to about 74 of Figure 106 (SEQ ID NO: 189), or a fragment thereof sufficient to provide a binding site for an anti-PRO1317 antibody, It relates to an isolated PRO1317 polypeptide. Preferably, the PRO1317 fragment retains the qualitative biological activity of the native PRO1317 polypeptide.

In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
PRO having the sequence from about 19 to about 74 amino acid residues of SEQ ID NO: 06 (SEQ ID NO: 189)
1317 polypeptide-encoding DNA molecule, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule is at least about 80% sequence identity, preferably at least about 8
(Ii) expressing a host cell containing a test DNA molecule into a polypeptide if it has 5% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Under conditions suitable for and (ii
i) providing a polypeptide produced by recovering the polypeptide from the cell culture medium. 54. PRO1303 In the present application, a cDNA clone (DNA65409-1566), which was named "PRO1303" and which encodes a novel polypeptide having sequence identity with a protease including neuropsin, was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1303 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule that encodes a PRO1303 polypeptide having amino acid residue 1 of Figure 108 (SEQ ID NO: 194) or a sequence of about 18 to about 248, or (b) ( at least about 80% sequence identity, preferably at least about 85% sequence identity to the complement of the DNA molecule of a),
More preferably it comprises DNA having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In another aspect, the invention features an isolated nucleic acid molecule that encodes a PRO1303 polypeptide that includes DNA that hybridizes to the complement of the nucleic acid at residues 172 to 864 of Figure 107 (SEQ ID NO: 193). Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA65409-1566) of ATCC Deposit No. 203232, or (b) the complement of the DNA molecule of (a). Against
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203232 (DNA65409-1566). In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 18 to about 248 amino acid residues of Figure 108 (SEQ ID NO: 194). , And more preferably at least about 90%
Isolated nucleic acid molecule comprising a DNA encoding a polypeptide having sequence identity of, most preferably at least about 95% sequence identity, or the complement of DNA of (a).

In a further aspect, the invention provides a test DNA molecule, (a) PRO130 having a sequence from about 18 to about 248 amino acid residues of Figure 108 (SEQ ID NO: 194).
Hybridizing with a DNA molecule encoding the 3 polypeptide or (b) the complement of the DNA molecule of (a) under stringent conditions, wherein the DNA molecule has at least about 80 relative to (a) or (b). Isolating a test DNA molecule when it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Produced by at least about 50 nucleotides, preferably at least about 100 nucleotides
It relates to an isolated nucleic acid molecule having nucleotides. In another aspect, the invention provides (a) residue 18 of Figure 108 (SEQ ID NO: 194).
To at least about 80% positive when compared to about 248 amino acid sequences,
Preferably at least about 85% positive, more preferably at least about 90%
A DNA encoding a polypeptide positive, most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising the complement of (b) (a) DNA. Another embodiment is a PR that finds use as a hybridization probe.
It relates to a fragment of the O1303 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides in length, and most preferably about 20 to about 40 nucleotides in length. In another embodiment, the invention provides an isolated PRO1303 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1303 polypeptide, which in certain embodiments comprises an amino acid sequence comprising residues 18 to 248 of Figure 108 (SEQ ID NO: 194). There is. In another aspect, the invention features amino acid residue 1 of Figure 108 (SEQ ID NO: 194).
8 to about 248 sequences, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%. It relates to an isolated PRO1303 polypeptide comprising an amino acid sequence having sequence identity. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 18 to 248 of Figure 108 (SEQ ID NO: 194). It relates to an isolated PRO1303 polypeptide which comprises an amino acid sequence that scores positive, most preferably at least about 95% positive.

In yet another aspect, the invention includes a sequence of amino acid residues 18 to about 248 of Figure 108 (SEQ ID NO: 194), or a fragment thereof sufficient to provide a binding site for an anti-PRO1303 antibody. To an isolated PRO1303 polypeptide consisting of Preferably, the PRO1303 fragment retains the qualitative biological activity of the native PRO1303 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
PR having a sequence of about 18 to about 248 amino acid residues of 08 (SEQ ID NO: 194)
A DNA molecule encoding the O1303 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule is at least about (Ii) testing if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. DNA
A host cell containing the molecule is cultured under conditions suitable for expression of the polypeptide, and (i
ii) Providing the polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1303 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1303 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1303 polypeptide by contacting the native PRO1303 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising a PRO1303 polypeptide, or an agonist or antagonist specified above, together with a pharmaceutically acceptable carrier. 55. PRO1306 This application is named "PRO1306", and has AIT1 / daintain (da
cDNA clone () that encodes a novel polypeptide homologous to
DNA65410-1569) has been identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1306 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1306 polypeptide having a sequence from about 1 to about 150 amino acid residues of Fig110 (SEQ ID NO: 196), or (b) (a). At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity to the complement of the DNA molecule of It comprises DNA having sequence identity.

In another aspect, the invention features an isolated nucleic acid encoding a PRO1306 polypeptide that comprises a DNA that hybridizes to the complement of a nucleic acid from about residue 106 to about 555 of Fig109 (SEQ ID NO: 195). Regarding the molecule. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203231 (DNA65410-1569), or (b) the complement of the DNA molecule of (a). Against
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203231 (DNA65410-1569). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 1 to about 150 amino acid residues of Figure 110 (SEQ ID NO: 196). , More preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity, or a DNA encoding a polypeptide of (a) the complement of the isolated DNA. Relates to nucleic acid molecules. In a further aspect, the invention provides for a test DNA molecule to be (a) PRO1306 having a sequence from about 1 to about 150 amino acid residues of Fig110 (SEQ ID NO: 196).
Hybridizing with a DNA molecule encoding a polypeptide, or (b) the complement of a DNA molecule of (a) under stringent conditions, wherein the DNA molecule is at least about 80% relative to (a) or (b) A test DNA molecule is isolated if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. And an isolated nucleic acid molecule having at least about 50 nucleotides, preferably at least about 100 nucleotides. In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive, and more preferably when compared to the amino acid sequence of residues 1 to about 150 of Fig110 (SEQ ID NO: 196). Relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide with a score of at least about 90% positive, most preferably at least about 95% positive, or the complement of DNA of (b) (a). Another embodiment is a PR that finds use as a hybridization probe.
It concerns a fragment of the O1306 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides in length, and most preferably about 20 to about 40 nucleotides in length.

In another embodiment, the invention provides an isolated PRO1306 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1306 polypeptide, which in certain embodiments comprises an amino acid sequence comprising residues 1 to 150 of Figure 110 (SEQ ID NO: 196). There is. In another aspect, the invention features amino acid residue 1 of Figure 110 (SEQ ID NO: 196).
To about 150 sequences, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. It relates to an isolated PRO1306 polypeptide comprising an amino acid sequence having identity. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive amino acid sequence when compared to the amino acid sequence of residues 1 to 150 of FIG110 (SEQ ID NO: 196). Relates to an isolated PRO1306 polypeptide comprising an amino acid sequence with a positive, most preferably at least about 95% positive score. In yet another aspect, the invention comprises a sequence of amino acid residues 1 to about 150 of Fig110 (SEQ ID NO: 196), or a fragment thereof sufficient to provide a binding site for an anti-PRO1306 antibody, It relates to an isolated PRO1306 polypeptide. Preferably, the PRO1306 fragment retains the qualitative biological activity of the native PRO1306 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
PRO having a sequence of about 1 to about 150 amino acid residues of 10 (SEQ ID NO: 196)
1306 polypeptide-encoding DNA molecule, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule is at least about 80% sequence identity, preferably at least about 8
(Ii) expressing a host cell containing a test DNA molecule into a polypeptide if it has 5% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Under conditions suitable for and (ii
i) providing a polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1306 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1306 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1306 polypeptide by contacting the native PRO1306 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.

In yet a further embodiment, the invention relates to a composition comprising a PRO1306 polypeptide, or an agonist or antagonist identified above, together with a pharmaceutically acceptable carrier. 56. PRO1336 A cDNA clone (DNA6542) named “PRO1336” in the present application and encoding a novel polypeptide having sequence identity with a slit.
3-1595) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1336 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1336 polypeptide having amino acid residue 1 of Figure 112 (SEQ ID NO: 198) or a sequence from about 28 to about 1523, or (b) ( For the complement of the DNA molecule of a),
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. . In another aspect, the invention features about residue 1 of Fig111A-B (SEQ ID NO: 197).
PRO1 containing DNA that hybridizes to the complement of 64 to about 4651 nucleic acids
It relates to an isolated nucleic acid molecule encoding a 336 polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA65423-1595) of ATCC Deposit No. 203227, or (b) the complement of the DNA molecule of (a). Against
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203227 (DNA65423-1595). In a still further aspect, the invention provides (a) at least about 80% sequence identity with the sequence of amino acid residues from about 28 to about 1523 of Figure 112 (SEQ ID NO: 198),
Preferably at least about 85% sequence identity, more preferably at least about 90.
It relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide having a% sequence identity, most preferably at least about 95% sequence identity, or the complement of the DNA of (a). In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO13 having a sequence from about 28 to about 1523 amino acid residues of Fig112 (SEQ ID NO: 198).
A DNA molecule encoding the 36 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, wherein the DNA molecule has at least 80 Isolate a test DNA molecule if it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. At least about 50 nucleotides, preferably at least about 10
It relates to an isolated nucleic acid molecule having 0 nucleotides.

In another aspect, the invention features residue 28 of (a) Fig112 (SEQ ID NO: 198).
From about 1523 amino acid sequences to at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive.
% Nucleic acid, and most preferably at least about 95% positive DNA that encodes a polypeptide, or an isolated nucleic acid molecule comprising the complement of (b) (a) DNA. Another embodiment is a PR that finds use as a hybridization probe.
It relates to a fragment of the O1336 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides in length, and most preferably about 20 to about 40 nucleotides in length. In another embodiment, the invention provides an isolated PRO1336 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1336 polypeptide, which, in certain embodiments, comprises an amino acid sequence comprising residues 28 to 1523 of Figure 112 (SEQ ID NO: 198). There is. In another aspect, the invention features amino acid residue 2 of Figure 112 (SEQ ID NO: 198).
8 to about 1523 sequences, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. It relates to an isolated PRO1336 polypeptide comprising an amino acid sequence having sequence identity. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 28 to 1523 of Figure 112 (SEQ ID NO: 198). It relates to an isolated PRO1336 polypeptide comprising an amino acid sequence with a positive, most preferably at least about 95% positive score. In yet another aspect, the invention comprises a sequence of amino acid residues 28 to about 1523 of Figure 112 (SEQ ID NO: 198), or a fragment thereof sufficient to provide a binding site for an anti-PRO1336 antibody, It relates to an isolated PRO1336 polypeptide. Preferably, the PRO1336 fragment retains the qualitative biological activity of the native PRO1336 polypeptide.

In a still further aspect, the present invention provides (i) a test DNA molecule, (a) Fig1.
12 (SEQ ID NO: 198) having a sequence from about 28 to about 1523 amino acid residues P
DNA molecule encoding RO1336 polypeptide, or DNA of (b) (a)
The test DNA molecule is hybridized to the complement of the molecule under stringent conditions,
Or to (b) at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. (Ii) test DN if
A host cell containing the A molecule is cultured under conditions suitable for expression of the polypeptide, and (
iii) providing a polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1336 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1336 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1336 polypeptide by contacting the native PRO1336 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising a PRO1336 polypeptide, or an agonist or antagonist specified above, together with a pharmaceutically acceptable carrier. 57. PRO1278 In the present application, a cDNA clone (DNA66304-15) named "PRO1278" and encoding a novel polypeptide having homology with lysozyme C.
46) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1278 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule that encodes a PRO1278 polypeptide having amino acid residue 1 of Figure 114 (SEQ ID NO: 203) or a sequence of about 20 to about 148, or (b) ( at least about 80% sequence identity, preferably at least about 85% sequence identity to the complement of the DNA molecule of a),
More preferably it comprises DNA having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In another aspect, the invention features an isolated nucleic acid molecule that encodes a PRO1278 polypeptide that comprises DNA that hybridizes to the complement of the nucleic acid at residues 198 to 584 of Figure 113 (SEQ ID NO: 202). Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203321 (DNA66304-1546), or (b) the complement of the DNA molecule of (a). Against
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203321 (DNA66304-1546).

In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with a sequence from about 20 to about 148 amino acid residues of Figure 114 (SEQ ID NO: 203). Sequence identity, more preferably at least about 90%
Isolated nucleic acid molecule comprising a DNA encoding a polypeptide having sequence identity of, most preferably at least about 95% sequence identity, or the complement of DNA of (a). In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO127 having a sequence of about 20 to about 148 amino acid residues of Fig114 (SEQ ID NO: 203).
At least about 80 relative to (a) or (b), wherein said DNA molecule hybridizes with a DNA molecule encoding 8 polypeptide or (b) the complement of the DNA molecule of (a) under stringent conditions. Isolating a test DNA molecule when it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Produced by at least about 50 nucleotides, preferably at least about 100 nucleotides
It relates to an isolated nucleic acid molecule having nucleotides. In a particular aspect, the invention provides an isolated nucleic acid molecule comprising a DNA encoding a PRO1278 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and a soluble or transmembrane domain thereof. Are deleted or inactivated variants, or are complementary to such encoding nucleic acid molecules. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 19 in the sequence of Figure 114 (SEQ ID NO: 203). In another aspect, the invention provides (a) residue 20 of Figure 114 (SEQ ID NO: 203).
To at least about 80% positive when compared to about 148 amino acid sequences,
Preferably at least about 85% positive, more preferably at least about 90%
A DNA encoding a polypeptide positive, most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising the complement of (b) (a) DNA. Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1278 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides in length, and most preferably about 20 to about 40 nucleotides in length.

In another embodiment, the invention provides an isolated PRO1278 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1278 polypeptide, which in certain embodiments comprises an amino acid sequence comprising residues 20 to 148 of Figure 114 (SEQ ID NO: 203). There is. In another aspect, the invention features amino acid residue 2 of Figure 114 (SEQ ID NO: 203).
0 to about 148 sequences, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. It relates to an isolated PRO1278 polypeptide comprising an amino acid sequence having sequence identity. In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 20 to 148 of Figure 114 (SEQ ID NO: 203). It relates to an isolated PRO1278 polypeptide which comprises an amino acid sequence that scores positive, most preferably at least about 95% positive. In yet another aspect, the invention comprises a sequence of amino acid residues 20 to about 148 of Figure 114 (SEQ ID NO: 203), or a fragment thereof sufficient to provide a binding site for an anti-PRO1278 antibody, It relates to an isolated PRO1278 polypeptide. Preferably, the PRO1278 fragment retains the qualitative biological activity of the native PRO1278 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
PR having a sequence of about 20 to about 148 amino acid residues of 14 (SEQ ID NO: 203)
A DNA molecule encoding an O1278 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule has at least about at least about (a) or (b). (Ii) testing if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. DNA
A host cell containing the molecule is cultured under conditions suitable for expression of the polypeptide, and (i
ii) Providing the polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1278 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1278 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1278 polypeptide by contacting the native PRO1278 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.

In yet a further embodiment, the invention relates to a composition comprising a PRO1278 polypeptide, or an agonist or antagonist identified above, together with a pharmaceutically acceptable carrier. 58. PRO1298 In the present application, designated as "PRO1298", is a cDNA clone (D) encoding a novel polypeptide having sequence identity with glycosyltransferase.
NA66511-1563) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1298 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1298 polypeptide having amino acid residue 1 of Fig116 (SEQ ID NO: 210) or a sequence of about 16 to about 323, or (b) ( at least about 80% sequence identity, preferably at least about 85% sequence identity to the complement of the DNA molecule of a),
More preferably it comprises DNA having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In another aspect, the invention features a PRO1298 that comprises a DNA that hybridizes to the complement of a nucleic acid from residues about 139 to about 1062 of Figure 115 (SEQ ID NO: 209).
It relates to an isolated nucleic acid molecule encoding a polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA66511-1563) of ATCC Deposit No. 203228, or (b) the complement of the DNA molecule of (a). Against
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203228 (DNA66511-1563). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 16 to about 323 amino acid residues of Fig116 (SEQ ID NO: 210). , And more preferably at least about 90%
Isolated nucleic acid molecule comprising a DNA encoding a polypeptide having sequence identity of, most preferably at least about 95% sequence identity, or the complement of DNA of (a). In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO129 having a sequence from about 16 to about 323 amino acid residues of Fig116 (SEQ ID NO: 210).
At least about 80 relative to (a) or (b), wherein said DNA molecule hybridizes with a DNA molecule encoding 8 polypeptide or (b) the complement of the DNA molecule of (a) under stringent conditions. Isolating a test DNA molecule when it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Produced by at least about 50 nucleotides, preferably at least about 100 nucleotides
It relates to an isolated nucleic acid molecule having nucleotides.

In another aspect, the invention features (a) residue 16 of Figure 116 (SEQ ID NO: 210).
To at least about 80% positive when compared to about 323 amino acid sequences,
Preferably at least about 85% positive, more preferably at least about 90%
A DNA encoding a polypeptide positive, most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising the complement of (b) (a) DNA. Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1298 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides in length, and most preferably about 20 to about 40 nucleotides in length. In another embodiment, the invention provides an isolated PRO1298 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1298 polypeptide, which in certain embodiments comprises an amino acid sequence comprising residues 16 to 323 of Fig116 (SEQ ID NO: 210). There is. In another aspect, the invention features amino acid residue 1 of Figure 116 (SEQ ID NO: 210).
6 to about 323 sequences, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%. It relates to an isolated PRO1298 polypeptide comprising an amino acid sequence having sequence identity. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, and more preferably at least about 90% positive when compared to the amino acid sequence of residues 16 to 323 of Figure 116 (SEQ ID NO: 210). It relates to an isolated PRO1298 polypeptide comprising an amino acid sequence with a positive, most preferably at least about 95% positive score. In yet another aspect, the invention comprises a sequence from amino acid residue 16 to about 323 of Figure 116 (SEQ ID NO: 210), or a fragment thereof sufficient to provide a binding site for an anti-PRO1298 antibody, It relates to an isolated PRO1298 polypeptide. Preferably, the PRO1298 fragment retains the qualitative biological activity of the native PRO1298 polypeptide.

In a still further aspect, the present invention provides (i) a test DNA molecule, (a) Fig1.
PR having a sequence of about 16 to about 323 amino acid residues of 16 (SEQ ID NO: 210)
A DNA molecule encoding an O1298 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule is at least about (Ii) testing if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. DNA
A host cell containing the molecule is cultured under conditions suitable for expression of the polypeptide, and (i
ii) Providing the polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1298 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1298 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1298 polypeptide by contacting the native PRO1298 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising a PRO1298 polypeptide, or an agonist or antagonist specified above, together with a pharmaceutically acceptable carrier. 59. PRO1301 A cDNA clone (DNA66512) named “PRO1301” in the present application and encoding a novel polypeptide having homology with cytochrome P450.
-1564) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1301 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1301 polypeptide having amino acid residue 1 of Figure 118 (SEQ ID NO: 212) or a sequence from about 19 to about 462, or (b) ( at least about 80% sequence identity, preferably at least about 85% sequence identity to the complement of the DNA molecule of a),
More preferably it comprises DNA having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In another aspect, the invention features an isolated nucleic acid molecule encoding a PRO1301 polypeptide that comprises a DNA that hybridizes to the complement of a nucleic acid from about residue 97 to about 1428 of Figure 117 (SEQ ID NO: 211). Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA66512-1564) of ATCC Deposit No. 203218, or (b) the complement of the DNA molecule of (a). Against
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203218 (DNA66512-1564).

In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with a sequence from about 19 to about 462 amino acid residues of Figure 118 (SEQ ID NO: 212). Sequence identity, more preferably at least about 90%
Isolated nucleic acid molecule comprising a DNA encoding a polypeptide having sequence identity of, most preferably at least about 95% sequence identity, or the complement of DNA of (a). In a further aspect, the invention provides a test DNA molecule, (a) PRO130 having a sequence from about 19 to about 462 amino acid residues of Fig118 (SEQ ID NO: 212).
Hybridizing with a DNA molecule encoding one polypeptide or (b) the complement of the DNA molecule of (a) under stringent conditions, wherein the DNA molecule is at least about 80 relative to (a) or (b). Isolating a test DNA molecule when it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Produced by at least about 50 nucleotides, preferably at least about 100 nucleotides
It relates to an isolated nucleic acid molecule having nucleotides. In a particular aspect, the invention provides an isolated nucleic acid molecule comprising a DNA encoding a PRO1301 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and a soluble or transmembrane domain thereof. Are deleted or inactivated variants, or are complementary to such encoding nucleic acid molecules. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 18 in the sequence of Figure 118 (SEQ ID NO: 212). The transmembrane domain has a PRO1301 amino acid sequence (Fig118, SEQ ID NO: 21).
It has been tentatively identified as extending from about amino acid position 271 to about amino acid position 290 in 2). In another aspect, the invention provides (a) residue 19 of Figure 118 (SEQ ID NO: 212).
To at least about 80% positive when compared to the amino acid sequence of about 462,
Preferably at least about 85% positive, more preferably at least about 90%
A DNA encoding a polypeptide positive, most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising the complement of (b) (a) DNA. Another embodiment is a PR that finds use as a hybridization probe.
It concerns a fragment of the O1301 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides in length, and most preferably about 20 to about 40 nucleotides in length.

In another embodiment, the invention provides an isolated PRO1301 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1301 polypeptide, which in certain embodiments comprises an amino acid sequence comprising residues 19 to 462 of Figure 118 (SEQ ID NO: 212). There is. In another aspect, the invention features amino acid residue 1 of Figure 118 (SEQ ID NO: 212).
9 to about 462 sequences, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%. It relates to an isolated PRO1301 polypeptide comprising an amino acid sequence having sequence identity. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 19 to 462 of Figure 118 (SEQ ID NO: 212). It relates to an isolated PRO1301 polypeptide which comprises an amino acid sequence that scores positive, most preferably at least about 95% positive. In yet another aspect, the invention comprises a sequence from amino acid residue 19 to about 462 of Figure 118 (SEQ ID NO: 212), or a fragment thereof sufficient to provide a binding site for an anti-PRO1301 antibody, It relates to an isolated PRO1301 polypeptide. Preferably, the PRO1301 fragment retains the qualitative biological activity of the native PRO1301 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
PR having a sequence of about 19 to about 462 amino acid residues of 18 (SEQ ID NO: 212)
A DNA molecule encoding the O1301 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule is at least about about the same as (a) or (b). (Ii) testing if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. DNA
A host cell containing the molecule is cultured under conditions suitable for expression of the polypeptide, and (i
ii) Providing the polypeptide produced by recovering the polypeptide from the cell culture medium. 60. PRO1268 A cDNA clone (DNA66519-1535) has been identified which encodes a novel transmembrane polypeptide designated "PRO1268" in this application.

In one embodiment, the present invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1268 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1268 polypeptide having a sequence from about 1 to about 140 amino acid residues of Figure 120 (SEQ ID NO: 214), or (b) (a). At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity to the complement of the DNA molecule of It comprises DNA having sequence identity. In another aspect, the invention features an isolated nucleic acid molecule that encodes a PRO1268 polypeptide that comprises a DNA that hybridizes to the complement of the nucleic acid from residues 89 to 508 of Figure 119 (SEQ ID NO: 213). Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA66519-1535) of ATCC Deposit No. 203236, or (b) the complement of the DNA molecule of (a). Against
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203236 (DNA66519-1535). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of about 1 to about 140 amino acid residues of Figure 120 (SEQ ID NO: 214). , More preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity, or a DNA encoding a polypeptide, or (a) a complement of DNA isolated. Relates to nucleic acid molecules. In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO1268 having a sequence from about 1 to about 140 amino acid residues of Fig120 (SEQ ID NO: 214).
Hybridizing with a DNA molecule encoding a polypeptide, or (b) the complement of a DNA molecule of (a) under stringent conditions, wherein the DNA molecule is at least about 80% relative to (a) or (b) A test DNA molecule is isolated if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. And an isolated nucleic acid molecule having at least about 50 nucleotides, preferably at least about 100 nucleotides. In a particular aspect, the invention provides a DNA encoding a PRO1268 polypeptide having one or more of its soluble, ie transmembrane domains, deleted or inactivated.
Is provided, or is complementary to such an encoding nucleic acid molecule. The transmembrane domain is a PRO1268 amino acid sequence (Fig120,
Amino acids of SEQ ID NO: 214) approximately 12-28 (type II), 51-66 and 107
It has been tentatively identified as being at -124.

In another aspect, the invention features (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residues 1 to about 140 of Figure 120 (SEQ ID NO: 214). , More preferably at least about 90% positive, most preferably at least about 95% positive, DNA encoding a polypeptide, or (b) an isolated nucleic acid molecule comprising the complement of DNA of (a). Another embodiment is a PR that finds use as a hybridization probe.
It concerns a fragment of the O1268 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides in length, and most preferably about 20 to about 40 nucleotides in length. In another embodiment, the invention provides an isolated PRO1268 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1268 polypeptide, which in certain embodiments comprises an amino acid sequence comprising residues 1 to 140 of Figure 120 (SEQ ID NO: 214). There is. In another aspect, the invention features amino acid residue 1 of Figure 120 (SEQ ID NO: 214).
To about 140 sequences, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated PRO1268 polypeptide comprising an amino acid sequence having identity. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 1-140 of Figure 120 (SEQ ID NO: 214). It relates to an isolated PRO1268 polypeptide comprising an amino acid sequence with a positive, most preferably at least about 95% positive score. In yet another aspect, the invention comprises a sequence of amino acid residues 1 to about 140 of Figure 120 (SEQ ID NO: 214), or a fragment thereof sufficient to provide a binding site for an anti-PRO1268 antibody, It relates to an isolated PRO1268 polypeptide. Preferably, the PRO1268 fragment retains the qualitative biological activity of the native PRO1268 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
PRO having a sequence of about 1 to about 140 amino acid residues of 20 (SEQ ID NO: 214)
1268 polypeptide-encoding DNA molecule, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule is at least about 80% sequence identity, preferably at least about 8
(Ii) expressing a host cell containing a test DNA molecule into a polypeptide if it has 5% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Under conditions suitable for and (ii
i) providing a polypeptide produced by recovering the polypeptide from the cell culture medium.

61. PRO1269 In the present application, designated as "PRO1269", is a cDNA clone (DNA66520) encoding a novel polypeptide having homology with granule cell peptide A.
-1536) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1269 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1269 polypeptide having amino acid residue 1 of Figure 122 (SEQ ID NO: 216) or a sequence of about 21 to about 196, or (b) ( at least about 80% sequence identity, preferably at least about 85% sequence identity to the complement of the DNA molecule of a),
More preferably it comprises DNA having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In another aspect, the invention features an isolated nucleic acid molecule that encodes a PRO1269 polypeptide that comprises DNA that hybridizes to the complement of a nucleic acid from residues 86 to 613 of Figure 121 (SEQ ID NO: 215). Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA66520-1536) of ATCC Deposit No. 203226, or (b) the complement of the DNA molecule of (a). Against
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203226 (DNA66520-1536). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about amino acid residues 21 to about 196 of Figure 122 (SEQ ID NO: 216). , And more preferably at least about 90%
Isolated nucleic acid molecule comprising a DNA encoding a polypeptide having sequence identity of, most preferably at least about 95% sequence identity, or the complement of DNA of (a).

In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO126 having a sequence from about 21 to about 196 amino acid residues of Figure 122 (SEQ ID NO: 216).
At least about 80% of the DNA molecule with respect to (a) or (b) by hybridizing under stringent conditions with a DNA molecule encoding 9 polypeptide or (b) the complement of the DNA molecule of (a). Isolate a test DNA molecule if it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Produced by at least about 50 nucleotides, preferably at least about 100 nucleotides
It relates to an isolated nucleic acid molecule having nucleotides. In a particular aspect, the invention provides an isolated nucleic acid molecule comprising a DNA encoding a PRO1269 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and a soluble or transmembrane domain thereof. Are deleted or inactivated variants, or are complementary to such encoding nucleic acid molecules. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 20 in the sequence of Figure 122 (SEQ ID NO: 216). In another aspect, the invention provides (a) residue 21 of Figure 122 (SEQ ID NO: 216).
To at least about 80% positive when compared to the about 196 amino acid sequence,
Preferably at least about 85% positive, more preferably at least about 90%
A DNA encoding a polypeptide positive, most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising the complement of (b) (a) DNA. Another embodiment is a PR that finds use as a hybridization probe.
It concerns a fragment of the O1269 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides in length, and most preferably about 20 to about 40 nucleotides in length. In another embodiment, the invention provides an isolated PRO1269 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1269 polypeptide, which in certain embodiments comprises an amino acid sequence comprising residues 21 to 196 of Figure 122 (SEQ ID NO: 216). There is. In another aspect, the invention features amino acid residue 2 of Figure 122 (SEQ ID NO: 216).
1 to about 196 sequences, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. It relates to an isolated PRO1269 polypeptide comprising an amino acid sequence having sequence identity.

In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 80% positive when compared to the amino acid sequence of residues 21 to 196 of Figure 122 (SEQ ID NO: 216). It relates to an isolated PRO1269 polypeptide which comprises an amino acid sequence with a score of about 90% positive, most preferably at least about 95% positive. In yet another aspect, the invention comprises a sequence of amino acid residues 21 to about 196 of Figure 122 (SEQ ID NO: 216), or a fragment thereof sufficient to provide a binding site for an anti-PRO1269 antibody, It relates to an isolated PRO1269 polypeptide. Preferably, the PRO1269 fragment retains the qualitative biological activity of the native PRO1269 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
PR having the sequence of about 21 to about 196 amino acid residues of 22 (SEQ ID NO: 216)
A DNA molecule encoding the O1269 polypeptide or (b) a complement of the DNA molecule of (a) is hybridized under stringent conditions, and the test DNA molecule is at least about about the same as (a) or (b). (Ii) testing if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. DNA
A host cell containing the molecule is cultured under conditions suitable for expression of the polypeptide, and (i
ii) Providing the polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1269 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1269 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1269 polypeptide by contacting the native PRO1269 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising a PRO1269 polypeptide, or an agonist or antagonist specified above, together with a pharmaceutically acceptable carrier. 62. PRO1327 In the present application, a cDNA clone (DNA66521-1583) has been identified, which has been named “PRO1327” and which encodes a novel polypeptide and has homology with a nucleic acid encoding neurexoplilin. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1327 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule that encodes a PRO1327 polypeptide having the sequence from about 1 or about 15 to about 252 amino acid residues of Figure 124 (SEQ ID NO: 218), or (b) For the complement of the DNA molecule of (a),
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. .

In another aspect, the invention provides an isolated PRO1327 polypeptide encoding a DNA that hybridizes to the complement of a nucleic acid of about nucleotide 55 or about 97 to about 810 of Figure 123 (SEQ ID NO: 217). Nucleic acid molecule. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA665211583) of ATCC Deposit No. 203225, or (b) the complement of a nucleic acid molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity,
More preferably it relates to an isolated nucleic acid molecule comprising DNA having at least about 90% sequence identity, most preferably at least about 95% sequence identity.
In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203225 (DNA66521-1583). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence with amino acid residue 1 of Fig124 (SEQ ID NO: 218) or the sequence from about 15 to about 252. DNA comprising a polypeptide having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) complement of DNA of (a). To an isolated nucleic acid molecule. In a further aspect, the invention provides a test DNA molecule comprising (a) a PRO having the amino acid residue 1 of Fig124 (SEQ ID NO: 218) or the sequence of about 15 to about 252.
A DNA molecule encoding the 1327 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions such that the DNA molecule (a) or (b)
) To at least about 80% sequence identity, preferably at least about 85%
Having at least 260 nucleotides, prepared by isolating a test DNA molecule when having sequence identity of, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a particular aspect, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1327 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, or such a code. A complementary nucleic acid molecule. The signal peptide has been tentatively identified as extending from about amino acid position 1 to about amino acid position 14 in the sequence of Figure 124 (SEQ ID NO: 218).

In another aspect, the invention features (a) at least about 80% positive, preferably at least about 80% positive when compared to the amino acid sequence of residue 1 or about 15 to about 252 of Figure 124 (SEQ ID NO: 218). An isolated nucleic acid comprising a DNA encoding a polypeptide with a score of 85% positive, more preferably at least about 90% positive, most preferably at least about 95% positive, or the complement of DNA of (b) (a). Regarding the molecule. Another embodiment is a PR that finds use as a hybridization probe.
It relates to a fragment of the O1327 polypeptide coding sequence. Such a nucleic acid fragment has a length of about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides,
More preferably about 20 to about 50 nucleotides long, most preferably about 20 to about 40 nucleotides long and can be derived from the nucleotide sequence shown in Figure 123 (SEQ ID NO: 217). In another embodiment, the invention provides an isolated PRO1327 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1327 polypeptide, which in certain embodiments comprises residue 1 of Figure 124 (SEQ ID NO: 218) or an amino acid comprising from about 15 to about 252. Contains an array. In another aspect, the invention features amino acid residue 1 of Figure 124 (SEQ ID NO: 218).
Or about 15 to about 252 sequences, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90%.
Of sequence identity, most preferably at least about 95% sequence identity, to an isolated PRO1327 polypeptide. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, and more preferably when compared to the amino acid sequence of residue 1 or about 15 to about 252 of Figure 124 (SEQ ID NO: 218). It relates to an isolated PRO1327 polypeptide which comprises an amino acid sequence with a score of at least about 90% positive, and most preferably at least about 95% positive. In yet another aspect, the invention includes amino acid residue 1 of Figure 124 (SEQ ID NO: 218) or the sequence from about 15 to about 252, or a fragment thereof sufficient to provide a binding site for an anti-PRO1327 antibody. To an isolated PRO1327 polypeptide consisting of Preferably, the PRO1327 fragment is the native PRO1327.
Retains the qualitative biological activity of the polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
A DNA molecule encoding a PRO1327 polypeptide having the sequence of about 1 or about 15 to about 252 amino acid residues of 24 (SEQ ID NO: 218), or (b) the complement of the DNA molecule of (a) and stringent conditions. Hybridized below, the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably at least about 85% sequence identity, and more preferably at least about 90% sequence identity. If there is identity, most preferably at least about 95% sequence identity, (ii) the host cell containing the test DNA molecule is cultured under conditions suitable for expression of the polypeptide, and (iii) from the cell culture medium. Provided is a polypeptide produced by recovering the polypeptide. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1327 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1327 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1327 polypeptide by contacting the native PRO1327 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising a PRO1327 polypeptide, or an agonist or antagonist identified above, together with a pharmaceutically acceptable carrier.

63. PRO1382 In the present application, a cDNA clone named "PRO1382", which encodes a novel polypeptide having homology to cerebellin (DNA665).
26-1616) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1382 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1382 polypeptide having amino acid residue 1 of Figure 126 (SEQ ID NO: 220) or a sequence of about 28 to about 201, or (b) ( at least about 80% sequence identity, preferably at least about 85% sequence identity to the complement of the DNA molecule of a),
More preferably it comprises DNA having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In another aspect, the invention features about residue 418 of Figure 125 (SEQ ID NO: 219).
To PRO938 containing DNA hybridizing to the complement of about 939 nucleic acids from
It relates to an isolated nucleic acid molecule encoding a polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA66526-1616) of ATCC Deposit No. 203246, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203246 (DNA66526-1616). In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about amino acid residue 28 to about 201 of Figure 126 (SEQ ID NO: 220). , And more preferably at least about 90%
To a DNA encoding a polypeptide having sequence identity of, most preferably at least about 95% sequence identity, or (b) an isolated nucleic acid molecule comprising the complement of the DNA molecule of (a). In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO138 having a sequence from about 28 to about 201 amino acid residues of Figure 126 (SEQ ID NO: 220).
At least about 80% of the DNA molecule with respect to (a) or (b) by hybridizing under stringent conditions with a DNA molecule encoding the 2 polypeptide or (b) the complement of the DNA molecule of (a) Isolate a test DNA molecule if it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule having at least about 50 nucleotides, preferably 100 nucleotides.

In a particular aspect, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1382 polypeptide with or without an N-terminal signal sequence, or such an encoding nucleic acid. It is complementary to the molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 27 of Figure 126 (SEQ ID NO: 220). In another aspect, the invention provides (a) residue 28 of Figure 126 (SEQ ID NO: 220).
To at least about 80% positive when compared to about 201 amino acid sequences,
Preferably at least about 85% positive, more preferably at least about 90%
A DNA molecule encoding a polypeptide positive, most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising (b) (a) the complement of the DNA molecule. Another embodiment is a PR that finds use as a hybridization probe.
It relates to fragments of the O1382 polypeptide coding sequence. Such a nucleic acid fragment is
In another embodiment, the invention is about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long. Provides an isolated PRO1382 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a specific aspect, the invention provides an isolated native sequence PRO1382 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 28 to 201 of Figure 126 (SEQ ID NO: 220). In another aspect, the invention features amino acid residue 2 of Figure 126 (SEQ ID NO: 220).
8 to about 201 to at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity.
To an isolated PRO1382 polypeptide comprising an amino acid sequence having sequence identity of, most preferably at least about 95% sequence identity. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 28 to 201 of Figure 126 (SEQ ID NO: 220). It relates to an isolated PRO1382 polypeptide which comprises an amino acid sequence that scores positive, most preferably at least about 95% positive. In a still further aspect, the invention provides an isolated sequence comprising the sequence of amino acid residues 28 to about 201 of Figure 126 (SEQ ID NO: 220), or a fragment thereof sufficient to bind an anti-PRO1382 antibody. It relates to PRO1382 polypeptides.
Preferably, the PRO1382 fragment retains the qualitative biological activity of the native PRO1382 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
PR having a sequence of about 28 to about 201 amino acid residues of 26 (SEQ ID NO: 220)
A DNA molecule encoding the O1382 polypeptide or (b) a complement of the DNA molecule of (a) is hybridized under stringent conditions such that the test DNA molecule is at least about (Ii) test if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. DNA
A host cell containing the molecule is cultured under conditions suitable for expression of the polypeptide, and (i
ii) Providing the polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1382 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1382 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1382 polypeptide by contacting the native PRO1382 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In yet a further embodiment, the invention relates to a composition comprising a PRO1382 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

64. PRO1328 In the present application, a cDNA clone (DNA66658-1584) was identified, which was named "PRO1328" and encodes a novel transmembrane polypeptide. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1328 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1328 polypeptide having the sequence of about amino acid residue 1 or about 20 to about 257 of Figure 128 (SEQ ID NO: 225), or (b) For the complement of the DNA molecule of (a),
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. . In another aspect, the invention features a PRO1 that comprises a DNA that hybridizes to the complement of a nucleic acid from residue about 9 or about 66 to about 779 of Figure 127 (SEQ ID NO: 224).
It relates to an isolated nucleic acid molecule encoding a 328 polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA66658-1584) of ATCC Deposit No. 203229, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203229 (DNA66658-1584). In a still further aspect, the invention features (a) at least about 80% sequence identity with amino acid residue 1 of Fig128 (SEQ ID NO: 225) or the sequence from about 20 to about 257, preferably at least about 85% sequence. A DNA encoding a polypeptide having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) complement of the DNA molecule of (a). To an isolated nucleic acid molecule consisting of

In a further aspect, the invention provides a test DNA molecule comprising (a) a PRO having amino acid residue 1 of Fig128 (SEQ ID NO: 225) or a sequence of about 20 to about 257.
Hybridized with a DNA molecule encoding the 1328 polypeptide, or (b) the complement of the DNA molecule of (a), under stringent conditions such that the DNA molecule (a) or (b)
) To at least about 80% sequence identity, preferably at least about 85%
At least about 457 nucleotides prepared by isolating a test DNA molecule having sequence identity of, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Having an isolated nucleic acid molecule. In a particular aspect, the invention encodes a PRO1328 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and solubilizing, ie transmembrane domain deletion or inactivating variants thereof. An isolated nucleic acid molecule containing DNA is provided or is complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 19 of Figure 128 (SEQ ID NO: 225). The transmembrane domain is PRO1
About 32 amino acid positions in the 328 amino acid sequence (Fig128, SEQ ID NO: 225)
From about amino acid position about 51, from about amino acid position about 119 to about amino acid position 138, about from amino acid position about 152 to about amino acid position 169, and from about amino acid position 216 to about amino acid position 235. In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residue 1 or about 20 to about 257 of Fig128 (SEQ ID NO: 225). , More preferably at least about 90% positive, most preferably at least about 95% positive, a DNA molecule encoding a polypeptide, or an isolated nucleic acid molecule comprising the complement of a DNA molecule of (b) (a). Regarding Another embodiment is a PR that finds use as a hybridization probe.
O1328 polypeptide coding sequence fragments. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides in length, preferably about 20 to about 60 nucleotides in length, more preferably about 20 to about 50 nucleotides in length, most preferably about 20 to about 40 nucleotides in length, as shown in Figure 127 (SEQ ID NO: 224). It is derived from the nucleotide sequence shown.

In another embodiment, the present invention provides an isolated PRO1328 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1328 polypeptide, which in one embodiment comprises a residue 1 of Figure 128 (SEQ ID NO: 225) or an amino acid sequence comprising about 20 to 257. There is. In another aspect, the invention features amino acid residue 1 of Figure 128 (SEQ ID NO: 225).
Or at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 80 to about 257. It relates to an isolated PRO1328 polypeptide which comprises an amino acid sequence having about 95% sequence identity. In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 80% positive when compared to the amino acid sequence of residue 1 or about 20 to 257 of Figure 128 (SEQ ID NO: 225). About 9
It relates to an isolated PRO1328 polypeptide which comprises an amino acid sequence with a score of 0% positive, most preferably at least about 95% positive. In a still further aspect, the invention comprises a single amino acid residue 1 of Fig128 (SEQ ID NO: 225) or a sequence of about 20 to about 257, or a fragment thereof sufficient to bind an anti-PRO1328 antibody. Isolated PRO1328 polypeptide. Preferably, this PRO1328 fragment retains the qualitative biological activity of the native PRO1328 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
DNA molecule encoding the PRO1328 polypeptide having amino acid residue 1 of 28 (SEQ ID NO: 225) or a sequence of about 20 to about 257, or D of (b) (a)
Hybridization with the complement of the NA molecule under stringent conditions allows the test DNA molecule to
at least about 80% sequence identity to a) or (b), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity,
Most preferably, (ii) culturing a host cell containing a test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) culturing the polypeptide from the cell culture medium, provided that it has at least about 95% sequence identity. A polypeptide produced by recovering is provided.

65. PRO1325 In the present application, a cDNA clone (DNA66659-1593), which was named "PRO1325" and which encodes a novel transmembrane polypeptide, was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1325 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1325 polypeptide having a sequence from about 1 or about 19 to about 832 amino acid residues of Figure 130 (SEQ ID NO: 227), or (b) For the complement of the DNA molecule of (a),
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. . In another aspect, the invention provides a DNA that hybridizes to the complement of the nucleic acid from about nucleotide 51 or about 105 to about 2546 of Figure 129 (SEQ ID NO: 226).
To an isolated nucleic acid molecule encoding a PRO1325 polypeptide comprising
Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA66659-1593) of ATCC Deposit No. 203269, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203269 (DNA66659-1593). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence with amino acid residue 1 of Fig130 (SEQ ID NO: 227) or the sequence from about 19 to about 832. DNA comprising a polypeptide having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or complement of a DNA molecule of (b) (a). To an isolated nucleic acid molecule consisting of In a further aspect, the invention provides a test DNA molecule comprising: (a) a PRO having the amino acid residue 1 of Fig130 (SEQ ID NO: 227) or a sequence from about 19 to about 832.
1325 polypeptide-encoding DNA molecule, or (b) hybridized with the complement of the DNA molecule of (a) under stringent conditions, whereby the DNA molecule (a) or (b)
) To at least about 80% sequence identity, preferably at least about 85%
At least about 100 nucleotides prepared by isolating a test DNA molecule having sequence identity of, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Having an isolated nucleic acid molecule. In a particular aspect, the invention encodes a PRO1325 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and solubilizing, ie transmembrane domain deletion or inactivating variants thereof. An isolated nucleic acid molecule containing DNA is provided or is complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 18 of Figure 130 (SEQ ID NO: 227). The transmembrane domain is PRO1
Approximately 29 amino acid positions of the 325 amino acid sequence (Fig130, SEQ ID NO: 227)
2 to amino acid position 317, amino acid position 451 to amino acid position 470
, From amino acid position 501 to amino acid position 520, from amino acid position 607 to amino acid position 627, and from amino acid position 751 to amino acid position 770.

In another aspect, the invention features (a) at least about 80% positive, preferably at least about 80% positive when compared to the amino acid sequence of residue 1 or about 19 to about 832 of Figure 130 (SEQ ID NO: 227). An isolated DNA molecule encoding a polypeptide having a score of 85% positive, more preferably at least about 90% positive, most preferably at least about 95% positive, or (b) (a) the complement of the DNA molecule. Nucleic acid molecule. Another embodiment is a PR that finds use as a hybridization probe.
It relates to fragments of the O1325 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides in length, preferably about 20 to about 60 nucleotides in length, more preferably about 20 to about 50 nucleotides in length, most preferably about 20 to about 40 nucleotides in length, as shown in Figure 129 (SEQ ID NO: 226). It is derived from the nucleotide sequence shown. In another embodiment, the invention provides an isolated PRO1325 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1325 polypeptide, which in one embodiment comprises an amino acid sequence comprising residue 1 of Figure 130 (SEQ ID NO: 227) or about 19-832. There is. In another aspect, the invention features amino acid residue 1 of Figure 130 (SEQ ID NO: 227).
Or at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 80% sequence identity to the sequence contained in about 19 to about 832. It relates to an isolated PRO1325 polypeptide comprising an amino acid sequence having about 95% sequence identity. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least at least about 80% positive when compared to the amino acid sequence of residue 1 or about 19-832 of Figure 130 (SEQ ID NO: 227). About 9
It relates to an isolated PRO1325 polypeptide which comprises an amino acid sequence with a score of 0% positive, most preferably at least about 95% positive. In a still further aspect, the invention comprises a single amino acid residue 1 of Fig130 (SEQ ID NO: 227) or a sequence from about 19 to about 832, or a fragment thereof sufficient to bind to an anti-PRO1325 antibody. Isolated PRO1325 polypeptide. Preferably, this PRO1325 fragment retains the qualitative biological activity of the native PRO1325 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
A DNA molecule encoding a PRO1325 polypeptide having the sequence of about 1 or about 19 to about 832 of amino acid residue 30 (SEQ ID NO: 227), or (b) the complement of the DNA molecule of (a) and stringent conditions. Hybridized below, the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably at least about 85% sequence identity, and more preferably at least about 90% sequence identity. If there is identity, most preferably at least about 95% sequence identity, (ii) the host cell containing the test DNA molecule is cultured under conditions suitable for expression of the polypeptide, and (iii) from the cell culture medium. Provided is a polypeptide produced by recovering the polypeptide.

66. PRO1340 In the present application, a cDNA clone (DNA66663) named "PRO1340", which encodes a novel polypeptide having homology to Ksp-cadherin.
-1598) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1340 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1340 polypeptide having amino acid residue 1 of Figure 132 (SEQ ID NO: 229) or a sequence from about 19 to about 807, or (b) ( at least about 80% sequence identity, preferably at least about 85% sequence identity to the complement of the DNA molecule of a),
More preferably it comprises DNA having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In another aspect, the invention features about residue 182 of Figure 131 (SEQ ID NO: 228).
PRO134 containing DNA that hybridizes to the complement of about 2548 nucleic acids from
0 polypeptide encoding an isolated nucleic acid molecule. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203268 (DNA66663-1598), or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203268 (DNA66663-1598). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence of about amino acid residues 19 to about 807 of Fig132 (SEQ ID NO: 229). , And more preferably at least about 90%
To a DNA encoding a polypeptide having sequence identity of, most preferably at least about 95% sequence identity, or (b) an isolated nucleic acid molecule comprising the complement of the DNA molecule of (a). In a further aspect, the invention provides a test DNA molecule, (a) PRO134 having a sequence from about 19 to about 807 amino acid residues of Figure 132 (SEQ ID NO: 229).
At least about 80 relative to (a) or (b) by hybridizing under stringent conditions with a DNA molecule encoding the 0 polypeptide, or (b) the complement of the DNA molecule of (a). Isolate a test DNA molecule if it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Produced by at least about 50 nucleotides, preferably at least about 100 nucleotides
It relates to an isolated nucleic acid molecule having nucleotides.

In a particular aspect, the invention provides a PRO1340 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and solubilizing, ie transmembrane domain deletion or inactivating variants thereof. Providing an isolated nucleic acid molecule comprising DNA encoding, or being complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 18 of Figure 132 (SEQ ID NO: 229). The transmembrane domain is PRO1
Approximately 76 amino acid positions of the 340 amino acid sequence (Fig132, SEQ ID NO: 229)
It has been tentatively identified as extending from 2 to about amino acid position 784. In another aspect, the invention features (a) about 1 residue of Figure 132 (SEQ ID NO: 229).
At least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to the amino acid sequence of 9 to about 807.
A DNA molecule encoding a polypeptide having a% positive score, most preferably at least about 95% positive score, or (b) an isolated nucleic acid molecule comprising the complement of the DNA molecule of (a). Another embodiment is a PR that finds use as a hybridization probe.
It relates to fragments of the O1340 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides in length, preferably about 20 to about 60 nucleotides in length, more preferably about 20 to about 50 nucleotides in length, most preferably about 20 to about 40 nucleotides in length, as shown in Figure 127 (SEQ ID NO: 224). It is derived from the nucleotide sequence shown.

In another embodiment, the invention provides an isolated PRO1340 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1340 polypeptide, which in one embodiment comprises about residue 19 of Fig132 (SEQ ID NO: 229).
To 807 are included. In another aspect, the invention features at least about 80% sequence identity to the sequence contained in amino acid residues about 19 to about 807 of Figure 132 (SEQ ID NO: 229),
Preferably at least about 85% sequence identity, more preferably at least about 90.
It relates to an isolated PRO1340 polypeptide comprising an amino acid sequence having a% sequence identity, most preferably at least about 95% sequence identity. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 19 to 807 of Figure 132 (SEQ ID NO: 229). It relates to an isolated PRO1340 polypeptide that comprises an amino acid sequence that scores positive, most preferably at least about 95% positive. In a still further aspect, the invention provides an isolated sequence comprising the sequence from amino acid residue 19 to about 807 of Figure 132 (SEQ ID NO: 229), or a fragment thereof sufficient to bind an anti-PRO1340 antibody. It relates to PRO1340 polypeptides.
Preferably, the PRO1340 fragment retains the qualitative biological activity of the native PRO1340 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
PR having a sequence of about 19 to about 807 amino acid residues of 32 (SEQ ID NO: 229)
A DNA molecule encoding the O1340 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule is at least about (Ii) testing if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. DNA
A host cell containing the molecule is cultured under conditions suitable for expression of the polypeptide, and (i
ii) Providing the polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1340 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1340 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1340 polypeptide by contacting the native PRO1340 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising a PRO1340 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

67. PRO1339 In the present application, designated as "PRO1339", is a cDNA clone (DNA66) encoding a novel polypeptide having sequence identity with carboxypepsyse.
669-1597) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1339 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1339 polypeptide having amino acid residue 1 of Figure 134 (SEQ ID NO: 234) or a sequence of about 17 to about 421, or (b) ( at least about 80% sequence identity, preferably at least about 85% sequence identity to the complement of the DNA molecule of a),
More preferably it comprises DNA having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In another aspect, the invention features a PRO1339 comprising a DNA that hybridizes to the complement of a nucleic acid from about 58 to about 1271 residues of Figure 133 (SEQ ID NO: 233).
It relates to an isolated nucleic acid molecule encoding a polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA66669-1597) of ATCC Deposit No. 203272, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203272 (DNA66669-1597). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of amino acid residues about 17 to about 421 of Figure 134 (SEQ ID NO: 234). , And more preferably at least about 90%
To a DNA encoding a polypeptide having sequence identity of, most preferably at least about 95% sequence identity, or (b) an isolated nucleic acid molecule comprising the complement of the DNA molecule of (a). In a further aspect, the invention provides a test DNA molecule, (a) PRO133 having a sequence from about 17 to about 421 amino acid residues of Figure 134 (SEQ ID NO: 234).
At least about 80% of the DNA molecule with respect to (a) or (b) by hybridizing under stringent conditions with a DNA molecule encoding 9 polypeptide or (b) the complement of the DNA molecule of (a). Isolating a test DNA molecule when it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule having at least about 50 nucleotides, preferably 100 nucleotides.

[0212] In another aspect, the invention features (a) about 1 residue of Figure 134 (SEQ ID NO: 234).
At least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to the amino acid sequence of 7 to about 421.
A DNA molecule encoding a polypeptide having a% positive score, most preferably at least about 95% positive score, or (b) an isolated nucleic acid molecule comprising the complement of the DNA molecule of (a). Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1339 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long. In another embodiment, the invention provides an isolated PRO1339 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1339 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 17 to 421 of Figure 134 (SEQ ID NO: 234). In another aspect, the invention features amino acid residue 1 of Figure 134 (SEQ ID NO: 234).
7 to about 421, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90%.
To a isolated PRO1339 polypeptide comprising an amino acid sequence having sequence identity of, most preferably at least about 95% sequence identity. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 17 to 421 of Figure 134 (SEQ ID NO: 234). It relates to an isolated PRO1339 polypeptide comprising an amino acid sequence with a positive, most preferably at least about 95% positive score. In a still further aspect, the invention provides an isolated sequence comprising amino acid residues 17 to about 421 of Figure 134 (SEQ ID NO: 234), or a fragment thereof sufficient to bind an anti-PRO1339 antibody. It relates to the PRO1339 polypeptide.
Preferably, this PRO1339 fragment retains the qualitative biological activity of the native PRO1339 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
PR having a sequence of about 17 to about 421 amino acid residues of No. 34 (SEQ ID NO: 234)
A DNA molecule encoding the O1339 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule is at least about (Ii) testing if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. DNA
A host cell containing the molecule is cultured under conditions suitable for expression of the polypeptide, and (i
ii) Providing the polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1339 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1339 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1339 polypeptide by contacting the native PRO1339 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In yet a further embodiment, the invention relates to a composition comprising the PRO1339 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

68. PRO1337 In the present application, a cDNA clone (DNA66672-1586), which is named "PRO1337" and which encodes a novel transmembrane polypeptide, was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1337 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule that encodes a PRO1337 polypeptide having the sequence of amino acid residues about 1 or about 21 to about 417 of Figure 136 (SEQ ID NO: 236), or (b). For the complement of the DNA molecule of (a),
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. . In another aspect, the invention features about residue 120 of Figure 135 (SEQ ID NO: 235).
133 containing DNA that hybridizes to the complement of about 1310 nucleic acids from
It relates to an isolated nucleic acid molecule encoding a 7 polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA66672-1586) of ATCC Deposit No. 203265, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203265 (DNA66672-1586).

In yet a further aspect, the invention features (a) at least about 80% sequence identity with amino acid residue 1 of Figure 136 (SEQ ID NO: 236) or the sequence from about 21 to about 417, preferably at least about 85%. DNA encoding a polypeptide having a% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity, or the complement of the DNA molecule of (b) (a). It relates to an isolated nucleic acid molecule comprising the body. In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO133 having a sequence from about amino acid residue 21 to about 417 of Figure 136 (SEQ ID NO: 236).
Hybridizing with a DNA molecule encoding a 7 polypeptide or (b) the complement of the DNA molecule of (a) under stringent conditions, wherein the DNA molecule has at least about 80 relative to (a) or (b). Isolate a test DNA molecule if it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule having at least about 50 nucleotides, preferably about 100 nucleotides. In a particular aspect, the invention encodes a PRO1337 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and solubilized, ie transmembrane domain deleted or inactivated variants thereof. An isolated nucleic acid molecule containing DNA is provided or is complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 20 of Figure 136 (SEQ ID NO: 236). In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residues 1 or 21 to about 417 of Figure 136 (SEQ ID NO: 236), preferably at least about 85% positive, More preferably it relates to a DNA molecule encoding a polypeptide which scores at least about 90% positive, most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising the complement of (b) (a) the DNA molecule. . Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1337 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides in length, preferably about 20 to about 60 nucleotides in length, more preferably about 20 to about 50 nucleotides in length, most preferably about 20 to about 40 nucleotides in length, as shown in Figure 127 (SEQ ID NO: 224). It is derived from the nucleotide sequence shown. In another embodiment, the invention provides an isolated PRO1337 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1337 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 1 or 21 to 417 of Figure 136 (SEQ ID NO: 236). . In another aspect, the invention features amino acid residue 2 of Figure 136 (SEQ ID NO: 236).
1 to about 417, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90%.
To a PRO1337 polypeptide which comprises an amino acid sequence having sequence identity of, most preferably at least about 95% sequence identity.

In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 80% positive when compared to the amino acid sequence of residues 21 to 417 of Figure 136 (SEQ ID NO: 236). It relates to an isolated PRO1337 polypeptide which comprises an amino acid sequence with a score of about 90% positive, most preferably at least about 95% positive. In a still further aspect, the invention provides an isolated sequence comprising the sequence of amino acid residues 21 to about 417 of Figure 136 (SEQ ID NO: 236), or a fragment thereof sufficient to bind an anti-PRO1337 antibody. It relates to PRO1337 polypeptides.
Preferably, this PRO1337 fragment retains the qualitative biological activity of the native PRO1337 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
PR having a sequence of about 21 to about 417 amino acid residues of SEQ ID NO: 36 (SEQ ID NO: 236)
A DNA molecule encoding the O1337 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule is at least about about the same as (a) or (b). (Ii) test if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. DNA
A host cell containing the molecule is cultured under conditions suitable for expression of the polypeptide, and (i
ii) Providing the polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1337 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1337 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1337 polypeptide by contacting the native PRO1337 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In yet a further embodiment, the invention relates to a composition comprising a PRO1337 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

69. PRO1342 In this application, a cDNA clone (DNA66674-1599) has been identified, which has been named "PRO1342" and which encodes a novel transmembrane polypeptide. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1342 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1342 polypeptide having amino acid residue 1 of Figure 138 (SEQ ID NO: 243) or a sequence of about 21 to about 596, or (b) ( at least about 80% sequence identity, preferably at least about 85% sequence identity to the complement of the DNA molecule of a),
More preferably it comprises DNA having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In another aspect, the invention features about residue 299 of Figure 137 (SEQ ID NO: 242).
To PRO20 containing DNA that hybridizes to the complement of about 2026 nucleic acids from
It relates to an isolated nucleic acid molecule encoding a 2 polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203281 (DNA66674-1599), or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203281 (DNA66674-1599). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about amino acid residue 21 to about 596 of Figure 138 (SEQ ID NO: 243). , And more preferably at least about 90%
To a DNA encoding a polypeptide having sequence identity of, most preferably at least about 95% sequence identity, or (b) an isolated nucleic acid molecule comprising the complement of the DNA molecule of (a). In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO134 having a sequence from about 21 to about 596 amino acid residues of Figure 138 (SEQ ID NO: 243).
At least about 80% of the DNA molecule with respect to (a) or (b) by hybridizing under stringent conditions with a DNA molecule encoding the 2 polypeptide or (b) the complement of the DNA molecule of (a). Isolating a test DNA molecule when it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Produced by at least about 50 nucleotides, preferably at least about 100 nucleotides
It relates to an isolated nucleic acid molecule having nucleotides.

In a particular aspect, the invention provides a PRO1342 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and its solubilization (ie transmembrane domain deletion or inactivation). An isolated nucleic acid molecule comprising DNA encoding a variant is provided, or is complementary to such an encoding nucleic acid molecule.
The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 20 of Figure 138 (SEQ ID NO: 243). The transmembrane domain is PR
It has been tentatively identified as extending from about amino acid position 510 to about amino acid position 532 of the O1342 amino acid sequence (Fig138, SEQ ID NO: 243). In another aspect, the invention provides (a) residue 21 of Figure 138 (SEQ ID NO: 243).
To at least about 80% positive when compared to about 596 amino acid sequences,
Preferably at least about 85% positive, more preferably at least about 90%
A DNA molecule encoding a polypeptide positive, most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising (b) (a) the complement of the DNA molecule. Another embodiment is a PR that finds use as a hybridization probe.
It relates to a fragment of the O1342 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long. In another embodiment, the invention provides an isolated PRO1342 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1342 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 21 to 596 of Figure 138 (SEQ ID NO: 243). In another aspect, the invention features amino acid residue 2 of Figure 138 (SEQ ID NO: 243).
1 to about 596, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90%.
To a isolated PRO1342 polypeptide comprising an amino acid sequence having sequence identity of, most preferably at least about 95% sequence identity. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 21 to 596 of Figure 138 (SEQ ID NO: 243). It relates to an isolated PRO1342 polypeptide which comprises an amino acid sequence that scores positive, most preferably at least about 95% positive. In yet a further aspect, the invention provides an isolated sequence comprising amino acid residues 21 to about 596 of Figure 138 (SEQ ID NO: 243), or a fragment thereof sufficient to bind an anti-PRO1342 antibody. It relates to the PRO1342 polypeptide.
Preferably, the PRO1342 fragment retains the qualitative biological activity of the native PRO1342 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
PR having a sequence of about 21 to about 596 amino acid residues of 38 (SEQ ID NO: 243)
A DNA molecule encoding the O1342 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule is at least about (Ii) test if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. DNA
A host cell containing the molecule is cultured under conditions suitable for expression of the polypeptide, and (i
ii) Providing the polypeptide produced by recovering the polypeptide from the cell culture medium.

70. PRO1343 In the present application, a cDNA clone (DNA66675-1587), which was named "PRO1343" and which encodes a novel transmembrane polypeptide, was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1343 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1343 polypeptide having the sequence from about 1 or about 26 to about 247 amino acid residues of Figure 140 (SEQ ID NO: 248), or (b) For the complement of the DNA molecule of (a),
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. . In another aspect, the invention relates to a PR that comprises a DNA that hybridizes to the complement of a nucleic acid from residues about 71 or about 146 to about 811 of Figure 139 (SEQ ID NO: 247).
It relates to an isolated nucleic acid molecule encoding an O1343 polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA66675-1587) of ATCC Deposit No. 203282, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203282 (DNA66675-1587). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence with amino acid residue 1 of Fig140 (SEQ ID NO: 248) or the sequence from about 26 to about 247. DNA comprising a polypeptide having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or complement of a DNA molecule of (b) (a). To an isolated nucleic acid molecule consisting of

In a further aspect, the invention provides a test DNA molecule comprising (a) a PRO having the amino acid residue 1 of Fig140 (SEQ ID NO: 248) or the sequence from about 26 to about 247.
Hybridized with a DNA molecule encoding the 1343 polypeptide or (b) the complement of the DNA molecule of (a) under stringent conditions, whereby the DNA molecule (a) or (b)
) To at least about 80% sequence identity, preferably at least about 85%
At least about 100 nucleotides prepared by isolating a test DNA molecule having sequence identity of, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Having an isolated nucleic acid molecule. In a particular aspect, the invention encodes a PRO1343 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and solubilizing, ie transmembrane domain deletion or inactivating variants thereof. An isolated nucleic acid molecule containing DNA is provided or is complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 25 of Figure 140 (SEQ ID NO: 248). In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residue 1 or about 26 to about 247 of Fig140 (SEQ ID NO: 248). , More preferably at least about 90% positive, most preferably at least about 95% positive, a DNA molecule encoding a polypeptide, or an isolated nucleic acid molecule comprising the complement of (b) (a) a DNA molecule. Regarding Another embodiment is a PR that finds use as a hybridization probe.
It relates to a fragment of the O1343 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides in length, preferably about 20 to about 60 nucleotides in length, more preferably about 20 to about 50 nucleotides in length, most preferably about 20 to about 40 nucleotides in length, as shown in Figure 139 (SEQ ID NO: 247). It is derived from the nucleotide sequence shown.

In another embodiment, the invention provides an isolated PRO1343 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1343 polypeptide, which in one embodiment comprises an amino acid sequence comprising residue 1 of Figure 140 (SEQ ID NO: 248) or about 26 to 247. There is. In another aspect, the invention features amino acid residue 1 of Figure 140 (SEQ ID NO: 248).
Or at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 80% sequence identity to the sequence contained in about 26 to about 247. It relates to an isolated PRO1343 polypeptide comprising an amino acid sequence having about 95% sequence identity. In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, and more preferably at least about 80% positive when compared to the amino acid sequence of residue 1 or about 26 to 247 of Figure 140 (SEQ ID NO: 248). About 9
It relates to an isolated PRO1343 polypeptide which comprises an amino acid sequence with a score of 0% positive, most preferably at least about 95% positive. In a still further aspect, the invention comprises a single amino acid residue 1 of Fig140 (SEQ ID NO: 248) or a sequence of about 26 to about 247, or a fragment thereof sufficient to bind an anti-PRO1343 antibody. Related to the released PRO1343 polypeptide. Preferably, this PRO1343 fragment retains the qualitative biological activity of the native PRO1343 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
40 (SEQ ID NO: 248), a DNA molecule encoding a PRO1343 polypeptide having the sequence of about 1 or about 26 to about 247 of amino acid residues, or (b) the complement of the DNA molecule of (a) and stringent conditions. Hybridized below, the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity. If there is identity, most preferably at least about 95% sequence identity, (ii) the host cell containing the test DNA molecule is cultured under conditions suitable for expression of the polypeptide, and (iii) from the cell culture medium. Provided is a polypeptide produced by recovering the polypeptide.

71. PRO1480 A cDNA clone (DNA67962-16) named "PRO1480" in the present application and encoding a novel polypeptide having homology to semaphorin C.
49) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1480 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1480 polypeptide having a sequence from about 1 to about 837 amino acid residues of Figure 142 (SEQ ID NO: 253), or (b) (a). Of at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity to the complement of a DNA molecule of It comprises DNA having sequence identity. In another aspect, the invention features residues about 241 of Figure 141 (SEQ ID NO: 252).
To PRO275 containing DNA that hybridizes to the complement of about 2751 nucleic acids from
0 polypeptide encoding an isolated nucleic acid molecule. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA67962-1649) of ATCC Deposit No. 203291, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203291 (DNA67962-1649). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of about 1 to about 837 amino acid residues of Figure 142 (SEQ ID NO: 253). , More preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a DNA encoding a polypeptide, or (b) a complement of a DNA molecule of (a). It relates to an isolated nucleic acid molecule. In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO1480 having a sequence from about 1 to about 837 amino acid residues of Figure 142 (SEQ ID NO: 253).
Hybridizing with a DNA molecule encoding a polypeptide, or (b) the complement of a DNA molecule of (a) under stringent conditions, wherein the DNA molecule is at least about 80% relative to (a) or (b) A test DNA molecule is isolated if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. And an isolated nucleic acid molecule having at least about 50 nucleotides, preferably at least about 100 nucleotides.

In a particular embodiment, the invention provides a PRO1480 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and its solubilization (ie transmembrane domain deletion or inactivation). An isolated nucleic acid molecule comprising DNA encoding a variant is provided, or is complementary to such an encoding nucleic acid molecule.
The signal peptide is amino acid position 23 to amino acid position 46 (type I) and amino acid position 718 to amino acid position 7 of FIG. 142 (SEQ ID NO: 253).
It has been tentatively identified as extending to 38. In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residues 1 to about 837 of Figure 142 (SEQ ID NO: 253), more preferably at least about 85% positive. Refers to a DNA molecule encoding a polypeptide that scores at least about 90% positive, and most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising the complement of (b) (a) DNA molecule. Another embodiment is a PR that finds use as a hybridization probe.
O1480 polypeptide coding sequence fragments. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides in length, preferably about 20 to about 60 nucleotides in length, more preferably about 20 to about 50 nucleotides in length, most preferably about 20 to about 40 nucleotides in length, as shown in Figure 127 (SEQ ID NO: 252). It is derived from the nucleotide sequence shown. In another embodiment, the invention provides an isolated PRO1480 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1480 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 1-837 of Figure 142 (SEQ ID NO: 253). In another aspect, the invention features amino acid residue 1 of Figure 142 (SEQ ID NO: 253).
To about 837, to at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%. To an isolated PRO1480 polypeptide comprising an amino acid sequence having the sequence identity of In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 1-837 of Figure 142 (SEQ ID NO: 253). Relates to an isolated PRO1480 polypeptide comprising an amino acid sequence with a positive, most preferably at least about 95% positive score. In a still further aspect, the invention provides an isolated sequence comprising the sequence of amino acid residues 1 to about 837 of Figure 142 (SEQ ID NO: 253), or a fragment thereof sufficient to bind an anti-PRO1480 antibody. It relates to PRO1480 polypeptides. Preferably, the PRO1480 fragment retains the qualitative biological activity of the native PRO1480 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
PRO having a sequence of about 1 to about 837 amino acid residues of 42 (SEQ ID NO: 253)
A DNA molecule encoding a 1480 polypeptide, or (b) a complement of a DNA molecule of (a), is hybridized under stringent conditions such that the test DNA molecule is at least about 80% sequence identity, preferably at least about 8
(Ii) expressing a host cell containing a test DNA molecule into a polypeptide if it has 5% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Under conditions suitable for and (ii
i) providing a polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1480 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1480 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1480 polypeptide by contacting the native PRO1480 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising a PRO1480 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

72. PRO1487 In this application, a cDNA clone (DNA68836-1656) has been identified, designated "PRO1487" and encoding a novel transmembrane polypeptide. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1487 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1487 polypeptide having amino acid residue 1 of Figure 144 (SEQ ID NO: 260) or a sequence from about 24 to about 802, or (b) ( at least about 80% sequence identity, preferably at least about 85% sequence identity to the complement of the DNA molecule of a),
More preferably it comprises DNA having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In another aspect, the invention features about residue 5 of Figure 143A-B (SEQ ID NO: 259).
PRO1 containing DNA that hybridizes to the complement of 58 to about 2894 nucleic acids
It relates to an isolated nucleic acid molecule encoding a 487 polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA68836-1656) of ATCC Deposit No. 203455, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203455 (DNA68836-1656). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of about amino acid residues 24 to about 802 of Figure 144 (SEQ ID NO: 260). , And more preferably at least about 90%
To a DNA encoding a polypeptide having sequence identity of, most preferably at least about 95% sequence identity, or (b) an isolated nucleic acid molecule comprising the complement of the DNA molecule of (a). In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO148 having the sequence of about amino acid residues 24 to about 802 of Figure 144 (SEQ ID NO: 260).
Hybridizing with a DNA molecule encoding a 7 polypeptide or (b) the complement of the DNA molecule of (a) under stringent conditions such that the DNA molecule has at least about 80 relative to (a) or (b). Isolating a test DNA molecule when it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Produced by at least about 50 nucleotides, preferably at least about 100 nucleotides
It relates to an isolated nucleic acid molecule having nucleotides.

In a particular aspect, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1487 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, or Is complementary to such an encoded nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 23 of Figure 144 (SEQ ID NO: 260). In another aspect, the invention provides (a) residue 24 of Figure 144 (SEQ ID NO: 260).
To at least about 80% positive when compared to about 802 amino acid sequences,
Preferably at least about 85% positive, more preferably at least about 90%
A DNA molecule encoding a polypeptide positive, most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising (b) (a) the complement of the DNA molecule. Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1487 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long. In another embodiment, the invention provides an isolated PRO1487 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1487 polypeptide, which in one embodiment, comprises an amino acid sequence comprising residues 24-802 of Figure 144 (SEQ ID NO: 260). In another aspect, the invention features amino acid residue 2 of Figure 144 (SEQ ID NO: 260).
4 to about 802, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90%.
To an isolated PRO1487 polypeptide comprising an amino acid sequence having sequence identity of, most preferably at least about 95% sequence identity.

In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least at least about 80% positive when compared to the amino acid sequence of residues 24-802 of Figure 144 (SEQ ID NO: 260). It relates to an isolated PRO1487 polypeptide which comprises an amino acid sequence with a score of about 90% positive, most preferably at least about 95% positive. In yet a further aspect, the invention provides an isolated sequence comprising amino acid residue 24 to about 802 of Figure 144 (SEQ ID NO: 260), or a fragment thereof sufficient to bind an anti-PRO1487 antibody. It relates to PRO1487 polypeptides.
Preferably, the PRO1487 fragment retains the qualitative biological activity of the native PRO1487 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
PR having a sequence of about 24 to about 802 amino acid residues of 44 (SEQ ID NO: 260)
A DNA molecule encoding the O1487 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a), under stringent conditions, wherein the test DNA molecule is at least about relative to (a) or (b). (Ii) testing if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. DNA
A host cell containing the molecule is cultured under conditions suitable for expression of the polypeptide, and (i
ii) Providing the polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1487 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1487 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1487 polypeptide by contacting the native PRO1487 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a yet further embodiment, the invention relates to a composition comprising a PRO1487 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

73. PRO1418 In this application, a cDNA clone (DNA68864-1629) has been identified, designated "PRO1418" and encoding a novel secreted polypeptide. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1418 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1418 polypeptide having the sequence from about 1 or about 20 to about 350 amino acid residues of Figure 146 (SEQ ID NO: 265), or (b) For the complement of the DNA molecule of (a),
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. . In another aspect, the invention features about residue 195 of Figure 145 (SEQ ID NO: 264).
To PRO141 containing DNA that hybridizes to the complement of about 1187 nucleic acids from
8 isolated nucleic acid molecule encoding a polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203276 (DNA68864-1629), or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203276 (DNA68864-1629). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 20 to about 350 amino acid residues of Figure 146 (SEQ ID NO: 265). , And more preferably at least about 90%
To a DNA encoding a polypeptide having sequence identity of, most preferably at least about 95% sequence identity, or (b) an isolated nucleic acid molecule comprising the complement of the DNA molecule of (a). In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO141 having a sequence of about 20 to about 350 amino acid residues of Figure 146 (SEQ ID NO: 265).
At least about 80 relative to (a) or (b), wherein said DNA molecule hybridizes with a DNA molecule encoding 8 polypeptide or (b) the complement of the DNA molecule of (a) under stringent conditions. Isolating a test DNA molecule when it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Produced by at least about 50 nucleotides, preferably at least about 100 nucleotides
It relates to an isolated nucleic acid molecule having nucleotides.

In another aspect, the invention features (a) residue 20 of Figure 146 (SEQ ID NO: 265).
To at least about 80% positive when compared to about 350 amino acid sequences,
Preferably at least about 85% positive, more preferably at least about 90%
A DNA molecule encoding a polypeptide positive, most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising (b) (a) the complement of the DNA molecule. Another embodiment is a PR that finds use as a hybridization probe.
O1418 polypeptide coding sequence fragments. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long, as shown in Figure 145 (SEQ ID NO: 264). It is derived from the nucleotide sequence shown. In another embodiment, the invention provides an isolated PRO1418 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1418 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 20 to 350 of Figure 146 (SEQ ID NO: 265). In another aspect, the invention features amino acid residue 2 of Figure 146 (SEQ ID NO: 265).
At least about 80% sequence identity, preferably at least about 85% sequence identity, and more preferably at least about 90%, relative to the sequence comprised from 0 to about 350.
To a PRO1418 polypeptide comprising an amino acid sequence having sequence identity of, most preferably at least about 95% sequence identity. In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 20 to 350 of Figure 146 (SEQ ID NO: 265). It relates to an isolated PRO1418 polypeptide which comprises an amino acid sequence that scores positive, most preferably at least about 95% positive. In yet a further aspect, the invention provides an isolated sequence comprising the sequence from amino acid residue 20 to about 350 of Figure 146 (SEQ ID NO: 265), or a fragment thereof sufficient to bind an anti-PRO1418 antibody. It relates to PRO1418 polypeptides.
Preferably, the PRO1418 fragment retains the qualitative biological activity of the native PRO1418 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
A DNA molecule encoding a PRO1418 polypeptide having amino acid residue 1 of 46 (SEQ ID NO: 265) or a sequence of about 20 to about 350, or D of (b) (a)
Hybridization with the complement of the NA molecule under stringent conditions allows the test DNA molecule to
at least about 80% sequence identity to a) or (b), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity,
Most preferably, (ii) culturing a host cell containing a test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) culturing the polypeptide from the cell culture medium, provided that it has at least about 95% sequence identity. A polypeptide produced by recovering is provided. In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1418 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1418 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1418 polypeptide by contacting the native PRO1418 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising a PRO1418 polypeptide, or agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

74. PRO1472 Named "PRO1472" in the present application, butyrophilin
cDNA clone (D) encoding a novel polypeptide having sequence identity with n).
NA68866-1644) has been identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1472 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule that encodes a PRO1472 polypeptide having the sequence from about 1 or about 18 to about 466 amino acid residues of Figure 148 (SEQ ID NO: 267), or (b). For the complement of the DNA molecule of (a),
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. . In another aspect, the invention features about residue 185 of Figure 147 (SEQ ID NO: 266).
To PRO153 containing DNA hybridizing to the complement of about 1531 nucleic acids from
It relates to an isolated nucleic acid molecule encoding a 2 polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA68866-1644) of ATCC Deposit No. 203283, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203283 (DNA68866-1644). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of about amino acid residues 18 to about 466 of Figure 148 (SEQ ID NO: 267). , And more preferably at least about 90%
To a DNA encoding a polypeptide having sequence identity of, most preferably at least about 95% sequence identity, or (b) an isolated nucleic acid molecule comprising the complement of the DNA molecule of (a). In a further aspect, the invention provides a test DNA molecule, (a) PRO147 having a sequence from about 18 to about 466 amino acid residues of Figure 148 (SEQ ID NO: 267).
At least about 80% of the DNA molecule with respect to (a) or (b) by hybridizing under stringent conditions with a DNA molecule encoding the 2 polypeptide or (b) the complement of the DNA molecule of (a). Isolating a test DNA molecule when it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Produced by at least about 50 nucleotides, preferably at least about 100 nucleotides
It relates to an isolated nucleic acid molecule having nucleotides.

In a particular aspect, the invention provides PRO1472 polypeptides with or without an N-terminal signal sequence and / or an initiation methionine, and solubilizing, ie transmembrane domain deletion or inactivating variants thereof. Providing an isolated nucleic acid molecule comprising DNA encoding, or being complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid positions 1-17 of Figure 148 (SEQ ID NO: 267). The transmembrane domain is PR
It has been tentatively identified as extending from about amino acid position 131 to about amino acid position 150 and from about amino acid position 235 to about amino acid position 259 of the O1472 amino acid sequence (FIG. 148, SEQ ID NO: 267). In another aspect, the invention provides (a) residue 18 of Figure 148 (SEQ ID NO: 267).
To at least about 80% positive when compared to the about 466 amino acid sequence,
Preferably at least about 85% positive, more preferably at least about 90%
A DNA molecule encoding a polypeptide positive, most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising (b) (a) the complement of the DNA molecule. Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1472 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.

In another embodiment, the invention provides an isolated PRO1472 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1472 polypeptide, which in one embodiment comprises the amino acid sequence comprising residues 18 to 466 of Figure 148 (SEQ ID NO: 267). In another aspect, the invention features amino acid residue 1 of Figure 148 (SEQ ID NO: 267).
8 to about 466, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90%.
To an isolated PRO1472 polypeptide comprising an amino acid sequence having sequence identity of, most preferably at least about 95% sequence identity. In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 18 to 466 of Figure 148 (SEQ ID NO: 267). Relates to an isolated PRO1472 polypeptide comprising an amino acid sequence with a positive, most preferably at least about 95% positive score. In a still further aspect, the invention provides an isolated sequence comprising the sequence of amino acid residues 18 to about 466 of Figure 148 (SEQ ID NO: 267), or a fragment thereof sufficient to bind an anti-PRO1472 antibody. It relates to PRO1472 polypeptides.
Preferably, the PRO1472 fragment retains the qualitative biological activity of the native PRO1472 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
PR having a sequence of about 18 to about 466 amino acid residues of 48 (SEQ ID NO: 267)
A DNA molecule encoding the O1472 polypeptide, or (b) a complement of the DNA molecule of (a), is hybridized under stringent conditions such that the test DNA molecule is at least about (Ii) testing if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. DNA
A host cell containing the molecule is cultured under conditions suitable for expression of the polypeptide, and (i
ii) Providing the polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1472 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1472 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1472 polypeptide by contacting the native PRO1472 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In yet a further embodiment, the invention relates to a composition comprising the PRO1472 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

75. PRO1461 A cDNA clone (DNA688871) named “PRO1461” in the present application and encoding a novel polypeptide having homology with serine protease.
-1638) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1461 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1461 polypeptide having the sequence of amino acid residues from about 1 to about 423 of Figure 150 (SEQ ID NO: 269), or (b) (a). Of at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity to the complement of a DNA molecule of It comprises DNA having sequence identity. In another aspect, the invention features a PRO1461 that comprises a DNA that hybridizes to the complement of a nucleic acid from about 32 to about 1300 residues of Figure 149 (SEQ ID NO: 268).
It relates to an isolated nucleic acid molecule encoding a polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA68871-1638) of ATCC Deposit No. 203280, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203280 (DNA68871-1638). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of amino acid residues about 1 to about 423 of Figure 150 (SEQ ID NO: 269). , More preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a DNA encoding a polypeptide, or (b) a complement of a DNA molecule of (a). It relates to an isolated nucleic acid molecule. In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO1461 having a sequence from about amino acid residue 1 to about 423 of Fig150 (SEQ ID NO: 269).
Hybridizing with a DNA molecule encoding a polypeptide, or (b) the complement of a DNA molecule of (a) under stringent conditions, wherein the DNA molecule is at least about 80% relative to (a) or (b) A test DNA molecule is isolated if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. And an isolated nucleic acid molecule having at least about 50 nucleotides, preferably at least about 100 nucleotides.

In a particular embodiment, the invention provides a PRO1461 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and its solubilization (ie transmembrane domain deletion or inactivation). An isolated nucleic acid molecule comprising DNA encoding a variant is provided, or is complementary to such an encoding nucleic acid molecule.
The type II transmembrane domain has been tentatively identified as extending from about amino acid position 21 to about amino acid position 40 of the PRO1461 amino acid sequence (Fig150, SEQ ID NO: 269). In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residues 1 to about 423 of Figure 150 (SEQ ID NO: 269), more preferably at least about 85% positive. Refers to a DNA molecule encoding a polypeptide that scores at least about 90% positive, and most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising the complement of (b) (a) DNA molecule. Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1461 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides in length, preferably about 20 to about 60 nucleotides in length, more preferably about 20 to about 50 nucleotides in length, most preferably about 20 to about 40 nucleotides in length, as shown in Figure 149 (SEQ ID NO: 268). It is derived from the nucleotide sequence shown. In another embodiment, the invention provides an isolated PRO1461 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1461 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 1 to 423 of Figure 150 (SEQ ID NO: 269). In another aspect, the invention features amino acid residue 1 of Figure 150 (SEQ ID NO: 269).
To about 423, to at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95%. To an isolated PRO1461 polypeptide comprising an amino acid sequence having the sequence identity of

In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 80% positive when compared to the amino acid sequence of residues 1 to 423 of Figure 150 (SEQ ID NO: 269). It relates to an isolated PRO1461 polypeptide which comprises an amino acid sequence with a score of about 90% positive, most preferably at least about 95% positive. In a still further aspect, the invention provides an isolated sequence comprising the sequence of amino acid residues 1 to about 423 of Figure 150 (SEQ ID NO: 269), or a fragment thereof sufficient to bind an anti-PRO1461 antibody. It relates to the PRO1461 polypeptide. Preferably, the PRO1461 fragment retains the qualitative biological activity of the native PRO1461 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
PRO having a sequence of about 1 to about 423 amino acid residues of 50 (SEQ ID NO: 269)
Hybridizing with a DNA molecule encoding the 1461 polypeptide, or (b) the complement of the DNA molecule of (a), under stringent conditions, wherein the test DNA molecule is at least about 80% sequence identity, preferably at least about 8
(Ii) expressing a host cell containing a test DNA molecule into a polypeptide if it has 5% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Under conditions suitable for and (ii
i) providing a polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1461 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1461 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1461 polypeptide by contacting the native PRO1461 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a yet further embodiment, the invention relates to a composition comprising a PRO1461 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

76. PRO1410 In this application, a cDNA clone (DNA68874-1622) has been identified, designated "PRO1410" and encoding a novel transmembrane polypeptide. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1410 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1410 polypeptide having the sequence from about 1 or about 21 to about 238 amino acid residues of Figure 152 (SEQ ID NO: 271), or (b) For the complement of the DNA molecule of (a),
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. . In another aspect, the invention provides a DNA that hybridizes to the complement of the nucleic acid of about nucleotide 152 or about 212 to about 865 of Figure 151 (SEQ ID NO: 270).
To an isolated nucleic acid molecule that encodes a PRO1410 polypeptide.
Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203277 (DNA68874-1622), or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203277 (DNA68874-1622). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence with amino acid residue 1 of Figure 152 (SEQ ID NO: 271) or the sequence from about 21 to about 238. DNA comprising a polypeptide having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or complement of a DNA molecule of (b) (a). To an isolated nucleic acid molecule consisting of In a further aspect, the invention provides a test DNA molecule comprising: (a) a PRO having amino acid residue 1 of Figure 152 (SEQ ID NO: 271) or a sequence from about 21 to about 238.
A DNA molecule encoding the 1410 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, wherein the DNA molecule (a) or (b)
) To at least about 80% sequence identity, preferably at least about 85%
At least about 100 nucleotides prepared by isolating a test DNA molecule having sequence identity of, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Having an isolated nucleic acid molecule. In a particular aspect, the invention encodes a PRO1410 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and solubilizing, ie transmembrane domain deletion or inactivation variants thereof. An isolated nucleic acid molecule containing DNA is provided or is complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 20 of Figure 152 (SEQ ID NO: 271). The transmembrane domain is PRO1
Approximately 19 amino acid positions in the 410 amino acid sequence (FIG. 152, SEQ ID NO: 271)
It has been tentatively identified as extending from 4 to about amino acid position 220. In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residue 1 or about 21 to about 238 of Figure 152 (SEQ ID NO: 271). , More preferably at least about 90% positive, most preferably at least about 95% positive, a DNA molecule encoding a polypeptide, or an isolated nucleic acid molecule comprising the complement of a DNA molecule of (b) (a). Regarding Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1410 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides in length, preferably about 20 to about 60 nucleotides in length, more preferably about 20 to about 50 nucleotides in length, most preferably about 20 to about 40 nucleotides in length and shown in Figure 151 (SEQ ID NO: 270). It is derived from the nucleotide sequence shown.

In another embodiment, the invention provides an isolated PRO1410 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1410 polypeptide, which in one embodiment comprises an amino acid sequence comprising residue 1 of Figure 152 (SEQ ID NO: 271) or about 21 to 238. There is. In another aspect, the invention features amino acid residue 1 of Figure 152 (SEQ ID NO: 271).
Or at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 80% sequence identity to the sequence contained in about 21 to about 238. It relates to an isolated PRO1410 polypeptide which comprises an amino acid sequence having about 95% sequence identity. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 80% positive when compared to the amino acid sequence of residue 1 or about 21 to 238 of Figure 152 (SEQ ID NO: 271). About 9
It relates to an isolated PRO1410 polypeptide comprising an amino acid sequence with a score of 0% positive, most preferably at least about 95% positive. In a still further aspect, the invention comprises a single amino acid residue 1 of Figure 152 (SEQ ID NO: 271) or a sequence of about 21 to about 238, or a fragment thereof sufficient to bind an anti-PRO1410 antibody. Isolated PRO1410 polypeptide. Preferably, the PRO1410 fragment retains the qualitative biological activity of the native PRO1410 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
A DNA molecule encoding a PRO1410 polypeptide having the sequence from about 1 or about 21 to about 238 of amino acid residue 52 (SEQ ID NO: 271), or (b) the complement of the DNA molecule of (a) and stringent conditions. Hybridized below, the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably at least about 85% sequence identity, and more preferably at least about 90% sequence identity. If there is identity, most preferably at least about 95% sequence identity, (ii) the host cell containing the test DNA molecule is cultured under conditions suitable for expression of the polypeptide, and (iii) from the cell culture medium. Provided is a polypeptide produced by recovering the polypeptide. In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1410 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1410 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1410 polypeptide by contacting the native PRO1410 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a yet further embodiment, the invention relates to a composition comprising a PRO1410 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

77. PRO1568 In the present application, a cDNA clone (DNA) which is named “PRO1568” and which encodes a novel polypeptide having sequence identity with tetraspans.
68880-1676) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1568 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1568 polypeptide having the sequence of about amino acid residue 1 or about 34 to about 305 of Figure 154 (SEQ ID NO: 273), or (b) For the complement of the DNA molecule of (a),
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. . In another aspect, the invention features about residue 307 of Figure 153 (SEQ ID NO: 272).
To PRO112 containing DNA hybridizing to the complement of about 1122 nucleic acids from
8 isolated nucleic acid molecule encoding a polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA68880-1676) of ATCC Deposit No. 203319, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203319 (DNA68880-1676). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of amino acid residues about 34 to about 305 of Figure 154 (SEQ ID NO: 273). , And more preferably at least about 90%
To a DNA encoding a polypeptide having sequence identity of, most preferably at least about 95% sequence identity, or (b) an isolated nucleic acid molecule comprising the complement of the DNA molecule of (a). In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO156 having the sequence from about amino acid residue 34 to about 305 of Figure 154 (SEQ ID NO: 273).
At least about 80 relative to (a) or (b), wherein said DNA molecule hybridizes with a DNA molecule encoding 8 polypeptide or (b) the complement of the DNA molecule of (a) under stringent conditions. Isolating a test DNA molecule when it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Produced by at least about 50 nucleotides, preferably at least about 100 nucleotides
It relates to an isolated nucleic acid molecule having nucleotides.

In a particular aspect, the invention provides a PRO1568 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and solubilizing or transmembrane domain deletion or inactivating variants thereof. Providing an isolated nucleic acid molecule comprising DNA encoding, or being complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 33 of Figure 154 (SEQ ID NO: 273). The transmembrane domain is PRO1
Approximate amino acid 1 of the 568 amino acid sequence (Fig154, SEQ ID NO: 273)
It has been tentatively identified as extending to 2-35, 57-86, 94-114 and 226-248. In another aspect, the invention provides (a) residue 34 of Figure 154 (SEQ ID NO: 273).
To at least about 80% positive when compared to about 305 amino acid sequences,
Preferably at least about 85% positive, more preferably at least about 90%
A DNA molecule encoding a polypeptide positive, most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising (b) (a) the complement of the DNA molecule. Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1568 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides in length, preferably about 20 to about 60 nucleotides in length, more preferably about 20 to about 50 nucleotides in length, most preferably about 20 to about 40 nucleotides in length, as shown in Figure 153 (SEQ ID NO: 272). It is derived from the nucleotide sequence shown. In another embodiment, the invention provides an isolated PRO1568 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1568 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 34 to 305 of Figure 154 (SEQ ID NO: 273).

In another aspect, the invention features amino acid residue 3 of Figure 154 (SEQ ID NO: 273).
4 to about 305, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90%.
Of a sequence identity of 1, most preferably at least about 95% sequence identity, to an isolated PRO1568 polypeptide. In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 34 to about 305 of Figure 154 (SEQ ID NO: 273). % PROPOSITIVE, most preferably at least about 95% positive score, with respect to an isolated PRO1568 polypeptide. In a still further aspect, the invention features an isolated PRO1568 comprising a sequence of amino acid residues 34 to 305 of Figure 154 (SEQ ID NO: 273), or a fragment thereof sufficient to bind an anti-PRO1568 antibody. Relates to polypeptides. Preferably, the PRO1568 fragment retains the qualitative biological activity of the native PRO1568 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
PR having a sequence of about 34 to about 305 amino acid residues of 54 (SEQ ID NO: 273)
A DNA molecule encoding an O1568 polypeptide or (b) a complement of the DNA molecule of (a) is hybridized under stringent conditions, and the test DNA molecule is at least about (Ii) testing if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. DNA
A host cell containing the molecule is cultured under conditions suitable for expression of the polypeptide, and (i
ii) Providing the polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1568 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1568 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1568 polypeptide by contacting the native PRO1568 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a yet further embodiment, the invention relates to a composition comprising a PRO1568 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

78. PRO1570 In the present application, a cDNA clone named "PRO1570" and encoding a novel polypeptide having a sequence identity with SP60 (DNA68885-16).
78) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1570 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1570 polypeptide having a sequence from about amino acid residue 1 to about 432 of Figure 156 (SEQ ID NO: 275), or (b) (a). Of at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity to the complement of a DNA molecule of It comprises DNA having sequence identity. In another aspect, the invention features about residue 210 of Figure 155 (SEQ ID NO: 274).
To PRO157 containing DNA hybridizing to the complement of about 1505 nucleic acids from
0 polypeptide encoding an isolated nucleic acid molecule. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA688885-1678) of ATCC Deposit No. 203311, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203331 (DNA68888-1678). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of amino acid residues about 1 to about 432 of Figure 156 (SEQ ID NO: 275). , More preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a DNA encoding a polypeptide, or (b) a complement of a DNA molecule of (a). It relates to an isolated nucleic acid molecule. In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO1570 having a sequence from about amino acid residue 1 to about 432 of Figure 156 (SEQ ID NO: 275).
Hybridizing with a DNA molecule encoding a polypeptide, or (b) the complement of a DNA molecule of (a) under stringent conditions, wherein the DNA molecule is at least about 80% relative to (a) or (b) A test DNA molecule is isolated if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. And an isolated nucleic acid molecule having at least about 50 nucleotides, preferably at least about 100 nucleotides. In a preferred embodiment, the probe provided herein is from the amino terminus of the peptide identified in Figure 1 and is defined as amino acids 1-199 of SEQ ID NO: 275. In a particular aspect, the invention provides a D encoding a PRO1570 polypeptide in secreted or solubilized form, ie in a transmembrane domain deletion or inactivation variant.
Provided is an isolated nucleic acid molecule that comprises NA.

In another aspect, the invention features (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residues 1 to 432 of Figure 156 (SEQ ID NO: 275). , More preferably at least about 90% positive, most preferably at least about 95% positive, a DNA molecule encoding a polypeptide, or an isolated nucleic acid molecule comprising the complement of (b) (a) a DNA molecule. Regarding Another embodiment is a PR that finds use as a hybridization probe.
It relates to fragments of the O1570 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides in length, preferably about 20 to about 60 nucleotides in length, more preferably about 20 to about 50 nucleotides in length, and most preferably about 20 to about 40 nucleotides in length, as shown in Figure 155 (SEQ ID NO: 274). It is derived from the nucleotide sequence shown. Preferably, the probe is from the amino terminus provided herein. In another embodiment, the invention provides an isolated PRO1570 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1570 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 1 to 432 of Figure 156 (SEQ ID NO: 275). In another aspect, the invention features amino acid residue 1 of Figure 156 (SEQ ID NO: 275).
To about 432, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95%. To an isolated PRO1570 polypeptide comprising an amino acid sequence having the sequence identity of In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 1 to 432 of Figure 156 (SEQ ID NO: 275). It relates to an isolated PRO1570 polypeptide, which comprises an amino acid sequence with a positive, most preferably at least about 95% positive score.

In a still further aspect, the invention comprises a sequence of amino acid residues 1 to about 432 of Figure 156 (SEQ ID NO: 275), or a fragment thereof sufficient to bind an anti-PRO1570 antibody. Isolated PRO1570 polypeptide. Preferably, this PRO1570 fragment retains the qualitative biological activity of the native PRO1570 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
PRO having a sequence of about 1 to about 432 amino acid residues of 56 (SEQ ID NO: 275)
1570 polypeptide-encoding DNA molecule, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule is at least about 80% sequence identity, preferably at least about 8
(Ii) expressing a host cell containing a test DNA molecule into a polypeptide if it has 5% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Under conditions suitable for and (ii
i) providing a polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1570 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1570 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1570 polypeptide by contacting the native PRO1570 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a yet further embodiment, the invention relates to a composition comprising a PRO1570 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

79. PRO1317 A cDNA clone (DNA71166-16), which is named "PRO1317" in the present application, and which encodes a novel polypeptide having homology to semaphorin B.
85) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1317 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1317 polypeptide having amino acid residue 1 of Figure 158 (SEQ ID NO: 277) or a sequence from about 31 to about 761, or (b) ( at least about 80% sequence identity, preferably at least about 85% sequence identity to the complement of the DNA molecule of a),
More preferably it comprises DNA having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In another aspect, the invention features about residue 195 of Figure 157 (SEQ ID NO: 276).
To PRO2 containing DNA that hybridizes to the complement of about 2387 nucleic acids from
It relates to an isolated nucleic acid molecule encoding a 7 polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule that encodes the same mature polypeptide encoded by the human protein cDNA (DNA71166-1685) of ATCC Deposit No. 203355, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203355 (DNA71166-1685). In a still further aspect, the invention features (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of amino acid residues about 31 to about 761 of Figure 158 (SEQ ID NO: 277). , And more preferably at least about 90%
To a DNA encoding a polypeptide having sequence identity of, most preferably at least about 95% sequence identity, or (b) an isolated nucleic acid molecule comprising the complement of the DNA molecule of (a). In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO131 having the sequence of about amino acid residues about 31 to about 761 of Figure 158 (SEQ ID NO: 277).
Hybridizing with a DNA molecule encoding a 7 polypeptide or (b) the complement of the DNA molecule of (a) under stringent conditions such that the DNA molecule has at least about 80 relative to (a) or (b). Isolating a test DNA molecule when it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Produced by at least about 50 nucleotides, preferably at least about 100 nucleotides
It relates to an isolated nucleic acid molecule having nucleotides. In a particular aspect, the invention provides PRO1317 polypeptides with or without an N-terminal signal sequence and / or an initiation methionine, and solubilizing (ie, transmembrane domain deletion or inactivation) variants thereof. An isolated nucleic acid molecule containing the encoding DNA is provided, or is complementary to such an encoding nucleic acid molecule.
The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 30 of Figure 158 (SEQ ID NO: 277). The transmembrane domain is PR
Approximate amino acids 13-31, 136-156, 222-247, 474-490, and 685 of the O1317 amino acid sequence (Figure 158, SEQ ID NO: 277).
Tentatively identified as extending to -704. In another aspect, the invention provides (a) residue 31 of Figure 158 (SEQ ID NO: 277).
To at least about 80% positive when compared to the about 761 amino acid sequence,
Preferably at least about 85% positive, more preferably at least about 90%
A DNA molecule encoding a polypeptide positive, most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising (b) (a) the complement of the DNA molecule.

Another embodiment of the PR finds use as a hybridization probe.
It relates to fragments of the O1317 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long. In another embodiment, the invention provides an isolated PRO1317 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1317 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 31 to 761 of Figure 158 (SEQ ID NO: 277). In another aspect, the invention features amino acid residue 3 of Figure 158 (SEQ ID NO: 277).
1 to about 761 to at least about 80% sequence identity, preferably at least about 85% sequence identity, and more preferably at least about 90% sequence identity.
Of sequence identity, most preferably at least about 95% sequence identity, to an isolated PRO1317 polypeptide. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 31 to 761 of Figure 158 (SEQ ID NO: 277). It relates to an isolated PRO1317 polypeptide comprising an amino acid sequence with a positive score, most preferably at least about 95% positive. In yet a further aspect, the invention provides an isolated sequence comprising the sequence of amino acid residues 31 to about 761 of Figure 158 (SEQ ID NO: 277), or a fragment thereof sufficient to bind an anti-PRO1317 antibody. It relates to PRO1317 polypeptides.
Preferably, the PRO1317 fragment retains the qualitative biological activity of the native PRO1317 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
PR having a sequence of about 31 to about 761 amino acid residues of 58 (SEQ ID NO: 277)
A DNA molecule encoding the O1317 polypeptide or (b) a complement of the DNA molecule of (a) is hybridized under stringent conditions, and the test DNA molecule is at least about (Ii) testing if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. DNA
A host cell containing the molecule is cultured under conditions suitable for expression of the polypeptide, and (i
ii) Providing the polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1317 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1317 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1317 polypeptide by contacting the native PRO1317 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In yet a further embodiment, the invention relates to a composition comprising a PRO1317 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

80. PRO1780 In the present application, a cDNA clone named "PRO1780" and encoding a novel polypeptide having homology with glucuronosyltransferase (D
NA71169-1709) has been identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1780 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule that encodes a PRO1780 polypeptide having amino acid residue 1 of Figure 160 (SEQ ID NO: 282) or a sequence of about 20 to about 523, or (b) ( at least about 80% sequence identity, preferably at least about 85% sequence identity to the complement of the DNA molecule of a),
More preferably it comprises DNA having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In another aspect, the invention features about residue 125 of Figure 159 (SEQ ID NO: 281).
PRO178 containing DNA hybridizing to the complement of about 1636 nucleic acids from
0 polypeptide encoding an isolated nucleic acid molecule. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA71169-1709) of ATCC Deposit No. 203467, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203467 (DNA71169-1709). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 20 to about 523 amino acid residues of Figure 160 (SEQ ID NO: 282). , And more preferably at least about 90%
To a DNA encoding a polypeptide having sequence identity of, most preferably at least about 95% sequence identity, or (b) an isolated nucleic acid molecule comprising the complement of the DNA molecule of (a).

In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO178 having a sequence from about 20 to about 523 amino acid residues of Figure 160 (SEQ ID NO: 282).
At least about 80 relative to (a) or (b) by hybridizing under stringent conditions with a DNA molecule encoding the 0 polypeptide, or (b) the complement of the DNA molecule of (a). Isolate a test DNA molecule if it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Produced by at least about 50 nucleotides, preferably at least about 100 nucleotides
It relates to an isolated nucleic acid molecule having nucleotides. In a particular aspect, the invention provides PRO1780 polypeptides with or without an N-terminal signal sequence and / or an initiation methionine, and solubilizing (ie, transmembrane domain deletion or inactivation) variants thereof. An isolated nucleic acid molecule containing the encoding DNA is provided, or is complementary to such an encoding nucleic acid molecule.
The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 19 of Figure 160 (SEQ ID NO: 282). The transmembrane domain is PR
It has been tentatively identified as extending from about amino acid position 483 to about amino acid position 504 of the O1780 amino acid sequence (Fig160, SEQ ID NO: 282). In another aspect, the invention provides (a) residue 20 of Figure 160 (SEQ ID NO: 282).
To at least about 80% positive when compared to the amino acid sequence of about 523,
Preferably at least about 85% positive, more preferably at least about 90%
A DNA molecule encoding a polypeptide positive, most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising (b) (a) the complement of the DNA molecule. Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1780 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long. In another embodiment, the invention provides an isolated PRO1780 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1780 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 20 to 523 of Figure 160 (SEQ ID NO: 282). In another aspect, the invention features amino acid residue 2 of Figure 160 (SEQ ID NO: 282).
0 to about 523, to at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90%.
To an isolated PRO1780 polypeptide comprising an amino acid sequence having sequence identity of, most preferably at least about 95% sequence identity.

In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, and more preferably at least about 80% positive when compared to the amino acid sequence of residues 20 to 523 of Figure 160 (SEQ ID NO: 282). It relates to an isolated PRO1780 polypeptide which comprises an amino acid sequence with a score of about 90% positive, most preferably at least about 95% positive. In a still further aspect, the invention provides an isolated sequence comprising the sequence of amino acid residues 20 to about 523 of Figure 160 (SEQ ID NO: 282), or a fragment thereof sufficient to bind an anti-PRO1780 antibody. It relates to PRO1780 polypeptides.
Preferably, this PRO1780 fragment retains the qualitative biological activity of the native PRO1780 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
60 (SEQ ID NO: 282) amino acid residue 1 or a DNA molecule encoding a PRO1780 polypeptide having a sequence of about 20 to about 523, or (b) (a) D
Hybridization with the complement of the NA molecule under stringent conditions allows the test DNA molecule to
at least about 80% sequence identity to a) or (b), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity,
Most preferably, (ii) culturing a host cell containing a test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) culturing the polypeptide from the cell culture medium, provided that it has at least about 95% sequence identity. A polypeptide produced by recovering is provided. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1780 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1780 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1780 polypeptide by contacting the native PRO1780 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In yet a further embodiment, the invention relates to a composition comprising a PRO1780 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

81. PRO1486 A cDNA clone (DNA71180-1) named "PRO1486" in the present application and encoding a novel polypeptide having sequence identity with cereverin.
655) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1486 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1486 polypeptide having the sequence of about amino acid residue 1 or about 33 to about 205 of Figure 162 (SEQ ID NO: 287), or (b) For the complement of the DNA molecule of (a),
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. . In another aspect, the invention features about residue 568 of Figure 161 (SEQ ID NO: 286).
PRO148 containing DNA hybridizing to the complement of about 1086 nucleic acids from
It relates to an isolated nucleic acid molecule encoding a 6 polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA71180-1655) of ATCC Deposit No. 203403, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203403 (DNA71180-1655). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of amino acid residues about 33 to about 205 of Figure 162 (SEQ ID NO: 287). , And more preferably at least about 90%
To a DNA encoding a polypeptide having sequence identity of, most preferably at least about 95% sequence identity, or (b) an isolated nucleic acid molecule comprising the complement of the DNA molecule of (a). In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO148 having a sequence from about amino acid residue 33 to about 205 of Figure 162 (SEQ ID NO: 287).
Hybridizing with a DNA molecule encoding the 6 polypeptide or (b) the complement of the DNA molecule of (a) under stringent conditions, wherein the DNA molecule has at least about 80 relative to (a) or (b). Isolating a test DNA molecule when it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Produced by at least about 50 nucleotides, preferably at least about 100 nucleotides
It relates to an isolated nucleic acid molecule having nucleotides.

In another aspect, the invention features (a) about 3 residues of Figure 162 (SEQ ID NO: 287).
At least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to the amino acid sequence of 3 to about 205.
A DNA molecule encoding a polypeptide having a% positive score, most preferably at least about 95% positive score, or (b) an isolated nucleic acid molecule comprising the complement of the DNA molecule of (a). Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1486 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides in length, preferably about 20 to about 60 nucleotides in length, more preferably about 20 to about 50 nucleotides in length, most preferably about 20 to about 40 nucleotides in length and shown in Figure 161 (SEQ ID NO: 286). It is derived from the nucleotide sequence shown. In another embodiment, the invention provides an isolated PRO1486 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1486 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 33 to 205 of Figure 162 (SEQ ID NO: 287). In another aspect, the invention features amino acid residue 3 of Figure 162 (SEQ ID NO: 287).
3 to about 205, with at least about 80% sequence identity, preferably at least about 85% sequence identity, and more preferably at least about 90%.
Of PRO1486 polypeptides comprising an amino acid sequence having sequence identity of, most preferably at least about 95% sequence identity. In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive as compared to the amino acid sequence of residues 33 to 205 of Figure 162 (SEQ ID NO: 287). Relates to an isolated PRO1486 polypeptide comprising an amino acid sequence with a positive, most preferably at least about 95% positive score. In a still further aspect, the invention provides an isolated sequence comprising the sequence of amino acid residues 33 to about 205 of Figure 162 (SEQ ID NO: 287), or a fragment thereof sufficient to bind an anti-PRO1486 antibody. It relates to the PRO1486 polypeptide.
Preferably, the PRO1486 fragment retains the qualitative biological activity of the native PRO1486 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
PR having a sequence of amino acid residues of about 62 (SEQ ID NO: 287) from about 33 to about 205
A DNA molecule encoding the O1486 polypeptide, or (b) a complement of the DNA molecule of (a), is hybridized under stringent conditions such that the test DNA molecule is at least about (Ii) test if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. DNA
A host cell containing the molecule is cultured under conditions suitable for expression of the polypeptide, and (i
ii) Providing the polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1486 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1486 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1486 polypeptide by contacting the native PRO1486 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising a PRO1486 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

82. PRO1433 In this application, a cDNA clone (DNA71184-1634) has been identified, designated "PRO1433" and encoding a novel transmembrane polypeptide. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1433 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1433 polypeptide having a sequence from about amino acid residue 1 to about 388 of Figure 164 (SEQ ID NO: 292), or (b) (a). At least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity to the complement of the DNA molecule of It comprises DNA having sequence identity. In another aspect, the invention provides a PR that comprises a DNA that hybridizes to the complement of the nucleic acid from about nucleotide 185 to about 1348 of Figure 163 (SEQ ID NO: 291).
It relates to an isolated nucleic acid molecule encoding an O1433 polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA71184-1634) of ATCC Deposit No. 203266, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203266 (DNA71184-1634).

In a still further aspect, the invention features (a) at least about 80% sequence identity, preferably at least about 85% sequence, with the sequence from amino acid residue 1 to about 388 of Fig164 (SEQ ID NO: 292). DNA comprising a polypeptide having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or complement of a DNA molecule of (b) (a). To an isolated nucleic acid molecule consisting of In a further aspect, the invention provides that a test DNA molecule is (a) a DNA molecule encoding a PRO1433 polypeptide having a sequence from amino acid residue 1 to about 388 of Fig164 (SEQ ID NO: 292), or (b) (a). ) DNA molecule complement,
Hybridized under stringent conditions, the DNA molecule has at least about 80% sequence identity to (a) or (b), preferably at least about 85% sequence identity, more preferably at least about 90%. Of a nucleic acid molecule having at least about 250 nucleotides prepared by isolating a test DNA molecule when having sequence identity of, most preferably at least about 95%. In a particular aspect, the invention encodes a PRO1433 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and solubilizing, ie transmembrane domain deletion or inactivating variants thereof. An isolated nucleic acid molecule containing DNA is provided, or is complementary to such an encoding nucleic acid molecule. The transmembrane domain has a PRO1433 amino acid sequence (FIG. 164, SEQ ID NO: 292).
) From about amino acid position 76 to about amino acid position 97. In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residues 1 to about 388 of Fig164 (SEQ ID NO: 292), more preferably at least about 85% positive. Refers to a DNA molecule encoding a polypeptide that scores at least about 90% positive, and most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising the complement of (b) (a) DNA molecule. Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1433 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides in length, preferably about 20 to about 60 nucleotides in length, more preferably about 20 to about 50 nucleotides in length, most preferably about 20 to about 40 nucleotides in length, as shown in Figure 163 (SEQ ID NO: 291). It is derived from the nucleotide sequence shown. In another embodiment, the invention provides an isolated PRO1433 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1433 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 1 to about 388 of Figure164 (SEQ ID NO: 292).

In another aspect, the invention features amino acid residue 1 of Figure 164 (SEQ ID NO: 292).
To about 388, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%. To an isolated PRO1433 polypeptide comprising an amino acid sequence having the sequence identity of In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 1 to about 388 of Figure 164 (SEQ ID NO: 292). It relates to an isolated PRO1433 polypeptide which comprises an amino acid sequence with a score of% positive, most preferably at least about 95% positive. In a still further aspect, the invention comprises an isolated sequence of amino acid residues 1 or 1 to about 388 of Figure 164 (SEQ ID NO: 292), or a fragment thereof sufficient to bind an anti-PRO1433 antibody. Related PRO1433 polypeptide. Preferably, the PRO1433 fragment retains the qualitative biological activity of the native PRO1433 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
PRO having a sequence of about 1 to about 388 amino acid residues of 64 (SEQ ID NO: 292)
A DNA molecule encoding a 1433 polypeptide or (b) a complement of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule is at least about 80% sequence identity, preferably at least about 8
(Ii) expressing a host cell containing a test DNA molecule into a polypeptide if it has 5% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Under conditions suitable for and (ii
i) providing a polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1433 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1433 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1433 polypeptide by contacting the native PRO1433 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising a PRO1433 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

83. PRO1490 In this application, designated as "PRO1490", is a cDNA clone (DNA71) having homology with a nucleic acid encoding a 1-acyl-sn-glycerol-3-phosphate acyltransferase protein, which encodes a novel polypeptide.
213-1659) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1490 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule that encodes a PRO1490 polypeptide having the sequence from about amino acid residue 1 or about 26 to about 368 of Figure 166 (SEQ ID NO: 297), or (b). For the complement of the DNA molecule of (a),
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. . In another aspect, the invention provides a DN that hybridizes to the complement of the nucleic acid from about nucleotide 272 or about 347 to about 1375 of Figure 165 (SEQ ID NO: 296).
An isolated nucleic acid molecule encoding a PRO1490 polypeptide comprising A. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA71213-1659) of ATCC Deposit No. 203401, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203401 (DNA71213-1659). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence with amino acid residue 1 of Figure 166 (SEQ ID NO: 297) or the sequence from about 26 to about 368. DNA comprising a polypeptide having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or complement of a DNA molecule of (b) (a). To an isolated nucleic acid molecule consisting of In a further aspect, the invention provides a test DNA molecule comprising (a) a PRO having amino acid residue 1 of Figure 166 (SEQ ID NO: 297) or a sequence from about 26 to about 368.
Hybridized under stringent conditions with a DNA molecule encoding a 1490 polypeptide, or (b) the complement of the DNA molecule of (a), wherein the DNA molecule (a) or (b)
) To at least about 80% sequence identity, preferably at least about 85%
At least about 258 nucleotides produced by isolating a test DNA molecule having sequence identity of, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Having an isolated nucleic acid molecule.

In a particular aspect, the invention provides a PRO1490 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and solubilizing or transmembrane domain deletion or inactivating variants thereof. Providing an isolated nucleic acid molecule comprising DNA encoding, or being complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 25 of Figure 166 (SEQ ID NO: 297). The transmembrane domain is PRO1
Approximately 30 amino acid positions of the 490 amino acid sequence (Fig166, SEQ ID NO: 297)
7 to about amino acid position 323, and amino acid position about 335 to amino acid position about 3
It has been tentatively identified as extending to 52. In another aspect, the invention features (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residue 1 or about 26 to about 368 of Figure 166 (SEQ ID NO: 297). , More preferably at least about 90% positive, most preferably at least about 95% positive, a DNA molecule encoding a polypeptide, or an isolated nucleic acid molecule comprising the complement of (b) (a) a DNA molecule. Regarding Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1490 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides in length, preferably about 20 to about 60 nucleotides in length, more preferably about 20 to about 50 nucleotides in length, most preferably about 20 to about 40 nucleotides in length and shown in Figure 165 (SEQ ID NO: 296). It is derived from the nucleotide sequence shown. In another embodiment, the invention provides an isolated PRO1490 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1490 polypeptide, which in one embodiment comprises an amino acid sequence comprising residue 1 of Figure 166 (SEQ ID NO: 297) or about 26 to 368. There is. In another aspect, the invention features amino acid residue 1 of Figure 166 (SEQ ID NO: 297).
Or at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 80% sequence identity to the sequence contained in about 26 to about 368. It relates to an isolated PRO1490 polypeptide which comprises an amino acid sequence having about 95% sequence identity. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least at least about 80% positive when compared to the amino acid sequence of residue 1 or about 26 to 368 of Figure 166 (SEQ ID NO: 297). About 9
It relates to an isolated PRO1490 polypeptide which comprises an amino acid sequence with a score of 0% positive, most preferably at least about 95% positive.

In yet a further aspect, the invention comprises amino acid residue 1 of Figure 166 (SEQ ID NO: 297) or the sequence from about 26 to about 368, or a fragment thereof sufficient to bind an anti-PRO1490 antibody. Of isolated PRO1490 polypeptides. Preferably, the PRO1490 fragment retains the qualitative biological activity of the native PRO1490 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
A DNA molecule encoding the PRO1490 polypeptide having amino acid residue 1 of 66 (SEQ ID NO: 297) or a sequence of about 26 to about 368, or D of (b) (a)
Hybridization with the complement of the NA molecule under stringent conditions allows the test DNA molecule to
at least about 80% sequence identity to a) or (b), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity,
Most preferably, (ii) culturing a host cell containing a test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) culturing the polypeptide from the cell culture medium, provided that it has at least about 95% sequence identity. A polypeptide produced by recovering is provided. In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1490 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1490 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1490 polypeptide by contacting the native PRO1490 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In yet a further embodiment, the invention relates to a composition comprising a PRO1490 polypeptide, or agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

84. PRO1482 In this application, a cDNA clone (DNA71234-1651) has been identified, which was named "PRO1482" and which encodes a novel secreted polypeptide. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1482 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule that encodes a PRO1482 polypeptide having the sequence of amino acid residues about 1 or about 29 to about 143 of Figure 168 (SEQ ID NO: 302), or (b) For the complement of the DNA molecule of (a),
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. . In another aspect, the invention features an isolated nucleic acid molecule that encodes a PRO1482 polypeptide that comprises a DNA that hybridizes to the complement of the nucleic acid from about nucleotide 33 or from nucleotides 117 to 461 of Figure 167 (SEQ ID NO: 301). Regarding Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA71234-1651) of ATCC Deposit No. 203402, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203402 (DNA71234-1651). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence with amino acid residue 1 of Figure 168 (SEQ ID NO: 302) or the sequence from about 29 to about 143. DNA comprising a polypeptide having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or complement of a DNA molecule of (b) (a). To an isolated nucleic acid molecule consisting of In a further aspect, the invention provides that a test DNA molecule is (a) a PRO having amino acid residue 1 of Figure 168 (SEQ ID NO: 302) or a sequence from about 29 to about 143.
Hybridized under stringent conditions with a DNA molecule encoding the 1482 polypeptide, or (b) the complement of the DNA molecule of (a), wherein the DNA molecule (a) or (b)
) To at least about 80% sequence identity, preferably at least about 85%
At least about 260 nucleotides produced by isolating a test DNA molecule having sequence identity of, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Having an isolated nucleic acid molecule. In a particular aspect, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1482 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, or such a code. A complementary nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 28 of Figure 168 (SEQ ID NO: 302). In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residue 1 or about 29 to about 143 of Figure 168 (SEQ ID NO: 302). , More preferably at least about 90% positive, most preferably at least about 95% positive, a DNA molecule encoding a polypeptide, or an isolated nucleic acid molecule comprising the complement of a DNA molecule of (b) (a). Regarding

In another embodiment, PR finds use as a hybridization probe.
A fragment of the O1482 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides in length, preferably about 20 to about 60 nucleotides in length, more preferably about 20 to about 50 nucleotides in length, most preferably about 20 to about 40 nucleotides in length, as shown in Figure 167 (SEQ ID NO: 301). It is derived from the nucleotide sequence shown. In another embodiment, the invention provides an isolated PRO1482 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1482 polypeptide, which in one embodiment comprises an amino acid sequence comprising residue 1 of Figure 168 (SEQ ID NO: 302) or about 29-143. There is. In another aspect, the invention features amino acid residue 1 of Figure 168 (SEQ ID NO: 302).
Or at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 80% sequence identity to the sequence contained in about 29 to about 143. It relates to an isolated PRO1482 polypeptide which comprises an amino acid sequence having about 95% sequence identity. In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 80% positive when compared to the amino acid sequence of residue 1 or about 29 to 143 of Figure 168 (SEQ ID NO: 302). About 9
It relates to an isolated PRO1482 polypeptide which comprises an amino acid sequence with a score of 0% positive, most preferably at least about 95% positive. In a still further aspect, the invention comprises a single amino acid residue 1 of Figure 168 (SEQ ID NO: 302) or the sequence from about 29 to about 143, or a fragment thereof sufficient to bind an anti-PRO1482 antibody. Isolated PRO1482 polypeptide. Preferably, the PRO1482 fragment retains the qualitative biological activity of the native PRO1482 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
A DNA molecule encoding a PRO1482 polypeptide having a sequence of about 1 or about 29 to about 143 amino acid residues of 68 (SEQ ID NO: 302), or (b) a complement of the DNA molecule of (a) and stringent conditions. Hybridized below, the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity. If there is identity, most preferably at least about 95% sequence identity, (ii) the host cell containing the test DNA molecule is cultured under conditions suitable for expression of the polypeptide, and (iii) from the cell culture medium. Provided is a polypeptide produced by recovering the polypeptide. In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1482 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1482 antibody. In a further embodiment, the invention relates to a method for identifying an agonist or antagonist of a native PRO1482 polypeptide by contacting the native PRO1482 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a yet further embodiment, the invention relates to a composition comprising a PRO1482 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

85. PRO1446 In this application, a cDNA clone (DNA71277-1636) has been identified, designated "PRO1446", which encodes a novel secreted polypeptide. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1446 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1446 polypeptide having a sequence from about 1 or about 16 to about 109 amino acid residues of Figure 170 (SEQ ID NO: 304), or (b) For the complement of the DNA molecule of (a),
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. . In another aspect, the invention features about residue 197 of Figure 169 (SEQ ID NO: 303).
To PRO478 containing DNA hybridizing to the complement of about 478 nucleic acids from
It relates to an isolated nucleic acid molecule encoding a polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA71277-1636) of ATCC Deposit No. 203285, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203285 (DNA71277-1636). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 16 to about 109 amino acid residues of Figure 170 (SEQ ID NO: 304). , And more preferably at least about 90%
To a DNA encoding a polypeptide having sequence identity of, most preferably at least about 95% sequence identity, or (b) an isolated nucleic acid molecule comprising the complement of the DNA molecule of (a). In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO144 having a sequence from about 16 to about 109 amino acid residues of Fig170 (SEQ ID NO: 304).
Hybridizing with a DNA molecule encoding the 6 polypeptide or (b) the complement of the DNA molecule of (a) under stringent conditions, wherein the DNA molecule has at least about 80 relative to (a) or (b). Isolating a test DNA molecule when it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Produced by at least about 50 nucleotides, preferably at least about 100 nucleotides
It relates to an isolated nucleic acid molecule having nucleotides.

In another aspect, the invention features (a) residue 16 of FIG. 170 (SEQ ID NO: 304).
To at least about 80% positive when compared to about 109 amino acid sequences,
Preferably at least about 85% positive, more preferably at least about 90%
A DNA molecule encoding a polypeptide positive, most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising (b) (a) the complement of the DNA molecule. Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1446 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long. In another embodiment, the invention provides an isolated PRO1446 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1446 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 16 to 109 of Fig170 (SEQ ID NO: 304). In another aspect, the invention features amino acid residue 1 of Figure 170 (SEQ ID NO: 304).
6 to about 109 contained in at least about 80% sequence identity, preferably at least about 85% sequence identity, and more preferably at least about 90% sequence identity.
To an isolated PRO1446 polypeptide comprising an amino acid sequence having sequence identity of, most preferably at least about 95% sequence identity. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 16 to 109 of Figure 170 (SEQ ID NO: 304). It relates to an isolated PRO1446 polypeptide comprising an amino acid sequence with a positive, most preferably at least about 95% positive score. In a still further aspect, the invention provides an isolated sequence comprising the sequence of amino acid residues 16 to about 109 of Figure 170 (SEQ ID NO: 304), or a fragment thereof sufficient to bind an anti-PRO1446 antibody. It relates to the PRO1446 polypeptide.
Preferably, the PRO1446 fragment retains the qualitative biological activity of the native PRO1446 polypeptide.

In yet a further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
PR having a sequence of about 16 to about 109 amino acid residues of 70 (SEQ ID NO: 304)
A DNA molecule encoding the O1446 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule is at least about (Ii) test if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. DNA
A host cell containing the molecule is cultured under conditions suitable for expression of the polypeptide, and (i
ii) Providing the polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1446 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1446 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1446 polypeptide by contacting the native PRO1446 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a yet further embodiment, the invention relates to a composition comprising a PRO1446 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

86. PRO1558 Named "PRO1558" in the present application, a cDNA having homology to a nucleic acid encoding a methyltransferase enzyme, which encodes a novel polypeptide.
The A clone (DNA71282-1668) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1558 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1558 polypeptide having the sequence from about amino acid residue 1 or about 26 to about 262 of Figure 172 (SEQ ID NO: 306), or (b). For the complement of the DNA molecule of (a),
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. . In another aspect, the invention features an isolated nucleic acid molecule encoding a PRO1558 polypeptide comprising a DNA that hybridizes to the complement of the nucleic acid of about 84 or about 159 to about 869 nucleotides of Figure 171 (SEQ ID NO: 305). Regarding Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203312 (DNA71282-1668), or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203312 (DNA712812-1668). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence with amino acid residue 1 of Fig172 (SEQ ID NO: 306) or the sequence from about 26 to about 262. A DNA encoding a polypeptide having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) complement of the DNA molecule of (a). To an isolated nucleic acid molecule consisting of In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO having the amino acid residue 1 of Figure 172 (SEQ ID NO: 306) or the sequence from about 26 to about 262.
A DNA molecule encoding a 1558 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, wherein the DNA molecule (a) or (b)
) To at least about 80% sequence identity, preferably at least about 85%
Having at least 100 nucleotides, prepared by isolating a test DNA molecule when having sequence identity of, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a particular aspect, the invention encodes a PRO1558 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and solubilizing, ie transmembrane domain deletion or inactivating variants thereof. An isolated nucleic acid molecule containing DNA is provided or is complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 25 of Figure 172 (SEQ ID NO: 306). The transmembrane domain is PRO1
It has been tentatively identified as extending from about amino acid position 8 to about amino acid position 30 and from about amino acid position 109 to about amino acid position 130 of the 558 amino acid sequence (FIG. 172, SEQ ID NO: 306).

In another aspect, the invention features (a) at least about 80% positive, preferably at least about 80% positive, when compared to the amino acid sequence of residue 1 or about 26 to about 262 of Figure 172 (SEQ ID NO: 306). An isolated DNA molecule encoding a polypeptide with a score of 85% positive, more preferably at least about 90% positive, most preferably at least about 95% positive, or (b) (a) the complement of the DNA molecule. Nucleic acid molecule. Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1558 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides in length, preferably about 20 to about 60 nucleotides in length, more preferably about 20 to about 50 nucleotides in length, most preferably about 20 to about 40 nucleotides in length and shown in Figure 171 (SEQ ID NO: 305). It is derived from the nucleotide sequence shown. In another embodiment, the invention provides an isolated PRO1558 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1558 polypeptide, which in one embodiment comprises an amino acid sequence comprising residue 1 of Figure 172 (SEQ ID NO: 306) or about 26-262. There is. In another aspect, the invention features amino acid residue 1 of Figure 172 (SEQ ID NO: 306).
Or at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 80% sequence identity to the sequence contained in about 26 to about 262. It relates to an isolated PRO1558 polypeptide, which comprises an amino acid sequence having about 95% sequence identity. In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to the amino acid sequence of residue 1 or about 26 to about 262 of Figure 172 (SEQ ID NO: 306), more preferably It relates to an isolated PRO1558 polypeptide comprising an amino acid sequence that scores at least about 90% positive, and most preferably at least about 95% positive. In a still further aspect, the invention comprises a single amino acid residue 1 of Figure 172 (SEQ ID NO: 306) or the sequence from about 26 to about 262, or a fragment thereof sufficient to bind an anti-PRO1558 antibody. Isolated PRO1558 polypeptide. Preferably, the PRO1558 fragment retains the qualitative biological activity of the native PRO1558 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
A DNA molecule encoding a PRO1558 polypeptide having the sequence of about 1 or about 26 to about 262 amino acid residues of 72 (SEQ ID NO: 306), or (b) the complement of the DNA molecule of (a) and stringent conditions. Hybridized below, the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity. If there is identity, most preferably at least about 95% sequence identity, (ii) the host cell containing the test DNA molecule is cultured under conditions suitable for expression of the polypeptide, and (iii) from the cell culture medium. Provided is a polypeptide produced by recovering the polypeptide. In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1558 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1558 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1558 polypeptide by contacting the native PRO1558 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a yet further embodiment, the invention relates to a composition comprising a PRO1558 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

87. PRO1604 Named "PRO1604" in the present application, and liver cancer-derived growth factor (HDG
F) a cDNA clone (DN) encoding a novel polypeptide having homology to
A71286-1687) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1604 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1604 polypeptide having amino acid residue 1 of Figure 174 (SEQ ID NO: 308) or a sequence from about 14 to about 671; or (b) ( at least about 80% sequence identity, preferably at least about 85% sequence identity to the complement of the DNA molecule of a),
More preferably it comprises DNA having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In another aspect, the invention features about residue 104 of Figure 173 (SEQ ID NO: 307).
To PRO20 containing DNA that hybridizes to the complement of about 2077 nucleic acids
It relates to an isolated nucleic acid molecule encoding a 4 polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA71286-1687) of ATCC Deposit No. 203357, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203357 (DNA71286-1687).

In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence from about amino acid residue 14 to about 671 of Figure 174 (SEQ ID NO: 308). Sequence identity, more preferably at least about 90%
To a DNA encoding a polypeptide having sequence identity of, most preferably at least about 95% sequence identity, or (b) an isolated nucleic acid molecule comprising the complement of the DNA molecule of (a). In a further aspect, the invention provides a test DNA molecule, (a) PRO160 having a sequence from about 14 to about 671 amino acid residues of Figure 174 (SEQ ID NO: 308).
At least about 80 relative to (a) or (b), wherein the DNA molecule hybridizes with a DNA molecule encoding a 4 polypeptide or (b) the complement of the DNA molecule of (a) under stringent conditions. Isolating a test DNA molecule when it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Produced by at least about 50 nucleotides, preferably at least about 100 nucleotides
It relates to an isolated nucleic acid molecule having nucleotides. In a particular aspect, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1604 polypeptide with or without an N-terminal signal sequence, or complementary to such an encoding nucleic acid molecule. Target. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 13 of Figure 174 (SEQ ID NO: 308). In another aspect, the invention provides (a) residue 14 of Figure 174 (SEQ ID NO: 308).
To at least about 80% positive when compared to the about 671 amino acid sequence,
Preferably at least about 85% positive, more preferably at least about 90%
A DNA molecule encoding a polypeptide positive, most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising (b) (a) the complement of the DNA molecule. Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1604 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long. In another embodiment, the invention provides an isolated PRO1604 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1604 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 14 to 671 of Figure 174 (SEQ ID NO: 308).

In another aspect, the invention features amino acid residue 1 of Figure 174 (SEQ ID NO: 308).
4 to about 671 to at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90%.
To a PRO1604 polypeptide which comprises an amino acid sequence having sequence identity of, most preferably at least about 95% sequence identity. In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive as compared to the amino acid sequence of residues 14 to 671 of Figure 174 (SEQ ID NO: 308). It relates to an isolated PRO1604 polypeptide which comprises an amino acid sequence that scores positive, most preferably at least about 95% positive. In a still further aspect, the invention provides an isolated sequence comprising the sequence of amino acid residues 14 to about 671 of Figure 174 (SEQ ID NO: 308), or a fragment thereof sufficient to bind an anti-PRO1604 antibody. It relates to PRO1604 polypeptides.
Preferably, the PRO1604 fragment retains the qualitative biological activity of the native PRO1604 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
PR having a sequence of about 14 to about 671 amino acid residues of 74 (SEQ ID NO: 308)
A DNA molecule encoding the O1604 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule is at least about (Ii) testing if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. DNA
A host cell containing the molecule is cultured under conditions suitable for expression of the polypeptide, and (i
ii) Providing the polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1604 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1604 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1604 polypeptide by contacting the native PRO1604 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In yet a further embodiment, the invention relates to a composition comprising a PRO1604 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

88. PRO1491 In the present application, a cDNA clone (DNA71883-1660) named "PRO1491" and having homology with a nucleic acid encoding collapsin, which encodes a novel polypeptide, was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1491 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1491 polypeptide having the sequence from about amino acid residue 1 or about 37 to about 777 of Figure 176 (SEQ ID NO: 310), or (b) For the complement of the DNA molecule of (a),
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. . In another aspect, the invention provides a DN that hybridizes to the complement of the nucleic acid from about nucleotide 107 or about nucleotide 215 to about 2437 of Figure 175 (SEQ ID NO: 309).
An isolated nucleic acid molecule encoding a PRO1491 polypeptide that comprises A. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203475 (DNA71883-1660), or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203475 (DNA71883-1660). In a still further aspect, the invention features (a) at least about 80% sequence identity, preferably at least about 85% sequence, with amino acid residue 1 of Figure 176 (SEQ ID NO: 310) or the sequence from about 37 to about 777. DNA comprising a polypeptide having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or complement of a DNA molecule of (b) (a). To an isolated nucleic acid molecule consisting of In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO having the amino acid residue 1 of Figure 176 (SEQ ID NO: 310) or the sequence from about 37 to about 777.
Hybridized under stringent conditions with a DNA molecule encoding the 1491 polypeptide, or (b) the complement of the DNA molecule of (a), wherein the DNA molecule (a) or (b)
) To at least about 80% sequence identity, preferably at least about 85%
At least about 1,670, which is prepared by isolating a test DNA molecule having sequence identity of, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule having nucleotides.

In a particular embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1491 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, or Is complementary to such an encoded nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 36 of Figure 176 (SEQ ID NO: 310). In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residue 1 or about 37 to about 777 of Figure 176 (SEQ ID NO: 310). , More preferably at least about 90% positive, most preferably at least about 95% positive, a DNA molecule encoding a polypeptide, or an isolated nucleic acid molecule comprising the complement of (b) (a) a DNA molecule. Regarding Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1491 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides in length, preferably about 20 to about 60 nucleotides in length, more preferably about 20 to about 50 nucleotides in length, most preferably about 20 to about 40 nucleotides in length and shown in Figure 175 (SEQ ID NO: 309). It is derived from the nucleotide sequence shown. In another embodiment, the invention provides an isolated PRO1491 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1491 polypeptide, which in one embodiment comprises an amino acid sequence comprising residue 1 of Figure 176 (SEQ ID NO: 310) or about 37 to about 777. I'm out. In another aspect, the invention features amino acid residue 1 of Figure 176 (SEQ ID NO: 310).
Or at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 37% to about 777. It relates to an isolated PRO1491 polypeptide which comprises an amino acid sequence having about 95% sequence identity. In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably when compared to the amino acid sequence of residue 1 or about 37 to about 777 of Figure 176 (SEQ ID NO: 310), more preferably It relates to an isolated PRO1491 polypeptide which comprises an amino acid sequence with a score of at least about 90% positive, and most preferably at least about 95% positive. In a still further aspect, the invention comprises a single amino acid residue 1 of Figure 176 (SEQ ID NO: 310) or the sequence of about 37 to about 777, or a fragment thereof sufficient to bind an anti-PRO1491 antibody. Related to the released PRO1491 polypeptide. Preferably, this PRO1491 fragment retains the qualitative biological activity of the native PRO1491 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
A DNA molecule encoding a PRO1491 polypeptide having amino acid residue 1 of 76 (SEQ ID NO: 310) or a sequence of about 37 to about 777, or (b) (a) D
Hybridization with the complement of the NA molecule under stringent conditions allows the test DNA molecule to
at least about 80% sequence identity to a) or (b), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity,
Most preferably, (ii) culturing a host cell containing a test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) culturing the polypeptide from the cell culture medium, provided that it has at least about 95% sequence identity. A polypeptide produced by recovering is provided. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1491 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1491 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1491 polypeptide by contacting the native PRO1491 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a yet further embodiment, the invention relates to a composition comprising a PRO1491 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

89. PRO1431 In the present application, this is designated as "PRO1431", and is a cDNA clone having a domain having homology with SH3 encoding a novel polypeptide (DNA7340).
1-1633) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1431 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule that encodes a PRO1431 polypeptide having a sequence from about amino acid residue 1 to about 370 of Figure 178 (SEQ ID NO: 315), or (b) (a). Of at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity to the complement of a DNA molecule of It comprises DNA having sequence identity. In another aspect, the invention isolates a PRO1431 polypeptide that comprises a DNA that hybridizes to the complement of the nucleic acids of residues about 1 to about 1335 and about 1560 to about 3934 of Figure 177 (SEQ ID NO: 314). Nucleic acid molecule. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203273 (DNA73401-1633), or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203273 (DNA73401-1633).

In a still further aspect, the invention features (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of amino acid residues about 1 to about 370 of Figure 178 (SEQ ID NO: 315). DNA encoding a polypeptide having sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity, or (b) (a) the complement of the DNA molecule. Relates to an isolated nucleic acid molecule comprising. In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO1431 having a sequence from about 1 to about 370 amino acid residues of Figure 178 (SEQ ID NO: 315).
Hybridizing with a DNA molecule encoding a polypeptide, or (b) the complement of a DNA molecule of (a) under stringent conditions, wherein the DNA molecule is at least about 80% relative to (a) or (b) A test DNA molecule is isolated if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. And an isolated nucleic acid molecule having at least about 15 nucleotides. In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive, more preferably when compared to the amino acid sequence of residues 1 to about 370 of Figure 178 (SEQ ID NO: 315). Refers to a DNA molecule encoding a polypeptide that scores at least about 90% positive, and most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising the complement of (b) (a) DNA molecule. In another embodiment, the invention provides an isolated PRO1431 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1431 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 1 to 370 of Figure 178 (SEQ ID NO: 315). In another aspect, the invention features amino acid residue 1 of Figure 178 (SEQ ID NO: 315).
To about 370, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%. To an isolated PRO1431 polypeptide comprising an amino acid sequence having the sequence identity of

In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least at least about 80% positive when compared to the amino acid sequence of residues 1 to 370 of Figure 178 (SEQ ID NO: 315). It relates to an isolated PRO1431 polypeptide which comprises an amino acid sequence with a score of about 90% positive, most preferably at least about 95% positive. In a still further aspect, the invention provides an isolated sequence comprising amino acid residue 1 to about 370 of Figure 178 (SEQ ID NO: 315), or a fragment thereof sufficient to bind an anti-PRO1431 antibody. It relates to PRO1431 polypeptides. Preferably, the PRO1431 fragment retains the qualitative biological activity of the native PRO1431 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
PRO having a sequence of about 1 to about 370 amino acid residues of 78 (SEQ ID NO: 315)
1431 polypeptide-encoding DNA molecule, or (b) hybridized to the DNA molecule complement of (a) under stringent conditions, wherein the test DNA molecule is at least about 80% sequence identity, preferably at least about 8
(Ii) expressing a host cell containing a test DNA molecule into a polypeptide if it has 5% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Under conditions suitable for and (ii
i) providing a polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1431 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1431 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1431 polypeptide by contacting the native PRO1431 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising a PRO1431 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

90. PRO1563 In the present application, a cDNA clone (“PRO1563”), which is homologous to a nucleic acid encoding ADAMTS-1, which encodes a novel polypeptide (
DNA73492-1671) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1563 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1563 polypeptide having the sequence of amino acid residue about 1 or about 49 to about 837 of Figure 180 (SEQ ID NO: 317), or (b). For the complement of the DNA molecule of (a),
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. . In another aspect, the invention provides an isolated PRO1563 polypeptide encoding a DNA that hybridizes to the complement of the nucleic acid of about nucleotide 419 or about 563 to about 2929 of Figure 179A-B (SEQ ID NO: 316). Relates to nucleic acid molecules. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA73492-1671) of ATCC Deposit No. 203324, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203324 (DNA73492-1671). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence with amino acid residue 1 of Fig180 (SEQ ID NO: 317) or the sequence from about 49 to about 837. DNA comprising a polypeptide having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or complement of a DNA molecule of (b) (a). To an isolated nucleic acid molecule consisting of In a further aspect, the invention provides a test DNA molecule comprising (a) a PRO having the amino acid residue 1 of Fig180 (SEQ ID NO: 317) or the sequence from about 49 to about 837.
Hybridized with a DNA molecule encoding the 1563 polypeptide or (b) the complement of the DNA molecule of (a) under stringent conditions, whereby the DNA molecule (a) or (b)
) To at least about 80% sequence identity, preferably at least about 85%
At least about 100 nucleotides prepared by isolating a test DNA molecule having sequence identity of, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Having an isolated nucleic acid molecule. In a particular aspect, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1563 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, or such a code. A complementary nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 48 of Figure 180 (SEQ ID NO: 317). In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residue 1 or about 49 to about 837 of Figure 180 (SEQ ID NO: 317). , More preferably at least about 90% positive, most preferably at least about 95% positive, a DNA molecule encoding a polypeptide, or an isolated nucleic acid molecule comprising the complement of (b) (a) a DNA molecule. Regarding

Another embodiment of the PR finds use as a hybridization probe.
It relates to fragments of the O1563 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides in length, preferably about 20 to about 60 nucleotides in length, more preferably about 20 to about 50 nucleotides in length, most preferably about 20 to about 40 nucleotides in length, and is shown in Figure 179A-B (SEQ ID NO: 316). ) Derived from the nucleotide sequence shown. In another embodiment, the invention provides an isolated PRO1563 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1563 polypeptide, which in one embodiment comprises an amino acid sequence comprising residue 1 of Figure 180 (SEQ ID NO: 317) or about 49 to 837. There is. In another aspect, the invention features amino acid residue 1 of Figure 180 (SEQ ID NO: 317).
Or at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 80% sequence identity to the sequence contained in about 49 to about 837. It relates to an isolated PRO1563 polypeptide which comprises an amino acid sequence having a sequence identity of about 95%. In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 80% positive when compared to the amino acid sequence of residue 1 or about 49 to 837 of Figure 180 (SEQ ID NO: 317). About 9
It relates to an isolated PRO1563 polypeptide which comprises an amino acid sequence with a score of 0% positive, most preferably at least about 95% positive. In a still further aspect, the invention comprises a single amino acid residue 1 of Figure 180 (SEQ ID NO: 317) or a sequence from about 49 to about 837, or a fragment thereof sufficient to bind an anti-PRO1563 antibody. Isolated PRO1563 polypeptide. Preferably, the PRO1563 fragment retains the qualitative biological activity of the native PRO1563 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
A DNA molecule encoding a PRO1563 polypeptide having a sequence of about 1 or about 49 to about 837 amino acid residues of 80 (SEQ ID NO: 317), or (b) a complement of the DNA molecule of (a) and stringent conditions. Hybridized below, the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity. If there is identity, most preferably at least about 95% sequence identity, (ii) the host cell containing the test DNA molecule is cultured under conditions suitable for expression of the polypeptide, and (iii) from the cell culture medium. Provided is a polypeptide produced by recovering the polypeptide. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1563 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1563 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1563 polypeptide by contacting the native PRO1563 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a yet further embodiment, the invention relates to a composition comprising a PRO1563 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

91. PRO1565 Named "PRO1565" in the present application, cDN having homology with a nucleic acid encoding a chondromodulin protein, which encodes a novel polypeptide.
The A clone (DNA73727-1673) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1565 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1565 polypeptide having the sequence from about amino acid residue 1 or about 41 to about 317 of Figure 182 (SEQ ID NO: 322), or (b). For the complement of the DNA molecule (a)
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. . In another aspect, the invention provides a DNA that hybridizes to the complement of the nucleic acid of about 59 or about 179 to about 1009 nucleotides of Fig181 (SEQ ID NO: 321).
To an isolated nucleic acid molecule encoding a PRO1565 polypeptide comprising
Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA73727-1673) of ATCC Deposit No. 203459, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203459 (DNA73727-1673).

In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85%, with amino acid residue 1 of Figure 182 (SEQ ID NO: 322) or the sequence from about 41 to about 317. DNA encoding a polypeptide having a% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity, or the complement of the DNA molecule of (b) (a). It relates to an isolated nucleic acid molecule comprising the body. In a further aspect, the invention provides a test DNA molecule comprising (a) a PRO having the amino acid residue 1 of Fig182 (SEQ ID NO: 322) or the sequence from about 41 to about 317.
Hybridized with a DNA molecule encoding the 1565 polypeptide, or (b) the complement of the DNA molecule of (a), under stringent conditions such that the DNA molecule (a) or (b)
) To at least about 80% sequence identity, preferably at least about 85%
At least about 410 nucleotides prepared by isolating a test DNA molecule having sequence identity of, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Having an isolated nucleic acid molecule. In a particular aspect, the invention encodes a PRO1565 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and solubilizing, ie transmembrane domain deletion or inactivating variants thereof. An isolated nucleic acid molecule containing DNA is provided or is complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 40 of Figure 182 (SEQ ID NO: 322). The transmembrane domain is PRO1
Approximately 25 amino acid positions in the 565 amino acid sequence (Fig182, SEQ ID NO: 322)
Tentatively identified as extending from to amino acid position about 47. In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residue 1 or about 41 to about 317 of Figure 182 (SEQ ID NO: 322). , More preferably at least about 90% positive, most preferably at least about 95% positive, a DNA molecule encoding a polypeptide, or an isolated nucleic acid molecule comprising the complement of (b) (a) a DNA molecule. Regarding Another embodiment is a PR that finds use as a hybridization probe.
It relates to fragments of the O1565 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides in length, preferably about 20 to about 60 nucleotides in length, more preferably about 20 to about 50 nucleotides in length, most preferably about 20 to about 40 nucleotides in length, as shown in Figure 181 (SEQ ID NO: 321). It is derived from the nucleotide sequence shown.

In another embodiment, the invention provides an isolated PRO1565 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1565 polypeptide, which in one embodiment comprises an amino acid sequence comprising residue 1 of Figure 182 (SEQ ID NO: 322) or about 41 to 317. There is. In another aspect, the invention features amino acid residue 1 of Figure 182 (SEQ ID NO: 322).
Or at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 80% sequence identity to the sequence contained in about 41 to about 317. It relates to an isolated PRO1565 polypeptide comprising an amino acid sequence having a sequence identity of about 95%. In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 80% positive when compared to the amino acid sequence of residue 1 or about 41 to 317 of Figure 182 (SEQ ID NO: 322). About 9
It relates to an isolated PRO1565 polypeptide comprising an amino acid sequence with a score of 0% positive, most preferably at least about 95% positive. In a still further aspect, the invention comprises a single amino acid residue 1 of Figure 182 (SEQ ID NO: 322) or the sequence from about 41 to about 317, or a fragment thereof sufficient to bind an anti-PRO1565 antibody. Isolated PRO1565 polypeptide. Preferably, the PRO1565 fragment retains the qualitative biological activity of the native PRO1565 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
82 (SEQ ID NO: 322), a DNA molecule encoding a PRO1565 polypeptide having a sequence of about 1 or about 41 to about 317 of amino acid residues, or (b) a complement of the DNA molecule of (a) and stringent conditions. Hybridized below, the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity. If there is identity, most preferably at least about 95% sequence identity, (ii) the host cell containing the test DNA molecule is cultured under conditions suitable for expression of the polypeptide, and (iii) from the cell culture medium. Provided is a polypeptide produced by recovering the polypeptide. In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1565 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1565 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1565 polypeptide by contacting the native PRO1565 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In yet a further embodiment, the invention relates to a composition comprising a PRO1565 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

92. PRO1571 In the present application, "PRO1571" is named and encodes a novel polypeptide, clustridium perfrin enterotoxin.
A cDNA clone (DNA73730-1679) having homology to the nucleic acid encoding the gens enterotoxin) receptor (CPE-R) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1571 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1571 polypeptide having the sequence of amino acid residues about 1 or about 22 to about 239 of Figure 184 (SEQ ID NO: 324), or (b). For the complement of the DNA molecule of (a),
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. . In another aspect, the invention features an isolated nucleic acid molecule encoding a PRO1571 polypeptide that comprises DNA that hybridizes to the complement of the nucleic acid of about 90 or about 153 to about 806 nucleotides of Figure 183 (SEQ ID NO: 323). Regarding Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA73730-1679) of ATCC Deposit No. 203320, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203320 (DNA73730-1679). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence with amino acid residue 1 of Fig184 (SEQ ID NO: 324) or the sequence from about 22 to about 239. A DNA encoding a polypeptide having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) complement of the DNA molecule of (a). To an isolated nucleic acid molecule consisting of

In a further aspect, the invention provides a test DNA molecule comprising: (a) a PRO having the sequence of amino acid residue 1 of Figure 184 (SEQ ID NO: 324) or from about 22 to about 239.
1571 polypeptide-encoding DNA molecule, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, whereby the DNA molecule (a) or (b)
) To at least about 80% sequence identity, preferably at least about 85%
Of at least about 910 nucleotides prepared by isolating a test DNA molecule having sequence identity of, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Having an isolated nucleic acid molecule. In a particular aspect, the invention encodes a PRO1571 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and solubilizing, ie transmembrane domain deletion or inactivating variants thereof. An isolated nucleic acid molecule containing DNA is provided or is complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 21 of Figure 184 (SEQ ID NO: 324). The transmembrane domain is PRO1
About amino acid position 82 in the 571 amino acid sequence (Fig184, SEQ ID NO: 324)
To amino acid position 103, amino acid position 115 to amino acid position 141,
And tentatively identified as extending from about amino acid position 160 to about amino acid position 182. In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residue 1 or about 22 to about 239 of Figure 184 (SEQ ID NO: 324). , More preferably at least about 90% positive, most preferably at least about 95% positive, a DNA molecule encoding a polypeptide, or an isolated nucleic acid molecule comprising the complement of a DNA molecule of (b) (a). Regarding Another embodiment is a PR that finds use as a hybridization probe.
It relates to a fragment of the O1571 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides in length, preferably about 20 to about 60 nucleotides in length, more preferably about 20 to about 50 nucleotides in length, most preferably about 20 to about 40 nucleotides in length, as shown in Figure 183 (SEQ ID NO: 323). It is derived from the nucleotide sequence shown. In another embodiment, the invention provides an isolated PRO1571 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1571 polypeptide, which in one embodiment comprises a residue 1 of Figure 184 (SEQ ID NO: 324) or an amino acid sequence comprising about 22 to 239. There is. In another aspect, the invention features amino acid residue 1 of Figure 184 (SEQ ID NO: 324).
Or at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 80% sequence identity to the sequence contained in about 22 to about 239. It relates to an isolated PRO1571 polypeptide which comprises an amino acid sequence having a sequence identity of about 95%.

In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, when compared to the amino acid sequence of residue 1 or about 22 to 239 of Figure 184 (SEQ ID NO: 324). Preferably at least about 9
It relates to an isolated PRO1571 polypeptide which comprises an amino acid sequence with a score of 0% positive, most preferably at least about 95% positive. In a still further aspect, the invention comprises a single amino acid residue 1 of Figure 184 (SEQ ID NO: 324) or a sequence of about 22 to about 239, or a fragment thereof sufficient to bind an anti-PRO1571 antibody. Isolated PRO1571 polypeptide. Preferably, this PRO1571 fragment retains the qualitative biological activity of the native PRO1571 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
A DNA molecule encoding a PRO1571 polypeptide having the sequence of about 1 or about 22 to about 239 amino acid residues of 84 (SEQ ID NO: 324), or (b) the complement of the DNA molecule of (a) and stringent conditions. Hybridized below, the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity. If there is identity, most preferably at least about 95% sequence identity, (ii) the host cell containing the test DNA molecule is cultured under conditions suitable for expression of the polypeptide, and (iii) from the cell culture medium. Provided is a polypeptide produced by recovering the polypeptide. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1571 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1571 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1571 polypeptide by contacting the native PRO1571 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In yet a further embodiment, the invention relates to a composition comprising a PRO1571 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

93. PRO1572 In the present application, a cDNA clone (DNA73734-16) which is named "PRO1572" and encodes a novel polypeptide having sequence identity with CPE-R.
80) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1572 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1572 polypeptide having the sequence of amino acid residues from about 1 or from about 24 to about 261 of Figure 186 (SEQ ID NO: 326), or (b). For the complement of the DNA molecule of (a),
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. . In another aspect, the invention features about residue 159 of Figure 185 (SEQ ID NO: 325).
To PRO872 containing DNA hybridizing to the complement of about 872 nucleic acids from
It relates to an isolated nucleic acid molecule encoding a polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203363 (DNA73734-1680), or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203363 (DNA73734-1680). In a still further aspect, the invention features (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of amino acid residues about 24 to about 261 of Figure 186 (SEQ ID NO: 326). , And more preferably at least about 90%
To a DNA encoding a polypeptide having sequence identity of, most preferably at least about 95% sequence identity, or (b) an isolated nucleic acid molecule comprising the complement of the DNA molecule of (a). In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO157 having the sequence of about amino acid residues 24 to about 261 of Figure 186 (SEQ ID NO: 326).
At least about 80% of the DNA molecule with respect to (a) or (b) by hybridizing under stringent conditions with a DNA molecule encoding the 2 polypeptide or (b) the complement of the DNA molecule of (a). Isolate a test DNA molecule if it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule having at least about 457 nucleotides.

In a particular aspect, the invention provides a PRO1572 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and solubilizing or transmembrane domain deletion or inactivating variants thereof. Providing an isolated nucleic acid molecule comprising DNA encoding, or being complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 23 of Figure 186 (SEQ ID NO: 326). The transmembrane domain is PRO1
Approximate amino acid 8 of the 572 amino acid sequence (Fig186, SEQ ID NO: 326)
It has been tentatively identified as extending to 1-100, 121-141, and 173-194. In another aspect, the invention features (a) about 2 residues of Figure 186 (SEQ ID NO: 326).
At least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to the amino acid sequence from 4 to about 261.
A DNA molecule encoding a polypeptide having a% positive score, most preferably at least about 95% positive score, or (b) an isolated nucleic acid molecule comprising the complement of the DNA molecule of (a). Another embodiment is a PR that finds use as a hybridization probe.
It relates to a fragment of the O1572 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long. In another embodiment, the invention provides an isolated PRO1572 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a specific aspect, the invention provides an isolated native sequence PRO1572 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 24-261 of Figure 186 (SEQ ID NO: 326). In another aspect, the invention features amino acid residue 2 of Figure 186 (SEQ ID NO: 326).
4 to about 261, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90%.
Of a sequence identity, most preferably at least about 95% sequence identity, to an isolated PRO1572 polypeptide. In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 24-261 of Figure 186 (SEQ ID NO: 326). It relates to an isolated PRO1572 polypeptide which comprises an amino acid sequence with a score of positive, most preferably at least about 95% positive. In a still further aspect, the invention comprises an isolated sequence of amino acid residues 1 or 24 of Figure 186 (SEQ ID NO: 326) to about 261, or a fragment thereof sufficient to bind an anti-PRO1572 antibody. Associated PRO1572 polypeptide. Preferably, the PRO1572 fragment retains the qualitative biological activity of the native PRO1572 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
A DNA molecule encoding a PRO1572 polypeptide having amino acid residue 1 of 86 (SEQ ID NO: 326) or a sequence of about 24 to about 261; or (b) (a) D
Hybridization with the complement of the NA molecule under stringent conditions allows the test DNA molecule to
at least about 80% sequence identity to a) or (b), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity,
Most preferably, (ii) culturing a host cell containing a test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) culturing the polypeptide from the cell culture medium, provided that it has at least about 95% sequence identity. A polypeptide produced by recovering is provided. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1572 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1572 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1572 polypeptide by contacting the native PRO1572 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising a PRO1572 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

94. PRO1573 In the present application, a cDNA clone named "PRO1573" and encoding a novel polypeptide having sequence identity with CPE-R (DNA73735-16)
81) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1573 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1573 polypeptide having amino acid residue 1 of Figure 188 (SEQ ID NO: 328) or a sequence of about 18 to about 225, or (b) ( at least about 80% sequence identity, preferably at least about 85% sequence identity to the complement of the DNA molecule of a),
More preferably it comprises DNA having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In another aspect, the invention features about residue 148 of Figure 187 (SEQ ID NO: 327).
To PRO773 containing DNA that hybridizes to the complement of about 771 nucleic acids from
It relates to an isolated nucleic acid molecule encoding a polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203356 (DNA73735-1681), or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203356 (DNA73735-1681). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence of amino acid residues about 18 to about 225 of Figure 188 (SEQ ID NO: 328). , And more preferably at least about 90%
To a DNA encoding a polypeptide having sequence identity of, most preferably at least about 95% sequence identity, or (b) an isolated nucleic acid molecule comprising the complement of the DNA molecule of (a). In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO157 having a sequence from about 18 to about 225 amino acid residues of Figure 188 (SEQ ID NO: 328).
Hybridizing with a DNA molecule encoding the 3 polypeptide or (b) the complement of the DNA molecule of (a) under stringent conditions, wherein the DNA molecule has at least about 80 relative to (a) or (b). Isolating a test DNA molecule when it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Produced by at least about 50 nucleotides, preferably at least about 100 nucleotides
It relates to an isolated nucleic acid molecule having nucleotides.

In a particular aspect, the invention provides a PRO1573 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and solubilizing, ie transmembrane domain deletion or inactivating variants thereof. Providing an isolated nucleic acid molecule comprising DNA encoding, or being complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 17 of Figure 188 (SEQ ID NO: 328). The transmembrane domain is PRO1
Approximate amino acid 8 of the 573 amino acid sequence (Fig188, SEQ ID NO: 328)
It has been tentatively identified as extending to 2-101, 118-145 and 164-188. In another aspect, the invention features (a) about 1 residue of Figure 188 (SEQ ID NO: 328).
At least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to the amino acid sequence of 8 to about 225.
A DNA molecule encoding a polypeptide having a% positive score, most preferably at least about 95% positive score, or (b) an isolated nucleic acid molecule comprising the complement of the DNA molecule of (a). Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1573 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long. In another embodiment, the invention provides an isolated PRO1573 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1573 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 18 to 225 of Figure 188 (SEQ ID NO: 328).

In another aspect, the invention features at least about 80% sequence identity to the sequence contained in amino acid residues about 18 to about 225 of Figure 188 (SEQ ID NO: 328),
Preferably at least about 85% sequence identity, more preferably at least about 90.
It relates to an isolated PRO1573 polypeptide which comprises an amino acid sequence having a% sequence identity, most preferably at least about 95% sequence identity. In a further aspect, the invention provides for about 18 residues of Figure 188 (SEQ ID NO: 328).
To 225 amino acid sequences, at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, most preferably at least about 95% positive. , An isolated PRO1573 polypeptide. In a still further aspect, the invention provides an isolated sequence comprising from amino acid residues about 18 to about 225 of Figure 188 (SEQ ID NO: 328), or a fragment thereof sufficient to bind an anti-PRO1573 antibody. PRO1573 polypeptide. Preferably, this PRO1573 fragment retains the qualitative biological activity of the native PRO1573 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
PR having a sequence of about 18 to about 225 amino acid residues of 88 (SEQ ID NO: 328)
A DNA molecule encoding the O1573 polypeptide or (b) a complement of the DNA molecule of (a) is hybridized under stringent conditions, and the test DNA molecule is at least about (Ii) testing if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. DNA
A host cell containing the molecule is cultured under conditions suitable for expression of the polypeptide, and (i
ii) Providing the polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1573 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1573 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1573 polypeptide by contacting the native PRO1573 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In yet a further embodiment, the invention relates to a composition comprising a PRO1573 polypeptide, or agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

95. PRO1488 In the present application, designated as "PRO1488", and is referred to as clustridium perfringens enterotoxin receptor (C
PE-R) and a cDNA clone encoding a novel polypeptide having homology (
DNA73736-1657) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1488 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1488 polypeptide having a sequence from about 1 to about 220 amino acid residues of Figure 190 (SEQ ID NO: 330), or (b) (a). Of at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity to the complement of a DNA molecule of It comprises DNA having sequence identity. In another aspect, the invention features an isolated nucleic acid molecule that encodes a PRO1488 polypeptide that comprises a DNA that hybridizes to the complement of a nucleic acid from about 6 to about 665 residues of Figure 189 (SEQ ID NO: 329). Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203466 (DNA73736-1657), or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203466 (DNA73736-1657). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of about 1 to about 220 amino acid residues of Figure 190 (SEQ ID NO: 330). , More preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a DNA encoding a polypeptide, or (b) a complement of a DNA molecule of (a). It relates to an isolated nucleic acid molecule. In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO1488 having a sequence from about 1 to about 220 amino acid residues of Figure 190 (SEQ ID NO: 330).
Hybridizing with a DNA molecule encoding a polypeptide, or (b) the complement of a DNA molecule of (a) under stringent conditions, wherein the DNA molecule is at least about 80% relative to (a) or (b) A test DNA molecule is isolated if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. And an isolated nucleic acid molecule having at least about 50 nucleotides, preferably at least about 100 nucleotides.

In a particular aspect, the invention provides a PRO1488 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and its solubilization (ie transmembrane domain deletion or inactivation). An isolated nucleic acid molecule comprising DNA encoding a variant is provided, or is complementary to such an encoding nucleic acid molecule.
The transmembrane domain has a PRO1488 amino acid sequence (Fig190, SEQ ID NO: 3).
30) approximately amino acids 8-30, 82-102, 121-140, and 16
It has been tentatively identified as extending to 6-186. In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive, more preferably when compared to the amino acid sequence of residues 1 to about 220 of Figure 190 (SEQ ID NO: 330), more preferably at least about 85% positive. Relates to a DNA molecule encoding a polypeptide which scores at least about 90% positive, most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising the complement of (b) (a) the DNA molecule. Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1488 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long. In another embodiment, the invention provides an isolated PRO1488 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1488 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 1 to 220 of Figure 190 (SEQ ID NO: 330). In another aspect, the invention features amino acid residue 1 of Figure 190 (SEQ ID NO: 330).
To about 220, to at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95%. To an isolated PRO1488 polypeptide comprising an amino acid sequence having the sequence identity of In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 1-220 of Figure 190 (SEQ ID NO: 330). It relates to an isolated PRO1488 polypeptide which comprises an amino acid sequence with a positive, most preferably at least about 95% positive score.

In a still further aspect, the invention comprises a sequence of amino acid residues 1 to about 220 of Figure 190 (SEQ ID NO: 330), or a fragment thereof sufficient to bind an anti-PRO1488 antibody. Isolated PRO1488 polypeptide. Preferably, the PRO1488 fragment retains the qualitative biological activity of the native PRO1488 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
PRO having a sequence of about 1 to about 220 amino acid residues of 90 (SEQ ID NO: 330)
A DNA molecule encoding a 1488 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule is at least about 80% sequence identity, preferably at least about 8
(Ii) expressing a host cell containing a test DNA molecule into a polypeptide if it has 5% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Under conditions suitable for and (ii
i) providing a polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1488 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1488 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1488 polypeptide by contacting the native PRO1488 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising the PRO1488 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

96. PRO1489 Clostridium perfringent enterotoxin receptor (CPE-R), which is named "PRO1489" in the present application, encodes a novel polypeptide.
) Was identified as a cDNA clone (DNA73737-1658). In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1489 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule that encodes a PRO1489 polypeptide having a sequence from about 1 to about 173 amino acid residues of Figure 192 (SEQ ID NO: 332), or (b) (a). Of at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity to the complement of a DNA molecule of It comprises DNA having sequence identity. In another aspect, the invention provides a PRO comprising a DNA that hybridizes to the complement of the nucleic acid from about nucleotide 264 to about 782 of Figure 191 (SEQ ID NO: 331).
It relates to an isolated nucleic acid molecule encoding a 1489 polypeptide. Preferably,
Hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA73737-1658) of ATCC Deposit No. 203412, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203412 (DNA73737-1658). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of amino acid residues 1 to about 173 of Figure 192 (SEQ ID NO: 332), More preferably, it comprises a DNA encoding a polypeptide having at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) a complement of a DNA molecule of (a). Relates to separated nucleic acid molecules. In a further aspect, the invention provides a test DNA molecule comprising (a) a DNA molecule encoding a PRO1489 polypeptide having a sequence from amino acid residue 1 to about 173 of Fig192 (SEQ ID NO: 332), or (b) (a). ) DNA molecule complement,
Hybridized under stringent conditions, the DNA molecule has at least about 80% sequence identity to (a) or (b), preferably at least about 85% sequence identity, more preferably at least about 90%. Of a nucleic acid molecule having at least about 25 nucleotides produced by isolating a test DNA molecule having at least about 95% sequence identity. In a particular embodiment, the present invention relates to PR with or without initiation methionine.
There is provided an isolated nucleic acid molecule comprising DNA encoding an O1489 polypeptide, and a solubilized, ie transmembrane domain deleted or inactivated variant thereof, or is complementary to such an encoded nucleic acid molecule. . The transmembrane domain extends from about amino acid position 31 to about amino acid position 51, from about amino acid position 71 to about amino acid position 90, and from about amino acid position 112 to about amino acid position 133 in the PRO1489 amino acid sequence (Fig192, SEQ ID NO: 332). Has been tentatively identified as.

In another aspect, the invention features (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residues 1 to about 173 of Figure 192 (SEQ ID NO: 332). , More preferably at least about 90% positive, most preferably at least about 95% positive, a DNA molecule encoding a polypeptide, or an isolated nucleic acid molecule comprising the complement of a DNA molecule of (b) (a). Regarding Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1489 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides in length, preferably about 20 to about 60 nucleotides in length, more preferably about 20 to about 50 nucleotides in length, most preferably about 20 to about 40 nucleotides in length, as shown in Figure 191 (SEQ ID NO: 331). It is derived from the nucleotide sequence shown. In another embodiment, the invention provides an isolated PRO1489 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1489 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 1-173 of Figure 192 (SEQ ID NO: 332). In another aspect, the invention features amino acid residue 1 of Figure 192 (SEQ ID NO: 332).
To about 173, to at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95%. To an isolated PRO1489 polypeptide comprising an amino acid sequence having the sequence identity of In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 1-173 of Figure 192 (SEQ ID NO: 332). It relates to an isolated PRO1489 polypeptide, which comprises an amino acid sequence with a positive, most preferably at least about 95% positive score. In a still further aspect, the invention provides an isolated sequence comprising the sequence of amino acid residues 1 to about 173 of Figure 192 (SEQ ID NO: 332), or a fragment thereof sufficient to bind an anti-PRO1489 antibody. It relates to PRO1489 polypeptides. Preferably, the PRO1489 fragment retains the qualitative biological activity of the native PRO1489 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
PRO1 having the sequence of amino acid residues 1 to about 173 of 92 (SEQ ID NO: 332)
A DNA molecule encoding a 489 polypeptide, or (b) a complement of the DNA molecule of (a), is hybridized under stringent conditions, and the test DNA molecule is (a) or (
at least about 80% sequence identity to b), preferably at least about 85
(Ii) a host cell containing the test DNA molecule for expression of the polypeptide if it has a sequence identity of%, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Culture under suitable conditions, and (iii
) Providing a polypeptide produced by recovering the polypeptide from a cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1489 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1489 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1489 polypeptide by contacting the native PRO1489 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising a PRO1489 polypeptide, or agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

97. PRO1474 In the present application, a cDNA clone (DNA73739-1) named "PRO1474", which encodes a novel polypeptide having sequence identity with ovomucoid.
645) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1474 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1474 polypeptide having a sequence from about 1 or about 20 to about 85 amino acid residues of Figure 194 (SEQ ID NO: 334), or (b) At least about 80% sequence identity to the complement of the DNA molecule of (a), preferably at least about 85% sequence identity,
More preferably it comprises DNA having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In another aspect, the invention features about residue 102 of Figure 193 (SEQ ID NO: 333).
To PRO299 containing DNA hybridizing to the complement of about 299 nucleic acids from
It relates to an isolated nucleic acid molecule encoding a polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA73739-1645) of ATCC Deposit No. 203270, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203270 (DNA73739-1645). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 20 to about 85 amino acid residues of Figure 194 (SEQ ID NO: 334). , More preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a DNA encoding a polypeptide, or (b) a complement of a DNA molecule of (a). It relates to an isolated nucleic acid molecule. In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO1474 having a sequence from about 20 to about 85 amino acid residues of Figure 194 (SEQ ID NO: 334).
Hybridizing with a DNA molecule encoding a polypeptide, or (b) the complement of a DNA molecule of (a) under stringent conditions, wherein the DNA molecule is at least about 80% relative to (a) or (b) A test DNA molecule is isolated if it has at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. And an isolated nucleic acid molecule having at least about 50 nucleotides, preferably at least about 100 nucleotides.

[0289] In another aspect, the invention features (a) about 2 residues of Figure 194 (SEQ ID NO: 334).
At least about 80% positive when compared to the 0 to about 85 amino acid sequence,
Preferably at least about 85% positive, more preferably at least about 90%
A DNA molecule encoding a polypeptide positive, most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising (b) (a) the complement of the DNA molecule. Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1474 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long. In another embodiment, the invention provides an isolated PRO1474 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1474 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 20 to 85 of Figure 194 (SEQ ID NO: 334). In another aspect, the invention features amino acid residue 2 of Figure 194 (SEQ ID NO: 334).
0 to about 85 to at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity. It relates to an isolated PRO1474 polypeptide, which comprises an amino acid sequence having% sequence identity. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 20 to 85 of Figure 194 (SEQ ID NO: 334). It relates to an isolated PRO1474 polypeptide which comprises an amino acid sequence with a score of positive, most preferably at least about 95% positive.

In a still further aspect, the invention comprises a sequence from amino acid residue 1 or 20 to about 85 of Figure 194 (SEQ ID NO: 334), or a fragment thereof sufficient to bind an anti-PRO1474 antibody. , An isolated PRO1474 polypeptide. Preferably, the PRO1474 fragment retains the qualitative biological activity of the native PRO1474 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
PRO having a sequence of about 20 to about 85 amino acid residues of 94 (SEQ ID NO: 334)
A DNA molecule encoding a 1474 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule is at least about 80% sequence identity, preferably at least about 8
(Ii) expressing a host cell containing a test DNA molecule into a polypeptide if it has 5% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Under conditions suitable for and (ii
i) providing a polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1474 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1474 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1474 polypeptide by contacting the native PRO1474 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising a PRO1474 polypeptide, or agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

98. PRO1508 In the present application, a cDNA clone (DNA73742-1662) named "PRO1508" and encoding a novel secreted polypeptide was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1508 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1508 polypeptide having the sequence from about amino acid residue 1 or about 31 to about 148 of Figure 196 (SEQ ID NO: 336), or (b). For the complement of the DNA molecule of (a),
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. . In another aspect, the invention features about residue 160 of Figure 195 (SEQ ID NO: 335).
PRO1508 containing DNA hybridizing to the complement of about 513 nucleic acids from
It relates to an isolated nucleic acid molecule encoding a polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203316 (DNA7374-21662), or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203316 (DNA73742-1662). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of amino acid residues about 31 to about 148 of Figure 196 (SEQ ID NO: 336). , And more preferably at least about 90%
To a DNA encoding a polypeptide having sequence identity of, most preferably at least about 95% sequence identity, or (b) an isolated nucleic acid molecule comprising the complement of the DNA molecule of (a). In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO150 having a sequence from about amino acid residue 31 to about 148 amino acids of Figure 196 (SEQ ID NO: 336).
At least about 80 relative to (a) or (b), wherein said DNA molecule hybridizes with a DNA molecule encoding 8 polypeptide or (b) the complement of the DNA molecule of (a) under stringent conditions. Isolating a test DNA molecule when it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Produced by at least about 50 nucleotides, preferably at least about 100 nucleotides
It relates to an isolated nucleic acid molecule having nucleotides.

In a particular embodiment, the invention provides an isolated nucleic acid molecule comprising a DNA encoding a PRO1508 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, or Is complementary to such an encoded nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 30 of Figure 196 (SEQ ID NO: 336). In another aspect, the invention provides (a) residue 31 of Figure 196 (SEQ ID NO: 336).
To at least about 80% positive when compared to about 148 amino acid sequences,
Preferably at least about 85% positive, more preferably at least about 90%
A DNA molecule encoding a polypeptide positive, most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising (b) (a) the complement of the DNA molecule. Another embodiment is a PR that finds use as a hybridization probe.
O1508 polypeptide coding sequence fragments. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long. In another embodiment, the invention provides an isolated PRO1508 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1508 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 31 to 148 of Figure 196 (SEQ ID NO: 336). In another aspect, the invention features amino acid residue 3 of Figure 196 (SEQ ID NO: 336).
1 to about 148, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90%.
Of a PRO1508 polypeptide comprising an amino acid sequence having sequence identity of, most preferably at least about 95% sequence identity. In a further aspect, the invention features about residue 31 of Figure 196 (SEQ ID NO: 336).
To 148 amino acid sequences, at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive, most preferably at least about 95% positive. , An isolated PRO1508 polypeptide. In a still further aspect, the invention features an isolated PRO1508 comprising the sequence of amino acid residues 31 to 148 of Figure 196 (SEQ ID NO: 336), or a fragment thereof sufficient to bind an anti-PRO1508 antibody. Relates to polypeptides. Preferably, this PRO1508 fragment retains the qualitative biological activity of the native PRO1508 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
PR having a sequence of about 31 to about 148 amino acid residues of 96 (SEQ ID NO: 336)
A DNA molecule encoding the O1508 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule is at least about (Ii) testing if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. DNA
A host cell containing the molecule is cultured under conditions suitable for expression of the polypeptide, and (i
ii) Providing the polypeptide produced by recovering the polypeptide from the cell culture medium.

99. PRO1555 In the present application, a cDNA clone (DNA73744-1665), which is named "PRO1555" and which encodes a novel transmembrane polypeptide, was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1555 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule that encodes a PRO1555 polypeptide having the sequence from about 1 or about 32 to about 246 amino acid residues of Figure 198 (SEQ ID NO: 338), or (b). For the complement of the DNA molecule of (a),
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. . In another aspect, the invention features an isolated nucleic acid molecule that encodes a PRO1555 polypeptide that comprises DNA that hybridizes to the complement of the nucleic acid at residues 83 to 827 of Figure 197 (SEQ ID NO: 337). Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203322 (DNA73744-1665), or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203322 (DNA73744-1665). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about amino acid residue 32 to about 246 of Figure 198 (SEQ ID NO: 338). , And more preferably at least about 90%
To a DNA encoding a polypeptide having sequence identity of, most preferably at least about 95% sequence identity, or (b) an isolated nucleic acid molecule comprising the complement of the DNA molecule of (a). In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO155 having a sequence from about amino acid residue 32 to about 246 of Figure 198 (SEQ ID NO: 338).
Hybridizing with a DNA molecule encoding a 5 polypeptide or (b) the complement of the DNA molecule of (a) under stringent conditions, wherein the DNA molecule has at least about 80 Isolate a test DNA molecule if it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Produced by at least about 50 nucleotides, preferably at least about 100 nucleotides
It relates to an isolated nucleic acid molecule having nucleotides.

In a particular aspect, the invention provides a PRO1555 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and its solubilization (ie transmembrane domain deletion or inactivation). An isolated nucleic acid molecule comprising DNA encoding a variant is provided, or is complementary to such an encoding nucleic acid molecule.
The signal peptide is tentatively said to extend from amino acid position 1 to about amino acid position 31 of Figure 198 (SEQ ID NO: 338). Two transmembrane domains
It has been tentatively identified as extending from about amino acid position 1 to about amino acid position 32, and from about amino acid position 195 to about amino acid position 217 of the PRO1555 amino acid sequence (Fig 198, SEQ ID NO: 338). In another aspect, the invention provides (a) residue 32 of Figure 198 (SEQ ID NO: 338).
To at least about 80% positive when compared to the amino acid sequence of about 246,
Preferably at least about 85% positive, more preferably at least about 90%
A DNA molecule encoding a polypeptide positive, most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising (b) (a) the complement of the DNA molecule. Another embodiment is a PR that finds use as a hybridization probe.
It relates to fragments of the O1555 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long. In another embodiment, the invention provides an isolated PRO1555 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1555 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 32-246 of Figure 198 (SEQ ID NO: 338). In another aspect, the invention features amino acid residue 3 of Figure 198 (SEQ ID NO: 338).
2 to about 246, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90%.
To a PRO1555 polypeptide which comprises an amino acid sequence having sequence identity of, most preferably at least about 95% sequence identity. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 32 to 246 of Figure 198 (SEQ ID NO: 338). It relates to an isolated PRO1555 polypeptide which comprises an amino acid sequence with a positive, most preferably at least about 95% positive score. In a still further aspect, the invention provides an isolated sequence comprising the sequence of amino acid residues 32 to about 246 of Figure 198 (SEQ ID NO: 338), or a fragment thereof sufficient to bind an anti-PRO1555 antibody. It relates to PRO1555 polypeptides.
Preferably, this PRO1555 fragment retains the qualitative biological activity of the native PRO1555 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig1.
PR having a sequence of about 32 to about 246 amino acid residues of 98 (SEQ ID NO: 338)
A DNA molecule encoding the O1555 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule is at least about (Ii) testing if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. DNA
A host cell containing the molecule is cultured under conditions suitable for expression of the polypeptide, and (i
ii) Providing the polypeptide produced by recovering the polypeptide from the cell culture medium.

100. PRO1485 Named "PRO1485" in the present application and is a cDNA encoding a novel polypeptide having sequence identity with a lysozyme, especially a lysozyme C precursor.
The A clone (DNA73746-1654) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1485 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1485 polypeptide having amino acid residue 1 of Figure 200 (SEQ ID NO: 340) or a sequence from about 19 to about 148, or (b) ( at least about 80% sequence identity, preferably at least about 85% sequence identity to the complement of the DNA molecule of a),
More preferably it comprises DNA having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In another aspect, the invention features about residue 205 of Figure 199 (SEQ ID NO: 339).
To PRO594 containing DNA hybridizing to the complement of about 594 nucleic acids from
It relates to an isolated nucleic acid molecule encoding a polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA73746-1654) of ATCC Deposit No. 203411, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203411 (DNA73746-1654).

In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence of about amino acid residues 19 to about 148 of Figure 200 (SEQ ID NO: 340). Sequence identity, more preferably at least about 90%
To a DNA encoding a polypeptide having sequence identity of, most preferably at least about 95% sequence identity, or (b) an isolated nucleic acid molecule comprising the complement of the DNA molecule of (a). In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO148 having a sequence of about 19 to about 148 amino acid residues of Figure 200 (SEQ ID NO: 340).
Hybridizing with a DNA molecule encoding a 5 polypeptide or (b) the complement of the DNA molecule of (a) under stringent conditions, wherein the DNA molecule has at least about 80 Isolate a test DNA molecule if it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Produced by at least about 50 nucleotides, preferably at least about 100 nucleotides
It relates to an isolated nucleic acid molecule having nucleotides. In another aspect, the invention provides (a) residue 19 of Figure 200 (SEQ ID NO: 340).
To at least about 80% positive when compared to about 148 amino acid sequences,
Preferably at least about 85% positive, more preferably at least about 90%
A DNA molecule encoding a polypeptide positive, most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising (b) (a) the complement of the DNA molecule. Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1485 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long. In another embodiment, the invention provides an isolated PRO1485 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1485 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 19 to 148 of Figure 200 (SEQ ID NO: 340). In another aspect, the invention features amino acid residue 1 of Figure 200 (SEQ ID NO: 340).
9 to about 148, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90%.
To an isolated PRO1485 polypeptide comprising an amino acid sequence having sequence identity of, most preferably at least about 95% sequence identity.

In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 80% positive when compared to the amino acid sequence of residues 19 to 148 of Figure 200 (SEQ ID NO: 340). It relates to an isolated PRO1485 polypeptide which comprises an amino acid sequence with a score of about 90% positive, most preferably at least about 95% positive. In a still further aspect, the invention provides an isolated sequence comprising the sequence of amino acid residues 19 to about 148 of Figure 200 (SEQ ID NO: 340), or a fragment thereof sufficient to bind an anti-PRO1485 antibody. It relates to PRO1485 polypeptides.
Preferably, the PRO1485 fragment retains the qualitative biological activity of the native PRO1485 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig2
PR having a sequence of about 19 to about 148 amino acid residues of 00 (SEQ ID NO: 340)
A DNA molecule encoding the O1485 polypeptide or (b) a complement of the DNA molecule of (a) is hybridized under stringent conditions such that the test DNA molecule is at least about (Ii) test if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. DNA
A host cell containing the molecule is cultured under conditions suitable for expression of the polypeptide, and (i
ii) Providing the polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1485 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1485 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1485 polypeptide by contacting the native PRO1485 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a yet further embodiment, the invention relates to a composition comprising a PRO1485 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

101. PRO1564 In the present application, a cDNA clone (DNA73760-1672) designated as "PRO1564" and having homology with a nucleic acid encoding N-acetylgalactosaminyltransferase, which encodes a novel polypeptide, was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1564 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule that encodes a PRO1564 polypeptide having a sequence from about 1 or about 29 to about 639 amino acid residues of Figure 202 (SEQ ID NO: 347), or (b) For the complement of the DNA molecule of (a),
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. . In another aspect, the invention provides a DN that hybridizes to the complement of the nucleic acid of about nucleotide 462 or about 546 to about 2378 of Figure 201 (SEQ ID NO: 346).
An isolated nucleic acid molecule encoding a PRO1564 polypeptide comprising A. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA73760-1672) of ATCC Deposit No. 203314, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203314 (DNA73760-1672). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence with amino acid residue 1 of Fig202 (SEQ ID NO: 347) or the sequence from about 29 to about 639. DNA comprising a polypeptide having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or complement of a DNA molecule of (b) (a). To an isolated nucleic acid molecule consisting of In a further aspect, the invention provides a test DNA molecule comprising: (a) a PRO having amino acid residue 1 of Fig202 (SEQ ID NO: 347) or a sequence from about 29 to about 639.
Hybridized with a DNA molecule encoding the 1564 polypeptide or (b) the complement of the DNA molecule of (a) under stringent conditions such that the DNA molecule (a) or (b)
) To at least about 80% sequence identity, preferably at least about 85%
At least about 457 nucleotides prepared by isolating a test DNA molecule having sequence identity of, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Having an isolated nucleic acid molecule.

In a particular embodiment, the invention provides PRO1564 polypeptides with or without an N-terminal signal sequence and / or an initiation methionine, and solubilizing, ie transmembrane domain deletion or inactivating variants thereof. Providing an isolated nucleic acid molecule comprising DNA encoding, or being complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 28 of Figure 202 (SEQ ID NO: 347). The transmembrane domain is PRO1
About 11 amino acid positions in the 564 amino acid sequence (Fig202, SEQ ID NO: 347)
Has been tentatively identified as extending from to amino acid position 36. In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residue 202 of Figure 202 (SEQ ID NO: 347) or from about 29 to about 639. , More preferably at least about 90% positive, most preferably at least about 95% positive, a DNA molecule encoding a polypeptide, or an isolated nucleic acid molecule comprising the complement of a DNA molecule of (b) (a). Regarding Another embodiment is a PR that finds use as a hybridization probe.
It relates to fragments of the O1564 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides in length, preferably about 20 to about 60 nucleotides in length, more preferably about 20 to about 50 nucleotides in length, most preferably about 20 to about 40 nucleotides in length and shown in FIG. 201 (SEQ ID NO: 346). It is derived from the nucleotide sequence shown. In another embodiment, the invention provides an isolated PRO1564 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1564 polypeptide, which in one embodiment comprises an amino acid sequence comprising residue 1 of Figure 202 (SEQ ID NO: 347) or about 29-639. There is. In another aspect, the invention features amino acid residue 1 of Figure 202 (SEQ ID NO: 347).
Or at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 80% sequence identity to the sequence contained in about 29 to about 639. It relates to an isolated PRO1564 polypeptide which comprises an amino acid sequence having about 95% sequence identity.

In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, when compared to the amino acid sequence of residue 1 or about 29 to 639 of Fig202 (SEQ ID NO: 347), more preferably at least about 85% positive. Preferably at least about 9
It relates to an isolated PRO1564 polypeptide which comprises an amino acid sequence with a score of 0% positive, most preferably at least about 95% positive. In a still further aspect, the invention comprises a single amino acid residue 1 of Fig202 (SEQ ID NO: 347) or a sequence from about 29 to about 639, or a fragment thereof sufficient to bind an anti-PRO1564 antibody. Isolated PRO1564 polypeptide. Preferably, this PRO1564 fragment retains the qualitative biological activity of the native PRO1564 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig2
02 (SEQ ID NO: 347) amino acid residue 1 or a DNA molecule encoding a PRO1564 polypeptide having a sequence from about 29 to about 639, or (b) (a) D
Hybridization with the complement of the NA molecule under stringent conditions allows the test DNA molecule to
at least about 80% sequence identity to a) or (b), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity,
Most preferably, (ii) culturing a host cell containing a test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) culturing the polypeptide from the cell culture medium, provided that it has at least about 95% sequence identity. A polypeptide produced by recovering is provided. In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1564 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1564 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1564 polypeptide by contacting the native PRO1564 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In yet a further embodiment, the invention relates to a composition comprising a PRO1564 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

102. PRO1755 In the present application, a cDNA clone (DNA76396-1698) has been identified, which has been named "PRO1755" and which encodes a novel transmembrane polypeptide. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1755 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1755 polypeptide having the sequence of about amino acid residue 1 or about 32 to about 276 of Figure 204 (SEQ ID NO: 352), or (b) For the complement of the DNA molecule of (a),
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. . In another aspect, the invention features residues about 151 of Figure 203 (SEQ ID NO: 351).
To PRO8755 containing DNA that hybridizes to the complement of about 885 nucleic acids from
It relates to an isolated nucleic acid molecule encoding a polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203471 (DNA76396-1698), or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203471 (DNA76396-1698). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of about amino acid residues 32 to about 276 of Figure 204 (SEQ ID NO: 352). , And more preferably at least about 90%
To a DNA encoding a polypeptide having sequence identity of, most preferably at least about 95% sequence identity, or (b) an isolated nucleic acid molecule comprising the complement of the DNA molecule of (a). In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO175 having a sequence from about amino acid residue 32 to about 276 of Fig204 (SEQ ID NO: 352).
Hybridizing with a DNA molecule encoding a 5 polypeptide or (b) the complement of the DNA molecule of (a) under stringent conditions, wherein the DNA molecule has at least about 80 Isolate a test DNA molecule if it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Produced by at least about 50 nucleotides, preferably at least about 100 nucleotides
It relates to an isolated nucleic acid molecule having nucleotides.

In a particular embodiment, the invention provides a PRO1755 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and its solubilization (ie transmembrane domain deletion or inactivation). An isolated nucleic acid molecule comprising DNA encoding a variant is provided, or is complementary to such an encoding nucleic acid molecule.
The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 31 of Figure 204 (SEQ ID NO: 352). The transmembrane domain is PR
It has been tentatively identified as extending from about amino acid position 178 to about amino acid position 198 of the O1755 amino acid sequence (Fig204, SEQ ID NO: 352). In another aspect, the invention provides (a) residue 32 of Figure 204 (SEQ ID NO: 352).
To at least about 80% positive when compared to about 276 amino acid sequences,
Preferably at least about 85% positive, more preferably at least about 90%
A DNA molecule encoding a polypeptide positive, most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising (b) (a) the complement of the DNA molecule. Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1755 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long. In another embodiment, the invention provides an isolated PRO1755 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1755 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 32-276 of Figure 204 (SEQ ID NO: 352). In another aspect, the invention features amino acid residue 3 of Figure 204 (SEQ ID NO: 352).
2 to about 276, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90%.
Of sequence identity, most preferably at least about 95% sequence identity, to an isolated PRO1755 polypeptide. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 32-276 of Figure 204 (SEQ ID NO: 352). It relates to an isolated PRO1755 polypeptide, which comprises an amino acid sequence with a positive, most preferably at least about 95% positive score. In a still further aspect, the invention provides an isolated sequence comprising the sequence of amino acid residues 32 to about 276 of Figure 204 (SEQ ID NO: 352), or a fragment thereof sufficient to bind an anti-PRO1755 antibody. It relates to PRO1755 polypeptides.
Preferably, this PRO1755 fragment retains the qualitative biological activity of the native PRO1755 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig2
PR having a sequence of about amino acid residues 32 to about 276 of 04 (SEQ ID NO: 352)
A DNA molecule encoding the O1755 polypeptide, or (b) a complement of the DNA molecule of (a), is hybridized under stringent conditions such that the test DNA molecule is at least about (Ii) testing if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. DNA
A host cell containing the molecule is cultured under conditions suitable for expression of the polypeptide, and (i
ii) Providing the polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1755 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1755 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1755 polypeptide by contacting the native PRO1755 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a yet further embodiment, the invention relates to a composition comprising a PRO1755 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

103. PRO1757 In this application, a cDNA clone (DNA76398-1699) has been identified, designated "PRO1757", which encodes a novel transmembrane polypeptide. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1757 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1757 polypeptide having a sequence of about 1 or about 20 to about 121 amino acid residues of Figure 206 (SEQ ID NO: 354), or (b) For the complement of the DNA molecule of (a),
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. . In another aspect, the invention features an isolated nucleic acid molecule encoding a PRO1757 polypeptide comprising a DNA that hybridizes to the complement of a nucleic acid from about nucleotide 59 or about 116 to about 121 of Figure 205 (SEQ ID NO: 353). Regarding Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA76398-1699) of ATCC Deposit No. 203474, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203474 (DNA76398-1699). In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence with amino acid residue 1 of Figure 206 (SEQ ID NO: 354) or the sequence from about 20 to about 121. A DNA encoding a polypeptide having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) complement of the DNA molecule of (a). To an isolated nucleic acid molecule consisting of

In a further aspect, the invention provides a test DNA molecule comprising: (a) a PRO having amino acid residue 1 of Fig206 (SEQ ID NO: 354) or a sequence of about 20 to about 121.
A DNA molecule encoding a 1757 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions such that the DNA molecule (a) or (b)
) To at least about 80% sequence identity, preferably at least about 85%
Having at least 125 nucleotides prepared by isolating a test DNA molecule when having sequence identity of, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a particular aspect, the invention encodes a PRO1757 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and solubilizing, ie transmembrane domain deletion or inactivating variants thereof. An isolated nucleic acid molecule containing DNA is provided or is complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 19 of Figure 206 (SEQ ID NO: 354). The transmembrane domain is PRO1
About amino acid position 91 of the 757 amino acid sequence (Fig206, SEQ ID NO: 354)
Has been tentatively identified as extending from to about 110 amino acid positions. In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residue 1 or about 20 to about 121 of Figure 206 (SEQ ID NO: 354). , More preferably at least about 90% positive, most preferably at least about 95% positive, a DNA molecule encoding a polypeptide, or an isolated nucleic acid molecule comprising the complement of (b) (a) a DNA molecule. Regarding Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1757 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides in length, preferably about 20 to about 60 nucleotides in length, more preferably about 20 to about 50 nucleotides in length, most preferably about 20 to about 40 nucleotides in length and shown in Fig 205 (SEQ ID NO: 353). It is derived from the nucleotide sequence shown. In another embodiment, the invention provides an isolated PRO1757 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1757 polypeptide, which in one embodiment comprises an amino acid sequence comprising residue 1 or about 20 to 121 of Figure 206 (SEQ ID NO: 354). There is.

In another aspect, the invention features amino acid residue 1 of Figure 206 (SEQ ID NO: 354).
Or at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 80% sequence identity to the sequence contained in about 20 to about 121. It relates to an isolated PRO1757 polypeptide, which comprises an amino acid sequence having about 95% sequence identity. In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least at least about 80% positive when compared to the amino acid sequence of residue 1 or about 20 to 121 of Figure 206 (SEQ ID NO: 354). About 9
It relates to an isolated PRO1757 polypeptide comprising an amino acid sequence with a score of 0% positive, most preferably at least about 95% positive. In a still further aspect, the invention comprises a single amino acid residue 1 of Figure 206 (SEQ ID NO: 354) or a sequence of about 20 to about 121, or a fragment thereof sufficient to bind an anti-PRO1757 antibody. Isolated PRO1757 polypeptide. Preferably, this PRO1757 fragment retains the qualitative biological activity of the native PRO1757 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig2
06 (SEQ ID NO: 354) amino acid residue 1 or a DNA molecule encoding a PRO1757 polypeptide having a sequence of about 20 to about 121, or D of (b) (a)
Hybridization with the complement of the NA molecule under stringent conditions allows the test DNA molecule to
at least about 80% sequence identity to a) or (b), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity,
Most preferably, (ii) culturing a host cell containing a test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) culturing the polypeptide from the cell culture medium, provided that it has at least about 95% sequence identity. A polypeptide produced by recovering is provided. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1757 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1757 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1757 polypeptide by contacting the native PRO1757 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a yet further embodiment, the invention relates to a composition comprising a PRO1757 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

104. PRO1758 In the present application, a cDNA clone (DNA76399-1700) designated as "PRO1758" and encoding a novel secretory polypeptide was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1758 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule that encodes a PRO1758 polypeptide having amino acid residue 1 of Figure 208 (SEQ ID NO: 356) or a sequence from about 16 to about 157, or (b) ( at least about 80% sequence identity, preferably at least about 85% sequence identity to the complement of the DNA molecule of a),
More preferably it comprises DNA having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In another aspect, the invention features about residue 123 of Figure 207 (SEQ ID NO: 355).
To PRO548 containing DNA hybridizing to the complement of about 548 nucleic acids from
It relates to an isolated nucleic acid molecule encoding a polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203472 (DNA76399-1700), or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203472 (DNA76399-1700). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 16 to about 157 amino acid residues of Figure 208 (SEQ ID NO: 356). , And more preferably at least about 90%
To a DNA encoding a polypeptide having sequence identity of, most preferably at least about 95% sequence identity, or (b) an isolated nucleic acid molecule comprising the complement of the DNA molecule of (a). In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO175 having a sequence from about 16 to about 157 amino acid residues of Figure 208 (SEQ ID NO: 356).
At least about 80 relative to (a) or (b), wherein said DNA molecule hybridizes with a DNA molecule encoding 8 polypeptide or (b) the complement of the DNA molecule of (a) under stringent conditions. Isolating a test DNA molecule when it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Produced by at least about 50 nucleotides, preferably at least about 100 nucleotides
It relates to an isolated nucleic acid molecule having nucleotides.

In a particular embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1758 polypeptide with or without an N-terminal signal sequence, or such an encoding nucleic acid. It is complementary to the molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 15 of Figure 208 (SEQ ID NO: 356). In another aspect, the invention features (a) about 1 residue of Figure 208 (SEQ ID NO: 356).
At least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to the 6 to about 157 amino acid sequence.
A DNA molecule encoding a polypeptide having a% positive score, most preferably at least about 95% positive score, or (b) an isolated nucleic acid molecule comprising the complement of the DNA molecule of (a). Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1758 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long. In another embodiment, the invention provides an isolated PRO1758 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1758 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 16 to 157 of Figure 208 (SEQ ID NO: 356). In another aspect, the invention features amino acid residue 1 of Figure 208 (SEQ ID NO: 356).
6 to about 157, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90%.
To a isolated PRO1758 polypeptide comprising an amino acid sequence having sequence identity of, most preferably at least about 95% sequence identity. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 16 to 157 of Figure 208 (SEQ ID NO: 356). It relates to an isolated PRO1758 polypeptide which comprises an amino acid sequence with a positive, most preferably at least about 95% positive, score. In a still further aspect, the invention provides an isolated sequence comprising the sequence of amino acid residues 16 to about 157 of Figure 208 (SEQ ID NO: 356), or a fragment thereof sufficient to bind an anti-PRO1758 antibody. It relates to PRO1758 polypeptides.
Preferably, the PRO1758 fragment retains the qualitative biological activity of the native PRO1758 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig2
PR having a sequence of about 16 to about 157 amino acid residues of 08 (SEQ ID NO: 356)
A DNA molecule encoding the O1758 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a), under stringent conditions, wherein the test DNA molecule is at least about relative to (a) or (b). (Ii) test if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. DNA
A host cell containing the molecule is cultured under conditions suitable for expression of the polypeptide, and (i
ii) Providing the polypeptide produced by recovering the polypeptide from the cell culture medium.

105. PRO1575 In the present application, a cDNA clone named "PRO1575" and encoding a novel polypeptide having homology with protein disulfide isomerase (D
NA76401-1683) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1575 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1575 polypeptide having amino acid residue 1 of Figure 210 (SEQ ID NO: 358) or a sequence of about 21 to about 273, or (b) ( at least about 80% sequence identity, preferably at least about 85% sequence identity to the complement of the DNA molecule of a),
More preferably it comprises DNA having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In another aspect, the invention features an isolated nucleic acid molecule encoding a PRO1575 polypeptide that comprises a DNA that hybridizes to the complement of a nucleic acid from about residue 82 to about 840 of Figure 209 (SEQ ID NO: 357). Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA76401-1683) of ATCC Deposit No. 203360, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203360 (DNA76401-1683). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of amino acid residues about 21 to about 273 of Fig210 (SEQ ID NO: 358). , And more preferably at least about 90%
To a DNA encoding a polypeptide having sequence identity of, most preferably at least about 95% sequence identity, or (b) an isolated nucleic acid molecule comprising the complement of the DNA molecule of (a). In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO157 having the sequence of about amino acid residues 21 to about 273 of Fig210 (SEQ ID NO: 358).
Hybridizing with a DNA molecule encoding a 5 polypeptide or (b) the complement of the DNA molecule of (a) under stringent conditions, wherein the DNA molecule has at least about 80 Isolate a test DNA molecule if it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Produced by at least about 50 nucleotides, preferably at least about 100 nucleotides
It relates to an isolated nucleic acid molecule having nucleotides.

In a particular aspect, the invention provides PRO1575 polypeptides with or without an N-terminal signal sequence and / or an initiation methionine, and solubilization thereof (ie, transmembrane domain deletion or inactivation). An isolated nucleic acid molecule comprising DNA encoding a variant is provided, or is complementary to such an encoding nucleic acid molecule.
The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 20 of Figure 210 (SEQ ID NO: 358). The transmembrane domain is PR
It has been tentatively identified as extending from about amino acid position 143 to about amino acid position 162 of the O1575 amino acid sequence (Fig210, SEQ ID NO: 358). In another aspect, the invention provides (a) residue 21 of Figure 210 (SEQ ID NO: 358).
To at least about 80% positive when compared to the about 273 amino acid sequence,
Preferably at least about 85% positive, more preferably at least about 90%
A DNA molecule encoding a polypeptide positive, most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising (b) (a) the complement of the DNA molecule. Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1575 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long. In another embodiment, the invention provides an isolated PRO1575 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1575 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 21 to 273 of Figure 210 (SEQ ID NO: 358).

In another aspect, the invention features amino acid residue 2 of Figure 210 (SEQ ID NO: 358).
1 to about 273, with at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90%.
To a isolated PRO1575 polypeptide comprising an amino acid sequence having sequence identity of, most preferably at least about 95% sequence identity. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 21 to 273 of Figure 210 (SEQ ID NO: 358). It relates to an isolated PRO1575 polypeptide, which comprises an amino acid sequence with a positive, most preferably at least about 95% positive score. In a still further aspect, the invention provides an isolated sequence comprising from amino acid residue 21 to about 273 of Fig210 (SEQ ID NO: 358), or a fragment thereof sufficient to bind an anti-PRO1575 antibody. It relates to PRO1575 polypeptides.
Preferably, the PRO1575 fragment retains the qualitative biological activity of the native PRO1575 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig2
PR having a sequence of about 21 to about 273 amino acid residues of 10 (SEQ ID NO: 358)
A DNA molecule encoding the O1575 polypeptide, or (b) a complement of the DNA molecule of (a), is hybridized under stringent conditions such that the test DNA molecule is at least about (Ii) testing if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. DNA
A host cell containing the molecule is cultured under conditions suitable for expression of the polypeptide, and (i
ii) Providing the polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1575 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1575 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1575 polypeptide by contacting the native PRO1575 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In yet a further embodiment, the invention relates to a composition comprising a PRO1575 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

106. PRO1787 In the present application, a cDNA clone (DNA76510-2) named "PRO1787", which encodes a novel polypeptide having sequence identity with myelin p0.
504) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1787 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1787 polypeptide having amino acid residue 1 of Figure 212 (SEQ ID NO: 364) or a sequence of about 38 to about 269, or (b) ( at least about 80% sequence identity, preferably at least about 85% sequence identity to the complement of the DNA molecule of a),
More preferably it comprises DNA having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In another aspect, the invention features about residue 274 of Figure 211 (SEQ ID NO: 363).
To PRO9787 containing DNA that hybridizes to the complement of about 969 nucleic acids from
It relates to an isolated nucleic acid molecule encoding a polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA76510-2504) of ATCC Deposit No. 203477, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203477 (DNA76510-2504). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of amino acid residues about 38 to about 269 of Figure 212 (SEQ ID NO: 364). , And more preferably at least about 90%
To a DNA encoding a polypeptide having sequence identity of, most preferably at least about 95% sequence identity, or (b) an isolated nucleic acid molecule comprising the complement of the DNA molecule of (a). In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO178 having a sequence from about amino acid residue 38 to about 269 of Fig212 (SEQ ID NO: 364).
Hybridizing with a DNA molecule encoding a 7 polypeptide or (b) the complement of the DNA molecule of (a) under stringent conditions such that the DNA molecule has at least about 80 relative to (a) or (b). Isolating a test DNA molecule when it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Produced by at least about 50 nucleotides, preferably at least about 100 nucleotides
It relates to an isolated nucleic acid molecule having nucleotides.

In a particular aspect, the invention provides PRO1787 polypeptides with or without an N-terminal signal sequence and / or an initiation methionine, and solubilizing, ie transmembrane domain deletion or inactivating, variants thereof. Providing an isolated nucleic acid molecule comprising DNA encoding, or being complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 37 of Figure 212 (SEQ ID NO: 364). The transmembrane domain is PRO1
Approximately 16 amino acid positions of the 787 amino acid sequence (Fig212, SEQ ID NO: 364)
It has been tentatively identified as extending from 1 to about amino acid position 183. In another aspect, the invention provides (a) residue 38 of Figure 212 (SEQ ID NO: 364).
To at least about 80% positive when compared to the about 269 amino acid sequence,
Preferably at least about 85% positive, more preferably at least about 90%
A DNA molecule encoding a polypeptide positive, most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising (b) (a) the complement of the DNA molecule. Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1787 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long. In another embodiment, the invention provides an isolated PRO1787 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1787 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 38 to 269 of Figure 212 (SEQ ID NO: 364). In another aspect, the invention features amino acid residue 3 of Figure 212 (SEQ ID NO: 364).
8 to about 269, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90%.
To a isolated PRO1787 polypeptide comprising an amino acid sequence having sequence identity of, most preferably at least about 95% sequence identity. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 38 to 269 of Figure 212 (SEQ ID NO: 364). It relates to an isolated PRO1787 polypeptide which comprises an amino acid sequence with a positive, most preferably at least about 95% positive score. In a still further aspect, the invention provides an isolated sequence comprising the sequence of amino acid residues 38 to about 269 of Figure 212 (SEQ ID NO: 364), or a fragment thereof sufficient to bind an anti-PRO1787 antibody. It relates to PRO1787 polypeptides.
Preferably, the PRO1787 fragment retains the qualitative biological activity of the native PRO1787 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig2
PR having a sequence of about 38 to about 269 amino acid residues of 12 (SEQ ID NO: 364)
A DNA molecule encoding the O1787 polypeptide or (b) a complement of the DNA molecule of (a) is hybridized under stringent conditions such that the test DNA molecule is at least about (Ii) testing if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. DNA
A host cell containing the molecule is cultured under conditions suitable for expression of the polypeptide, and (i
ii) Providing the polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1787 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1787 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1787 polypeptide by contacting the native PRO1787 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising a PRO1787 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

107. PRO1781 In the present application, a cDNA clone (DNA76522-2500) has been identified, which has been named “PRO1781” and which encodes a novel transmembrane polypeptide. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1781 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1781 polypeptide having amino acid residue 1 of Figure 214 (SEQ ID NO: 366) or a sequence from about 20 to about 373, or (b) ( at least about 80% sequence identity, preferably at least about 85% sequence identity to the complement of the DNA molecule of a),
More preferably it comprises DNA having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In another aspect, the invention features a PRO1781 that comprises a DNA that hybridizes to the complement of a nucleic acid from residues 78 to 1139 of Figure 213 (SEQ ID NO: 365).
It relates to an isolated nucleic acid molecule encoding a polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203469 (DNA76522-2500), or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203469 (DNA76522-2500). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence from about 20 to about 373 amino acid residues of Figure 214 (SEQ ID NO: 366). , And more preferably at least about 90%
To a DNA encoding a polypeptide having sequence identity of, most preferably at least about 95% sequence identity, or (b) an isolated nucleic acid molecule comprising the complement of the DNA molecule of (a). In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO178 having a sequence from about 20 to about 373 amino acid residues of Figure 214 (SEQ ID NO: 366).
Hybridizing with a DNA molecule encoding one polypeptide or (b) the complement of the DNA molecule of (a) under stringent conditions, wherein the DNA molecule is at least about 80 relative to (a) or (b). Isolating a test DNA molecule when it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Produced by at least about 50 nucleotides, preferably at least about 100 nucleotides
It relates to an isolated nucleic acid molecule having nucleotides.

In a particular aspect, the invention provides PRO1781 polypeptides with or without an N-terminal signal sequence and / or an initiation methionine, and solubilizing, ie transmembrane domain deletion or inactivating, variants thereof. Providing an isolated nucleic acid molecule comprising DNA encoding, or being complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 19 of Figure 214 (SEQ ID NO: 366). The transmembrane domain is PRO1
Approximately 39 amino acid positions of the 781 amino acid sequence (Fig214, SEQ ID NO: 366)
Tentatively identified as extending from about 60 amino acid positions. In another aspect, the invention provides (a) residue 20 of Figure 214 (SEQ ID NO: 366).
To at least about 80% positive when compared to the amino acid sequence of about 373,
Preferably at least about 85% positive, more preferably at least about 90%
A DNA molecule encoding a polypeptide positive, most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising (b) (a) the complement of the DNA molecule. Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1781 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long. In another embodiment, the invention provides an isolated PRO1781 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1781 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 20 to 373 of Figure 214 (SEQ ID NO: 366).

In another aspect, the invention features amino acid residue 2 of Figure 214 (SEQ ID NO: 366).
0 to about 373, and at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90%.
Of sequence identity, most preferably at least about 95% sequence identity, to an isolated PRO1781 polypeptide. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 20 to 373 of Figure 214 (SEQ ID NO: 366). It relates to an isolated PRO1781 polypeptide which comprises an amino acid sequence that scores positive, most preferably at least about 95% positive. In a still further aspect, the invention provides an isolated sequence comprising the sequence of amino acid residues 20 to about 373 of Figure 214 (SEQ ID NO: 366), or a fragment thereof sufficient to bind an anti-PRO1781 antibody. It relates to the PRO1781 polypeptide.
Preferably, the PRO1781 fragment retains the qualitative biological activity of the native PRO1781 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig2
PR having a sequence of about 20 to about 373 amino acid residues of SEQ ID NO: 14 (SEQ ID NO: 366)
A DNA molecule encoding the O1781 polypeptide or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule is at least about (Ii) testing if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. DNA
A host cell containing the molecule is cultured under conditions suitable for expression of the polypeptide, and (i
ii) Providing the polypeptide produced by recovering the polypeptide from the cell culture medium.

108. PRO1556 In the present application, a cDNA clone (DNA76529-1666) designated as "PRO1556" and encoding a novel transmembrane polypeptide was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1556 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1556 polypeptide having amino acid residue 1 of Figure 216 (SEQ ID NO: 372) or a sequence from about 25 to about 269, or (b) ( at least about 80% sequence identity, preferably at least about 85% sequence identity to the complement of the DNA molecule of a),
More preferably it comprises DNA having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In another aspect, the invention features about residue 160 of Figure 215 (SEQ ID NO: 371).
PRO1556 containing DNA hybridizing to the complement of about 891 nucleic acids from
It relates to an isolated nucleic acid molecule encoding a polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA76529-1666) of ATCC Deposit No. 203315, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203315 (DNA76529-1666). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of amino acid residues about 25 to about 269 of Figure 216 (SEQ ID NO: 372). , And more preferably at least about 90%
To a DNA encoding a polypeptide having sequence identity of, most preferably at least about 95% sequence identity, or (b) an isolated nucleic acid molecule comprising the complement of the DNA molecule of (a). In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO155 having the sequence of about amino acid residues 25 to about 269 of Fig216 (SEQ ID NO: 372).
Hybridizing with a DNA molecule encoding the 6 polypeptide or (b) the complement of the DNA molecule of (a) under stringent conditions, wherein the DNA molecule has at least about 80 relative to (a) or (b). Isolating a test DNA molecule when it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Produced by at least about 50 nucleotides, preferably at least about 100 nucleotides
It relates to an isolated nucleic acid molecule having nucleotides.

In a particular embodiment, the invention provides a PRO1556 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and its solubilization (ie transmembrane domain deletion or inactivation). An isolated nucleic acid molecule comprising DNA encoding a variant is provided, or is complementary to such an encoding nucleic acid molecule.
The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 24 of Figure 216 (SEQ ID NO: 372). The transmembrane domain is PR
O1556 amino acid sequence (FIG. 216, SEQ ID NO: 372) from about amino acid position 11 to about amino acid position 25, and from about amino acid position 226 to about amino acid position 2
It has been tentatively identified as extending to 43. In another aspect, the invention provides (a) residue 25 of Figure 216 (SEQ ID NO: 372).
To at least about 80% positive when compared to the about 269 amino acid sequence,
Preferably at least about 85% positive, more preferably at least about 90%
A DNA molecule encoding a polypeptide positive, most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising (b) (a) the complement of the DNA molecule. Another embodiment is a PR that finds use as a hybridization probe.
It relates to fragments of the O1556 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long. In another embodiment, the invention provides an isolated PRO1556 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1556 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 25 to 269 of Figure 216 (SEQ ID NO: 372). In another aspect, the invention features amino acid residue 2 of Figure 216 (SEQ ID NO: 372).
5 to about 269, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90%.
Of PRO1556 polypeptides comprising an amino acid sequence having sequence identity of, most preferably at least about 95% sequence identity. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 25 to 269 of Figure 216 (SEQ ID NO: 372). It relates to an isolated PRO1556 polypeptide which comprises an amino acid sequence with a positive, most preferably at least about 95% positive score. In a still further aspect, the invention provides an isolated sequence comprising the sequence of amino acid residues 25 to about 269 of Figure 216 (SEQ ID NO: 372), or a fragment thereof sufficient to bind an anti-PRO1556 antibody. It relates to the PRO1556 polypeptide.
Preferably, the PRO1556 fragment retains the qualitative biological activity of the native PRO1556 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig2
PR having a sequence of 16 (SEQ ID NO: 372) amino acid residues from about 25 to about 269
A DNA molecule encoding the O1556 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule is at least about (Ii) testing if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. DNA
A host cell containing the molecule is cultured under conditions suitable for expression of the polypeptide, and (i
ii) Providing the polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1556 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1556 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1556 polypeptide by contacting the native PRO1556 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a yet further embodiment, the invention relates to a composition comprising a PRO1556 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

109. PRO1759 A cDNA clone (DNA76531-170), which is named "PRO1759" in the present application, and which encodes a novel polypeptide having a plurality of transmembrane domains.
1) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1759 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule that encodes a PRO1759 polypeptide having amino acid residue 1 of Figure 218 (SEQ ID NO: 374) or a sequence of about 19 to about 450, or (b) ( at least about 80% sequence identity, preferably at least about 85% sequence identity to the complement of the DNA molecule of a),
More preferably it comprises DNA having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In another aspect, the invention features about residue 179 of Figure 217 (SEQ ID NO: 373).
To PRO175 containing DNA hybridizing to the complement of about 1474 nucleic acids from
It relates to an isolated nucleic acid molecule encoding a 9 polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA76531-1701) of ATCC Deposit No. 203465, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203465 (DNA76531-1701).

In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence of about amino acid residues 19 to about 450 of Figure 218 (SEQ ID NO: 374). Sequence identity, more preferably at least about 90%
To a DNA encoding a polypeptide having sequence identity of, most preferably at least about 95% sequence identity, or (b) an isolated nucleic acid molecule comprising the complement of the DNA molecule of (a). In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO175 having a sequence from about 19 to about 450 amino acid residues of Figure 218 (SEQ ID NO: 374).
At least about 80% of the DNA molecule with respect to (a) or (b) by hybridizing under stringent conditions with a DNA molecule encoding 9 polypeptide or (b) the complement of the DNA molecule of (a). Isolate a test DNA molecule if it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Produced by at least about 50 nucleotides, preferably at least about 100 nucleotides
It relates to an isolated nucleic acid molecule having nucleotides. In a particular aspect, the invention encodes a PRO1759 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and solubilizing, ie transmembrane domain deletion or inactivating variants thereof. An isolated nucleic acid molecule containing DNA is provided or is complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 18 of Figure 218 (SEQ ID NO: 374). The transmembrane domain is PRO1
Approximate amino acid 4 of the 759 amino acid sequence (Fig218, SEQ ID NO: 374)
1-55, 75-94, 127-143, 191-213, 249-270, 2
78-299, 314-330, 343-359, 379-394, and 410.
Tentatively identified as extending to -430. In another aspect, the invention provides (a) residue 19 of Figure 218 (SEQ ID NO: 374).
From at least about 80% positive when compared to about 450 amino acid sequences,
Preferably at least about 85% positive, more preferably at least about 90%
A DNA molecule encoding a polypeptide positive, most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising (b) (a) the complement of the DNA molecule. Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1759 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.

In another embodiment, the invention provides an isolated PRO1759 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1759 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 19 to 450 of Figure 218 (SEQ ID NO: 374). In another aspect, the invention features amino acid residue 1 of Figure 218 (SEQ ID NO: 374).
9 to about 450 sequences, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90%.
Of sequence identity, most preferably at least about 95% sequence identity, to an isolated PRO1759 polypeptide. In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 19 to 450 of Figure 218 (SEQ ID NO: 374). Relates to an isolated PRO1759 polypeptide comprising an amino acid sequence with a positive, most preferably at least about 95% positive score. In a still further aspect, the invention provides an isolated sequence comprising from amino acid residue 19 to about 450 of Figure 218 (SEQ ID NO: 374), or a fragment thereof sufficient to bind an anti-PRO1759 antibody. It relates to the PRO1759 polypeptide.
Preferably, this PRO1759 fragment retains the qualitative biological activity of the native PRO1759 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig2
PR having a sequence of about 19 to about 450 amino acid residues of 18 (SEQ ID NO: 374)
A DNA molecule encoding the O1759 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule is at least about (Ii) testing if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. DNA
A host cell containing the molecule is cultured under conditions suitable for expression of the polypeptide, and (i
ii) Providing the polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the present invention relates to agonists and antagonists of native PRO1759 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1759 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1759 polypeptide by contacting the native PRO1759 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a yet further embodiment, the invention relates to a composition comprising a PRO1759 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

110. PRO1760 In the present application, a cDNA clone (DNA76532-1702) named "PRO1760" and encoding a novel secreted polypeptide was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1760 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1760 polypeptide having the sequence of amino acid residues about 1 or about 21 to about 188 of Fig220 (SEQ ID NO: 376), or (b) For the complement of the DNA molecule of (a),
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. . In another aspect, the invention features about residue 120 of Figure 219 (SEQ ID NO: 375).
From PRO1760 containing DNA hybridizing to the complement of about 623 nucleic acids from
It relates to an isolated nucleic acid molecule encoding a polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA76532-1702) of ATCC Deposit No. 203473, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203473 (DNA76532-1702). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of about amino acid residues 21 to about 188 of Fig220 (SEQ ID NO: 376). , And more preferably at least about 90%
To a DNA encoding a polypeptide having sequence identity of, most preferably at least about 95% sequence identity, or (b) an isolated nucleic acid molecule comprising the complement of the DNA molecule of (a). In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO176 having a sequence from about 21 to about 188 amino acid residues of FIG.
At least about 80 relative to (a) or (b) by hybridizing under stringent conditions with a DNA molecule encoding the 0 polypeptide, or (b) the complement of the DNA molecule of (a). Isolate a test DNA molecule if it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Produced by at least about 50 nucleotides, preferably at least about 100 nucleotides
It relates to an isolated nucleic acid molecule having nucleotides.

In another aspect, the invention features (a) residue 21 of Figure 220 (SEQ ID NO: 376).
To at least about 80% positive when compared to the about 188 amino acid sequence,
Preferably at least about 85% positive, more preferably at least about 90%
A DNA molecule encoding a polypeptide positive, most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising (b) (a) the complement of the DNA molecule. Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1760 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long. In another embodiment, the invention provides an isolated PRO1760 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1760 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 21 to 188 of Figure 220 (SEQ ID NO: 376). In another aspect, the invention features amino acid residue 2 of Figure 220 (SEQ ID NO: 376).
1 to about 188, with at least about 80% sequence identity, preferably at least about 85% sequence identity, and more preferably at least about 90%.
Of sequence identity, most preferably at least about 95% sequence identity, to an isolated PRO1760 polypeptide. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 21 to 188 of Figure 220 (SEQ ID NO: 376). It relates to an isolated PRO1760 polypeptide comprising an amino acid sequence with a positive, most preferably at least about 95% positive score.

In a yet further aspect, the invention comprises a sequence of amino acid residues 21 to about 188 of Figure 220 (SEQ ID NO: 376), or a fragment thereof sufficient to bind an anti-PRO1760 antibody. Isolated PRO1760 polypeptide.
Preferably, this PRO1760 fragment retains the qualitative biological activity of the native PRO1760 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig2
PR having a sequence of about 20 to about 188 amino acid residues of 20 (SEQ ID NO: 376)
A DNA molecule encoding the O1760 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule is at least about (Ii) testing if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. DNA
A host cell containing the molecule is cultured under conditions suitable for expression of the polypeptide, and (i
ii) Providing the polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1760 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1760 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1760 polypeptide by contacting the native PRO1760 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising a PRO1760 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

111. PRO1561 Named “PRO1561” in the present application, cD having homology with a nucleic acid encoding a human phospholipase A2 protein encoding a novel polypeptide.
The NA clone (DNA76538-1670) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1561 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1561 polypeptide having the sequence of about amino acid residue 1 or about 18 to about 116 of Figure 222 (SEQ ID NO: 378), or (b) For the complement of the DNA molecule of (a),
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. . In another aspect, the invention features an isolated nucleic acid molecule encoding a PRO1561 polypeptide that comprises DNA that hybridizes to the complement of the nucleic acid of about nucleotide 29 or about 80 to about 376 of Figure 221 (SEQ ID NO: 377). Regarding Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA76538-1670) of ATCC Deposit No. 203313, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203313 (DNA76538-1670). In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence with amino acid residue 1 of Figure 222 (SEQ ID NO: 378) or the sequence from about 18 to about 116. DNA comprising a polypeptide having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or complement of a DNA molecule of (b) (a). To an isolated nucleic acid molecule consisting of In a further aspect, the invention provides a test DNA molecule comprising: (a) a PRO having the sequence of amino acid residue 1 of Fig222 (SEQ ID NO: 378) or about 18 to about 116.
Hybridized with a DNA molecule encoding the 1561 polypeptide or (b) the complement of the DNA molecule of (a) under stringent conditions, whereby the DNA molecule (a) or (b)
) To at least about 80% sequence identity, preferably at least about 85%
Having at least 100 nucleotides, prepared by isolating a test DNA molecule when having sequence identity of, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a particular aspect, the invention encodes a PRO1561 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and solubilizing, ie transmembrane domain deletion or inactivating variants thereof. An isolated nucleic acid molecule containing DNA is provided or is complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 17 of Figure 222 (SEQ ID NO: 378). The transmembrane domain is PRO1
It has been tentatively identified as extending from about amino acid position 1 to about amino acid position 24 of the 561 amino acid sequence (Fig222, SEQ ID NO: 378).

In another aspect, the invention features (a) at least about 80% positive, preferably at least about 80% positive, when compared to the amino acid sequence of residue 1 or about 18 to about 116 of Figure 222 (SEQ ID NO: 378). An isolated DNA molecule encoding a polypeptide having a score of 85% positive, more preferably at least about 90% positive, most preferably at least about 95% positive, or (b) (a) the complement of the DNA molecule. Nucleic acid molecule. Another embodiment is a PR that finds use as a hybridization probe.
It relates to a fragment of the O1561 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long, as shown in Figure 221 (SEQ ID NO: 377). It is derived from the nucleotide sequence shown. In another embodiment, the invention provides an isolated PRO1561 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1561 polypeptide, which in one embodiment comprises an amino acid sequence comprising residue 1 of Figure 222 (SEQ ID NO: 378) or about 18 to 116. There is. In another aspect, the invention features amino acid residue 1 of Figure 222 (SEQ ID NO: 378).
Or at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 80% to the sequence contained in about 18 to about 116. It relates to an isolated PRO1561 polypeptide which comprises an amino acid sequence having a sequence identity of about 95%. In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 80% positive when compared to the amino acid sequence of residue 1 or about 18 to 116 of Figure 222 (SEQ ID NO: 378). About 9
It relates to an isolated PRO1561 polypeptide which comprises an amino acid sequence with a score of 0% positive, most preferably at least about 95% positive. In a still further aspect, the invention comprises a single amino acid residue 1 of Fig222 (SEQ ID NO: 378) or a sequence of about 18 to about 116, or a fragment thereof sufficient to bind an anti-PRO1561 antibody. Isolated PRO1561 polypeptide. Preferably, the PRO1561 fragment retains the qualitative biological activity of the native PRO1561 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig2
22 (SEQ ID NO: 378), a DNA molecule encoding a PRO1561 polypeptide having amino acid residue 1 or a sequence from about 18 to about 116, or (b) (a) D
Hybridization with the complement of the NA molecule under stringent conditions allows the test DNA molecule to
at least about 80% sequence identity to a) or (b), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity,
Most preferably, (ii) culturing a host cell containing a test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) culturing the polypeptide from the cell culture medium, provided that it has at least about 95% sequence identity. A polypeptide produced by recovering is provided. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1561 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1561 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1561 polypeptide by contacting the native PRO1561 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In yet a further embodiment, the invention relates to a composition comprising a PRO1561 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

112. PRO1567 In the present application, designated as "PRO1567", a cDNA clone encoding a novel polypeptide having homology with the expression product of colon-specific gene CSG6 (D
NA76541-1675) has been identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1567 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1567 polypeptide having amino acid residue 1 of Figure 224 (SEQ ID NO: 383) or a sequence of about 23 to about 178, or (b) ( at least about 80% sequence identity, preferably at least about 85% sequence identity to the complement of the DNA molecule of a),
More preferably it comprises DNA having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In another aspect, the invention features about residue 175 of Figure 223 (SEQ ID NO: 382).
To PRO642 containing DNA hybridizing to the complement of about 642 nucleic acids from
It relates to an isolated nucleic acid molecule encoding a polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203409 (DNA76541-1675), or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203409 (DNA76541-1675). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of about amino acid residues 23 to about 178 of Figure 224 (SEQ ID NO: 383). , And more preferably at least about 90%
To a DNA encoding a polypeptide having sequence identity of, most preferably at least about 95% sequence identity, or (b) an isolated nucleic acid molecule comprising the complement of the DNA molecule of (a). In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO156 having a sequence from about amino acid residue 23 to about 178 of Figure 224 (SEQ ID NO: 383).
Hybridizing with a DNA molecule encoding a 7 polypeptide or (b) the complement of the DNA molecule of (a) under stringent conditions such that the DNA molecule has at least about 80 relative to (a) or (b). Isolating a test DNA molecule when it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Produced by at least about 50 nucleotides, preferably at least about 100 nucleotides
It relates to an isolated nucleic acid molecule having nucleotides.

In a particular aspect, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1567 polypeptide with or without an N-terminal signal sequence, or such an encoding nucleic acid. It is complementary to the molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 22 of Figure 224 (SEQ ID NO: 383). In another aspect, the invention provides (a) about 2 residues of Figure 224 (SEQ ID NO: 383).
At least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to the amino acid sequence of 3 to about 178.
A DNA molecule encoding a polypeptide having a% positive score, most preferably at least about 95% positive score, or (b) an isolated nucleic acid molecule comprising the complement of the DNA molecule of (a). Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1567 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long. In another embodiment, the invention provides an isolated PRO1567 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1567 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 23 to 178 of Figure 224 (SEQ ID NO: 383). In another aspect, the invention features amino acid residue 2 of Figure 224 (SEQ ID NO: 383).
3 to about 178, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90%.
To a isolated PRO1567 polypeptide comprising an amino acid sequence having sequence identity of, most preferably at least about 95% sequence identity.

In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, and more preferably at least about 80% positive when compared to the amino acid sequence of residues 23 to 178 of Figure 224 (SEQ ID NO: 383). It relates to an isolated PRO1567 polypeptide which comprises an amino acid sequence with a score of about 90% positive, most preferably at least about 95% positive. In yet a further aspect, the invention provides an isolated sequence comprising amino acid residues 23 to about 178 of Figure 224 (SEQ ID NO: 383), or a fragment thereof sufficient to bind an anti-PRO1567 antibody. It relates to a PRO1567 polypeptide.
Preferably, the PRO1567 fragment retains the qualitative biological activity of the native PRO1567 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig2
PR having the sequence of about 23 to about 178 amino acid residues of 24 (SEQ ID NO: 383)
A DNA molecule encoding the O1567 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a), under stringent conditions, wherein the test DNA molecule is at least about relative to (a) or (b). (Ii) testing if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. DNA
A host cell containing the molecule is cultured under conditions suitable for expression of the polypeptide, and (i
ii) Providing the polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1567 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1567 antibody. In a further embodiment, the invention relates to a method for identifying an agonist or antagonist of a native PRO1567 polypeptide by contacting the native PRO1567 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In yet a further embodiment, the invention relates to a composition comprising a PRO1567 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

113. PRO1693 In the present application, a cDNA clone (DNA77301-1708) named "PRO1693" and having homology with a nucleic acid encoding an insulin-like growth factor binding protein, which encodes a novel polypeptide, was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1693 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1693 polypeptide having the sequence of about amino acid residue 1 or about 34 to about 513 of Figure 226 (SEQ ID NO: 385), or (b) For the complement of the DNA molecule of (a),
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. . In another aspect, the invention provides a DNA that hybridizes to the complement of the nucleic acid from about nucleotide 508 or 607 to about 2046 of Figure 225 (SEQ ID NO: 384).
To an isolated nucleic acid molecule encoding a PRO1693 polypeptide comprising
Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203407 (DNA77301-1708), or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203407 (DNA77301-1708). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence with amino acid residue 1 of Figure 226 (SEQ ID NO: 385) or the sequence from about 34 to about 513. A DNA encoding a polypeptide having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) complement of the DNA molecule of (a). To an isolated nucleic acid molecule consisting of In a further aspect, the invention provides a test DNA molecule comprising: (a) a PRO having amino acid residue 1 of Figure 226 (SEQ ID NO: 385) or a sequence from about 34 to about 513.
A DNA molecule encoding the 1693 polypeptide or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, wherein the DNA molecule (a) or (b)
) To at least about 80% sequence identity, preferably at least about 85%
Having at least 175 nucleotides prepared by isolating a test DNA molecule having sequence identity of, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a particular aspect, the invention encodes a PRO1693 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and solubilizing, ie transmembrane domain deletion or inactivating variants thereof. An isolated nucleic acid molecule containing DNA is provided or is complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 33 of Figure 226 (SEQ ID NO: 385). The transmembrane domain is PRO1
Amino acid position about 42 of the 693 amino acid sequence (Fig. 226, SEQ ID NO: 385).
It has been tentatively identified as extending from 0 to about amino acid position 442.

In another aspect, the invention features (a) at least about 80% positive, preferably at least about 80% positive when compared to the amino acid sequence of residue 1 or about 34 to about 513 of Figure 226 (SEQ ID NO: 385). An isolated DNA molecule encoding a polypeptide with a score of 85% positive, more preferably at least about 90% positive, most preferably at least about 95% positive, or (b) (a) the complement of the DNA molecule. Nucleic acid molecule. Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1693 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long, as shown in Figure 225 (SEQ ID NO: 384). It is derived from the nucleotide sequence shown. In another embodiment, the invention provides an isolated PRO1693 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a specific aspect, the invention provides an isolated native sequence PRO1693 polypeptide, which in one embodiment comprises an amino acid sequence comprising residue 1 of Figure 226 (SEQ ID NO: 385) or about 34 to 513. There is. In another aspect, the invention features amino acid residue 1 of Figure 226 (SEQ ID NO: 385).
Or at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 80% sequence identity to the sequence contained in about 34 to about 513. It relates to an isolated PRO1693 polypeptide which comprises an amino acid sequence having about 95% sequence identity. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least at least about 80% positive when compared to the amino acid sequence of residue 1 or about 34 to 513 of Figure 226 (SEQ ID NO: 385). About 9
It relates to an isolated PRO1693 polypeptide which comprises an amino acid sequence with a score of 0% positive, most preferably at least about 95% positive. In a still further aspect, the invention comprises a single amino acid residue 1 of Figure 226 (SEQ ID NO: 385) or the sequence from about 34 to about 513, or a fragment thereof sufficient to bind an anti-PRO1693 antibody. Isolated PRO1693 polypeptide. Preferably, the PRO1693 fragment retains the qualitative biological activity of the native PRO1693 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig2
A DNA molecule encoding a PRO1693 polypeptide having the amino acid residue 1 of 26 (SEQ ID NO: 385) or a sequence of about 34 to about 513, or D of (b) (a)
Hybridization with the complement of the NA molecule under stringent conditions allows the test DNA molecule to
at least about 80% sequence identity to a) or (b), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity,
Most preferably, (ii) culturing a host cell containing a test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) culturing the polypeptide from the cell culture medium, provided that it has at least about 95% sequence identity. A polypeptide produced by recovering is provided. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1693 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1693 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1693 polypeptide by contacting the native PRO1693 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In yet a further embodiment, the invention relates to a composition comprising a PRO1693 polypeptide, or agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

114. PRO1784 In the present application, a cDNA clone (DNA77303-2502) has been identified, which was named "PRO1784" and which encodes a novel transmembrane polypeptide. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1784 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1784 polypeptide having amino acid residue 1 of Figure 228 (SEQ ID NO: 390) or a sequence of about 30 to about 146, or (b) ( at least about 80% sequence identity, preferably at least about 85% sequence identity to the complement of the DNA molecule of a),
More preferably it comprises DNA having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In another aspect, the invention features about residue 155 of Figure 227 (SEQ ID NO: 389).
To PRO5054 containing DNA that hybridizes to the complement of about 505 nucleic acids from
It relates to an isolated nucleic acid molecule encoding a polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA77303-2502) of ATCC Deposit No. 203479, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203479 (DNA77303-2502).

In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of amino acid residues from about 30 to about 146 of Figure 228 (SEQ ID NO: 390). Sequence identity, more preferably at least about 90%
To a DNA encoding a polypeptide having sequence identity of, most preferably at least about 95% sequence identity, or (b) an isolated nucleic acid molecule comprising the complement of the DNA molecule of (a). In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO178 having a sequence from about 30 to about 146 amino acid residues of Figure 228 (SEQ ID NO: 390).
At least about 80 relative to (a) or (b), wherein the DNA molecule hybridizes with a DNA molecule encoding a 4 polypeptide or (b) the complement of the DNA molecule of (a) under stringent conditions. Isolating a test DNA molecule when it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Produced by at least about 50 nucleotides, preferably at least about 100 nucleotides
It relates to an isolated nucleic acid molecule having nucleotides. In a particular embodiment, the invention encodes a PRO1784 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and solubilizing, ie transmembrane domain deletion or inactivating variants thereof. An isolated nucleic acid molecule containing DNA is provided or is complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 29 of Figure 228 (SEQ ID NO: 390). The transmembrane domain is PRO1
Approximately 52 amino acid positions in the 784 amino acid sequence (Fig228, SEQ ID NO: 390)
Has been tentatively identified as extending from to about 70 amino acid positions. In another aspect, the invention provides (a) residue 30 of Figure 228 (SEQ ID NO: 390).
To at least about 80% positive when compared to the about 146 amino acid sequence,
Preferably at least about 85% positive, more preferably at least about 90%
A DNA molecule encoding a polypeptide positive, most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising (b) (a) the complement of the DNA molecule. Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1784 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long.

In another embodiment, the invention provides an isolated PRO1784 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1784 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 30 to 146 of Figure 228 (SEQ ID NO: 390). In another aspect, the invention features amino acid residue 3 of Figure 228 (SEQ ID NO: 390).
0 to about 146, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90%.
To an isolated PRO1784 polypeptide comprising an amino acid sequence having sequence identity of, most preferably at least about 95% sequence identity. In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 30 to 146 of Figure 228 (SEQ ID NO: 390). It relates to an isolated PRO1784 polypeptide which comprises an amino acid sequence with a positive, most preferably at least about 95% positive, score. In a still further aspect, the invention provides an isolated sequence comprising amino acid residues 30 to about 146 of Figure 228 (SEQ ID NO: 390), or a fragment thereof sufficient to bind an anti-PRO1784 antibody. It relates to PRO1784 polypeptides.
Preferably, the PRO1784 fragment retains the qualitative biological activity of the native PRO1784 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig2
PR having a sequence of about 30 to about 146 amino acid residues of 28 (SEQ ID NO: 390)
A DNA molecule encoding the O1784 polypeptide, or (b) a complement of the DNA molecule of (a), is hybridized under stringent conditions such that the test DNA molecule is at least about (Ii) testing if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. DNA
A host cell containing the molecule is cultured under conditions suitable for expression of the polypeptide, and (i
ii) Providing the polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1784 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1784 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1784 polypeptide by contacting the native PRO1784 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In yet a further embodiment, the invention relates to a composition comprising a PRO1784 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

115. PRO1605 In the present application, a cDNA clone (DNA77648-1688), which is named "PRO1605" and which has homology with a nucleic acid encoding a glycosyltransferase protein, has been identified, which encodes a novel polypeptide. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1605 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1605 polypeptide having the sequence of about amino acid residue 1 or about 27 to about 140 of Figure 230 (SEQ ID NO: 395), or (b) For the complement of the DNA molecule of (a),
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. . In another aspect, the invention provides a DNA that hybridizes to the complement of the nucleic acid of about nucleotide 425 or about 503 to about 844 of Figure 229 (SEQ ID NO: 394).
To an isolated nucleic acid molecule encoding a PRO1605 polypeptide comprising
Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA77648-1688) of ATCC Deposit No. 203408, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203408 (DNA77648-1688). In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence with amino acid residue 1 of Fig230 (SEQ ID NO: 395) or the sequence from about 27 to about 140. A DNA encoding a polypeptide having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or (b) complement of the DNA molecule of (a). To an isolated nucleic acid molecule consisting of

In a further aspect, the invention provides a test DNA molecule comprising: (a) a PRO having the amino acid residue 1 of Fig230 (SEQ ID NO: 395) or the sequence from about 27 to about 140.
Hybridized under stringent conditions with a DNA molecule encoding a 1605 polypeptide, or (b) the complement of the DNA molecule of (a), wherein the DNA molecule (a) or (b)
) To at least about 80% sequence identity, preferably at least about 85%
At least about 380 nucleotides produced by isolating a test DNA molecule having sequence identity of, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Having an isolated nucleic acid molecule. In a particular aspect, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1605 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, or such a code. A complementary nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 26 in Figure 230 (SEQ ID NO: 395). In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residue 1 or about 27 to about 140 of Figure 230 (SEQ ID NO: 395). , More preferably at least about 90% positive, most preferably at least about 95% positive, a DNA molecule encoding a polypeptide, or an isolated nucleic acid molecule comprising the complement of (b) (a) a DNA molecule. Regarding Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1605 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides in length, preferably about 20 to about 60 nucleotides in length, more preferably about 20 to about 50 nucleotides in length, most preferably about 20 to about 40 nucleotides in length and shown in Figure 229 (SEQ ID NO: 394). It is derived from the nucleotide sequence shown. In another embodiment, the invention provides an isolated PRO1605 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1605 polypeptide, which in one embodiment comprises an amino acid sequence comprising residue 1 of Figure 230 (SEQ ID NO: 395) or about 27-140. There is. In another aspect, the invention features amino acid residue 1 of Figure 230 (SEQ ID NO: 395).
Or at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 80% to the sequence contained in about 27 to about 140. It relates to an isolated PRO1605 polypeptide, which comprises an amino acid sequence having about 95% sequence identity. In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least at least about 80% positive when compared to the amino acid sequence of residue 1 or about 27 to 140 of Figure 230 (SEQ ID NO: 395). About 9
It relates to an isolated PRO1605 polypeptide comprising an amino acid sequence with a score of 0% positive, most preferably at least about 95% positive.

In yet a further aspect, the invention comprises amino acid residue 1 of Figure 230 (SEQ ID NO: 395) or the sequence from about 27 to about 140, or a fragment thereof sufficient to bind an anti-PRO1605 antibody. Of isolated PRO1605 polypeptides. Preferably, this PRO1605 fragment retains the qualitative biological activity of the native PRO1605 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig2
30 (SEQ ID NO: 395) amino acid residue 1 or a DNA molecule encoding a PRO1605 polypeptide having a sequence from about 27 to about 140, or (b) (a) D
Hybridization with the complement of the NA molecule under stringent conditions allows the test DNA molecule to
at least about 80% sequence identity to a) or (b), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity,
Most preferably, (ii) culturing a host cell containing a test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) culturing the polypeptide from the cell culture medium, provided that it has at least about 95% sequence identity. A polypeptide produced by recovering is provided. In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1605 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1605 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1605 polypeptide by contacting the native PRO1605 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In yet a further embodiment, the invention relates to a composition comprising a PRO1605 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

116. PRO1788 In the present application, a cDNA clone (DNA7) which is named “PRO1788” and which encodes a novel polypeptide having homology with a leucine-rich repeat protein.
7652-2505) was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1788 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1788 polypeptide having amino acid residue 1 of Figure 232 (SEQ ID NO: 397) or a sequence from about 17 to about 353, or (b) ( at least about 80% sequence identity, preferably at least about 85% sequence identity to the complement of the DNA molecule of a),
More preferably it comprises DNA having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In another aspect, the invention features about residue 112 of Figure 231 (SEQ ID NO: 396).
To PRO112 containing DNA that hybridizes to the complement of about 1122 nucleic acids from
8 isolated nucleic acid molecule encoding a polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203480 (DNA77652-2505), or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203480 (DNA77652-2505). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of amino acid residues about 17 to about 353 of Fig232 (SEQ ID NO: 397). , And more preferably at least about 90%
To a DNA encoding a polypeptide having sequence identity of, most preferably at least about 95% sequence identity, or (b) an isolated nucleic acid molecule comprising the complement of the DNA molecule of (a). In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO178 having a sequence from about 17 to about 353 amino acid residues of Fig232 (SEQ ID NO: 397).
At least about 80 relative to (a) or (b), wherein said DNA molecule hybridizes with a DNA molecule encoding 8 polypeptide or (b) the complement of the DNA molecule of (a) under stringent conditions. Isolating a test DNA molecule when it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Produced by at least about 50 nucleotides, preferably at least about 100 nucleotides
It relates to an isolated nucleic acid molecule having nucleotides.

In a particular aspect, the invention provides PRO1788 polypeptides with or without an N-terminal signal sequence and / or an initiation methionine, and solubilizing, ie transmembrane domain deletion or inactivating variants thereof. Providing an isolated nucleic acid molecule comprising DNA encoding, or being complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 16 of Figure 232 (SEQ ID NO: 397). The transmembrane domain is PRO1
Approximately 21 amino acid positions in the 788 amino acid sequence (Fig232, SEQ ID NO: 397)
5 to about amino acid position 232, and amino acid position about 287 to amino acid position about 3
It has been tentatively identified as extending to 04. In another aspect, the invention provides (a) about 1 residue of Fig232 (SEQ ID NO: 397).
At least about 80% positive, preferably at least about 85% positive, more preferably at least about 90 when compared to the amino acid sequence from 7 to about 353.
A DNA molecule encoding a polypeptide having a% positive score, most preferably at least about 95% positive score, or (b) an isolated nucleic acid molecule comprising the complement of the DNA molecule of (a). Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1788 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long. In another embodiment, the invention provides an isolated PRO1788 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1788 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 17 to 353 of Fig232 (SEQ ID NO: 397). In another aspect, the invention features amino acid residue 1 of Figure 232 (SEQ ID NO: 397).
7 to about 353 to at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90%.
Of a sequence identity of 1, most preferably at least about 95% sequence identity, to an isolated PRO1788 polypeptide. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 17 to 353 of Fig232 (SEQ ID NO: 397). It relates to an isolated PRO1788 polypeptide which comprises an amino acid sequence with a positive, most preferably at least about 95% positive, score. In a still further aspect, the invention provides an isolated sequence comprising the sequence of amino acid residues 17 to about 353 of Figure 232 (SEQ ID NO: 397), or a fragment thereof sufficient to bind an anti-PRO1788 antibody. It relates to PRO1788 polypeptides.
Preferably, the PRO1788 fragment retains the qualitative biological activity of the native PRO1788 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig2
PR having a sequence of about 17 to about 353 amino acid residues of 32 (SEQ ID NO: 397)
A DNA molecule encoding the O1788 polypeptide, or (b) a complement of the DNA molecule of (a), is hybridized under stringent conditions such that the test DNA molecule is at least about (Ii) testing if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. DNA
A host cell containing the molecule is cultured under conditions suitable for expression of the polypeptide, and (i
ii) Providing the polypeptide produced by recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1788 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1788 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1788 polypeptide by contacting the native PRO1788 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In yet a further embodiment, the invention relates to a composition comprising a PRO1788 polypeptide, or agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

117. PRO1801 In the present application, a cDNA clone (DNA83500-2506), which is named "PRO1801" and which has homology with a nucleic acid encoding an IL-19 polypeptide, has been identified, which encodes a novel polypeptide. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1801 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1801 polypeptide having the sequence from about amino acid residue 1 or about 43 to about 261 of Figure 234 (SEQ ID NO: 402), or (b) For the complement of the DNA molecule of (a),
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. . In another aspect, the invention provides a DNA that hybridizes to the complement of a nucleic acid from about nucleotide 109 or about 235 to about 891 of Figure 233 (SEQ ID NO: 401).
To an isolated nucleic acid molecule encoding a PRO1801 polypeptide comprising
Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA83500-2506) of ATCC Deposit No. 203391, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203391 (DNA83500-2506).

In yet a further aspect, the invention features (a) at least about 80% sequence identity with amino acid residue 1 of Figure 234 (SEQ ID NO: 402) or the sequence from about 43 to about 261 and preferably at least about 85%. DNA encoding a polypeptide having a% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity, or the complement of the DNA molecule of (b) (a). It relates to an isolated nucleic acid molecule comprising the body. In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO having the amino acid residue 1 of Figure 234 (SEQ ID NO: 402) or the sequence from about 43 to about 261.
A 1801 polypeptide-encoding DNA molecule, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions such that the DNA molecule (a) or (b)
) To at least about 80% sequence identity, preferably at least about 85%
At least about 30 nucleotides prepared by isolating a test DNA molecule having sequence identity of, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity, Usually at least about 50
It relates to an isolated nucleic acid molecule having nucleotides, more usually at least about 100 nucleotides, and generally at least about 150 nucleotides. In a particular aspect, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1801 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, or such a code. A complementary nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 42 of Figure 234 (SEQ ID NO: 402). In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residue 1 or about 43 to about 261 of Figure 234 (SEQ ID NO: 402). , More preferably at least about 90% positive, most preferably at least about 95% positive, a DNA molecule encoding a polypeptide, or an isolated nucleic acid molecule comprising the complement of a DNA molecule of (b) (a). Regarding Another embodiment is a PR that finds use as a hybridization probe.
A fragment of the O1801 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long, as shown in Figure 233 (SEQ ID NO: 401). It is derived from the nucleotide sequence shown. In another embodiment, the invention provides an isolated PRO1801 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1801 polypeptide, which in one embodiment comprises an amino acid sequence comprising residue 1 of Figure 234 (SEQ ID NO: 402) or about 43-261. There is.

In another aspect, the invention features amino acid residue 1 of Figure 234 (SEQ ID NO: 402).
Or at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 80% sequence identity to the sequence comprised from about 43 to about 261. It relates to an isolated PRO1801 polypeptide comprising an amino acid sequence having about 95% sequence identity. In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 80% positive when compared to the amino acid sequence of residue 1 or about 43 to 261 of Figure 234 (SEQ ID NO: 402). About 9
It relates to an isolated PRO1801 polypeptide which comprises an amino acid sequence with a score of 0% positive, most preferably at least about 95% positive. In a still further aspect, the invention comprises a single amino acid residue 1 of Figure 234 (SEQ ID NO: 402) or the sequence from about 43 to about 261 or a fragment thereof sufficient to bind an anti-PRO1801 antibody. Isolated PRO1801 polypeptide. Preferably, the PRO1801 fragment retains the qualitative biological activity of the native PRO1801 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig2
A DNA molecule encoding a PRO1801 polypeptide having amino acid residue 1 of 34 (SEQ ID NO: 402) or a sequence of about 43 to about 261; or (b) (a) D
Hybridization with the complement of the NA molecule under stringent conditions allows the test DNA molecule to
at least about 80% sequence identity to a) or (b), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity,
Most preferably, (ii) culturing a host cell containing a test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) culturing the polypeptide from the cell culture medium, provided that it has at least about 95% sequence identity. A polypeptide produced by recovering is provided. In yet another embodiment, the invention relates to agonists and antagonists of the native PRO1801 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO1801 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1801 polypeptide by contacting the native PRO1801 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In yet a further embodiment, the invention relates to a composition comprising a PRO1801 polypeptide, or agonist or antagonist as above, together with a pharmaceutically acceptable carrier. Another embodiment of the present invention relates to a method of inhibiting the production of inflammatory cytokines by cells capable of producing inflammatory cytokines, the method comprising the step of treating the cells with PRO1801.
Including the process of contacting the polypeptide, production of inflammatory cytokines is inhibited. The cell is, for example, a T cell, an NK cell or a macrophage, and the inflammatory cytokine whose production is inhibited can be IL-1, IL-6, IFN- or TNF-. A further embodiment of the invention relates to a method of treating an individual in need of immunosuppression,
The method comprises the step of administering to an individual an immunosuppressive amount of PRO1801. Individuals in need of immunosuppression may be rheumatoid arthritis, myasthenia gravis, insulin-dependent diabetes mellitus, systemic lupus erythematosus, autoimmune diseases such as thyroiditis or colitis, or septic shock, endotoxic shock or immunosuppression. Suffer from other types of diseases in which is desired. The individual may also have or will receive a tissue transplant and this method inhibits rejection of the tissue transplant. Other embodiments will be apparent upon reading this specification.

118. UCP4 is designated "UCP4" in the present application and encodes a novel polypeptide,
A cDNA clone (DNA77568-1626) was identified that has some homology to several known human uncoupling proteins. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a UCP4 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a UCP4 polypeptide having a sequence from about amino acid residue 1 to about 323 of Figure 236 (SEQ ID NO: 406), or (b) (a). At least about 80 relative to the complement of the DNA molecule of
% Of sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In another aspect, the invention features a UCP comprising a DNA that hybridizes to the complement of the nucleic acid from about 40 to about 1011 nucleotides of Figure 235 (SEQ ID NO: 405).
It relates to an isolated nucleic acid molecule encoding a 4 polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions.

In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203134,
Or (b) at least about 80% sequence identity to the complement of the DNA molecule of (a), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, Preferably it relates to an isolated nucleic acid molecule comprising DNA having at least about 95% sequence identity. In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203134. In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of about amino acid residues 1 to about 323 of Figure 236 (SEQ ID NO: 406). , More preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a DNA encoding a polypeptide, or (b) a complement of a DNA molecule of (a). It relates to an isolated nucleic acid molecule. In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residues 1 to about 323 of Figure 236 (SEQ ID NO: 406), more preferably at least about 85% positive. Relates to a DNA molecule encoding a polypeptide which scores at least about 90% positive, most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising the complement of (b) (a) the DNA molecule. Another embodiment is U, which is long enough to be used as a hybridization probe.
It relates to a fragment of the CP4 coding sequence. Preferably such nucleic acid fragments are Fi
It contains at least about 20 to about 80 consecutive bases in the sequence of g235 (SEQ ID NO: 405). In some cases, these fragments include the N-terminus or C-terminus of the sequence of Figure 236 (SEQ ID NO: 406). In another embodiment, the invention provides an isolated UCP4 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence UCP4 polypeptide, which in one embodiment is residues 1 to 323 of Figure 236 (SEQ ID NO: 406).
It contains an amino acid sequence containing. In another aspect, the invention features amino acid residue 1 of Figure 236 (SEQ ID NO: 406).
To about 323, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95%. To an isolated UCP4 polypeptide comprising an amino acid sequence having the sequence identity of In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive amino acid sequence when compared to the amino acid sequence of residues 1 to 323 of Figure 236 (SEQ ID NO: 406). It relates to an isolated UCP4 polypeptide, which comprises an amino acid sequence with a positive, most preferably at least about 95% positive score.

In yet a further aspect, the invention comprises a sequence of amino acid residues 1 to about 323 of Figure 236 (SEQ ID NO: 406), or a fragment thereof sufficient to bind an anti-UCP4 antibody. Isolated UCP4 polypeptide. Preferably, the UCP4 fragment retains the qualitative biological activity of the native UCP4 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig2
UCP having a sequence of about 1 to about 323 amino acid residues of 36 (SEQ ID NO: 406)
And a test DNA molecule (a) or (b) hybridized under stringent conditions with a DNA molecule encoding the 4 polypeptide or (b) the complement of the DNA molecule of (a).
To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Provides a polypeptide produced by (ii) culturing a host cell containing a test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of native UCP4 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-UCP4 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native UCP4 polypeptide by contacting the native UCP4 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. The present invention also provides a therapeutic method and a diagnostic method using UCP4. In yet a further embodiment, the invention relates to a composition comprising a UCP4 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

119. PRO193 In the present application, a cDNA clone (DNA23322-1393), which was named "PRO193" and which encodes a novel multiple transmembrane polypeptide, was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO193 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO193 polypeptide having the sequence from about amino acid residue 1 to about 158 of Figure 238 (SEQ ID NO: 410), or (b) (a). Of at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity to the complement of a DNA molecule of It comprises DNA having sequence identity. In another aspect, the invention features about residue 138 of Figure 237 (SEQ ID NO: 409).
To about 611 nucleic acids to the complement of an isolated nucleic acid molecule encoding a PRO193 polypeptide comprising DNA hybridizing to the complement. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA23322-1393) of ATCC Deposit No. 203400, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203400 (DNA23322-1393). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence of amino acid residues about 1 to about 158 of Figure 238 (SEQ ID NO: 410). , More preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or a DNA encoding a polypeptide, or (b) a complement of a DNA molecule of (a). It relates to an isolated nucleic acid molecule. In a further aspect, the invention provides a test DNA molecule, (a) a DNA molecule encoding a PRO193 polypeptide having a sequence from about amino acid residue 1 to about 158 of Figure 238 (SEQ ID NO: 410), or (b) ( a) the complement of the DNA molecule,
Hybridized under stringent conditions, the DNA molecule has at least about 80% sequence identity to (a) or (b), preferably at least about 85% sequence identity, more preferably at least about 90%. Of a nucleic acid molecule produced by isolating a test DNA molecule having sequence identity of, most preferably at least about 95% sequence identity. In a particular aspect, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO193 polypeptide in its soluble form, ie, a transmembrane domain deletion or inactivating variant, or It is complementary to the encoded nucleic acid molecule. The transmembrane domain has a PRO193 amino acid sequence (FIG. 238, SEQ ID NO: 410).
About amino positions 23-42, 60-80, 97-117 and 128-14 of
It has been tentatively identified as extending to 8. In another aspect, the invention provides (a) at least about 80% positive, preferably at least about 85% positive, more preferably when compared to the amino acid sequence of residues 1 to 158 of Figure 238 (SEQ ID NO: 410), more preferably at least about 85% positive. Relates to a DNA molecule encoding a polypeptide which scores at least about 90% positive, most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising the complement of (b) (a) the DNA molecule.

In another embodiment, the invention provides an isolated PRO193 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO193 polypeptide, which in one embodiment is residues 1 to 1 of Figure 238 (SEQ ID NO: 410).
It contains an amino acid sequence containing 58. In another aspect, the invention features amino acid residue 1 of Figure 238 (SEQ ID NO: 410).
To about 158, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, most preferably at least about 95%. To an isolated PRO193 polypeptide comprising an amino acid sequence having the sequence identity of In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 1 to 158 of Figure 238 (SEQ ID NO: 410). It relates to an isolated PRO193 polypeptide which comprises an amino acid sequence that scores positive, most preferably at least about 95% positive. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig2
PRO having a sequence of about 1 to about 158 amino acid residues of 38 (SEQ ID NO: 410)
The test DNA molecule is hybridized under stringent conditions with a DNA molecule encoding the 193 polypeptide or (b) the complement of the DNA molecule of (a), and the test DNA molecule is (a) or (
at least about 80% sequence identity to b), preferably at least about 85
(Ii) a host cell containing the test DNA molecule for expression of the polypeptide if it has a sequence identity of%, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Culture under suitable conditions, and (iii
) Providing a polypeptide produced by recovering the polypeptide from a cell culture medium. In yet another embodiment, the invention relates to agonists and antagonists of the native PRO193 polypeptide. In a particular embodiment, the agonist or antagonist is an anti-PRO193 antibody. In a further embodiment, the invention relates to a method for identifying an agonist or antagonist of a native PRO193 polypeptide by contacting the native PRO193 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the invention relates to a composition comprising a PRO193 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

120. PRO1130 In the present application, a cDNA clone (DNA59814-1486) named "PRO1130" and having homology with a nucleic acid encoding a human 2-19 protein, which encodes a novel polypeptide, was identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1130 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1130 polypeptide having the sequence from about 1 or about 16 to about 224 amino acid residues of Figure 240 (SEQ ID NO: 415), or (b) For the complement of the DNA molecule of (a),
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. . In another aspect, the invention provides a DNA that hybridizes to the complement of the nucleic acid of about nucleotide 312 or about 357 to about 983 of Figure 239 (SEQ ID NO: 414).
To an isolated nucleic acid molecule encoding a PRO1130 polypeptide.
Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Deposit No. 203359 (DNA59814-1486), or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203359 (DNA59814-1486). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence with amino acid residue 1 of Fig240 (SEQ ID NO: 415) or the sequence from about 16 to about 224. DNA comprising a polypeptide having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or complement of a DNA molecule of (b) (a). To an isolated nucleic acid molecule consisting of In a further aspect, the invention provides a test DNA molecule comprising (a) a PRO having the amino acid residue 1 of Fig240 (SEQ ID NO: 415) or the sequence from about 16 to about 224.
1130 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, wherein the DNA molecule (a) or (b)
) To at least about 80% sequence identity, preferably at least about 85%
Having at least 10 nucleotides, prepared by isolating a test DNA molecule when having sequence identity of, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule.

In a particular embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1130 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, or Is complementary to such an encoded nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 15 of Figure 240 (SEQ ID NO: 415). In another aspect, the invention features (a) at least about 80% positive, preferably at least about 85% positive when compared to the amino acid sequence of residue 1 or about 16 to about 224 of Fig240 (SEQ ID NO: 415). , More preferably at least about 90% positive, most preferably at least about 95% positive, a DNA molecule encoding a polypeptide, or an isolated nucleic acid molecule comprising the complement of (b) (a) a DNA molecule. Regarding Another embodiment is a PR that finds use as a hybridization probe.
It relates to fragments of the O1130 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides in length, preferably about 20 to about 60 nucleotides in length, more preferably about 20 to about 50 nucleotides in length, most preferably about 20 to about 40 nucleotides in length, as shown in Figure 239 (SEQ ID NO: 414). It is derived from the nucleotide sequence shown. In another embodiment, the invention provides an isolated PRO1130 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1130 polypeptide, which in one embodiment comprises an amino acid sequence comprising residue 1 of Figure 240 (SEQ ID NO: 415) or about 16 to 224. There is. In another aspect, the invention features amino acid residue 1 of Figure 240 (SEQ ID NO: 415).
Or at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about sequence about 16 to about 224. It relates to an isolated PRO1130 polypeptide comprising an amino acid sequence having about 95% sequence identity. In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least at least about 80% positive when compared to the amino acid sequence of residue 1 or about 16 to 224 of Figure 240 (SEQ ID NO: 415). About 9
It relates to an isolated PRO1130 polypeptide comprising an amino acid sequence with a score of 0% positive, most preferably at least about 95% positive.

In yet a further aspect, the invention comprises amino acid residue 1 of Figure 240 (SEQ ID NO: 415) or the sequence from about 16 to about 224, or a fragment thereof sufficient to bind an anti-PRO1130 antibody. Of isolated PRO1130 polypeptides. Preferably, this PRO1130 fragment retains the qualitative biological activity of the native PRO1130 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig2
40 (SEQ ID NO: 415) amino acid residue 1 or a DNA molecule encoding a PRO1130 polypeptide having a sequence from about 16 to about 224, or (b) (a) D
Hybridization with the complement of the NA molecule under stringent conditions allows the test DNA molecule to
at least about 80% sequence identity to a) or (b), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity,
Most preferably, (ii) culturing a host cell containing a test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) culturing the polypeptide from the cell culture medium, provided that it has at least about 95% sequence identity. A polypeptide produced by recovering is provided. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1130 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1130 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1130 polypeptide by contacting the native PRO1130 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the present invention relates to a composition comprising the PRO1130 polypeptide, or the above agonist or antagonist together with a pharmaceutically acceptable carrier.

121. PRO1335 In the present application, "PRO1335" is named, and is a cDNA clone (DNA that encodes a novel polypeptide and has homology with a nucleic acid encoding decarboxylase).
62812-1594) has been identified. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1335 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1335 polypeptide having the sequence of amino acid residues from about 1 or from about 16 to about 337 of Figure 242 (SEQ ID NO: 423), or (b). For the complement of the DNA molecule of (a),
Comprises DNA having at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. . In another aspect, the invention provides a DN that hybridizes to the complement of a nucleic acid from about nucleotide 271 or nucleotides 316 to 1281 of Figure 241 (SEQ ID NO: 422).
An isolated nucleic acid molecule encoding a PRO1335 polypeptide comprising A. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA62812-1594) of ATCC Deposit No. 203248, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203248 (DNA62812-1594). In yet a further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence with amino acid residue 1 of Fig242 (SEQ ID NO: 423) or the sequence from about 16 to about 337. DNA comprising a polypeptide having identity, more preferably at least about 90% sequence identity, most preferably at least about 95% sequence identity, or complement of a DNA molecule of (b) (a). To an isolated nucleic acid molecule consisting of In a further aspect, the invention provides a test DNA molecule comprising (a) a PRO having amino acid residue 1 of Figure 242 (SEQ ID NO: 423) or a sequence of about 16 to about 337.
Hybridized with a DNA molecule encoding the 1335 polypeptide, or (b) the complement of the DNA molecule of (a), under stringent conditions such that the DNA molecule (a) or (b)
) To at least about 80% sequence identity, preferably at least about 85%
Having at least 180 nucleotides, prepared by isolating a test DNA molecule when having sequence identity of, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. It relates to an isolated nucleic acid molecule. In a particular aspect, the invention encodes a PRO1335 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, and solubilizing, ie transmembrane domain deletion or inactivating variants thereof. An isolated nucleic acid molecule containing DNA is provided or is complementary to such an encoding nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 15 of Figure 242 (SEQ ID NO: 423). The transmembrane domain is PRO1
About 29 amino acid positions of the 335 amino acid sequence (Fig242, SEQ ID NO: 423)
It has been tentatively identified as extending from 1 to about amino acid position 310.

In another aspect, the invention features (a) at least about 80% positive, preferably at least about 80% positive when compared to the amino acid sequence of residue 1 or about 16 to about 337 of Figure 242 (SEQ ID NO: 423). An isolated DNA molecule encoding a polypeptide having a score of 85% positive, more preferably at least about 90% positive, most preferably at least about 95% positive, or (b) (a) the complement of the DNA molecule. Nucleic acid molecule. Another embodiment is a PR that finds use as a hybridization probe.
It relates to fragments of the O1335 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides in length, preferably about 20 to about 60 nucleotides in length, more preferably about 20 to about 50 nucleotides in length, most preferably about 20 to about 40 nucleotides in length, as shown in Figure 241 (SEQ ID NO: 422). It is derived from the nucleotide sequence shown. In another embodiment, the invention provides an isolated PRO1335 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1335 polypeptide, which in one embodiment comprises an amino acid sequence comprising residue 1 of Figure 242 (SEQ ID NO: 423) or about 16 to 337. There is. In another aspect, the invention features amino acid residue 1 of Figure 242 (SEQ ID NO: 423).
Or at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity and most preferably at least about 80% sequence identity to the sequence contained in about 16 to about 337. It relates to an isolated PRO1335 polypeptide comprising an amino acid sequence having about 95% sequence identity. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 80% positive when compared to the amino acid sequence of residue 1 or about 16 to 337 of Figure 242 (SEQ ID NO: 423). About 9
It relates to an isolated PRO1335 polypeptide which comprises an amino acid sequence with a score of 0% positive, most preferably at least about 95% positive. In a still further aspect, the invention comprises a single amino acid residue 1 of Figure 242 (SEQ ID NO: 423) or a sequence from about 16 to about 337, or a fragment thereof sufficient to bind an anti-PRO1335 antibody. Isolated PRO1335 polypeptide. Preferably, this PRO1335 fragment retains the qualitative biological activity of the native PRO1335 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig2
A DNA molecule encoding a PRO1335 polypeptide having the sequence from about 1 or about 16 to about 337 of amino acid residue 42 (SEQ ID NO: 423), or (b) the complement of the DNA molecule of (a) and stringent conditions. Hybridized below, the test DNA molecule has at least about 80% sequence identity to (a) or (b), preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity. If there is identity, most preferably at least about 95% sequence identity, (ii) the host cell containing the test DNA molecule is cultured under conditions suitable for expression of the polypeptide, and (iii) from the cell culture medium. Provided is a polypeptide produced by recovering the polypeptide. In yet another embodiment, the invention relates to agonists and antagonists of native PRO1335 polypeptides. In a particular embodiment, the agonist or antagonist is an anti-PRO1335 antibody. In a further embodiment, the invention relates to a method of identifying an agonist or antagonist of a native PRO1335 polypeptide by contacting the native PRO1335 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a still further embodiment, the present invention relates to a composition comprising the PRO1335 polypeptide, or an agonist or antagonist as above, together with a pharmaceutically acceptable carrier.

122. PRO1329 In this application, a cDNA clone (DNA66660-1585) has been identified, which was named "PRO1329" and which encodes a novel polypeptide. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1329 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1329 polypeptide having amino acid residue 1 of Figure 244 (SEQ ID NO: 429) or a sequence of about 17 to about 209, or (b) ( at least about 80% sequence identity, preferably at least about 85% sequence identity to the complement of the DNA molecule of a),
More preferably it comprises DNA having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In another aspect, the invention features about residue 138 of Figure 243 (SEQ ID NO: 428).
To PRO716 containing DNA hybridizing to the complement of about 716 nucleic acids from
It relates to an isolated nucleic acid molecule encoding a polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA66660-1585) of ATCC Deposit No. 203279, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203279 (DNA66660-1585). In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity with the sequence of amino acid residues about 17 to about 209 of Figure 244 (SEQ ID NO: 429). , And more preferably at least about 90%
To a DNA encoding a polypeptide having sequence identity of, most preferably at least about 95% sequence identity, or (b) an isolated nucleic acid molecule comprising the complement of the DNA molecule of (a). In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO132 having a sequence from about 17 to about 209 amino acid residues of Figure 244 (SEQ ID NO: 429).
At least about 80% of the DNA molecule with respect to (a) or (b) by hybridizing under stringent conditions with a DNA molecule encoding 9 polypeptide or (b) the complement of the DNA molecule of (a). Isolate a test DNA molecule if it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Produced by at least about 50 nucleotides, preferably at least about 100 nucleotides
It relates to an isolated nucleic acid molecule having nucleotides.

In a particular aspect, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1329 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, or Is complementary to such an encoded nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 16 of Figure 244 (SEQ ID NO: 429). In another aspect, the invention features residue 17 of (a) Figure 244 (SEQ ID NO: 429).
To at least about 80% positive when compared to the about 209 amino acid sequence,
Preferably at least about 85% positive, more preferably at least about 90%
A DNA molecule encoding a polypeptide positive, most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising (b) (a) the complement of the DNA molecule. Another embodiment is a PR that finds use as a hybridization probe.
It relates to fragments of the O1329 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long. In another embodiment, the invention provides an isolated PRO1329 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1329 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 17 to 209 of Figure 244 (SEQ ID NO: 429). In another aspect, the invention features amino acid residue 1 of Figure 244 (SEQ ID NO: 429).
7 to about 209, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90%.
Of sequence identity, most preferably at least about 95% sequence identity, to an isolated PRO1329 polypeptide. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 17 to 209 of Figure 244 (SEQ ID NO: 429). It relates to an isolated PRO1329 polypeptide which comprises an amino acid sequence that scores positive, most preferably at least about 95% positive. In a still further aspect, the invention provides an isolated sequence comprising the sequence of amino acid residues 17 to about 209 of Figure 244 (SEQ ID NO: 429), or a fragment thereof sufficient to bind an anti-PRO1329 antibody. It relates to the PRO1329 polypeptide.
Preferably, this PRO1329 fragment retains the qualitative biological activity of the native PRO1329 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig2
PR having a sequence of about 17 to about 209 amino acid residues of 44 (SEQ ID NO: 429)
A DNA molecule encoding the O1329 polypeptide, or (b) hybridized to the complement of the DNA molecule of (a) under stringent conditions, wherein the test DNA molecule is at least about (Ii) testing if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. DNA
A host cell containing the molecule is cultured under conditions suitable for expression of the polypeptide, and (i
ii) Providing the polypeptide produced by recovering the polypeptide from the cell culture medium.

123. PRO1550 In this application, a cDNA clone (DNA76393-1664) has been identified, designated "PRO1550" and encoding a novel secreted polypeptide. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1550 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1550 polypeptide having amino acid residue 1 of Figure 246 (SEQ ID NO: 431) or a sequence from about 31 to about 243, or (b) ( at least about 80% sequence identity, preferably at least about 85% sequence identity to the complement of the DNA molecule of a),
More preferably it comprises DNA having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In another aspect, the invention features about residue 228 of Figure 245 (SEQ ID NO: 430).
PRO1550 containing DNA that hybridizes to the complement of about 866 to about 866 nucleic acids
It relates to an isolated nucleic acid molecule encoding a polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA76393-1664) of ATCC Deposit No. 203323, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203323 (DNA76393-1664).

In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence of amino acid residues about 31 to about 243 of Figure 246 (SEQ ID NO: 431). Sequence identity, more preferably at least about 90%
To a DNA encoding a polypeptide having sequence identity of, most preferably at least about 95% sequence identity, or (b) an isolated nucleic acid molecule comprising the complement of the DNA molecule of (a). In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO155 having a sequence from about amino acid residue 31 to about 243 of Fig246 (SEQ ID NO: 431).
At least about 80 relative to (a) or (b) by hybridizing under stringent conditions with a DNA molecule encoding the 0 polypeptide, or (b) the complement of the DNA molecule of (a). Isolate a test DNA molecule if it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Produced by at least about 50 nucleotides, preferably at least about 100 nucleotides
It relates to an isolated nucleic acid molecule having nucleotides. In a particular aspect, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1550 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, or such a code. A complementary nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 30 of Figure 246 (SEQ ID NO: 431). In another aspect, the invention provides (a) residue 31 of Figure 246 (SEQ ID NO: 431).
To at least about 80% positive when compared to the amino acid sequence of about 243,
Preferably at least about 85% positive, more preferably at least about 90%
A DNA molecule encoding a polypeptide positive, most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising (b) (a) the complement of the DNA molecule. Another embodiment is a PR that finds use as a hybridization probe.
It relates to fragments of the O1550 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long. In another embodiment, the invention provides an isolated PRO1550 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1550 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 31-243 of Figure 246 (SEQ ID NO: 431).

In another aspect, the invention features amino acid residue 3 of Figure 246 (SEQ ID NO: 431).
1 to about 243 sequences, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90%.
Of PRO1550 polypeptides comprising an amino acid sequence having sequence identity of, most preferably at least about 95% sequence identity. In a further aspect, the invention features at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 31 to 243 of Figure 246 (SEQ ID NO: 431). It relates to an isolated PRO1550 polypeptide comprising an amino acid sequence with a positive, most preferably at least about 95% positive score. In yet a further aspect, the invention provides an isolated sequence comprising the sequence of amino acid residues 31 to about 243 of Figure 246 (SEQ ID NO: 431), or a fragment thereof sufficient to bind an anti-PRO1550 antibody. It relates to PRO1550 polypeptides.
Preferably, the PRO1550 fragment retains the qualitative biological activity of the native PRO1550 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig2
PR having a sequence of about 31 to about 243 amino acid residues of 46 (SEQ ID NO: 431)
A DNA molecule encoding the O1550 polypeptide, or (b) a complement of the DNA molecule of (a), is hybridized under stringent conditions such that the test DNA molecule is at least about (Ii) testing if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. DNA
A host cell containing the molecule is cultured under conditions suitable for expression of the polypeptide, and (i
ii) Providing the polypeptide produced by recovering the polypeptide from the cell culture medium.

124. Further Embodiments In another embodiment of the present invention, the invention provides a vector comprising DNA encoding any of the polypeptides described herein. Host cells comprising such vectors are also provided. For example, the host cell is a CHO cell,
It can be E. coli or yeast. Further provided is a method for producing any of the polypeptides described herein, which comprises culturing a host cell under conditions suitable for expression of the desired polypeptide, and removing the desired polypeptide from the cell culture. Comprising recovering. In another embodiment, the invention provides a chimeric molecule comprising any of the polypeptides described herein fused to a heterologous polypeptide or amino acid sequence.
Examples of such chimeric molecules include any of the polypeptides described herein fused to an immunoglobulin Fc region or epitope tag sequence. In another embodiment, the invention provides an antibody that specifically binds to any of the above or below described polypeptides. In some cases, the antibody is a monoclonal antibody,
It is a humanized antibody, an antibody fragment or a single chain antibody. In yet another embodiment, the invention provides oligonucleotide probes useful for isolating genomic and cDNA nucleotide sequences, wherein the probes are derived from any of the above or below nucleotide sequences. sell. In another embodiment, the invention provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding a PRO polypeptide. In one aspect, the isolated nucleic acid molecule is (a) a full length amino acid sequence disclosed herein, an amino acid sequence lacking a signal peptide disclosed herein, or a cell of a transmembrane protein disclosed herein with or without a signal peptide. A DNA molecule encoding a PRO polypeptide having an ectodomain, or (b) at least about 80% sequence identity to the complement of the DNA molecule of (a), preferably at least about 81% sequence identity; Even more preferably at least about 82% sequence identity, even more preferably at least about 83% sequence identity, even more preferably at least about 84%.
Sequence identity, even more preferably at least about 85% sequence identity, even more preferably at least about 86% sequence identity, even more preferably at least about 87% sequence identity, even more preferably at least about 88% sequence identity, even more preferably at least about 89% sequence identity, even more preferably at least about 90% acid sequence identity, even more preferably at least about 91% sequence identity, even more preferably. Is at least about 92% sequence identity, even more preferably at least about 93% sequence identity, even more preferably at least about 94% sequence identity, even more preferably at least about 95% sequence identity, More preferably at least about 96% sequence identity, and even more preferably at least about 9
It comprises a nucleotide sequence having 7% sequence identity, even more preferably at least about 98% sequence identity, and even more preferably at least about 99% sequence identity.

In another embodiment, the isolated nucleic acid molecule comprises (a) a coding sequence for a full-length PRO polypeptide cDNA disclosed herein, a coding for a PRO polypeptide cDNA lacking the signal peptide disclosed herein. A sequence, or a coding sequence for the extracellular domain of a transmembrane PRO polypeptide disclosed herein with or without a signal peptide, or (
b) at least about 80% sequence identity, preferably at least about 81% sequence identity, and even more preferably at least about 8 to the complement of the DNA molecule of (a).
2% sequence identity, even more preferably at least about 83% sequence identity, even more preferably at least about 84% sequence identity, even more preferably at least about 85% sequence identity, even more preferably. At least about 86% sequence identity, even more preferably at least about 87% sequence identity, even more preferably at least about 88% sequence identity, even more preferably at least about 89% sequence identity, even more Preferably at least about 90% acid sequence identity, even more preferably at least about 91% sequence identity, even more preferably at least about 92.
% Sequence identity, even more preferably at least about 93% sequence identity, even more preferably at least about 94% sequence identity, even more preferably at least about 95% sequence identity, even more preferably at least About 96% sequence identity,
Even more preferably, it comprises a nucleotide sequence having at least about 97% sequence identity, even more preferably at least about 98% sequence identity, and even more preferably at least about 99% sequence identity. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by any of the human protein cDNAs deposited with the ATTC disclosed herein, or (b) of (a) At least about 80% sequence identity to the complement of the DNA molecule, preferably at least about 81% sequence identity, even more preferably at least about 82% sequence identity, even more preferably at least about 83%. Of sequence identity, even more preferably at least about 84% sequence identity, even more preferably at least about 85% sequence identity, even more preferably at least about 86% sequence identity, even more preferably at least about 87% sequence identity, even more preferably at least about 88% sequence identity, even more preferably at least about 8 % Sequence identity, even more preferably at least about 90
% Acid sequence identity, even more preferably at least about 91% sequence identity, even more preferably at least about 92% sequence identity, even more preferably at least about 93% sequence identity, even more preferably At least about 94% sequence identity, even more preferably at least about 95% sequence identity, even more preferably at least about 96% sequence identity, even more preferably at least about 97% sequence identity, even more Preferably it relates to an isolated nucleic acid molecule comprising a nucleotide sequence having at least about 98% sequence identity, and even more preferably at least about 99% sequence identity. Another aspect of the invention provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding a PRO polypeptide having a transmembrane domain deleted or transmembrane domain inactivated, or Disclosed herein are the transmembrane domains of such polypeptides, which are complementary to such encoding nucleotide sequences. Therefore, the soluble extracellular domain of the PRO polypeptides described herein is considered.

Another embodiment is a PR optionally encoding a polypeptide, eg as a hybridization probe or comprising a binding site for an anti-PRO antibody.
It relates to fragments of the PRO polypeptide coding sequence that find use for encoding fragments of the O polypeptide. Such nucleic acid fragments are usually at least about 20 nucleotides in length, preferably at least about 30 nucleotides in length, more preferably at least about 40 nucleotides in length, and even more preferably at least about 50 nucleotides in length.
Of nucleotides, even more preferably at least about 60 nucleotides, even more preferably at least about 70 nucleotides, even more preferably at least about 80 nucleotides, even more preferably at least about 90 nucleotides.
Of nucleotides, even more preferably at least about 100 nucleotides, even more preferably at least about 110 nucleotides, even more preferably at least about 120 nucleotides, even more preferably at least about 130 nucleotides. Length, even more preferably at least about 140 nucleotides in length, even more preferably at least about 150 nucleotides in length, even more preferably at least about 160 nucleotides in length, even more preferably at least about 170 nucleotides in length. , Even more preferably at least about 180
Of nucleotides, even more preferably at least about 190 nucleotides, even more preferably at least about 200 nucleotides, even more preferably at least about 250 nucleotides, even more preferably at least about 300 nucleotides. Length, even more preferably at least about 350 nucleotides in length, even more preferably at least about 400 nucleotides in length, even more preferably at least about 450 nucleotides in length, even more preferably at least about 500 nucleotides in length. , Even more preferably at least about 600
Of nucleotides, even more preferably at least about 700 nucleotides, even more preferably at least about 800 nucleotides, even more preferably at least about 900 nucleotides, even more preferably at least about 1000 nucleotides. Length, where the term "about" means a reference nucleotide sequence length of plus or minus 10% of its reference length. PR
Novel fragments of the O polypeptide-encoding nucleotide sequence can be prepared by aligning a PRO polypeptide-encoding nucleotide sequence with other known nucleotide sequences using any of a number of well known sequence alignment programs to determine which PRO It is noted that the peptide-encoding nucleotide sequence fragment can be routinely determined by determining whether it is novel. All such PRO polypeptide-encoding nucleotide sequences are considered herein. Also contemplated are PRO polypeptide fragments encoded by these nucleotide molecule fragments, preferably PRO polypeptide fragments that comprise a binding site for an anti-PRO antibody. In another embodiment, the invention provides an isolated PRO polypeptide encoded by any of the isolated nucleic acid sequences identified above.

In one aspect, the invention provides a full-length amino acid sequence disclosed herein, a full-length amino acid sequence lacking a signal peptide disclosed herein, or an extracellular domain of a transmembrane protein disclosed herein with or without a signal peptide. Having at least about 80% sequence identity, preferably at least about 81% sequence identity, even more preferably at least about 82% sequence identity, even more preferably at least about 83%. Sequence identity, even more preferably at least about 84
% Sequence identity, even more preferably at least about 85% sequence identity, even more preferably at least about 86% sequence identity, even more preferably at least about 87% sequence identity, even more preferably at least About 88% sequence identity,
Even more preferably at least about 89% sequence identity, even more preferably at least about 90% acid sequence identity, even more preferably at least about 91% sequence identity, even more preferably at least about 92% sequence identity. Identity, even more preferably at least about 93% sequence identity, even more preferably at least about 94%.
Of sequence identity, even more preferably at least about 95% sequence identity, even more preferably at least about 96% sequence identity, even more preferably at least about 97% sequence identity, even more preferably at least about It relates to an isolated PRO polypeptide comprising an amino acid sequence having 98% sequence identity, and even more preferably at least about 99% sequence identity. In a further aspect, the invention provides at least about 80% sequence identity, preferably at least about 81%, to the amino acid sequence encoded by any of the human protein cDNAs deposited with the ATTC disclosed herein. Of sequence identity, even more preferably at least about 82% sequence identity, even more preferably at least about 83% sequence identity, even more preferably at least about 84% sequence identity, even more preferably at least about 85% sequence identity, even more preferably at least about 86% sequence identity, even more preferably at least about 87% sequence identity, even more preferably at least about 88% sequence identity, even more preferably At least about 89% sequence identity, and even more preferably at least about 90
% Acid sequence identity, even more preferably at least about 91% sequence identity, even more preferably at least about 92% sequence identity, even more preferably at least about 93% sequence identity, even more preferably At least about 94% sequence identity, even more preferably at least about 95% sequence identity, even more preferably at least about 96% sequence identity, even more preferably at least about 97% sequence identity, even more Preferably it relates to an isolated PRO polypeptide comprising an amino acid sequence having at least about 98% sequence identity, and even more preferably at least about 99% sequence identity.

In a further aspect, the invention provides a full-length amino acid sequence disclosed herein, a full-length amino acid sequence lacking a signal peptide disclosed herein, or the extracellular domain of a transmembrane protein disclosed herein with or without a signal peptide. At least about 80% positive, preferably at least about 81% positive, more preferably at least about 82% positive, even more preferably at least about 83% positive, when compared to the amino acid sequence of a PRO polypeptide having: Even more preferably at least about 84% positive, even more preferably at least about 85%.
% Positive, even more preferably at least about 86% positive, even more preferably at least about 87% positive, even more preferably at least about 88% positive, even more preferably at least about 89% positive,
Even more preferably at least about 90% positive, even more preferably at least about 91% positive, even more preferably at least about 92% positive, even more preferably at least about 93% positive, even more preferably at least about. 94% positive, even more preferably at least about 95% positive, even more preferably at least about 96% positive, even more preferably at least about 97% positive, even more preferably at least about 9%.
It relates to an isolated PRO polypeptide comprising an amino acid sequence showing a score of 8% positive, and even more preferably at least about 99% positive. In a particular aspect, the invention provides an isolated PRO polypeptide lacking an N-terminal signal sequence and / or an initiation methionine, which is encoded by a nucleotide sequence encoding such an amino acid sequence described above. Methods of producing this are also described herein, wherein these methods culture host cells comprising a vector containing a suitable encoding nucleic acid molecule under conditions suitable for the expression of the PRO polypeptide, the cells Comprising recovering the PRO polypeptide from the medium.

Another aspect of the invention provides an isolated PRO polypeptide having a transmembrane domain deleted or transmembrane domain inactivated. Also described herein are methods of producing this, wherein the methods culture host cells comprising a vector containing a suitable encoding nucleic acid molecule under conditions suitable for expression of the PRO polypeptide,
Comprising recovering the PRO polypeptide from the cell culture medium. In yet another embodiment, the present invention relates to agonists and antagonists of the native PRO polypeptides identified herein. In a further embodiment, the invention provides a method of identifying an agonist or antagonist to a PRO polypeptide, comprising contacting the PRO polypeptide with a candidate molecule and monitoring the biological activity mediated by said PRO polypeptide. Regarding In a still further embodiment, the invention relates to a composition of matter comprising a PRO polypeptide, or an agonist or antagonist as described herein, or an anti-PRO antibody in association with a carrier. In some cases, the carrier is a pharmaceutically acceptable carrier. Another embodiment of the invention is a PRO polypeptide, or agonist thereof, for the preparation of a medicament useful in the treatment of a condition responsive to a PRO polypeptide, agonist or antagonist thereof or anti-PRO antibody as described above. It relates to the use of antagonists or anti-PRO antibodies.

Detailed Description of the Preferred Embodiments I. Definitions "PRO Polypeptide" and "PRO" or "UCP" as used herein
The term refers to various polypeptides immediately followed by a numerical code, with the full code (eg, PRO / number) referring to the particular polypeptide sequence described herein. As used herein, "PRO / number polypeptide" and "PRO / number"
Where the term “number” is given as the actual numerical symbol as used herein includes native sequence polypeptides and variants (defined in more detail herein). The PRO polypeptides described herein may be isolated from a variety of sources, such as human tissue types or other sources, and may be prepared by recombinant or synthetic methods. A "native sequence PRO polypeptide" or "UCP" is a naturally occurring corresponding PR
It contains a polypeptide having the same amino acid sequence as the O polypeptide. Such native sequence PRO polypeptides can be isolated from nature or can be produced by recombinant or synthetic means. "Natural sequence PRO polypeptide"
The term specifically refers to naturally occurring truncated or secreted forms of a particular PRO polypeptide (eg, extracellular domain sequences), naturally occurring variant forms (eg, alternatively spliced forms) and polypeptides thereof. Naturally occurring allelic variants are included. In various embodiments of the invention, the native sequence PRO polypeptide is a mature or full length native sequence polypeptide comprising the full length amino acid sequence shown in the accompanying figures. Start and stop codons are shown in bold or underlined in the figure. However, the PRO polypeptides disclosed in the accompanying figures are shown to begin with a methionine residue, designated herein as amino acid 1 in the figures, although other polypeptides located upstream or downstream of amino acid position 1 in the figures may be used. It is also possible and possible to use a methionine residue as the starting amino acid residue of the PRO polypeptide. The PRO polypeptide "extracellular domain" or "ECD" means a form of the PRO polypeptide that is substantially free of transmembrane and cytoplasmic domains. Usually PR
O polypeptides ECD have less than 1% of their transmembrane and / or cytoplasmic domains, preferably less than 0.5% of such domains. PRO of the present invention
It will be appreciated that any transmembrane domain identified for a polypeptide will be identified according to the criteria routinely used in the art to identify that type of hydrophobic domain. The exact boundaries of the transmembrane domain may vary, but are likely not to exceed about 5 amino acids from either end of the first identified domain. Thus, a PRO polypeptide extracellular domain optionally comprises no more than about 5 amino acids from either side of the transmembrane domain and / or extracellular domain boundaries as identified in the Examples or specification. However, those polypeptides and their encoding nucleic acids, with or without a signal peptide, are contemplated by the present invention.

The approximate location of the "signal peptides" of the various PRO polypeptides disclosed herein are shown in the accompanying figures. However, as noted, the C-terminal boundary of the signal peptide may vary, but is most likely to be less than about 5 amino acids on either side of the signal peptide C-terminal boundary as originally defined herein. High, the C-terminal boundary of the signal peptide can be identified according to the criteria routinely used to identify such types of amino acid sequence components (eg, Nielsen et al., Prot. Eng. 10: 1-
6 (1997) and von Heinje et al., Nucl. Acids. Res. 14: 4683-4690 (1986)). Furthermore, it is also recognized that in some cases cleavage of the signal peptide from the secreted polypeptide is not completely homogeneous, resulting in one or more secreted species. These mature polypeptides, and the polynucleotides encoding them, in which the signal peptide is cleaved within less than about 5 amino acids on either side of the C-terminal border of the signal peptide as defined herein, are contemplated by the present invention. It "PRO polypeptide variant" refers to a full length native sequence PRO polypeptide disclosed herein, a full length native sequence PRO polypeptide sequence lacking the signal peptide disclosed herein, a signal, as defined above or below. Active PR having at least about 80% amino acid sequence identity with the extracellular domain of PRO disclosed herein with or without peptides or other fragments of the full-length PRO polypeptides disclosed herein.
O polypeptide. Such PRO polypeptide variants include, for example, PRO polypeptides in which one or more amino acid residues have been added or deleted at the N- or C-terminus of the full-length native amino acid sequence. Generally, a PRO polypeptide variant is a full length native amino acid sequence disclosed herein, a full length native sequence PRO polypeptide sequence lacking the signal peptide disclosed herein, the extracellular domain of a PRO disclosed herein with or without a signal peptide. Or the full length PR disclosed herein
At least about 80% amino acid sequence identity with the other fragment of the O polypeptide, preferably at least about 81% amino acid sequence identity, more preferably at least about 82% amino acid sequence identity, more preferably at least about 83. % Amino acid sequence identity, more preferably at least about 84% amino acid sequence identity, more preferably at least about 85% amino acid sequence identity, more preferably at least about 86% amino acid sequence identity, more preferably at least About 87% amino acid sequence identity, more preferably at least about 88% amino acid sequence identity, more preferably at least about 89% amino acid sequence identity, more preferably at least about 90% amino acid sequence identity, more preferably Is at least about 91% amino acid sequence identity, more preferred Or at least about 92% amino acid sequence identity, more preferably at least about 93% amino acid sequence identity, more preferably at least about 94% amino acid sequence identity, more preferably at least about 95% amino acid sequence identity. , More preferably at least about 96% amino acid sequence identity, more preferably at least about 97% amino acid sequence identity, more preferably at least about 98% amino acid sequence identity, and more preferably at least about 99%. Have amino acid sequence identity. Generally, a PRO variant polypeptide is at least about 10 amino acids in length, more at least about 20 amino acids in length, more at least about 30 amino acids in length, more at least about 40 amino acids in length, more at least about 50 amino acids in length. Long, more at least about 60 amino acids in length, more at least about 70 amino acids in length, more at least about 80 amino acids in length,
More than at least about 90 amino acids long, more than at least about 100 amino acids long, more at least about 150 amino acids long, and more at least about 20 amino acids long.
It is 0 amino acids long, more than at least about 300 amino acids long, or more.

“Percent (%) amino acid sequence identity”, as identified herein, relative to a PRO polypeptide as defined herein, refers to the alignment of the sequences and if necessary to obtain maximum percent sequence identity. It is defined as the percentage of amino acid residues in the candidate sequence that are identical to amino acid residues in the PRO polypeptide, with the introduction of gaps and without considering any conservative substitutions as part of the sequence identity. Alignments for the purpose of determining percent amino acid sequence identity can be made by a variety of methods within the skill of the art, including publicly available BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. This can be achieved by using computer software. One of ordinary skill in the art can determine the appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. However, for purposes herein, the% amino acid sequence identity values are calculated using the WU-BLAST-2 computer program (Altschul et al.
, Methods in Enzymology 266: 460-480 (1996)). Most W
U-BLAST-2 search parameters are set to initial values. Not set to default values, ie adjustable parameters set to the following values: overlap span = 1, overlap fraction = 0.125, word threshold (T) = 11, and scoring matrix = BLOSUM62. For purposes herein, a% amino acid sequence identity value is (a) a PRO of interest having a sequence derived from the native PRO polypeptide.
Between identical amino acid residues of the polypeptide and the comparative amino acid sequence of interest (ie, the sequence which may be the PRO polypeptide variant with which the PRO polypeptide of interest is compared). The number is determined by the quotient (b) divided by the total number of residues of the PRO polypeptide of interest. Unless otherwise stated, all% amino acid sequence identity values used herein are obtained using the WU-BLAST-2 computer program as described in the immediately preceding paragraph. However, the% amino acid sequence identity value is, as described below,
The complete source code for the ALIGN-2 program is also available using the sequence comparison program ALIGN-2 provided in Figure 248A-Q. The ALIGN-2 sequence comparison computer program was written by Genentech, Inc. and the source code shown in Figure 248A-Q is submitted to the US Copyright Office, Washington DC, 20559 with user documentation and under US Copyright Registration No. TXU510087. It is registered in. ALIGN-2
Is suitably available from Genentech, Inc., South San Francisco, California and may be compiled from the source code provided in Figure 248A-Q.
The ALIGN-2 program is a UNIX operating system, preferably a digital UNI.
Compiled for use with X V4.0D. All sequence comparison parameters are ALI
It is set by the GN-2 program and does not change.

In the context where ALIGN-2 is used to compare amino acid sequences, the% amino acid sequence identity of a given amino acid sequence A with, or to, a given amino acid sequence B (or a given amino acid sequence B Or a given amino acid sequence A having or containing a certain% amino acid sequence identity thereto)
Is calculated as: 100 times the fraction X / Y, where X is the number of amino acid residues in the score that are matched by the alignment of A and B of the sequence alignment program ALIGN-2. , Y is the total number of amino acid residues of B. It will be appreciated that when the length of amino acid sequence A differs from the length of amino acid sequence B, the% amino acid sequence identity of A to B is different from the% amino acid sequence identity of B to A. As an example of calculating the% amino acid sequence identity using this method, Fig247A-B is a method for calculating the% amino acid sequence identity of an amino acid sequence called "comparative protein" with an amino acid sequence called "PRO". Indicates. In addition,% amino acid sequence identity is determined by the sequence comparison program NCBI-BLAST2 (Altschul
Et al., Nucleic Acids Res. 25: 3389-3402 (1997)). NCB
The I-BLAST2 sequence comparison program can be downloaded from http://ww.ncbi.nlm.nih.gov. NCBI-BLAST2 uses several search parameters, all of which are set to initial values, eg unmask = ok, chains = all, expected occurrences = 10, minimum low compound length = 15/5 , Multipath e-value = 0.01, multipath constant = 25, final gap alignment dropoff = 25, and scoring matrix = BLOSUM62. In the situation where NCBI-BLAST2 is used for amino acid sequence comparisons, the% amino acid sequence identity of a given amino acid sequence A with or to a given amino acid sequence B (or with a given amino acid sequence B, or On the other hand, a certain percentage
A given amino acid sequence A with or containing amino acid sequence identity may also be calculated) as follows: 100 times the fraction X / Y, where X is A in the sequence alignment program NCBI-BLAST2. And the number of amino acid residues in the score that were matched by the alignment of B to be identical, where Y is B
Is the total number of amino acid residues. It will be appreciated that when the length of amino acid sequence A differs from the length of amino acid sequence B, the% amino acid sequence identity of A to B is different from the% amino acid sequence identity of B to A.

A “PRO variant polynucleotide” or “PRO variant nucleic acid sequence” is a nucleic acid molecule that encodes an active PRO polypeptide, as defined below, which is a full-length native sequence PRO poly disclosed herein. A peptide sequence, a full length native sequence PRO polypeptide sequence lacking the signal peptide disclosed herein, an extracellular domain of a PRO polypeptide disclosed herein with or without a signal peptide, or any other of the full length PRO polypeptide sequences disclosed herein. A nucleic acid sequence encoding a fragment of at least 8
It has 0% sequence identity. Generally, a PRO variant polypeptide nucleotide is a full length native sequence PRO polypeptide sequence disclosed herein, a full length native sequence PRO polypeptide sequence lacking the signal peptide disclosed herein, a PRO polypeptide disclosed herein with or without a signal peptide. At least about 80% nucleic acid sequence identity, preferably at least about 81% nucleic acid sequence identity with the nucleic acid sequence encoding the extracellular domain of the peptide, or any other fragment of the full-length PRO polypeptide disclosed herein.
More preferably at least about 82% nucleic acid sequence identity, more preferably at least about 83% nucleic acid sequence identity, more preferably at least about 84% nucleic acid sequence identity, more preferably at least about 85% nucleic acid sequence identity. Sex, more preferably at least about 86% nucleic acid sequence identity, more preferably at least about 87% nucleic acid sequence identity, more preferably at least about 88% nucleic acid sequence identity, more preferably at least about 89% nucleic acid. Sequence identity, more preferably at least about 90%
Nucleic acid sequence identity, more preferably at least about 91% nucleic acid sequence identity, more preferably at least about 92% nucleic acid sequence identity, more preferably at least about 93% nucleic acid sequence identity, more preferably at least about 94% nucleic acid sequence identity, more preferably at least about 95% nucleic acid sequence identity, more preferably at least about 96% nucleic acid sequence identity, more preferably at least about 97% nucleic acid sequence identity, more preferably It has at least about 98% nucleic acid sequence identity, and more preferably at least about 99% nucleic acid sequence identity. Variants do not include native nucleotide sequences. Generally, a PRO variant polynucleotide is at least about 30 nucleotides long, more at least about 60 nucleotides long, more at least about 90 nucleotides long, more at least about 120 nucleotides long, more at least about 150 nucleotides long. Long, more often at least about 180 nucleotides, more at least about 210 nucleotides, and more at least about 24
0 nucleotides, more at least about 270 nucleotides, more at least about 300 nucleotides, more at least about 450 nucleotides, more at least about 600 nucleotides, more at least about 900 nucleotides, or More than that.

“Percent (%) nucleic acid sequence identity” to a PRO-encoded nucleic acid sequence identified herein means that the PRO sequences are aligned, introducing gaps if necessary to obtain maximal percent sequence identity, PRO Defined as the percentage of nucleotides in the candidate sequence that are identical to the nucleotides in the sequence. Alignments for the purpose of determining percent nucleic acid sequence identity can be performed by a variety of methods within the purview of those skilled in the art, such as BLAS.
This can be accomplished by using publicly available computer software such as T, BLAST-2, ALIGN or Megalign (DNASTAR) software. However, for purposes herein,% nucleic acid sequence identity values are calculated using the WU-BLAST-2 computer program (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Most WU-BLAST-2 search parameters are set to default values. Not set to initial values, ie adjustable parameters set to the following values: overlap span = 1, overlap fraction = 0.125, word threshold (T) = 11,
And scoring matrix = BLOSUM62. For purposes herein, a% nucleic acid sequence identity value is (a) a nucleic acid of a PRO polypeptide-encoding nucleic acid molecule of interest having a sequence derived from a native sequence PRO polypeptide-encoding nucleic acid molecule. WU between a sequence and a nucleic acid molecule of interest (ie, a sequence that may be a variant PRO polynucleotide with which the PRO polypeptide-encoding nucleic acid of interest is compared)
-The number of matching identical nucleotides determined by BLAST-2 is (b) the target PRO
Determined by the quotient divided by the total number of nucleotides of the polypeptide-encoding nucleic acid molecule. For example, in the description "an isolated nucleic acid sequence comprising a nucleic acid sequence having at least 80% nucleic acid sequence identity with nucleic acid sequence B", nucleic acid sequence A is the target comparison nucleic acid sequence and nucleic acid sequence B is the target nucleic acid sequence. Is a PRO polypeptide-encoding nucleic acid sequence.

Unless otherwise stated, all% nucleic acid sequence identity values used herein are obtained using the WU-BLAST-2 computer program as described in the immediately preceding paragraph. However, the% nucleic acid sequence identity values were determined by ALIGN-2 as described below.
The complete source code for the program is also available using the sequence comparison program ALIGN-2 provided in Figure 248A-Q. The ALIGN-2 sequence comparison computer program was written by Genentech, Inc. and the source code shown in Figure 248A-Q is submitted to the US Copyright Office, Washington DC, 20559 with user documentation and under US Copyright Registration No. TXU510087. It is registered in. The ALIGN-2 program is suitably available from Genentech, Inc., South San Francisco, California and may be compiled from the source code provided in Figure 248A-Q. The ALIGN-2 program is a UNIX operating system, preferably Digital U
Compiled for use with NIX V4.0D. All sequence comparison parameters are A
It is set by the LIGN-2 program and does not change. In the context where ALIGN-2 is used for nucleic acid sequence comparisons, the% nucleic acid sequence identity of a given nucleic acid sequence C to, or to a given nucleic acid sequence D (or with a given nucleic acid sequence D, or A given nucleic acid sequence C with or to which it has a certain% nucleic acid sequence identity can also be calculated) as: 100 times the fraction W / Z, where W is The number of nucleotides in the score that were matched as identical by the C and D alignment of the sequence alignment program ALIGN-2, and Z is the total number of nucleotides in D. When the length of the nucleic acid sequence C is different from the length of the nucleic acid sequence D, C
It will be appreciated that the% nucleic acid sequence identity of D to C is different from the% nucleic acid sequence identity of D to C. As an example of calculating% nucleic acid sequence identity, FIG.
CD indicates the method of calculating the% nucleic acid sequence identity of a nucleic acid sequence referred to as "comparative DNA" to a nucleic acid sequence referred to as "PRO-DNA". In addition,% nucleic acid sequence identity is determined by the sequence comparison program NCBI-BLAST2 (Altschul et al., N.
Nucleic Acids Res. 25: 3389-3402 (1997)). NCBI-BLA
The ST2 sequence comparison program can be downloaded from http://www.ncbi.nlm.nih.gov. NCBI-BLAST2 uses several search parameters, all of which are set to initial values, eg unmask = ok, chains = all, expected occurrence = 1
Includes 0, minimum low composite length = 15/5, multipath e-value = 0.01, multipath constant = 25, final gap alignment dropoff = 25, and scoring matrix = BLOSUM62. In the context where NCBI-BLAST2 is used for nucleic acid sequence comparisons, the% nucleic acid sequence identity of a given nucleic acid sequence C with or to a given nucleic acid sequence D (or,
A given nucleic acid sequence D can also be referred to as a given nucleic acid sequence C with or including a certain% nucleic acid sequence identity to it) is calculated as: fraction W / 100 times Z where W is the number of nucleic acid residues with a score that was matched by the C and D alignments of the sequence alignment program NCBI-BLAST2, and Z is the total number of nucleic acid residues in D. When the length of the nucleic acid sequence C is different from the length of the nucleic acid sequence D, D of C
It will be appreciated that the% nucleic acid sequence identity to C is different from the% nucleic acid sequence identity of D to C. In another embodiment, the PRO variant polypeptide nucleotide encodes an active PRO polypeptide, preferably under stringent hybridization and wash conditions.
Nucleic acid molecules that hybridize to the nucleotide sequences encoding the full-length PRO polypeptides disclosed herein. The PRO variant polypeptide may be one encoded by the PRO variant polynucleotide.

The term “positive” refers to residues in sequence comparisons performed as described above that are not identical but have similar properties in the compared sequences (eg, conservative). As a result of the substitution, see Table 1 below). For purposes herein, the% positive values are (a) the amino acid sequence of the PRO polypeptide of interest having a sequence derived from the native PRO polypeptide and the comparative amino acid sequence of interest (
That is, the amino acid sequence with which the PRO polypeptide sequence is compared)
The number of amino acid residues with a positive value in the BLOSUM62 matrix of -2,
(B) Determined by the quotient divided by the total number of amino acid residues in the PRO polypeptide of interest. Unless otherwise stated, positive% values are calculated as described in the paragraph immediately above. Obtained using the WU-BLAST-2 computer program. However, the amino acid sequence identities performed as described above for ALIGN-2 and NCBI-BLAST2 include amino acid residues in sequences that have similar as well as similar properties.
Amino acid residues that are positive for the target amino acid residue are the same as the target amino acid residue or are preferred substitutions for the target amino acid residue (defined in Table 1 below). It is a thing. In the amino acid sequence comparison using ALIGN-2 or NCBI-BLAST2, the positive% value of the given amino acid sequence A with or against the given amino acid sequence B (or with the given amino acid sequence B, Or a given amino acid sequence A which has or contains some% amino acid sequence identity thereto) is calculated as: 100 times the fraction X / Y, where X Is A and B of the sequence alignment program ALIGN-2 or NCBI-BLAST2
Is the number of amino acid residues in the score that are considered positive by the alignment, and Y is the total number of amino acid residues in B. It will be appreciated that if the length of the amino acid sequence A is not equal to the length of the amino acid sequence B, then the% positive for A to B is different from the% positive for B to A.

“Isolated”, when used to describe the various polypeptides disclosed herein, refers to polypeptides that have been identified, separated and / or recovered from components of their natural environment. means. Contaminant components of its natural environment are materials that typically interfere with diagnostic or therapeutic uses for the polypeptide, and include enzymes, hormones, and other proteinaceous or nonproteinaceous solutes. In a preferred embodiment, the polypeptide is (1) sufficient to obtain an N-terminal or internal amino acid sequence of at least 15 residues by using a spinning cup sequenator, or (2) Coomassie blue or It is preferably purified to homogeneity by SDS-PAGE under non-reducing or reducing conditions using silver staining. Isolated polypeptide includes protein in situ within recombinant cells, since at least one component of the PRO polypeptide natural environment will not be present. Ordinarily, however, isolated polypeptide will be prepared by at least one purification step. An "isolated" PRO polypeptide-encoding nucleic acid is a nucleic acid molecule that has been identified and separated from at least one contaminating nucleic acid molecule that is normally associated with the natural source of the nucleic acid encoding the PRO polypeptide. An isolated PRO polypeptide-encoding nucleic acid molecule is in a form or setting other than that found in nature. Thus, an isolated PRO polypeptide-encoding nucleic acid molecule can be the PRO that is present in native cells.
Distinct from the polypeptide-encoding nucleic acid molecule. However, an isolated PRO polypeptide-encoding nucleic acid molecule includes, for example, a PRO polypeptide nucleic acid molecule contained in a cell that normally expresses the PRO polypeptide in a chromosomal location where the nucleic acid molecule differs from that of the native cell. . The expression "control sequences" refers to DNA sequences necessary to express an operably linked coding sequence in a particular host organism. The control sequences that are suitable for prokaryotes, for example, include a promoter, optionally an operator sequence, and a ribosome binding site. Eukaryotic cells are known to utilize promoters, polyadenylation signals and enhancers. Nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For example, if the DNA of the presequence or secretory leader is expressed as a preprotein that participates in the secretion of the polypeptide, the DNA of that polypeptide
Is operably linked to; a promoter or enhancer is operably linked to the coding sequence if it affects the transcription of the sequence; or the ribosome binding site is such that it facilitates translation. Is operably linked to the coding sequence. Generally, "operably linked" means that D is bound to
It means that the NA sequences are contiguous and, in the case of a secretory leader, contiguous and in the reading phase. However, enhancers do not necessarily have to be in close proximity. Binding is accomplished by ligation at convenient restriction sites. If such sites do not exist, then synthetic oligonucleotide adapters or linkers are used in accord with conventional practice.

The term “antibody” is used in the broadest sense, eg, a single anti-P
RO polypeptide monoclonal antibody (including agonist, antagonist, and neutralizing antibody), anti-PRO antibody composition with multi-epitope specificity, single chain anti-PR
O antibodies, and fragments of anti-PRO antibodies are included (see below). The term "monoclonal antibody" as used herein is a substantially homogeneous population of antibodies, ie, the individual antibodies that comprise them, are identical except for the naturally occurring mutations that may be present in small amounts. Refers to the antibody obtained from the population. The "stringency" of a hybridization reaction is readily determined by one of ordinary skill in the art and is an empirical calculation that generally depends on probe length, wash temperature, and salt concentration. In general, longer probes have higher temperatures for proper annealing and shorter probes have lower temperatures. Hybridization generally depends on the ability of denatured DNA to reanneal when complementary strands are present in an environment near, but below their melting temperature. The higher the degree of desired homology between the probe and the hybridizable sequence, the higher the relative temperature that can be used. As a result, higher relative temperatures make the reaction conditions more stringent, while lower temperatures reduce stringency.
Moreover, stringency is inversely proportional to salt concentration. Further details and explanations of the stringency of the hybridization reaction can be found in Ausubel et al., Current Protocols in Molecular Biology, Wiley.
See Interscience Publishers, (1995). As defined herein, "stringent conditions" or "high stringency conditions" means (1) low ionic strength and high temperature for washing, eg, 0.015M sodium chloride / 0.0015M at 50 ° C. Using sodium citrate / 0.1% sodium dodecyl sulphate; (2) Denaturants such as formamide during hybridization, eg 50% (v / v) formamide and 0.1% bovine serum albumin at 42 ° C. /0.1% Ficoll / 0.1% Polyvinylpyrrolidone / 50 mM pH 6
． 5 sodium phosphate buffer, and 750 mM sodium chloride, 75 m
With M sodium citrate; (3) 50% formamide at 42 ° C., 5 × SSC (0.75M NaCl, 0.075M sodium citrate),
50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5x Denhard's solution, sonicated salmon sperm DNA (50 μg / ml), 0.1%
High stringency consisting of SDS and 0.1% SSC with 10% dextran sulfate, 0.2x SSC (sodium chloride / sodium citrate) wash at 42 ° C and 50% formamide at 55 ° C, then EDTA at 55 ° C. Identified by those using sexual wash. “Moderate stringency conditions” are described in Sambrook et al., Molecular Cloning: A Laboratory.
Manual (Identified as described in New York: Cold Spring Harbor Laboratory Press, 1989, and involves the use of less stringent wash solutions and hybridization conditions (eg, temperature, ionic strength and% SDS) as described above. Moderate stringency conditions were: 20% formamide, 5xSSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate pH 7.6, 5x denhard solution, 10% dextran sulfate, and 20 mg / mL. Denatured sheared salmon sperm DNA
Incubation in a solution containing at 37 ° C. overnight followed by 37-in 1 × SSC.
The condition is that the filter is washed at 50 ° C. One of ordinary skill in the art will recognize how to adjust temperature, ionic strength, etc. as needed to accommodate factors such as probe length.

The term “epitope tag” as used herein refers to a PRO polypeptide fused to a “tag polypeptide”, or a chimeric polypeptide comprising their domain sequences. The tag polypeptide has a sufficient number of residues to provide an epitope for which the antibody can be produced, or an epitope identifiable by some other reagent, but whose length is of the PRO polypeptide of interest. Short enough not to interfere with the activity of the peptide. Also, the tag polypeptide is preferably fairly unique so that the antibody does not substantially cross-react with other epitopes. Suitable tag polypeptides generally have at least 6 amino acid residues, usually about 8 to about 50 amino acid residues (preferably about 10 to about 20 residues). The term "immunoadhesin" as used herein refers to antibody-like molecules that combine the binding specificity of a heterologous protein (an "adhesin") with an immunoglobulin constant domain. Structurally, an immunoadhesin contains a fusion of an immunoglobulin constant domain sequence with an amino acid sequence that has the desired binding specificity and is other than the antigen recognition and binding site of an antibody (ie, "heterologous"). . The adhesin portion of the immunoadhesin molecule is typically a contiguous amino acid sequence containing at least the binding site for the receptor or ligand. The immunoglobulin constant domain sequence of the immunoadhesin is Ig
It can be obtained from any immunoglobulin such as G-1, IgG-2, IgG-3 or IgG-4 subtype, IgA (including IgA-1 and IgA-2), IgE, IgD or IgM. As used herein, “active” and “activity” refer to forms of PRO that retain the biological and / or immunological activity of the native or naturally occurring PRO polypeptide and are “biological”. By activity is meant a biological function (inhibitory or stimulatory) produced by a natural or naturally occurring PRO that excludes the ability of the natural or naturally occurring PRO to generate antibodies against the antigenic epitopes. However, "immunological" activity refers to the ability to generate antibodies against the antigenic epitopes of natural or naturally occurring PRO. The term "antagonist" is used in its broadest sense and refers to any molecule that blocks, inhibits, or neutralizes the biological activity of a native PRO polypeptide disclosed herein. Similarly, the term "agonist" is used in its broadest sense and refers to any molecule that mimics the biological activity of a native PRO polypeptide disclosed herein. Suitable agonist or antagonist molecules specifically include agonist or antagonist antibodies or antibody fragments, fragments or amino acid sequence variants of native PRO polypeptides, peptides, small organic molecules, and the like. A method of identifying an agonist or antagonist of a PRO polypeptide can include contacting the PRO polypeptide with a candidate antagonist or agonist and measuring a change in one or more biological activities normally associated with the PRO polypeptide.

“Treatment” as used herein refers to both curative treatment, prophylactic and preventative therapy, whereby the patient prevents or reduces (decreases) the targeted pathological condition or eczema. To be Those in need of treatment include those already with the disorder as well as those prone to have the disorder or those in whom the disorder has been prevented. By "chronic" administration is meant administration of the drug in a continuous manner as opposed to an acute manner to maintain the initial therapeutic effect (activity) over an extended period of time. An "intermittent" administration is a treatment that is cyclical in nature, rather than continuous without interruption. "Mammal" for treatment is classified as a mammal, including humans, domestic and agricultural animals, zoos, sports, or pet animals, such as dogs, cats, cows, horses, sheep, pigs, rabbits, etc. Means any animal. Preferably the mammal is a human. Administration "in combination with" one or more therapeutic agents includes simultaneous (concurrent) and sequential administration in any order. As used herein, "carrier" includes a pharmaceutically acceptable carrier, excipient, or stabilizer and is nontoxic to cells or mammals exposed to them at the dosages and concentrations employed. . The physiologically acceptable carrier is often an aqueous pH buffered solution. Examples of physiologically acceptable carriers are phosphate, citrate, and other organic acid salt buffers; antioxidants including ascorbic acid; low molecular weight (about 1
<0 residues) polypeptide; protein such as serum albumin, gelatin, or immunoglobulin; hydrophobic polymer such as polyvinylpyrrolidone; amino acid,
E. Glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides and other carbohydrates including glucose, mannose or dextran; E
Chelating agents such as DTA; sugar alcohols such as mannitol or proto-rubitol; salt forming counterions such as sodium; and / or nonionic surfactants such as TWEEN (trade name), polyethylene glycol (PEG), and PLURONICS First name) is included.

An “antibody fragment” comprises a portion of an intact antibody, preferably the antigen binding or variable region of the intact antibody. Examples of antibody fragments are Fab, Fab ′, F (ab ′) ₂ and Fv fragments; diabodies; linear antibodies (Zapata et al., Protein Eng. 8 (10): 1).
057-1062 [1995]); single-chain antibody molecules; and multispecific antibodies formed from antibody fragments. Papain digestion of antibodies produces two identical antibody-binding fragments, called "Fab" fragments, each of which has a single antigen-binding site and the rest "Fc", reflecting its ability to crystallize readily. Named Fragment. Pepsin treatment yields an F (ab ′) ₂ fragment that has two antigen-combining sites and is still capable of cross-linking antigen. "Fv" is the minimum antibody fragment that contains a complete antigen recognition and binding site. This region consists of a dimer of one heavy chain and one light chain variable region in close, non-covalent association. In this arrangement, the three CDRs of each domain interact to determine the VH-VL antigen binding site on the surface of the monomer. Correctly, the six CDRs have the antigen binding specificity for the antibody. However, even a single variable domain (or half of an Fv comprising only three CDRs specific for an antigen) has a lower affinity than the entire binding site, but has the ability to recognize and bind antigen . The Fab fragment also contains the constant domain of the light chain and the first constant domain (CH
Also includes 1). Fab fragments differ from Fab fragments by the addition of a few residues at the carboxy terminus of the heavy chain CH1 domain including one or more cysteines from the antibody hinge region. Here, Fab′-SH represents Fab ′ in which the cysteine residue of the constant domain has a free thiol group. F (ab ′) ₂ antibody fragments originally were produced as pairs of Fab ′ fragments which have hinge cysteines between them. Other chemical couplings of antibody fragments are also known. The "light chains" of antibodies (immunoglobulins) from any vertebrate species are classified into one of two distinct types called kappa and lambda, based on the amino acid sequences of their constant domains. Depending on the amino acid sequence of the constant domain of their heavy chains, immunoglobulins can be classified into different classes. Five major immunoglobulin classes: IgA, Ig
D, IgE, IgG and IgM, some of which are further subclasses (isotypes), eg IgG1, IgG2, IgG3, IgG4, IgA and Ig.
It is classified into A2.

“Single-chain Fv” or “sFv” antibody fragments include antibody fragments that comprise the VH and VL domains of the antibody, these domains being present in a single polypeptide chain. Preferably, the Fv polypeptide further comprises a polypeptide linker between the VH and VL domains, which enables the sFV to form the desired structure for antigen binding.
For an overview of scFv, see The Pharmacology of Monoclonal Antibodies, vol.
113, Rosenburg and Moore, Springer-Verlag, New York, pp. 269-315 (199
See 4) Pluckthun. The term "diabodies" refers to a small antibody fragment having two antigen binding sites, which fragment is a heavy chain linked to a light chain variable domain (VL) within the same polypeptide chain (VH-VL). It contains a variable domain (VH). By using a linker that is too short to pair between two domains on the same chain, the domains are forced to pair with the complementary domains on the other chain, creating two antigen binding sites. Diabodies are described, for example, in EP 404,097; WO 93/11161; and Hollinger et al., Proc. Natl.
Acad. Sci. USA, 90: 6444-6448 (1993). An "isolated" antibody is one that has been identified and separated and / or recovered from a component of its natural environment. Contaminant components of its natural environment are materials that would interfere with its diagnostic or therapeutic use for the antibody, including enzymes, hormones, and other proteinaceous or nonproteinaceous solutes. In a preferred embodiment, the antibody is (1) Lori method.
More than 95% antibody, most preferably 99% by weight when measured by (Lowry method)
By using (2) Spinning cup sequenator until
Enough to obtain an N-terminal or internal amino acid sequence of at least 15 residues,
Alternatively, (3) purification to homogeneity by SDS-PAGE under non-reducing or reducing conditions using Coomassie blue or preferably silver staining. Isolated antibody includes the antibody in situ within recombinant cells since at least one component of the antibody's natural environment will not be present. Ordinarily, however, isolated antibody will be prepared by at least one purification step. The term "label" as used herein refers to a detectable compound or composition which is conjugated directly or indirectly to the antibody to produce a "labeled" antibody. The label may itself be detectable (eg a radioactive or fluorescent label) or, in the case of an enzymatic label, may catalyze the chemical conversion of a detectable substrate compound or composition. By "solid phase" is meant a non-aqueous matrix to which the antibodies of the invention can adhere. Examples of solid phases contemplated herein include those formed partly or wholly from glass (eg, controlled pore glass), polysaccharides (eg, agarose), polyacrylamide, polystyrene, polyvinyl alcohol and silicone. In certain embodiments, depending on the context, the solid phase can comprise the wells of an assay plate; in others it can be a purification column (eg, an affinity chromatography column). The term also includes a discontinuous solid phase of discrete particles, as described in US Pat. No. 4,275,149. A “liposome” is a small vesicle composed of various types of lipids, phospholipids, and / or surfactants, and is a drug for mammals (such as PRO polypeptide or its antibody).
Useful for transportation. The components of the liposome are commonly arranged in a bilayer formation, similar to the lipid arrangement of biological membranes. A "small molecule" is defined herein as having a molecular weight of less than about 500 Daltons.

II. Compositions and Methods of the Invention The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide designated herein as a PRO polypeptide. In particular, cDNAs encoding various PRO polypeptides have been identified and isolated, as described in further detail in the Examples below. Note that although proteins produced in separate expression rounds are given different PRO numbers, the UNQ numbers are unique to all given DNA and encoding proteins and do not change. However, for the sake of simplicity, herein, the proteins encoded by the full-length natural nucleic acid molecules disclosed herein, as well as additional natural homologues and variants included within the definition of PRO above, are referred to in their source or preparative form. Regardless of this, it is referred to as “PRO / number”. Various cDNA clones have been deposited with the ATCC, as disclosed in the Examples below. The exact nucleotide sequences of these clones can be readily determined by sequencing the deposited clones using methods routine in the art. The predicted amino acid sequence can be determined from the nucleotide sequence using routine skill. For the PRO polypeptides and encoding nucleic acids described herein,
Applicants have identified what is believed to be the reading frame that best matches the currently available sequence information.

Full-length PRO Polypeptide 1. Using the PRO1560 WU-BLAST2 sequence alignment computer program, the full-length native sequence PRO1560 (shown in Figure 2 and SEQ ID NO: 4) has some amino acid sequence identity with Tspan-6 identified herein after the discovery of the invention. Have sex. Therefore, PRO1560 disclosed in this application is now considered to be a member of the newly identified tetraspan family. 2. PRO444 DNA26846-1397 was isolated from a human fetal lung library using a capture technique that selects for nucleotides encoding secreted proteins. Therefore DNA2
6846-1397 encodes a secretory factor. As far as I know, DNA26846
The -1397 sequence encodes a novel factor designated PRO444. WU-BLAST2
A sequence alignment computer program was used to reveal no significant sequence identity with any known protein. 3. PRO1018 DNA56107-1415 was isolated from a human ovarian tissue library using a capture technique that selects for nucleotides encoding secreted proteins. To our knowledge, the DNA56107-1415 sequence encodes a novel factor designated PRO1018. The WU-BLAST2 sequence alignment computer program was used to reveal no significant sequence identity with any known protein. 4. Using the PRO1773 WU-BLAST2 sequence alignment program, the full-length native sequence PRO17
73 (shown in FIG. 8 and SEQ ID NO: 10) was rattus norvegicus (ROH2_R).
TA) and some of the retinol dehydrogenase type II protein has been found to have some amino acid sequence identity. Therefore, PRO1773 disclosed in the present application is now believed to be a member of the newly identified retinol dehydrogenase protein family, with activities typical of those protein families.

5. Using the PRO1477 WU-BLAST2 sequence alignment program, full-length native sequence PRO14
77 (shown in Figure 10 and SEQ ID NO: 12) was found to have some amino acid sequence identity with the mannosyl-oligosaccharide 1,2-alpha-mannosidase protein (A54408). Therefore, PRO1477 disclosed in the present application is now considered to be a newly identified member of the mannosidase protein family, with activity typical of the mannosidase protein family. 6. Using the PRO1478 WU-BLAST2 sequence alignment program, full-length native sequence PRO14
78 (shown in Figure 12 and SEQ ID NO: 17) was found to have some amino acid sequence identity with galactosyltransferase. Therefore, it is presently believed that PRO1478 disclosed in this application is a newly identified member of the galactosyltransferase family and has at least one common mechanism with other members of this family. 7. PRO831 DNA56862-1343 was isolated from a human uterine library using a capture technique that selects for nucleotides encoding secreted proteins. Therefore DNA56
862-1343 encodes a secretory factor. As far as I know, DNA56862-
The 1343 sequence encodes a novel element designated herein as PRO831; WU-BLA
The ST2 sequence alignment computer program was used to reveal no significant sequence identity with any known protein.

8. Using the PRO1113 WU-BLAST2 sequence alignment program, the full-length native sequence PRO11
13 (shown in FIG. 16 and SEQ ID NO: 24) was found to have some amino acid sequence identity with LIG-1 and SLIT. Therefore, PRO1113 disclosed in the present application is now believed to be a member of the newly identified leucine-rich repeat family, with protein-protein interaction activity typical of this family. 9. PRO1194 To the best of our knowledge, the DNA57841-1522 sequence encodes a novel factor, referred to herein as PRO1194; using the WU-BLAST2 sequence alignment computer program, it may have limited sequence identity with known proteins. It was revealed. 10. Using the PRO1110 WU-BLAST2 sequence alignment program, the full-length native sequence PRO11
10 (shown in Figure 20 and SEQ ID NO: 31) was found to have some amino acid sequence identity with the up-regulated protein of mouse bone marrow. Therefore, PRO1110 disclosed in the present application is now a member of the newly identified bone marrow up-regulating protein family and is believed to have activity typical of this family. 11. PRO1378 DNA58730-1607 was isolated from a bone marrow library using a capture technique that selects for nucleotides encoding secreted proteins. Therefore, DNA5873
0-1607 encodes a secretory factor. As far as I know, DNA58730-16
The 07 sequence encodes a novel factor designated herein as PRO1378. WU-BLA
The ST2 sequence alignment computer program revealed some sequence identity between PRO1378 and known proteins. But,
These were determined not to be significant. 12. PRO1481 To the best knowledge, the DNA58732-1650 sequence encodes a novel factor, referred to herein as PRO1481. The WU-BLAST2 sequence alignment computer program was used to reveal some sequence identity with known proteins.

13. Using the PRO1189 WU-BLAST2 sequence alignment program, the full-length native sequence PRO11
89 (shown in Fig. 26 and SEQ ID NO: 43) is "MUS" in the Dayhoff database.
It has been found to have some degree of amino acid sequence identity with the amino acid sequence of the E25 protein designated "E25A_1". Therefore, at present, the PR disclosed in the present application
O1189 is a newly identified member of the E25 protein family,
It is believed to have characteristics typical of this family. 14. PRO1415 DNA58852-1637 was isolated from a human prostate library using a capture technique that selects for nucleotides encoding secreted proteins. As far as I know,
The DNA58852-1637 sequence encodes a novel factor, referred to herein as PRO1415; using the WU-BLAST2 sequence alignment computer program, was found to have no significant sequence identity with any known protein. . 15. PRO1411 To the best of our knowledge, the DNA59212-1627 sequence encodes a novel factor, referred to herein as PRO1411. However, the WU-BLAST2 sequence alignment computer program was used to reveal some sequence identity with known proteins. 16. PRO1295 To the best knowledge, the DNA59218-1559 sequence encodes a novel factor, referred to herein as PRO1295. The WU-BLAST2 sequence alignment computer program was used to reveal some sequence identity with known proteins.

17. Using the PRO1359 WU-BLAST2 sequence alignment program, the full-length native sequence PRO13
59 (shown in Figure 34 and in SEQ ID NO: 56) was found to have some amino acid sequence identity with N-acetylgalactosamine alpha-2,6-sialyltransferase. Therefore, at present, PRO13 disclosed in the present application
59 is a newly identified member of the sialyltransferase family and is believed to have properties typical of this family. 18. Using the PRO1190 WU-BLAST2 sequence alignment program, the full-length native sequence PRO11
90 (shown in Figure 36 and SEQ ID NO: 58) was found to have some amino acid sequence identity with rat and human CD0. Therefore, PRO1190 disclosed in the present application is now considered to be a newly identified member of the CD0 family, and to have cell adhesion activity typical of the CD0 family. 19. Using the PRO1772 WU-BLAST2 sequence alignment program, the full length native sequence PRO17
72 (shown in Figure 38 and SEQ ID NO: 63) was found to have some amino acid sequence identity with the microsomal dipeptidase protein (P_R13857). Therefore, PRO1772 disclosed in the present application is now a member of the newly identified peptidase protein family and is believed to have activity typical of this family. 20. Using the PRO1248 WU-BLAST2 sequence alignment program, full-length native sequence PRO12
48 (shown in Fig40 and SEQ ID NO: 68) are PUT-2 proteins (AF0261).
98_5) and was found to have amino acid sequence identity. Therefore, PRO1248 disclosed in the present application is now considered to be a novel PUT-2 homolog, with activity typical of PUT-2 proteins. 21. Using the PRO1316 WU-BLAST2 sequence alignment program, the full length native sequence PRO13
16 (shown in Figure 42 and in SEQ ID NO: 70) was found to have some amino acid sequence identity with mouse dickkopf. So now,
PRO1316 disclosed in the present application is a newly identified member of the dickkopf family and is believed to have the ability to undergo head induction from Speman organizers and / or Wnt antagonism.

22. PRO1197 To the best knowledge, the DNA60611-1524 sequence encodes a novel element, referred to herein as PRO1197. The WU-BLAST2 sequence alignment computer program was used to reveal some sequence identity with the known proteins, as further described in the Examples. 23. Using the PRO1293 WU-BLAST2 sequence alignment program, full-length native sequence PRO12
93 (shown in Figure 46 and SEQ ID NO: 77) was found to have some amino acid sequence identity with the human Ig heavy chain V region protein (HSVCD54_1).
Thus, PRO1293 disclosed in the present application is now a newly identified member of the Ig superfamily of proteins and fragments thereof and is believed to have activity typical of this family. 24. The PRO1380 DNA60740-1615 clone was isolated from a human retinal library.
To the best knowledge, the DNA60740-1615 sequence encodes a novel multi-spanning transmembrane polypeptide designated herein as PRO1380. The WU-BLAST2 sequence alignment computer program was used to reveal some sequence identity with any known protein. 25. The full length native sequence PRO12 using the PRO1265 WU-BLAST2 sequence alignment program.
65 (shown in Figure 50 and SEQ ID NO: 84) was found to have some amino acid sequence identity with the FIG1 polypeptide designated "MMU70429_1" in the Dayhoff database (version 35.45 SwissProt 35). Accordingly, PRO1265 disclosed in the present application is now believed to be a newly identified member of the FIG1 family with activities typical of FIG1 polypeptides, including activation by interleukin-4. 26. Using the PRO1250 WU-BLAST2 sequence alignment program, full-length native sequence PRO12
50 (shown in Figure 52 and SEQ ID NO: 86) was found to have some amino acid sequence identity with the human long chain CoA ligase protein (LCFB_HUMAN). Accordingly, PRO1250 disclosed in the present application is now believed to be a newly identified long chain CoA ligase homolog, with typical activity of long chain CoA ligase.

27. Using the PRO1475 WU-BLAST2 Sequence Alignment Computer Program, the full length native sequence PRO1475 (shown in Figure 54 and SEQ ID NO: 88) was cloned into mouse alpha.
It has been found to have some amino acid sequence identity with the 3-D-mannoside beet-1,2-N-acetylglucosaminyl transferase I protein. Therefore, PRO1475 disclosed in the present application is now considered to be a member of the newly identified N-glucosaminyl transferase protein family and has activity typical of this protein family. 28. PRO1377 As described herein, the WU-BLAST2 sequence alignment program was run on the PRO
It was used to determine the sequence identity between the 1377 amino acid sequence and the amino acid sequences of known proteins. Although some sequence identity was found, they were determined to be insignificant. Therefore, to the best of our knowledge, the DNA61608 sequence is referred to herein as PRO13.
It encodes a novel transmembrane protein designated 77. 29. The PRO1326 DNA62808-1582 clone is believed to encode a secretory factor. To the best of our knowledge, the DNA62808-1582 sequence is found here at PRO1326.
The WU-BLAST2 sequence alignment computer program revealed a sequence identity with a known protein, but was determined to be non-significant. 30. The PRO1249 DNA62809-1531 clone was isolated from a human colon tumor tissue library using a capture technique that selects for nucleotides encoding secreted proteins.
To the best of our knowledge, the DNA62809-1531 sequence encodes a novel factor designated herein as PRO1249; using the WU-BLAST2 sequence alignment computer program, it was revealed that there is no sequence identity with any known protein. became. 31. The full-length native sequence PRO13 using the PRO1315 WU-BLAST2 sequence alignment program.
15 (shown in Figure 62 and SEQ ID NO: 104) was found to have some amino acid sequence identity with the mus muscle class II cytokine receptor 4 protein (MMU53696_1). Therefore, at present, PRO1 disclosed in the present application
315 is a newly identified member of the cytokine receptor protein family and is believed to have activity typical of this protein family.

32. Using the PRO1599 WU-BLAST2 sequence alignment program, full-length native sequence PRO15
99 (shown in FIG. 64 and SEQ ID NO: 111) is the Dayhoff sequence “CFAD_PIG”.
It was found to have some amino acid sequence identity with. Therefore, PRO1599 disclosed in the present application is now believed to be a newly identified member of the Granzyme M family, with activities or properties typical of the Granzyme M family. 33. Using the PRO1430 WU-BLAST2 Sequence Alignment Computer Program, the full length native sequence PRO1430 (shown in Figure 66 and SEQ ID NO: 116) was labeled with prostate specific reductase (designated "P_W03198" in the Dayhoff database) and some amino acids. It was found to have sequence identity. Therefore, PRO1430 disclosed in the present application is now considered to be a newly identified member of the reductase family and has activity typical of the reductase family. 34. PRO1374 To the best of our knowledge, the DNA64849-1604 sequence encodes a novel factor, herein referred to as PRO1374; using the WU-BLAST2 sequence alignment computer program, some of the known proteins, such as the human alpha subunit of P4HA. The sequence identity of was revealed. Therefore, PRO1374 is thought to be associated with P4HA and share one or more mechanisms. 35. The PRO1311 DNA64863-1573 clone was isolated from human arterial endothelial cells and is believed to encode a novel transmembrane polypeptide designated herein as PRO1311. The WU-BLAST2 sequence alignment computer program was used to reveal some sequence identity with known proteins, but was determined to be insignificant. 36. Using the PRO1357 WU-BLAST2 sequence alignment program, the full-length native sequence PRO13
57 (shown in Figure 72 and SEQ ID NO: 128) was found to have some amino acid sequence identity with the muscular von Ebner minor salivary gland protein (MMU46068_1). Therefore, at present, PRO13 disclosed in the present application
57 is believed to be a newly identified von Ebner minor salivary gland protein homolog.

37. The full length native sequence PRO12 using the PRO1244 WU-BLAST2 sequence alignment program.
44 (shown in Figure 74 and in SEQ ID NO: 130) was found to have some amino acid sequence identity with a known transplantation related protein designated "AF008554_1" in the Dayhoff database (version 35.45 SwissProt 35). It was Therefore, PRO1244 disclosed in the present application is now considered to be a member of the newly identified transplantation-related protein family and possesses the adhesive activity typical of these protein families. 38. Using the PRO1246 WU-BLAST2 sequence alignment program, full-length native sequence PRO12
46 (shown in Figure 76 and SEQ ID NO: 132) was found to have some amino acid sequence identity with the mouse bone-associated sulfatase precursor protein (P_R51355). Therefore, PRO1246 disclosed in the present application is now believed to be a newly identified bone-associated sulfatase homolog, with activity typical of bone-associated sulfatase. 39. Using the PRO1356 WU-BLAST2 sequence alignment program, full-length native sequence PRO13
56 (shown in Figure 78 and SEQ ID NO: 134) was found to have some amino acid sequence identity with the mus muscle CPE receptor protein (AB000713_1). Therefore, PRO1356 disclosed in this application is now a member of the newly identified CPE receptor family and is believed to have activity typical of this family. 40. PRO1275 To the best knowledge, the DNA64888-1542 sequence encodes a novel element designated herein as PRO1275. The WU-BLAST2 sequence alignment computer program was used to reveal some sequence identity with known proteins.

41. PRO1274 To the best knowledge, the DNA64889-1541 sequence encodes a novel factor, referred to herein as PRO1274. The WU-BLAST2 sequence alignment computer program was used to reveal some sequence identity with known proteins. 42. The PRO1412 DNA64897-1628 clone is believed to be a secretory factor. To the best of our knowledge, the DNA64897-1628 sequence encodes a novel factor, herein designated PRO1412; the WU-BLAST2 sequence alignment computer program was used to reveal sequence identity with known proteins, but with significant significance. Was not decided. 43. Using the PRO1557 WU-BLAST2 sequence alignment program, full-length native sequence PRO15
57 (shown in Figure 86 and in SEQ ID NO: 142) was AF0 in the Dayhoff database.
It was found to have some amino acid sequence identity with the chorea protein designated 34606_1. Therefore, PRO1557 disclosed in the present application is now considered to be a newly identified member of the chorea family and has activity typical of the chorea family. 44. The PRO1286 DNA64903-1553 clone was identified using the technique of selecting nucleotides encoding secreted proteins. To the best knowledge, the DNA64903 sequence encodes a novel secretory factor designated herein as PRO1286. WU-BLAST2
A sequence alignment computer program was used to reveal some sequence identity with any known protein; however, it was determined not to be significant. 45. Using the PRO1294 WU-BLAST2 sequence alignment program, the full-length native sequence PRO12
94 (shown in Fig90 and SEQ ID NO: 146) was found to have some amino acid sequence identity with the rat neuronal olfactomedin-related ER localization protein. Therefore, PRO1294 disclosed in the present application is now believed to be a newly identified olfactomedin homologue with typical activity for this protein. 46. Using the PRO1347 WU-BLAST2 sequence alignment program, the full-length native sequence PRO13
47 (shown in Figure 92 and SEQ ID NO: 148) was found to have some amino acid sequence identity with butyrophilin. Furthermore, as is typical of butyrophilin, there is a transmembrane domain approximately in the middle of the sequence. So now,
PRO1347 disclosed in the present application is a newly identified member of the butyrophilin family and is believed to play a role in the emergence and release of milk fat particles during lactation.

47. The PRO1305 DNA64952-1568 clone was isolated from a human fetal kidney library using a capture technique that selects for nucleotides encoding secreted proteins. Thus, the DNA64952-1568 clone encodes a secretory factor. To the best knowledge, the DNA64952-1568 sequence encodes a novel secretory factor designated herein as PRO1305; using the WU-BLAST2 sequence alignment computer program there may be no sequence identity with any known protein. It was revealed. 48. Using the PRO1273 WU-BLAST2 sequence alignment program, full-length native sequence PRO12
73 (shown in Figure 96 and in SEQ ID NO: 158) was found to have some amino acid sequence identity with the lipocalin precursor. Furthermore, Fig96 is PR
It shows that O1273 has a motif conserved in lipocalin. Therefore, PRO1273 disclosed in the present application is now believed to be a newly identified member of the lipocalin family and to share at least one mechanism with lipocalin. 49. Using the PRO1302 WU-BLAST2 sequence alignment program, the full-length native sequence PRO13
02 (shown in FIG. 98 and SEQ ID NO: 160) is CD33L1 and CD33.
It was found to have some amino acid sequence identity with L2. Therefore, PRO1302 disclosed in the present application is now considered to be a member of the newly identified sialoadhesin family and has characteristics typical of this family. In particular, PRO1302 is involved in cancer, inflammation, hematopoiesis, nerve growth and / or immunity. 50. Using the PRO1283 WU-BLAST2 sequence alignment program, the full-length native sequence PRO12
83 (shown in Figure 100 and in SEQ ID NO: 162) was found to have some amino acid sequence identity with the rat odorant protein homolog OBP-II precursor (A404464). Therefore, currently, PRO1283 disclosed in the present application
Is a novel odorant protein and is believed to have activity typical of odorant-related proteins.

51. Using the PRO1279 WU-BLAST2 sequence alignment program, full-length native sequence PRO12
79 (shown in Figure 102 and SEQ ID NO: 170) was found to have some amino acid sequence identity with the mouse neuropsin protein (I56559). Therefore, PRO1279 disclosed in the present application is now believed to be a newly identified neuropsin homolog, with typical activity for neuropsin proteins. 52. Using the PRO1304 WU-BLAST2 sequence alignment program, full-length native sequence PRO13
04 (shown in Fig104 and SEQ ID NO: 180) is FK-506 of mus muscle.
It was found to have some amino acid sequence identity with the protein (AF040252_1). Therefore, PRO1304 disclosed in the present application is now considered to be a member of the newly identified FK506-binding protein family and has activity typical of this family. 53. Using the PRO1317 WU-BLAST2 sequence alignment program, the full-length native sequence PRO13
17 (shown in Figure 106 and SEQ ID NO: 189) was found to have some amino acid sequence identity with the human CD97 protein. Therefore, PRO1317 disclosed in this application is now considered to be a leukocyte antigen that may be involved in leukocyte activation. 54. Using the PRO1303 WU-BLAST2 sequence alignment program, the full-length native sequence PRO13
03 (shown in Figure 108 and in SEQ ID NO: 194) was found to have some amino acid sequence identity with neuropsin. Therefore, PRO1303 disclosed in the present application is now considered to be a member of the newly identified serine protease family and has catabolic activity typical of this family.

55. Using the PRO1306 WU-BLAST2 sequence alignment program, the full-length native sequence PRO13
06 (shown in Figure 110 and SEQ ID NO: 196) is Dayhoff SEQ ID NO: AIF1_HU
It was found to have some amino acid sequence identity with MAN. Therefore, PRO1306 disclosed in the present application is now believed to be a newly identified member of the AIF1 / Dynetein family with activities and properties typical of AIF1 / Dynetein. 56. Using the PRO1336 WU-BLAST2 sequence alignment program, the full-length native sequence PRO13
36 (shown in Figure 112 and SEQ ID NO: 198) was found to have some amino acid sequence identity with slit. Therefore, PRO1336 disclosed in the present application is now believed to be a newly identified member of the EGF repeat family and possess protein interaction-mediating activity. 57. Using the PRO1278 WU-BLAST2 sequence alignment program, full-length native sequence PRO12
78 (shown in Figure 114 and SEQ ID NO: 203) was found to have some amino acid sequence identity with the lysozyme c-1 precursor designated "LYC1_ANAPL" in the Dayhoff database. Therefore, at present, the PRO disclosed in the present application
1278 is a newly identified member of the lysozyme family and is believed to have the hydrolysis and other activities typical of the lysozyme family. 58. The full length native sequence PRO12 using the PRO1298 WU-BLAST2 sequence alignment program.
98 (shown in Figure 116 and in SEQ ID NO: 210) was found to have some amino acid sequence identity with the glycosyltransferase alg2. Therefore, PRO1298 disclosed in the present application is now believed to be a newly identified member of the glycosyltransferase family and shares at least one mechanism with members of this family.

59. Using the PRO1301 WU-BLAST2 sequence alignment program, full-length native sequence PRO13
01 (shown in Figure 118 and SEQ ID NO: 212) was found to have amino acid sequence identity consistent with the cytochrome P450 protein. Therefore, at present, PRO1301 disclosed in the present application is a newly identified cytochrome P45.
It is a member of the O family and is believed to have the monooxygenase activity typical of the cytochrome P450 family. 60. PRO1268 To the best knowledge, the DNA66519-1535 sequence encodes a novel transmembrane polypeptide agent designated herein as PRO1268. The WU-BLAST2 sequence alignment computer program was used to reveal limited, but not significant, sequence identity with known proteins. 61. The full length native sequence PRO12 using the PRO1269 WU-BLAST2 sequence alignment program.
69 (shown in FIG. 122 and SEQ ID NO: 216) are available in the Dayhoff database (
It was found in version 35.45 SwissProt 35) to have some degree of amino acid sequence identity with the bovine granulocyte peptide A precursor designated "P_W23722". Therefore,
Presently, PRO1269 disclosed in this application is a newly identified member of the granulocyte A peptide family and is believed to have microbial activity typical of this peptide family. 62. Using the PRO1327 WU-BLAST2 sequence alignment program, the full-length native sequence PRO13
27 (shown in Figure 124 and SEQ ID NO: 218) was found to have some amino acid sequence identity with rat neurexophyrin-1 anti- (NPH1_RAT). Therefore, PRO1327 disclosed in the present application is now a member of the newly identified neurexophyrin protein family and is believed to have activity typical of this protein family.

63. Using the PRO1382 WU-BLAST2 sequence alignment program, the full-length native sequence PRO13
82 (shown in Figure 126 and SEQ ID NO: 220) was found to have some amino acid sequence identity with the amino acid sequence of a known cerberine-like glycoprotein designated "CERL_RAT" in the Dayhoff database. Accordingly, PRO1382 disclosed in the present application is now believed to be a member of the cereverin family of newly identified neuropeptides, with activities and properties typical of cereverin. 64. The PRO1328 DNA66658-1584 clone was isolated from a human diseased prostate tissue library using a capture technique that selects for nucleotides encoding secreted proteins. To the best of our knowledge, the DNA66658-1584 sequence encodes a novel factor designated herein as PRO1328; lacking significant sequence identity with any known protein using the WU-BLAST2 sequence alignment computer program. Became clear. 65. The PRO1325 DNA66659-1593 clone was isolated from a human thymus tissue library using a capture technique that selects for nucleotide sequences that encode proteins. To the best of our knowledge, the DNA66659-1593 sequence encodes a novel factor, referred to herein as PRO1325; using the WU-BLAST2 sequence alignment computer program, it was revealed that there is no sequence identity with any known protein. Became. 66. Using the PRO1340 WU-BLAST2 sequence alignment program, full-length native sequence PRO13
40 (shown in Figure 132 and in SEQ ID NO: 229) is Dayhoff SEQ ID NO: I46536.
It was found to have some amino acid sequence identity with. Therefore, PRO1340 disclosed in the present application is now believed to be a newly identified member of the cadherin family with activities and properties typical of the cadherin family. 67. Using the PRO1339 WU-BLAST2 sequence alignment program, the full-length native sequence PRO13
39 (shown in Figure 134 and in SEQ ID NO: 234) was found to have some amino acid sequence identity with human pancreatic carboxypeptidase and carboxypeptidase a1. Therefore, at present, PRO1339 disclosed in the present application
Is a newly identified member of the carboxypeptidase family and is believed to have carboxypeptidase activity.

68. Using the PRO1337 WU-BLAST2 sequence alignment program, full-length native sequence PRO13
37 (shown in Figure 136 and SEQ ID NO: 236) was found to have some amino acid sequence identity with human TBG, which is defined as "THBG_HUMAN" in the Dayhoff database. Therefore, PRO1337 disclosed in the present application is now considered to be a newly identified member of the TBG family, having thymic hormone transport stress and others. 69. The PRO1342 DNA66674-1599 clone was isolated from human esophageal tissue. As explained in more detail below, the WU-BLAST2 sequence alignment computer program was used to reveal some sequence identity with any known protein. The DNA66674-1599 clone was found to encode a novel transmembrane polypeptide. 70. The PRO1343 DNA66675-1587 clone was isolated from a human smooth muscle cell tissue library using a capture technique that selects for nucleotides encoding secreted proteins. Thus, the DNA66675-1587 clone encodes a secretory factor. To the best of our knowledge, the DNA66675-1587 sequence encodes a novel element designated herein as PRO1343; using the WU-BLAST2 sequence alignment computer program, lacking significant sequence identity with any known protein. Became clear. 71. Using the PRO1480 WU-BLAST2 sequence alignment program, the full-length native sequence PRO14
80 (shown in Figure 142 and in SEQ ID NO: 253) is Dayhoff SEQ ID NO: I48746.
It was found to have some amino acid sequence identity with. Therefore, PRO1480 disclosed in the present application is now considered to be a newly identified member of the semaphorin C family.

72. Using the PRO1487 WU-BLAST2 sequence alignment program, the full-length native sequence PRO14
87 (shown in FIG. 144 and SEQ ID NO: 260) was G in the Dayhoff database.
It was found to have some amino acid sequence identity with the radical fringe protein designated GU82088_1. Therefore, at present, the PRO disclosed in the present application
1487 is a newly identified fringe family member and is believed to have activity typical of the fringe family. 73. PRO1418 To the best knowledge, the DNA68864-1629 sequence encodes a novel factor, referred to herein as PRO1418. Using the WU-BLAST2 sequence alignment computer program, there was minimal sequence identity with known proteins. 74. Using the PRO1472 WU-BLAST2 sequence alignment program, full-length native sequence PRO14
72 (shown in Figure 148 and SEQ ID NO: 267) was found to have some amino acid sequence identity with butyrophilin. Therefore, PRO1472 disclosed in the present application is now considered to be a newly identified member of the butyrophilin family and is associated with lactation. 75. Using the PRO1461 WU-BLAST2 sequence alignment program, full-length native sequence PRO14
61 (shown in Figure 150 and SEQ ID NO: 269) was found to have some amino acid sequence identity with the trypsin-like enzyme defined as "P_R89435" in the Dayhoff database. Therefore, at present, PRO146 disclosed in the present application
1 is a newly identified member of the serine protease family, which is believed to have serine protease activity, particularly the enzymatic activity typical of other trypsin-like enzymes. It was also found that there is homology between the PRO1461 amino acid sequence and other trypsin-like enzymes and serine proteases of the Dayhoff database.

76. The PRO1410 DNA68874-1622 clone was isolated from a human cerebral meningioma tissue library using a capture technique that selects for nucleotides encoding secreted proteins.
To the best of our knowledge, the DNA68874-1622 sequence encodes a novel factor, herein designated PRO1410; using the WU-BLAST2 sequence alignment computer program, lacking significant sequence identity with any known protein. Became clear. 77. Using the PRO1568 WU-BLAST2 sequence alignment program, the full-length native sequence PRO15
68 (shown in Figure 154 and SEQ ID NO: 273) was found to have some amino acid sequence identity with Tetraspan 5 and Tetraspan 4. Therefore, PRO1568 disclosed in the present application is now considered to be a newly identified member of the tetraspanin family and has the molecular promoting activity typical of this family. 78. Using the PRO1570 WU-BLAST2 sequence alignment program, the full-length native sequence PRO15
70 (shown in Figure 156 and SEQ ID NO: 275) was found to share some amino acid sequence identity with SP60, but initially the first 19 of the protein.
Nine amino acids (or amino terminus) are identical and are presented here. Therefore, PRO1570 disclosed in the present application is now considered to be a newly identified member of the serine protease family and included in cancer. 79. Using the PRO1317 WU-BLAST2 sequence alignment program, the full-length native sequence PRO13
17 (shown in FIG. 158 and SEQ ID NO: 277) was found to have some amino acid sequence identity with the known semaphorin B protein designated "I48745" in the Dayhoff database. Therefore, at present, the PR disclosed in the present application
O1317 is a newly identified member of the semaphorin glycoprotein family and is believed to have the activity or properties typical of semaphorins.

80. Using the PRO1780 WU-BLAST2 sequence alignment program, the full-length native sequence PRO17
80 (shown in Figure 160 and SEQ ID NO: 282) was found to have some amino acid sequence identity with the known glucuronosyl transferase designated as "UDA2_RABIT" in the Dayhoff database. Accordingly, PRO1780 disclosed in the present application is now believed to be a newly identified member of the glucuronosyltransferase family, with enzymatic activity and other properties typical of the glucuronosyltransferase family. . 81. Using the PRO1486 WU-BLAST2 sequence alignment program, full-length native sequence PRO14
86 (shown in Figure 162 and in SEQ ID NO: 287) was found to have some amino acid sequence identity with the cereverin 1 precursor. Therefore, PRO1486 disclosed in the present application is now considered to be a newly identified member of the cereverin family and shares at least one mechanism with cereverin. 82. The PRO1433 DNA71184-1634 clone was isolated from a human adrenal tissue library using a capture technique that selects for nucleotide sequences that encode proteins. To the best of our knowledge, the DNA71184-1634 sequence encodes a novel factor, herein referred to as PRO1433; using the WU-BLAST2 sequence alignment computer program, lacking significant sequence identity with any known protein. Became clear. 83. Using the PRO1490 WU-BLAST2 sequence alignment program, full-length native sequence PRO14
90 (shown in Figure 166 and SEQ ID NO: 297) was found to have some amino acid sequence identity with a portion of the 1-acyl-sn-glycerol-3-phosphate acyltransferase protein (S60478). . Therefore, PRO1490 disclosed in the present application is now a newly identified member of the acyltransferase protein family, 1-acyl-sn-glycerol-3.
-It is believed to have activity typical of phosphate acyltransferase proteins. 84. The PRO1482 DNA71234-1651 clone was isolated from a human adrenal library using a capture technique that selects for nucleotide sequences encoding secreted proteins. Thus, the DNA71234-1651 clone encodes a secretory factor. To the best of our knowledge, the DNA71234-1651 sequence encodes a novel element designated herein as PRO1482; using the WU-BLAST2 sequence alignment computer program, it is clear that there is no sequence identity with any known protein. Became.

85. PRO1446 To the best knowledge, the DNA71277-1636 sequence encodes a novel factor, referred to herein as PRO1446. The WU-BLAST2 sequence alignment computer program was used to reveal minimal sequence identity with known proteins. 86. Using the PRO1558 WU-BLAST2 sequence alignment program, the full-length native sequence PRO15
58 (shown in Figure 172 and in SEQ ID NO: 306) was found to have significant amino acid sequence identity with the methyltransferase protein (CAMT_EUCGU). Therefore, PRO1558 disclosed in the present application is now a member of the newly identified methyltransferase protein family and is believed to have activity typical of this protein family. 87. Using the PRO1604 WU-BLAST2 sequence alignment program, full-length native sequence PRO16
04 (shown in FIG. 174 and SEQ ID NO: 308) is P in the Dayhoff database.
It was found to have some amino acid sequence identity with a cell growth factor derived from mouse liver cancer designated _W37483. Therefore, at present, the PR disclosed in the present application
O1604 is a newly identified member of the HDGF family, and other HD
It is believed to have growth factor activity typical of GF. 88. Using the PRO1491 WU-BLAST2 sequence alignment program, full-length native sequence PRO14
91 (shown in FIG. 176 and SEQ ID NO: 310) is chicken collapsin-.
It was found to have some degree of amino acid sequence identity with part of the two proteins (GGU28240_1). Therefore, PRO1491 disclosed in the present application is now considered to be a member of the newly identified collapsin protein family, with activity typical of this protein family. 89. PRO1431 The full length native sequence PRO1431 [shown in Figure 178 (SEQ ID NO: 315)] was found to have significant amino acid sequence identity with the SH3 domain containing protein SH17_HUMAn. Therefore, PRO1431 disclosed in the present application is now considered to be a member of the newly identified SH3 domain-containing protein and has signaling properties.

90. Using the PRO1563 WU-BLAST2 sequence alignment program, full-length native sequence PRO15
63 (shown in Figure 180 and in SEQ ID NO: 317) was found to have some amino acid sequence identity with part of the mouse ADAMS-1 protein (AB001735_1). Therefore, PRO1563 disclosed in the present application is now considered to be a member of the newly identified ADAM protein family and has activity typical of this protein family. 91. Using the PRO1565 WU-BLAST2 sequence alignment program, full-length native sequence PRO15
65 (shown in Figure 182 and SEQ ID NO: 322) was found to have some amino acid sequence identity with a portion of the Rattus norvegicus chondromodulin-I protein (AF051425_1). Therefore, PRO1565 disclosed in the present application is now a member of the newly identified chondromodulin protein family and is believed to have activity typical of this protein family. 92. Using the PRO1571 WU-BLAST2 sequence alignment program, the full-length native sequence PRO15
71 (shown in Figure 184 and SEQ ID NO: 324) was found to have some amino acid sequence identity with a portion of the human Clostridium perfringens enterotoxin receptor protein (AB000712_1). So now,
PRO1571 disclosed in this application is a newly identified CPE-R homolog and is believed to have activity typical of CPE-R proteins. 93. Using the PRO1572 WU-BLAST2 sequence alignment program, the full-length native sequence PRO15
72 (shown in Figure 186 and SEQ ID NO: 326) was found to have some amino acid sequence identity with CPE-R. Therefore, it is presently believed that PRO1572 disclosed in this application is associated with CPE-R and shares at least one mechanism. 94. Using the PRO1573 WU-BLAST2 sequence alignment program, full-length native sequence PRO15
73 (shown in Figure 188 and SEQ ID NO: 328) was found to have some amino acid sequence identity with CPE-R. Therefore, it is presently believed that PRO1573 disclosed in this application is associated with CPE-R and shares at least one mechanism.

95. Using the PRO1488 WU-BLAST2 sequence alignment program, full-length native sequence PRO14
88 (shown in Figure 190 and SEQ ID NO: 330) was found to have some amino acid sequence identity with the known CPE-R designated "AB000712_1" in the Dayhoff database. Therefore, at present, PRO148 disclosed in this application
8 is a newly identified member of the CPE-R family and is believed to have the binding activity typical of the CPE-R family. 96. Using the PRO1489 WU-BLAST2 sequence alignment program, the full-length native sequence PRO14
89 (shown in Figure 192 and in SEQ ID NO: 332) was found to have some amino acid sequence identity with the cleaving clostridium perfringens enterotoxin receptor (D88492_1). Therefore, PRO1489 disclosed in the present application is now believed to be a newly identified Clostridium perfringens enterotoxin receptor homolog, with activity typical of Clostridium perfringens enterotoxin receptor proteins. 97. Using the PRO1474 WU-BLAST2 sequence alignment program, the full-length native sequence PRO14
74 (shown in Figure 194 and in SEQ ID NO: 334) was found to have some amino acid sequence identity with ovomucoid. Therefore, PRO1474 disclosed in the present application is now considered to be a member of the newly identified family of casalserine protease inhibitors, with binding activity typical of this family. 98. The PRO1508 DNA73742-1508 clone was isolated from a human diseased cartilage tissue library. To the best of our knowledge, the DNA73742-1508 sequence is now in PRO15
It encodes a novel factor designated 08; however, some sequence identity with known proteins was revealed using the WU-BLAST2 sequence alignment computer program. 99. The PRO1555 DNA73744-1665 clone was isolated from a human tissue library.
To the best of our knowledge the DNA73744-1665 sequence encodes a novel transmembrane protein designated herein as PRO1555. The WU-BLAST2 sequence alignment computer program was used to reveal some sequence identity with known proteins.

100. Using the PRO1485 WU-BLAST2 sequence alignment program, the full-length native sequence PRO14
85 (shown in Figure 200 and SEQ ID NO: 340) was found to have some amino acid sequence identity with the lysozyme C precursor peptide. Thus, it is now believed that PRO1485 disclosed in this application is a newly identified member of the lysozyme family and shares at least one similar mechanism. 101. Using the PRO1564 WU-BLAST2 sequence alignment program, the full-length native sequence PRO15
64 (shown in Figure 202 and in SEQ ID NO: 347) is the mouse polypeptide GalN.
It was found to have some amino acid sequence identity with a portion of the Ac transferase T4 protein (MMU73819_1). Therefore, PRO1564 disclosed in the present application is now considered to be a newly identified member of the N-acetylgalactosaminyl transferase protein family and has a binding activity typical of this protein family. 102. PRO1755 To the best knowledge, the DNA76396-1698 sequence encodes a novel transmembrane protein referred to herein as PRO1755. However, the WU-BLAST2 sequence alignment computer program was used to reveal some sequence identity with known proteins. 103. The PRO1757 DNA76398-1699 clone was isolated from a human testis tissue library using a capture technique that selects for nucleotide sequences that encode proteins. To the best of our knowledge, the DNA76398-1699 sequence encodes a novel element designated herein as PRO1757; using the WU-BLAST2 sequence alignment computer program, it was revealed that there is no significant sequence identity with known proteins. Became. 104. The PRO1758 DNA76399-1700 clone was isolated from a library derived from human thymus tissue obtained from a fetus that died at 17 weeks gestation from anencephaly. DNA763
The 99-1700 clone encodes a novel secretory factor designated herein as PRO1758. Using the WU-BLAST2 sequence alignment computer program,
Significant sequence identity between PRO1758 and Dayhoff SEQ ID NO: AC005328_2 was revealed.

105. Using the PRO1575 WU-BLAST2 sequence alignment program, the full-length native sequence PRO15
75 (shown in Figure 210 and in SEQ ID NO: 358) is Dayhoff SEQ ID NO: A12005_.
It was found to have some amino acid sequence identity with 1. Accordingly, PRO1575 disclosed in the present application is now believed to be a newly identified member of the protein disulfide isomerase family, with activities and properties typical of the disulfide isomerase family. 106. Using the PRO1787 WU-BLAST2 sequence alignment program, the full-length native sequence PRO17
87 (shown in Figure 212 and in SEQ ID NO: 364) was found to have some amino acid sequence identity with various species of myelin p0. Therefore, PRO1787 disclosed in the present application is now believed to be a newly identified member of the myelin p0 family, sharing at least one similar mechanism. Modulators of PRO1787 can be used to treat myelin p0 related disorders such as neuropathy, hereditary dental disorders. 107. Using the PRO1781 WU-BLAST2 sequence alignment program, some sequence identity was found between the PRO1781 amino acid sequence (SEQ ID NO: 366) and the amino acid sequences of known proteins, but was found not to be significant. It was Therefore, to the best of our knowledge, the DNA76522-2500 sequence encodes a novel protein. 108. The PRO1556 DNA76529-1666 clone was isolated from a breast cancer tissue library.
To the best of our knowledge, the DNA76529-1666 sequence encodes a novel transmembrane protein designated herein as PRO1556. The WU-BLAST2 sequence alignment computer program was used to reveal some sequence identity with known proteins. 109. PRO1759 To the best of our knowledge, the DNA76531-1701 sequence encodes a novel element designated herein as PRO1759; the WU-BLAST2 sequence alignment computer program was used to reveal limited sequence identity with known proteins. became.

110. PRO1760 To the best of our knowledge, the DNA76532-1702 sequence encodes a novel factor, referred to herein as PRO1760; the WU-BLAST2 sequence alignment computer program was used to reveal limited sequence identity with known proteins. became. 111. Using the PRO1561 WU-BLAST2 sequence alignment program, full-length native sequence PRO15
61 (shown in Figure 222 and SEQ ID NO: 378) is human phospholipase A
It was found to have some amino acid sequence identity with part of the 2 protein (P_R63053). Therefore, PRO1561 disclosed in the present application is now considered to be a newly identified member of the phospholipase A2 protein family and has activity typical of this protein family. 112. Using the PRO1567 WU-BLAST2 sequence alignment program, the full-length native sequence PRO15
67 (shown in Fig. 224 and SEQ ID NO: 383) is P in the Dayhoff database.
It was found to have some amino acid sequence identity with the human colon-specific gene CSG6 polypeptide, which was defined as —W06549. Therefore, PRO1567 disclosed in the present application is now believed to be a newly identified CSG expression product, with properties typical of this protein. 113. Using the PRO1693 WU-BLAST2 sequence alignment program, full-length native sequence PRO16
93 (shown in Figure 226 and SEQ ID NO: 385) was found to have some amino acid sequence identity with a portion of the mouse insulin-like growth factor binding protein (ALS_MOUSE). Therefore, at present, PRO16 disclosed in the present application
93 is a newly identified member of the insulin-like growth factor binding protein family and is believed to have activity typical of this protein family. 114. PRO1784 To the best of our knowledge, the DNA77303-2502 sequence encodes a novel factor, herein referred to as PRO1784; the WU-BLAST2 sequence alignment computer program was used to reveal some sequence identity with known proteins. became.
115. Using the PRO1605 WU-BLAST2 sequence alignment program, the full-length native sequence PRO16
05 (shown in FIG. 230 and SEQ ID NO: 395) is human alpha-1,3-
Mannosyl glycoprotein β-1,6-n-acetyltransferase protein (
GNT5_HUMAN) with some degree of amino acid sequence identity. Therefore, PRO1605 disclosed in the present application is now a member of the newly identified glycosyltransferase protein family and is believed to have activity typical of this protein family.

116. Using the PRO1788 WU-BLAST2 sequence alignment program, the full-length native sequence PRO17
88 (shown in FIG. 232 and SEQ ID NO: 397) has the Dayhoff sequence “GARP_HUMA.
N ", a leucine-rich repeat-containing protein encoded by a gene located in the 11q14 chromosomal region was found to have some amino acid sequence identity.
Accordingly, PRO1788 disclosed in the present application is now believed to be a newly identified member of the leucine-rich containing family, with activities or properties typical of leucine-rich repeat containing families. 117. Using the PRO1801 WU-BLAST2 sequence alignment program, the full-length native sequence PRO18
01 (shown in FIG. 234 and SEQ ID NO: 402) is IL-19 (P_W37935)
It was found to have some degree of amino acid sequence identity with some of the. Therefore, PRO1801 disclosed in the present application is now a newly identified member of the IL-10-related cytokine family and is believed to have activity typical of this cytokine family. 118. The UCP4 Megaling DNASTAR computer program (and the algorithm and parameters of this software set by the manufacturer) (Oxford Molecular Group, In
Using c.), the full length native sequence UCP4 (shown in Figure 236 and SEQ ID NO: 406) was found to have some amino acid sequence identity with UCP3, UCP2 and UCP1. Thus, UCP4 disclosed in the present application is now a member of a newly identified human non-binding protein family that affects the activity and / or properties typical of this protein family, such as mitochondrial membrane potential. Is considered to have the ability to improve or suppress the metabolic rate. 119. PRO193 The present invention provides a newly identified and isolated nucleotide sequence that encodes the polypeptide designated PRO193 in outbreak cancer. In particular, Applicants have determined that the cD encoding a PRO193 polypeptide, as disclosed in further detail in the Examples below.
NA identified and isolated. The PRO193-encoding clone was isolated from a human retinal library.

120. Using the PRO1130 WU-BLAST2 sequence alignment program, the full-length native sequence PRO11
30 (shown in Figure 240 and in SEQ ID NO: 415) was found to have amino acid sequence identity with the human 2-19 protein. Therefore, PRO1130 disclosed in the present application is now considered to be the newly identified 2-19 protein homolog. 121. Using the PRO1335 WU-BLAST2 sequence alignment program, the full-length native sequence PRO13
35 (shown in Figure 242 and SEQ ID NO: 423) was found to have some amino acid sequence identity with the human decarboxylase precursor protein (AF037335_1). Therefore, PRO1335 disclosed in the present application is now a newly identified member of the decarboxylase protein family and is believed to have activity typical of this family. 122. The PRO1329 DNA66660-1585 clone is believed to encode a secretory factor. To the best of our knowledge, the DNA66660-1585 sequence can be found here at PRO132
Encoding a novel factor designated 9; the WU-BLAST2 sequence alignment computer program was used to reveal sequence identity with known proteins,
It was determined not to be significant. 123. The PRO1550 DNA76393-1664 clone was isolated from a subtracted human breast cancer tissue library. To the best of our knowledge, the DNA76393-1664 sequence is here
It encodes a novel factor designated 1550; the WU-BLAST2 sequence alignment computer program was used to reveal sequence identity with known proteins, but was determined not to be significant.

B. PRO Variants In addition to the full-length native sequence PRO polypeptides described herein, PRO variants could also be prepared. PRO variants can be prepared by introducing appropriate nucleotide changes into the PRO polypeptide DNA, or by synthesizing the desired PRO polypeptide. Those skilled in the art will appreciate that amino acid changes, such as changes in the number or position of glycosylation sites or changes in membrane anchoring properties, can alter post-translational processes of PRO polypeptides. Mutations in the native full-length sequence PRO or in various domains of the PRO polypeptides described herein are made using, for example, any technique and guidance for conservative and non-conservative mutations described in US Pat. No. 5,364,934. be able to. A mutation may be a substitution, deletion or insertion of one or more codons encoding a PRO polypeptide that results in a change in the amino acid sequence of the PRO polypeptide as compared to the native sequence PRO. In some cases, the mutation is the replacement of at least one amino acid with any other amino acid in one or more domains of the PRO polypeptide. A guideline for which amino acid residues are to be inserted, substituted or deleted without adversely affecting the desired activity is to compare the sequence of the PRO polypeptide with that of a protein molecule of known homology and It is found by minimizing the amino acid sequence changes made within the high region of Amino acid substitutions can be the result of substitutions of one amino acid for another amino acid with similar structural and / or chemical properties, eg, replacement of leucine with serine, a conservative amino acid substitution. Insertions and deletions can optionally be in the range of 1 to 5 amino acids. The permissible mutations are
It is determined by systematically making amino acid insertions, deletions or substitutions in the sequence and testing the resulting variants for activity in any of the in vitro assays described in the Examples below.

PRO polypeptide fragments are provided herein. Such fragments may be truncated at the N-terminus or C-terminus, or may lack internal residues, for example, when compared to the full length native protein. Certain fragments lack amino acid residues that are not essential for the desired biological activity of the PRO polypeptide. PRO fragments may be prepared by any of many conventional techniques. The desired peptide fragment may be chemically synthesized. An alternative method is enzymatic digestion, for example by treating the protein with an enzyme known to cleave the protein at sites determined by specific amino acid residues, or by digesting the DNA with appropriate restriction enzymes. Including the generation of the PRO fragment by isolating the desired fragment. Yet another suitable technique involves isolating and amplifying a DNA fragment encoding the desired polypeptide fragment by polymerase chain reaction (PCR). Oligonucleotides that determine the desired ends of the DNA fragments are used in the 5'and 3'primers of PCR.
Preferably, PRO polypeptide fragments share at least one biological and / or immunological activity with the native PRO polypeptide disclosed herein. In a particular embodiment, the conservative substitutions of interest are shown in Table 1, beginning with the preferred substitution. If such a substitution results in a change in biological activity, the product is screened for by introducing a more substitutional change, termed exemplary substitutions in Table 1 or as further described below in the amino acid taxonomy. To be done.

[0407]                   Table 1 Original residue Exemplary substitution Preferred substitution Ala (A) val; Leu; ile val Arg (R) lys; gln; asn lys Asn (N) gln; his; lys; arg gln Asp (D) glu glu Cys (C) ser ser Gln (Q) asn ans Gln (E) asp asp Gly (G) pro; ala ala His (H) asn; gln; lys; arg arg Ile (I) leu; val; met; ala; phe;               Norleucine leu Leu (L) norleucine; ile; val;               met; ala; phe ile Lys (K) arg; gln; asn arg Met (M) leu; phe; ile leu Phe (F) leu; val; ile; ala; tyr leu Pro (P) ala ala Ser (S) thr thr Thr (T) ser ser Trp (W) tyr; phe tyr Tyr (Y) trp; phe; thr; ser phe Val (V) ile; leu; met; phe;              ala; Norleucine leu

Substitutional modifications of PRO polypeptide function and immunological identity can be accomplished by (a) structure of the polypeptide backbone of the replacement region, eg, sheet or helical arrangement, (b) charge or hydrophobicity of the target site, or (C) It is achieved by selecting substituents that are substantially different in their effect, while maintaining the bulk of the side chains. Naturally occurring residues can be divided into groups based on common side chain properties: (1) Hydrophobicity: norleucine, met, ala, val, leu, ile; (2) Neutral hydrophilicity: cys, ser. , thr; (3) Acidity: asp, glu; (4) Basicity: asn, gln, his, lys, arg; (5) Residues affecting chain orientation: gly, pro; and (6) aromatic: trp, tyr, phe. Non-conservative substitutions will entail exchanging a member of one of these classes for another class. Residues so substituted may also be introduced at conservative substitution sites, preferably left-over (non-conserved) sites. Mutations include oligonucleotide-mediated (site-directed) mutagenesis, alanine scanning, and PCR mutagenesis [Carter et al., Nucl. Acids Res., 13: 4331.
(1986); Zoller et al., Nucl. Acids Res., 10: 6487 (1987)], cassette mutagenesis [Wells et al., Gene, 34: 315 (1985)], restricted selective mutagenesis [Wells et al.
Philos. Trans. R. Soc. London SerA, 317: 415 (1986)] or any other known technique for cloning D.
It can also be performed on NA to generate PRO mutant DNA. Also, scanning amino acid analysis can be used to identify one or more amino acids along a flanking sequence. The preferred scanning amino acids are relatively small, neutral amino acids. Such amino acids include alanine, glycine,
Contains serine and cysteine. Alanine is typically the preferred scanning amino acid in this group because it excludes side chains above the beta carbon and does not alter the backbone structure of the mutant [Cuningham and Wells, Science, 244: 1081-1085]. (198
9)]. Also, alanine is typically preferred because it is the most common amino acid. Moreover, it is often found in both buried and exposed locations [Crei
ghton, The Proteins, (WH Freeman &amp; Co., NY); Chothia, J. Mol. Bi
ol., 150: 1 (1976)]. If alanine substitution does not yield a sufficient amount of variant, an isoteric amino acid can be used.

C. Modifications of PRO Covalent modifications of PRO polypeptides are included within the scope of this invention. One type of covalent modification is to react a targeted amino acid residue of the PRO polypeptide with an organic derivatizing reagent capable of reacting with a selected side chain or N- or C-terminal residue of the PRO polypeptide. . Derivatization with bifunctional reagents is useful, for example, to crosslink PRO to a water-insoluble support matrix or surface for use in a method of purifying anti-PRO antibodies or vice versa. The cross-linking agent usually used is, for example, 1,1
-Including bis (diazoacetyl) -2-phenylethane, glutaraldehyde, N-hydroxysuccinimide ester such as 4-azidosalicylic acid, and disuccinimidyl ester such as 3,3'-dithiobis (succinimidylpropionate) Includes homobifunctional imide esters, bifunctional maleimides such as bis-N-maleimido-1,8-octane, and reagents such as methyl-3-[(p-azidophenyl) -dithio] propioimidate. Other modifications include deamination of glutaminyl and asparaginyl residues to the corresponding glutamyl and aspartyl, hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl or threonyl residues, lysine, arginine, and histidine side chains. Methylation of α-amino groups of [TE Creighton, Proteins: Structur
e and Molecular Properties, WH Freeman &amp;amp; Co., San Francisco, p
p.79-86 (1983)], acetylation of N-terminal amines, and amidation of any C-terminal carboxyl groups.

Other types of covalent modifications of the PRO polypeptide included within the scope of this invention are:
Includes alteration of the native glycosylation pattern of the polypeptide. By "altering the native glycosylation pattern" is intended herein a deletion of one or more carbohydrate moieties found in the native sequence PRO (elimination of existing glycosylation sites or chemical and / or chemical
Or by the removal of glycosylation by enzymatic means) and / or the addition of one or more glycosylation sites not present in the native sequence PRO. In addition, this clause includes qualitative changes in glycosylation of native proteins, including changes in the properties and properties of the various carbohydrate moieties present. Addition of glycosylation sites to the PRO polypeptide may be accomplished by altering the amino acid sequence. This modification may be made, for example, by the addition or substitution of one or more serine or threonine residues to the native sequence PRO (O-linked glycosylation site). The PRO amino acid sequence is optionally altered through changes at the DNA level, particularly by mutating the DNA encoding the PRO polypeptide at preselected bases to produce codons that are translated into the desired amino acid. Good.

Another means of increasing the number of carbohydrate moieties on the PRO polypeptide is by chemical or enzymatic coupling of glycosides to the polypeptide. Such methods are described in the art, for example WO 87/05330, published September 11, 1987, and Aplin.
And Wriston, CRC Crit. Rev. Biochem., Pp. 259-306 (1981). Removal of carbohydrate moieties present on the PRO polypeptide may be accomplished chemically or enzymatically, or by mutational substitution of codons encoding amino acid residues presented as targets for glycosylation. Chemical deglycosylation techniques are known in the art, eg Hakimuddin et al., Arch. Biochem. Biophys., 259: 5.
2 (1987) and by Edge et al., Anal. Biochem., 118: 131 (1981). Enzymatic cleavage of carbohydrate moieties on polypeptides is described by Thotakura et al., Meth.
This is accomplished by using various endo and exoglycosidases, as described in Enzymol. 138: 350 (1987). Another type of covalent modification of PRO of the present invention is US Pat. No. 4,640,835 to PRO polypeptides to one of a variety of non-proteinaceous polymers such as polyethylene glycol, polypropylene glycol, or polyoxyalkylenes. ； 4th, 4th
96,689; 4,301,144; 4,670,417; 4,791,192 or 4,179,337.

The PRO polypeptides of the invention may also be modified in a manner to form chimeric molecules that include the PRO polypeptide fused to other heterologous polypeptides or amino acid sequences. In one embodiment, such a chimeric molecule comprises a fusion of a PRO polypeptide with a tag polypeptide that provides an epitope to which an anti-tag antibody can selectively bind.
The epitope tag is generally placed at the amino- or carboxyl-terminus of the PRO polypeptide. The presence of such epitope-tagged forms of PRO polypeptides is
It can be detected using an antibody against the tag polypeptide. Also, provision of the epitope tag enables the PRO polypeptide to be readily purified by affinity purification using an anti-tag antibody or another type of affinity matrix that binds to the epitope tag. Various tag polypeptides and their respective antibodies are well known in the art. Examples include poly-histidine (poly-his) or poly-histidine-glycine (poly-his-gly) tags; flu HA-tagged polypeptides and their antibodies 12
CA5 [Field et al., Mol. Cell. Biol., 8: 2159-2165 (1988)]; c-myc tag and 8F9, 3C7, 6E10, G4, B7 and 9E10 antibodies thereto [Evan et al.
Molecular and Cellular Biology, 5: 3610-3616 (1985)]; and herpes simplex virus glycoprotein D (gD) tag and its antibody [Paborsky et al., Protein Engineer.
ing, 3 (6): 547-553 (1990)]. Other tag polypeptides include flag peptides [Hopp et al., BioTechnology, 6: 1204-1210 (1988)]; KT3 epitope peptides [Martin et al., Science, 255: 192-194 (1992)]; α-tubulin epitope peptides. [Skinner et al., J. Biol. Chem., 266: 15163-15166 (1991)]; and T7 gene 10 protein peptide tag [Lutz-Freyermuth et al., Proc. Natl. Acad. Sci.
USA, 87: 6393-6397 (1990)]. In an alternative embodiment, the chimeric molecule may comprise a fusion of PRO with an immunoglobulin or a particular region of an immunoglobulin. For the divalent form of the chimeric molecule (also referred to as the "immunoadhesin"), such a fusion is an F molecule of an IgG molecule.
It can be the c region. Ig fusions preferably include a soluble (transmembrane domain deleted or inactivated) form of the PRO polypeptide in place of at least one variable region within the Ig molecule. In a particularly preferred embodiment, the immunoglobulin fusion comprises the hinge, CH2 and CH3, or hinge, CH1, CH2 and CH3 regions of an IgG molecule. See US Pat. No. 5,428,130 issued Jun. 27, 1995 for the preparation of immunoglobulin fusions.

D. Preparation of PRO The following description primarily relates to methods of producing PRO by culturing cells transformed or transfected with a vector containing PRO nucleic acid. Of course, it is contemplated that PRO may be prepared using other methods well known in the art. For example, the PRO sequence, or a portion thereof, may be produced by direct peptide synthesis using solid phase techniques [eg, Stewart et al., Solid-Phase Pepti.
de Synthesis, WH Freeman Co., San Francisco, CA (1969); Merrifield, J.
Am. Chem. Soc., 85: 2149-2154 (1963)]. In vitro protein synthesis may be performed by manual techniques or by automation. Automated synthesis may be performed, for example, using an Applied Biosystems Peptide Synthesizer (Foster City, CA) according to the manufacturer's instructions. Various portions of PRO may be chemically synthesized separately and combined using chemical or enzymatic methods to produce full-length PRO.

1. Isolation of PRO-encoding DNA PRO-encoding DNA can be obtained from cDNA libraries prepared from tissues that carry PRO mRNA and are suspected of expressing it at detectable levels. Therefore, human PRODNA can be conveniently obtained from a cDNA library prepared from human tissue, as described in the Examples. PRO-encoding genes can also be obtained from genomic libraries or by known synthetic methods (eg, automated nucleic acid synthesis). Libraries can be screened with probes (such as antibodies to PRO or oligonucleotides of at least about 20-80 bases) designed to identify the gene of interest or the protein encoded by the gene.
Screening a cDNA or genomic library with selected probes
For example, Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold
It can be carried out using standard procedures described in Spring Harbor Laboratory Press, 1989). Another method for isolating the gene encoding the desired PRO polypeptide is to use the PCR method [Sambrook et al., Supra; Dieffenba.
ch et al., PCR Primer: A Laboratory Manual (Cold Spring Harbor Laboratory Pres
s, 1995)].

The following examples describe techniques for screening a cDNA library. The oligonucleotide sequence selected as a probe should be of sufficient length and sufficiently unambiguous that false positives are minimized. The oligonucleotide is preferably detectably labeled upon hybridisation with the DNA in the library to be screened. Methods of labeling are well known in the art and include the use of radiolabels such as ³² P labeled ATP, biotinylation or enzyme labeling. Hybridization conditions, including moderate and high stringency, are given in Sambrook et al., Supra. Sequences identified in such library screening methods are Genban
It can be compared and aligned with known sequences that have been deposited in public databases such as k or private sequence databases and are available to the public. Within a defined region of the molecule or over its entire length (either at the amino acid or nucleic acid level)
Sequence identity can be determined using methods known in the art and described herein. Nucleic acids having protein-encoding sequences are used for the first time using the deduced amino acid sequences disclosed herein and, if necessary, to detect intermediates and precursors of mRNA that have not been reverse transcribed into cDNA, Sambrook et al., Supra. It can be obtained by screening the selected cDNA or genomic library using conventional primer extension methods as described in.

2. Selection and Transformation of Host Cells Host cells are transfected or transformed with the expression or cloning vectors for PRO production described herein to induce promoters, select transformants, or encode desired sequences. The cells are cultured in a conventional nutrient medium which has been appropriately modified to amplify the gene. Culture conditions such as medium, temperature, pH, etc. can be selected by those skilled in the art without undue experimentation. Generally, principles, protocols, and practical techniques for maximizing cell culture productivity are described in Mammalian Cell Biotechnology:
a Practical Approach, edited by M. Butler (IRL Press, 1991) and Sambrook et al., supra. Methods of prokaryotic and eukaryotic cell transfection, such as CaCl ₂ , CaPO ₄ , liposome-mediated and electroporation are known to those of skill in the art. Depending on the host cell used, transformation is done using standard methods appropriate to the cell. Calcium treatment with calcium chloride or electroporation as described in Sambrook et al., Supra, is generally used for prokaryotes. Infection by Agrobacterium tumefaciens was reported by Shaw et al., Ge
ne, 23: 315 (1983) and WO 89/05859 published June 29, 1989 and used for the transformation of certain plant cells. For mammalian cells without such cell walls, the calcium phosphate precipitation method of Graham and van der Eb, Virology, 52: 456-457 (1978) is preferred. General aspects of mammalian cell host system transformations have been described in US Pat. No. 4,399,216. Transformation into yeast is typically performed by Van solingen et al., J. Bact., 130: 946 (1977) and Hsiao et al., Proc. Nat.
l. Acad. Sci. USA, 76: 3829 (1979). However, other methods of introducing DNA into cells, such as nuclear microinjection,
Electroporation, intact cells, or polycations such as polybrene,
Bacterial protoplast fusion, such as with polyornithine, can also be used.
For various techniques for transforming mammalian cells, see Keown et al., Methods i.
n Enzymology, 185: 527-537 (1990) and Mansour et al., Nature, 336: 348-352 (198).
See 8).

Suitable host cells for cloning or expressing the DNA in the vectors described herein are prokaryote, yeast, or higher eukaryote cells. Suitable prokaryotes include, but are not limited to, eubacteria, such as Gram-negative or Gram-positive organisms, for example, Enterobacteriaceae such as E. coli. Various E. coli strains are publicly available, for example E. coli K12 strain MM294 (ATCC31,446); E. coli X1776.
(ATCC31,537); E. coli strains W3110 (ATCC27,325) and K5772 (ATCC53,6)
35). Other preferred prokaryotic host cells are E. coli, such as E. coli, Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella, for example Salmonella typhimurium, Serratia, for example Serratia marcesans ( Serratia marcescans), and Shigella, and bacilli, such as B. subtilis and B. licheniformis.
) (Eg, Bacillus licheniformis 41P described in DD 266,710 issued Apr. 12, 1989), Pseudomonas, for example, Pseudomonas aeruginosa and Enterobacteriaceae such as Streptomyces. These examples are illustrative rather than limiting. Strain W3110 is one particularly preferred host or parent host as it is a common host strain for recombinant DNA production and publishing. Preferably, the host cell secretes a minimal amount of proteolytic enzyme. For example, strain W3110 may be modified to make a genetic mutation in a gene encoding a protein that is foreign to the cell, and examples of such hosts include E. coli W3110 strain 1A2 with the complete genotype tonA; Genotype ton
E. coli W3110 strain 9E4 carrying A ptr3; complete genotype tonA p
rt3 phoA E15 (argF-lac) 169 degP ompTk
E. coli W3110 strain 27C7 (ATCC 55,244); complete genotype t
onA ptr3 phoA E15 (algF-lac) 169 degP
E. coli W3110 strain 37D6 having ompT rbs7ilvGkan; E. coli W3110 strain 4 which is 37D6 strain having a non-kanamycin resistant degP deletion mutation
0B4; and E. coli strains having a mutant periplasmic protease disclosed in US Pat. No. 4,946,783 issued Aug. 7, 1990. Alternatively, in vitro methods of cloning such as PCR or other nucleic acid polymerase polymerase reactions are preferred.

In addition to prokaryotes, eukaryotic microbes such as filamentous fungi or yeast are suitable cloning or expression hosts for PRO polypeptide-encoding vectors. Saccharomyces cerevisiae is a commonly used lower eukaryotic host microorganism. In addition, Schizosaccharomyces prombe (Beach and Nur
se, Nature, 290: 140 [1981]; EP 139,383, issued May 2, 1985; Kluveromyces hosts (US Pat. No. 4,943,529; Fleer et al., Bio / Tech).
nology, 9: 968-975 (1991)), for example K. lactis (MW98-8C, CBS
683, CBS4574; Louvencourt et al., J. Bacteriol. 737 [1983]), Kefragiris (
K. fragilis) (ATCC 12,424), K. bulgaricus (ATCC 16,04)
5), K. wickeramii (ATCC 24,178), K. walamii (K. walamii)
tii) (ATCC 56,500), K. drosophilarum (ATCC 36,906
; Van den Berg et al., Bio / Technology, 8: 135 (1990)), Katemoto Tolerance (K.
the motolerans) and K. marxianus; yarrowia
) (EP 402,226); Pichia pastoris (EP 183,070; Sheekr
ishna et al., J. Basic Microbiol, 28: 265-278 [1988]); Candida; Trichoder Malaysia (reesia) (EP 244,234); Panax mold (Case et al., Proc. Natl. Acad)
Sci. USA, 76: 5259-5263 [1979]); schwanniomyces,
For example, Schwanniomyces occidentalis (EP 394,538, published October 31, 1990); and filamentous fungi, such as Neurospora, Penicillium, Tolypocladium (published January 10, 1991) WO 91/00357); and Koji bacterium, such as pseudo-nest Koji bacterium (Ballance et al., Biochem. Biophys. Res. Commun.
, 112: 284-289 [1983]; Tilburn et al., Gene, 26: 205-221 [1983]; Yelton et al., Pr.
oc. Natl. Acad. Sci. USA, 81: 1470-1474 [1984]) and black mold (Kelly and H.
ynes, EMBO J., 4: 475-479 [1985]). Preferred methylotropic yeasts here include, but are not limited to, Hansenula,
Includes a methanol-growth yeast selected from the genus consisting of Candida, Kloeckera, Pichia, Saccharomyces, Torulopsis, and Rhodotorula. A list of specific species that are exemplary of this yeast class is set forth in C. Anthony, The Biochemistry of Methylotrophs, 269 (1982).

Suitable host cells for the expression of glycosylated PRO are derived from multicellular organisms.
Examples of invertebrate cells include insect cells such as Drosophila S2 and Spodaspera Sf9, as well as plant cells. Examples of useful mammalian host cell lines include Chinese Hamster Ovary (CHO) and COS cells. A more detailed example is
Monkey kidney CV1 strain transformed with SV40 (COS-7, ATCC CRL 1651); human embryonic kidney strain (293 or 293 cells subcloned for growth in suspension culture,
Graham et al., J. Gen Virol., 36:59 (1977)); Chinese hamster ovary cells /
-DHFR (CHO, Urlaub and Chasin, Proc. Natl. Acad. Sci. USA, 77: 4216 (19
80)); Sertoli cells of mouse (TM4, Mather, Biol. Reprod., 23: 243-251 (1980).
) Human lung cells (W138, ATCC CCL 75); human hepatocytes (Hep G2, HB 8065); and mouse breast tumor cells (MMT 060562, ATTC CCL51). Selection of an appropriate host cell is
Within the common general knowledge of this field.

3. Selection and Use of Replicable Vectors A nucleic acid encoding PRO (eg, cDNA or genomic DNA) is inserted into a replicable vector for cloning (amplification of DNA) or expression. Various vectors are publicly available. The vector can be in the form of, for example, a plasmid, cosmid, viral particle, or phage. The appropriate nucleic acid sequence is
It is inserted into the vector by various techniques. Generally, the DNA is inserted into the appropriate restriction endonuclease sites using techniques well known in the art. Vector components generally include, but are not limited to, one or more signal sequences, origins of replication, one or more marker genes, enhancer elements, promoters, and transcription termination sequences. Construction of suitable vectors containing one or more of these components employs standard ligation techniques known to those of ordinary skill in the art. PRO is not only directly produced by recombinant techniques, but also as a fusion peptide with a heterologous polypeptide which is a signal sequence or a mature protein or another polypeptide having a specific cleavage site at the N-terminus of the polypeptide. Is also produced. Generally, the signal sequence is a component of the vector or part of the PRO-encoding DNA that is inserted into the vector. The signal sequence may be, for example, a prokaryotic signal sequence selected from the group of alkaline phosphatase, penicillinase, lpp or thermostable enterotoxin II leaders. For yeast secretion, the signal sequences are yeast invertase leader, alpha factor leader (
Includes yeast (Saccharomyces) and Kluyveromyces α factor leaders, the latter of which are described in US Pat. (EP362179, published April 4, 1990), or the signals described in WO 90/13646 published November 15, 1990. In mammalian cell expression, the mammalian signal sequence is
It may be used for direct secretion of proteins such as signal sequences from secreted polypeptides of the same or related species, as well as viral secretory leaders.

Both expression and cloning vectors contain a nucleic acid sequence that enables the vector to replicate in one or more selected host cells. Such sequences are common to many bacteria,
It is well known for yeasts and viruses. The origin of replication derived from plasmid pBR322 is suitable for most Gram-negative bacteria, the 2μ plasmid origin is suitable for yeast, and various viral origins (SV40, polyoma, adenovirus, VSV or BPV) are mammalian. It is useful as a cloning vector in animal cells. Expression and cloning vectors typically contain a selection gene, also termed a selectable marker. Typical selection genes are (a) ampicillin, neomycin,
Not resistant to antibiotics or other toxins such as methotrexate or tetracycline, (b) supplementing auxotrophic defects, or (c) obtained from complex media such as the gene code D-alanine racemase for Bacillus It encodes a protein that supplies important nutrients.

Examples of selectable markers suitable for mammalian cells are those that can identify cellular components, such as DHFR or thymidine kinase, that are capable of incorporating PRO-encoding nucleic acid. Suitable host cells using wild type DHFR are:
CHO cell line deficient in DHFR activity prepared and propagated as described by Urlaub et al., Proc. Natl. Acad. Sci. USA, 77: 4216 (1980). A preferred selection gene for use in yeast is the trp1 gene present in the yeast plasmid YRp7 [Stinchcomb et al., Nature, 282: 39 (1979); Kingman et al.,
Gene, 7: 141 (1979); Tschemper et al., Gene, 10: 157 (1980)]. The trp1 gene provides a selectable marker for mutant strains of yeast lacking the ability to grow in tryptophan, such as ATCC No. 44076 or PEP4-1 [Jones, Genetics, 85:12 (1977)]. Expression and cloning vectors usually contain a promoter operably linked to the PRO-encoding nucleic acid sequence to control mRNA synthesis. Suitable promoters recognized by a variety of possible host cells are known. Suitable promoters for use in prokaryotic hosts include the β-lactamase and lactose promoter systems [Cahng
Et al., Nature, 275: 615 (1978); Goeddel et al., Nature, 281: 544 (1979)], alkaline phosphatase, tryptophan (trp) promoter system [Goeddel, Nucleic Ac
ids Res., 8: 4057 (1980); EP 36,776], and hybrid promoters such as the tac promoter [deBoer et al., Proc. Natl. Acad. Sci. USA, 80: 21-25 (1
983)] is included. Promoters used in bacterial systems also have a Shine-Dalgarno (SD) sequence operably linked to the DNA encoding PRO.

Examples of suitable promoter sequences for use with yeast hosts include 3-phosphoglycerate kinase [Hitzeman et al., J. Biol. Chem., 255: 2073 (1980)] or other glycolytic enzymes [Hess et al. , J. Adv. Enzyme Reg., 7: 149 (1968); Holland, Biochem.
istry, 17: 4900 (1987)], for example, enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, Pyruvate kinase, trioselate isomerase, phosphoglucose isomerase, and glucokinase are included. Other yeast promoters are inducible promoters that have the additional effect of transcription being regulated by growth conditions, such as alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, metallothionein, glycerin. There are promoter regions for aldehyde-3-phosphate dehydrogenase and enzymes that control the utilization of maltose and galactose. Vectors and promoters suitable for expression in yeast are further described in EP 73,657. PRO transcription from a vector in mammalian host cells can be performed, for example, by polyomavirus, infectious epithelioma virus (UK 2,211,504 published July 5, 1989), adenovirus (eg adenovirus 2), bovine papilloma virus, avian virus. Sarcoma virus,
Cytomegalovirus, retrovirus, hepatitis B virus and simian virus 4
0 (SV40), a promoter derived from the genome of a virus, a heterologous mammalian promoter such as an actin promoter or an immunoglobulin promoter,
And promoters derived from heat shock promoters, as long as such promoters are compatible with the host cell line.

Transcription of the DNA encoding the desired PRO by higher eukaryotes can be enhanced by inserting an enhancer sequence into the vector. Enhancers, usually about 10 to 300 base pairs, are cis-acting elements of DNA that act on promoters to enhance their transcription. Many enhancer sequences from mammalian genes are currently known (globin, elastase, albumin, α-fetoprotein and insulin). However, typically enhancers from eukaryotic viruses will be used. Examples include the SV40 enhancer on the late side of the replication origin (100-270 base pairs), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and the adenovirus enhancer. The enhancer may be spliced into the vector at the 5'or 3'positions of the PRO coding sequence, but is preferably located 5'from the promoter. Expression vectors for use in eukaryotic host cells (yeast, fungi, insects, plants, animals, humans, or nucleated cells from other multicellular organisms) also include termination of transcription and mRNA.
It also contains the sequences required for the stabilization of Such sequences are used in eukaryotic or viral DNs.
It can be obtained from the A or cDNA, usually 5'and sometimes 3'untranslated regions. These regions contain nucleotide segments transcribed as polyadenylated fragments in the untranslated portion of the mRNA encoding PRO. Other methods suitable for adapting the synthesis of PRO in recombinant vertebrate cell culture,
Vectors and host cells are described in Gething et al., Nature, 293: 620-625 (1981); Mantei et al.,
Nature, 281: 40-46 (1979); EP 117,060; and EP 117,058.

4. Detection of Gene Amplification / Expression Amplification and / or expression of a gene can be carried out using appropriately labeled probes based on the sequence provided herein, for example, conventional Southern blotting, Northern quantifying mRNA transcription. Blotting [Thomas, Proc. Natl. Acad. Sci. USA, 77:52
01-5205 (1980)], the dot blot method (DNA analysis), or the in situ hybridization method, and can be directly measured in the sample. Alternatively, DNA
Antibodies capable of recognizing specific double strands, including double strands, RNA double strands and DNA-RNA hybrid double strands or DNA-protein double strands can also be used. The antibody can then be labeled and the assay performed, wherein the duplex is surface bound, such that the antibody bound to the duplex at the time of surface duplex formation. Presence can be detected. Alternatively, gene expression can also be measured by immunological methods that directly quantitate the expression of the gene product, such as immunohistochemical staining of cells or tissue sections and cell culture or body fluid assays. Antibodies useful for immunohistochemical staining and / or assay of sample fluids may be monoclonal or polyclonal and can be prepared in any mammal. Conveniently, the antibody is directed against the native sequence PRO polypeptide, or against a synthetic peptide based on the DNA sequences provided herein, or against an exogenous sequence fused to PRODNA and encoding a specific antibody epitope. Can be prepared.

5. Purification of Polypeptides Forms of PRO can be recovered from culture medium or lysates of host cells. If membrane-bound, it can be detached from the membrane using a suitable wash (eg Triton-X100) or enzymatic cleavage. The cells used to express PRO can be disrupted by various chemical or physical means such as freeze-thaw cycling, sonication, mechanical disruption, or cell lysing agents. It may be desirable to purify PRO from recombinant cell proteins or polypeptides. Purified by the following procedure, which is an example of a suitable purification procedure: Fractionation on an ion exchange column; ethanol precipitation; reverse phase HPLC; chromatography on silica or cation exchange resins such as DEAE; chromatofocusing; SDS.
-PAGE; ammonium sulfate precipitation; gel filtration using eg Sephadex G-75; protein A Sepharose column to remove contaminants such as IgG; and PR
Metal chelation column that binds the epitope-tagged form of O polypeptides. Known in the art, for example Deutcher, Methodes in Enzymology, 182 (1990).
Scopes, Protein Purification: Principles and Practice, Springer-Verlag
Many of the protein purification methods described in New York (1982) can be used. The purification process chosen will depend, for example, on the production method used and the nature of the particular PRO produced.

6. Uses of PRO Nucleic acid sequences encoding PRO (or their complements) may be used in a variety of areas in molecular biology, including use as hybridization probes, in chromosome and gene mapping, and in the production of antisense RNA and DNA. Has uses. PRO nucleic acids will also be useful in the preparation of PRO polypeptides by the recombinant techniques described herein. The full-length native sequence PRO gene, or a portion thereof, may be the isolation of full-length PRO cDNA or other genes with the desired sequence identity to the PRO sequences disclosed herein (eg, naturally occurring variants of PRO or other species (Encoding PRO from E. coli) can be used as a hybridization probe for a cDNA library.
In some cases, the length of the probe is about 20 to about 50 bases. Hybridization probes may be derived, at least in part, from novel regions of the full-length native nucleotide sequence, which regions, without undue experimentation, produce the native sequence PRO.
Can be derived from a genomic sequence containing the promoter, enhancer component and intron. For example, screening methods include isolating the coding region of the PRO polypeptide gene using known DNA sequences to synthesize a selected probe of about 40 bases. Hybridization probes can be labeled with a variety of labels, including radioactive nucleotides such as ³² P or ³⁵ S, or enzyme labels such as alkaline phosphatase attached to the probe via the avidin / biotin binding system. P of the present invention
A labeled probe having a sequence complementary to the RO polypeptide gene is human c
It can be used to screen a library of DNA, genomic DNA or mRNA and determine which members of the library hybridize to the probe. Hybridization techniques are described in further detail in the examples below.

Any EST disclosed in this application can be used in the methods described herein, as well as probes. Other useful fragments of PRO nucleic acid are target PRO mRNA (sense) or PROD
An antisense or sense oligonucleotide comprising an antisense or sense oligonucleotide comprising a single stranded nucleic acid sequence (either RNA or DNA) capable of binding to an NA (antisense) sequence is according to the invention encoded by PRODNA. Contains region fragments. Such fragments generally contain at least about 14 nucleotides, preferably about 14 to 30 nucleotides. The possibility of controlling antisense or sense oligonucleotides based on a cDNA sequence encoding a given protein has been described, for example, by Stein and Cohen (CancerRes. 48: 2659: 1988) and van der Krol et al. (BioTechniques 6: 958, 1988). Binding of the antisense or sense oligonucleotide to the target nucleic acid sequence results in the formation of a duplex, which is one of several methods including promoting duplex degradation, premature termination of transcription or translation, or Other methods prevent transcription or translation of the target sequence. Thus, antisense oligonucleotides are used to block the expression of PRO proteins. The antisense or sense oligonucleotide further comprises an oligonucleotide having a modified sugar-phosphodiester backbone (or other sugar bond, such as those described in WO 91/06629), such sugar bond being resistant to an endogenous nuclease. is there. Oligonucleotides with such resistant sugar linkages are stable in vivo (ie, can withstand enzymatic degradation) but retain the sequence specificity of being able to bind the target nucleotide sequence.

Other examples of sense or antisense oligonucleotides are organic moieties, such as those described in WO 90/10048, and other moieties that enhance the affinity of the oligonucleotide for the target nucleic acid sequence, eg It contains an oligonucleotide covalently linked to poly- (L-lysine). Furthermore, an intercalating agent such as ellipticine, an alkylating agent, or a metal working substance may be bound to the sense or antisense oligonucleotide to modify the binding specificity of the antisense or sense oligonucleotide to the target nucleotide sequence. Antisense or sense oligonucleotides can be prepared, for example, by CaPO ₄ -mediated D
By any gene conversion method including NA transfection, electroporation, or by using a gene conversion vector such as Epstein-Barr virus
It is introduced into cells containing the target nucleic acid sequence. In a preferred method, the antisense or sense oligonucleotide is inserted into a suitable retroviral vector. Cells containing the target nucleic acid sequence are contacted with the recombinant retroviral vector in vivo or ex vivo. Suitable retroviral vectors include, but are not limited to, those derived from the murine retrovirus M-MuLV, N2 (retrovirus derived from M-MuLV), or the double named DCT5A, DCT5B and DCT5C. Includes a copy vector (see WO 90/13641).

Sense or antisense oligonucleotides may also be introduced into cells containing the target sequence by forming a complex with a ligand binding molecule, as described in WO 91/04753. Suitable ligand binding molecules include, but are not limited to, cell surface receptors, growth factors, other cytokines, or other ligands that bind to cell surface receptors. Preferably, the complexing of the ligand-binding molecule substantially limits the ability of the ligand-binding molecule to bind to its corresponding molecule or receptor, or prevent the sense or antisense oligonucleotide or complex thereof from entering the cell. Do not block. Alternatively, sense or antisense oligonucleotides may be introduced into cells containing the target nucleic acid sequence by formation of an oligonucleotide-lipid complex, as described in WO 90/10448. The sense or antisense oligonucleotide-lipid complex is preferably degraded intracellularly by endogenous lipase.

The probes can also be used in PCR techniques to generate a pool of sequences for the identification of closely related PRO coding sequences. The PRO-encoding nucleic acid sequence can also be used to create hybridization probes for mapping the PRO-encoding gene and for genetic analysis of individuals with genetic disorders. The nucleic acid sequences provided herein can be mapped to chromosomes and specific regions of chromosomes using well-known techniques such as in situ hybridization, binding analysis for known chromosomal markers, and hybridization screening in libraries. . If the PRO coding sequence encodes a protein that binds to another protein (eg, PRO is a receptor), PRO can be used in an assay to identify its ligand. In this way, inhibitors of receptor / ligand binding interactions can be identified. Proteins involved in such binding interactions can also be used to screen for peptides or small molecule inhibitors or agonists of binding interactions. The receptor PRO can also be used to isolate related ligands. The screening assay is a natural PRO
Or designed for the discovery of lead compounds that mimic the biological activity of the PRO receptor. Such screening assays are also used in high throughput screening of chemical libraries, making them particularly suitable for identifying small molecule drug candidates. Small molecules considered include synthetic organic or inorganic compounds. The assays are performed in a variety of formats, including protein-protein binding assays, biological screening assays, immunoassays and cell-based assays that are well known and characterized in the art.

Nucleic acids encoding PRO or any modified form thereof can also be used to produce transgenic or "knockout" animals, which are useful in the development and screening of therapeutically useful reagents. is there. A transgenic animal (eg, mouse or rat) is an animal that has cells that contain the transgene introduced prenatally, eg, at the embryonic stage, into the animal or an ancestor of the animal. What is a transgene?
It is DNA that has been integrated into the genome of the cell in which a transgenic animal develops.
In one embodiment, the PRO-encoding cDNA is prepared by established techniques.
, And the genomic sequence can be used to produce transgenic animals having cells expressing PRO-encoding DNA. Methods for producing transgenic animals, especially certain animals such as mice or rats, are routine in the art and are described, for example, in US Pat. Nos. 4,736,866 and 4,870,009. Typically, particular cells are targeted for the introduction of the PRO transgene with tissue-specific enhancers. Transgenic animals containing a copy of the PRO-encoded transgene introduced into the germline of the animal at the embryonic stage can be used to investigate the effects of increased expression of DNA encoding PRO. Such animals can be used, for example, as tester animals for reagents that would provide protection against pathological conditions associated with their overexpression. In this aspect of the invention, treatment of an animal with a reagent and a lower incidence of the pathological condition as compared to untreated animals carrying the transgene indicates a potential therapeutic treatment for the pathological condition. .

Alternatively, a non-human homologue of PRO is obtained by homologous recombination between a modified genomic DNA encoding PRO introduced into an embryonic cell of an animal and an endogenous gene encoding PRO. It can be used to generate PRO "knockout" animals with the coding defect or altered gene. For example, the cD encoding PRO
NA can be used for cloning genomic DNA encoding PRO according to established techniques. A portion of the genomic DNA encoding PRO may be deleted or replaced with another gene, such as the gene encoding the selectable marker used to monitor integration. Typically, the vector has a constant flanking D
It contains several kilobases of NA (both at the 5'and 3'ends) [see, for example, Thomas and Capecchi, Cell, 51: 503 (1987) for homologous recombination vectors]. The vector is introduced into embryonic stem cells (eg, by electroporation), and cells in which the introduced DNA is homologously recombined with the endogenous DNA are selected [eg, Li etc.
, Cell, 69: 915 (1992)]. The selected cells are then injected into the blastocyst of an animal (eg mouse or rat) to form an assembled chimera [eg Bradley, Terato.
carcinomas and Embryonic Stem Cells: A Practical Approach, EJ Roberts
on, ed. (IRL, Oxford, 1987), pp. 113-152]. The chimeric embryos are then transplanted into a suitable pseudopregnant female nanny and at intervals, "knockout" animals are created. Offspring with DNA that has been homologously recombined into germ cells are identified by standard techniques and can be used to breed animals in which all cells of the animal contain homologously recombined DNA. . Knockout animals are characterized by the ability to protect against certain pathological conditions and the progression of that pathological condition due to the absence of PRO polypeptide.

Nucleic acids encoding PRO polypeptides can also be used in gene therapy. In gene therapy applications, for example, to replace a defective gene, the gene is introduced to achieve in vivo synthesis of a therapeutically effective amount of the gene product. "Gene therapy"
The term includes both conventional gene therapy in which a single treatment achieves a continuous effect and administration of a gene therapeutic agent including single or repeated administration of therapeutically effective DNA or mRNA. Antisense RNA and DNA can be used as therapeutic agents to block the in vivo expression of certain genes. It has already been shown that a short antisense oligonucleotide can be transferred into cells where it acts as an inhibitor despite low intracellular concentrations due to limited uptake by the cell membrane (Zamecnik et al., Proc. Natl. Acad. Sci. USA 83: 4143-4146 [1986]). Oligonucleotides may be modified to facilitate uptake by replacing their negatively charged phosphodiester groups with uncharged groups. There are various techniques for introducing nucleic acids into viable cells. These techniques will vary depending on whether the nucleic acid is transferred to cultured cells in vitro or in vivo in the cells of the intended host. Suitable methods for transferring nucleic acids into mammalian cells in vitro include liposomes, electroporation, microinjection, cell fusion, DEAE-dextran, calcium phosphate precipitation and the like. Currently preferred in vivo gene transfer techniques are transfection with viral (typically retroviral) vectors and viral coat protein-liposome mediated transfection (Dzau et al., Trends, in Biotechnology 11, 205-219). In some situations it is desirable to provide the nucleic acid source with an agent that targets the target cell, such as a cell surface membrane protein or an antibody specific for the target cell, a ligand for a receptor on the target cell. When using liposomes, proteins that bind to cell surface membrane proteins with endocytosis, for example, capsid proteins or fragments thereof that are tropic for certain cell types, antibodies to proteins that undergo internalization in the cycle, intracellular localization A protein that targets
Used for targeting and / or promoting uptake. Receptor-mediated endocytosis is described, for example, by Wu et al., J. Biol. Chem. 262, 4429-2232 (1987); and Wa.
Gner et al., Proc. Natl. Acad. Sci. USA 87, 3410-3414 (1990). Anderson for a review of gene creation and gene therapy protocols
Et al., Science 256, 808-813 (1992).

The PRO polypeptides described herein may be used as molecular weight markers for protein electrophoresis purposes. Nucleic acid molecules encoding the PRO polypeptides or fragments thereof described herein are useful for chromosome identification. In this regard, there is a need for the identification of novel chromosomal markers, as chromosomal marking reagents based on actual sequences are scarcely available. Each PRO nucleic acid molecule of the present invention can be used as a chromosomal marker. The PRO polypeptides and nucleic acid molecules of the invention can also be used for tissue typing,
The PRO polypeptides of the invention are differentially expressed in one tissue as compared to the other.
PRO nucleic acid molecules will find use for generating probes for PCR, Northern, Southern and Western analyses. The PRO polypeptides described herein may be used as therapeutic agents. P of the present invention
The RO polypeptide is formulated according to known methods for preparing pharmaceutically useful compositions, whereby the PRO product is mixed with a pharmaceutically acceptable carrier medium. Therapeutic formulations may be prepared by mixing the active ingredient with the desired degree of purification with any pharmaceutically acceptable carrier, excipient or stabilizer in the form of a lyophilized formulation or aqueous solution ( Remington's Pharmaceutical Sciences, 16th edition, A. Oso
l, Ed., [1980]), prepared and stored. Acceptable carriers, excipients or stabilizers are non-toxic to recipients at the doses and concentrations used, and buffers such as phosphoric acid, citric acid and other organic acids; antioxidants including ascorbic acid. Agents; low molecular weight (less than 10 residues) polypeptides; proteins such as serum albumin, gelatin or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; glucose, Monosaccharides such as mannose or dextrin, disaccharides or other carbohydrates, chelating agents such as EDTA, saccharides such as mannitol or sorbitol, salt forming counterions such as sodium; and / or TWEEN (trade name), PLURONICS (trade name) Alternatively, it contains a nonionic surfactant such as polyethylene glycol (PEG).

The formulations used for in vivo administration must be sterile. This is easily accomplished by filtration through sterile filter membranes, either before or after lyophilization and reconstitution. Here, the pharmaceutical composition of the present invention is generally placed in a container having a sterile access port, for example, an intravenous bag or a vial having a stopper pierceable by a hypodermic injection needle. The route of administration is by well-known methods, such as injection or infusion by intravenous, intraperitoneal, intracerebral, intramuscular, intraocular, intraarterial or intralesional routes, local administration, or sustained release system. The dosage and desired drug concentration of the pharmaceutical compositions of the present invention will vary depending on the particular intended use. Determination of the proper dosage or route of administration is within the skill of the ordinary physician. Animal studies provide reliable guidance on the determination of effective doses for human therapy. Toxicokinetics and New Dru
g Development, Yacobi et al., ed., Pergamon Press, New York 1989, pp. 42-96, M.
ordenti, J. and chappell, W. `` The use of interspecies scaling in toxico
kinetics ”.

When in vivo administration of the PRO polypeptide or agonist or antagonist thereof is used, the normal dosage is 1 per mammal body weight, depending on the route of administration.
From about 10 ng / kg to 100 mg / kg daily, preferably about 1 μg / kg / day
It is 10 mg / kg / day from the day. Guidance on specific doses and delivery methods is given in the literature; eg, US Pat. Nos. 4,657,760, 5,206,344, or 5,225,21.
See No. 2. That different formulations are effective for different therapeutic compounds and different diseases,
For example, it is expected that targeted administration to one organ or tissue will require delivery in a different manner than other organs or tissues. Microencapsulation of PRO polypeptide is contemplated when sustained release of PRO polypeptide is desired in a formulation with release characteristics suitable for the treatment of any disease or disorder that requires administration of PRO polypeptide. Microencapsulation of recombinant proteins for sustained release has been successfully performed with human growth hormone (rhGH), interferon (rhIFN), interleukin-2, and MNrgp120. Johnson et al., Nat. Med., 2: 795-799 (1996); Yasuda, Biomed. The
r., 27: 1221-1223 (1993); Hora et al., Bio / Technology, 8: 755-758 (1990); Cle.
land, `` Design and Production of Single Immunization Vaccines Using Poly
actide Polyglycolide Microsphere Systems '' Vaccine Design: The Subunit an
d Adjuvant Approach, Powell and Newman, (Plenum Press: New York, 1995
), p. 439-462; WO 97/03692, WO 96/40072, WO 96/07399; and U.S. Pat.
No. 4,010.

Sustained-release formulations of these proteins include poly-lactic-coglycolic acid (PLGA
) Polymers, based on their biocompatibility and wide range of biodegradable properties. The degradation products of PLGA, lactic acid and glycolic acid, are immediately cleared within the human body. Furthermore, the degradability of this polymer can be adjusted from months to years depending on the molecular weight and composition. Lewis, `` Controlled release of bioactive age
nts from lactide / glycolide polymer '': M. Chasin and R. Langer (ed.), Biod
egradable Polymers as Drug Delivery Systems (Marcel Dekker: New York, 19
90), pp. 1-41. The present invention also includes methods of screening compounds to identify those that are similar to PRO polypeptides (agonists) or that inhibit the effects of PRO polypeptides (antagonists). The screening assay for antagonist candidates is
Designed to identify compounds that bind or complex with the PRO polypeptide encoded by the genes identified herein, or otherwise inhibit the interaction of the encoded polypeptide with other cellular proteins . Such screening assays include those applicable to high throughput screening of chemical libraries, making them particularly suitable for identifying small molecule drug candidates. The assay is performed in a variety of formats, including protein-protein binding assays, biochemical screening assays, immunoassays, and cell-based assays, including those known in the art. All assays for antagonists require that they contact the candidate drug with the PRO polypeptide encoded by the nucleic acid identified herein under conditions and for a time sufficient for these two components to interact. Is common in doing.

In binding assays, the interaction is binding and the complex formed is isolated or detected in the reaction mixture. In a particular embodiment, the PRO polypeptide or candidate drug encoded by a gene identified herein is immobilized covalently or non-covalently on a solid phase, eg, a microtiter plate. Non-covalent attachment generally is accomplished by coating the solid surface with a solution of the polypeptide and drying.
Alternatively, an immobilized antibody specific for the PRO polypeptide to be immobilized, eg a monoclonal antibody, can be used to anchor it to a solid surface. The assay is performed by adding the non-immobilized component, which may be labeled with a detectable label, to the immobilized component, eg, the coated surface containing the anchored component. When the reaction is complete, unreacted components are removed, for example by washing, and the complex adhered to the solid surface is detected. When the first non-immobilized component carries a detectable label, detection of the label immobilized on the surface indicates that complex formation has occurred. If the first non-immobilized component has no label, complex formation can be detected, for example, by a labeled antibody that specifically binds to the immobilized complex. Specific PRs that interact with candidate compounds but are encoded by the gene identified here
If it does not bind to O-polypeptide, its interaction with the polypeptide can be assayed by well-known methods for detecting protein-protein interactions. Such assays include traditional techniques such as cross-linking, co-immunoprecipitation, and co-purification through gradients or chromatographic columns. In addition, protein-protein interactions have been demonstrated by Fields and coworkers [Fiels and Song, Natur.
e (London) 340, 245-246 (1989); Chien et al., Proc. Natl. Acad. Sci. USA 88, 95.
78-9582 (1991)] by using the yeast-based gene system described in Ch.
It can be monitored using the yeast-based system disclosed in evray and Nathans [Proc. Natl. Acad. Sci. USA 89, 5789-5793 (1991)]. Many transcriptional activators, such as yeast GAL4, consist of two physically distinct modular domains, one acting as a DNA binding domain and the other functioning as a transcriptional activation domain. Yeast expression system described in previous literature (generally "2-hybrid system"
Takes advantage of this property and uses two hybrid proteins, one in which the target protein is fused to the DNA binding domain of GAL4 and the other in which the candidate activating protein is fused to the activation domain. is doing. GAL1
Expression of the -lacZ reporter gene under the control of the GAL4-activated promoter depends on the reconstitution of GAL4 activity via protein-protein interactions.
Colonies containing interacting polypeptides are detected with a chromogenic substance for β-galactosidase. Complete kit for identifying protein-protein interactions between two specific proteins using 2-hybrid technology (MATCH
MAKER) is commercially available from Clontech. This system can be extended to the mapping of protein domains involved in a particular protein interaction, as well as the identification of amino acid residues important for this interaction.

Compounds that inhibit the interaction of the PRO polypeptide-encoding genes identified herein with intracellular or extracellular components can be tested as follows: Usually, the reaction mixture is the gene product and extracellular components. Alternatively, the intracellular component is prepared under conditions and for a time when the two products interact and bind. To test the ability of a candidate compound to inhibit binding, the reaction is performed in the absence and presence of the test compound.
In addition, placebo may be added to the third reaction mixture to provide a positive control. The binding (complex formation) of the test compound present in the mixture with intracellular or extracellular components is monitored as described above. The formation of the complex in the control reaction but not in the reaction mixture containing the test compound indicates that the test compound inhibits the interaction of the test compound with its binding partner. To assay an antagonist, a PRO polypeptide may be added with a compound that is screened for a particular activity, and the ability of the compound to inhibit the activity of interest in the presence of the PRO polypeptide is such that the compound is an antagonist of the PRO polypeptide. Indicates that there is. Alternatively, the antagonist may be detected by binding the PRO polypeptide and a potential antagonist with the membrane-bound PRO polypeptide receptor or recombinant receptor under conditions suitable for competitive inhibition assays. PRO polypeptides can be labeled, such as radioactively, and the number of PRO polypeptides bound to the receptor can be used to determine the efficacy of a potential antagonist. The gene encoding the receptor can be identified by many methods known to those of skill in the art, such as ligand panning and FACS sorting. Coligan, etc.,
Current Protocols in Immun., 1 (2): Chapter 5 (1991). Preferably, expression cloning is used, polyadenylated RNA is prepared from cells responsive to PRO polypeptide, and the cDNA library generated from this RNA is distributed into pools, COS cells or other non-PRO polypeptide responsive. Used for transfection of cells. Transfected cells grown on glass slides are exposed to labeled PRO polypeptide. PRO polypeptides can be labeled by a variety of means including iodination or the inclusion of recognition sites for site-specific protein kinases. After fixation and incubation, slides are subjected to autoradiographic analysis. Positive pools are identified and subpools are prepared and retransfected using an interactive subpooling and rescreening step, resulting in the generation of a single clone encoding the putative receptor.

As an alternative method for receptor identification, labeled PRO polypeptide can be photoaffinity-linked with cell membrane or extract preparations that express the receptor molecule. The crosslinked material is dissolved in PAGE and exposed to X-ray film. The labeled complex containing the receptor can be excited, separated into peptide fragments and subjected to protein microsequencing. The amino acid sequence obtained from microsequencing is used to design a set of degradable oligonucleotide probes that screen a cDNA library to identify genes encoding putative receptors. In another assay for antagonists, mammalian cells expressing the receptor or a membrane preparation are incubated with labeled PRO polypeptide in the presence of the candidate compound. The ability of the compound to enhance or block this interaction is then measured. More particular examples of potential antagonists are oligonucleotides that bind to fusions of immunoglobulins and PRO polypeptides, particularly but not limited to polypeptide- and monoclonal antibodies and antibody fragments, single chain antibodies, anti-antibodies. -Idiotypic antibodies, and chimeric or humanized forms of these antibodies or fragments, as well as antibodies, including human antibodies and antibody fragments. Alternatively, the potential antagonist recognizes closely related proteins, eg, receptors, but has no effect, and thus PR
It may be a mutated form of PRO polypeptide that competitively inhibits the action of O polypeptide. Other potential PRO polypeptide antagonists are antisense RNA or DNA constructs prepared using antisense technology, eg, antisense RNA or DNA hybridizes to a target mRNA to interfere with protein translation. This acts to directly block the translation of mRNA. Antisense technology can be used to control gene expression through triple helix formation or antisense DNA or RNA, both of which methods are based on the binding of polypeptide nucleotides to DNA or RNA. For example, the 5'coding portion of the polypeptide nucleotide sequence encoding the mature PRO polypeptide herein is:
It is used to design antisense RNA oligonucleotides of about 10 to 40 base pairs in length. DNA oligonucleotides are designed to be complementary to regions of the gene involved in transcription (Triple Helix-Lee et al., Nucl, Acid Res., 6: 3073.
(1979); Cooney et al., Science, 241: 456 (1988); Dervan et al., Science, 251: 1360.
(1991)), thereby preventing transcription and production of PRO polypeptides. Antisense RNA oligonucleotides hybridize to mRNA in vivo and block translation of mRNA molecules into PRO polypeptides (antisense-Ok
ano, Neurochem., 56: 560 (1991); Oligodeoxynucleotides as Antisense Inhi
bitors of Gene Expression (SRS Press: Boca Raton, FL, 1988)). The oligonucleotides described above can also be delivered to cells to express antisense RNA or DNA in vivo and inhibit the production of PRO polypeptides. If antisense DNA is used, oligodeoxyribonucleotides derived from the translation initiation site, eg, between the -10 and +10 positions of the target gene nucleotide sequence, are preferred.

A potential antagonist is a small molecule that binds to the active site, receptor binding site, or growth factor or other related binding site of a PRO polypeptide, thereby blocking the normal biological activity of the PRO polypeptide. Including. Examples of small molecules include, but are not limited to, small peptides or peptide-like molecules, preferably soluble peptides, and synthetic non-peptide organic or inorganic compounds. Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. Ribozymes act by sequence-specific hybridization to complementary target RNA, followed by endonucleolytic cleavage. Specific ribozyme cleavage sites within potential RNA targets can be identified by known techniques. Further details can be found in, for example, Rossi, Current B
See Biology 4: 469-471 (1994) and PCT publication, number WO 97/33551 (published September 18, 1997). Nucleic acid molecules in triple-helix formation used to inhibit transcription are single-stranded and composed of deoxynucleotides. The basic composition of these oligonucleotides is designed to promote triple helix formation via Hoogsteen base pairing rules,
It generally requires resizable extension of purines or pyrimidines on one strand of the duplex. For further details, see, for example, PCT publication, number WO 97/33551, supra. These small molecules can be identified by any one or more of the screening assays discussed above and / or by any other screening technique well known to those of skill in the art.

F. Anti-PRO Antibody The present invention further provides an anti-PRO antibody. Examples of antibodies include
Included are polyclonal, monoclonal, humanized, bispecific and heteroconjugate antibodies. 1. Polyclonal Antibodies Anti-PRO antibodies include polyclonal antibodies. Methods of preparing polyclonal antibodies are known to those of skill in the art. Polyclonal antibodies in mammals can be generated by one or more injections of, for example, an immunizing agent and, if desired, an adjuvant. Typically, the immunizing agent and / or adjuvant will be injected in the mammal by multiple subcutaneous or intraperitoneal injections. The immunizing agent may include the PRO polypeptide or a fusion protein thereof. It is useful to conjugate the immunizing agent to a protein known to be immunogenic in the immunized mammal. Examples of such immunogenic proteins include, but are not limited to, keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin and soybean trypsin inhibitor. Examples of adjuvants that may be used include Freund's complete adjuvant and MPL-TDM adjuvant (monophosphoryl lipid A, synthetic trehalose dicorynomycolate). The immunization protocol will be selected by one of ordinary skill in the art without undue experimentation.

2. Monoclonal Antibody Alternatively, the anti-PRO antibody may be a monoclonal antibody. Monoclonal antibodies can be prepared using the hybridoma method as described by Kohler and Milstein, Nature, 256: 495 (1975). In the hybridoma method, mice, hamsters or other suitable host animals are typically immunized with an immunizing agent to produce lymphocytes that produce or are capable of producing antibodies that specifically bind to the immunizing agent. Induce. The lymphocytes can also be immunized in vitro. The immunizing agent will typically include the PRO polypeptide of interest or a fusion protein thereof. Generally, when human-derived cells are desired, peripheral blood lymphocytes (“PBL
)) Is used, or if a non-human mammalian source is desired, spleen cells or lymph node cells are used. Then, a lymphocyte is fused with an immortalized cell line using an appropriate fusion agent such as polyethylene glycol to form a hybridoma cell [Goding, Monoclonal Antibodies: Principles and Practice, Academic Pre
ss, (1986) pp. 59-103]. Immortalized cell lines are usually transformed mammalian cells, particularly myeloma cells of rodent, bovine, and human origin. Usually, rat or mouse myeloma cell lines are used. The hybridoma cells are preferably
Cultured in a suitable medium containing one or more substances that inhibit the survival or growth of unfused, immortalized cells. For example, if the parental cell lacks the enzyme hypoxanthine guanine phosphoribosyl transferase (HGPRT or HPRT), the hybridoma's medium typically contains hypoxatin, aminoputilin and thymidine.
HAT medium "), this substance prevents the growth of HGPRT-deficient cells. Preferred immortalized cell lines are those that fuse efficiently, support stable high level expression of antibody by the selected antibody-producing cells, and are sensitive to a medium such as HAT medium. A more preferred immortalized cell line is the mouse myeloma line, which is available, for example, from the Salk Institute Cell Distribution Center in San Diego, Calif. And the American Type Culture Collection in Rockville, Md. Human myeloma and mouse-human heterologous myeloma cell lines for producing human monoclonal antibodies have also been disclosed [Kozbor, J. Immunol., 133: 3001.
(1984), Brodeur et al., Monoclonal Antibody Production Techniques and Applic.
ations, Marcel Dekker, Inc., New York, (1987) pp. 51-63]. The culture medium in which the hybridoma cells are cultured is then assayed for the presence of monoclonal antibodies against PRO. Preferably, the binding specificity of the monoclonal antibody produced by the hybridoma cells is measured by immunoprecipitation or an in vitro binding assay such as radioimmunoassay (RIA) or enzyme-linked immunoassay (ELISA). Such techniques and assays are known in the art. The binding affinity of a monoclonal antibody is, for example, Munson and Pollard, Anal. Biochem.,
It can be measured by the Scatchard analysis method according to 107: 220 (1980). After the desired hybridoma cells have been identified, clones can be subcloned by a limiting dilution step and grown by standard methods [Goding, supra].
Suitable culture media for this purpose include, for example, Dulbecco's Modified Eagle's Medium and RPMI-1640 medium. Alternatively, the hybridoma cells can be grown in vivo as ascites in a mammal. The monoclonal antibody secreted by the subclone is, for example, protein A
-Isolated or purified from culture medium or ascites fluid by conventional immunoglobulin purification methods such as Sepharose method, hydroxylapatite chromatography method, gel electrophoresis method, dialysis method or affinity chromatography. Monoclonal antibodies are also prepared by recombinant DNA methods, such as US Pat. No. 4,816,567.
It can be prepared by the method described in No. The DNA encoding the monoclonal antibody of the present invention can be easily prepared using a conventional method (for example, using an oligonucleotide probe capable of specifically binding to the genes encoding the heavy and light chains of mouse antibody). Can be isolated and sequenced. The hybridoma cells of the invention are a preferred source of such DNA. Once isolated, DNA
Can be placed in an expression vector, which is transfected into a host cell, such as monkey COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not produce immunoglobulin proteins, Monoclonal antibody can be synthesized with. In addition, DNA may be non-immunized with immunoglobulin coding sequences, for example, by substituting coding sequences for human heavy and light chain constant domains in place of homologous mouse sequences [US Pat. No. 4,816,567; Morrison et al., Supra]. It can be modified by covalently linking part or all of the coding sequence for the globulin polypeptide. Such non-immunoglobulin polypeptides can be substituted for the constant domain of the antibodies of the invention or for the variable domain of one of the antigen binding sites of the antibodies of the invention to produce chimeric, bivalent antibodies. The antibody may be a monovalent antibody. Methods for preparing monovalent antibodies are well known in the art. For example, one method involves recombinant expression of immunoglobulin light chain and modified heavy chain. The heavy chain is truncated generally at any point in the Fc region so as to prevent heavy chain crosslinking. Alternatively, the relevant cysteine residue is replaced or deleted with another amino acid residue to prevent cross-linking. In vitro methods are also suitable for preparing monovalent antibodies. Generation of fragments thereof, particularly Fab fragments, by digestion of the antibody can be accomplished using conventional techniques known in the art.

3. Human and Humanized Antibodies The anti-PRO antibodies of the present invention further include humanized antibodies or human antibodies. Humanized forms of non-human (eg, murine) antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (eg, Fv, Fab, Fab ′, F (ab ′) ₂ or other antigen-binding subsequences of antibodies). It contains a minimal sequence derived from non-human immunoglobulin. Humanized antibodies have residues in the complementarity determining region (CDR) of the recipient
Includes human immunoglobulins (recipient antibodies) replaced by residues in the CDRs of a non-human species (donor antibody) with the desired specificity, affinity and potency, such as mouse, rat or rabbit. In some examples, human immunoglobulin Fv framework residues are replaced by corresponding non-human residues. Humanized antibodies may also contain residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. Generally, a humanized antibody has at least one, and typically no, at least one, where all or almost all CDR regions correspond to those of a non-human immunoglobulin and all or almost all FR regions are of human immunoglobulin consensus sequences. Contains substantially all of the two variable domains. A humanized antibody optimally comprises at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin [Jones et al., Nature, 321: 522-525 (
1986); Riechmann et al., Nature, 332: 323-329 (1988); and Presta, Curr. Op Str.
uct. Biol., 2: 593-596 (1992)]. Methods for humanizing non-human antibodies are well known in the art. Generally, a humanized antibody has one or more amino acid residues of non-human origin introduced. These non-human amino acid residues are often referred to as "import" residues, which typically result from an "import" variable domain. Humanization is basically done by replacing the corresponding sequence of the human antibody with a rodent CDR or CDR sequences by winter and coworkers [
Jones et al., Nature, 321: 522-525 (1986); Riechmann et al., Nature, 332: 323-327 (1).
988); Verhoeyen et al., Science, 239: 1534-1536 (1988)] by replacing the rodent CDRs or CDR sequences with the corresponding sequences of human antibodies. Thus, such "humanized" antibodies are chimeric antibodies in which substantially less than the intact human variable domain has been replaced with the corresponding sequence from a non-human species (US Pat.
, 816, 567). In fact, humanized antibodies are typically human antibodies in which some CDR residues and optionally some FR residues have been replaced by residues from similar sites in rodent antibodies. Human antibodies are also available in phage display libraries [Hoogenboom and Winter, J. Mol.
Biol., 227: 381 (1992); Marks et al., J. Mol. Biol., 222: 581 (1991)], and can be prepared using various methods known in the art. The methods of Cole et al. And Boerner et al. Can also be used for the preparation of human monoclonal antibodies [Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss. P. 77 (1
985) and Boerner et al., J. Immunol., 147 (1): 86-95 (1991)]. Similarly, human antibodies can be produced by introducing human immunoglobulin loci into transgenic animals, eg, mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon administration, production of human antibodies is observed that is very similar to that found in humans in all respects, including gene rearrangement, assembly, and antibody repertoire. This approach is described, for example, in US Pat. Nos. 5,545,807;
No. 45,806; No. 5,569,825; No. 5,625,126; No. 5,633,425; No. 5,661,0
16 and the following scientific literature: Marks et al., Bio / Technology 10, 779-783 (1992); Lonb
erg et al., Nature 368 856-859 (1994); Morrison, Nature 368, 812-13 (1994); F
ishwild et al., Nature Biotechnology 14, 845-51 (1996); Neuberger, Nature Bio
technology 14, 826 (1996); Lonberg and Huszar, Intern. Rev. Immunol. 136.
5-93 (1995).

4. Bispecific Antibodies Bispecific antibodies are monoclonal antibodies, preferably human or humanized antibodies, that have binding specificities for at least two different antigens. In the case of the present invention, one of the binding specificities is for PRO, the other one is any other antigen,
Preferred is for cell surface proteins or receptors or receptor subunits. Methods of making bispecific antibodies are well known in the art. Traditionally, recombinant production of bispecific antibodies is based on the co-expression of two immunoglobulin heavy / light chain pairs in which the two heavy chains have different specificities [Milstein and Cuello, Nature,
305: 537-539 (1983)]. Due to the random assortment of immunoglobulin heavy and light chains, these hybridomas (quadromas) produce a potential mixture of 10 different antibody molecules, of which only one has the correct bispecific structure. Purification of the correct molecule is usually accomplished by affinity chromatography steps. A similar procedure is WO 93/08829 published May 13, 1993, and Traunecker et al., EMBO J., 10: 3655-.
3656 (1991). Antibody variable domains with the desired binding specificities (antibody-antigen combining sites) can be fused to immunoglobulin constant domain sequences. The fusion is preferably with an immunoglobulin heavy chain constant domain, comprising at least the hinge region, and portions of the CH2 and CH3 regions. It is preferred to have the first heavy-chain constant region (CH1) containing the site necessary for light-chain binding present in at least one of the fusions. The DNA encoding the immunoglobulin heavy chain fusion, and, if desired, the immunoglobulin light chain, are inserted into separate expression vectors and cotransfected into a suitable host organism. For further details on making bispecific antibodies, see, eg, Suresh et al., Methods in Enzymology, 121: 210 (1986).

According to another method described in WO 96/27011, the interface between a pair of antibody molecules can be manipulated to maximize the proportion of heterodimers recovered from recombinant cell culture. . The preferred interface comprises at least part of the CH3 region of an antibody constant domain. In this method, one or more small amino acid side chains from the interface of the first antibody molecule are replaced with larger side chains (eg tyrosine or tryptophan). Complementary "cavities" of the same or similar size as the large side chains are created at the interface of the second antibody molecule by replacing the large amino acid side chains with smaller ones (eg alanine or threonine). This provides a mechanism to increase the yield of heterodimers relative to unwanted other end products such as homodimers. Bispecific antibodies can be prepared as full length antibodies or antibody fragments (eg F (ab ′) ₂ bispecific antibodies). Techniques for producing bispecific antibodies from antibody fragments have also been described in the literature. For example, chemical coupling can be used to prepare bispecific antibodies. Brennan et al., Science, 229: 81 (1985) describe a procedure for the proteolytic cleavage of intact antibodies to produce F (ab ') ₂ fragments. These fragments are reduced in the presence of the dithiol complexing agent sodium arsenite to stabilize vicinal dithiols and prevent intermolecular disulfide formation. The Fab 'fragments produced are then converted to thionitrobenzoate (TNB) derivatives. One of the Fab'-TNB derivatives is then reconverted to Fab'-thiol by reduction with mercaptoethylamine and mixed with an equimolar amount of another Fab'-TNB derivative to form the bispecific antibody. The produced bispecific antibody can be used as a drug for selective immobilization of an enzyme. The Fab 'fragment can be recovered directly from E. coli, which can be chemically coupled to form bispecific antibodies. Shalaby et al., J. Exp. Med., 175: 217-225.
(1992) describes the preparation of fully humanized bispecific antibody F (ab ') ₂ molecules. Each Fab 'fragment is separately secreted from E. coli and undergoes directed chemical coupling in vitro to form the bispecific antibody. The bispecific antibody thus formed is capable of binding to normal human T cells and cells overexpressing the ErbB2 receptor and induces cytolytic activity of human cytotoxic lymphocytes against human breast tumor targets. Become.

Various methods for making and isolating bispecific antibody fragments directly from recombinant cell culture have also been described. For example, bispecific antibodies have been produced using leucine zippers. Kostelny et al., J. Immunol. 148 (5): 1547-1553 (1992). Leucine zipper peptides from the Fos and Jun proteins are linked by gene fusion to the Fab ′ portions of two different antibodies. The antibody homodimer is reduced at the hinge region to form a monomer and then reoxidized to form the antibody heterodimer. This method can also be used for the production of antibody homodimers. Hollinge
The "diabody" technology described by R et al., Proc. Natl. Acad. Sci. USA, 90: 6444-6448 (1993) provided another mechanism for making bispecific antibody fragments. Fragments consist of a heavy chain variable domain ( _VH ) linked to a light chain variable domain ( _VL ) with a linker short enough to allow pairing between two domains on the same chain. Thus, the V _H and V _L domains of one fragment are forced to pair with the complementary V _L and V _H domains of the other fragment, forming two antigen binding sites. Single chain Fv (s
Other strategies for producing bispecific antibody fragments by the use of Fv) dimers have also been reported. See Gruber et al., J. Immunol. 152: 5368 (1994). Antibodies with more than two valencies are possible. For example, trispecific antibodies can be prepared. Tutt et al. J. Immunol. 147: 60 (1991). Exemplary bispecific antibodies can bind to two different epitopes of the PRO polypeptide provided herein. Alternatively, the arm of the anti-PRO polypeptide is
In order to concentrate the cell defense mechanism on a specific PRO polypeptide-expressing cell,
Trigger molecules on leukocytes such as T cell receptor molecules (eg CD2, CD3, CD28, or B7) or FcγRI (CD64), FcγRII (CD32) and Fc
It may bind to an arm that binds the Fc receptor for IgG (Fc.R) such as γRIII (CD16). Bispecific antibodies can also be used to localize cytotoxic drugs to cells expressing a particular PRO polypeptide. These antibodies are P
RO binding arm and cytotoxic agent or radioactive chelator such as EOTUBE,
It has an arm that binds to DPTA, DOTA, or TETA. Other bispecific antibodies of interest bind to the PRO polypeptide and further bind tissue factor (
TF).

5. Heteroconjugate Antibodies Heteroconjugate antibodies are also within the scope of the present invention. Heteroconjugate antibodies are composed of two covalently joined antibodies. Such antibodies may be used, for example, to target immune system cells to unwanted cells [US Pat. No. 4,676,980] and for the treatment of HIV infection [WO 91/00360; WO 92/200373; EP 03089]. Proposed. It is believed that this antibody can be prepared in vitro using known methods in synthetic protein chemistry, including those associated with cross-linking agents. For example, immunotoxins can be made using a disulfide exchange reaction or by forming a thioether bond. Examples of suitable reagents for this purpose include iminothiolate and methyl-4-mercaptobutyrimidate, and for example US Pat. No. 4,6767,980.
Include those disclosed in the issue. 6. Effector Function Processing It is desirable to modify the antibody of the present invention with respect to effector function, eg to improve the effectiveness of the antibody in treating cancer. For example, cysteine residue (s) may be introduced in the Fc region, thereby allowing interchain disulfide bond formation in this region. The homodimeric antibody thus produced has improved internalization capacity and / or
Or it may have increased complement-mediated cell killing and antibody-dependent cellular cytotoxicity (ADCC). Caron et al., J. Exp. Med. 176: 1191-1195 (1992) and Shopes, BJ I.
See mmunol. 148: 2918-2922 (1992). Allodimeric antibodies with improved anti-tumor activity can also be prepared using heterobifunctional crosslinks as described by Wolff et al., Cancer research 53: 2560-2565 (1993). Alternatively, the antibody can be engineered to have two Fc regions, thereby improving complement lysis and ADCC capabilities. See Stevenson et al., Anti-Cancer Drug Design 3: 219-230 (1989). 7. Immune Conjugates The present invention also relates to chemotherapeutic agents, cytotoxic agents such as toxins (eg, enzymatically active toxins of bacterial, fungal, plant or animal origin, or fragments thereof) or radioisotopes (ie, radioconjugates). It also relates to an immunoconjugate comprising the conjugated antibody. Chemotherapeutic agents useful in the formation of such immune complexes have been described above. Enzymatically active toxins and fragments thereof that can be used are diphtheria A chain, non-binding active fragments of diphtheria toxin, exotoxin A chain (from Pseudomonas aeruginosa), ricin A chain, abrin A chain, modexin.
(modeccin) A chain, alpha-sarcin, Aleurites fo
rdii) protein, dianthin protein, Phytolaca americana protein (PAPI, PAPII, and PAP-S)
, Momordica charantia inhibitor, curcin (
curcin, crotin, sapaonaria ofici
nalis) inhibitor, gelonin, mitogellin, restrictocin, phenomycin, enomycin
n) and trichothecene. Various radionucleotides are available for the production of radioconjugated antibodies. As an example, ²¹² Bi, ¹³¹ I, ¹³¹ I
n, ⁹⁰ Y and ¹⁸⁶ Re. Antibodies and cytotoxic drug conjugates can be conjugated to various bifunctional protein coupling agents such as N-succinimidyl-3- (2-pyridyldithiol) propionate (SPDP), iminothiolane (IT), imidoester bifunctional. Derivatives (dimethyl adipimidate HCL, etc.), active esters (disuccinimidyl suberate, etc.), aldehydes (glutaraldehyde, etc.),
Bis-azide compounds (bis (p-azidobenzoyl) hexanediamine, etc.), bis-
Using diazonium derivatives (bis- (p-diazoniumbenzoyl) -ethylenediamine, etc.), diisocyanates (triene 2,6-diisocyanate, etc.), and bis-active fluorine compounds (1,5-difluoro-2,4-dinitrobenzene, etc.) Can be created. For example, a ricin immunotoxin can be prepared as described in Vitetta et al., Science 238: 1098 (1987). Carbon-14-labeled 1-isothiocyanatobenzyl-3-methyldiethylenetriaminepentaacetic acid (MX-DTPA) is an example of a chelating agent for conjugation of radionucleotide to the antibody. WO 94/11026
reference. In other embodiments, the antibody may be conjugated to a "receptor" (such as streptavidin) for use in tumor pre-targeting, and the antibody-receptor complex is administered to the patient, followed by a clarifier. It is used to remove unbound complex from the circulation and then administer a "ligand" (such as avidin) conjugated to a cytotoxic drug (such as a radionucleotide).

8. Immunoliposomes The antibodies disclosed herein may also be prepared as immunoliposomes. Liposomes containing antibodies are described by Epstein et al., Proc. Natl. Acad. Sci. USA, 82: 3688 (1985).
Hwang et al., Proc. Natl. Acad. Sci. USA, 77: 4030 (1980); and U.S. Pat.
Prepared by methods known in the art, such as those described in 485,045 and 4,544,545. Liposomes with improved circulation time are disclosed in US Pat. No. 5,013,556. Particularly useful liposomes are phosphatidylcholine, cholesterol and PEG.
-Produced by the reverse phase evaporation method with a lipid composition containing derivatized phosphatidylethanolamine (PEG-PE). The liposomes are extruded through a filter of a given size to produce liposomes with the desired size. Fab of the antibody of the present invention
The'fragment can be conjugated to liposomes via a disulfide exchange reaction as described by Martin et al., J. Biol. Chem. 257: 286-288 (1982). Chemotherapy (
Doxorubicin, etc.) is optionally contained within the liposome. See Gabizon et al., J. National Cancer Inst. 81 (19) 1484 (1989).

9. Pharmaceutical Compositions of Antibodies Antibodies that specifically bind to the PRO polypeptides identified herein, as well as other molecules identified in the screening assays disclosed above, may be used in pharmaceutical compositions to treat various diseases. It can be administered in the form. When the PRO polypeptide is intracellular and whole antibodies are used as inhibitors,
Internalized antibodies are preferred. However, lipofections or liposomes can also be used to introduce the antibody, or antibody fragment, into cells. When antibody fragments are used, the smallest inhibitory fragment that specifically binds to the binding domain of the target protein is preferred. For example,
Based on the variable region sequences of antibodies, peptide molecules can be designed that retain the ability to bind to target protein sequences. Such peptides can be chemically synthesized or can be produced by recombinant DNA technology. For example, Marasco et al., Proc. Natl. Acad. S
See ci. USA 90, 7889-7893 (1993). The formulation herein comprises one or more active compounds as necessary for the particular indication being treated,
Those having complementary activities that preferably do not adversely affect each other may also be included. Alternatively, or in addition, the composition may include a cytotoxic drug, cytokine or growth inhibitor. These molecules are suitably present in combination in amounts that are effective for the purpose intended. Also, the active ingredient may be incorporated into a colloidal drug delivery system (eg , Liposomes, albumin globules, microemulsions, nanoparticles and nanocapsules) or microemulsions. These techniques are disclosed in Remington's Pharmaceutical Science, supra. The formulations used for in vivo administration must be sterile. This is easily accomplished by filtration through a sterile filtration membrane. Sustained-release preparations may be prepared. Suitable examples of sustained release formulations include semipermeable matrices of solid hydrophobic polymers containing the antibody, which matrices are shaped articles,
For example, in the form of a film or microcapsules. Examples of sustained release matrices are polyester hydrogels (eg poly (2-hydroxyethyl-methacrylate) or poly (vinyl alcohol)), polyactides (US Pat. No. 3,773,919).
L-glutamic acid and γ-ethyl-L-glutamate, non-degradable ethylene-vinyl acetate, LUPRON DEPOT (trade name) (injectable globules of lactic acid-glycolic acid copolymer and leuprolide acetate) Acid Copolymer, Poly- (D)
Contains 3-hydroxybutyric acid. While polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid enable release of molecules for over 100 days, certain hydrogels release proteins for shorter time periods. When the encapsulated antibodies remain in the body for a long time, they are denatured or aggregated by exposure to water at 37 ° C, resulting in reduced biological activity and possible altered immunogenicity. . Rational methods can be devised for stabilization depending on the mechanism involved. For example, if the aggregation mechanism was found to be intermolecular SS bond formation through thio-disulfide exchange, stabilization could be modification of sulfhydryl residues, lyophilization from acidic solution, control of water content, appropriate Can be achieved by the addition of various additives and the development of specific polymer matrix compositions.

G. Uses of anti-PRO antibody The anti-PRO antibody of the present invention has various utilities. For example, anti-PRO antibodies are used in diagnostic assays for PRO, eg, detecting its expression in specific cells, tissues, or serum. Competitive binding assays, direct or indirect sandwich assays and heterogeneous or homogeneous phase immunoprecipitation assays [Zola, Monoclonal Antibodie
s: A Manual of Techniques, CRC Press, Inc. (1987) pp. 147-158], and various diagnostic assay techniques known in the art are used. The antibody used in the diagnostic assay is labeled with a detectable moiety. Detectable site, directly or indirectly,
It must produce a detectable signal. For example, the detectable moiety may be a radioisotope such as ³ H, ¹⁴ C, ³² P, ³⁵ S or ¹²⁵ I, a fluorescent or chemiluminescent compound such as fluorescein isothiocyanate, rhodamine or luciferin,
Alternatively it may be an enzyme such as alkaline phosphatase, beta-galactosidase or horseradish peroxidase. Any method known in the art for conjugating a detectable site to an antibody can be used, including Hunter et al. Nature, 1
44: 945 (1962); David et al., Biochemistry, 13: 1014 (1974); Pain et al., J. Immuno.
l. Meth., 40: 219 (1981); and Nygren, J. Histochem. and Cytochem., 30: 407.
The method described in (1982) is included. Anti-PRO antibodies are also useful for affinity purification of PRO from recombinant cell culture or natural sources. In this method, antibodies to PRO are immobilized on a suitable support such as Sephadex resin or filter paper using methods well known in the art. Next, after contacting the immobilized antibody with a sample containing PRO to be purified, a support is used with a suitable solvent that removes substantially all substances in the sample other than PRO bound to the immobilized antibody. To wash. Finally, the support is washed with another suitable solvent that will release PRO from the antibody. The following examples are provided for illustrative purposes only and are not intended to limit the scope of the invention in any way. The entirety of all patents and references cited herein are hereby incorporated by reference.

EXAMPLES All commercial reagents referred to in the examples were used according to manufacturer's instructions unless otherwise indicated. The source of cells identified by the ATCC Registry Number throughout the examples and throughout the specification is American Type Culture Collection, Manassas, VA. Example 1: Extracellular domain homology screen to identify novel polypeptides and cDNAs encoding them Extracellular domain (ECD) sequences from approximately 950 known secreted proteins from the Swiss-Prot public database ( The secretory signal sequence, if any) was used to search the EST database. EST databases include public databases (eg Dayhoff, GenBank) and corporate databases (eg LIFESEQ (trade name), I
ncyte Pharmaceuticals, Palo Alto, CA). The search is performed by the computer program BLAST or BLAST-2 (Altschul et al., Methods in Enzymology 266: 460-480 (19
96)) was used as a comparison with the 6-frame translation of the EST sequence of the ECD protein sequence. Comparables that do not encode a known protein and have a BLAST score of 70 (sometimes 90) or higher can be found in the program “phrap” (Phil Green, U.
Niversity of Washington, Seattle, WA) and assembled into a consensus DNA sequence. This extracellular domain homology screen was used to construct consensus DNA sequences against other identified EST sequences using phrap. Furthermore, the consensus DNA sequences obtained are often (but not always) BLAST or BLAST-2 and
Elongated using repeated cycles of phrap and consensus sequences discussed above E
The ST sequence source was used to extend as much as possible. Based on the consensus sequence obtained as described above, oligonucleotides are then synthesized, and PCR is used to identify a cDNA library containing the sequence of interest and a clone of the full-length coding sequence for the PRO polypeptide is isolated. Used as a probe. Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give PCR products of about 100-1000 bp in length. The probe sequence is typically 40-55b
It is p-long. In some cases, additional oligonucleotides are synthesized when the consensus sequence is greater than about 1-1.5 kbp. To screen several libraries for full-length clones, DNA from the libraries was added to Ausube
Screening by PCR with PCR primer pairs as in I. et al., Current Protocols in Molecular Biology. The positive library was then used to isolate clones encoding the gene of interest using one of the probe oligonucleotides and the primer pair. The cDNA library used for the isolation of the cDNA clone is Invitrogen, San Di
Prepared by standard methods using commercially available reagents such as those from ego, CA. cd
NA was primed with an oligo dT containing a NotI site, blunt-ended with a SalI hemikinase adapter, cut with NotI, roughly sized by gel electrophoresis, and a suitable cloning vector (such as pRK5B or pRK5D; pRK5B is a precursor of pRK5D that does not contain an SfiI site; Holmes et al.,
Science, 253: 1278-1280 (1991)) at the unique XhoI and NotI sites.

Example 2: Isolation of cDNA clones by amylase screening 1. Preparation of oligo dT primed cDNA library mRNA was isolated from human tissues of interest using reagents and protocols from Invitrogen, San Diego, CA (Fast Track 2). This RNA is called Life Techn
oligo dT primed cDNA in vector pRK5D using reagents and protocols from Strategy, Gaithersburg, MD (Super Script Plasmid System)
Used to generate A. In this method, the double-stranded cDNA was size-classified to over 1000 bp and the SalI / NotI binding cDNA was cloned into the XhoI / NotI cut vector. pRK5D is sp6 transcription start site followed by S
It was cloned into a vector having a fiI restriction enzyme site and an XhoI / NotI cDNA cloning site. 2. Preparation of Random Primed cDNA Library A secondary cDNA library was created to preferably represent the 5'end of the primary cDNA clone. Sp6 RNA was generated from the primary library (described above) and this RNA was used as the vector pSST-AMY. It was used to generate a random primed cDNA library using reagents and protocols from Life Technologies at 0 (Super Script Plasmid System referenced above). In this method, double-stranded cDNA was sized to 500-1000 bp, blunt-ended with a NotI adapter, cut at the SfiI site, and cloned into a SfiI / NotI cut vector. pSST-AMY. 0 is a cloning vector that has a yeast alcohol dehydrogenase promoter in front of the cDNA cloning site and a mouse amylase sequence (mature sequence without a secretory signal) followed by the yeast alcohol dehydrogenase transcription terminator after the cloning site. That is,
CDNA cloned into this vector fused in frame with an amylase sequence
A will lead to the secretion of amylase from appropriately transfected yeast colonies. 3. Transformation and Detection DNA from the library described in paragraph 2 above was chilled on ice and electrocompetent DH10B bacteria (Life Technoligies, 20 ml) were added. The mixture of bacteria and vector was then electroporated as recommended by the manufacturer. SOC medium (Life Technplogies, 1 ml) was then added and the mixture was incubated at 37 ° C for 30 minutes. The transformants were then plated on 20 standard 150 mm LB plates containing ampicillin and incubated for 16 hours (37 ° C). Positive colonies were discarded from the plate and DNA was isolated from the bacterial pellet using standard methods, eg CsCl-gradient. The purified DNA was then loaded into the following yeast protocol. Yeast methods can be divided into three categories: (1) transformation of yeast with plasmid / cDNA binding vectors; (2) detection and isolation of amylase secreting yeast clones; and (3) direct from yeast colonies. PCR amplification of inserts and DNA purification for sequencing and further analysis.

The yeast strain used was HD56-5A (ATCC-90785). This strain has the following genotypes: MAT alpha, ura3-52, leu2-3, leu2-112, h
It has is3-11, his3-15, MAL ⁺ , SUC ⁺ , and GAL ⁺ . Preferably, a yeast mutant having an incomplete post-translational pathway can be used. Such mutants have translocation-deficient alleles at sec71, sec72, and sec62, with truncated sec71 being most preferred. Alternatively, antagonists (including antisense nucleotides and / or ligands) that inhibit the normal manipulation of these genes, other proteins involved in this post-translational pathway (eg, SEC61p, S
EC72p, SEC62p, SEC63p, TDJ1p or SSA1p-4p)
Alternatively, complex formation of these proteins is also preferably used in combination with the amylase-expressing yeast. Transformation was performed based on the protocol outlined in Gietz et al., Nucl. Acid. Res., 20: 1425 (1992). Transformed cells are then agar to YEPD
Seed in complex medium broth (100 ml) and grow overnight at 30 ° C. YEPD Broth, Kaiser et al., Methods in Yeast Genetics, Cold Spring Harbor Press, C
Prepared as described in old Spring Harbor, NY, p. 207 (1994). The overnight medium was then diluted to approximately 2x10 ⁶ cells / ml (approximately OD ₆₀₀ = 0.1) in fresh YEPD broth (500 ml) and 1x10 ⁷ cells / ml (approximately OD _{60 0} = 0.4-0. It was regrown until 5). The cells are then harvested, transferred to a GS3 rotor bottle in a Sorval GS3 rotor for 5 minutes at 5,000 rpm, prepared for transformation by discarding the supernatant and then resuspending in sterile water, and in a 50 ml Falcon tube. And re-centrifuged at 3,500 rpm in a Beckman GS-6KR centrifuge. Discard the supernatant and transfer the cells to LiAc / TE (10 ml
, 10 mM Tris-HCl, 1 mM EDTA pH 7.5, 100 mM Li ₂ OOCCH ₃ ) followed by a wash and resuspended in LiAc / TE (2.5 ml). For the transformation, the prepared cells (100 μl) were transferred to fresh denatured single-stranded salmon sperm DNA (Lofstrand Labs, Gaitherburg, MD) and transformed DNA in a microtube.
It was caused by mixing with (1 μg vol. <10 μl). The mixture was vortexed briefly and then 40% PEG / TE (600 μl, 40% polyethylene glycol-4000, 10 mM Tris-HCl, 1 mM EDTA, 100 mM Li ₂ OOCCH ₃ , pH 7.5) was added. The mixture was gently agitated and incubated at 30 ° C. with agitation for 30 minutes. The cells are then heat shocked at 42 ° C for 15 minutes, the reaction vessel is centrifuged in a microtube at 12,000 rpm for 5-10 seconds, decanted and TE (500 μl, 10 mM Tris-HCl, 1 mM EDTA pH 7.5). Was resuspended and then centrifuged. The cells were then diluted in TE (1 ml) and aliquots (200 μl) were spread on 150 mm growth plates (VWR) in pre-prepared selective medium. Alternatively, the transformations were performed in one large reaction rather than multiple small reactions, but the amount of reagents was scaled up accordingly. The selection medium used was Kaiser et al., Methods in Yeast Genetics, Cold Spring Har.
Uracil-free synthetic complete dextrose agar (SCD-Ura) prepared as described in Bor Press, Cold Spring Harbor, NY, p. 208-210 (1994). Transformants were grown at 30 ° C for 2-3 days. Detection of colonies secreting amylase was performed by the inclusion of red starch in the selective growth medium. Starch was coupled to a red dye (reactive Red-120, Sigma) according to the method described by Biely et al., Anal. Biochem., 172: 176-179 (1988). Bound starch on SCD-Ura agar plates to a final concentration of 0.15% (w / v)
And buffered to pH 7.0 with potassium phosphate (final concentration 50-100 mM). Positive colonies were picked and streaked on fresh selection medium (150 mm plate) to give well isolated and identifiable single colonies. Well-isolated colonies positive for amylase secretion were detected by direct introduction of the red dye group into buffered SCD-Ura agar. Positive colonies were determined by their ability to degrade starch and form visible halos directly around the positive colonies.

[0456] 4. Isolation of DNA by PCR Amplification When positive colonies were isolated, a portion was picked with a toothpick and diluted in sterile water (30 μl) in a 96-well plate. At this point, positive colonies are either frozen and either stored for subsequent analysis or immediately amplified.
Aliquots of cells (5 μl) into 0.5 μl of Klentaq (Clontech, Palo Alto, CA);
4.0 μl 10 mM dNTP (Perkin Elmer-Cetus); 2.5 μl Kentaq buffer (Clonte
ch); 0.25 μl forward oligo 1; 0.25 μl reverse oligo 2; used as template for PCR reaction in a 25 μl volume containing 12.5 μl distilled water. The sequence of the forward oligonucleotide 1 was: 5'-TGTAAAACGACGGCCAGT TAAATAGACCTGCAATTATTAATCT -3 '(SEQ ID NO: 1). The sequence of the reverse oligonucleotide 2 was: 5'- CAGGAAACAGCTATGACC ACCTGCACACCTGCAAATCCATT -3 '(SEQ ID NO: 2). PCR was then performed as follows: a. Denaturation 92 ° C, 5 minutes b. Next 3 cycles: Denaturation 92 ° C, 30 seconds Annealing 59 ° C, 30 seconds Extension 72 ° C, 60 seconds c. Next 3 cycles: Denaturation 92 ° C, 30 seconds Anneal 57 ° C, 30 seconds Extension 72 ° C, 60 seconds d. Next 25 cycles: denaturation 92 ° C, 30 seconds Anneal 55 ° C, 30 seconds Extension 72 ° C, 60 seconds e. The regions underlined at 4 ° C. are annealed to the ADH promoter region and the amylase region, respectively, and the vector pSST-AMY. Amplify the 307 bp region from 0. Typically, the first 18 nucleotides at the 5'end of these oligonucleotides contained the sequence primer annealing site. That is, the total product of the PCR reaction from the empty vector was 343 bp. However, the signal sequence fusion cDNA resulted in a rather long nucleotide sequence. Following PCR, an aliquot (5 μl) of the reaction was tested by agarose gel electrophoresis using a Tris-borate-EDTA (TBE) buffer system in a 1% agarose gel as described by Sambrook et al., Supra. . Clones yielding single, strong PCR products larger than 400 bp were cloned into a 96 Qiaquick PCR clean column (Qiagen Inc).
, Chatsworth, CA) and further analyzed by DNA sequence.

Example 3: Isolation of cDNA Clones Using Signal Algorithm Analysis Various polypeptide-encoding nucleic acid sequences are described in Genentech, Inc. (South San
The proprietary sequence-finding algorithms developed by Francisco, CA) are publicly (eg, GenBank) and / or private (LIFESEQ®, Incyte Pharmaceuticals
, Inc., Palo Alto, CA) database and identified by applying to the assembled and assembled EST fragments. The signal sequence algorithm calculates a secretory signal score based on the letters of the DNA nucleotides surrounding the first, and optionally the second, methionine codon (ATG) at the 5'-end of the sequence or sequence fragment under consideration. The nucleotides following the first ATG must encode at least 35 unambiguous amino acids with no stop codon.
If the first ATG has the required amino acids, the second is not tested. If neither met the requirements, the candidate sequences were not scored. In order to determine whether the EST sequence contains an authentic signal sequence, the DNA surrounding the ATG codon and the corresponding amino acid sequence were analyzed using a set of seven sensors (evaluation parameters) known to be associated with the secretory signal. Used to score. The use of this algorithm has led to the identification of many polypeptide-encoding nucleic acid sequences. Example 4: Isolation of a cDNA clone encoding human PRO1560 As described in Example 1 above, consensus DNA sequences were assembled using phrap with other ESTs. This consensus sequence is now DNA1740
Name it 9. Based on the DNA17409 consensus sequence, 1) to identify a cDNA library containing the sequence of interest by PCR, and 2) PRO1.
Oligonucleotides were synthesized for use as probes to isolate clones of the 560 full length coding sequence. By DNA sequencing of the clones isolated as described above, DNA19902-
The full length DNA sequence of 1669 (Fig1, SEQ ID NO: 3) and the derived protein sequence of PRO1560 were obtained. The entire coding sequence of DNA19902-1669 is shown in Figure 1 (SEQ ID NO: 3). Clone DNA19902-1669 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 41-43 and ending at the apparent stop codon at nucleotide positions 776-778. The predicted polypeptide precursor is 245 amino acids long. The signal peptide, transmembrane domain, N-glycosylation site, N-myristoylation site, tyrosine kinase phosphorylation site, and membrane lipoprotein lipid attachment site are also shown in Figure 2. Clone DNA19902-1669 has been deposited with the ATCC, ATCC Deposit No. 203
454 was awarded. The full-length PRO1560 protein shown in Fig2 is about 27.
, 563 Daltons and a pI of about 8.36. The Dayhoff database (version 35.45) using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in Fig2 (SEQ ID NO: 4).
SwissProt 35) analysis of the PRO1560 amino acid sequence and the following Dayhoff sequences: AF053453_1, AF053454_1, A15_HUMAN, AF054840_1, CD63_HUMAN, AF065389_.
Sequence identity between 1, AF054838_1, AF089749_1, P_R27525 and P_R86834 was revealed.

Example 5: Isolation of a cDNA clone encoding human PRO444 The cDNA sequence isolated in the amylase screen was named DNA13121, as described in Example 2 above. A probe was created based on this sequence and used to screen a human fetal lung library (LIB25) prepared as described in paragraph 1 of Example 2 above. The cloning vector is pRK5B (pRK5B is a precursor of pRK5D that does not contain an SfiI site; see Holmes et al., Science, 253: 1278-1280 (1991)) and cleaved c
The DNA size was less than 2800 bp. A full-length clone was identified that contains a single open reading frame, has an apparent translational initiation site at nucleotide positions 608-610, and terminates at the stop codon at nucleotide positions 959-961 (Fig3; SEQ ID NO: 5).
). The predicted polypeptide precursor is 117 amino acids long and contains approximately 12,692 amino acids.
With a calculated molecular weight of and an estimated pI of about 7.50. Analysis of the full-length PRO444 sequence shown in Figure 4 (SEQ ID NO: 6) demonstrated the presence of a signal peptide from amino acid 1 to about amino acid 16. Analysis of the Dayhoff database (version 35.45 SwissProt 35) demonstrated homology between the PRO444 amino acid sequence and the following Dayhoff sequences: CEF44D12_8, P_R88452, YNE1_CAEEL, A47312, AF009957_1, and A_06133_1. Clone DNA26846-1397
Was deposited with the ATCC on October 27, 1998, ATCC deposit no.
Number 6 was added.

Example 6: Isolation of a cDNA clone encoding human PRO1018 A cDNA clone encoding a native human PRO1018 polypeptide (DNA
56107-1415) was identified using a yeast screen in a human ovarian tumor cDNA library that predominates at the 5'end of the primary cDNA clone. The yeast screen used was a single E, designated herein as DNA41000.
ST clones were identified. The DNA41000 sequence is then transferred to public EST databases (eg GenBank) and corporate EST databases (LIFESEQ (trade name), In
Homologous EST sequences were identified by comparison with various EST databases, including Cyte Pharmaceuticals, Palo Alto, CA). Comparison is the computer program BLAST
Alternatively, it was performed using BLAST2 [Altschul et al., Methods in Enzymology 266: 460-480 (1996)]. Comparables that do not encode a known protein and have a BLAST score of 70 (sometimes 90) or higher can be found in the program "phrap" (Phil Green, Uni
versity of Washington, Seattle, Washington)
The A sequence was constructed. This consensus sequence is designated herein as DNA44449. Oligonucleotide primers based on the DNA44449 sequence were then synthesized and screened for a human ovarian tumor cDNA library to show D5 in Figure 5.
The NA56107-1415 clone was identified. The full-length DNA56107-1415 clone shown in Fig5 contains a single open reading frame, has an apparent translational initiation site at nucleotide positions 129-131, and ends at the stop codon at nucleotide positions 696-698 (Fig5). The predicted polypeptide precursor is 189 amino acids long (F
ig6). Analysis of the full-length PRO1018 sequence shown in Figure 6 (SEQ ID NO: 8) demonstrated the presence of the following: a signal peptide from about amino acids 1 to 24, about amino acids 86 to 103 and about amino acids 60 to about amino acids 7.
An amino acid sequence block having homology to the transmembrane domain of 5 and a G-protein coupled receptor protein from about amino acid 44 to about amino acid 84. Clone DN
A56107-1415 was deposited with the ATCC on October 27, 1998
CC deposit number 203405 has been assigned. The Dayhoff database (version 35.45 SwissPro) using WU-BLAST-2 sequence alignment analysis of the full length sequence shown in FIG. 6 (SEQ ID NO: 8).
t35), the PRO1018 amino acid sequence and the following Dayhoff sequence: CEB03
Significant homology was demonstrated between 99_4, S59764, YHDT_HAEIN and AE000675_3. Example 7: Isolation of a cDNA clone encoding human PRO1773 Consensus DNA sequences were assembled for other ESTs using phrap as described in Example 1 above. This consensus sequence is now DNA4979
Name it 7. DNA49797 consensus sequence and Incyte EST clone 5
Based on the observed homology with the EST sequences contained within 09434, Incy
te EST clone 509434 was purchased and its insert was obtained and sequenced. The sequence is shown here in Figure 7 and is designated as DNA56406-1704. The entire nucleotide sequence of DNA56406-1704 is shown in Figure 7 (SEQ ID NO: 9).
). Clone DNA56406-1704 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 111-113, and ending at the apparent stop codon at nucleotide positions 1068-1070 (Fig7). The predicted polypeptide precursor is 319 amino acids long (
Fig8). The full-length PRO1773 protein shown in FIG. 8 is about 35,227.
It has an estimated molecular weight of Daltons and a pI of about 8.97. Fig8 (SEQ ID NO: 1
Analysis of the full-length PRO1773 shown in 0) demonstrates the presence of:
A signal peptide of about amino acids 1 to about amino acids 17, a transmembrane domain of about amino acids 136 to about amino acids 152, about amino acids 161 to about amino acids 164, about amino acids 187 to about amino acids 190 and about amino acids 253 to about amino acids 25.
6 potential N-glycosylation sites, about amino acid 39 to about amino acid 42 glycosaminoglycan attachment sites and about amino acid 36 to about amino acid 41, about amino acid 42 to about amino acid 47, about amino acid 108 to about amino acid 113, Potential N-myristoylation sites from about amino acids 166 to about amino acids 171, about amino acids 198 to about amino acids 203, and about amino acids 207 to about amino acids 212.
Clone DNA56406-1704 was deposited with the ATCC on November 17, 1998 and was assigned ATCC deposit no. 203478. The Dayhoff database (version 35.4) using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. 8 (SEQ ID NO: 10).
5 SwissProt 35), the amino acid sequence of PRO1773 and the following Dayhof
f array: ROH2_RAT, ROH3_RAT, AF030513_1, ROH1_RAT, AF056194_1, AF057034_1,
Significant homology was demonstrated between P_W18337, P_W18328, BDH_HUMAN and BDH_RAT.

Example 8: Isolation of a cDNA clone encoding human PRO1477 As described in Example 1 above, conrap was used to assemble consensus DNA sequences against other EST sequences. This consensus sequence is now DNA52
It is named 641. 1) PCR based on the DNA52641 consensus sequence
To identify a cDNA library containing the sequence of interest, and 2) PR
Oligonucleotides were synthesized for use as probes to isolate clones of the O240 full-length coding sequence. PCR primers (forward and reverse) were synthesized: Forward PCR primer 5'-CGCCAGAAGGGCGTGATTGACGTC-3 '(SEQ ID NO: 13) Reverse PCR primer 5'-CCATCCTTCTTCCCAGACAGGCCG-3' (SEQ ID NO: 14) Furthermore, synthetic oligonucleotide The hybridization probe was made from the DNA52641 sequence having the following nucleotide sequence: Hybridization probe 5'-GAAGCCTGTGTCCAGGTCCTTCAGTGAGTGGTTTGGCCTCGGTC-3 '(SEQ ID NO: 15) To screen several libraries for a source of full length clones, DNA from the libraries was PCR amplified with the PCR primer pair identified above. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate clones encoding the PRO240 gene with one of the primer pairs. RNA for making a cDNA library was isolated from human fetal liver tissue. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO1477 (herein designated as DNA56529-1647 [Fig9, SEQ ID NO: 11]); and the derived protein sequence for PRO1477. The entire nucleotide sequence of DNA56529-1647 is shown in FIG.
It is shown in 1). Clone DNA56529-1647 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 23-25, and ending at the apparent stop codon at nucleotide positions 2120-2122 (Fig9). The predicted polypeptide precursor is 699 amino acids long (F
ig10). The full-length PRO240 protein shown in FIG. 10 is about 79,553.
It has an estimated molecular weight of Daltons and a pI of approximately 7.83. Fig10 (SEQ ID NO:
Analysis of the full-length PRO1477 shown in 12) demonstrates the presence of: about amino acid 21 to about amino acid 40 and about amino acid 84 to about amino acid 105.
Is a transmembrane domain of. Clone DNA56529-1647 is 1998 9
It was deposited with the ATCC on 29th March and was assigned ATCC deposit no. 203293. The Dayhoff database (version 35) using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. 10 (SEQ ID NO: 12).
.45 SwissProt 35), and the amino acid sequence of PRO1477 and the following Dayh
off array: CELT03G11_1, CEZC410_4, A54408, SSMAN9MAN_1, GEN12643, GEN12642
, AF027156_1, P_W46900, SPAC23A1_4 and DMC86E4_5 were proved to have significant homology.

Example 9: Isolation of a cDNA clone encoding human PRO1478 As described in Example 1 above, phrap was used to assemble consensus DNA sequences for other ESTs. This consensus sequence is now referred to as "DNA527
19 ”. 1) PCR based on the DNA52719 consensus sequence
To identify a cDNA library containing the sequence of interest, and 2) PR
Oligonucleotides were synthesized for use as probes to isolate clones of the O1478 full length coding sequence. PCR primers (forward and reverse) were synthesized: Forward PCR primer 5'GCGAACGCTTCGAGGAGTCCTGG3 '(SEQ ID NO: 18) Reverse PCR primer 5'GCAGTGCGGGAAGCCACATGGTAC3' (SEQ ID NO: 19) Furthermore, the synthetic oligonucleotide hybridization probe was as follows: Was prepared from the DNA52719 sequence having the nucleotide sequence of Hybridization probe 5'CTTCCTGAGCAGGAAGAAGATCCGGCACCACATCTACGTGCTCAAC3 '(SEQ ID NO: 20) To screen several libraries for a source of full length clones, DNA from the libraries was PCR amplified with the PCR primer pair identified above. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate clones encoding the PRO1478 gene with one of the primer pairs. RNA for making a cDNA library was isolated from human fetal liver tissue. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence of PRO1478 and the derived protein sequence of PRO1478. The entire coding sequence of PRO1478 is shown in Figure 11 (SEQ ID NO: 16). Clone DNA56531-1648 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 77-79 of SEQ ID NO: 16, and ending at the apparent stop codon at nucleotide positions 1058-1060. The predicted polypeptide precursor is 327 amino acids long. The type II transmembrane sequence is believed to be at about amino acids 29-49 of SEQ ID NO: 17, and the N-glycosylation site is believed to be at about amino acids 154-157 of SEQ ID NO: 17. Clone DNA56531-1648 has been deposited with the ATCC and is assigned ATCC deposit no. 203.
286 was awarded. The full-length PRO1478 protein shown in FIG.
It has an estimated molecular weight of 7,406 daltons and a pI of approximately 9.3. The Dayhoff database (version 35) using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. 12 (SEQ ID NO: 17).
.45 SwissProt 35) analysis revealed that the amino acid sequence of PRO1478 and the following Dayh
off array: YNJ4_CAEEL, P_R55706, A38781_1, NALS_MOUSE, HUMHGT_1, AF048687_
Sequence identity between 1, CEWO2B12_11, YO9F_MYCTU, FOJO_DROME, and GO1936 was revealed.

Example 10: Isolation of a cDNA clone encoding human PRO831 D applying the corporate signal sequence discovery algorithm described in Example 3 above.
NA56862-1343 was identified. Incyte EST cluster number 2550 from the Incyte database using the signal sequence algorithm described above.
It has made possible the identification of the EST cluster sequence named 7. Then this EST
Cluster sequences are available in public databases (eg GenBank) and independently developed EST DNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo).
Existing homology was identified by comparison with various expressed sequence tag (EST) databases, including Alto, CA). The homology search is performed by the computer program BLAST or BLAST.
2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparables that do not encode a known protein and have a BLAST score of 70 (sometimes 90) or higher are those that have the program "phrap" (Phil Green, University of
Washington) to build a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated DNA55714. In view of the observed sequence homology between the DNA55714 sequence and the EST sequence contained in Merck's EST clone number AA099445, MerckEST
Clone number AA099445 was purchased and the cDNA insert was obtained and sequenced.
The sequence of this cDNA insert is shown in Figure 13, where DNA56862-13
Name it 43. Clone DNA56862-1343 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 40-42 and ending at the stop codon at nucleotide positions 259-261 (Fig 13). The predicted polypeptide precursor is 73 amino acids long (Figure 14). The full-length PRO831 protein shown in FIG. 14 has an estimated molecular weight of about 7,879 and about 7.21.
Has a pI of Analysis of the full-length PRO831 sequence shown in Figure 14 (SEQ ID NO: 22) revealed the presence of the following: about amino acid 1 to about amino acid 15
Is an amino acid sequence block having homology with the signal peptide of and the growth factor and cytokine receptor family proteins of about amino acid 3 to about amino acid 18. Clone DNA56862-1343 was added to ATCC on September 1, 1998.
And has been assigned ATCC deposit no. 203174. The Dayhoff database (version 35.45 Swis using the WU-BLAST-2 sequence alignment analysis of the full length sequence shown in FIG. 14 (SEQ ID NO: 22)).
sProt 35) analysis revealed that the PRO831 amino acid sequence and the following Dayhoff sequence: P_W
30724, HUMPPA_1, AF022238_1, 4HHB_C, P_R39727, P_R39728, TRYT_MERUN, GRP
Significant homology was demonstrated between 5_HUMAN, AB010266_3 and HSBCL3S2_1.

Example 11: Isolation of a cDNA clone encoding human PRO1113 As described in Example 1 above, conrap was used to assemble consensus DNA sequences for other ESTs. This consensus sequence is now referred to as "DNA340
25 ”. 1) PCR based on the DNA34025 consensus sequence
To identify a cDNA library containing the sequence of interest, and 2) PR
Oligonucleotides were synthesized for use as probes to isolate clones of the full-length coding sequence of O1113. PCR primers (forward and reverse) were synthesized: Forward PCR primer 5'GAGGACTCACCAATCTGGTTCGGC3 '(SEQ ID NO: 25);
And reverse PCR primer 5 ′ AACTGGAAAGGAAGGCTGTCTCCC3 ′ (SEQ ID NO: 26) Further, a synthetic oligonucleotide hybridization probe was prepared from the consensus DNA34025 sequence having the following nucleotide sequence. Hybridization probe 5'GTAAAGGAGAAGAACATCACGGTACGGGATACCAGGTGTGTTTATCCTAA3 '(SEQ ID NO: 27) To screen several libraries for a source of full length clones, DNA from the libraries was PCR amplified with the PCR primer pair identified above. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate a clone encoding the PRO1113 gene with one of the primer pairs. RNA for making a cDNA library was isolated from human fetal kidney. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO1113 (designated herein as DNA57254-1477 [Fig15, SEQ ID NO: 23]); and the derived protein sequence for PRO1113. The entire coding sequence of PRO1113 is shown in Figure 15 (SEQ ID NO: 23). Clone DNA57254-1477 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 214-216 of SEQ ID NO: 23, and ending at the apparent stop codon at nucleotide positions 2062-2064. The predicted polypeptide precursor is 616 amino acids long. The transmembrane domain (type II) is believed to be at about amino acids 13-40 of SEQ ID NO: 24. N
-Glycosylation sites and N-myristoylation sites are shown in Figure 16. Clone DNA57254-1477 has been deposited with the ATCC, ATCC Deposit No. 203
289 was awarded. The full-length PRO1113 protein shown in FIG.
It has an estimated molecular weight of 8,243 Daltons and a pI of about 8.66. The Dayhoff database (version 35 using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. 16 (SEQ ID NO: 24)).
.45 SwissProt 35) analysis of the amino acid sequence of PRO1113 and the following Dayh
off array (data is taken in here): D86983_1, A58532, SLIT_DROME, AB00786
5_1, AC004142_1, CELT21D12_8, AB003184_1, DMU42767_1, MUSLRRP_1 and GPCR_
Sequence identity with LYMST was revealed.

Example 12: Isolation of a cDNA clone encoding human PRO1194 The use of the signal sequence algorithm described in Example 3 above enabled the identification of EST cluster sequences from the Incyte database. Then this ES
T-cluster sequences, public databases (eg GenBank) and corporate ESTs
DNA database (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto,
The existing homology was identified by comparison with various expressed sequence tag (EST) databases, including CA). One or more of the ESTs was retrieved from the human pineal gland library. The homology search is performed by the computer program BLAST or BLAST2 (Altschul et al., Metho.
ds in Enzymology 266: 460-480 (1996)). A comparison that does not encode a known protein and has a BLAST score of 70 (sometimes 90) or higher is the program "phrap" (Phil Green, University of Washington, Seattle.
, Washington) to construct a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated DNA56511. ES contained in DNA56511 sequence and Merck's ESTAA069568
In view of the sequence homology with the T sequence, clone 382736 containing this EST was purchased and the cDNA insert was obtained and sequenced. The sequence of this cDNA insert is Fi
It is shown in g17 and is herein designated as DNA57841-1522. The full-length clone shown in Figure 17 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 9-11 and ending at the stop codon at nucleotide positions 252-254 (Fig17; SEQ ID NO: 28).
). The predicted polypeptide precursor (Fig18, SEQ ID NO: 29) is 81 amino acids long. The signal peptide is located at about amino acids 1-21 of SEQ ID NO: 29. PRO1194 has an estimated molecular weight of about 9,223 and an estimated pI of about 10.47. Clone DNA57841-1522 was added to ATCC on November 3, 1998.
And has been assigned ATCC deposit no. 203458. Dayhoff database (version 35.45 Swis) using WU-BLAST-2 sequence alignment analysis of the full length sequence shown in FIG. 18 (SEQ ID NO: 29).
sProt 35) analysis revealed that the PRO1194 amino acid sequence and the following Dayhoff sequence: P
T17_YEAST, RR2_CHLVU, CEK12F2_1, S22452, S76705, AF031898_7, A4_DROME, A
Sequence identities between F038931_1, E49905, and GSPL_AERHY were revealed.

Example 13: Isolation of a cDNA clone encoding human PRO1110 A cDNA clone encoding a native human PRO1110 polypeptide (DNA
58727-1474) was identified using a yeast screen in a human fetal kidney cDNA library that predominates at the 5'end of the primary cDNA clone. The yeast screen used was a single E, designated herein as DNA45566.
ST clones were identified. The DNA45566 sequence is then translated into a public EST database (eg GenBank) and a company EST database (LIFESEQ (trade name), In
Homologous EST sequences were identified by comparison with various EST databases, including Cyte Pharmaceuticals, Palo Alto, CA). Comparison is the computer program BLAST
Alternatively, it was performed using BLAST2 [Altschul et al., Methods in Enzymology 266: 460-480 (1996)]. Comparables that do not encode a known protein and have a BLAST score of 70 (sometimes 90) or higher can be found in the program "phrap" (Phil Green, Uni
versity of Washington, Seattle, Washington)
The A sequence was constructed. This consensus sequence is designated herein as DNA46965. An oligonucleotide primer based on the DNA46965 sequence was then synthesized and used to screen a human SK-Lu-1 adenocarcinoma cDNA library (LIB247) to identify the DNA58727-1474 clone shown in Figure 19. The full length DNA58727-1474 clone shown in Figure 19 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 131-133 and ending at the stop codon at nucleotide positions 1097-1099 (Fig19). The predicted polypeptide precursor is 322 amino acids long (Figure 20). The full-length PRO1110 protein shown in FIG.
It has an estimated molecular weight of 5,274 daltons and a pI of about 8.57. Fig20 (
Analysis of full length PRO1110 set forth in SEQ ID NO: 31) demonstrates the presence of the following: about amino acid 41 to about amino acid 60, about amino acid 66 to about amino acid 85, about amino acid 101 to about amino acid 120, about amino acid 137. To about amino acid 153, about amino acid 171 to about amino acid 192, about amino acid 205 to about amino acid 226, about amino acid 235 to about amino acid 255 and about amino acid 294.
From about amino acid 312 to the transmembrane domain, from about amino acid 6 to about amino acid 69 N
-Glycosylation sites and glycosaminoglycan attachment sites from about amino acid 18 to about amino acid 21. Clone DNA58727-1474 was deposited with the ATCC on September 1, 1998 and was assigned ATCC deposit no. 203171. The Dayhoff database (version 35.45 Swis using the WU-BLAST-2 sequence alignment analysis of the full length sequence shown in FIG. 20 (SEQ ID NO: 31)).
sProt 35) analysis revealed that PRO1110 amino acid sequence and the following Dayhoff sequence: M
MMYELUPR_1, P_R99799, MAL_HUMAN, P_P80929, RNMALGENE_1, S68406, PLLP_RAT
, And significant homology between MMMALPROT_1, I38891 and S55622 was demonstrated.

Example 14: Isolation of a cDNA clone encoding human PRO1378 A yeast screen was used in a human bone marrow cDNA library in which the first DNA sequence, referred to herein as DNA51941, is predominantly at the 5'end of the primary cDNA clone. Identified. Based on the DNA51941 sequence, the following oligonucleotide was synthesized and used as a probe to isolate a clone of the full length coding sequence for PRO1377 from a bone marrow cDNA library: TGTCCTTTGTCCCAGACTTCTG.
TCC (SEQ ID NO: 34); CTGGATGCTAATGTGTCCAGTAAATGATCCCCTTATCCCGTCGCGATGCT
(SEQ ID NO: 35); TTCCACTCAATGAGGTGAGCCACTC (SEQ ID NO: 36); GGCGAGCCCTAAC
TATCCAGGAG (SEQ ID NO: 37); GGAGATCGCTGCGCTGGCCAGGTCCTCCCTGCATGGTAT (SEQ ID NO: 38); and CTGCTGCAAAGCGAGCCTCTTG (SEQ ID NO: 39). The full-length DNA58730-1607 clone shown in Figure 21 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 1365-1367 and ending at the stop codon at nucleotide positions 2370-2372 (Fig21; SEQ ID NO: : 32). The predicted polypeptide precursor (Fig22, SEQ ID NO: 33) is 335 amino acids long and has a signal peptide sequence at about amino acids 1-15. PRO1378 has a calculated molecular weight of approximately 36,108 daltons and an estimated pI of approximately 4.51. The Dayhoff database (version 35.45 Swis using the WU-BLAST-2 sequence alignment analysis of the full length sequence shown in FIG. 22 (SEQ ID NO: 33)).
sProt 35), the PRO1378 amino acid sequence and the following Dayhoff sequence: I
Some homology was revealed between CAL_RABIT, SP2_HUMAN, SHPSPRBB_1, SP23_HUMAN, P_W08158, and P_W08150. Clone DNA58730-1607 was deposited with the ATCC on September 15, 1998 and was assigned ATCC deposit no. 203221. Example 15: Isolation of a cDNA clone encoding human PRO1481 The first DNA sequence, referred to herein as DNA53254, was identified using a yeast screen in a human fetal kidney cDNA library that predominates at the 5'end of the primary cDNA clone. did. Oligonucleotides were synthesized based on the DNA53254 sequence and used as a probe (or primer) to isolate a clone of the full-length coding sequence for PRO1481 from a human fetal kidney cDNA library. The full-length DNA58732-1650 clone shown in Figure 23 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 320-322 and ending at the stop codon at nucleotide positions 1322-1324 (Fig23; SEQ ID NO: : 40). Predicted polypeptide precursor (F
ig24, SEQ ID NO: 41) is 334 amino acids long. The signal sequence is at about amino acids 1-23 of SEQ ID NO: 41 and the transmembrane domain is about amino acids 235-2.
62. The N-glycosylation site is shown in Figure 24. PRO1481 has a calculated molecular weight of approximately 36,294 daltons and an estimated pI of approximately 4.98. Clone DNA58732-1650 has been deposited with the ATCC, ATCC Deposit No. 20.
3290 was awarded. Dayhoff database (version 35.45 Swis) using WU-BLAST-2 sequence alignment analysis of the full length sequence shown in FIG. 24 (SEQ ID NO: 41).
sProt 35) analysis revealed that the PRO1481 amino acid sequence and the following Dayhoff sequence: Y
N23_YEAST, S67770, H36857, YLU2_PICAN, GEN12881, CVY15035_28, YM96_YEAST
, The sequence identity between ESC1_SCHP0, CELZK783_1 and S59310 was revealed.

Example 16: Isolation of a cDNA clone encoding human PRO1189 The cDNA sequence isolated by the amylase screen described in Example 2 above is herein designated DNA41784. The DNA41784 sequence is then compared to various expressed sequence tag (EST) databases, including public EST databases (eg GenBank) and corporate EST DNA databases (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA). The existing homologies were identified. The homology search is performed by the computer program BLAST or BLAST2 (Altschul et al., Methods i.
n Enzymology 266: 460-480 (1996)). A comparison that does not encode a known protein and has a BLAST score of 70 (sometimes 90) or higher is the program "phrap" (Phil Green, University of Washington, Seattle, Wa.
shington) to construct a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated DNA45499. Oligonucleotide probes were made based on the DNA45499 sequence and used to screen a human bone marrow library prepared as described in paragraph 1 of Example 2 above. The cloning vector is pRK5B (pRK5B is a precursor of pRK5D that does not contain an SfiI site; Holmes et al., Science, 253:
1278-1280 (1991)), the size of the cleaved cDNA was less than 2800 bp. PCR primers (forward and reverse) were synthesized: Forward PCR primer (45499.f1): 5'-GAAAGACACGACACAGCAGCTTGC-3 '(SEQ ID NO: 44) Forward PCR primer (45499.f2): 5'-GGGAACTGCTATCTGATGCC-3 '(SEQ ID NO: 45) Forward PCR primer (45499.f3): 5'-CAGGATCTCCTCTTGCAGTCTGCAGC-3' (SEQ ID NO: 46) Reverse PCR primer (45499.r1): 5'-CTTCTCGAACCACATAAGTTTGAGGCAG-3 '(
SEQ ID NO: 47) Reverse PCR primer (45499.r2): 5'-CACGATTCCCTCCACAGCAACTGGG-3 '(SEQ ID NO: 48) Further, a synthetic oligonucleotide hybridization probe was prepared from the DNA45499 sequence having the following nucleotide sequence. Hybridization probe (45499.p1): 5'-CGCCTTACCGCGCAGCCCGAAGATTCACTATGGTGAAAATCGCCTTCAAT-3 '(SEQ ID NO: 49) To screen several libraries for sources of full-length clones, PCR primer pair identified above It was amplified by PCR. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate clones encoding the PRO1189 gene with one of the primer pairs. A full-length clone was identified, containing a single open reading frame, with an apparent translational initiation site at nucleotide positions 79-81 and a stop codon at nucleotide positions 868-870 (Fig25; SEQ ID NO: 42). The predicted polypeptide precursor is 263 amino acids long, has a calculated molecular weight of approximately 29,741 daltons and an estimated pI of approximately 5.74. Additional features include a Type II transmembrane domain at about amino acids 53-75 and a potential N-glycosylation site at about amino acids 166-169. The Dayhoff database (version 35.45 Swis) using WU-BLAST-2 sequence alignment analysis of the full length sequence shown in FIG. 26 (SEQ ID NO: 43).
sProt 35) analysis showed that PRO1189 amino acid sequence and Dayhoff sequence MUSE25A_1
And significant homology between HS696H22_1 was demonstrated. Also, some homology P
RO1189 amino acid sequence and the following Dayhoff sequence: AF017985_1, CBRG01D9_2, I79
662, and CHPDRBAG_1. Clone DNA58828-1519 has been deposited with the ATCC and is assigned ATCC deposit no. 203172.

Example 17: Isolation of a cDNA clone encoding human PRO1415 By using the signal sequence algorithm described in Example 3 above, Incy
It was possible to identify the EST cluster sequence from the Incyte database, which was named te EST cluster sequence number 150918. Then this EST
Cluster sequences are published in public EST databases (eg GenBank) and corporate E
STDNA database (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Al
existing homology was identified by comparison with various expressed sequence tag (EST) databases, including to, CA). The homology search is performed by the computer program BLAST or BLAST2.
(Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparables that do not encode a known protein and have a BLAST score of 70 (sometimes 90) or higher are those that have the program "phrap" (Phil Green, University of
(Washington, Seattle, Washington) to construct a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated DNA55720. In view of the sequence homology between the DNA55720 sequence and the EST sequence contained in Incyte's EST clone no. 4081476, Incyte's EST clone no. This cd
The sequence of the NA insert is shown in Figure 27 and is herein designated as DNA58852-1637. Clone DNA58852-1637 contains a single open reading frame, has an apparent translational initiation site at nucleotide positions 148-150, and ends at the stop codon at nucleotide positions 997-999 (Fig 27). The predicted polypeptide precursor is 283 amino acids long (Fig28). Fig
The full-length PRO1415 protein shown at 28 has a predicted molecular weight of about 29,191 and a pI of about 4.52. Full length PR shown in FIG. 28 (SEQ ID NO: 50)
Analysis of O1415 demonstrates the presence of the following: a signal peptide of about amino acids 1 to about amino acids 25, a transmembrane domain of about amino acids 94 to about amino acids 118 and about amino acids 18 to about amino acids 23, about amino acids 40 to about amino acids. 45, about amino acid 46 to about amino acid 51, about amino acid 145 to about amino acid 1
50, about amino acids 192 to about amino acids 197, about amino acids 193 to about amino acids 198, about amino acids 211 to about amino acids 216, about amino acids 238 to about amino acids 243, and about amino acids 242 to about amino acids 247, potential N-myristoylation sites. . Clone DNA58852-1637 was deposited with the ATCC on September 22, 1998 and was assigned ATCC deposit no. 203271. The Dayhoff database (version 35) using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. 28 (SEQ ID NO: 50).
.45 SwissProt 35), and the amino acid sequence of PRO1415 and the following Dayh
off array: HSU66616_1, P_W24017, A38219, CD30_HUMAN, HSU78971_1, P_W22214,
Significant homology was demonstrated with NFM_HUMAN, ADH1_ASPFL, PAU93274_5 and CENB_MOUSE.

Example 18: Isolation of a cDNA clone encoding human PRO1411 By using the signal sequence algorithm described in Example 3 above, Incy
It has become possible to identify EST cluster sequences from the te database. This EST cluster sequence is then transformed into a public EST database (eg GenBank) and a corporate EST DNA database (LIFESEQ (trade name), Incyte Pharmaceuticals).
, Palo Alto, CA) and compared the various expressed sequence tag (EST) databases to identify existing homologies. Homolog search is a computer program BLAST
Alternatively, it was performed using BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparables that do not encode a known protein and have a BLAST score of 70 (sometimes 90) or higher can be found in the program "phrap" (Phil Green, Uni
versity of Washington, Seattle, Washington)
The A sequence was constructed. The consensus sequence obtained therefrom is now DNA560
Name it 13. ES contained in DNA56013 sequence and Incyte EST 14444225
In view of the sequence homology with the T sequence, a clone containing this EST was purchased and
The NA insert was obtained and sequenced. The sequence of this cDNA insert is shown in Figure 29 and is herein designated as DNA59212-1627. The full-length clone shown in Figure 29 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 184-186 and ending at the stop codon at nucleotide positions 1504-1506 (Figure 29; SEQ ID NO: 51). . Predicted polypeptide precursor (Fig30, SEQ ID NO: 52)
Is 440 amino acids long. The signal peptide is approximately amino acid 1 of SEQ ID NO: 52.
At -21, the site of cell attachment is at about amino acids 301-303. PRO141
1 has a calculated molecular weight of about 42,208 daltons and an estimated pI of about 6.36.
Clone DNA59212-1627 was deposited with the ATCC on September 9, 1998 and was assigned ATCC deposit no. The Dayhoff database (version 35) using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. 30 (SEQ ID NO: 52).
.45 SwissProt 35) analysis of the amino acid sequence of PRO1411 and the following Dayh
off array: MTV023_19, P_R05307, P_W26348, P_P82962, AF000949_1, EBN1_EBV,
Sequence identity was revealed between P_R95107, GRP2_PHAVU, P_R81318, and S74439_1.

Example 19: Isolation of a cDNA clone encoding human PRO1295 By using the signal sequence algorithm described in Example 3 above, Incy
It has become possible to identify EST cluster sequences from the te database. This EST cluster sequence is then transformed into a public EST database (eg GenBank) and a corporate EST DNA database (LIFESEQ (trade name), Incyte Pharmaceuticals).
, Palo Alto, CA) and compared the various expressed sequence tag (EST) databases to identify existing homologies. Homolog search is a computer program BLAST
Alternatively, it was performed using BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparables that do not encode a known protein and have a BLAST score of 70 (sometimes 90) or higher can be found in the program "phrap" (Phil Green, Uni
versity of Washington, Seattle, Washington)
The A sequence was constructed. The consensus sequence obtained therefrom is now referred to as DNA562
It is named 62. ES contained in the DNA56262 sequence and Incyte EST 3743334
In light of the sequence homology with T, a clone containing this EST was purchased and
The insert was obtained and sequenced. The sequence of this cDNA insert is shown in Figure 31 and is herein designated as DNA59218-1559. The full-length clone shown in Figure 31 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 207-209 and ending at the stop codon at nucleotide positions 1047-1049 (Fig31; SEQ ID NO: 53). . Predicted polypeptide precursor (Fig32, SEQ ID NO: 54)
Is 280 amino acids long. The signal peptide is about amino acid 1 of SEQ ID NO: 54.
-18. Target signals and N-glycosylation sites are also shown in Figure 54. PRO1295 has a calculated molecular weight of approximately 30,163 daltons and an estimated pI of approximately 6.87. Clone DNA59218-1559 was Sep. 29, 1998.
It was deposited with the ATCC on the day and was assigned ATCC deposit no. 203287. The Dayhoff database (version 35) using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. 32 (SEQ ID NO: 54).
.45 SwissProt 35) analysis of the amino acid sequence of PRO1295 and the following Dayh
off array: AB011099_1, ILVE_MYCTU, ATTECR_2, AF010496_27, P_R15346, S37191
, Sequence identity between PER_DROMS, L2MU_ADECC and P_W34238 was revealed.

Example 20: Isolation of a cDNA clone encoding human PRO1359 By using the signal sequence algorithm described in Example 3 above, Incy
It has become possible to identify EST cluster sequences from the te database. This EST cluster sequence is then transformed into a public EST database (eg GenBank) and a corporate EST DNA database (LIFESEQ (trade name), Incyte Pharmaceuticals).
, Palo Alto, CA) and compared the various expressed sequence tag (EST) databases to identify existing homologies. One or more of the ESTs was retrieved from the sigmoid colon tissue library. The homology search is performed by the computer program BLAST or BLAST2 (A
ltschul et al., Methods in Enzymology 266: 460-480 (1996)).
Comparables that do not encode a known protein and have a BLAST score of 70 (sometimes 90) or higher are the programs "phrap" (Phil Green, University of Was.
hington, Seattle, Washington) to construct a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated DNA56263. In view of the sequence homology between the DNA56263 sequence and Incyte's EST1931418, a clone containing this EST was purchased and a cDNA insert was obtained and sequenced. The sequence of this cDNA insert is shown in Figure 33, where DNA592
It is named 19-1613. The full-length clone shown in Figure 33 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 184-186 and ending at the stop codon at nucleotide positions 1081-1083 (Fig33; SEQ ID NO: 55). . Predicted polypeptide precursor (Fig34, SEQ ID NO: 56)
Is 299 amino acids long. The transmembrane domain is approximately amino acid 9- of SEQ ID NO: 56.
31. The N-glycosylation site is at about amino acids 64-67 and 115-118 of SEQ ID NO: 56. PRO1359 has a calculated molecular weight of approximately 34,291 daltons and an estimated pI of approximately 9.87. Clone DNA59219-1613 was deposited with the ATCC on September 15, 1998 and was assigned ATCC deposit no. 203220. The Dayhoff database (version 35) using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. 34 (SEQ ID NO: 56).
.45 SwissProt 35) analysis of the amino acid sequence of PRO1359 and the following Dayh
off array (data is taken in here): GEM14384, P_R78622, A23699_1, P_R6524
4, Sequence identity with A54898, AF059321_1, RNU55938_1, BTRNAST6_1, P_R75199 and P_R63216 was revealed.

Example 21: Isolation of a cDNA clone encoding human PRO1190 By the method described in Example 1 above, a single Merck / Washington University EST sequence, designated herein as "DNA53943", EST number AA3398.
02 can be identified. Based on the DNA53394 sequence, 1) for identifying a cDNA library containing the sequence of interest by PCR, and 2) PRO11
For use as a probe to isolate 90 full length coding sequence clones,
Oligonucleotides were synthesized. PCR primers (forward and reverse) were synthesized: Forward PCR primer (53943.f1) GGGAAACACAGCAGTCATTGCCTGC (SEQ ID NO: 5)
9) Reverse PCR primer (53943.r1) GCACACGTAGCCTGTCGCTGGAGC (SEQ ID NO: 60)
) Furthermore, a synthetic oligonucleotide hybridization probe was made from the consensus DNA53394 sequence with the following nucleotide sequence: Hybridization probe: (53943.p1) CACCCCAAAGCCCAGGTCCGGTACAGCGTCAAAC
AAGAGTGG (SEQ ID NO: 61) To screen several libraries for a source of full length clones, DNA from the libraries was PCR amplified with the PCR primer pair identified above. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate a clone encoding the PRO1190 gene with one of the primer pairs. RNA for making a cDNA library was isolated from human bone marrow. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO1190 (designated herein as DNA59586-1520 [Fig35, SEQ ID NO: 57]); and the derived protein sequence for PRO1190. The entire coding sequence of PRO1190 is shown in Figure 35 (SEQ ID NO: 57). Clone DNA59586-1520 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 340-342 and an apparent stop codon at nucleotide positions 3685-3687. The predicted polypeptide precursor is 1115 amino acids long. Full length PRO1 shown in Fig36
The 190 protein has an estimated molecular weight of approximately 121,188 daltons and a p of approximately 7.07.
I have. Other features of the PRO1190 protein are: two transmembrane domains at amino acids 16-30 and 854-879; a cytochrome P450 cysteine heme iron ligand signature at amino acids 1051-1060; and amino acids 65-68.
, 76-79, 98-101, 189-192, 275-278, 518-52.
Includes 1, 726-729, and 760-763 potential N-glycosylation sites. Clone DNA59586-1520 was deposited with the ATCC on September 29, 1998 and was assigned ATCC deposit no. 203288. The Dayhoff database (version 35) using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. 36 (SEQ ID NO: 58).
.45 SwissProt 35) analysis shows the amino acid sequence of PRO1190 and the following Dayh
off array (data is taken in here): AF004840_1, AF004841_1, AF026465_1, H
The homology with SU72391_1, P_R13144, AX01_HUMAN, GEN13349, I58164, D87212_1, A53449, and D86983_1, and KIAA0230 was revealed.

Example 22: Isolation of a cDNA clone encoding human PRO1772 A consensus DNA sequence was constructed against other EST sequences using the phrap method as described in Example 1 above. This consensus sequence is DN here
It was named A45120. 1) based on the DNA45120 consensus sequence
To identify a cDNA library containing the sequence of interest by PCR, and 2
3.) Oligonucleotides were synthesized for use as probes to isolate clones of the full-length coding sequence for PRO1772. PCR primers (forward and reverse) were synthesized: Forward PCR primer (45120.f1) 5'-CCTTCACCTGCAGTACACCATGGGC-3 '(SEQ ID NO: 64) Reverse PCR primer (45120.r1) 5'-GTCACACACAGCTCTGGCAGCTGAG-3' ( SEQ ID NO: 65) Further, a synthetic oligonucleotide hybridization probe was prepared from the consensus DNA45120 sequence having the following nucleotide sequence: Hybridization probe: (45120.p1) 5'-CCAAGTTCAGACACCACATGTACACCAACGT
CAGCGGATTGACAAGC-3 '(SEQ ID NO: 66) RNA for construction of a cDNA library was isolated from human bone marrow tissue. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO1772 (designated herein as DNA59817-1703 [Fig37, SEQ ID NO: 62]); and the derived protein sequence for PRO1772. The entire nucleotide sequence of DNA59817-1703 is shown in FIG. 37 (SEQ ID NO:
62). Clone DNA59817-1703 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 93-95 and ending at the apparent stop codon at nucleotide positions 1554-1556 (Fig 37). The predicted polypeptide precursor is 487 amino acids long (Figure 38). The full-length PRO1772 protein shown in FIG. 38 is about 53.5
It has an estimated molecular weight of 69 Daltons and a pI of about 7.68. Analysis of the full-length PRO1772 sequence shown in Figure 38 (SEQ ID NO: 63) demonstrates the presence of the following: a signal peptide from about amino acid 1 to about amino acid 36, about amino acid 313.
From about amino acid 331 to the transmembrane domain, from about amino acid 119 to about amino acid 12
2. Potential N-glycosylation sites of about amino acids 184 to about amino acids 187, about amino acids 243 to about amino acids 246 and about amino acids 333 to about amino acids 336, about amino acids 41 to about amino acids 46, about amino acids 59 to about amino acids 64.
, About amino acid 73 to about amino acid 78, about amino acid 133 to about amino acid 138
, About amino acid 182 to about amino acid 187, about amino acid 194 to about amino acid 1
99, about amino acids 324 to about amino acids 329, about amino acids 354 to about amino acids 359, about amino acids 357 to about amino acids 362, about amino acids 394 to about amino acids 399, about amino acids 427 to about amino acids 432, and about amino acids 472 to about amino acids 477. Potential N-myristoylation site and prokaryotic membrane lipoprotein lipid attachment site from about amino acid 136 to about amino acid 146. Clone DNA59
817-1703 was deposited with the ATCC on November 17, 1998 and was assigned ATCC deposit no. 203470. The Dayhoff database (version 35) using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. 38 (SEQ ID NO: 63).
.45 SwissProt 35) analysis of the amino acid sequence of PRO1772 and the following Dayh
off array (data is taken in here): P_R30823, MDP1_PIG, MDP1_HUMAN, P_R13
Significant homology was demonstrated with 857, P_R53920, MDP1_MOUSE, P_R30822, JC4222, CELF52C6_2 and MYV027_13.

Example 23: Isolation of a cDNA clone encoding human PRO1248 By using the signal sequence algorithm described in Example 3 above, Incy
It enabled the identification of EST cluster sequences from the Incyte database named teEST cluster SEQ ID NO: 7494. This EST cluster sequence is then converted into a public EST database (eg GenBank) and a corporate ESTDN.
A database (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, CA)
The existing homologies were identified by comparison with various expressed sequence tag (EST) databases including. The homology search is performed by the computer program BLAST or BLAST2 (Altschu
l et al., Methods in Enzymology 266: 460-480 (1996)). Comparables that do not encode a known protein and have a BLAST score of 70 (sometimes 90) or higher are those of the program "phrap" (Phil Green, University of Washingto
n, Seattle, Washington) to construct a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated DNA56056. Given the sequence homology between the DNA56056 sequence and the EST contained within the Merck EST clone number AA404441, the Merck EST clone number AA404441 was purchased and the cDNA insert was obtained and sequenced. This cdn
The sequence of the A insert is shown in Figure 39 and is herein designated as DNA60278-1530. Clone DNA60278-1530 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 122-124, and ending at the stop codon at nucleotide positions 671-673 (Fig40). The predicted polypeptide precursor is 183 amino acids long (Fig40). Fig
The full-length PRO1248 protein shown at 40 has a predicted molecular weight of about 20,574 daltons and a pI of about 6.60. Full length P shown in Fig40 (SEQ ID NO: 68)
Analysis of the RO1248 sequence demonstrates the presence of the following: a signal peptide of about amino acids 1 to about amino acids 20, a transmembrane domain of about amino acids 90 to about amino acids 112 and about amino acids 21 to about amino acids 24, about amino acids 38 to about 38. Potential N-glycosylation sites from amino acid 41 and from about amino acid 47 to about amino acid 50. Clone DNA60278-1530 was deposited with the ATCC on September 1, 1998 and was assigned ATCC deposit no. 203170. The Dayhoff database (version 35) using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. 40 (SEQ ID NO: 68).
.45 SwissProt 35) analysis of the amino acid sequence of PRO1248 and the following Dayh
off array: AF026198_5, CELR12C12_5, PN0563, S64541_1, PN0564, P_R44881 and
Significant homology with XLU78189_1 was demonstrated.

Example 24: Isolation of cDNA clones encoding human PRO1316 The extracellular domain (ECD), containing any publicly available signal sequences known to contain secretory sequences, was cloned into a variety of public domains. It was used to search the EST (expressed sequence tag) database (GenBank, Merck / Wash.U) that can be used for. The search is performed by the computer program BLAST or BLAST2 [Altschul et al., Methods in Enzymology 266:
460-480 (1996)] as a comparison of ECD protein sequences for 6-frame translation of EST sequences. No known protein, BLAST score 7
Comparables with 0 (sometimes 90) or more are programs "phrap" (P
hil Green, University of Washington, Seattle, Washington) to construct a consensus DNA sequence. As a result of the above search, W55979 showed homology with secretory protein Dkk-1.
An EST named was identified. A clone corresponding to ESTW55979 (clone NbHH19W) was purchased from the University of Merck / Washington and a cDNA insert was obtained and sequenced in its entirety. Full length PRO1316 (DNA6060 encoded by the purchased clone)
The nucleic acid sequence corresponding to 8-1577 is shown in FIG. 41 (SEQ ID NO: 69). DNA60608-1577 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 211-213, and a stop codon at nucleotide positions 988-990 (Fig42; SEQ ID NO: 70).
). The predicted polypeptide precursor is 259 amino acids long. Additional regions of great interest are the signal peptide (211-283), the N-glycosylation site (364-366), and the Zn (2) -Cys (6) binuclear cluster domain (50
5-655). Clone DNA60608
-1577 has been deposited with the ATCC and is assigned ATCC deposit no. 203126. The full-length PRO1316 shown in Figure 42 has a predicted molecular weight of approximately 28,447 and a pI of approximately 9.48. Based on BLAST and FastA sequence alignment analysis of the full-length sequence (using the ALIGN computer program), PRO1316 yields a dickk
It shows significant amino acid sequence identity with the opf family of proteins. Also, DN
A60608 is AF030433_1, LFE4_CHICK, COL_RABIT, YQI6_CAEEL, ITB6_HUMA
The homology between N, CONO_LYMST, S41033, D63483_1, D86864_1 and AB001978_1 was revealed.

Example 25: Isolation of a cDNA clone encoding human PRO1197 In a human SK-Lu-1 adenocarcinoma cDNA library, the first DNA sequence, herein designated DNA56267, is predominantly at the 5'end of the primary cDNA clone. , Identified using yeast screening. DNA56267 was used to synthesize an oligonucleotide for use as a probe to isolate a clone of the full length coding sequence for PRO1197 from a human breast cancer cDNA library. SEQ ID NO: 73: 5 'AATTCATGGCAAATATTTCCCTTCCC3'(forward); SEQ ID NO: 74: 5 'TGGTAAACTGGCCCAAACTCGG3' (reverse direction); SEQ ID NO: 75: 5 'TTAAAGTCATCCGTCCTTGGCTCAGGATTTGGAGAGCTTGCACCACCAAA3
'(probe). The full-length DNA60611-1524 clone shown in Fig43 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 311-313 and ending at the stop codon at nucleotide positions 1400-1402 (Fig43; SEQ ID NO: : 71). Predicted polypeptide precursor (F
ig44, SEQ ID NO: 72) is 363 amino acids long. The signal peptide is located at about amino acids 1-24 of SEQ ID NO: 72. PRO1197 has a calculated molecular weight of approximately 38,825 daltons and an estimated pI of approximately 9.88. Clone DNA606
11-1524 has been deposited with the ATCC and is assigned ATCC deposit no. 203175. Dayhoff database (version 35.45 Swis) using WU-BLAST-2 sequence alignment analysis of the full length sequence shown in FIG. 44 (SEQ ID NO: 72).
sProt 35) analysis revealed that the PRO1197 amino acid sequence and the following Dayhoff sequence (
Information from the database captured here): Y144_HUMAN, I47141 (stomach mucus,
Mucin is described in Ann.NY Acad.Sci., 140 (2): 804-834 (1967)), AMYH_YEAS
T, CELK06A9_3, CELZK783_1, HKR1_YEAST, AB003521_1, D87895_1, S61993 and Y
Sequence identity with M96_YEAST was revealed.

Example 26: Isolation of a cDNA clone encoding human PRO1293 By using the signal sequence algorithm described in Example 3 above, IncyteE
ES from the Incyte database named ST cluster SEQ ID NO: 115204
It became possible to identify the T cluster sequence. This EST cluster sequence is then
Public databases (eg GenBank) and corporate EST DNA databases (L
Existing homology was identified by comparison with various expressed sequence tag (EST) databases, including IFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA). The homology search is performed by the computer program BLAST or BLAST2 (Altschul et al., Methods in
Enzymology 266: 460-480 (1996)). A comparison that does not encode a known protein and has a BLAST score of 70 (sometimes 90) or higher is:
Program "phrap" (Phil Green, University of Washington, Seattle, Wash
in Washington) to construct a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated DNA56522. In view of the sequence homology between the DNA56522 sequence and the EST sequence contained in Incyte EST clone no. 2966119, Incyte EST clone no. 2966119 was purchased and the cDNA insert was obtained and sequenced. This cd
The sequence of the NA insert is shown in Figure 45 and is herein designated as DNA60618-1557. Clone DNA60618-1557 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 37-39 and ending at the stop codon at nucleotide positions 1060-1062 (Fig 45). The predicted polypeptide precursor is 341 amino acids long (Figure 46). Fig
The full-length PRO1293 shown at 46 has a calculated molecular weight of approximately 38,070 daltons and an estimated pI of approximately 6.88. Analysis of the full-length PRO1293 sequence set forth in Figure 46 (SEQ ID NO: 77) demonstrates the presence of the following: a signal peptide of about amino acids 1 to about amino acids 19, about amino acids 237 to about amino acids 262.
Homologous to the transmembrane domain of, from about amino acid 205 to about amino acid 208, a potential glycosylation site, from about amino acid 151 to about amino acid 152, a cell attachment sequence and from about amino acid 115 to about amino acid 140, a coproporphyrinogen III oxidase protein. Amino acid sequence block having sex. Clone DNA60618-15
57 was deposited with the ATCC on September 29, 1998, and has been assigned ATCC deposit no. 2032.
92 is assigned. Dayhoff database (version 35.45 Swis) using WU-BLAST-2 sequence alignment analysis of the full length sequence shown in FIG. 46 (SEQ ID NO: 77).
sProt 35) analysis revealed that the PRO1293 amino acid sequence and the following Dayhoff sequence: H
SVCD54_1, A33_HUMAN, AF009220_1, HSU82279_1, AF004230_1, P_R13272, AF004
Significant homology was demonstrated between 231_1, AF043644_1, S44125 and HSIGGHC85_1.

Example 27: Isolation of a cDNA clone encoding human PRO1380 cD isolated in the amylase screen described in Example 2 above.
The NA sequence is herein designated DNA45776. Based on the DNA45776 sequence, an oligonucleotide probe was produced and used to screen the human retinal library described in the first paragraph of Example 2 above. The cloning vector was pRK5B (pRK5B is a precursor of pRK5D that does not contain an SfiI site; see Holmes et al., Science 253: 1278-1280 (1991)) and the cleaved cDNA size was less than 2800 bp. . PCR primers (forward and reverse) were synthesized: Forward PCR primer (45776.f1) 5'-TTTTGCGGTCACCATTGTCTGC-3 '(SEQ ID NO: 80) and reverse PCR primer (45776.r1) 5'-CGTAGGTGACACAGAAGCCCAGG-. 3 '(SEQ ID NO: 81). In addition, the synthetic oligonucleotide hybridization probe has the following nucleotide sequence: Hybridization probe (45776.p1): 5'-TACGGCATGACCGGCTCCTTTCCTATGAGGAACTCCCAGGCACTGATAT-3 '(SEQ ID NO: 82).
Was prepared from the DNA45776 sequence having To screen several libraries against a source of full-length clones, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. The positive library was then used to isolate clones encoding the PRO1380 gene using one of the probe oligonucleotides and PCR primers. A full length clone was identified containing a single open reading frame with an apparent translational initiation site at nucleotide positions 36-38 and a stop signal at nucleotide positions 1461-1463 (Fig47; SEQ ID NO: 78). The predicted polypeptide precursor is 470 amino acids long, has a calculated molecular weight of approximately 51,715 daltons and approximately 7.
It has an estimated pI of 86. A further feature is about amino acids 50-74, 105-127.
, 135-153, 163-183, 228-252, 305-330, and 4
It contains a transmembrane domain of 48-472; potential N-glycosylation sites of about amino acids 14-17 and 84-87; and a dihydrofolate reductase signature of about amino acids 60-68. Dayhoff database (version 35 using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. 48 (SEQ ID NO: 79)).
． 45SwissProt35), the PRO1380 amino acid sequence and the following Da
yhoff array, HSU81375_1, CEZK809_6, CEK02E11_1, AF034102_1, JC4196, C
The homology between EF36H2_2, P_R92315, YAC2_YEAST, F1707_13, and CEF44D12_3 was proved. Clone DNA60740-1615 was deposited with the ATCC on November 3, 1998 and is assigned ATCC deposit no. 203456.

Example 28: Isolation of a cDNA clone encoding human PRO1265 The use of the signal sequence algorithm described in Example 3 above allows the identification of EST cluster sequences from the LIFESEQ database designated EST cluster number 86995. Became. This EST cluster sequence is then translated into public databases (eg GenBank) and corporate EST DNA databases (LIFES
Existing homology was identified by comparison with various expressed sequence tag (EST) databases, including EQ (trade name), Incyte Pharmaceuticals, Palo Alto, CA). The homology search is performed by the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzy.
mology 266: 460-480 (1996)). A comparison that does not encode a known protein and has a BLAST score of 70 (sometimes 90) or higher is the program "phrap" (Phil Green, University of Washington, Seattle, Washingt.
on) to build a consensus DNA sequence. One or more of the ESTs used in the construction was prepared from RNA isolated from inflammatory human adenoid tissue c
It was removed from the DNA library. The consensus sequence obtained therefrom is herein designated DNA55717. ES contained in DNA55717 sequence and Incyte EST number 20965
Given the sequence homology with the T sequence, purchased EST clone no. 20965,
The cDNA insert was obtained and sequenced. The sequence of this cDNA insert is shown in Figure 49 and is herein designated as DNA60764. The full-length clone shown in Figure 49 contains a single open reading frame, has an apparent translational initiation site at nucleotide positions 79-81, and terminates at the stop codon found at nucleotide positions 1780-1782 (Fig.
49; SEQ ID NO: 83). The predicted polypeptide precursor (Fig50, SEQ ID NO: 84) is 567 amino acids long. PRO1265 has a calculated molecular weight of about 62,881 daltons and an estimated pI of about 8.97. A further feature is a signal peptide of about amino acids 1-21; about amino acids 54-57, 134-137, 220.
-223 and 559-562 potential N-glycosylation sites; and a region of approximately amino acids 61-80 with amino acid sequence identity to the D-amino acid oxidase protein. Dayhoff database (version 35.45 Swis) using WU-BLAST-2 sequence alignment analysis of the full length sequence shown in FIG. 50 (SEQ ID NO: 84).
Analysis of sProt 35) revealed significant sequence identity between the PRO1265 amino acid sequence and the following Dayhoff SEQ ID NO: MMU70429_1. Sequence homology is also F
ig50 (SEQ ID NO: 84) full length sequence and the following additional Dayhoff sequence: BC542
A_1, E69899, S76290, MTV014_14, A0FB_HUMAN, ZMJ002204_1, S45812_1, DBRNA
Sequence homology was found between PD_1 and CRT1_SOYBN. Clone DNA60764-1533 was deposited with the ATCC on November 10, 1998 and was assigned ATCC deposit no. 203452.

Example 29: Isolation of a cDNA clone encoding human PRO1250 By using the signal sequence algorithm described in Example 3 above, IncyteE
EST from Incyte database named ST cluster SEQ ID NO: 56523
It became possible to identify the cluster sequence. This EST cluster sequence is then translated into public databases (eg GenBank) and corporate EST DNA databases (Lif
Existing homology was identified by comparison with various expressed sequence tag (EST) databases including eseq (trade name), Incyte Pharmaceuticals, Palo Alto, CA). The homology search is performed by the computer program BLAST or BLAST2 (Altschul et al., Methods in En.
zymology 266: 460-480 (1996)). A comparison that does not encode a known protein and has a BLAST score of 70 (sometimes 90) or higher is the program "phrap" (Phil Green, University of Washington, Seattle, Washin.
gton) to construct a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated DNA56103. In view of the sequence homology between the DNA56103 sequence and the EST sequence contained in Incyte EST clone number 3371784, Incyte EST clone number 3
371784 was purchased and the cDNA insert was obtained and sequenced. The sequence of this cDNA insert is shown in Figure 51 and is herein designated as DNA60775-1532. Clone DNA60775-1532 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 74-76 and ending at the stop codon at nucleotide positions 2291-2293 (Fig51). The predicted polypeptide precursor is 739 amino acids long (Fig52). Fig
The full length PRO1250 shown at 52 has an estimated molecular weight of about 82,263 daltons and a pI of about 7.55. Full length PRO shown in Fig52 (SEQ ID NO: 86)
Analysis of 1250 demonstrates the presence of the following: a type II transmembrane domain from about amino acids 61 to about amino acids 80, a predicted AMP-binding domain signature sequence from about amino acids 314 to about amino acids 325, and about amino acids 102 to about amino acids. 105, potential N-glycosylation sites at about amino acids 588 to about amino acids 591 and about amino acids 619 to about amino acids 622. Cloned DNA60775
-1532 was deposited with the ATCC on September 1, 1998, and has been assigned ATCC deposit no. 20.
3173 was granted. The Dayhoff database (version 35) using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. 52 (SEQ ID NO: 86).
.45 SwissProt 35) analysis revealed that the amino acid sequence of PRO1250 and the following Dayh
off array: LCFB_HUMAN, S56508_1, BNAMPBP2_1, BNACS7_1, CELT08B1_6, CELC46F
Significant homology was demonstrated between 4_2, AF008206_6, CELR07C3_11, LMU70253_2 and AF008206_7.

Example 30: Isolation of a cDNA clone encoding human PRO1475 As described in Example 1 above, phrap was used to assemble consensus DNA sequences for other ESTs. This consensus sequence is now DNA4563
Name it 9. Based on the DNA45639 consensus sequence, 1) to identify a cDNA library containing the sequence of interest by PCR, and 2) PRO1.
Oligonucleotides were synthesized for use as probes to isolate clones of 475 full length coding sequences. PCR primers (forward and reverse) were synthesized: Forward PCR primer (45639.f1) 5'-GATGGCAAAACGTGTGTTTGACACG-3 '(SEQ ID NO: 89) Forward PCR primer (45639.f2) 5'-CCTCAACCAGGCCACGGGCCAC-3' ( SEQ ID NO: 90) Reverse PCR primer (45639.r1) 5'-CCCAGGCAGAGATGCAGTACAGGC-3 '(SEQ ID NO: 91) Reverse PCR primer (45639.r2) 5'-CCTCCAGTAGGTGGATGGATTGGCTC-3' (SEQ ID NO: 92) A synthetic oligonucleotide hybridization probe was prepared from the consensus DNA45639 sequence having the following nucleotide sequence: Hybridization probe (45639.p1) 5'-CTCACCTCATGAGGATGAGGCCATGGTGCTATTCCTCAACATGGTAG-3 '(SEQ ID NO: 93) To screen several libraries for a source of full-length clones, the DNA from the library with the PCR primer pair identified above. PCR amplified. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate clones encoding the PRO1475 gene with one of the primer pairs. RNA for making a cDNA library was isolated from human fetal brain tissue. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO1475 (herein designated as DNA61185-1646 [Fig53, SEQ ID NO: 87]); and the derived protein sequence for PRO1475. The entire nucleotide sequence of DNA61185-1646 is shown in Fig53 (SEQ ID NO:
87). Clone DNA61185-1646 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 130-132 and ending at the apparent stop codon at nucleotide positions 2110-2112 (Fig53). The predicted polypeptide precursor is 660 amino acids long (Figure 54). The full-length PRO1475 protein shown in FIG. 54 is about 7
It has an estimated molecular weight of 5,220 daltons and a pI of about 6.76. Fig54 (
Analysis of full length PRO1475 set forth in SEQ ID NO: 88) demonstrates the presence of the following: a transmembrane domain from about amino acid 38 to about amino acid 55 and a region of homology to mouse GNT1 from about amino acid 229 to about amino acid 660. Clone DNA61185-1646 was deposited with the ATCC on November 17, 1998,
ATCC Deposit No. 203464 has been assigned. The Dayhoff database (version 35) using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. 54 (SEQ ID NO: 88).
.45 SwissProt 35) analysis revealed that the amino acid sequence of PRO1475 and the following Dayh
off array: GNT1_MOUSE, CGU65792_1, CGU65791_1, P_R24781, CELF48E3_1, G786_
Significant homology was demonstrated with HUMAN, P_W06547, GNT1_CAEEL, 219_HUMAN and EF07_MOUSE.

Example 31: Isolation of a cDNA clone encoding human PRO1377 A yeast screen was performed in a human umbilical vein endothelial cell cDNA library in which the first DNA sequence, referred to herein as DNA46892, is predominantly at the 5'end of the primary cDNA clone. Was identified using. Based on the DNA46892 sequence, the following oligonucleotides were synthesized to produce PRO13 from a human fetal kidney cDNA library.
Used as a probe to isolate a full length coding sequence clone for 77: GTTG
TGGGTGAATAAAGGAGGGCAG (SEQ ID NO: 96); CTGTGCTCATGTTCATGGACAACTG (SEQ ID NO: 97); and GGATGATTTCATCTCCATTAGCCTGCTGTCTCTGGCTATGTTGGTGGGAT (SEQ ID NO: 98). The full-length DNA61608-1606 clone shown in Figure 55 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 149-151 and ending at the stop codon at nucleotide positions 1070-1072 (Fig55; SEQ ID NO: : 94). Predicted polypeptide precursor (F
ig56, SEQ ID NO: 95) is 307 amino acids long. About 3 for PRO1377
It has a calculated molecular weight of 2,251 daltons and an estimated pI of approximately 6.62. A further feature is a signal peptide of about amino acids 1-18; about amino acids 29-32 and 24.
1-244 potential N-glycosylation sites and about amino acids 37-56, 10
It contains 6-122, 211-230, 240-260, and 288-304 transmembrane domains. The Dayhoff database (version 35.45 Swis using the WU-BLAST-2 sequence alignment analysis of the full-length sequence shown in FIG. 56 (SEQ ID NO: 95).
sProt 35) analysis revealed that the PRO1377 amino acid sequence and the following Dayhoff sequence: C
ET01D3_6, CET28F3_4, CEF26D10_3, S66962, ATX2_YEAST, CEH13N06_8, S49959,
Some homology between YIC3_YEAST, G02273, and P_W35557 was revealed. Clone DNA61608-1606 has been deposited with the ATCC and is assigned ATCC deposit no. 203239. Example 32: Isolation of a cDNA clone encoding human PRO1326 By using the signal sequence algorithm described in Example 3 above, the EST cluster from the LIFESEQ database, named EST cluster number 59366, also referred to herein as "DNA10295". The sequence can be identified. This EST cluster sequence is then transferred to a public database (eg GenBank)
And company EST DNA database (LIFESEQ (trade name), Incyte Pharmaceutic
existing homology was identified by comparison with various expressed sequence tag (EST) databases, including als, Palo Alto, CA). The homologue search is the computer program BLAS
It was performed using T or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparables that do not encode a known protein and have a BLAST score of 70 (sometimes 90) or higher can be found in the program "phrap" (Phil Green, Uni
versity of Washington, Seattle, Washington)
The A sequence was constructed. One or more of the ESTs was derived from RNA isolated from tumor tissue removed from the penis of a man with squamous cell carcinoma. The consensus sequence obtained therefrom is herein designated DNA56257. In light of the sequence homology between the DNA56257 sequence and the EST sequence contained in Incyte's EST number 1450878, EST clone number 1450878 was purchased and the cDNA insert was obtained and sequenced in its entirety. The sequence of this cDNA insert is shown in Figure 57 and is herein designated as DNA62808-1582. The full-length clone shown in Figure 57 contains a single open reading frame, has an apparent translational initiation site at nucleotide positions 112-114, and terminates at the stop codon found at nucleotide positions 1315-1317 (F
ig57; SEQ ID NO: 99). The predicted polypeptide precursor (Fig58, SEQ ID NO: 100) is 401 amino acids long. Other features of PRO1326 are a signal sequence of about amino acids 1-29; a ribosomal protein S3Ae homology region of about amino acids 129-166; and a potential N-glycosylation of about amino acids 109-112, 144-147 and 398-401. Including parts. About 4 for PRO1326
It has a calculated molecular weight of 5,333 Daltons and an estimated pI of approximately 4.95. Clone DNA62808-1582 is ATC on October 20, 1998.
Deposited at C and assigned ATCC Deposit No. 203358. The Dayhoff database (version 35.45 Sw) using WU-BLAST-2 sequence alignment analysis of the full length sequence shown in FIG. 58 (SEQ ID NO: 100).
issProt 35), the PRO1326 amino acid sequence and the following Dayhoff sequence: AC004013_1, HROMHCEMB_1, CEF47A4_2, A45592, MYSP_HUMAN, NFU43192_1, ON
Some homology was revealed between GMBWMZ_1, CELC25A11_2, CELC25A11_1 and A42184.

Example 33: Isolation of a cDNA clone encoding human PRO1249 By using the signal sequence algorithm described in Example 3 above, IncyteE
It was possible to identify the EST cluster sequence from the Incyte database named ST cluster number 122605. This EST cluster sequence is then translated into public databases (eg GenBank) and corporate EST DNA databases (Lifes
Existing homology was identified by comparison with various expressed sequence tag (EST) databases, including eq (trade name), Incyte Pharmaceuticals, Palo Alto, CA). The homology search is performed by the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzy.
mology 266: 460-480 (1996)). A comparison that does not encode a known protein and has a BLAST score of 70 (sometimes 90) or higher is the program "phrap" (Phil Green, University of Washington, Seattle, Washingt.
on) to build a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated DNA56060. In view of the sequence homology between the DNA56060 sequence and the EST sequence contained in Incyte EST clone number 2630770, Incyte EST clone number 2
630770 was purchased and the cDNA insert was obtained and sequenced. The sequence of this cDNA insert is shown in Figure 59 and is herein designated as DNA62809-1531. Clone DNA62809-1531 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 3-5 and ending at the stop codon at nucleotide positions 3270-3272 (Fig59). The predicted polypeptide precursor is 1089 amino acids long (Fig60). Fig6
The full-length PRO1249 shown at 0 has an estimated molecular weight of about 118,699 daltons and a pI of about 8.49. Full length PR shown in Fig60 (SEQ ID NO: 102)
Analysis of O1249 demonstrates the presence of the following: a signal peptide from about amino acid 1 to about amino acid 16, from about amino acid position 317 to about amino acid position 341.
, About amino acid position 451 to about amino acid position 470, about amino acid position 481 to about amino acid position 500, about amino acid position 510 to about amino acid position 527, about amino acid position 538 to about amino acid position 555, about amino acid position 831 to about amino acid position 850. A transmembrane domain from about amino acid position 1016 to about amino acid position 1034 and about amino acid position 1052 to about amino acid position 1070, a leucine zipper pattern sequence from about amino acid 843 to about amino acid 864 and about amino acid 3;
7 to about amino acid 40 and about amino acid 268 to about amino acid 271 potential N
-Glycosylation site. Clone DNA62809-1531 is September 9, 1998.
It was deposited with the ATCC on the day and was assigned ATCC Deposit No. 203237. The Dayhoff database (version) using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. 60 (SEQ ID NO: 102).
35.45 SwissProt 35) analysis revealed that the amino acid sequence of PRO1249 and the following Da
yhoff array: AC004472_3, AB004539_7, S64782, S62432, YJG2_YEAST, CELC27A12
Significant homology was demonstrated between _8, YKQ5_YEAST, AB009505_3, SPBC24E9_8 and AF060218_4.

Example 34: Isolation of a cDNA clone encoding human PRO1315 As described in Example 1 above, conrap was used to assemble consensus DNA sequences for other ESTs. This consensus sequence is now DNA4563
Name it 9. Based on the DNA35925 consensus sequence, 1) to identify a cDNA library containing the sequence of interest by PCR, and 2) PRO1.
Oligonucleotides were synthesized for use as probes to isolate 315 full length coding sequence clones. PCR primers (forward and reverse) were synthesized: Forward PCR primer (35925.f1) 5'-CGCTGCTGCTGTTGCTCCTGG-3 '(SEQ ID NO: 105) Forward PCR primer (35925.f2) 5'-CAGTGTGCCAGGACTTTG-3' ( Sequence number:
106) Reverse PCR primer (35925.r1) 5'-AGTCGCAGGCAGCGTTGG-3 '(SEQ ID NO:
107) Reverse PCR primer (35925.r2) 5'-CTCCTCCGAGTCTGTGTGCTCCTGC-3 '(SEQ ID NO: 108) Further, a synthetic oligonucleotide hybridization probe was prepared from the consensus DNA35925 sequence having the following nucleotide sequence. Hybridization probe (35925.p1) 5'- GGACGGGCAGTTCCCTGTGTCTCTGGTGGTTTGCCTAAACCTGCAAACAT-3 '(SEQ ID NO: 109)
3.) To screen several libraries for a source of full length clones, DNA from the libraries was PCR amplified with the PCR primer pair identified above. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate clones encoding the PRO1315 gene with one of the primer pairs. RNA for making a cDNA library was isolated from human fetal brain tissue. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO1315 (herein designated as DNA62815-1576 [Fig61, SEQ ID NO: 103]); and the derived protein sequence for PRO1315. The entire nucleotide sequence of DNA62815-1576 is shown in Figure 61 (SEQ ID NO:
103). Clone DNA62815-1576 contains a single open reading frame, has an apparent translational initiation site at nucleotide positions 121-123, and ends at the apparent stop codon at nucleotide positions 1447-1449 (Fig 61). The predicted polypeptide precursor is 442 amino acids long (Fig62). The full-length PRO1315 protein shown in Figure 62 has a predicted molecular weight of about 49,932 daltons and a pI of about 4.55. Fig62
Analysis of full length PRO1315 set forth in (SEQ ID NO: 104) demonstrates the presence of the following: a signal peptide from about amino acid 1 to about amino acid 28, a transmembrane domain from about amino acid 140 to about amino acid 163, and about amino acid. 71 to about amino acid 74, about amino acid 80 to about amino acid 83, about amino acid 89 to about amino acid 92, about amino acid 204 to about amino acid 207, and about amino acid 423 to about amino acid 426 potential N-glycosylation sites. Clone DNA62815
-1576 was deposited with the ATCC on September 9, 1998, ATCC Deposit No. 20.
3247 was awarded. Using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. 62 (SEQ ID NO: 104), the Dayhoff database (version
35.45 SwissProt 35) analysis revealed that the amino acid sequence of PRO1315 and the following Da
yhoff array: MMU53696 _1, NVY08571_2, B64560, STMSLPE_1, P_R80508, P_W19258, A55817, GEN14043,
Significant homology was demonstrated between AE000768_7 and RNMUCASGP5_1pSMC.

Example 35: Isolation of a cDNA clone encoding human PRO1599 Incyte does not encode a known protein and has a BLAST score of 70 or higher.
EST number 1491360 was identified as the sequence of interest using the method described in Example 1. The nucleotide sequence of EST number 1491360 and its complement are designated herein as "DNA37192". 1) P based on the DNA37192 sequence
To identify a cDNA library containing the sequence of interest by CR, and 2)
Oligonucleotides were synthesized for use as probes to isolate clones of the PRO1599 full-length coding sequence. PCR primers (forward and reverse) were synthesized: Forward PCR primer: GACGTCTGCAACAGCTCCTGGAAG (37192.f1; SEQ ID NO: 1)
12) Reverse PCR primer: CGAGAAGGAAACGAGGCCGTGAG (37192.r1; SEQ ID NO: 11)
3) Further, a synthetic oligonucleotide hybridization probe was prepared from the consensus DNA37192 sequence having the following nucleotide sequence: Hybridization probe: TGACACTTACCATGCTCTGCACCCGCAGTGGGGACAGCCACAGA
(SEQ ID NO: 114) To screen several libraries for a source of full length clones, DNA from the libraries was PCR amplified with the PCR primer pair identified above. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate a clone encoding the PRO1599 gene with one of the primer pairs. RNA for making a cDNA library was isolated from human fetal liver tissue. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO1599 (designated herein as DNA62845-1684 [Fig63, SEQ ID NO: 110]); and the derived protein sequence for PRO1599. The entire coding sequence of PRO1599 is shown in Figure 63 (SEQ ID NO: 110). Clone DNA62845-1684 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 69-71 and an apparent stop codon at nucleotide positions 918-920. The predicted polypeptide precursor is 283 amino acids long. The full-length PRO1599 protein shown in Figure 64 has a predicted molecular weight of approximately 30,350 daltons and a pI of approximately 9.66. Other features of the PRO1599 protein are: a signal peptide at amino acids 1-30, potential N-glycosylation sites at amino acids 129-132 and 189-192; potential cAMP and cGMP-dependent protein kinases at about amino acids 263-241. Phosphorylation site; about amino acids 28-33, 55-60, 174-179,
And potential 236-241 N-myristoylation sites; about amino acid 144-1.
47 potential amidation sites; and about 70-75 serine proteases, the trypsin family, a histidine active site. Dayhoff database (version) using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. 64 (SEQ ID NO: 111).
35.45 SwissProt 35) analysis revealed that the amino acid sequence of PRO1599 and the following Da
yhoff sequence: Significant homology with CFAD_PIG was revealed. Homology is PRO
1599 amino acid sequence and the following Dayhoff sequence: CFAD_HUMAN; P_R05421; P_R55757;
P_R05772; GRAM_HUMAN; MUSLMET_1; P_P80335; P_R55758; A42048_1 and P_W053
It was also discovered between 83. Clone DNA62845-1684 was deposited with the ATCC on October 20, 1998 and was assigned ATCC deposit no. 203361.

Example 36: Isolation of a cDNA clone encoding human PRO1430 The DNA sequence designated herein as DNA49433 was obtained as described in Example 1 above. Identified from assembly as subject EST
Merck EST number T49469 was purchased and a cDNA insert was obtained and sequenced in its entirety. By DNA sequencing of the above-mentioned clones, we now see "DNA64842-163.
The full-length DNA sequence for PRO1430, designated 2 "(SEQ ID NO: 115), and the derived protein sequence for PRO1430 (SEQ ID NO: 116) were obtained. Clone DNA64842-1632 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 82-84 and an apparent stop codon at nucleotide positions 1075-1077. Fig
The full-length PRO1430 protein, shown at 66, has a predicted molecular weight of about 35,932 daltons and a pI of about 8.45. The predicted polypeptide precursor is 331 amino acids long. Still other features are a signal peptide of about amino acids 1-17; a potential N-glycosylation site of about amino acids 171-174; about amino acids 29-51.
, 116-126, 180-217, and 222-230 short chain alcohol dehydrogenase family proteins. Dayhoff database (version) using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. 66 (SEQ ID NO: 116).
35.45 SwissProt 35) analysis revealed that the amino acid sequence of PRO1430 and the following Da
Significant homology with yhoff SEQ ID NO: P_W03198 was revealed. Homology is PR
O1430 amino acid sequence and the following Dayhoff sequence: MTV030_10, MTV037_2, A40116_1
, S42651, CEC15H11_6, SPCC736_13, SCU43704_1, S19842, OXIR_STRAT, and OX
It was also discovered with IR_STRLI. Clone DNA64842-1632 has been deposited with the ATCC and is assigned ATCC deposit no.

Example 37: Isolation of a cDNA clone encoding human PRO1374 A consensus DNA sequence was constructed against other EST sequences using the phrap method as described in Example 1 above. This consensus sequence is DN here
It was named A47357. 1) based on the DNA47357 consensus sequence
To identify a cDNA library containing the sequence of interest by PCR, and 2
3.) Oligonucleotides were synthesized for use as probes to isolate clones of the full-length coding sequence for PRO1374. PCR primers (forward and reverse) were synthesized: Forward PCR primer: 5'CGGGACAGGAGACCCAGAAAGGG3 '(SEQ ID NO: 119) Reverse PCR primer: 5'GGCCAAGTGATCCAAGGCATCTTC3' (SEQ ID NO: 120) Furthermore, the synthetic oligonucleotide hybridization probe is , Consensus DNA47357 sequence having the following nucleotide sequence: Hybridization probe: 5'CTGCGGGACCTGACTAGATTCTACGACAAGGTACTTTCTTTGC
ATGGGG 3 '(SEQ ID NO: 121) To screen several libraries against a source of full length clones, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. The positive library was then used to isolate clones encoding the PRO1374 gene using one of the probe oligonucleotides and PCR primers. RNA for the construction of a cDNA library was isolated from human bone marrow tissue. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO1374 and the derived protein sequence for PRO1374. The entire coding sequence of DNA1374 is shown in Figure 67 (SEQ ID NO: 117). Clone DNA64849-1604 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 20-22 and an apparent stop codon at nucleotide positions 1653-1655 (SEQ ID NO: 11).
7). The predicted polypeptide precursor is 544 amino acids long. The approximate positions of the signal peptide, N-glycosylation site, leucine zipper pattern and ribonucleic acid reductase small subunit signature are shown in Figure 68. Clone DNA64849-1604 has been deposited with the ATCC, ATCC Deposit No. 203
468 was awarded. The full-length PRO1374 protein shown in FIG.
, 126 Daltons and a pI of about 6.4. Dayhoff database (version) using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. 68 (SEQ ID NO: 118).
35.45 SwissProt 35) analysis revealed that the amino acid sequence of PRO1374 and the following Da
yhoff array (data is taken in here): CEF35G2_4, P_W37046, S44204, CET28D
6_1, CET20B3_6, CELC14E2_3, CUAL_CHICK, ATM7J2_3, S74997 and HIVH5994R8_1
Significant homology between and was demonstrated.

Example 38: Isolation of a cDNA clone encoding human PRO1311 The cDNA sequence isolated by the amylase screen described in Example 2 above is herein designated DNA37721. The DNA37721 sequence is then sequenced into public databases (eg GenBank) and corporate EST DNA databases (LIFES
Existing homology was identified by comparison with various expressed sequence tag (EST) databases, including EQ (trade name), Incyte Pharmaceuticals, Palo Alto, CA). The homology search is performed by the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzy.
mology 266: 460-480 (1996)). A comparison that does not encode a known protein and has a BLAST score of 70 (sometimes 90) or higher is the program "phrap" (Phil Green, University of Washington, Seattle, Washingt.
on) to build a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated DNA48616. An oligonucleotide probe was created based on the DNA48616 sequence and used to screen a human bone marrow library prepared as described in paragraph 1 of Example 2 above. The cloning vector is pRK5B (pRK5B is a precursor of pRK5D that does not contain an SfiI site; Holmes et al., Science, 253:
1278-1280 (1991)), the size of the cleaved cDNA was less than 2800 bp. PCR primers (forward and reverse) were synthesized: Forward PCR primer (48616.f1): 5'-ATCATCTATTCCACCGTGTTCTGGC-3 '(SEQ ID NO: 124) Reverse PCR primer (48616.r1): 5'-GGGAACTGCTATCTGATGCC-3 '(SEQ ID NO: 125) Furthermore, a synthetic oligonucleotide hybridization probe was made from the DNA45499 sequence having the following nucleotide sequence: Hybridization probe (48616.p1): 5'- CCTGTCTGTGGGCATCTATGCAGAGGTTGAGCGGCAGAAATATAAAACCC-3 '(SEQ ID NO: 126)
3.) To screen several libraries for a source of full length clones, DNA from the libraries was PCR amplified with the PCR primer pair identified above. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate a clone encoding the PRO1311 gene with one of the primer pairs. A full-length clone was identified that contains a single open reading frame with an apparent translational initiation site at nucleotide positions 195-197 and a stop codon at nucleotide positions 1077-1079 (Fig69; SEQ ID NO: 12).
2). The predicted polypeptide precursor is 294 amino acids long and contains approximately 33,21
It has a calculated molecular weight of 1 Dalton and an estimated pI of about 5.35. Additional features include a signal sequence of about amino acids 1-44, about amino acids 22-42, 57-85,
94-116, and possible transmembrane domains of 230-257, about amino acid 118
-121, 1899-192 and 230-233 potential N-glycosylation sites, about amino acids 3-11 and 129-136 potential tyrosine kinase phosphorylation sites, about amino acids 80-85, 109-114, 180. -185,218-2
23, 248-253, 276-281, 285-290 and 287-292 N-myristoylation sites and cell attachment sequences of about amino acids 3-5. Dayhoff database (version 35.45 Sw) using WU-BLAST-2 sequence alignment analysis of the full length sequence shown in FIG. 70 (SEQ ID NO: 123).
issProt 35), the PRO1311 amino acid sequence and the following Dayhoff sequences: AF065389_1, AF053455_1, CD63_HUMAN, A15_HUMAN, AF043906_1, C151_HUMAN,
Significant homology was demonstrated with AF053453_1, AF054838_1, P_R91446, and CD82_HUMAN. Clone DNA64863-1573 was deposited with the ATCC on September 9, 1998 and was assigned ATCC deposit no. 203251.

Example 39: Isolation of a cDNA clone encoding human PRO1357 By using the signal sequence algorithm described in Example 3 above, Incy
It was possible to identify the EST cluster sequence from the Incyte database, which was named te EST cluster SEQ ID NO: 69537. This EST cluster sequence is then converted into a public EST database (eg GenBank) and a company ES.
TDNA database (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto
, CA) and compared the various expressed sequence tag (EST) databases to identify existing homologies. The homology search is performed by the computer program BLAST or BLAST2 (A
ltschul et al., Methods in Enzymology 266: 460-480 (1996)).
Comparables that do not encode a known protein and have a BLAST score of 70 (sometimes 90) or higher are the programs "phrap" (Phil Green, University of Was.
hington, Seattle, Washington) to construct a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated DNA56034. In view of the sequence homology between the DNA56034 sequence and the EST sequence contained in Incyte's EST clone number 936239, Incyte's EST clone number 636239 was purchased and the cDNA insert was obtained and sequenced. This cDNA
The sequence of the insert is shown in Figure 71 and is herein designated as DNA64881-1602. Clone DNA64881-1602 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 74-76 and ending at the stop codon at nucleotide positions 1526-1528 (Fig 71). The predicted polypeptide precursor is 484 amino acids long (Fig72). Fig
The full-length PRO1357 protein shown at 72 has a predicted molecular weight of about 52,468 and a pI of about 7.14. Full length P shown in Figure 72 (SEQ ID NO: 128)
Analysis of RO1357 demonstrates the presence of the following: a signal peptide from about amino acids 1 to about amino acids 21, a potential amino acid from about amino acids 48 to about amino acids 51, about amino acids 264 to about amino acids 267 and about amino acids 401 to about amino acids 404. A block of amino acids having homologous N-glycosylation sites, glycosaminoglycan attachment sites from about amino acids 412 to about amino acids 415, and homology to the LBP / BPI / CETP family of proteins from about amino acids 407 to about amino acids 457. Clone DNA64881-1602 was cloned into ATCC on September 9, 1998.
And has been assigned ATCC deposit no. 203240. Dayhoff database (version) using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. 72 (SEQ ID NO: 128).
35.45 SwissProt 35) analysis revealed that the amino acid sequence of PRO1357 and the following Da
yhoff array: MMU46068_1, S17447, MMU1_1, BPI_RABIT, P_W16808, P_R21844, PS
Significant homology was demonstrated between P_MOUSE, HSLBPEX1_1 and BTU79413_1.

Example 40: Isolation of a cDNA clone encoding human PRO1244 The use of the signal sequence algorithm described in Example 3 above allows the identification of EST cluster sequences from the LIFESEQ database designated as EST cluster number 7874. Became. This EST cluster sequence is then converted into a public database (eg GenBank) and a corporate EST DNA database (LIFESEQ).
Existing homology was identified by comparison with various expressed sequence tag (EST) databases, including (trade name), Incyte Pharmaceuticals, Palo Alto, CA). One or more of the ESTs was removed from a library prepared from cavernosal tissue. The homology search is performed by the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymolo.
gy 266: 460-480 (1996)). Does not encode a known protein,
Comparables with a BLAST score of 70 (sometimes 90) or higher are programs "phrap" (Phil Green, University of Washington, Seattle, Washington)
Were assembled into a consensus DNA sequence. CDN prepared from RNA isolated from inflammatory human adenoid tissue (s) used for construction
Retrieved from the A library. The consensus sequence obtained therefrom is herein designated DNA56011. In view of the sequence homology between the DNA56011 sequence and the EST sequence contained in Incyte EST number 3202349, EST clone number 3202349 was purchased and the cDNA insert was obtained and sequenced. The sequence of this cDNA insert is Fi
It is shown in g73 (SEQ ID NO: 129) and is herein designated as DNA64883-1526. The full-length clone shown in Figure 73 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 9-11 and ending at the stop codon found at nucleotide positions 1014-1016 (Fig7.
3; SEQ ID NO: 129). The predicted polypeptide precursor (Fig74, SEQ ID NO: 130) is 335 amino acids long. PRO1244 has a calculated molecular weight of approximately 38,037 daltons and an estimated pI of approximately 9.87. Another feature is a signal peptide of about amino acids 1-29; about amino acids 183-205, 217-237,2.
71-287, and 301-321 transmembrane domains; about amino acids 1-74, and 215-218 potential N-glycosylation sites; and about amino acids 150-1.
Includes 52 cell attachment sequences. Dayhoff database (version 35.45 Sw) using WU-BLAST-2 sequence alignment analysis of the full length sequence shown in Figure 74 (SEQ ID NO: 130).
issProt 35), the PRO1244 amino acid sequence and the following Dayhoff SEQ ID NOs: AF008554_1, P_485334, G02297, HUMN33S11_1, HUMN33S10_1, Y013_CAEE
The homology between L, GEN13255, S49758, E70107 and ERP5_MEDSA was revealed. Clone DNA64883-1526 was deposited with the ATCC on September 9, 1998 and was assigned ATCC deposit no. 203253.

Example 41: Isolation of a cDNA clone encoding human PRO1246 By using the signal sequence algorithm described in Example 3 above, Incy
It was possible to identify the EST cluster sequence from the Incyte database, which was named te EST cluster SEQ ID NO: 56853. This EST cluster sequence is then converted into a public EST database (eg GenBank) and a company ES.
TDNA database (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto
, CA) and compared the various expressed sequence tag (EST) databases to identify existing homologies. The homology search is performed by the computer program BLAST or BLAST2 (A
ltschul et al., Methods in Enzymology 266: 460-480 (1996)).
Comparables that do not encode a known protein and have a BLAST score of 70 (sometimes 90) or higher are the programs "phrap" (Phil Green, University of Was.
hington, Seattle, Washington) to construct a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated DNA56021. In view of the sequence homology between the DNA56021 sequence and the EST sequence contained in Incyte's EST clone no. 2481345, Incyte's EST clone no. 2481345 was purchased and the cDNA insert was obtained and sequenced. This cd
The sequence of the NA insert is shown in Figure 75 and is herein designated as DNA64885-1529. Clone DNA64885-1529 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 119-121 and ending at the stop codon at nucleotide positions 1727-1729 (Fig75).
. The predicted polypeptide precursor is 536 amino acids long (Figure 76). F
The full-length PRO1246 protein shown in ig76 has a predicted molecular weight of approximately 61,450 and a pI of approximately 9.17. Analysis of full length PRO1246 shown in Figure 76 (SEQ ID NO: 132) demonstrates the presence of the following: a signal peptide of about amino acids 1 to about amino acids 15, about amino acids 108 to about amino acids 111,
About amino acid 166 to about amino acid 169, about amino acid 193 to about amino acid 19
6, about amino acids 262 to about amino acids 265, about amino acids 375 to about amino acids 378, about amino acids 413 to about amino acids 416 and about amino acids 498 to about amino acids 501, and about amino acids 286 to about amino acids 315. , An amino acid sequence block having homology to the sulfatase protein from about amino acids 359 to about amino acids 369 and about amino acids 78 to about amino acids 97. Clone DNA64885-1529 was ATC on November 3, 1998.
Deposited at C and assigned ATCC Deposit No. 203457. The Dayhoff database (version) using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. 76 (SEQ ID NO: 132).
35.45 SwissProt 35), and the amino acid sequence of PRO1246 and the following Da
yhoff array: P_R51355, CELK09C4_1, BCU44852_1, IDS_HUMAN, G65169, E64903,
Significant homology was demonstrated between ARSA_HUMAN, GL6S_HUMAN, HSARSF_1 and GEN12648.

Example 42: Isolation of a cDNA clone encoding human PRO1356 By using the signal sequence algorithm described in Example 3 above, Incy
It was possible to identify the EST cluster sequence from the Incyte database, named te EST cluster SEQ ID NO: 44725. This EST cluster sequence is then converted into a public EST database (eg GenBank) and a company ES.
TDNA database (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto
, CA) and compared the various expressed sequence tag (EST) databases to identify existing homologies. The homology search is performed by the computer program BLAST or BLAST2 (A
ltschul et al., Methods in Enzymology 266: 460-480 (1996)).
Comparables that do not encode a known protein and have a BLAST score of 70 (sometimes 90) or higher are the programs "phrap" (Phil Green, University of Was.
hington, Seattle, Washington) to construct a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated DNA56023. In view of the sequence homology between the DNA56023 sequence and the EST sequence contained in Incyte EST clone no. 4071746, Incyte's EST clone no. 4071746 was purchased and the cDNA insert was obtained and sequenced. This cd
The sequence of the NA insert is shown in Figure 77 and is herein designated as DNA64886-1601. Clone DNA64886-1601 contains a single open reading frame, has an apparent translational initiation site at nucleotide positions 122-124, and ends at the stop codon at nucleotide positions 812-814 (Fig 77). The predicted polypeptide precursor is 230 amino acids long (Fig78). Fig
The full-length PRO1356 protein shown at 78 has a predicted molecular weight of about 24,549 and a pI of about 8.56. Full length P shown in Fig78 (SEQ ID NO: 134)
Analysis of RO1356 demonstrates the presence of the following: a signal peptide of about amino acids 1 to about amino acids 24, about amino acids 82 to about amino acids 102, about amino acids 117 to about amino acids 140 and about amino acids 163 to about amino acids 182 transmembrane. Domain, a potential N-glycosylation site from about amino acid 190 to about amino acid 193, and a protein PMP-22 from about amino acid 46 to about amino acid 59.
Amino acid sequence block with homology to the / EMP / MP20 family. Clone DNA64886-1601 was deposited with the ATCC on September 9, 1998 and was assigned ATCC deposit no. 203241. Dayhoff database (version) using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. 78 (SEQ ID NO: 134).
35.45 SwissProt 35) analysis revealed that the amino acid sequence of PRO1356 and the following Da
yhoff array: AB00014_1, AB000712_1, A39484, AF000959_1, AF035814_1, HSU899
Significant homology was demonstrated between 16_1, MMU19582_1, P_R30059, HUAC004125_1 and PM22_RAT.

Example 43: Isolation of a cDNA Clone Encoding Human PRO1275 A new secreted molecule, herein designated DNA57700, was identified as a database of Incyte's (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, Calif.) Company and GenBan.
Used for BLAST against k public databases. Identify positive clones,
Used to generate an assembly file with the seqext program. The search was performed by the computer program BLAST or BLAST2 [Altschul et al., Methods in Enzymology 266: 46 as a comparison of ECD protein sequences with 6-frame translation of EST sequences.
0-480 (1996)]. Comparatives that do not encode a known protein and have a BLAST score of 70 (or 90 in some cases) or higher are those of the program "ph
rap ”(Phil Green, University of Washington, Seattle, Washington) to construct a consensus DNA sequence. The consensus DNA sequence is transformed into another E using the BLAST and phrap repeat cycles.
Constructed against ST sequence. This consensus sequence is referred to here as "DNA59572.
". Based on the association of the DNA59572 consensus sequence with the sequence identified in the assembly, one of the clones containing one of the sequences in the assembly (Incyte clone 2026581) was purchased and sequenced. Incyte clone 202658
1 was obtained from a library made from RNA from epidermal breast keratinocytes. The entire coding sequence of PRO1275 is shown in Figure 79 (SEQ ID NO: 135). Clone DNA64888-1542 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 37-39 and an apparent stop codon at nucleotide positions 394-396 (SEQ ID NO: 135). The predicted polypeptide precursor is 119 amino acids long. The signal peptide is about amino acids 1-25 (SEQ ID NO: 136). The signal peptide is located at about amino acids 1-25 of SEQ ID NO: 136. Clone DNA64888-1542
Was deposited with the ATCC and was assigned ATCC deposit no. 203249. Fig7
The full-length PRO1275 protein shown in 9 has a predicted molecular weight of approximately 13,248 daltons and a pI of approximately 7.78. Dayhoff database (version 35.45 Sw) using WU-BLAST-2 sequence alignment analysis of the full length sequence shown in FIG. 80 (SEQ ID NO: 136).
issProt 35) and the PRO1275 amino acid sequence and the following Dayhoff sequence (information from the database incorporated here): B48151 (Mst98Cb), D86424_1 (
High sulfur keratin protein), P_R79964 (connective tissue growth factor), CHRD_RAT (chordin), MT_DREPO (metallothionein), PL05_PLETR (plectoxin (plec
toxins)), P_R25156 (Ig antigen), S73732_1 (VLDP), AF025440_1 (0IP4) and P_R327
Sequence identity with 57 (IGF-II) was revealed.

Example 44: Isolation of a cDNA Clone Encoding Human PRO1274 A novel secretory molecule, herein designated DNA57700, was identified as a database of Incyte's (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, Calif.) Company and GenBan.
Used for BLAST against k public databases. Identify positive clones,
Used to generate an assembly file with the seqext program. The search was performed by the computer program BLAST or BLAST2 [Altschul et al., Methods in Enzymology 266: 46 as a comparison of ECD protein sequences with 6-frame translation of EST sequences.
0-480 (1996)]. Comparatives that do not encode a known protein and have a BLAST score of 70 (or 90 in some cases) or higher are those of the program "ph
rap ”(Phil Green, University of Washington, Seattle, Washington) to construct a consensus DNA sequence. The consensus DNA sequence is transformed into another E using the BLAST and phrap repeat cycles.
Constructed against ST sequence. This consensus sequence can be found here as "DNA59573
". Based on the association of the DNA59573 consensus sequence with the sequence identified in the assembly, one of the clones containing one of the sequences in the assembly (Incyte clone 2623992) was purchased and sequenced. Incyte clone 262399
2 was obtained from a library made from RNA from epidermal breast keratinocytes. The entire coding sequence of PRO1274 is shown in Figure 81 (SEQ ID NO: 137). Clone DNA64889-1541 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 24-26, and an apparent stop codon at nucleotide positions 354-356 (SEQ ID NO: 137). The predicted polypeptide precursor is 110 amino acids long. The signal peptide is about amino acids 1-24 of SEQ ID NO: 138. The conserved regions and N-glycosylation sites in the insulin family of proteins are shown in Figure 82.
Clone DNA64889-1541 has been deposited with the ATCC and is assigned ATCC deposit no. 203250. The full-length PRO1274 protein shown in Figure 82 has a predicted molecular weight of approximately 12,363 daltons and a pI of approximately 8.31. The Dayhoff database (version 35.45 Sw) using WU-BLAST-2 sequence alignment analysis of the full length sequence shown in FIG. 82 (SEQ ID NO: 138).
issProt 35) and the PRO1274 amino acid sequence and the following Dayhoff sequence (information from the database incorporated here): CEW05B2_9, AF016922_1 (insulin-like growth factor 1), B48151, A53640, BTIGF2REC_1 (insulin-like growth factor 2).
, HSNF1GEN12_1, TXA3_RADMA (Neurotoxin 3), CXM1_CONGE, P_P61301, TX
Sequence identity with A4_RADMA (neurotoxin 4) was revealed.

Example 45: Isolation of a cDNA clone encoding human PRO1412 By using the signal sequence algorithm described in Example 3 above, Incy
te EST cluster SEQ ID NO: 101368, where "DNA10
It is now possible to identify EST cluster sequences from the Incyte database, also referred to as "643". This EST cluster sequence is then transformed into various expressed sequence tags (including public EST databases (eg GenBank) and corporate EST DNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alto, CA).
EST) database to identify existing homologies. The homolog search is
Computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology
266: 460-480 (1996)). BL does not code for known proteins
Comparisons with an AST score of 70 (sometimes 90) or higher were assembled with the program "phrap" (Phil Green, University of Washington, Seattle, Washington) to build consensus DNA sequences. One or more of the ESTs was derived from RNA isolated from prostate stromal fibroblasts removed from male fetuses. The consensus sequence obtained therefrom is herein designated DNA58754. In view of the sequence homology between the DNA58754 sequence and the EST sequence contained in Incyte EST clone no. 3597385, Incyte EST clone no. 3597385 was purchased and the cDNA insert was obtained and sequenced. This cd
The sequence of the NA insert is shown in Figure 83 and is herein designated as DNA64897-1628. The full-length clone shown in Figure 83 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 142-144 and ending at the stop codon at nucleotide positions 1075-1077 (Fig83; SEQ ID NO: 139). . Predicted polypeptide precursor (Fig84, SEQ ID NO: 14)
0) is 311 amino acids long. Other features of PRO1412 are: about amino acids 1-
28 signal peptides; transmembrane domains of about amino acids 190-216; about amino acids 49-52, 91-94, 108-111, 128-131, 135-13.
8 and 190-193 potential N-glycosylation sites; about amino acids 62-69
And a lysosomal associated membrane glycoprotein replication domain of about amino acids 183-224. PRO1412 has a calculated molecular weight of about 33,908 daltons and an estimated pI of about 6.87. Clone DNA6489
7-1628 was deposited with the ATCC on September 15, 1998 and was assigned ATCC deposit no. 203216. Dayhoff database (version 35.45 Sw) using WU-BLAST-2 sequence alignment analysis of the full length sequence shown in FIG. 84 (SEQ ID NO: 140).
issProt 35), the PRO1412 amino acid sequence and the following Dayhoff SEQ ID NOs: I50116, AF035963_1, NCA2_RAT, I61783, P_W07682, MMHC135G15_3, S214.
A significant sequence identity was revealed between 61, MMIGL2_1, ONHIGMV9A_1 and MMU70448_1.

Example 46: Isolation of a cDNA clone encoding human PRO1557 By using the signal sequence algorithm described in Example 3 above, "DNA
It enabled the identification of an EST cluster sequence from the Genentech database, named "58763". This EST sequence was then compared to various expressed sequence tag (EST) databases, including the EST database listed above, to identify existing homologies. The homology search is performed by the computer program BLAST or BLAST.
2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparables that do not encode a known protein and have a BLAST score of 70 (sometimes 90) or higher are those that have the program "phrap" (Phil Green, University of
(Washington, Seattle, Washington) to construct a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated DNA58763. DNA58763 sequence and EST contained in EST clone number 2267403
In view of sequence homology with the sequence, EST clone number 2267403 was purchased and the cDNA insert was obtained and sequenced. The sequence of this cDNA insert is
And is herein designated as DNA64902-1667. The full-length clone shown in Figure 85 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 287-289, and ending at the stop codon at nucleotide positions 1640-1642 (Fig85; SEQ ID NO: 141). . Predicted polypeptide precursor (Fig86, SEQ ID NO: 14
2) is 451 amino acids long. PRO1557 has a calculated molecular weight of about 49,675 daltons and an estimated pI of about 7.15. Further features are: about amino acids 1-2
5 signal peptide; a potential N-glycosylation site at about amino acids 114-117; a potential cAMP and cGMP-dependent protein kinase phosphorylation site at about amino acids 388-41; about amino acids 54-49, 66-71. 146-151
, And 367-372 potential N-myristoylation sites; about amino acid 36-3.
9 and 205-208 potential amination sites; and about amino acids 151-258.
ATP / GTP binding site motif A (P-loop). Dayhoff database (version) using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. 86 (SEQ ID NO: 142).
35.45 SwissProt 35) analysis revealed that the amino acid sequence of PRO1557 and Dayhoff
A significant homology with the sequence: AF03460 was revealed. Homology is also PRO1
557 amino acid sequence and the following Dayhoff sequence: P_W31559, AF031230_1, SOG_DROME
, CA11_MOUSE, P_R41320, CHRD_RAT, P_W40288, NEL_CHICK, and HSMUC5B_1. Clone DNA64902-1667 was deposited with the ATCC on October 6, 1998 and was assigned ATCC deposit no. 203317.

Example 47: Isolation of a cDNA clone encoding human PRO1286 The use of the signal sequence algorithm described in Example 3 above allows the identification of EST cluster sequences from the LIFESEQ database designated EST cluster number 86809. Became. This EST cluster sequence is then translated into public databases (eg GenBank) and corporate EST DNA databases (LIFES
Existing homology was identified by comparison with various expressed sequence tag (EST) databases, including EQ (trade name), Incyte Pharmaceuticals, Palo Alto, CA). The homology search is performed by the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzy.
mology 266: 460-480 (1996)). A comparison that does not encode a known protein and has a BLAST score of 70 (sometimes 90) or higher is the program "phrap" (Phil Green, University of Washington, Seattle, Washingt.
on) to build a consensus DNA sequence. ESTs in the assembly included those identified from tumors, cell lines, or diseased tissue. One or more of the ESTs was obtained from a cDNA library made from RNA isolated from diseased colon tissue. The consensus sequence obtained therefrom is herein referred to as DNA58822.
To name. In view of the sequence homology between the DNA58822 sequence and the EST sequence contained in Incyte's EST number 1695434, EST clone number 1695434 was purchased and the cDNA insert was obtained and sequenced. The sequence of this cDNA insert is Fi
It is shown in g87 and is herein designated as DNA64903-1553. (SEQ ID NO: 1
43) The full length clone shown in Figure 87 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 93-95 and ending at the stop codon found at nucleotide positions 372-374 (Fig87
SEQ ID NO: 143). The predicted polypeptide precursor (Fig88, SEQ ID NO: 144) is a signal sequence of about amino acids 1-18 and 93 amino acids in length with the signal sequence at about amino acids 1-18. PRO1286 has a calculated molecular weight of about 10,111 daltons and an estimated pI of about 9.70. Dayhoff database (version 35.45 Sw) using WU-BLAST-2 sequence alignment analysis of the full length sequence shown in Figure 88 (SEQ ID NO: 144).
issProt 35), the PRO1286 amino acid sequence and the following Dayhoff sequences: SR5C_ARATH, CELC17H12_11, MCPD_ENTAE, JQ2283, INVO_LEMCA, P_R07309, AD
Some homology was revealed between EVBCAGN_4, AF020947_1, CELT23H2_1, and MDH_STRAR. Clone DNA64903-1553 was deposited with the ATCC on September 15, 1998, and was assigned ATCC deposit no. 203223.

Example 48: Isolation of a cDNA clone encoding human PRO1294 The use of the signal sequence algorithm described in Example 3 above allows the identification of EST cluster sequences from the LIFESEQ database designated as EST cluster number 10559. Became. This EST cluster sequence is then translated into public databases (eg GenBank) and corporate EST DNA databases (LIFES
Existing homology was identified by comparison with various expressed sequence tag (EST) databases, including EQ (trade name), Incyte Pharmaceuticals, Palo Alto, CA). The homology search is performed by the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzy.
mology 266: 460-480 (1996)). A comparison that does not encode a known protein and has a BLAST score of 70 (sometimes 90) or higher is the program "phrap" (Phil Green, University of Washington, Seattle, Washingt.
on) to build a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated DNA57203. In view of the sequence homology between the DNA57203 sequence and the EST sequence contained in Incyte's EST number 3037763, EST clone number 3037763 was purchased and the cDNA insert was obtained and sequenced. The sequence of this cDNA insert is Fi
It is shown in g89 and is herein designated as DNA64905-1558. Clone DNA64905-1558 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 110-112 and ending at the stop codon at nucleotide positions 1328-1330 (Fig89).
. The predicted polypeptide precursor is 406 amino acids long (Fig90). F
The full-length PRO1294 protein shown at ig90 has a predicted molecular weight of about 46,038 and a pI of about 6.50. Analysis of full length PRO1294 shown in Figure 90 (SEQ ID NO: 146) demonstrates the presence of the following: a signal peptide from about amino acids 1 to about amino acids 21 and about amino acids 177 to about amino acids 180.
And a potential N-glycosylation site from about amino acid 248 to about amino acid 251.
Clone DNA64905-1558 was deposited with the ATCC on September 15, 1998 and was assigned ATCC deposit no. Using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in Fig90 (SEQ ID NO: 146), the Dayhoff database (version
35.45 SwissProt 35) analysis revealed that the amino acid sequence of PRO1294 and the following Da
yhoff array: I73636, AF028740_1, AB006686S3_1, P_R98225, RNU78105_1, CELC4
Significant homology was demonstrated with 8E7_4, CEF11C3_3, SCP1_MESAU, TPM3_HUMAN and CELK05B2_3.

Example 49: Isolation of a cDNA clone encoding human PRO1347 Consensus DNA sequences were constructed against other EST sequences using the phrap method as described in Example 1 above. This consensus sequence is DN here
It was named A47373. 1) based on the DNA47373 consensus sequence
To identify a cDNA library containing the sequence of interest by PCR, and 2
3.) Oligonucleotides were synthesized for use as probes to isolate clones of the full-length coding sequence for PRO1347. PCR primers (forward and reverse) were synthesized: Forward PCR primer 5'GCGTGGTCCACCTCTACAGGGACG3 '(SEQ ID NO: 149) Reverse PCR primer 5'GGAACTGACCCAGTGCTGACACC3' (SEQ ID NO: 150) Furthermore, the synthetic oligonucleotide hybridization probe was as follows: Was prepared from the consensus DNA47373 sequence having the nucleotide sequence of Hybridization probe: 5'GCAGATGCCACAGTATCAAGGCAGGACAAA ACTGGTGAAG GATTC3 '(SEQ ID NO: 151) To screen several libraries for a source of full-length clones, DNA from the libraries was PCR amplified with the PCR primer pair identified above. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate a clone encoding the PRO1347 gene with one of the primer pairs. RNA for the construction of a cDNA library was isolated from human bone marrow tissue. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence of PRO1347 and the derived protein sequence of PRO1347. The entire sequence of PRO1347 is shown in Figure 91 (SEQ ID NO: 147). Clone DNA64950-1590 contains a single open reading frame,
It has an apparent translational initiation site at nucleotide positions 183-185 and an apparent stop codon at nucleotide positions 1683-1685 (SEQ ID NO: 147). The predicted polypeptide precursor is 500 amino acids long. The signal peptide is about amino acids 1-17 and the transmembrane domain is about amino acids 239-255 (SEQ ID NO:
148). Clone DNA64950-1590 has been deposited with the ATCC,
ATCC Deposit No. 203224 has been assigned. Full length PRO13 shown in Fig92
The 47 protein has an estimated molecular weight of approximately 56,748 daltons and a pI of approximately 8.5. Dayhoff database (version) using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. 92 (SEQ ID NO: 148).
35.45 SwissProt 35) analysis revealed that the amino acid sequence of PRO1347 and the following Da
yhoff array: BUTY_HUMAN, AF033107_1, HSU90142_1, HSU90144_1, HSB73_1, HS11
The sequence identity between 1M5_2, R052_HUMAN, AF018080_1, HSAJ03147_4, and MOG_MOUSE was revealed.

Example 50: Isolation of a cDNA clone encoding human PRO1305 Consensus DNA sequences were constructed against other EST sequences using the phrap method as described in Example 1 above. This consensus sequence is DN here
It was named A38103. 1) based on the DNA38103 consensus sequence
To identify a cDNA library containing the sequence of interest by PCR, and 2
3.) Oligonucleotides were synthesized for use as probes to isolate clones of the full-length coding sequence of PRO1305. PCR primers (forward and reverse) were synthesized: Forward PCR primer (38103.f1) 5'-AACTGCTCTGTGGTTGGAAGCCTG-3 '(SEQ ID NO: 154) Reverse PCR primer (38103.r1) 5'-CAGTCACATGGCTGACAGACCCAC-3' ( SEQ ID NO: 155) Furthermore, a synthetic oligonucleotide hybridization probe was made from the consensus DNA38103 sequence with the following nucleotide sequence: Hybridization probe (38103.p1): 5'-AGGTTATCAGGGGCTTCACTGTGAAACCTGCAAAGAGG-3 '(SEQ ID NO: 156) To screen several libraries for a source of full-length clones, PCR primer pairs identified above from DNA from libraries It was amplified by PCR. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate clones encoding the PRO1305 gene with one of the primer pairs. RNA for the construction of a cDNA library was isolated from human bone marrow tissue. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO1305 (designated herein as DNA64952-1568 [Fig93, SEQ ID NO: 152]); and the derived protein sequence for PRO1305. The entire nucleotide sequence of DNA64952-1568 is shown in Figure 93 (SEQ ID NO:
152). Clone DNA64952-1568 contains a single open reading frame, has an apparent translational initiation site at nucleotide positions 126-128, and ends at the apparent stop codon at nucleotide positions 900-902 (Fig93). The predicted polypeptide precursor is 258 amino acids long (Fig94). The full-length PRO1305 protein shown in FIG.
It has an estimated molecular weight of 716 Daltons and a pI of about 8.13. Analysis of the full length PRO1305 sequence shown in Figure 94 (SEQ ID NO: 153) demonstrates the presence of the following: a signal peptide from about amino acid 1 to about amino acid 25, about amino acid 3
0 to about amino acid 33, about amino acid 172 to about amino acid 175, about amino acid 1
95 to about amino acid 198, about amino acid 208 to about amino acid 211 and about amino acid 235 to about amino acid 238 potential N-glycosylation sites and about amino acid 214 to about amino acid 225 EGF-like cysteine pattern signature sequences. Clone DNA64952-1568 was deposited with the ATCC on September 15, 1998 and was assigned ATCC deposit no. 203222. Dayhoff database (version) using the WU-BLAST2 sequence alignment analysis method of the full-length sequence shown in FIG. 94 (SEQ ID NO: 153).
35.45 SwissProt 35) analysis revealed that the amino acid sequence of PRO1305 and the following Da
yhoff array (data is taken in here): CET22A_3, LMA2_MOUSE, AF055580_1, A
F016903_1, LMB2_MOUSE, P_R71730, LMB3_MOUSE, LMG1_HUMAN, LMG1_DROME and L
Significant homology with MA5_MOUSE was demonstrated. Thus, the PRO1305 polypeptide shows homology to laminin and may be a laminin homolog.

Example 51: Isolation of cDNA Clone Encoding Human DNA1273 Expression Sequence Tag (EST) DNA Database (LIFESEQ (trade name), Incyte Phar
EST was identified by searching for maceuticals, Palo Alto, CA). The sequence was blasted against public and Incyte databases. The search is performed by the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-48.
0 (1996)). No known protein, BLAST score 7
Comparables with 0 (sometimes 90) or more are programs "phrap" (P
hil Green, University of Washington, Seattle, Washington) to construct a consensus DNA sequence. The consensus DNA sequence is transformed into another E using the BLAST and phrap repeat cycles.
Constructed against ST sequence. This consensus sequence is referred to here as "DNA60747
". Incyte clone 3541105 was purchased and sequenced in its entirety based on the association of the DNA60747 consensus sequence with the sequences in the assembly of aligned sequences. This Incyte clone was obtained from a library made from RNA isolated from seminal vesicle tissue. The entire coding sequence of PRO1273 is shown in Figure 95 (SEQ ID NO: 157). Clone DNA65402-1540 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 26-28, and an apparent stop codon at nucleotide positions 515-517 (SEQ ID NO: 157). The predicted polypeptide precursor is 163 amino acids long. The signal peptide is at about amino acids 1-20 of SEQ ID NO: 158, and the conserved region in lipocalins is at about amino acids 25-36. Clone DNA65402-1540
Was deposited with the ATCC and was assigned ATCC deposit no. 203252. Fig9
The full-length PRO1273 protein shown in 6 has an estimated molecular weight of approximately 18,045 daltons and a pI of approximately 4.87. The Dayhoff database (version 35.45 Sw) using WU-BLAST-2 sequence alignment analysis of the full length sequence shown in FIG. 96 (SEQ ID NO: 158).
issProt 35), the PRO1273 amino acid sequence and the following Dayhoff sequence (information from the database incorporated here): PGHD_FELCA (prostaglandin-h2d-isomerase precursor), S57748 (prostaglandin D synthase precursor) ,
LIPO_BUFMA (lipocalin precursor), S52354, QSP_CHICK, ECP19_1, LACB_CAPHI, O
Sequence identity was revealed between LFA_RANPI, D87752_1, and LACB_BOVIN.

Example 52: Isolation of a cDNA clone encoding human PRO1302 A consensus DNA sequence encoding PRO1302 was constructed against other EST sequences using the phrap method as described in Example 1 above. . This consensus sequence is herein designated "DNA28742". Based on the DNA28742 consensus sequence, the consensus sequence derived assembly and other information and findings provided herein, Incyte clone number 3344926 (from a diseased spleen tissue library) was purchased and sequenced in its entirety. By sequencing, PRO13
02 full length DNA sequences and an inducible protein for PRO1302 were provided. The entire coding sequence of PRO1302 is shown in Figure 97 (SEQ ID NO: 159). Clone DNA65403-1565 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 43-45 and an apparent stop codon at nucleotide positions 1432-1435 (SEQ ID NO: 159). The predicted polypeptide precursor is 463 amino acids long. The signal peptide is at about amino acids 1-15 of SEQ ID NO: 160 and the transmembrane sequence is at about amino acids 351-370. Clone DNA65403-1565 has been deposited with ATCC and is assigned ATCC deposit no. Full length PR shown in Fig98
The O1302 protein has an estimated molecular weight of approximately 50,082 daltons and a pI of approximately 7.3.
Have. The Dayhoff database (version 35.45 Sw) using WU-BLAST-2 sequence alignment analysis of the full length sequence shown in FIG. 98 (SEQ ID NO: 160).
issProt 35), the PRO1302 amino acid sequence and the following Dayhoff sequence (information from the database incorporated here): D86358_1, D86359_1, S71403.
_1, MAG_HUMAN, JH0593, MMSIAL2_1, C22A_HUMAN, PGBM_HUMAN, PGBM_HUMAN, LA
Sequence identity between CH_DROME and KMLS_HUMAN was revealed. Example 53: Isolation of a cDNA clone encoding human PRO1283 A consensus DNA sequence was assembled for other ESTs using phrap as described in Example 1 above. This consensus sequence is now DNA2875
Name it 3. Based on the DNA28753 consensus sequence, 1) to identify a cDNA library containing the sequence of interest by PCR, and 2) PRO1.
Oligonucleotides were synthesized for use as probes to isolate clones of 283 full length coding sequences. PCR primers (forward and reverse) were synthesized: Forward PCR primer (28753.f1) 5'-GGAGATGAAGACCCTGTTCCTG-3 '(SEQ ID NO: 163) Forward PCR primer (28753.f11) 5'-GGAGATGAAGACCCTGTTCCTGGGTG-3' (
SEQ ID NO: 164) Reverse PCR primer (28753.r1) 5'-GTCCTCCGGAAAGTCCTTATC-3 '(SEQ ID NO: 165) Reverse PCR primer (28753.r11) 5'-GCCTAGTGTTCGGGAACGCAGCTTC-3' (SEQ ID NO: 166) A synthetic oligonucleotide hybridization probe was prepared from the consensus DNA28753 sequence having the following nucleotide sequence: Hybridization probe (28753.p1) 5'-CAGGGACCTGGTACGTGAAGGCCATGGTGGTCGATAAGGACTTTCCGGAG-3 '(SEQ ID NO: 167)
) Hybridization probe (28753.p11) 5'-CTGTCCTTCACCCTGGAGGAGGAGGATATCACAGGGACCTGGTAC-3 '(SEQ ID NO: 168) In order to screen several libraries for a source of full length clones, PCR primer pairs identified above from DNA from libraries It was amplified by PCR. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate a clone encoding the PRO1283 gene with one of the primer pairs. RNA for making a cDNA library was isolated from human fetal brain tissue. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO1283 (herein designated as DNA65404-1551 [Fig99, SEQ ID NO: 161]); and the derived protein sequence for PRO1283. The entire nucleotide sequence of DNA65404-1551 is shown in Fig99 (SEQ ID NO:
161). Clone DNA65404-1551 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 45-47, and ending at the apparent stop codon at nucleotide positions 555-557 (Fig99). The predicted polypeptide precursor is 170 amino acids long (
Figure 100). The full-length PRO1283 protein shown in FIG.
It has an estimated molecular weight of 457 Daltons and a pI of about 9.10. Analysis of full length PRO1283 shown in Figure 100 (SEQ ID NO: 162) demonstrates the presence of the following: a signal peptide from about amino acid 1 to about amino acid 17. Clone D
NA65404-1551 was deposited with the ATCC on September 9, 1998, and
C deposit number 203244 has been assigned. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 100 (SEQ ID NO: 162) and the amino acid sequence of PRO1283
Dayhoff array: A40464, VEGP_HUMAN, ALL1_CANFA, LALP_TRIVU, S51803, XELPDS_
Significant homology was demonstrated with 1, LIPO_BUFMA, S52354, QSP_CHICK and ERBP_RAT.

Example 54: Isolation of a cDNA clone encoding human PRO1279 As described in Example 1 above, phrap was used to assemble consensus DNA sequences for other ESTs. This consensus sequence is now DNA3085
Name it 6. Based on the DNA30856 consensus sequence, 1) to identify a cDNA library containing the sequence of interest by PCR, and 2) PRO1.
Oligonucleotides were synthesized for use as probes to isolate clones of 279 full length coding sequences. PCR primers (forward and reverse) were synthesized: Forward PCR primer (30856.f1) 5'-GGCTGCGGGACTGGAAGTCATCGGG-3 '(SEQ ID NO: 171) Forward PCR primer (30856.f11) 5'-CTCCAGGCCATGAGGATTCTGCAG-3' ( Sequence ID: 172) Forward PCR primer (30856.f12) 5'-CCTCTGGTCTGTAACCAG-3 '(SEQ ID NO: 173) Reverse PCR primer (30856.r1) 5'-TCTGTGATGTTGCCGGGGTAGGCG-3' (SEQ ID NO: 174) Reverse Direction PCR primer (30856.r11) 5'-CGTGTAGACACCAGGCTTTCGGGTG-3 '(SEQ ID NO: 175) Reverse PCR primer (30856.r12) 5'-CCCTTGATGATCCTGGTC-3' (SEQ ID NO: 176) Furthermore, synthetic oligonucleotide hybridization The probe was made from the consensus DNA30856 sequence with the following nucleotide sequence: Hybridization probe (30856.p1) 5'-AGGCCATGAGGATTCTGCAGTTAATCCTGCTTGCTCTGGCAACAGGGCTT-3 '(SEQ ID NO: 177)
) Hybridization probe (30856.p11) 5'-GAGAGACCAGGATCATCAAGGGGTTCGAGTGCAAGCCTCACTC-3 '(SEQ ID NO: 178) To screen several libraries for a source of full length clones, PCR primer pairs identified above from DNA from libraries It was amplified by PCR. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate a clone encoding the PRO1279 gene with one of the primer pairs. RNA for making a cDNA library was isolated from human fetal brain tissue. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO1279 (herein designated as DNA65405-1547 [Fig101, SEQ ID NO: 169]); and the derived protein sequence for PRO1279.

The entire nucleotide sequence of DNA65405-1547 is shown in Figure 101 (SEQ ID NO: 169). Clone DNA65405-1547 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 106-108 and ending at the apparent stop codon at nucleotide positions 856-858 (Fig101). The predicted polypeptide precursor is 250 amino acids long (Figure 102). The full-length PRO1279 protein shown in Figure 102 has a predicted molecular weight of approximately 27,466 daltons and a pI of approximately 8.87. Fig1
02 (SEQ ID NO: 170) analysis of full length PRO1279 demonstrates the presence of the following: a signal peptide from about amino acid 1 to about amino acid 18, a serine protease from about amino acid 58 to about amino acid 63, a trypsin family histidine. Active site, about amino acid 99 to about amino acid 102, about amino acid 165
To about amino acid 168, about amino acid 181 to about amino acid 184, and about amino acid 210 to about amino acid 213, a potential N-glycosylation site, about amino acid 14
5 to about amino acid 148, about amino acid glycosaminoglycan attachment site, about amino acid 197 to about amino acid 209 and about amino acid 47 to about amino acid block in amino acid block existing in kringle domain protein of about amino acid 64, about amino acid 199 to about amino acid 209, about Amino acid 47 to about amino acid 64 and about amino acid 220 to about amino acid 243 serine protease, trypsin family, amino acid sequence block having homology with histidine protein, and about amino acid 222 to about amino acid 249 and about amino acid 189 to about amino acid 222 apple An amino acid sequence block that has homology to a domain protein. Clone DNA654
05-1547 was deposited with the ATCC on November 17, 1998 and was assigned ATCC deposit no. 203476. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 102 (SEQ ID NO: 170) and the amino acid sequence of PRO1279
Dayhoff array: I56559, S55066, KLK7_RAT, KLK7_RAT, KLK1_RAT, LKLB_RAT, KLK
Significant homology was demonstrated between 3_MOUSE, KLK8_RAT, AF013988_1, D78203_1 and HSU62801_1. Also, DNA65405-1547 is an Incyte EST clone number 272364.
6 was obtained by sequencing the insert of the clone,
1 (SEQ ID NO: 169) resulting in DNA65405-1547 sequence.

Example 55: Isolation of a cDNA clone encoding human PRO1304 As described in Example 1 above, conrap was used to assemble consensus DNA sequences for other ESTs. This consensus sequence is now DNA3574
Name it 5. Based on the DNA35745 consensus sequence, 1) to identify a cDNA library containing the sequence of interest by PCR, and 2) PRO1.
Oligonucleotides were synthesized for use as probes to isolate 304 full length coding sequence clones. PCR primers (forward and reverse) were synthesized: Forward PCR primer (35745.f1) 5'-GTGTTCTGCTGGAGCCGATGCC-3 '(SEQ ID NO: 181) Forward PCR primer (35745.f2) 5'-GACATGGACAATGACAGG-3' ( SEQ ID NO: 18
2) Forward PCR primer (35745.f3) 5'-CCTTTCAGGATGTAGGAG-3 '(SEQ ID NO: 18
3) Forward PCR primer (35745.f4) 5'-GATGTCTGCCACCCCAAG-3 '(SEQ ID NO: 18
4) Reverse PCR primer (35745.r1) 5'-GCATCCTGATATGACTTGTCACGTGGC-3 '(SEQ ID NO: 185) Reverse PCR primer (35745.r2) 5'-TACAAGAGGGAAGAGGAGTTGCAC-3' (SEQ ID NO: 186) Furthermore, synthetic oligo A nucleotide hybridization probe was made from the DNA35745 sequence having the following nucleotide sequence: Hybridization probe (35745.p1) 5'-GCCCATTATGACGGCTACCTGGCTAAAGACGGCTCGAAATTCTACTGCAG-3 '(SEQ ID NO: 187
3.) To screen several libraries for a source of full length clones, DNA from the libraries was PCR amplified with the PCR primer pair identified above. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate a clone encoding the PRO1304 gene with one of the primer pairs. RNA for making a cDNA library was isolated from human ovarian tissue. DNA sequencing of the clones isolated as described above revealed the full-length DNA sequence for PRO1304 (DNA65406-1567 [Fig103, SEQ ID NO: 179]).
, And the derived protein sequence of PRO1304 was obtained. The entire nucleotide sequence of DNA65406-1567 is shown in Figure 103 (SEQ ID NO: 179). Clone DNA65406-1567 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 23-25 and ending at the apparent stop codon at nucleotide positions 689-691 (Fig103). The predicted polypeptide precursor is 222 amino acids long (Figure 104). The full-length PRO1304 protein shown in Figure 104 has a predicted molecular weight of approximately 25,794 daltons and a pI of approximately 6.24. Fig10
Analysis of the full-length PRO1304 sequence set forth in SEQ ID NO: 4 (SEQ ID NO: 180) demonstrates the presence of the following: an endoplasmic reticulum target sequence of about amino acids 219 to about amino acids 222, about 45 to about 48 potential amino acids. N-glycosylation site, an FKBP-type peptidyl-prolyl cis-trans isomerase homology block from about amino acid 87 to about amino acid 123 and about amino acid 129 to about amino acid 142 and about amino acid 202 to about amino acid 214 and about amino acid 195 to about amino acid 214. EF hand calcium binding domain protein homology block. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 104 (SEQ ID NO: 180) and the amino acid sequence of PRO1304
Dayhoff array: AF040252_1, P_R28980, S71238, CELC05C8_1, VFU52045_1, S7514
4, significant homology was revealed between FKB3_BOVIN, CELC50F2_6, CELB0511_12 and P_R41781. DNA65406-1567 was also cloned into Incyte EST Clone No. 2813577.
The insert was isolated and sequenced.

Example 56: Isolation of a cDNA clone encoding human PRO1317 Using the method described in Example 1 above, Incyte EST No. 33598 does not encode a known protein and has a BLAST score of 70 or higher. It was identified as a target sequence to have. The sequence of Incyte EST No. 33598 is referred to herein as "DNA36958.
". Oligonucleotides were synthesized based on the DNA36958 sequence for 1) identification of a cDNA library containing the sequence of interest by PCR and 2) use as a probe to isolate clones of the full-length coding sequence of PRO1317. . The following are suitable PCs that can be synthesized based on the DNA36958 sequence.
R primers (forward and reverse): Forward PCR primer: AGGGACCATTGCTTCTTCCAGGCC (36958.f1; SEQ ID NO: 19
0) Reverse PCR primer: CGTTACATGTCTCCAAGGGGAATG (36958.r1; SEQ ID NO: 19
1) Further, a synthetic oligonucleotide hybridization probe was prepared from the consensus DNA36958 sequence having the following nucleotide sequence. Hybridization probe: CCTGTGCTAAGTGCCCCCCAAATGCTTCCT GTGTCAATAACACTC
ACTGC (36958.p1; SEQ ID NO: 192) To screen several libraries for a source of full length clones, DNA from the libraries was PCR amplified with the PCR primer pair identified above. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate clones encoding the PRO1317 gene with one of the primer pairs. RNA for making a cDNA library can be isolated from tissues containing the sequence of interest, such as peripheral blood, especially blood taken from patients with high white blood cell counts (eg hyperacidosis). The full-length DNA sequence of PRO1317, designated here as DNA65408-1578 (Fig105, SEQ ID NO: 188), was obtained by purchasing Incyte EST No. 335958, obtaining a cDNA insert and sequencing the whole. Incyte derived from a library created using RNA isolated from peripheral blood cells
Clone No. 335958 shows the entire coding sequence for hyperacid PRO1317 in Figure 105 (SEQ ID NO: 188). Clone DNA65408-1578 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 6-8 and an apparent stop codon at nucleotide positions 228-230. The predicted polypeptide precursor is 74 amino acids long. Full length PRO1317 shown in FIG106
The protein has an estimated molecular weight of approximately 7,831 daltons and a pI of approximately 9.08. A further feature is a signal peptide of about amino acids 1-18, about amino acids 34-3.
7 and 39-42 potential N-glycosylation sites, and about amino acids 72-74
Containing the microbody C-terminal targeting signal. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis of the full length sequence shown in Figure 106 (SEQ ID NO: 189) and the amino acid sequence of PRO1317 and CD97_H.
Significant homology was revealed between the Dayhoff sequences named UMAN. In addition, the PRO1317 amino acid sequence and the following Dayhoff sequence: GEN12618, CELZK783_1,
G156_PARPR, GIAVSPE_1, AF040387_1, S78059, I50617, XLSEK1_1, and NEL2_R
Some homology was found with AT. Clone DNA65408-1578 was deposited with the ATCC on September 15, 1998 and was assigned ATCC deposit no. 203217.

Example 57: Isolation of a cDNA clone encoding human PRO1303 As described in Example 1 above, consensus DNA sequences were assembled using phrap with other ESTs. This consensus sequence is now referred to as "DNA473
47 ”. Incyte clone 1430305 (from ileal tissue library) was purchased and sequenced in its entirety based on its homology with the DNA47347 consensus sequence and IncyteEST in the assembly from which DNA47347 was removed.
Thereby the sequence coding for PRO1303 was identified. The entire coding sequence of PRO1303 is shown in Figure 107 (SEQ ID NO: 193). Clone DNA65409-1566 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 121-123 and an apparent stop codon at nucleotide positions 865-867. The predicted polypeptide precursor is 248 amino acids long. The signal peptide is located at about amino acids 1-17 of SEQ ID NO: 194. N-glycosylation sites, active and conserved regions and domains are further shown in Figure 194. Clone DNA65409-
1566 has been deposited with the ATCC and is assigned ATCC deposit no.
The full-length PRO1303 protein shown in Figure 108 has a predicted molecular weight of approximately 26,734 daltons and a pI of approximately 7.9. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in FIG. 108 (SEQ ID NO: 194) and the amino acid sequence of PRO1303
Dayhoff array (data is taken in here): AB009849_1, P_W08475, AF024605_1,
A42048_1, TRY3_RAT, MMAE00066414, TRY1_RAT, MMAE000663_4, MMAE000665_2,
And sequence identity with MMAE00066412 was revealed.

Example 58: Isolation of a cDNA clone encoding human PRO1306 Using the method described in Example 1 above, Incyte EST No. 2449282, also referred to herein as DNA5918, does not encode a known protein and is BLAST.
It was identified as a subject sequence with a score of 70 or higher. From the DNA5918 sequence, the consensus sequence is BLAST and the program "phrap" (Phil Green, Universi
ty of Washington, Seattle, Washington). This consensus sequence is designated herein as "DNA47399". Based on the DNA47399 consensus sequence, oligonucleotides were synthesized to 1) identify a cDNA library containing the sequence of interest by PCR and 2) use as a probe to isolate clones of the full-length coding sequence of PRO1306. did. The entire coding sequence of PRO1306 shown in Fig109 (SEQ ID NO: 195) was obtained by purchasing Incyte EST No. 2449282, obtaining a cDNA insert, and determining the whole in parallel. Clone DNA65410-1569
Contains a single open reading frame at nucleotide position 106-1
It has an apparent translational initiation site at 08 and an apparent stop codon at nucleotide positions 556-558. The predicted polypeptide precursor is 150 amino acids long. The full-length PRO1306 protein shown in FIG. 110 is about 17,068.
It has a predicted molecular weight of Daltons, a pI of about 7.29, and a potential N-glycosylation site of about amino acids 131-134. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 110 (SEQ ID NO: 196) and the amino acid sequence of PRO1306 and Dayhof.
Significant homology between the f sequences AIF1_HUMAN was revealed. PRO1306 amino acid sequence and the following Dayhoff sequence: JC4902, BAR1_RAT, AF020281_1, HSU95213_1, TCH
The homology was also shown between 3_ARATH, LEY14765_1, CATR_NAEGR, S35185, and AF065247_1. Clone DNA65410-1569 was deposited with the ATCC on September 15, 1998 and was assigned ATCC deposit no. 203231.

Example 59: Isolation of cDNA clones encoding human PRO1336 The EST sequences were identified and entered into the company Genentech database. The ESTs were blasted against various EST databases. The EST database is a public ES
T databases (eg GenBank) and corporate EST databases (LIFESEQ (
Trade name), Incyte Pharmaceuticals, Palo Alto, CA), and Genentech companies' ESTs. The search is performed by the computer program BLAST or BLAST2 [Altsc
hul et al., Methods in Enzymology 266: 460-480 (1996)] as a comparison of ECD protein sequences with 6-frame translation of EST sequences. Comparables that do not encode a known protein and have a BLAST score of 70 (sometimes 90) or higher can be found in the program "phrap" (Phil Green, University of Washington, Sea.
(ttle, Washington) to construct a consensus DNA sequence. A consensus DNA sequence encoding PRO1336 was constructed against other aligned EST sequences (forming the assembly) using phrap. This consensus sequence is herein designated "DNA43319". Oligonucleotides were synthesized based on the DNA43319 consensus sequence to 1) identify a cDNA library containing the sequence of interest by PCR and 2) to use as a probe to isolate a clone of the PRO1336 full-length coding sequence. did. PCR primers (forward and reverse) were synthesized: forward PCR primer: 5'ATGGAGATTCCTGCCAACTTGCCG3 '(SEQ ID NO: 199); and reverse PCR primer: 5'TTGTTGGCATTGAGGAGGAGCAGC3' (SEQ ID NO: 200). In addition, a synthetic oligonucleotide hybridization probe was made from the consensus DNA43319 sequence with the following nucleotide sequence: Hybridization probe: 5'GAGGGCATCGTCGAAATACGCCTAGAACAGAACTCCATCAAAGC
CATCCC3 '(SEQ ID NO: 201) To screen several libraries for a source of full length clones, DNA from the libraries was PCR amplified with the PCR primer pair identified above. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate clones encoding the PRO1336 gene with one of the primer pairs. RNA for making a cDNA library was isolated from human fetal lung tissue. By DNA sequencing of the clones isolated as described above, PRO133
Full-length DNA sequence for 6 (where DNA65423-1595 [Fig111
AB, SEQ ID NO: 198]) and an inducible protein of PRO1336 were obtained. The entire coding sequence of PRO1336 is shown in Fig111A-B (SEQ ID NO: 198).
Shown in. Clone DNA65423-1595 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 83-85 of SEQ ID NO: 198 and an apparent stop codon at nucleotide positions 4652-4654. The predicted polypeptide precursor is 1523 amino acids long. Signal peptides (amino acids 1-27), aspartic acid and asparagine hydroxylation sites, EGF-like domain cysteine pattern signature regions, leucine zipper pattern regions, regions conserved in immunoglobulins and major histocompatibility complexes, and N-glycosyls. The site of conversion is shown in FIG. 112. Clone DN
A65423-1595 deposited with ATCC, ATCC Deposit No. 203227
Was granted. The full-length PRO1336 protein shown in Fig112 is about 167.
, 715 Daltons and a pI of about 8.06. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 112 (SEQ ID NO: 198) and the amino acid sequence of PRO1336
Dayhoff array (Capture data here): SLIT_DROME, CEF40E10_1, LCU58977_
Sequence identity between 1, AF029779_1, FBP1_STRPU, NOTC_XENLA, AC004663_1, XELXDEL_1, P_W05835 and HSU77720_1 was revealed.

Example 60: Isolation of a cDNA clone encoding human PRO1278 A consensus DNA sequence was constructed against other EST sequences using the phrap method as described in Example 1 above. This consensus sequence is here
nsen 5230 ”. Also, the Consen 5230 consensus sequence was extended using repeated BLAST and phrap cycles, and the consensus sequence was extended as much as possible using the source of the EST sequences discussed above. The extended consensus sequence is designated herein as "DNA44801". Based on the DNA44801 consensus sequence, oligonucleotides were synthesized to 1) identify a cDNA library containing the sequence of interest by PCR and 2) to use as a probe to isolate a clone of the PRO1278 full-length coding sequence. did. PCR primers (forward and reverse) were synthesized: Forward PCR primer: GCAGGCTTTGAGGATGAAGGCTGC (44801.f1; SEQ ID NO: 20)
4) and CTCATTGGCTGCCTGGTCACAGGC (44801.f2; SEQ ID NO: 205) Reverse PCR primer: CCAGTCGGACAGGTCTCTCCCCTC (44801.r1; SEQ ID NO: 20)
6) and TCAGTGACCAAGGCTGAGCAGGCG (44801.r2; SEQ ID NO: 207) Further, a synthetic oligonucleotide hybridization probe was prepared from the consensus DNA44801 sequence having the following nucleotide sequence. Hybridization probe: CTACACTCGTTGCAAACTGGCAAAAATATTCTCGAGGGCTGGCCTG
G (44801.p1; SEQ ID NO: 208) To screen several libraries for a source of full length clones, DNA from the libraries was PCR amplified with the PCR primer pair identified above. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate clones encoding the PRO1278 gene with one of the primer pairs. RNA for making a cDNA library was isolated from human testis. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO1278 (herein designated as DNA66304-1546 [Fig113, SEQ ID NO: 202]) and the derived protein sequence for PRO1278. The entire coding sequence of PRO1278 is shown in Figure 113 (SEQ ID NO: 202). Clone DNA66304-1546 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 141-143 and an apparent stop codon at nucleotide positions 585-587. The predicted polypeptide precursor is 148 amino acids long. Full length PR shown in Fig114
The O1278 protein has a predicted molecular weight of approximately 16,623 daltons and a pI of approximately 8.47. Further features are signal peptide sequences of about amino acids 1-19; potential N-glycosylation sites of about amino acids 58-61; α-lactalbumin / lysozyme C signature of about amino acids 94-112; and about amino acids 35-59.
, 67-59 and 112-133 with α-lactalbumin / lysozyme C homologous sequences. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 114 (SEQ ID NO: 203) and the amino acid sequence of PRO1278
Dayhoff sequences: Significant homology between LYC1_ANAPL, LYC3_ANAPL, and LYC_HUMAN was revealed. Clone DNA66304-1546 was deposited with the ATCC on October 6, 1998 and was assigned ATCC deposit no. 203321.

Example 61: Isolation of a cDNA clone encoding human PRO1298 The use of the signal sequence algorithm described in Example 3 above enabled the identification of EST cluster sequences from the Incyte database. Then this ES
T-cluster sequences can be found in public EST databases (eg GenBank) and corporate EST DNA databases (LIFESEQ®, Incyte Pharmaceuticals, Palo).
Existing homology was identified by comparison with various expressed sequence tag (EST) databases, including Alto, CA). One or more of the ESTs was retrieved from a diseased prostate tissue library. The homology search is performed by the computer program BLAST or BLAST2 (Altschu
l et al., Methods in Enzymology 266: 460-480 (1996)). Comparables that do not encode a known protein and have a BLAST score of 70 (sometimes 90) or higher are those of the program "phrap" (Phil Green, University of Washingto
n, Seattle, Washington) to construct a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated DNA56389. Incy in the assembly where the DNA56389 sequence and consensus sequence were extracted
In light of the sequence homology with the EST sequences contained within teEST, Incyte clone 3355717 was purchased and the cDNA insert was obtained and sequenced. The sequence of this cDNA insert is shown in Figure 115 and is herein designated as DNA66511-1563. The full-length clone shown in Figure 115 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 94-96 and ending at the stop codon at nucleotide positions 1063-1065 (Fig115; SEQ ID NO: 209). . Predicted polypeptide precursor (Fig116, SEQ ID NO: 2
10) is 323 amino acids long. The signal peptide is located at about amino acids 1-15 of SEQ ID NO: 210. PRO1298 has a calculated molecular weight of about 37,017 and about 8
． It has an estimated pI of 83. Clone DNA66511-1563 has been deposited with the ATCC on September 15, 1998 and is assigned ATCC deposit no. Dayhoff database (version 35.45) using WU-BLAST-2 sequence alignment analysis of the full length sequence shown in Figure 116 (SEQ ID NO: 210).
SwissProt 35) analysis of the PRO1298 amino acid sequence and the following Dayhoff sequence (data captured here): ALG2_YEAST, CAPM_STAAU, C69098, C69255, SU
Sequence identity with S2_MAIZE, A69143, S74778, AB009527_13, AF050103_2 and BBA224769_1 was revealed.

Example 62: Isolation of a cDNA clone encoding human PRO1301 By the use of the signal sequence algorithm described in Example 3 above, "herein"
It has made possible the identification of the EST cluster sequence from the Incyte database, named Incyte cluster number 93492, also called DNA10591 ". This EST cluster sequence is then converted into a public EST database (eg GenBank).
And company EST DNA database (LIFESEQ (trade name), Incyte Pharmaceutic
existing homology was identified by comparison with various expressed sequence tag (EST) databases, including als, Palo Alto, CA). The homologue search is the computer program BLAS
It was performed using T or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparables that do not encode a known protein and have a BLAST score of 70 (sometimes 90) or higher can be found in the program "phrap" (Phil Green, Uni
versity of Washington, Seattle, Washington)
The A sequence was constructed. One or more of the ESTs was retrieved from a cDNA library made from RNA isolated from lung tissue removed from men with adenocarcinoma. The consensus sequence obtained therefrom is herein designated "DNA57725". In light of the sequence homology between the DNA57725 sequence and the EST sequence contained within EST number 3395984, EST clone 3395984 was purchased and the cDNA
The insert was obtained and sequenced in its entirety. The sequence of this cDNA insert is
7 and is herein designated as DNA66512-1564. The full-length clone shown in Figure 117 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 43-45 and ending at the stop codon at nucleotide positions 1429-1431 (Fig117; SEQ ID NO: 211). . Predicted polypeptide precursor (Fig118, SEQ ID NO: 2
12) is 462 amino acids long. Other features of the PRO1301 protein are a signal sequence of about amino acids 1-18; a transmembrane domain of about amino acids 271-290; and a potential N of about amino acids 94-97, 217-220 and 246-249.
-Includes a glycosylation site. PRO1301 has a calculated molecular weight of about 52,432 and an estimated pI of about 6.14. Clone DNA66512-1564 is 199
It was deposited with the ATCC on September 15, 8 and is assigned ATCC deposit no. 203218. Dayhoff database (version 35.45) using WU-BLAST-2 sequence alignment analysis of the full length sequence shown in Figure 118 (SEQ ID NO: 212).
SwissProt 35), the PRO1301 amino acid sequence and the following Dayhoff sequences: PSU29243_1, A69975, ATAC00448418, D78607_1, CEB0331_1, HUMCYTIIIA_1,
Some homology between AF014800_1, CELT13C5_4, CELC45H4_14, and CEC54E10_1 was revealed.

Example 63: Isolation of a cDNA clone encoding human PRO1268 By using the signal sequence algorithm described in Example 3 above, an EST cluster from the LIFESEQ database designated EST number 8879. The sequence can be identified. This EST cluster sequence is then transformed into the official EST
Databases (eg GenBank) and corporate EST DNA databases (LIFES
Existing homology was identified by comparison with various expressed sequence tag (EST) databases, including EQ (trade name), Incyte Pharmaceuticals, Palo Alto, CA). The homology search is performed by the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzy.
mology 266: 460-480 (1996)). A comparison that does not encode a known protein and has a BLAST score of 70 (sometimes 90) or higher is the program "phrap" (Phil Green, University of Washington, Seattle, Washingt.
on) to build a consensus DNA sequence. One or more of the ESTs was taken from a cDNA library made from human brain tumor tissue taken from a cerebral meningeal lesion. The consensus sequence obtained therefrom is now referred to as DNA562
It is named 58. DNA56258 sequence and EST contained within Incyte EST number 2944541
In view of the sequence homology with the sequence, EST clone 2944541 was purchased and c
The DNA insert was obtained and sequenced. The sequence of this cDNA insert is shown in Figure 119 and is herein designated as DNA66519-1535. The full-length clone shown in Figure 119 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 89-91 and ending at the stop codon at nucleotide positions 509-511 (Fig119; SEQ ID NO: 213). . Predicted polypeptide precursor (Fig120, SEQ ID NO: 214)
) Is 140 amino acids long. PRO1268 has a calculated molecular weight of about 15,503 and an estimated pI of about 6.64. A further feature is the II of about amino acids 12-28.
Type transmembrane domain; type I transmembrane domains at about amino acids 51-66 and 107-124; potential N-glycosylation sites at about amino acids 79-82, and homology to G protein-coupled receptors at about amino acids 59-99. Including a region having. Dayhoff database (version 35.45) using WU-BLAST-2 sequence alignment analysis of the full length sequence shown in Figure 120 (SEQ ID NO: 214).
Analysis of SwissProt 35) revealed some homology between the PRO1268 amino acid sequence and the following Dayhoff SEQ ID NO: CEF39B2_9. However, percent sequence identity was determined to be insignificant. Clone DNA66519-1535 has been deposited with the ATCC on September 15, 1998 and is assigned ATCC deposit no. 203236.

Example 64: Isolation of a cDNA clone encoding human PRO1269 By using the signal sequence algorithm described in Example 3 above, an EST from the LIFESEQ database designated EST cluster number 101920. It became possible to identify the cluster sequence. This EST cluster sequence is then compared to various expressed sequence tag (EST) databases, including public EST databases (eg GenBank) and corporate EST DNA databases (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, CA). And identified existing homologies. The homology search is performed by the computer program BLAST or BLAST2 (Altschul et al., M
ethods in Enzymology 266: 460-480 (1996)). Comparables that do not encode a known protein and have a BLAST score of 70 (sometimes 90) or higher can be found in the program "phrap" (Phil Green, University of Washington, Sea.
(ttle, Washington) to construct a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated DNA56509. In light of the sequence homology between the DNA56509 sequence and the EST sequence contained within EST number 103157, EST clone number 103157 was purchased and the cDNA
The insert was obtained and sequenced. The sequence of this cDNA insert is shown in Figure 121,
Here, it is designated as DNA66520-1536. The full-length clone shown in Figure 121 contains a single open reading frame, has an apparent translational initiation site at nucleotide positions 26-29, and terminates at the stop codon found at nucleotide positions 614-616 (Figure 12).
1; SEQ ID NO: 215). The predicted polypeptide precursor (Fig122, SEQ ID NO: 215) is 196 amino acids long and the signal peptide is about amino acids 1-.
20. There is a potential N-glycosylation site at about amino acids 112-115. PRO1269 has a calculated molecular weight of approximately 21,731 and an estimated pI of approximately 8.97. Dayhoff database (version 35.45) using WU-BLAST-2 sequence alignment analysis of the full length sequence shown in Figure 122 (SEQ ID NO: 216).
Analysis of SwissProt 35) revealed significant homology between the PRO1269 amino acid sequence and the amino acid sequence of Dayhoff SEQ ID NO: P_W23722 below. Also,
Sequence homology with PRO1269 amino acid sequence and the following Dayhoff sequence: MMTAG7_1, MTV
It was found between 026_16, NAAA_BPT3, S75616_1, and NCP_PIG. Clone DNA66520-1536 was deposited with the ATCC on September 15, 1998 and is assigned ATCC deposit no.

Example 65: Isolation of a cDNA clone encoding human PRO1327 By using the signal sequence algorithm described in Example 3 above, IncyteE
It enabled the identification of the EST cluster sequence from the Incyte database, named ST cluster SEQ ID NO: 173410. This EST cluster sequence is then compared to various expressed sequence tag (EST) databases, including public EST databases (eg GenBank) and corporate EST DNA databases (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, CA). And identified existing homologies. The homology search is performed by the computer program BLAST or BLAST2 (Altschul et al., M
ethods in Enzymology 266: 460-480 (1996)). Comparables that do not encode a known protein and have a BLAST score of 70 (sometimes 90) or higher can be found in the program "phrap" (Phil Green, University of Washington, Sea.
(ttle, Washington) to construct a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated DNA56520. DNA56520 sequence and Incyte EST clone number 3
In view of the sequence homology with the EST sequences contained within 451760, IncyteES
T clone number 3451760 was purchased and the cDNA insert was obtained and sequenced.
The sequence of this cDNA insert is shown in Figure 123, where DNA665211-1.
It is named 583. Clone DNA665211583 contains a single open reading frame, has an apparent translational initiation site at nucleotide positions 55-57, and ends at the stop codon at nucleotide positions 811-813 (Fig123). The predicted polypeptide precursor is 252 amino acids long (Fig124). Fig
The full-length PRO1327 shown at 124 has a predicted molecular weight of about 28,127 and about 8.
It has a pI of 91. Full-length PRO shown in Fig124 (SEQ ID NO: 218)
Analysis of 1327 demonstrates the presence of the following: a signal peptide of about amino acids 1 to about amino acids 14, about amino acids 62 to about amino acids 165, about amino acids 127 to about amino acids 130, about amino acids 137 to about amino acids 140 and about amino acids. A potential N-glycosylation site from 143 to about amino acids 146 and a 2-oxo acid dehydrogenase acyltransferase homology block from about amino acids 61 to about amino acids 71. Clone DNA66521-1583 is 1998 9
It was deposited with the ATCC on 15th March and was assigned ATCC deposit number 203225. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 124 (SEQ ID NO: 218) and the amino acid sequence of PRO1327
Dayhoff array: NPH1_RAT, NPH2_MOUSE, OTU_DROME, D40750, BB61_RABIT, P_R238
73, P_W09673, CAGHMGPA_1, HUMPRP11_1 and S670958_1 showed significant homology.

Example 66: Isolation of a cDNA clone encoding human PRO1382 Using the method described in Example 1 for Incyte EST No. 2719 as a sequence of interest that does not encode a known protein and has a BLAST score of 70 or higher. Identified. The nucleotide sequence of EST No. 2719 and its complementary sequence are referred to as "DNA4
2842 ". Based on the DNA42842 sequence, 1) to identify a cDNA library containing the sequence of interest by PCR, and 2) PRO138
Oligonucleotides were synthesized for use as probes to isolate clones of two full length coding sequences. PCR primers (forward and reverse) were synthesized: Forward PCR primer ACGGCTCACCATGGGCTCCG (42842.f1; SEQ ID NO: 221) Reverse PCR primer AGGAAGAGGAGCCCTTGGAGTCCG (42842.r1; SEQ ID NO: 222)
) Furthermore, a synthetic oligonucleotide hybridization probe was made from the consensus DNA42842 sequence having the following nucleotide sequence: Hybridization probe CGTGCTGGAGGGCAAGTGTCTGGTGGTGTG CGACTCGAAC (4284
2.p1; SEQ ID NO: 223) To screen several libraries for a source of full length clones, DNA from the libraries was PCR amplified with the PCR primer pair identified above. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate clones encoding the PRO1382 gene with one of the primer pairs. RNA for making a cDNA library was isolated from human breast cancer. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO1382 (designated herein as DNA66526-1616 [Fig125, SEQ ID NO: 219]); and the derived protein sequence for PRO1382. The entire coding sequence of PRO1382 is shown in Figure 125 (SEQ ID NO: 219). Clone DNA66526-1616 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 337-339 and an apparent stop codon at nucleotide positions 940-942. The predicted polypeptide precursor is 201 amino acids long. Full length PRO shown in Fig126
The 1382 protein has an estimated molecular weight of approximately 21,808 daltons and a p of approximately 9.04.
I have. Additional features are signal peptides of about amino acids 1-27; potential N-glycosylation sites of about amino acids 29-32 and 88-91;
32 and 88-91 potential N-glycosylation sites; and about amino acid 92-1
26, 159-178, and 191-200 containing regions of homology with the C1q protein. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 126 (SEQ ID NO: 220) and PRO1382 amino acid sequence and Dayhof.
f Significant homology was revealed between SEQ ID NO: CERL_RAT. Homology is also PRO
1382 amino acid sequence and the following Dayhoff sequence: CERB_HUMAN, S76975_1, A41752, HUM
C1QB2_1, A57131, CA1A_HUMAN, ACR3_MOUSE, and COLE_LEPMA. Clone DNA66526-1616 has been deposited with the ATCC and is assigned ATCC deposit no.

Example 67: Isolation of a cDNA clone encoding human PRO1328 By using the signal sequence algorithm described in Example 3 above, IncyteE
E from the Incyte database, named ST cluster SEQ ID NO: 40671
It became possible to identify the ST cluster sequence. This EST cluster sequence is then compared to various expressed sequence tag (EST) databases, including public EST databases (eg GenBank) and corporate EST DNA databases (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, CA). And identified existing homologies. The homology search is performed by the computer program BLAST or BLAST2 (Altschul et al.
hods in Enzymology 266: 460-480 (1996)). A comparison that does not encode a known protein and has a BLAST score of 70 (sometimes 90) or higher is the program "phrap" (Phil Green, University of Washington, Seatt.
le, Washington) to construct a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated DNA56749. DNA56749 sequence and Incyte EST clone no. 41
In view of the sequence homology with the EST sequence contained within 11192, IncyteEST
Clone number 4111192 was purchased and the cDNA insert was obtained and sequenced. The sequence of this cDNA insert is shown in Figure 127, where DNA66658-15
It is named 84. Clone DNA66658-1584 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 9-11, and ending at the stop codon at nucleotide positions 780-782 (Fig127). The predicted polypeptide precursor is 257 amino acids long (Fig128). Fig1
The full-length PRO1328 shown in 28 has an estimated molecular weight of about 28,472 and about 9.3.
It has a pI of 3. Full length PRO1 shown in Fig128 (SEQ ID NO: 225)
Analysis of 328 demonstrates the presence of the following: a signal peptide from about amino acid 1 to about amino acid 19, about amino acid 32 to about amino acid 51, about amino acid 11
9 to about amino acid 138, about amino acid 152 to about amino acid 169 and about amino acid 216 to about amino acid 235, a transmembrane domain, about amino acid 120 to about amino acid 123 glycosaminoglycan attachment site, and about amino acid 31 to about amino acid 65 sodium. / Neurotransmitter cotransporter family protein homology block. Clone DNA66658-1584 was deposited with the ATCC on September 15, 1998 and was assigned ATCC deposit no. 203229. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 128 (SEQ ID NO: 225) and the amino acid sequence of PRO1328 and the following:
Dayhoff array: CEVF36H2L_2, TIP2_TOBAC, AB009466_16, ATU39485_1, P_R60153,
Significant homology was demonstrated with P_R77082, S73351, C69392, LEU95008_1 and E64667.

Example 68: Isolation of a cDNA clone encoding human PRO1325 By using the signal sequence algorithm described in Example 3 above, IncyteE
It enabled the identification of the EST cluster sequence from the Incyte database, named ST cluster SEQ ID NO: 139524. This EST cluster sequence is then compared to various expressed sequence tag (EST) databases, including public EST databases (eg GenBank) and corporate EST DNA databases (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, CA). And identified existing homologies. The homology search is performed by the computer program BLAST or BLAST2 (Altschul et al., M
ethods in Enzymology 266: 460-480 (1996)). Comparables that do not encode a known protein and have a BLAST score of 70 (sometimes 90) or higher can be found in the program "phrap" (Phil Green, University of Washington, Sea.
(ttle, Washington) to construct a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated DNA56115. DNA56115 sequence and Incyte EST clone number 3
In view of sequence homology with EST sequences contained within 744079, IncyteES
T clone no. 3744079 was purchased and the cDNA insert was obtained and sequenced.
The sequence of this cDNA insert is shown in Figure 129 where DNA66659-1
It is named 593. Clone DNA66659-1593 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 51-53, and ending at the stop codon at nucleotide positions 2547-2549 (Fig129).
The predicted polypeptide precursor is 832 amino acids long (Figure 130). F
The full-length PRO1325 protein shown in ig130 has a predicted molecular weight of approximately 94,454 and a pI of approximately 6.94. Analysis of full length PRO1325 set forth in Figure 130 (SEQ ID NO: 227) demonstrates the presence of the following: a signal peptide from about amino acid 1 to about amino acid 18, about amino acid 292 to about amino acid 3
17, a transmembrane domain of about amino acids 451 to about amino acids 470, about amino acids 501 to about amino acids 520, about amino acids 607 to about amino acids 627, and about amino acids 751 to about amino acids 770, and a leucine zipper pattern of about amino acids 497 to about amino acids 518. Sequence and about amino acid 27 to about amino acid 30, about amino acid 54 to about amino acid 57, about amino acid 60 to about amino acid 63, about amino acid position 123 to about amino acid position 126, about amino acid position 141 to about amino position 144, about amino acid position 165. To about amino acid position 168, about amino acid position 36
4 to about amino acid position 367, about amino acid position 476 to about amino acid position 479
A potential N-glycosylation site from about amino acid position 496 to about amino acid position 499, about amino acid position 572 to about amino acid position 575, about amino acid position 603 to about amino acid position 606, and about amino acid position 699 to about amino acid position 702. Clone DNA66659-1593 was deposited with the ATCC on September 22, 1998 and was assigned ATCC deposit no. 203269. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 130 (SEQ ID NO: 227) and the amino acid sequence of PRO1325 and the following:
Dayhoff array: CELR04E5_1, CELZK721_5, CELC30E1_5, CELC30E1_6, CELC30E1_2,
Significant homology was demonstrated with CEY37H2C_1, CELC30E1_7, CELT07H8_7 and E64006.

Example 69: Isolation of a cDNA clone encoding human PRO1340 Using the method described in Example 1 Incyte EST number 878906 as a sequence of interest that does not encode a known protein and has a BLAST score of 70 or higher. Identified. The nucleotide sequence of EST No. 878906 and its complementary sequence are shown here as "
DNA42809 ". 1) PCR based on the DNA42809 sequence
To identify a cDNA library containing the sequence of interest, and 2) PR
Oligonucleotides were synthesized for use as probes to isolate clones of the O1340 full length coding sequence. PCR primers (forward and reverse) were synthesized: Forward PCR primer TCCAGGTGGACCCCACTTCAGG (42809.f1; SEQ ID NO: 270)
Reverse PCR primer GGGAGGCTTATAGGCCCAATCTGG (42809.r1; SEQ ID NO: 271
) Furthermore, a synthetic oligonucleotide hybridization probe was made from the consensus DNA42809 sequence with the following nucleotide sequence: Hybridization probe GGCTTCAGCAGCACGTGTGAAGTCGAAGTCGCAGTCACAGATATC
AATGA (42809.p1; SEQ ID NO: 272) To screen several libraries for a source of full length clones, DNA from the libraries was PCR amplified with the PCR primer pair identified above. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate a clone encoding the PRO1340 gene with one of the primer pairs. RNA for making a cDNA library was isolated from human fetal kidney tissue. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO1340 (designated herein as DNA66663-1598 [Fig131, SEQ ID NO: 228]); and the derived protein sequence for PRO1340. The entire coding sequence of PRO1340 is shown in Figure 131 (SEQ ID NO: 228). Clone DNA66663-1598 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 128-130 and an apparent stop codon at nucleotide positions 2549-2551. The predicted polypeptide precursor is 807 amino acids long. Full length P shown in Fig132
The RO1340 protein has an estimated molecular weight of about 87,614 daltons and about 4.83.
Has a pI of Additional features include a signal peptide of about amino acids 1-18; a transmembrane domain of about amino acids 762-784; a cell attachment sequence of about amino acids 492-494; a potential of about amino acids 517-520, 602-605 and 700-703.
N-glycosylation site; and about amino acids 307-351, 324-348, 67-
It contains the cadherin extracellular repeat domains of 103, 97-141 and 114-138. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 132 (SEQ ID NO: 229) and the amino acid sequence of PRO1340 and Dayhof.
f Significant homology was revealed between SEQ ID NO: I46536. Homology is also PRO1
340 amino acid sequence and the following Dayhoff sequence: S55396, RATPDRPT_1, CADD_CHICK, CAD
Clarified between 1_CHICK, CADB_CHICK, I50180, CAD4_CHICK, G02878, and DSC1_MOUSE. Clone DNA66663-1598 has been deposited with the ATCC and is assigned ATCC deposit no.

Example 70: Isolation of a cDNA clone encoding human PRO1339 A consensus DNA sequence was constructed against other EST sequences using the phrap method as described in Example 1 above. This consensus sequence is here "D
NA40652 ". Incyte EST in the consensus array assembly
There were 2479394. Based on the consensus sequence and other findings and information provided herein, a clone containing Incyte EST2479394 was purchased and sequenced in its entirety. By sequencing, FIG133 containing the sequence encoding PRO1339.
The nucleic acid sequence shown in was obtained. Clone DNA66669-1597 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 9-11 of SEQ ID NO: 233 and an apparent stop codon at nucleotide positions 1272-1274. The predicted polypeptide precursor is 421 amino acids long. The signal peptide is located at about amino acids 1-16 of SEQ ID NO: 234. A conserved region within the zinc carboxypeptidase and N-glycosylation site is shown in Figure 134. Clone DNA66669-1597 has been deposited with the ATCC and is assigned ATCC deposit no.
03272 was awarded. The full-length PRO1339 protein shown in Figure 134 has a predicted molecular weight of approximately 47,351 daltons and a pI of approximately 6.61. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 134 (SEQ ID NO: 234) and the amino acid sequence of PRO1339 and the following:
Dayhoff array (data is taken in here): P_W01505, CBP1_HUMAN, HSA224866_1
, P_R90293, YHT2_YEAST, CEF02D8_4, CEW01A8_6, P_W36815, HSU83411_1 and CB
Sequence identity with PN_HUMAN was revealed.

Example 71: Isolation of a cDNA clone encoding human PRO1337 Using the method described in Example 1 above, a single Incyte EST was identified (E
ST No. 1747546), also referred to herein as "DNA4417". To build the consensus sequence, it was extended using repeated cycles of BLAST and phrap, and the DNA4417 sequence was extended as much as possible using the source of the EST sequences discussed above. The consensus sequence is designated herein as "DNA45669". D
Oligonucleotides were synthesized based on the NA45669 consensus sequence to 1) identify a cDNA library containing the sequence of interest by PCR and 2) to use as a probe to isolate a clone of the PRO1337 full-length coding sequence. did. PCR primers (forward and reverse) were synthesized: Forward PCR primer: CAACCATGCAAGGACAGGGCAGG (45669.f1; SEQ ID NO: 23)
7) and CTTTGCTGTTGGCCTCTGTGCTCCCAACCATGCAAGGACAGGGCAGG (45669.f2; SEQ ID NO: 238) Reverse PCR primer: TGACTCGGGGTCTCCAAAACCAGC (45669.r1; SEQ ID NO: 23)
9) and GGTATAGGCGGAAGGCAAAGTCGG (45669.r2; SEQ ID NO: 240) Further, a synthetic oligonucleotide hybridization probe was prepared from the consensus DNA45669 sequence having the following nucleotide sequence. Hybridization probe: GGCATCTTACCTTTATGGAGTACTCTTTGC TGTTGGCCTCTGTGC
To screen several libraries for the source of TCC (45669.p1; SEQ ID NO: 241) full length clones, DNA from the libraries was PCR amplified with the PCR primer pair identified above. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate clones encoding the PRO1337 gene with one of the primer pairs. RNA for making a cDNA library was isolated from human tissue. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO1337 (herein designated as DNA66672-1586 [Fig135, SEQ ID NO: 235]) and the derived protein sequence for PRO1337. The entire coding sequence of PRO1337 is shown in Figure 135 (SEQ ID NO: 235). Clone DNA66672-1586 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 60-62 and an apparent stop codon at nucleotide positions 1311-1313. The predicted polypeptide precursor is 417 amino acids long. Full length PR shown in Fig 136
The O1337 protein has a predicted molecular weight of approximately 46,493 daltons and a pI of approximately 9.79. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 136 (SEQ ID NO: 236) and the amino acid sequence of PRO1337 and the following:
Significant homology with the Dayhoff sequence THBG_HUMAN was revealed. Homology also refers to the PRO1337 amino acid sequence and the following Dayhoff sequences: KAIN_HUMAN, HSACT1_1, IPSP_
Found during HUMAN, G02081, HAMHPP_1, CPI6_RAT, S31507, AB000547_1, and KBP_MOUSE. Clone DNA66672-1586 was deposited with the ATCC on September 22, 1998 and was assigned ATCC deposit no. 203265.

Example 72: Isolation of a cDNA clone encoding human PRO1342 The cDNA sequence isolated by the amylase screen described in Example 2 above is herein designated DNA43203. The DNA43203 sequence is then compared to various expressed sequence tag (EST) databases, including public EST databases (eg GenBank) and corporate EST DNA databases (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, CA). The existing homologies were identified. The homology search is performed by the computer program BLAST or BLAST2 (Altschul et al., Methods i.
n Enzymology 266: 460-480 (1996)). A comparison that does not encode a known protein and has a BLAST score of 70 (sometimes 90) or higher is the program "phrap" (Phil Green, University of Washington, Seattle, Wa.
shington) to construct a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated "DNA48360". An oligonucleotide probe was prepared based on the DNA48360 sequence and used to screen a human esophageal tissue library prepared as described in paragraph 1 of Example 2 above. The cloning vector is pRK5B (pR
K5B is a precursor of pRK5D that does not contain an SfiI site; Holmes et al., Scienc
e, 253: 1278-1280 (1991)), the size of the cleaved cDNA was less than 2800 bp. PCR primers (forward and reverse) were synthesized: Forward PCR primer: 5'-GAAGCACCAGCCTTTATCTCTTCACC-3 '(48360.f1; SEQ ID NO: 244) Reverse PCR primer: 5'-GTCAGAGTTGGTGGCTGTGCTAGC-3'(48360.r1; (SEQ ID NO: 245) Further, a synthetic oligonucleotide hybridization probe was prepared from the DNA48360 sequence having the following nucleotide sequence. Hybridization probe: 5'GGACCCAGGCATCTTGCTTTCCAGCCACAAAGAGACAGATGAAGATGC3 '(48360.p1; SEQ ID NO: 246) To screen several libraries for sources of full length clones, DNA from the libraries was PCR amplified with the PCR primer pair identified above. . The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate a clone encoding the PRO1342 gene with one of the primer pairs. A full-length clone was identified, which contains a single open reading frame with an apparent translational initiation site at nucleotide positions 239-241 and a stop signal at nucleotide positions 2027-2029 (Fig 137; SEQ ID NO :).
242). The predicted polypeptide precursor is 596 amino acids long and contains about 57,
It has a calculated molecular weight of 173 Daltons and an estimated pI of approximately 4.82. Additional features include a signal sequence of about amino acids 1-20; a transmembrane domain of about amino acids 510-532; a potential N-glycosylation site of about amino acids 25-28;
25-328 glycosaminoglycan attachment site; and about amino acids 284-337.
, 404-457, 254-307, 359-412, 194-247, 239.
-292, 299-352, 134-187, 314-367, and 164-2.
Contains 17 bacterial ice-nucleating protein octamer repeats. Dayhoff database (version 35.45) using WU-BLAST-2 sequence alignment analysis of the full length sequence shown in Figure 138 (SEQ ID NO: 243).
SwissProt 35) analysis of the PRO1342 amino acid sequence and the following Dayhoff sequences: CELZC178_2, LMSAP2GN_1, D88734_, AMYH_YEAST, MMDSPPG_1, VGLX_HSVEB,
Some homology was demonstrated with S52714, CELF59A6_5, CELK06A9_3, and YM96_YEAST. Clone DNA66674-1599 was deposited with the ATCC on September 22, 1998 and was assigned ATCC deposit no. 203281.

Example 73: Isolation of a cDNA clone encoding human PRO1343 The cDNA sequence isolated by the amylase screen described in Example 2 above was prepared according to the WU-BLAST2 sequence alignment computer program for any known human encoded nucleic acid. It was found that they also did not have significant sequence identity with. This cDNA sequence is designated herein as DNA48921. A probe was produced from the sequence of the DNA48921 molecule and used to screen a human smooth muscle cell tissue library prepared as described in paragraph 1 above. The cloning vector was pRK5B (pRK5B is a precursor of pRK5D that does not contain the SfiI site; Holmes et al., Science, 253: 1278-1280 (1991)) and the cleaved cDNA size was less than 2800 bp. The oligonucleotide probes used were as follows: Forward PCR primer (48921.f1) 5'-CAATATGCATCTTGCACGTCTGG-3 '(SEQ ID NO: 249) Reverse PCR primer (48921.r1) 5'-AAGCTTCTCTGCTTCCTTTCCTGC-3 '(SEQ ID NO: 250) Hybridization probe (48921.p1) 5'-TGACCCCATTGAGAAGGTCATTGAAGGGATCAACCGAGGGCTG-3' (SEQ ID NO: 251) A full length clone was identified that contained a single open reading frame at nucleotide positions 71-73. It has an apparent translational initiation site and a stop signal at nucleotide positions 812-814 (Fig139; SEQ ID NO: 247).
. The predicted polypeptide precursor is 247 amino acids long, has a calculated molecular weight of approximately 25,335 daltons and an estimated pI of approximately 7.0. Analysis of full length PRO1343 shown in Figure 140 (SEQ ID NO: 248) demonstrates the presence of the following: a signal peptide from about amino acid 1 to about amino acid 25 and about amino acid 35.
To the circumsporozoite repeat of about amino acid 225. Clone DNA66675-1587 was deposited with the ATCC on September 22, 1998,
ATCC Deposit No. 203282 has been assigned. Dayhoff database (version 35.45) using WU-BLAST-2 sequence alignment analysis of the full length sequence shown in Figure 140 (SEQ ID NO: 248).
SwissProt 35), the PRO1343 amino acid sequence and the following Dayhoff sequences: CSP_PLACC, CEF25H8_2, U88974_40, BNAMRNAA_1, B0B0PC3_1, S58135, AF06.
Significant homology was demonstrated between 1832_1, BHU52040_1, HUMPROFILE_1 and MTV023_14. Also, an Incyte EST clone (Incyte EST clone having homology to the DNA48921 sequence)
EST clone number 4701148) was obtained and the insert was sequenced, resulting in the DNA66675-1587 sequence shown in Figure 139.

Example 74: Isolation of a cDNA clone encoding human PRO1480 Using the method described in Example 1 above, Incyte EST Nos. 550415 and 1628847 do not encode a known protein and have a BLAST score of 70 or It was identified as a target sequence having the above. These sequences are programmed into the program "phrap" (Phi
Green, University of Washington, Seattle, Washington) and assembled into consensus DNA sequences. This consensus sequence is referred to here as "DNA139
5 ”. In addition, the "DNA1395" consensus sequence was analyzed by BLAST and phrap.
The consensus sequence was extended using the repeat cycle of
It was extended as much as possible using the source of the sequence. The extended consensus sequence is designated herein as "DNA40642". Based on the DNA40642 consensus sequence, oligonucleotides were synthesized to 1) identify a cDNA library containing the sequence of interest by PCR, and 2) use as a probe to isolate clones of the PRO1480 full-length coding sequence. did. PCR primers (forward and reverse) were synthesized: Forward PCR primer: AGCCCGTGCAGAATCTGCTCCTGG (40642.f1; SEQ ID NO: 254
) Reverse PCR primer: TGAAGCCAGGGCAGCGTCCTCTGG (40642.r1; SEQ ID NO: 255
); GTACAGGCTGCAGTTGGC (40642.r2; SEQ ID NO: 256) Further, a synthetic oligonucleotide hybridization probe was prepared from the consensus DNA40642 sequence having the following nucleotide sequence. Hybridization probe: AGAAGCCATGTGAGCAAGTCCAGTTCCAGCCCAACACAGTG (4064
2.p1; SEQ ID NO: 257); GAGCTGCAGATCTTCTCATC GGGACAGCCCGTGCAGAATCTGCTC (40
642.p2; SEQ ID NO: 258). To screen several libraries for a source of full-length clones, DNA from the libraries was PCR amplified with the PCR primer pair identified above. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate a clone encoding the PRO1480 gene with one of the primer pairs. RNA for making a cDNA library was isolated from human fetal kidney tissue. By DNA sequencing of the clones isolated as described above, the DNA
PRO named 67962-1649 [Fig 141, SEQ ID NO: 252]
The full length DNA sequence of 1480; and the derived protein sequence of PRO1480 were obtained. The entire coding sequence of PRO1480 is shown in Figure 141 (SEQ ID NO: 252). Clone DNA67962-1649 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 241-243, and an apparent stop codon at nucleotide positions 2752-2754. The predicted polypeptide precursor is 837 amino acids long. The full-length PRO1480 protein shown in FIG. 142 has an estimated molecular weight of about 92,750 daltons and about 7.0.
It has a pI of 4. A further feature is about amino acids 23-46 (type II) and 718.
The transmembrane domain of -738; about amino acids 69-72, 96-99, 165-16
8, 410-413, 525-528, and 630-633 potential N-glycosylation sites; and a leucine zipper pattern of about amino acids 12-33. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 142 (SEQ ID NO: 253) and PRO1480 amino acid sequence and Dayhof.
A significant homology between the f sequences I48746 was revealed. Homology is also PRO148
0 amino acid sequence and the following Dayhoff sequence: S66498; P_W17658; MMU69535_1; HSU60800_
1; I48745; A49069; I48747; GGU28240_1; and AF022946_1. Clone DNA67962-1649 has been deposited with the ATCC and is assigned ATCC deposit no. 203291.

Example 75: Isolation of a cDNA clone encoding human PRO1487 As described in Example 1 above, a single MerckEST, HSC2ID011, referred to herein as "DNA8208", encodes a known protein. No, it was identified as a subject sequence with a BLAST score of 70 or higher. BLAS DNA8208 sequence
It was extended using repeated cycles of T and phrap, and the sequence was extended as much as possible using the source of EST sequences discussed above. The consensus sequence obtained was herein designated "DNA68836". Synthesize oligonucleotides based on the DNA68836 consensus sequence to 1) identify a cDNA library containing the sequence of interest by PCR and 2) use as a probe to isolate a clone of the PRO1487 full-length coding sequence. did. PCR primers (forward and reverse) were synthesized: Forward PCR primer: GTGCCACTACGGGGTGTGGACGAC (54209.f1; SEQ ID NO: 261
) And reverse PCR primer: TCCCATTTCTTCCGTGGTGCCCAG (54209.r1; SEQ ID NO: 262)
) Further, a synthetic oligonucleotide hybridization probe was made from the consensus DNA68836 sequence having the following nucleotide sequence: Hybridization probe: CCAGAAGAAGTCCTTCATGA TGCTCAAGTACATGCACGACCACTA
C (54209.p1; SEQ ID NO: 263) To screen several libraries for a source of full length clones, DNA from the libraries was PCR amplified with the PCR primer pair identified above. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate a clone encoding the PRO1487 gene with one of the primer pairs. RNA for making a cDNA library was isolated from human fetal kidney tissue. By DNA sequencing of the clones isolated as described above, PRO148
0 full-length DNA sequence (herein DNA68836-1656 (Fig143A-B
, SEQ ID NO: 259)); and an inducible protein sequence of PRO1487 (F
ig144; SEQ ID NO: 260) was obtained. The entire coding sequence of PRO1487 is shown in Figure 143A-B (SEQ ID NO: 259).
Shown in. Clone DNA68836-1656 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 489-491 and an apparent stop codon at nucleotide positions 2895-2897.
The predicted polypeptide precursor is 802 amino acids long. The full-length PRO1487 protein shown in Figure 144 has a predicted molecular weight of approximately 91,812 daltons and a pI of approximately 9.52. Additional features include a signal peptide of about amino acids 1-23; potential N-glycosylation sites of about amino acids 189-192, 623-626, and 796-799; and a cell attachment sequence of about amino acids 62-64. . Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 144 (SEQ ID NO: 260) and the amino acid sequence of PRO1487 and the following Da
yhoff sequence: CET24D1_1, S44860, CELC02H6_1, CEC38H2_3, CELC17A2_5, CET09E1
Significant homology between 1_10, CEE03H4_3, CELT22B11_3, GGU82088_1, and CEF56H6_1 was revealed. Clone DNA68836-1656 was deposited with the ATCC on November 3, 1998 and was assigned ATCC deposit no. 203455.

Example 76: Isolation of a cDNA clone encoding human PRO1418 The use of the signal sequence algorithm described in Example 3 above enabled the identification of EST cluster sequences from the Incyte database. Then this ES
T-cluster sequences can be found in public EST databases (eg GenBank) and corporate EST DNA databases (LIFESEQ®, Incyte Pharmaceuticals, Palo).
Existing homology was identified by comparison with various expressed sequence tag (EST) databases, including Alto, CA). One or more of the ESTs was removed from the placental tissue library. The homology search is performed by the computer program BLAST or BLAST2 (Altschul et al., M
ethods in Enzymology 266: 460-480 (1996)). Comparables that do not encode a known protein and have a BLAST score of 70 (sometimes 90) or higher can be found in the program "phrap" (Phil Green, University of Washington, Sea.
(ttle, Washington) to construct a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated DNA58845. Given the sequence homology between the DNA58845 sequence and the EST sequence contained within Incyte clone 1306026, the clone was purchased and the cDNA insert was obtained and sequenced. The sequence of this cDNA insert is shown in Figure 145 where DNA
It is named 68864-1629. The full-length clone shown in Figure 145 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 138-140 and ending at the stop codon at nucleotide positions 1188-1190 (Fig145;
SEQ ID NO: 264). The predicted polypeptide precursor (Fig146, SEQ ID NO: 265) is 350 amino acids long and the signal peptide is from about amino acids 1-19 of SEQ ID NO: 265. PRO1418 has a calculated molecular weight of about 39,003 and about 5
． It has an estimated pI of 59. Clone DNA68864-1629 was deposited with the ATCC on September 22, 1998 and was assigned ATCC deposit no. 203276. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in FIG.
Dayhoff sequence (data is taken in here): AGA1_HAEIN (immunoglobulin a1 protease precursor), P_W03740, CELT23E7_1, SSN6_YEAST, MMPININ_1, AB00993_1,
Sequence identity was demonstrated between P_R52601, S22624, A10377_1 and MUA1_XENLA.

Example 77: Isolation of a cDNA clone encoding human PRO1472 The Incyte sequence was identified and entered into a computer to determine if it has homology to other proteins in the database. EST databases included public EST databases (eg GenBank), and corporate EST databases (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, CA). The homology search is performed by the computer program BLAST or BLAST2 [Altschul et al., Metho
ds in Enzymology 266: 460-480 (1996)] as a comparison of ECD protein sequence with 6-frame translation of EST sequence. A comparison that does not encode a known protein and has a BLAST score of 70 (sometimes 90) or higher is the program "phrap" (Phil Green, University of Washington, Seattle, Washingt.
on) to build a consensus DNA sequence. A consensus DNA sequence encoding PRO1472 was constructed against other EST sequences using phrap. This consensus sequence is now referred to as "DNA628
24 ”. Based on the DNA62824 consensus sequence and other findings and information provided herein, an Incyte clone containing EST 1579843 (from the duodenal tissue library) found in assembly was purchased and sequenced in its entirety. PRO1472 shown in Figure 147 (SEQ ID NO: 266) by sequencing.
The entire coding sequence of Clone DNA68866-1644 contains a single open reading frame and includes nucleotide position 13 of SEQ ID NO: 266.
It has an apparent translational initiation site at 4-136, and nucleotide position 1532-
It has an apparent stop codon at 1534. 466 predicted polypeptide precursors
It is amino acid long. As shown in Figure 148, the signal peptide is at about amino acids 1-17 of SEQ ID NO: 267 and the transmembrane domain is about amino acids 131-.
150 and 235-259. Clone DNA68866-1644 is AT
It has been deposited with the CC and has been assigned ATCC deposit no. 203283. The full-length PRO1472 protein shown in FIG. 148 has an estimated molecular weight of about 52,279 and about 6
． Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method of the full length sequence shown in Figure 148 (SEQ ID NO: 267) having a pI of 16 and the amino acid sequence of PRO1472 and the following:
Dayhoff array (capture data here): BUTY_HUMAN, HS45P21_1, HS45P21_3,
HS45P21_5, HS45P21_4, HSU90142_1, HSU90546_1, AF033107_1, MMHC135G15_7
And HSB73_1 sequence identity was demonstrated.

Example 78: Isolation of a cDNA clone encoding human PRO1461 By the use of the signal sequence algorithm described in Example 3 above, "
It has become possible to identify the EST cluster sequence from the LIFESEQ (trade name) database, named Incyte EST cluster number 159103, also called DNA10747 ". The DNA10747 sequence was then compared to various EST databases, including public EST databases (eg GenBank) and LIFESEQ ™ databases to identify existing homologies. The homology search is performed by the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (199
6)) was used. Does not encode a known protein and has a BLAST score of 70 (9
Comparables with 0 or more) can be found in the program "phrap" (Phil Gr
een, University of Washington, Seattle, Washington) to construct a consensus DNA sequence. One or more of the ESTs was retrieved from a library created from pancreatic tumor tissue. The consensus sequence obtained from it is here
DNA59553 ". EST contained within DNA59553 sequence and Incyte EST number 2944541
In view of sequence homology with the sequences, EST clones were purchased, cDNA inserts were obtained and sequenced. The sequence of this cDNA insert is shown in Figure 149, where D
It is named NA68871-1638. The full-length clone shown in Figure 149 contains a single open reading frame, has an apparent translational initiation site at nucleotide positions 32-34, and ends at the stop codon found at nucleotide positions 1301-1303 (Fig.
149; SEQ ID NO: 268). Predicted polypeptide precursors (Fig150,
SEQ ID NO: 269) is 423 amino acids long. PRO1461 is about 47,69
It has a calculated molecular weight of 6 and an estimated pI of about 8.96. A further feature is a type II transmembrane domain of about amino acids 21-40; ATP / GT of about amino acids 359-366.
P-binding site motif A (P-loop); trypsin family histidine active site at about amino acids 228-233; about amino acids 179-184, 213-218,
317-322, and potential N-myristoylation sites of 360-365; and N-glycosylation sites of about amino acids 75-78, 166-169 and 223-226. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 150 (SEQ ID NO: 269) and PRO1461 amino acid sequence and Dayhof.
f Significant homology between SEQ ID NO: P_R89435 was revealed. Homology is also PRO
1461 amino acid sequence and the following additional Dayhoff sequences: AB002134_1, P_R89430, P_W22
987, HEPS_MOUSE, ENTK_HUMAN, P_W22986, KAL_MOUSE, ACR0_PIG, p_R57283, and TRY7_ANGA. Clone DNA68871-68871 was deposited with the ATCC on September 22, 1998 and was assigned ATCC deposit no. 203280.

Example 79: Isolation of a cDNA clone encoding human PRO1410 By using the signal sequence algorithm described in Example 3 above, IncyteE
E from the Incyte database, named ST cluster SEQ ID NO: 98502
It became possible to identify the ST cluster sequence. This EST cluster sequence is then compared to various expressed sequence tag (EST) databases, including public EST databases (eg GenBank) and corporate EST DNA databases (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, CA). And identified existing homologies. The homology search is performed by the computer program BLAST or BLAST2 (Altschul et al.
hods in Enzymology 266: 460-480 (1996)). A comparison that does not encode a known protein and has a BLAST score of 70 (sometimes 90) or higher is the program "phrap" (Phil Green, University of Washington, Seatt.
le, Washington) to construct a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated DNA56451. In view of the sequence homology between the DNA56451 sequence and the EST sequence contained within Incyte EST clone number 1257046, Incyte EST clone 125046.
Was purchased and the cDNA insert was obtained and sequenced. The sequence of this cDNA insert is F
ig151 and designated herein as DNA68874-1622. Clone DNA68874-1622 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 152-154 and ending at the stop codon at nucleotide positions 866-868 (Fig 151).
The predicted polypeptide precursor is 238 amino acids long (Fig152). F
The full-length PRO1410 protein shown in ig152 has a predicted molecular weight of about 25,262 and a pI of about 6.44. Analysis of the full-length PRO1410 sequence shown in Figure 152 (SEQ ID NO: 271) demonstrated the presence of the following: a signal peptide from about amino acid 1 to about amino acid 20; a transmembrane domain from about amino acid 194 to about amino acid 220 and about Potential N-glycosylation site from amino acid 132 to about amino acid 135. Clone DNA68874-1622 was published on September 9, 1998.
It was deposited with the ATCC on 22nd March and was assigned ATCC deposit no. 203277. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 152 (SEQ ID NO: 271) and the amino acid sequence of PRO1410
Dayhoff array: I48652, P_R76466, HSMHC3W36A_2, EPB4_HUMAN, P_R14256, EPA8_
Significant homology was demonstrated with MOUSE, P_R77285, P_W13569, AF000560_1, and ASF1_HELAN. Example 80: Isolation of a cDNA clone encoding human PRO1568 As described in Example 1 above, consensus DNA sequences were assembled to other ESTs using phrap to form an assembly. The consensus sequence is herein designated "DNA54208". ES within the assembly based on the DNA54208 consensus sequence, the assembly provided here and other information and findings.
Clones containing T were ordered and sequenced. The EST is Incyte 3089490. Overall sequencing gave the sequence shown in Figure 153. The entire coding sequence of PRO1568 is contained in Figure 153 (SEQ ID NO: 272). Clone DNA68880-1676 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 208-210 of SEQ ID NO: 272 and an apparent stop codon at nucleotide positions 1123-1125. The predicted polypeptide precursor is 305 amino acids long. The signal peptide, transmembrane region, N-myristoylation site and amidation site are also F
ig154. Clone DNA68880-1676 has been deposited with the ATCC and is assigned ATCC deposit no. Full length P shown in Figure 154
The RO1568 protein has an estimated molecular weight of approximately 35,383 daltons and approximately 5.99.
Has a pI of Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 154 (SEQ ID NO: 273) and the amino acid sequence of PRO1568
Dayhoff array (incorporated here): AF089749_1, AF054841_1, NAG2_HUMAN, CD63_
HUMAN, CD82_HUMAN, P_W05732, P_R86834, A15_HUMAn, P_W27333 and CD37_HUMAN
The sequence identity between and was revealed.

Example 81: Isolation of a cDNA clone encoding human PRO1570 PRO1 was used against other ESTs using phrap as described in Example 1 above.
The consensus DNA sequence encoding 570 was assembled to form an assembly. This consensus sequence is designated herein as "DNA65415". DNA65
Based on the 415 consensus sequence and other information and findings provided here, Incy
A clone containing teEST3232285 (uterine / colon cancer tissue library) was purchased and sequenced in its entirety to give SEQ ID NO: 274. The entire coding sequence of PRO1570 is contained in Figure 155 (SEQ ID NO: 274). Clone DNA68888-1678 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 210-212 of SEQ ID NO: 274, and an apparent stop codon at nucleotide positions 1506-1508. The predicted polypeptide precursor is 432 amino acids long. Fi
g275 represents a number of motifs. Clone DNA68888-1678 is AT
Deposited with CC and assigned ATCC Deposit No. 203311. The full-length PRO1570 protein shown in Figure 156 has a predicted molecular weight of approximately 47,644 daltons and a pI of approximately 5.18. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 156 (SEQ ID NO: 275) and the amino acid sequence of PRO1570
Dayhoff array (incorporated here): P_W22986, TMS2_HUMAN, HEPS_HUMAN, P_R8943
5, AB002134_1, KAL_MOUSE, ACRO_HUMAN, GEN12917, AF045649_1, and P_W34285
The sequence identity between and was revealed.

Example 82: Isolation of a cDNA clone encoding human PRO1317 A consensus DNA sequence was constructed against other EST sequences using phrap as described in Example 1 above. This consensus sequence is now called "Consen
8865 ". In addition, the Consen8865 consensus sequence is converted to BLAST and phr.
EST extended using repeated cycles of ap and consensus sequence discussed above
It was extended as much as possible using the source of the sequence. The extended consensus sequence is designated herein as "DNA63334". Oligonucleotides were synthesized based on the DNA63334 consensus sequence to 1) identify a cDNA library containing the sequence of interest by PCR and 2) to use as a probe to isolate a clone of the PRO1317 full-length coding sequence. did. PCR primers (forward and reverse) were synthesized: Forward PCR primer: CTGCTGGTGAAATCTGGCGTGGAG (63334.f1; SEQ ID NO: 27)
8); and reverse PCR primer: GTCTGGTCCTGGCTGTCCACCCAG (63334.r1; SEQ ID NO: 27)
9). In addition, a synthetic oligonucleotide hybridization probe was prepared from the consensus DNA63334 sequence having the following nucleotide sequence. Hybridization probe: CATCTTGTCATGTACCTGGGAACCACCACA GGGTCGCTCCACAAG
(63334.p1; SEQ ID NO: 280) To screen several libraries for sources of full length clones, DNA from the libraries was PCR amplified with the PCR primer pair identified above. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate clones encoding the PRO1317 gene with one of the primer pairs. RNA for making a cDNA library was isolated from human hippocampal tissue. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO1317 (herein designated as DNA71166-1685 [Fig157, SEQ ID NO: 276]) and the derived protein sequence for PRO1317. The entire coding sequence of PRO1317 is shown in Figure 157 (SEQ ID NO: 276). Clone DNA71166-1685 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 105-107 and an apparent stop codon at nucleotide positions 2388-2390. The predicted polypeptide precursor is 761 amino acids long, has a predicted molecular weight of approximately 83,574 daltons and a pI of approximately 6.78. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in FIG.
f Significant homology with SEQ ID NO: I48745 was revealed. Homology is also PRO
1317 amino acid sequence and the following Dayhoff sequence: I48746, GEN13418, P_W58540, P_217
657, MUSC1_1, P_471380, U73167_5, HSU33920_1, and GG828240_1. Clone DNA71166-1685 was deposited with the ATCC on October 20, 1998 and was assigned ATCC deposit no. 203355.

Example 83: Isolation of cDNA clone encoding human PRO1780 The DNA63837.init sequence was obtained as described in Example 1 above and BLA
ST and Program "phrap" (Phil Green, University of Washington, Seattle)
Was used to extend the consensus sequence as much as possible using the sources of EST sequences discussed above. The expanded consensus sequence is designated herein as "DNA63837". Based on the DNA63837 consensus sequence, oligonucleotides were synthesized for 1) identification of a cDNA library containing the sequence of interest by PCR and 2) use as a probe to isolate clones of the full-length coding sequence of PRO1780. did. PCR primers (forward and reverse) were synthesized: Forward PCR primer: TGCCTTTGCTCACCTACCCCAAGG (63837.f1; SEQ ID NO: 28)
3) Reverse PCR primer: TCAGGCTGGTCTCCAAAGAGAGGG (63837.r1; SEQ ID NO: 28)
Four). In addition, a synthetic oligonucleotide hybridization probe was prepared from the consensus DNA63837 sequence having the following nucleotide sequence. Hybridization probe: CCCAAAGATGTCCACCTGGCTGCAAATGTGAAAATTGTGGACTGG (63837.p1; SEQ ID NO: 285) To screen several libraries for a source of full length clones, DNA from the libraries was PCR amplified with the PCR primer pair identified above. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate a clone encoding the PRO1780 gene with one of the primer pairs. RNA for making a cDNA library was isolated from human fetal kidney. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO1780 (designated herein as DNA71169-1709 [Fig159, SEQ ID NO: 281]) and the derived protein sequence for PRO1780. The entire coding sequence of PRO1780 is shown in Figure 159 (SEQ ID NO: 281). Clone DNA71169-1709 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 68-70 and an apparent stop codon at nucleotide positions 1637-1639. The predicted polypeptide precursor is 523 amino acids long. Full length PR shown in Fig160
The O1780 protein has a predicted molecular weight of about 59,581 daltons and a pI of about 8.68. Additional features are a signal peptide of about amino acids 1-19; a transmembrane domain of about amino acids 483-504; about amino acids 68-74 and 425-43.
3 tyrosine phosphorylation site; about amino acids 16-21, 301-206, 370-
375, and the N-myristoylation site at 494-499; and about amino acid 493.
-Includes a leucine zipper pattern of 514. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 160 (SEQ ID NO: 282) and the amino acid sequence of PRO1780 and Dayhof.
f array: UDA2_RABIT, CGT_HUMAN, UD11_HUMAN, P_R26153, UDB1_RAT, HSU59209_1
, AB010872_1, UDB5_MOUSE, UDB8_HUMAN, and UD14_HUMAN revealed significant homology. Clone DNA71169-1709 was deposited with the ATCC on November 17, 1998 and was assigned ATCC deposit no. 203467.

Example 84: Isolation of a cDNA clone encoding human PRO1486 A consensus DNA sequence was constructed against other EST sequences using phrap as described in Example 1 above. This consensus sequence is now referred to as "DNA48
897 ”. 1) PC based on the DNA48897 consensus sequence
To identify a cDNA library containing the sequence of interest by R, and 2) P
Oligonucleotides were synthesized for use as probes to isolate clones of the RO1486 full-length coding sequence. PCR primers (forward and reverse) were synthesized: forward PCR primer: 5'AGGCAGCCACCAGCTCTGTGCTAC3 '(SEQ ID NO: 288); and reverse PCR primer: 5'CAGAGAGGGAAGATGAGGAAGCCAGAG3' (SEQ ID NO: 289) Furthermore, synthetic oligonucleotide hybridization. The probe was made from the consensus DNA48897 sequence with the following nucleotide sequence: Hybridization probe: 5'CTGTGCTACTGCCCTTGGAC CCTGGGGACCGAGTGTCTCTGC3
'(SEQ ID NO: 290). To screen several libraries for a source of full-length clones, DNA from the libraries was PCR amplified with the PCR primer pair identified above. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate clones encoding the PRO1486 gene with one of the primer pairs. RNA for making a cDNA library was isolated from a human adenocarcinoma cell line. By DNA sequencing of the clones isolated as described above, PRO148
6 full length DNA sequences and the PRO1486 derived protein sequence were obtained. The entire coding sequence of PRO1486 is shown in Figure 161 (SEQ ID NO: 286). Clone DNA71180-1655 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 472-474 of SEQ ID NO: 286 and an apparent stop codon at nucleotide positions 1087-1089. The predicted polypeptide precursor is 205 amino acids long. The signal peptide is located at about amino acids 1-32 of SEQ ID NO: 287. Regions similar to those of C1q and N-glycosylation sites are located as shown in Figure 162. Clone DNA71180-1655 has been deposited with the ATCC and is assigned ATCC deposit no. 203403. The full-length PRO1486 protein shown in Figure 162 has a predicted molecular weight of approximately 21,521 daltons and a pI of approximately 7.07. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis of the full length sequence shown in Figure 162 (SEQ ID NO: 287) and the amino acid sequence of PRO1486 and the following Da
yhoff array: CERB_HUMAN, CERL_RAT, GEN11893, P_R22263, CA18_HUMAN, C1QC_HU
Sequence identity among MAN, AF054891_1, A57131, HUMC1Qb2_1, ACR3_MOUSE was revealed.

Example 85: Isolation of a cDNA clone encoding human PRO1433 A consensus DNA sequence was constructed against other EST sequences using phrap as described in Example 1 above. This consensus sequence is now DNA452
It was named 30. Based on the DNA45230 consensus sequence, 1) to identify a cDNA library containing the sequence of interest by PCR, and 2) PRO
Oligonucleotides were synthesized for use as probes to isolate clones of the 1433 full length coding sequence. PCR primers (forward and reverse) were synthesized: Forward PCR primer (45230.f1): 5'-GCTGACCTGGTTCCCATCTACTCC-3 '(SEQ ID NO: 293) Reverse PCR primer (45230.r1): 5'-CCCACAGACACCCATGACACTTCC-3 '(SEQ ID NO: 294) Furthermore, a synthetic oligonucleotide hybridization probe was made from the consensus DNA45230 sequence having the following nucleotide sequence: Hybridization probe (45230.p1): 5'-AAGAATGAATTGTACAAAGC AGGTGATCTT
CGAGGAGGGCTCCTGGGGCC-3 '(SEQ ID NO: 295). To screen several libraries for a source of full-length clones, DNA from the libraries was PCR amplified with the PCR primer pair identified above. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate clones encoding the PRO1433 gene with one of the primer pairs. RNA for making a cDNA library was isolated from human adrenal tissue. DNA sequencing of the clones isolated as described above revealed that PRO143
The full-length DNA sequence of 3 (herein designated as DNA71184-1634 [Fig163, SEQ ID NO: 291]); and the derived protein sequence of PRO1433 were obtained. The entire nucleotide sequence of DNA71184-1634 is shown in Figure 163 (SEQ ID NO: 291). Clone DNA71184-1634 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 185-187 and ending at the apparent stop codon at nucleotide positions 1349-1351 (Fig163). The predicted polypeptide precursor is 388 amino acids long (Fig164). The full-length PRO1433 protein shown in Figure 164 has a predicted molecular weight of approximately 43,831 daltons and a pI of approximately 9.64. F
Analysis of full length PRO1433 shown in ig164 (SEQ ID NO: 292) demonstrates the presence of the following: a transmembrane domain from about amino acid 76 to about amino acid 97; about amino acid 60 to about amino acid 63, about amino acid 173 to about amino acid 173 to about 173. Amino acid 17
6 and about amino acids 228 to about amino acids 231 potential N-glycosylation sites and about amino acids 10 to about amino acids 15, about amino acids 41 to about amino acids 46,
About amino acid 84 to about amino acid 89, about amino acid 120 to about amino acid 125,
About amino acid 169 to about amino acid 174, about amino acid 229 to about amino acid 23
4, potential N-myristoylation sites from about amino acids 240 to about amino acids 245, about amino acids 318 to about amino acids 323 and about amino acids 378 to about amino acids 383. Clone DNA71184-1634 is ATC on September 22, 1998.
Deposited at C and assigned ATCC Deposit No. 203266. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 164 (SEQ ID NO: 292) and the amino acid sequence of PRO1433 and the following Da
yhoff sequence: Significant homology between CELW01A11_4, CEF59A1_4, S67138, MTV050_3, S75135 and S12411 was demonstrated.

Example 86: Isolation of a cDNA clone encoding human PRO1490 Consensus DNA sequences were constructed against other EST sequences using the phrap method as described in Example 1 above. This consensus sequence is DN here
It was named A67006. 1) based on the DNA67006 consensus sequence
To identify a cDNA library containing the sequence of interest by PCR, and 2
3.) Oligonucleotides were synthesized for use as probes to isolate clones of the PRO1490 full length coding sequence. PCR primers (forward and reverse) were synthesized: Forward PCR primer (67006.f1) 5'-CTTCCTCTGTGGGTGGACCATGTG-3 '(SEQ ID NO: 298) Reverse PCR primer (67006.r1) 5'-GCCACCTCCATGCTAACGCGG-3' ( (SEQ ID NO: 299) Furthermore, a synthetic oligonucleotide hybridization probe was made from the consensus DNA67006 sequence having the following nucleotide sequence: Hybridization probe: (67006.p1) 5'-CCAAGGTCCTCGCTAAGAAGGAGCTGCTCTA
CGTGCCCCTCATCG-3 '(SEQ ID NO: 300) To screen several libraries for sources of full length clones, DNA from the libraries was PCR amplified with the PCR primer pair identified above. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate clones encoding the PRO1490 gene with one of the primer pairs. RNA for making a cDNA library was isolated from human adrenal tissue. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO1490 (designated herein as DNA71213-1659 [Fig165, SEQ ID NO: 296]); and the derived protein sequence for PRO1490. The entire nucleotide sequence of DNA71213-1659 is shown in Figure 165 (SEQ ID NO: 296). Clone DNA71213-1659 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 272-274 and ending at the apparent stop codon at nucleotide positions 1376-1378 (Fig165). The predicted polypeptide precursor is 368 amino acids long (Figure 166). The full-length PRO1490 protein shown in Figure 166 has a predicted molecular weight of approximately 42,550 daltons and a pI of approximately 9.11. Fi
Analysis of the full-length PRO1490 sequence set forth in g166 (SEQ ID NO: 297) demonstrates the presence of the following: a signal peptide of about amino acids 1 to about amino acids 25, about amino acids 307 to about amino acids 323 and about amino acids 335 to about amino acids 352. And a tyrosine kinase phosphorylation site from about amino acid 160 to about amino acid 168 and about amino acid 161 to about amino acid 168. Clone D
NA71213-1659 was deposited with the ATCC on October 27, 1998.
TCC Deposit No. 203401 has been assigned. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 166 (SEQ ID NO: 297) and the amino acid sequence of PRO1490 and the following:
Dayhoff array: A52744_1, S60478, P_R99249, P_R59712, YBP2_YEAST, S54641, C
Significant homology with ELT05H4_15, CELF28B3_1, CELZK40_1 and YIHG_ECOLI was demonstrated.

Example 87: Isolation of a cDNA clone encoding human PRO1482 A cDNA clone encoding the native human PRO1482 polypeptide (DN
A71234-1651) was identified using a yeast screen in a human fetal adrenal gland cDNA library predominantly at the 5'end of the primary cDNA clone. The full length DNA71234-1651 clone shown in Figure 167 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 33-35, and ending at the stop codon at nucleotide positions 462-464 (Fig167). The predicted polypeptide precursor is 143 amino acids long (Fig168). The total length PRO1482 shown in FIG. 168 is about 15,624.
It has an estimated molecular weight of Daltons and a pI of about 9.58. Analysis of the full-length PRO1482 sequence shown in Figure 168 (SEQ ID NO: 302) demonstrates the presence of the following: a signal peptide from about amino acid 1 to about amino acid 28. Clone DNA7
1234-1651 deposited with the ATCC on October 27, 1998
Deposit number 203402 has been assigned. Dayhoff database (version 35.45) using WU-BLAST-2 sequence alignment analysis of the full length sequence shown in Figure 168 (SEQ ID NO: 302).
Analysis of SwissProt 35) demonstrated the predominant homology between the PRO1482 amino acid sequence and the following Dayhoff sequence: A18267_3.

Example 88: Isolation of a cDNA clone encoding human PRO1446 The use of the signal sequence algorithm described in Example 3 above enabled the identification of EST cluster sequences from the Incyte database. Then this ES
T-cluster sequences can be found in public EST databases (eg GenBank) and corporate EST DNA databases (LIFESEQ®, Incyte Pharmaceuticals, Palo).
Existing homology was identified by comparison with various expressed sequence tag (EST) databases, including Alto, CA). One or more of the ESTs was removed from the islet cell library. The homology search is performed by the computer program BLAST or BLAST2 (Altschul et al., M
ethods in Enzymology 266: 460-480 (1996)). Comparables that do not encode a known protein and have a BLAST score of 70 (sometimes 90) or higher can be found in the program "phrap" (Phil Green, University of Washington, Sea.
(ttle, Washington) to construct a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated DNA56514. In view of the sequence homology between the DNA56514 sequence and the EST sequence contained within Incyte EST clone number 2380344, a clone containing this EST was purchased and a cDNA insert was obtained and sequenced. The sequence of this cDNA insert is
9 and is herein designated as DNA71277-1636. The full-length clone shown in Figure 169 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 152-154, and ending at the stop codon at nucleotide positions 479-481 (Fig169; SEQ ID NO: 303). . Predicted polypeptide precursor (Fig170; SEQ ID NO: 3)
04) is 109 amino acids long and the signal peptide is at about amino acids 1-15 of SEQ ID NO: 304. PRO1446 has a calculated molecular weight of about 11,822 and about 8.6.
It has an estimated pI of 3. Clone DNA71277-1636 was deposited with the ATCC on September 22, 1998 and was assigned ATCC deposit no. 203285. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 170 (SEQ ID NO: 304) and the amino acid sequence of PRO1446
Dayhoff array (Capture data here): P53_CANFA, P53_FELCA, LRP1_HSV1F,
Sequence identity with OSU57338_1, S75842, P_P93722, AF002189_1, B70408, S54309 and S53365 was revealed. The first in this list is Kraegel et al., Can
cer Lett., 92 (2) * 181-186 (1995).

Example 89: Isolation of a cDNA clone encoding human PRO1558 By using the signal sequence algorithm described in Example 3 above, IncyteE
E from the Incyte database, named ST cluster SEQ ID NO: 86390
It became possible to identify the ST cluster sequence. This EST cluster sequence is then compared to various expressed sequence tag (EST) databases, including public EST databases (eg GenBank) and corporate EST DNA databases (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, CA). And identified existing homologies. The homology search is performed by the computer program BLAST or BLAST2 (Altschul et al.
hods in Enzymology 266: 460-480 (1996)). A comparison that does not encode a known protein and has a BLAST score of 70 (sometimes 90) or higher is the program "phrap" (Phil Green, University of Washington, Seatt.
le, Washington) to construct a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated DNA58842. In view of the sequence homology between the DNA58842 sequence and the EST sequence contained within Incyte EST clone no. 3746964, Incyte EST clone no.
964 was purchased and the cDNA insert was obtained and sequenced. The sequence of this cDNA insert is shown in Figure 171 and is herein designated as DNA71282-1668. Clone DNA71282-1668 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 84-86 and ending at the stop codon at nucleotide positions 870-872 (Fig171). The predicted polypeptide precursor is 262 amino acids long (Fig172). Fig
The full-length PRO1558 protein shown at 172 has a predicted molecular weight of about 28,809 and a pI of about 8.80. Analysis of full length PRO1558 shown in Figure 172 (SEQ ID NO: 306) demonstrates the presence of the following: a signal peptide of about amino acids 1 to about amino acids 25, about amino acids 8 to about amino acids 30 and about amino acids 109 to about amino acids. 130 transmembrane domains, about amino acid 190 to about amino acid 193 potential N-glycosylation site, about amino acid 238 to about amino acid 246 tyrosin kinase phosphorylation site, about amino acid 22 to about amino acid 27.
, About amino acid 28 to about amino acid 33, about amino acid 110 to about amino acid 115
, N-myristoylation sites from about amino acid 205 to about amino acid 210 and about amino acid 255 to about amino acid 260 and amidation sites from about amino acid 31 to about amino acid 34 and about amino acid 39 to about amino acid 42. Clone DNA71282-
1668 was deposited with the ATCC on October 6, 1998, ATCC deposit no. 20.
3312 was awarded. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in FIG.
yhoff array: AF075724_2, MXU24657_3, CAMT_EUCGU, MSU20736_1, P_R29515, B70
Significant homology between 431, JC4004, CEY32B12A_3, CELF53B3_2 and P_R13543 was proved.

Example 90: Isolation of a cDNA clone encoding human PRO1604 Expression sequence tag (EST) DNA database (LIFESEQ (trade name), Incyte Phar)
Maceuticals, Palo Alto, CA) was searched. Incyte EST number 3550440 was identified as having homology with HDGF. Then, EST number 355044
0 was compared to various EST databases, including public EST databases (eg GenBank) and LIFESEQ ™ database to identify homologous EST sequences. The search is performed by the computer program BLAST or BLAST2 [Altschul et al., Methods i
n Enzymology 266: 460-480 (1996)]. A comparison that does not encode a known protein and has a BLAST score of 70 (sometimes 90) or higher is the program "phrap" (Phil Green, University of Washington, Seattle, Wa.
shington) to construct a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated "DNA67237". DNA67237 sequence and EST number 336706 from LIFESEQ database
In view of the sequence homology with 0, a clone containing Incyte EST number 3367060 was purchased, the cDNA insert was obtained and sequenced, and FIG. 173 (SEQ ID NO: 307
), The entire coding sequence of PRO1604 is obtained. Clone DNA71286-1687 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 65-67, and ending at the stop codon at nucleotide positions 2078-2080. The predicted polypeptide precursor is 671 amino acids long. Full length PRO16 shown in FIG. 174
The 04 protein has a predicted molecular weight of approximately 74,317 and a pI of approximately 7.62.
A further feature is a signal peptide of about amino acids 1-13; about amino acids 156-1.
59, 171-174, and 451-454 cAMP and cGMP-dependent protein kinase phosphorylation sites; and a cell attachment sequence of about amino acids 661-663. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in FIG.
f Significant homology with SEQ ID NO: P_W37483 was revealed. Homology is also PR
O1604 amino acid sequence and the following Dayhoff sequence: AF063020_1, P_R66727, P_W37482,
It was also shown between JC5661, CEC25A1_11, CEU33058_1, I38073, MST2_DROHY, and HSATRX36_1. Clone DNA71286-1687 was deposited with the ATCC on October 20, 1998 and was assigned ATCC deposit no. 203357.

Example 91: Isolation of a cDNA clone encoding human PRO1491 Consensus DNA sequences were constructed against other EST sequences using the phrap method as described in Example 1 above. This consensus sequence is DN here
It was named A67202. 1) based on the DNA67202 consensus sequence
To identify a cDNA library containing the sequence of interest by PCR, and 2
3.) Oligonucleotides were synthesized for use as probes to isolate clones of the full-length coding sequence of PRO1491. PCR primers (forward and reverse) were synthesized: Forward PCR primer (67202.f1) 5'-CAACGCAGCCGTGATAAACAAGTGG-3 '(SEQ ID NO: 311) Reverse PCR primer (67202.r1) 5'-GCTTGGACATGTACCAGGCCGTGG-3' ( SEQ ID NO: 312) Further, a synthetic oligonucleotide hybridization probe was made from the consensus DNA67202 sequence having the following nucleotide sequence: Hybridization probe: (67202.p1) 5'-GGCCAGACTGATTTGCTCAATTCCTGGAAGT
GATGGGGCAGATAC-3 '(SEQ ID NO: 313) RNA for construction of a cDNA library was isolated from human aortic endothelial cell tissue. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO1491 (designated herein as DNA71883-1660 [Fig175, SEQ ID NO: 309]); and the derived protein sequence for PRO1491. The entire nucleotide sequence of DNA71883-1660 is shown in Figure 175 (SEQ ID NO: 309). Clone DNA71883-1660 contains a single open reading frame, has an apparent translational initiation site at nucleotide positions 107-109, and ends at the apparent stop codon at nucleotide positions 2438-2440 (Fig175). The predicted polypeptide precursor is 777 amino acids long (Figure 176). The full-length PRO1491 protein shown in Figure 176 has a predicted molecular weight of about 89,651 daltons and a pI of about 7.97. Fi
Analysis of the full-length PRO1491 sequence set forth in g176 (SEQ ID NO: 310) demonstrates the presence of the following: a signal peptide of about amino acids 1 to about amino acids 36, about amino acids 139 to about amino acids 142, about amino acids 607 to about amino acids 6
Potential N-glycosylation sites of 10 and about amino acids 724 to about amino acids 727, tyrosine kinase phosphorylation sites of about amino acids 571 to about 576 amino acids and Gram-positive coccus surface protein anchor hexapeptide sequences of about amino acids 32 to about amino acids 37. . Clone DNA71883-1660 was deposited with the ATCC on November 17, 1998 and was assigned ATCC deposit no. 203475. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 176 (SEQ ID NO: 310) and the amino acid sequence of PRO1491 and the following:
Dayhoff sequence: GGU28240_1, MUSC1_1, D49423, MMSEMH_1, AB002329_1, AF022947
Significant homology was demonstrated with _1, HSU33920_1, HUMLUCA19_1, G01856 and AF022946_1.

Example 92: Isolation of a cDNA clone encoding human PRO1431 Expression Sequence Tag (EST) DNA database (LIFESEQ (trade name), Incyte Phar
maceuticals, Palo Alto, CA) to identify ESTs (isolated from adult brainstem tissue) that were homologous to SH3 (1370141, DNA66505). cd
RNA for the generation of NA libraries was isolated from human bone marrow. Isolated ES
The full-length cDNA corresponding to T was cloned in vitro in pRK5 (DNA
73401-1633). The cDNA library used to isolate the cDNA clone encoding human PRO1431 was made by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. cDNA is Not
Primed with oligo dT containing the I site, blunt-ended with SalI hemikinase adapter, cut with NotI, sized appropriately by gel electrophoresis, and cloned into a suitable cloning vector (such as pRKB or pRK5D; pRK5B
It is a precursor of pRK5D that does not contain an iI site; Holmes et al., Science, 253: 1278.
-1280 (see 1991)), with unique XhoI and NotI sites in the desired orientation. The cDNA clone was sequenced in its entirety. The entire nucleotide sequence of DNA73401-1633 (SEQ ID NO: 314) is shown in Figure 177. Clone DN
A73401-1633 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 630-632 and a stop codon at nucleotide positions 1740-1742. The predicted polypeptide precursor encoded by DNA73401-1633 is 370 amino acids long. Clone D
NA73401 (designated as DNA73401-1633) has been deposited with the ATCC,
ATCC Deposit No. 203273 has been assigned. Based on sequence alignment analysis of the full-length sequence (using the ALIGN computer program), PRO1431 shows significant amino acid sequence identity with SH17_HUMAN, an SH3 containing the protein known as SH3P17. Further significant identities are D89164_1, AF032118_1, EXLP_TOBAC, YHR4_YEAST, S46992, RATP130CAS
_2, AF043259_1, RATP130CAS_1 and MYSC_ACACA were also found.

Example 93: Isolation of a cDNA clone encoding human PRO1563 Consensus DNA sequences were constructed against other EST sequences using the phrap method as described in Example 1 above. This consensus sequence is DN here
It was named A67191. 1) based on the DNA67191 consensus sequence
To identify a cDNA library containing the sequence of interest by PCR, and 2
3.) Oligonucleotides were synthesized for use as probes to isolate clones of the full-length coding sequence of PRO1563. PCR primers (forward and reverse) were synthesized: Forward PCR primer (67191.f1) 5'-CCCTGAAGCTGCCAGATGGCTCC-3 '(SEQ ID NO: 318) Reverse PCR primer (67191.r1) 5'-CTGTGCTCTTCGGTGCAGCCAGTC-3' ( (SEQ ID NO: 319) Furthermore, a synthetic oligonucleotide hybridization probe was made from the consensus DNA67191 sequence with the following nucleotide sequence: Hybridization probe: (67191.p1) 5'-CCACAGATGTGGTACTGCCTGGGGCAGTCAG
CTTGCGCTACAG-3 '(SEQ ID NO: 320) To screen several libraries for a source of full length clones, DNA from the libraries was PCR amplified with the PCR primer pair identified above. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate a clone encoding the PRO1563 gene with one of the primer pairs. RNA for making a cDNA library was isolated from human bone marrow tissue. By DNA sequencing of the clones isolated as described above, the full-length DNA sequence of PRO1563 (designated herein as DNA73492-1671 [Fig179A-B
, SEQ ID NO: 316]); and the derived protein sequence of PRO1563 was obtained. The entire nucleotide sequence of DNA73492-1671 is shown in Figure 179A-B (SEQ ID NO: 316). Clone DNA73492-1671 contains a single open reading frame, has an apparent translational initiation site at nucleotide positions 419-421, and ends at the apparent stop codon at nucleotide positions 2930-2932 (Figure 179A-B). The predicted polypeptide precursor is 837 amino acids long (Fig180). Full length PRO15 shown in Fig180
The 63 protein has a predicted molecular weight of approximately 90,167 daltons and a pI of approximately 8.39. Analysis of the full-length PRO1563 sequence shown in Figure 180 (SEQ ID NO: 317) demonstrates the presence of the following: a signal peptide from about amino acid 1 to about amino acid 48, a potential N-glycosylation from about amino acid 6 to about amino acid 71. Site, about amino acid 188 to about amino acid 191 and about amino acid 772 to about amino acid 775 glycosaminoglycan attachment site, about amino acid 182 to about amino acid 1
85 cAMP and cGMP-dependent protein kinase phosphorylation site; about amino acid 730 to about amino acid 736 tyrosine kinase phosphorylation site, about amino acid 5
From about amino acid 10, about amino acid 19 to about amino acid 24, about amino acid 121 to about amino acid 126, about amino acid 125 to about amino acid 130, about amino acid 13
0 to about amino acid 135, about amino acid 147 to about amino acid 152, about amino acid 167 to about amino acid 172, about amino acid 168 to about amino acid 173, about amino acid 174 to about amino acid 179, about amino acid 323 to about amino acid 328, about amino acid 352, etc. About amino acid 357, about amino acid 539 to about amino acid 544,
About amino acid 555 to about amino acid 560, about amino acid 577 to about amino acid 58
2, potential N-myristoylation sites from about amino acids 679 to about amino acids 684, about amino acids 682 to about amino acids 687, and about amino acids 763 to about amino acids 768, about amino acids 560 to about amino acids 563 and about amino acids 834 to about amino acids. 837 amidation site, about amino acid 17 to about amino acid 38 and about amino acid 24 to about amino acid 45 leucine zipper pattern sequence and about amino acid 3
Neutral zinc metallopeptidase from 58 to about amino acid 367, zinc binding region signature sequence. Clone DNA73492-1671 was cloned on October 6, 1998 at A
It has been deposited with the TCC and has been assigned ATCC deposit no. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 180 (SEQ ID NO: 317) and the amino acid sequence of PRO1563
Dayhoff array: AB014588_1, D67076_1, AB001735_1, P_W47028, AB002364_1, P_W
Significant homology was demonstrated between 47029, GEN13695, P_R40823, AF005665_1 and DISA_TRIGA.

Example 94: Isolation of a cDNA clone encoding human PRO1565 Consensus DNA sequences were constructed against other EST sequences using the phrap method as described in Example 1 above. This consensus sequence is DN here
It was named A67183. Based on the observed homology between the DNA67183 consensus sequence and the EST sequence contained within Incyte EST clone number 2510320, Incyte EST clone number 251032 was purchased and its insert was obtained and sequenced. The insert sequence is shown in Figure 181, where DNA73
727-1673 (SEQ ID NO: 321). The entire nucleotide sequence of DNA73727-1673 is shown in Figure 181 (SEQ ID NO: 321). Clone DNA73727-1673 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 59-61 and ending at the apparent stop codon at nucleotide positions 1010-1012 (Fig181). The predicted polypeptide precursor is 317 amino acids long (Fig182). The full-length PRO1565 protein shown in Figure 182 has a predicted molecular weight of approximately 37,130 daltons and a pI of approximately 5.18. Fig1
Analysis of the full-length PRO1565 sequence set forth in 82 (SEQ ID NO: 322) demonstrates the presence of the following: a signal peptide from about amino acid 1 to about amino acid 40, a potential type II transmembrane from about amino acid 25 to about amino acid 47. Domain, about N amino acids 94 to about amino acids 97 and about amino acids 180 to 183 potential N
-Glycosylation site, about amino acids 92 to about amino acids 95, about amino acids 70 to about amino acids 73, about amino acids 85 to about amino acids 88, about amino acids 133 to about amino acids 136, about amino acids 148 to about amino acids 151, about amino acids 192 to about 192 Glycosaminoglycan attachment sites of amino acids 195 and about amino acids 239 to about amino acids 242, about amino acids 33 to about amino acids 38, about amino acids 95 to about amino acids 100, about amino acids 116 to about amino acids 121, about amino acids 215 to about amino acids 220 and Potential N-from about amino acid 272 to about amino acid 277
A myristoylation site, a microbody C-terminal targeting signal sequence from about amino acids 315 to about amino acids 317, and a cytochrome C family heme binding site signature sequence from about amino acids 9 to about amino acids 14. Clone DNA73727-1673 is 199
It was deposited with the ATCC on November 3, 8 and was assigned ATCC deposit no. 203459. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in FIG. 182 (SEQ ID NO: 322) resulted in the PRO1565 amino acid sequence and the following Da
yhoff array: AF051425_1, P_R65488, GRPE_STAAU, RNU31330_1, ACCD_BRANA, D50
Significant homology was demonstrated between 558_1, HUMAMYAB3_1, P_W34452 and P_P50629.

Example 95: Isolation of cDNA clones encoding human PRO1571 Consensus DNA sequences were constructed against other EST sequences using the phrap method as described in Example 1 above. This consensus sequence is DN here
It was named A69559. Based on the observed homology between the DNA69559 consensus sequence and the EST sequences contained within Incyte EST clone number 3140760, Incyte EST clone number 3240760 was purchased and its insert was obtained and sequenced. The insert sequence is shown in Figure 183, where DNA7
It is named 3730-1679. Clone DNA73730-1679 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 90-92 and ending at the apparent stop codon at nucleotide positions 807-809 (Fig18.
3). The predicted polypeptide precursor is 239 amino acids long (Figure 184).
). The full-length PRO1571 protein shown in Figure 184 has a predicted molecular weight of approximately 25,699 daltons and a pI of approximately 8.99. Figure 184 (SEQ ID NO: 32)
Analysis of the full-length PRO1571 sequence shown in 4) demonstrates the presence of:
A signal peptide of about amino acids 1 to about amino acids 21 and about amino acids 82 to about amino acids 103, about amino acids 115 to about amino acids 141 and about amino acids 160.
To a transmembrane domain of about amino acid 182. Clone DNA73730-1679
Deposited with the ATCC on October 6, 1998, ATCC Deposit No. 203320
Was granted. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 184 (SEQ ID NO: 324) results in the PRO1571 amino acid sequence and the following Da
yhoff array: AF072128_1, AB000712_1, AB000714_1, AF007189_1, AF000959_1, A
Significant homology was demonstrated with F068863_1, P_W15288, PM22_HUMAN, P_R30056 and LSU46824_1. Example 96: Isolation of a cDNA clone encoding human PRO1572 A consensus sequence was obtained using the method described in Example 1 above. The consensus sequence is designated herein as "DNA69560". DNA69
Based on the 560 consensus sequence and other information provided herein, the entire coding sequence for PRO1573, including other ESTs from the assembly, is shown in Figure 185 (SEQ ID NO: 325). Clone DNA73734-1680 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 90-92 and an apparent stop codon at nucleotide positions 873-875. The predicted polypeptide precursor is 261 amino acids long. The signal peptide is located at about amino acids 1-23 of SEQ ID NO: 326 and has a transmembrane domain of about 81.
-100, 121-141, and 173-194. One or more of the transmembrane domains can be deleted or inactivated. The N-glycosylation site, N-myristoylation site, tyrosine kinase phosphorylation site and prokaryotic membrane lipoprotein lipid attachment site are shown in Figure 186. Clone DNA73734-1680 is AT
It has been deposited with the CC and has been assigned ATCC deposit no. 203363. The full-length PRO1572 protein shown in Figure 186 has a predicted molecular weight of approximately 27,856 daltons and a pI of approximately 8.5. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in FIG.
yhoff array (incorporated here): AF072127_1, HSU89916_1, AB000713_1, AB00071
4_1, AB000712_1, AF000959_1, AF072128_1, AF068863_1, P_W29881, and P_W58
Sequence identity with 869 was revealed.

Example 97: Isolation of a cDNA clone encoding human PRO1573 EST3628990 was isolated from the Incyte database (LIFESEQ (trade name), Incyte Phar).
maceuticals, Palo Alto, CA) and extended in comparison with other sequences in the database to form an assembly. The alignment search is performed using the computer program BLAST or BLAST2 [Altschul et al., Methods in Enzymology 266: 46.
0-480 (1996)] as a comparison of ECD protein sequence with 6-frame translation of EST sequence. Does not encode a known protein and has a BLAST score of 70 (9
Comparables with 0 or more) can be found in the program "phrap" (Phil Gr
een, University of Washington, Seattle, Washington) to construct a consensus DNA sequence. The consensus sequence is designated herein as "DNA69561". Based on the DNA69561 consensus sequence and other information and findings provided here, a clone containing another EST from the assembly (IncyteDNA3752657) was purchased and sequenced. This clone was from a breast tumor tissue library. The entire coding sequence of PRO1573 is contained in Figure 187 (SEQ ID NO: 327). Clone DNA73735-1681 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 97-99, and an apparent stop codon at nucleotide positions 772-774. The predicted polypeptide precursor is 225 amino acids long. Signal peptide is SEQ ID NO: 3
At about amino acids 1-17 of 28, the transmembrane domain is about amino acids 82-101,
118-145, and 164-188. One or more of the transmembrane domains can be deleted or inactivated. The phosphorylation site, amidation site, and N-myristoylation site are shown in Figure 188. Clone DNA73735-1681 has been deposited with ATCC and is assigned ATCC deposit no. Fig18
The full-length PRO1573 protein shown in 8 has a predicted molecular weight of approximately 24,845 daltons and a pI of approximately 9.07. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 188 (SEQ ID NO: 328) and the amino acid sequence of PRO1573 and the following:
Dayhoff array (incorporated here): AF007189_1, AB000714_1, AB000713_1, AB000
712_1, A39484, AF000959_1, AF072127_, AF072128_1, AF68863_1 and AF077739_
Sequence identity with 1 was revealed.

Example 98: Isolation of cDNA Clone Encoding Human PRO1488 Expression Sequence Tag (EST) DNA Database (LIFESEQ®, Incyte Phar)
search for maceuticals, Palo Alto, CA) and CP EST number 3639112H1
It was identified as having homology with ER. EST number 3639112H1 is herein designated "DNA69562". EST clone 3639112H1
Was taken from a lung tissue library of a 20-week-old fetus who died of Pateau's syndrome, was purchased and a cDNA insert was obtained and sequenced in its entirety.
The entire nucleotide sequence of PRO1488 is contained in Figure 189 (SEQ ID NO: 329) and is herein designated DNA73736-1657. DNA73736-1
657 contains a single open reading frame at nucleotide positions 6-8
And an apparent stop codon at nucleotide positions 666-668 (FIG. 189; SEQ ID NO: 329). The predicted polypeptide precursor is 220 amino acids long. The full-length PRO1488 protein shown in Figure 190 has a predicted molecular weight of approximately 23,292 daltons and a pI of approximately 8.43. Four transmembrane domains have been identified that are located at about amino acid positions 8-30, 82-102, 121-140, and 166-186. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 190 (SEQ ID NO: 330) and the amino acid sequence of PRO1488 and Dayhof.
A significant homology between the f sequences AB000712_1 was revealed. Homology is also PRO1
488 amino acid sequence and the following Dayhoff sequence: AB000714_1, AF007189_1, AF000959_1,
P_W63697, MMU82758_1, AF072127_1, AF072128_1, HSU89916_1, AF068863_1, C
It was also found between EAF000418_1 and AF077739_1. Clone DNA73736-1657 was deposited with the ATCC on November 17, 1998 and was assigned ATCC deposit no. 203466. Example 99: Isolation of a cDNA clone encoding human PRO1489 Using the phrap described in Example 1 above, the consensus sequence was converted to another EST.
Constructed against an array. This consensus sequence is herein designated DNA69563. DNA69563 consensus sequence and Incyte EST clone no. 3376
Incy based on the observed sequence similarity to the EST sequences contained within 608.
teEST clone no. 3376608 was purchased and its insert was obtained and sequenced. The insert is herein designated DNA73737-1658. The entire nucleotide sequence of DNA73737-1658 is shown in Figure 191 (SEQ ID NO: 331). Clone DNA73737-1658 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 264-266 and ending at the apparent stop codon at nucleotide positions 783-785 (Fig 191). The predicted polypeptide precursor is 173 amino acids long (Fig192). The full-length PRO1489 protein shown in Figure 192 has a predicted molecular weight of approximately 18,938 daltons and a pI of approximately 9.99. F
Analysis of the full-length PRO1489 sequence set forth in ig192 (SEQ ID NO: 332) demonstrates the presence of the following: about amino acid 31 to about amino acid 51, about amino acid 7
1 to about amino acid 90 and about amino acid 112 to about amino acid 133 transmembrane domain and about amino acid 161 to about amino acid 164 potential N-glycosylation sites. Clone DNA73737-1658 was added to ATCC on October 27, 1998.
And has been assigned ATCC deposit no. 203412. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 192 (SEQ ID NO: 332) revealed the PRO1489 amino acid sequence and the following Da
yhoff array: AF007189_1, AB000712_1, AF000959_1, MMU82758_1, AF035814_1, A
Significant homology was demonstrated with F072127_1, AF072128_1, HSU89916_1, AF068863_1 and PPU50051_1.

Example 100: Isolation of cDNA Clone Encoding Human PRO1474 Expression Sequence Tag (EST) DNA Database (LIFESEQ®, Incyte Phar
An EST was identified by searching Maceuticals, Palo Alto, CA). This EST
Showed homology with a pancreatic secretory trypsin inhibitor. The clone containing this EST was purchased from Incyte (which was from a cervical tissue library) and sequenced in whole to reveal the nucleic acid of SEQ ID NO: 333 encoding PRO1474. The entire nucleotide sequence of PRO1474 is shown in Figure 193 (SEQ ID NO: 333). Clone DNA73739-1645 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 45-47 and an apparent stop codon at nucleotide positions 300-302 (Fig.
193; SEQ ID NO: 333). The predicted polypeptide precursor is 85 amino acids long. As shown in Figure 194, the Kasal serine protease inhibitor family signature begins at about amino acid 45 of SEQ ID NO: 334. Further, FIG. 194 shows a region conserved in the integrin α chain (starting at about amino acid 32 of SEQ ID NO: 334). Clone DNA73739-1645 has been deposited with the ATCC and is assigned ATCC deposit no. 203270. Fig19
The full-length PRO1474 protein shown in 4 has a molecular weight of approximately 9,232 daltons and a pI of approximately 7.94. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in FIG.
yhoff array: IOVO_FRAER, IOVO_FRAAF, IOVO_FRACO, IOVO_CYRMO, IOVO_STRCA, H
Sequence identities between 61492, C61589, IOVO_POLPL, D61589, and IOVO_TURME were revealed.

Example 101: Isolation of a cDNA clone encoding human PRO1508 By using the signal sequence algorithm described in Example 3 above, Incy
te cluster number 34523, referred to herein as "DNA10047", enabled the identification of an EST cluster sequence from the LIFESEQ database. This EST cluster sequence is then converted into a public EST database (eg GenBank) and a company EST DNA database (LIFESEQ (trade name), Incy
te Pharmaceuticals, Palo Alto, CA) and compared with various expressed sequence tag (EST) databases to identify existing homologies. The homology search is performed by the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-
480 (1996)). A comparison that does not encode a known protein and has a BLAST score of 70 (sometimes 90) or higher is the program "phrap".
(Phil Green, University of Washington, Seattle, Washington) to construct a consensus DNA sequence. The consensus sequence obtained from it,
Here, it is named "DNA55723". In view of the sequence homology between the DNA55723 sequence and the sequence contained in Incyte EST number 2989064, EST clone 2989064 was purchased and the cDNA insert was obtained and sequenced in its entirety. The sequence of this cDNA insert is shown in Figure 195.
, And is herein designated as "DNA73742-1662". The full-length clone shown in Figure 195 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 70-72, and ending at the stop codon at nucleotide positions 514-516 (Figure 195; SEQ ID NO: 335). . Predicted polypeptide precursor (Fig196; SEQ ID NO: 33)
5) is 148 amino acids long. Other features of the PRO1508 protein are a signal sequence of about amino acids 1-30; a tyrosine kinase phosphorylation motif of about amino acids 96-103; and about amino acids 27-32, 28-33, and 140-14.
It contains 5 N-myristoylation sites. PRO1508 has a calculated molecular weight of about 17,183 and an estimated pI of about 8.77. Clone DNA73742-1662
Was deposited with the ATCC on October 6, 1998, ATCC deposit no.
Was granted. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 196 (SEQ ID NO: 336) and the amino acid sequence of PRO1508
Dayhoff sequence: HSAJ3728_1; P_R74962; P_R74941; AF053074_1; F69515; S20706;
Some homology between RPB1_PLAFD; A20587_1; A51861_1; and S75947 was revealed.

Example 102: Isolation of a cDNA clone encoding human PRO1555 By using the signal sequence algorithm described in Example 3 above, LI was designated EST cluster number 521, also referred to herein as "DNA10316".
It has become possible to identify EST cluster sequences from the FESEQ database. This EST cluster sequence is then converted into a public EST database (eg GenB
ank) and company EST DNA database (LIFESEQ (trade name), Incyte Pharmac
existing homology was identified by comparison with various expressed sequence tag (EST) databases, including euticals, Palo Alto, CA). The homology search is performed by the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996).
) Was used. Does not encode a known protein and has a BLAST score of 70 (90
, Or higher) is a program "phrap" (Phil Gree
n, University of Washington, Seattle, Washington) to construct a consensus DNA sequence. The consensus sequence obtained from it is shown here as "DN
A55374 ". In light of the sequence homology between the DNA56374 sequence and the sequence contained in Incyte EST No. 2855769, EST No. 2855769 was purchased and the cDNA insert was obtained and sequenced. The sequence of this cDNA insert is shown in Figure 197 and is herein designated as DNA73744-1665. The full-length clone shown in Figure 197 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 90-92 and ending at the stop codon at nucleotide positions 828-830 (Fig197; SEQ ID NO: 337). . Predicted polypeptide precursor (Fig198; SEQ ID NO: 33)
8) is 246 amino acids long. PRO1555 has a calculated molecular weight of about 26,261 and an estimated pI of about 5.65. Additional features are signal peptides of about amino acids 1-31; transmembrane domains of about amino acids 11-31 and 195-217; potential N-glycosylation sites of about amino acids 111-114; about amino acids 2-5,9.
8-101, and 191-194 potential casein kinase II phosphorylation sites; and about amino acids 146-151 and 192-197 potential N-myristoylation sites. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 198 (SEQ ID NO: 338) and the amino acid sequence of PRO1555 and the following:
Dayhoff array: YKA4_CAEEL, AB014541_1, HVSX99518_2, SSU63019_1, GEN14286,
Some homology between MMU68267_1, XP2_XENLA, ICP4_HSV11, P_W40200, and AE001360_1 was revealed. Clone DNA73744-1665 was deposited with the ATCC on October 6, 1998 and was assigned ATCC deposit no. 203322.

Example 103: Isolation of a cDNA clone encoding human PRO1485. Consensus DNA sequences were assembled using phrap with other EST sequences as described in Example 1 above. This consensus sequence is now referred to as "DNA4
4791 ". 1) P based on the DNA44791 consensus sequence
To identify a cDNA library containing the sequence of interest by CR, and 2)
Oligonucleotides were synthesized for use as probes to isolate clones of the PRO1485 full length coding sequence. PCR primers (two forward and two reverse) were synthesized: Forward PCR primer 1: 5'CCCTCCAAGGATGACAAAGGCGC3 '(SEQ ID NO: 341); Forward PCR primer 2: 5'GGTCAGCAGCTTTCTTGCCCTAAATCAGG3' (SEQ ID NO: 3).
42); Reverse PCR primer 1: 5'ATCTCAGGCGGCATCCTGTCAGCC3 '(SEQ ID NO: 343)
And the reverse PCR primer 2: 5'GTGGATGCCTGCAAGAAGGTTGGG3 '(SEQ ID NO: 344)
. In addition, a synthetic oligonucleotide hybridization probe was made from the consensus DNA44791 sequence with the following nucleotide sequence: Hybridization probe: 5'AGCTTTCTTGCCCTAAATCAGGCCAGCCTCATCAGTCGCTGTGAC3 '(SEQ ID NO: 345) To screen several libraries for a source of full length clones, DNA from the libraries was PCR amplified with the PCR primer pair identified above. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate a clone encoding the PRO1485 gene with one of the primer pairs. RNA for making a cDNA library was isolated from human testis. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence of PRO1485 (herein designated as DNA73746-1654 [Fig 199, SEQ ID NO: 339]); and the derived protein sequence of PRO1485. The entire coding sequence of PRO1485 is shown in Figure 199 (SEQ ID NO: 339). Clone DNA73746-1654 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 151-153 of SEQ ID NO: 339, and ending at the apparent stop codon at nucleotide positions 595-597. The predicted polypeptide precursor is 148 amino acids long. The signal peptide is located at about amino acids 1-18 of SEQ ID NO: 340. The lysozyme C signature, CAAX box, and N-glycosylation site are shown in Figure 200. Clone DNA73746-1654 has been deposited with the ATCC and is assigned ATCC deposit no. 203411. The full-length PRO1485 protein shown in Figure 200 has a predicted molecular weight of approximately 16,896 daltons and a pI of approximately 6.05. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 200 (SEQ ID NO: 340) and the amino acid sequence of PRO1485 and the following:
Dayhoff array: LYC_PHACO, P_R76684, 2HFL_Y, JC2144, JC5544, JC5555, JC5369
, LYC2_PIG, P_R12113, and JC5380 were found to have sequence identity.

Example 104: Isolation of a cDNA clone encoding human PRO1564 Consensus DNA sequences were assembled to other EST sequences using phrap as described in Example 1 above. This consensus sequence is now DNA67
213. 1) PCR based on the DNA67213 consensus sequence
To identify a cDNA library containing the sequence of interest, and 2) PR
Oligonucleotides were synthesized for use as probes to isolate clones of the O1564 full length coding sequence. PCR primers (forward and reverse) were synthesized: Forward PCR primer (67213.f1) 5'-GGAGAGGTGGTGGCCATGGACAG-3 '(SEQ ID NO: 348) Reverse PCR primer (67213.r1) 5'-CTGTCACTGCAAGGAGCCAACACC-3 '(SEQ ID NO: 349). In addition, a synthetic oligonucleotide hybridization probe was made from the consensus DNA67213 sequence with the following nucleotide sequence: Hybridization probe: 5'-TATGTCGCTGCGAGGTGGTGAAAACCTCGAACTGTCTTTCAAGGC-3 '(SEQ ID NO: 350) To screen several libraries for a source of full-length clones, DNA from the libraries was PCR amplified with the PCR primer pair identified above. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate a clone encoding the PRO1564 gene with one of the primer pairs. RNA for making a cDNA library was isolated from human testis. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO1564 (herein designated as DNA73760-1672 [Fig201, SEQ ID NO: 346]); and the derived protein sequence for PRO1564. The entire nucleotide sequence of DNA73760-1672 is shown in Fig201 (SEQ ID NO: 346). Clone DNA73760-1672 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 462-464 and ending at the apparent stop codon at nucleotide positions 2379-2381 (Fig201). The predicted polypeptide precursor is 639 amino acids long (Fig202). The full-length PRO1564 protein shown in Figure 202 has a predicted molecular weight of approximately 73,063 daltons and a pI of approximately 6.84. F
Analysis of full length PRO1564 set forth in ig202 (SEQ ID NO: 347) demonstrates the presence of the following: a signal peptide of about amino acids 1 to about amino acids 28, a transmembrane domain of about amino acids 11 to about amino acids 36, about amino acids. 107 to about amino acid 110 and about amino acid 574 to about amino acid 577 potential N-
A glycosylation site, a tyrosine kinase phosphorylation site of about amino acids 50 to about amino acids 57, about amino acids 158 to about amino acids 163, about amino acids 236 to about amino acids 241, about amino acids 262 to about amino acids 267, about amino acids 270 to about amino acids 275, About amino acid 380 to about amino acid 385 and about amino acid 51
3 to about amino acid 518 N-myristoylation site, about amino acid 110 to about amino acid 113 amidation site, and about amino acid 15 to about amino acid 25 prokaryotic membrane lipoprotein lipid attachment site. Clone DNA73760-1672 was deposited with the ATCC on October 6, 1998 and was assigned ATCC deposit no. 203314. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 202 (SEQ ID NO: 347) and the amino acid sequence of PRO1564
Dayhoff array: MMU73819_1, HSY08564_1, P_W34470, P_R66402, PAGT_HUMAN, CEG
Significant homology was demonstrated with LY5B_1, CEGLY6A_1, CEGLY6B_1, AP000006_308 and E69322.

Example 105: Isolation of a cDNA clone encoding human PRO1755 By using the signal sequence algorithm described in Example 3 above, an EST from the LIFESEQ database designated EST cluster number 141872. It became possible to identify the cluster sequence. This EST cluster sequence was then compared to various ESTs from the databases listed above to identify existing homologies. The homology search is performed by the computer program BLAST or BLAST2 (Altschul
Et al., Methods in Enzymology 266: 460-480 (1996)). Comparables that do not encode a known protein and have a BLAST score of 70 (sometimes 90) or higher are those of the program "phrap" (Phil Green, University of Washingto
n, Seattle, Washington) to construct a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated "DNA55731". Given the sequence homology between the DNA55731 sequence and the sequence contained in Incyte EST number 257323, EST clones were purchased, cDNA inserts were obtained and sequenced. Incyte clone 257323 is a hNT2 cell line derived from a human teratocarcinoma that exhibits characteristics characteristic of neuronal precursors involved in early development (
It was taken from a library created using RNA isolated from Stratagene library number STR9372310). The sequence of this cDNA insert is
No. 03, which is designated herein as "DNA76396-1698". Or D
NA76396-1698 can be obtained by preparing oligonucleotide probes and primers and isolating the sequence from an appropriate library (eg STR9372310). The full-length clone shown in Figure 203 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 58-60 and ending at the stop codon at nucleotide positions 886-888 (Fig203; SEQ ID NO: 351). . Predicted polypeptide precursor (Fig204, SEQ ID NO: 35)
2) is 276 amino acids long. PRO1755 has a calculated molecular weight of about 29,426 and an estimated pI of about 9.40. Additional features include a signal peptide sequence of about amino acids 1-31; a transmembrane domain of about amino acids 178-198;
10-213 cAMP and cGMP-dependent protein kinase phosphorylation sites;
Potential N of about amino acids 117-122, 154-149, and 214-219
-Myristoylation site; and a cell attachment sequence of about amino acids 149-151. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 204 (SEQ ID NO: 352) and the amino acid sequence of PRO1755
Dayhoff array: APG-BRANA, P_R37743, NAU88587_1, YHL1_EBV, P_W31855, CET10B
Some homology with 10_4, AF039404_1, PRP1_HUMAN, AF038575_1, and AF053091_1 was revealed. Clone DNA76396-1698 was deposited with the ATCC on November 17, 1998 and was assigned ATCC deposit no. 203471.

Example 106: Isolation of a cDNA clone encoding human PRO1757 By using the signal sequence algorithm described in Example 3 above, IncyteE
It has made possible the identification of three EST sequences from the Incyte database, designated ST clone numbers 200794, 2014962 and 1912034. These EST cluster sequences were then transferred to the program "phrap" (Phil Green, Univers
City of Washington, Seattle, Washington) to construct a consensus DNA sequence. The consensus sequence obtained therefrom is herein referred to as DNA56054
To name. Considering the sequence homology between the DNA56054 sequence and the sequence contained in Incyte EST No. 2007947, Incyte EST Clone No. 2007747 was purchased,
The cDNA insert was obtained and sequenced. The sequence of this cDNA insert is
And designated herein as DNA76398-1699. Clone DNA76398-1699 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 59-61 and ending at the stop codon at nucleotide positions 422-424 (Fig205). The predicted polypeptide precursor is 121 amino acids long (Figure 206). Fig
The full-length PRO1757 protein shown at 206 has a predicted molecular weight of approximately 12,073 and a pi of approximately 4.11. Analysis of full length PRO1757 shown in Figure 206 (SEQ ID NO: 354) demonstrates the presence of the following: a signal peptide from about amino acid 1 to about amino acid 19, a transmembrane domain from about amino acid 91 to about amino acid 110, about amino acid. A glycosaminoglycan attachment site from 44 to about amino acid 47, a cAMP and cGMP-dependent protein kinase phosphorylation site from about amino acid 116 to about amino acid 119, and a potential N-myristoylation site from about amino acid 91 to about amino acid 96. Clone DNA76398-1699 was deposited with the ATCC on November 17, 1998 and was assigned ATCC deposit no. 203474. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 206 (SEQ ID NO: 354) and the amino acid sequence of PRO1757
Dayhoff array: JQ0964, COLL_HSVS7, HSU70136_1, AF003473_1, D89728_1, MTF1_
Significant homology was demonstrated between MOUSE, AF029777_1, HSU88153_1 and P_W05321.

Example 107: Isolation of a cDNA clone encoding human PRO1758 By using the signal sequence algorithm described in Example 3 above, IncyteE
It has made possible the identification of EST cluster sequences from the LIFESEQ database, designated ST Clone No. 20926. This EST cluster sequence was then compared to various sequence tags (ESTs) from the databases listed above to identify existing homologies. The homology search is performed by the computer program BLAST or BLA.
ST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)) was used. Does not encode a known protein and has a BLAST score of 70 (sometimes 90)
Comparables with or more are the program "phrap" (Phil Green, University
of Washington, Seattle, Washington) to construct a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated DNA56260. DNA56260 sequence and LIFE SEQ (trade name) database EST number 2936
In light of the sequence homology with the sequence contained in 330, we purchased an EST clone, which was derived from a library prepared from fetal thymus tissue that died of anencephaly,
The NA insert was obtained and sequenced. The sequence of this cDNA insert is
And designated herein as DNA76399-1700. The full-length clone shown in Figure 207 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 78-80 and ending at the stop codon at nucleotide positions 549-551 (Fig207; SEQ ID NO: 355). . Predicted polypeptide precursor (Fig208; SEQ ID NO: 356)
) Is 157 amino acids long. PRO1758 has a calculated molecular weight of about 17,681 and an estimated pI of about 7.65. Additional features are signal peptides of about amino acids 1-15; potential N-glycosylation sites of about amino acids 24-27; cAMP and cGMP dependent protein kinase phosphorylation sites of about amino acids 27-30;
Casein kinase II phosphorylation site at about amino acids 60-63; about amino acids 17-
Potential N-myristoylation sites at 22, 50-55, 129-134, and 133-138; a cell attachment sequence at about amino acids 153-155; and about amino acids 18
-23 cytochrome c family heme binding site signatures. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full-length sequence shown in Figure 208 (SEQ ID NO: 356) and the amino acid sequence of PRO1758 and Dayhof.
f Significant homology with SEQ ID NO: AC005328_2 was revealed. Homology is also P
It was also found between the RO1758 amino acid sequence and Dayhoff SEQ ID NO: CELC46F2_1. Clone DNA76399-1700 was deposited with the ATCC on November 17, 1998 and was assigned ATCC deposit no. 203472.

Example 108: Isolation of a cDNA clone encoding human PRO1575 A consensus DNA sequence was constructed against other EST sequences using phrap as described in Example 1 above. This consensus sequence is now "DNA
35699 ". 1) based on the DNA35699 consensus sequence
To identify a cDNA library containing the sequence of interest by PCR, and 2
3.) Oligonucleotides were synthesized for use as probes to isolate clones of the full-length coding sequence of PRO1575. PCR primers (forward and reverse) were synthesized: Forward PCR primer: CCAGCAGTGCCCATACTCCATAGC (35699.f1; SEQ ID NO: 35)
9); TGACGAGTGGGATACACTGC (35699.f2; SEQ ID NO: 360) Reverse PCR primer: GCTCTACGGAAACTTCTGCTGTGG (35699.r1; SEQ ID NO: 36)
1) Further, a synthetic oligonucleotide hybridization probe was prepared from the consensus DNA35699 sequence having the following nucleotide sequence. Hybridization probe: ATTCCCAGGCGTGTCATTTGGGATCAGCACTGATTCTGAGGTTCTG
ACAC (35699.p1; SEQ ID NO: 362) To screen several libraries for a source of full length clones, DNA from the libraries was PCR amplified with the PCR primer pair identified above. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate a clone encoding the PRO1575 gene with one of the primer pairs. RNA for making a cDNA library was isolated from human pancreatic tissue. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO1575 (designated herein as DNA76401-1683 [Fig209, SEQ ID NO: 357]); and the derived protein sequence for PRO1575. The entire coding sequence of PRO1575 is shown in Figure 209 (SEQ ID NO: 357). Clone DNA76401-16833 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 22-24 and an apparent stop codon at nucleotide positions 841-843. The predicted polypeptide precursor is 273 amino acids long. Full length PRO1 shown in Fig210
The 575 protein has an estimated molecular weight of approximately 30,480 daltons and a pI of approximately 4.60.
Have. Additional features are a signal peptide of about amino acids 1-20; a transmembrane domain of about amino acids 143-162; a potential N-glycosylation site of about amino acids 100-103; and about amino acids 84-89, 103-108, 154-159
, And 201-206 potential N-myristoylation sites. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 210 (SEQ ID NO: 358) and the amino acid sequence of PRO1575 and Dayhof.
f Significant homology with SEQ ID NO: A12005_1 was revealed. Homology is also PR
O1575 amino acid sequence and the following additional Dayhoff sequence: P_P80615; P_R25297; P_R51
696; A47300; PDI_DROME; P_R49829; P_R63807; DMALPADAP_1; and DRZNF6_1. Clone DNA76401-1683 was deposited with the ATCC on October 20, 1998 and was assigned ATCC deposit no.

Example 109: Isolation of a cDNA clone encoding human PRO1787 [0556] As described in Example 1 above, consensus DNA sequences were assembled to other ESTs using phrap to form an assembly. This consensus sequence is designated herein as "DNA45123". Incyte E identified in the assembly
Based on the homology of DNA45123 with ST3618549, as well as other findings and information provided herein, a clone containing this EST was purchased and sequenced.
The DNA sequence of the clone was used to determine the full-length DNA sequence of PRO1787 and PRO1787.
87 derived protein sequences were obtained. The entire coding sequence of PRO1787 is contained in Figure 211 (SEQ ID NO: 363). Clone DNA76510-2504 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 163-165 of SEQ ID NO: 363 and an apparent stop codon at nucleotide positions 970-972. The approximate positions of the signal peptide, transmembrane region, N-glycosylation site, N-myristoylation site and kinase phosphorylation site are shown in Figure 212. The predicted polypeptide precursor is 269 amino acids long. Clone DNA7
6510-2504 has been deposited with the ATCC and is assigned ATCC deposit no. 203477. The full-length PRO1787 protein shown in Fig212 is about 29,08.
It has an estimated molecular weight of 2 Daltons and a pI of approximately 9.02. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 212 (SEQ ID NO: 364) revealed the amino acid sequence of PRO1787 and the following Da.
yhoff array: MYP_RAT, MYPO_HUMAN, MYPO_BOVIN, GEN12838, HSSCN2B2_1, AF0077
83_1, HSU90716_1, P_W42015. Sequence identity between XLU43330_1 and AF060231_1 was revealed. Example 110: Isolation of cDNA clones encoding human PRO1781 Human SK-Lu-1 adenocarcinoma cell line cDNA showing the first DNA sequences referred to herein as DNA58070 and DNA56340, predominantly at the 5'end of the primary cDNA clones. Identified in the library using yeast screening. Computer program "phrap" (Phil Green, University of Washington, Sea
These sequences were assembled using ttle, Washington) to construct a consensus DNA sequence. The consensus sequence is designated herein as "DNA59575". Based on the DNA59575 consensus sequence, the following oligonucleotide was synthesized and used as a probe to isolate a clone of the full length coding sequence for PRO1781: TGGAAAAGAAGTCTGGTCAGAAGGTTTAGG (SEQ ID NO: 367), CATTTGGCTTC.
ATTCTCCTGCTCTG (SEQ ID NO: 368), AAAACCTCAGAACAACTCATTTTGCACC (SEQ ID NO: 3)
69) and GTCTCACCATGGTTGCTCTTGCCAAATTGTGGGAAGCAGGG (SEQ ID NO: 370). The full-length DNA76522-2500 clone shown in Figure 213 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 21-23 and ending at the stop codon at nucleotide positions 1141-1143 (Fig213; SEQ ID NO: : 365). Predicted polypeptide precursor (
Figure 214, SEQ ID NO: 366 is 373 amino acids long. PRO1781 has a calculated molecular weight of approximately 41,221 Daltons and an estimated pI of approximately 8.54. A further feature is a possible signal peptide of about amino acids 1-19; about amino acids 39-6.
0 transmembrane domain; about amino acid 228-236 tyrosine phosphorylation site; about amino acids 16-21, 17-22, 43-48, 45-50, 47-52, 49-
54, 53-58, 58-63, 59-64, 62-67, 126-131, and 142-147 potential N-myristoylation sites; amidation sites of about amino acids 22-25 and 280-283; And a eukaryotic membrane lipoprotein lipid attachment site of about amino acids 12-22. Dayhoff database (version 35.45) using WU-BLAST-2 sequence alignment analysis of the full length sequence shown in Figure 214 (SEQ ID NO: 366).
SwissProt 35) analysis of the PRO1781 amino acid sequence and the following Dayhoff sequences: CEY4510D_5, AP000001_146, P_R10676, DAC_STRSQ, CEC40H5_5, P_R35204, KP.
Some homology between U58495_1, KPN16781_1, AF010403_1, and AF056116_14 was revealed. Clone DNA76522-2500 was deposited with the ATCC on November 17, 1998 and was assigned ATCC deposit no. 203469.

Example 111: Isolation of a cDNA clone encoding human PRO1556 By using the signal sequence algorithm described in Example 3 above, LIFESEQ (
An EST cluster sequence, designated as EST cluster number 103158, also referred to herein as "DNA10398," was identified from the Tradename database. This EST cluster sequence is then translated into public databases (eg GenBank) and corporate EST DNA databases (LIFESEQ (trade name), Incyte Pharmaceuticals, P
alo Alto, CA) compared to various expressed sequence tag (EST) databases,
The existing homologies were identified. The homologue search is performed by the computer program BLAST or B
It was carried out using LAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparables that do not encode a known protein and have a BLAST score of 70 (sometimes 90) or higher can be found in the program "phrap" (Phil Green, Universit
y of Washington, Seattle, Washington) to construct a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated DNA56417. In view of the sequence homology between the DNA56417 sequence and the sequence contained in Incyte's EST No. 959332, EST No. 959332 was purchased and the cDNA insert was obtained and sequenced. The sequence of this cDNA insert is shown in Figure 215 and is herein designated as DNA76529-1666. The full-length clone shown in Figure 215 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 85-87 and ending at the stop codon at nucleotide positions 892-894 (Fig215; SEQ ID NO: 371). . Predicted polypeptide precursor (Fig216, SEQ ID NO: 372)
) Is 269 amino acids long. PRO1556 has a calculated molecular weight of about 28,004 Daltons and an estimated pI of about 5.80. A further feature is about amino acids 1-24.
Signal peptide of; amino acid 11-25 and transmembrane domains of amino acids 226-243; potential N-glycosylation site of amino acids 182-185, amino acid 7;
0-73 potential cAMP- and cGMP-dependent protein kinase phosphorylation sites; and about amino acids 29-34, 35-39, 117-122, 121-12.
6, 125-130, 154-159, 166-171, 241-246, 24
6-251, 247-252, 249-254, 250-255, 251-25
6, 252-257, 253-258, 254-259, 255-260, 25
6-261, 257-262, and 259-264 potential N-myristoylation sites. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 216 (SEQ ID NO: 372) and the amino acid sequence of PRO1556
Dayhoff array: T8F5_4, R23B_MOUSE, CANS_HUMAN, P_W41640, DSU51091_1, TP2B_
Some homology between CHICK, DVU20660_1, S43296, P_R23962, and BRN1_HUMAN was revealed. Clone DNA76529-1666 was deposited with the ATCC on October 6, 1998 and was assigned ATCC deposit no. 203315.

Example 112: Isolation of a cDNA clone encoding human PRO1759 By using the signal sequence algorithm described in Example 3 above, the EST cluster sequence designated DNA10571 was identified from the Incyte database. This EST cluster sequence is then transferred to a public database (eg GenBank)
And company EST DNA database (LIFESEQ (trade name), Incyte Pharmaceutic
existing homology was identified by comparison with various expressed sequence tag (EST) databases, including als, Palo Alto, CA). The homologue search is the computer program BLAS
It was performed using T or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparables that do not encode a known protein and have a BLAST score of 70 (sometimes 90) or higher can be found in the program "phrap" (Phil Green, Uni
versity of Washington, Seattle, Washington)
The A sequence was constructed. The consensus sequence obtained therefrom is here the DNA573
Name it 13. In view of the sequence homology between the DNA57313 sequence and the sequence contained in Incyte's EST clone 2434255, a clone containing this EST was purchased and c
The DNA insert was obtained and sequenced. The sequence of this cDNA insert is shown in Figure 217 and is herein designated as DNA76531-1701. The full-length clone shown in Figure 217 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 125-127, and ending at the stop codon at nucleotide positions 1475-1477 (Fig217;
SEQ ID NO: 373). Approximate positions of the signal peptide and transmembrane domain are Fi
The N-myristoylation site, lipid attachment site, amidation site and kinase phosphorylation site are shown in Figure 218 while shown in g218. The predicted polypeptide precursor (Fig218, SEQ ID NO: 374) is 450 amino acids long. PR
O1759 has a calculated molecular weight of about 49,765 daltons and an estimated pI of about 8.14. Clone DNA76531-1701 is AT on November 17, 1998
It has been deposited with the CC and has been assigned ATCC deposit no. 203465. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full-length sequence shown in Figure 218 (SEQ ID NO: 374) and the amino acid sequence of PRO1759
Dayhoff array: OPDE_PSEAE, TH11_TRYBB, S67684, RGT2_YEAST, S68362, ATSUGTR
Sequence identity between PR_1, P_W17836 (patent application WO9715668-A2), F69587, A48076, and A45611 was revealed.

Example 113: Isolation of a cDNA clone encoding human PRO1760 The EST cluster sequence was identified from the Incyte database using the signal sequence algorithm described in Example 3 above. This EST cluster sequence is then compared to various expressed sequence tag (EST) databases, including public databases (eg GenBank) and corporate EST DNA databases (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA). , Identified the existing homology. The homology search is performed by the computer program BLAST or BLAST2 (Altschul et al.
hods in Enzymology 266: 460-480 (1996)). A comparison that does not encode a known protein and has a BLAST score of 70 (sometimes 90) or higher is the program "phrap" (Phil Green, University of Washington, Seatt.
le, Washington) to construct a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated DNA58798. Given the sequence homology between the DNA58798 sequence and the sequence contained in Incyte's EST clone 3358745, a clone containing this EST was purchased and c
The DNA insert was obtained and sequenced. The sequence of this cDNA insert is shown in Figure 219 and is herein designated as DNA76532-1702. The full length clone shown in Figure 219 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 60-62 and ending at the stop codon at nucleotide positions 624-626 (Fig219; SEQ ID NO: 375). . Predicted polypeptide precursor (Fig220, SEQ ID NO: 376)
) Is 188 amino acids long. The motif is further shown in Fig220. PRO
1760 has a calculated molecular weight of approximately 21,042 daltons and an estimated pI of approximately 5.36. Clone DNA76532-1702 was cloned into ATC on November 17, 1998.
Deposited at C and assigned ATCC Deposit No. 203473. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 220 (SEQ ID NO: 376) and the amino acid sequence of PRO1760
Dayhoff array: CELT07F12_2, T22J18_16, ATF1C12_3, APE3_YEAST, P_W22471, SA
Sequence identity was revealed between U56908_1, SCPA_STRPY, ATAC00423817, SAPURCLUS_2 and AF041468_9.

Example 114: Isolation of a cDNA clone encoding human PRO1561 Consensus DNA sequences were assembled for other ESTs using phrap as described in Example 1 above. This consensus sequence is now DNA40630
To name. Based on the DNA40630 consensus sequence, 1) to identify a cDNA library containing the sequence of interest by PCR, and 2) PRO15
For use as a probe to isolate a clone of 61 full length coding sequences,
Oligonucleotides were synthesized. PCR primers (forward and reverse) were synthesized: Forward PCR primer (40630.f1) 5'-CTGCCTCCACTGCTCTGTGCTGGG-3 '(SEQ ID NO: 379) and reverse PCR primer (40630.r1) 5'-CAGAGCAGTGGATGTTCCCCTGGG-. 3 '(SEQ ID NO: 380). In addition, a synthetic oligonucleotide hybridization probe was made from the DNA40630 sequence having the following nucleotide sequence: Hybridization probe (40630.p1): 5'-CTGAACAAGATGGTCAAGCAAGTGACTGGGAAAATGCCCATCCTC-3 '(SEQ ID NO: 381). To screen several libraries against a source of full-length clones, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. The positive library was then used to isolate clones encoding the PRO1561 gene using one of the probe oligonucleotides and PCR primers. RNA for the construction of a cDNA library was isolated from human breast tumor tissue. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO1561 (herein designated as DNA76538-1670 [Fig221, SEQ ID NO: 377]); and the derived protein sequence for PRO1561. The entire nucleotide sequence of DNA76538-1670 is shown in Figure 221 (SEQ ID NO: 377). Clone DNA76538-1670 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 29-31 and ending at the stop codon at nucleotide positions 377-379 (
Figure 221). The predicted polypeptide precursor is 116 amino acids long (F
ig222). The full-length PRO1561 protein shown in FIG. 222 is about 12,
It has an estimated molecular weight of 910 daltons and a pI of approximately 6.41. Analysis of full length PRO1561 shown in Figure 222 (SEQ ID NO: 378) demonstrates the presence of the following: a signal peptide from about amino acid 1 to about amino acid 17, a transmembrane domain from about amino acid 1 to about amino acid 24, about amino acid. Potential N-glycosylation site from 86 to about amino acid 89, potential N-myristoylation site from about amino acid 20 to about amino acid 25 and about amino acid 45 to about amino acid 50 and phospholipase A2 from about amino acid 63 to about amino acid 70. Histidine active site. Clone D
NA76538-1670 was deposited with the ATCC on October 6, 1998
CC deposit number 203313 is attached. Analysis of the Dayhoff database (version 35.45 SwissProt35) using the WU-BLAST2 sequence alignment analysis method for the full-length sequence shown in FIG. 222 (SEQ ID NO: 378) revealed that the PRO1561 amino acid sequence and the following Dayhoff sequence: P_R63053, P_R25416, P_R63055, P_P93363, P_R63046, PA
Significant homology was demonstrated between 2A_VIPAA, P_W58476, GEN13747, PA2X_HUMAN and PA2A_CR0DU. In addition to the above, sequence homology searches were performed to identify the DNA40630 consensus sequence.
Significant homology was demonstrated between Incyte EST clone number 1921092. Then, Incyte EST clone No. 1921092 was purchased, the insert fragment was obtained and sequenced, and thereby the DNA76538-1670 sequence shown in Fig. 221 was obtained (SEQ ID NO: 377).

Example 115: Isolation of a cDNA clone encoding human PRO1567 cD isolated in the amylase screen described in Example 2 above.
The NA sequence is designated herein as DNA47580. The DNA47580 sequence is then present in comparison with various expressed sequence tag (EST) databases, including public databases (eg GenBank) and corporate EST DNA databases (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, CA). Was identified. Homology searches are performed using the computer program BLAST or BLAST2 (Altschul et al., Methods i.
n Enzymology 266: 460-480 (1996)). A comparison that does not encode a known protein and has a BLAST score of 70 (sometimes 90) or higher is the program "phrap" (Phil Green, University of Washington, Seattle, Wa.
shington) to construct a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated "DNA57246". EST number 17 from DNA57246 sequence and LIFESEQ database
Based on the sequence homology between 93996, a clone containing EST number 1793996 from a library prepared from prostate tumor tissue was purchased and its cDNA
The insert was obtained and sequenced. The sequence of this cDNA insert is here Fig2
23 (SEQ ID NO: 382) and is herein designated as DNA76541-1675. A full length clone was identified that contained a single open reading frame with an apparent translational initiation site at nucleotide positions 109-111 and a stop signal at nucleotide positions 643-645 (Fig223; SEQ ID NO: 382). The predicted polypeptide precursor is 178 amino acids long, has a calculated molecular weight of approximately 19,600 daltons and an estimated pI of approximately 5.89. Further features are a signal peptide of about amino acids 1-22; a potential N-glycosylation site of about amino acids 167-170; a protein kinase C phosphorylation site of about amino acids 107-109; and about amino acids 46-.
Contains 51, 72-77, and 120-125 potential N-myristoylation sites. Analysis of the Dayhoff database (version 35.45 SwissProt35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in FIG.
Significant sequence homology with the human colon-specific gene CSG6 polypeptide, designated the yhoff sequence "P_W06549", was demonstrated. PRO1567 amino acid sequence and the following Dayhoff sequence: HUAC002301_1, P_246880, A49685, SPBP_RAT, S42924
, Homology was also found among SPBP_MOUSE, I52115, MMU03711_1, and AF041468_31. Clone DNA76541-1675 has been deposited with the ATCC on October 27, 1998 and is assigned ATCC deposit no. 203409.

Example 116: Isolation of a cDNA clone encoding human PRO1693 Consensus DNA sequences were assembled to other ESTs using phrap as described in Example 1 above. This consensus sequence is now DNA38251
To name. Based on the DNA38251 consensus sequence, 1) to identify a cDNA library containing the sequence of interest by PCR, and 2) PRO16
For use as a probe to isolate a clone of 93 full length coding sequences,
Oligonucleotides were synthesized. PCR primers (forward and reverse) were synthesized: Forward PCR primer (38251.f1) 5'-CTGGGATCTGAACAGTTTCGGGGC-3 '(SEQ ID NO: 386) and reverse PCR primer (38251.r1) 5'-GGTCCCCAGGACATGGTCTGTCCC-. 3 '(SEQ ID NO: 387). In addition, a synthetic oligonucleotide hybridization probe was made from the DNA38251 sequence having the following nucleotide sequence: Hybridization probe (38251.p1): 5'-GCTGAGTTTACATTTACGGTCTAACTCCCTGAGAACCATCCCTGTGCG-3 '(SEQ ID NO: 388). To screen several libraries against a source of full-length clones, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. The positive library was then used to isolate clones encoding the PRO1693 gene using one of the probe oligonucleotides and PCR primers. RNA for the construction of a cDNA library was isolated from human fetal kidney tissue. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO1693 (herein designated as DNA77301-1708 [Fig225, SEQ ID NO: 384]); and the derived protein sequence for PRO1693. The entire nucleotide sequence of DNA77301-1708 is shown in Figure 225 (SEQ ID NO: 384). Clone DNA77301-1708 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 508-510 and ending at the stop codon at nucleotide positions 2047-2049 (Fig225). The predicted polypeptide precursor is 513 amino acids long (Figure 226). The full-length PRO1693 protein shown in Figure 226 has a predicted molecular weight of approximately 58,266 daltons and a pI of approximately 9.84. Fig2
Analysis of full-length PRO1693 shown in SEQ ID NO: 26 (SEQ ID NO: 385) demonstrates the presence of the following: a signal peptide from about amino acid 1 to about amino acid 33, a transmembrane domain from about amino acid 420 to about amino acid 442, about amino acid. 126 to about amino acid 129, about amino acid 357 to about amino acid 360, about amino acid 496
From about amino acid 499 to about amino acid 504 to about amino acid 507 from potential N
-Glycosylation site, cAMP- and c from about amino acid 465 to about amino acid 468
GMP-dependent protein kinase phosphorylation site and about amino acids 11 to about amino acids 16, about amino acids 33 to about amino acids 38, about amino acids 245 to about amino acids 250, about amino acids 332 to about amino acids 337, about amino acids 497 to about amino acids 502 and Potential N-myristoylation site from about amino acid 507 to about amino acid 512. Clone DNA77301-1708 was deposited with the ATCC on October 27, 1998 and is assigned ATCC deposit no. 203407. Analysis of the Dayhoff database (version 35.45SwissProt35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in FIG. HSCHONO3_1, P_R85889, AF06200
Significant homology was demonstrated between 6_1, AB014462_1, A58532, MUSLRRPA_1, AB007865_1 and AF030435_1.

Example 117: Isolation of a cDNA clone encoding human PRO1784 cD isolated in the amylase screen described in Example 2 above.
The NA sequence is designated herein as DNA43862. Based on the DNA43862 sequence, an oligonucleotide probe was produced and used to screen the human fetal kidney library described in the first paragraph of Example 2 above. The cloning vector is pRK5B (pRK5B is a pRK5D containing no SfiI site).
, Holmes et al., Science 253: 1278-1280 (1991)),
The size of the cleaved cDNA was less than 2800 bp. PCR primers (forward and reverse) were synthesized: Forward PCR primer (f1) 5'-CTTTTCAGTGTCACCTCAGCGATCTC-3 '(SEQ ID NO:
391) and the reverse PCR primer (r1) 5'-CCAAAACATGGAGCAGGAACAGG-3 '(SEQ ID NO: 392)
). In addition, a synthetic oligonucleotide hybridization probe was prepared from the DNA43862 sequence having the following nucleotide sequence: Hybridization probe (p1): 5'-CCAGTTGGTGCTCTCGGACCTACCATGCGAAGAAGATGAAATGTGTG-3 '(SEQ ID NO: 393). To screen several libraries against a source of full-length clones, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. The positive library was then used to isolate clones encoding the PRO1784 gene using one of the probe oligonucleotides and PCR primers. A full length clone was identified containing a single open reading frame with an apparent translational initiation site at nucleotide positions 68-70 and a stop signal at nucleotide positions 506-508 (Fig227; SEQ ID NO: 389). The predicted polypeptide precursor is 146 amino acids long, has a calculated molecular weight of approximately 16,116 daltons and approximately 4.
It has an estimated pI of 99. The approximate positions of the signal peptide, transmembrane domain and N-myristoylation site are shown in Figure 228. Clone DNA77303-2
502 has been deposited with the ATCC and is numbered ATCC Deposit No. 203479. Analysis of the Dayhoff database (version 35.45SwissProt35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in FIG. P_W31947, S18038, AE001300
_8, AF039833_1, P_W39833_1, P_W39788, HSU872231, NTU06712_1, and P_W3194
Sequence identity between 6 was proved.

Example 118: Isolation of cDNA Clone Encoding Human PRO1605 A cDNA clone encoding the native human PRO1605 polypeptide (DNA
77648-1688) was identified using a yeast screen in a human fetal kidney cDNA library predominantly at the 5'end of the primary cDNA clone. The full-length DNA77648-1688 clone shown in Figure 229 contains a single open reading frame, has an apparent translational initiation site at nucleotide positions 425-427, and terminates at the stop codon at nucleotide positions 845-847 (Fig229). The predicted polypeptide precursor is 140 amino acids long (Fig230). The PRO1605 protein shown in Fig230 is about 1
It has an estimated molecular weight of 5,668 daltons and a pI of approximately 10.14. Fig23
Analysis of the full-length PRO1605 sequence shown at 0 (SEQ ID NO: 395) demonstrated the presence of the following: a signal peptide from about amino acid 1 to about amino acid 26. Clone DNA77648-1688 has been deposited with the ATCC on October 27, 1998 and is assigned ATCC deposit no. 203408. Dayhoff database (version 35.45) using WU-BLAST-2 sequence alignment analysis of the full length sequence shown in Figure 230 (SEQ ID NO: 395).
SwissProt 35), the PRO1605 amino acid sequence and the following Dayhoff sequences: GNT5_HUMAN, P_R48975, P_W22519, MM26SPR0T_1, HSU86782_1, CH60_LEPIN,
Significant homology was demonstrated between HMCT_HELPY, F65126, HIU08875_1 and P_R41724.

Example 119: Isolation of a cDNA clone encoding human PRO17880 Extracellular domain (ECD) sequences (including sequences that cause secretory death) from approximately 950 known secreted proteins from the Swiss-Prot public database. Was used to search the EST database. EST databases are public databases (eg GenB
ank) and company EST DNA database (LIFESEQ (trade name), Incyte Pharmac
euticals, Palo Alto, CA). Search the computer program BLA
ST or BLAST2 [Altschul et al., Methods in Enzymology 266: 460-480 (1996)] was used as a comparison of the ECD protein sequence with a 6-frame translation of the EST sequence. Incyte clone number 2968304 was identified as a sequence of interest that encodes no known protein and has a BLAST score of 70 or higher. The nucleotide sequence of Incyte clone no. 2968304 is herein designated "DNA6612". In addition, the DNA6612 sequence was replaced with BLAST and phrap (Phil Green, University of
Washington, Seattle, Washington) and the sequence was extended as much as possible using the source of the EST sequences discussed above. The extended consensus sequence is designated herein as "DNA49648". DNA49648
Based on the consensus sequence, 1) cDNA containing the sequence of interest by PCR
Oligonucleotides were synthesized for identifying libraries and 2) for use as probes to isolate clones of the full-length coding sequence of PRO1788. PCR primers (forward and reverse) were synthesized :: Forward PCR primer CCCTGCCAGCCGAGAGCTTCACC (49648.f1; SEQ ID NO: 398)
) Reverse PCR primer GGTTGGTGCCCGAAAGGTCCAGC (49648.r1; SEQ ID NO: 399)
) Furthermore, a synthetic oligonucleotide hybridization probe was made from the consensus DNA49648 sequence having the following nucleotide sequence: Hybridization probe: CAACCCCAAGCTTAACTGGGCAGGAGCTGA GGTGTTTTCAGGCC
(49648.p1 SEQ ID NO: 400) To screen several libraries for a source of full-length clones, DNA from the libraries was PCR amplified with the PCR primer pair identified above. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate a clone encoding the PRO1788 gene with one of the primer pairs. RNA for making a cDNA library was isolated from human fetal kidney tissue. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO1788 (herein designated as DNA77652-2505 [Fig231, SEQ ID NO: 396]); and the derived protein sequence for PRO1788. The entire coding sequence of PRO1788 is shown in Figure 231 (SEQ ID NO: 396). Clone DNA77652-2505 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 64-66 and an apparent stop codon at nucleotide positions 1123-1125. The predicted polypeptide precursor is 353 amino acids long. Full length PR shown in Fig232
The O1788 protein has a predicted molecular weight of approximately 37,847 daltons and a pI of approximately 6.80. Additional features of PRO1788 include a signal peptide of about amino acids 1-16; a transmembrane domain of about amino acids 215-232 and 287-304; a potential N-glycosylation site of about amino acids 74-77 and 137-140; Amino acid 45-48 glycosaminoglycan attachment site; about amino acids 13-18, 3
2-37, 88-93, 214-219, and 223-228 N-myristoylation sites; and a leucine zipper pattern of about amino acids 284-305. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis of the full length sequence shown in Figure 232 (SEQ ID NO: 397) and the amino acid sequence of PRO1788
Dayhoff array: AF030435_1; AF062006_1; DMTARTAN_1; GARP_HUMAN; S42799; P_R
71294; HSU88879_1; DROWHEELER_1; A58532; and AF068920_1 revealed significant homology. Clone DNA77652-2505 was deposited with the ATCC on November 17, 1998 and was assigned ATCC deposit no. 203480.

Example 120: Isolation of cDNA Clone Encoding Human PRO1801 Corporate Expression Sequence Tag (EST) DNA Database (LIFESEQ®, Incyt)
e Pharmaceuticals, Palo Alto, CA) to identify ESTs that show homology to the IL-19 protein. This EST sequence is Incyte EST clone number 819592 and is herein designated DNA79293. Oligonucleotides were synthesized based on the DNA79293 sequence for 1) identification of a cDNA library containing the sequence of interest by PCR, and 2) use as a probe to isolate clones of the PRO1801 full-length coding sequence. . PCR primers (forward and reverse) were synthesized :: forward PCR primer 5'-CTCCTGTGGTCTCCAGATTTCAGGCCTA-3 '(SEQ ID NO: 403)
); And the reverse PCR primer 5′-AGTCCTCCTTAAGATTCTGATGTCAA-3 ′ (SEQ ID NO: 404)
. RNA for the construction of a cDNA library was isolated from human fetal kidney tissue. The cDNA library used for the isolation of the cDNA clone is Invitrogen, San Di
Prepared by standard methods using commercially available reagents such as those from ego, CA. cd
NA was primed with an oligo dT containing a NotI site, blunt-ended with a SalI hemikinase adapter, cut with NotI, roughly sized by gel electrophoresis, and a suitable cloning vector (pRKB or pRK5D etc .;
pRK5B is a precursor of pRK5D that does not contain an SfiI site; Holmes et al., Sc
ience, 253: 1278-1280 (1991)) at the unique XhoI and NotI sites. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO1801 [herein designated as DNA83500-2506] (FIG. 233, SEQ ID NO: 401); and the derived protein sequence for PRO1801. The entire nucleotide sequence of DNA83500-2506 is shown in Figure 233 (SEQ ID NO: 401). Clone DNA83500-2506 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 109-111 and ending at the stop codon at nucleotide positions 892-894 (Fig 233). The predicted polypeptide precursor is 261 amino acids long (Figure 234). The full-length PRO1801 protein shown in FIG.
It has an estimated molecular weight of 9,667 daltons and a pI of about 8.76. Figure 234
Analysis of full length PRO1801 set forth in (SEQ ID NO: 402) demonstrates the presence of the following: a signal peptide from about amino acid 1 to about amino acid 42, about amino acid 192 to about amino acid 195 and about amino acid 225 to about amino acid 228. CAMP- and cGMP-dependent protein kinase phosphorylation sites and about amino acids 42 to about amino acids 47, about amino acids 46 to about amino acids 51 and about amino acids 1
Potential N-myristoylation site from 36 to about amino acid 141. Cloned DNA
83500-2506 was deposited with the ATCC on October 29, 1998,
C deposit number 203391 has been assigned. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis of the full length sequence shown in Figure 234 (SEQ ID NO: 402) and the amino acid sequence of PRO1801
Dayhoff array: P_W37935, HGS_B477, P_R32277, IL10_MACFA, P_W46585, P_W4658
5, significant homology with P_R39714, P_R71471, P_R10159, IL10_RAT and P_W57201 was demonstrated.

Example 121: Isolation of a cDNA clone encoding human UCP4 E containing a public EST database (eg GenBank) and a corporate EST DNA database (LIFESEQ ™, Incyte Pharmaceuticals, Palo Alto, CA).
The ST database was searched for sequences having homology to human UCP3. The search is performed by the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymo
logy 266: 460-480 (1996)) as a comparison with 6-frame translation of the EST sequence of the UCP3 protein. A comparison that does not encode a known protein and has a BLAST score of 70 (sometimes 90) or higher is the program Assemble.
LIGN and MacVector (Oxford Molecular Group, Inc.) were assembled to construct a consensus DNA sequence. Use AsemnlLIGN software to compare DNA sequences ("from
DNA "). Also, the fromDNA sequence was extended using repeated cycles of BLAST and AssemblLIGN, and the sequence was extended as much as possible using the source of the EST sequences discussed above. Oligonucleotides were synthesized based on this consensus sequence and a clone of the full length coding sequence for UCP4 was isolated by PCR.
Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give PCR products of about 100-1000 bp in length. The probe sequence is typically 40-55 bp long. In some cases, additional oligonucleotides are synthesized when the consensus sequence is greater than about 1-1.5 kbp. PCR primers (forward and reverse) were synthesized :: Forward PCR primer CGCGGATCCCGTTATCGTCTTGCGCTACTGC (SEQ ID NO: 407) Reverse PCR primer GCGGAATTCTTAAAATGGACTGACTCCACTCATC (SEQ ID NO: 408)
). RNA for making a cDNA library was isolated from brain tissue. cDNA
The cDNA library used to isolate the clones was made by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. cDNA is N
Primed with oligo dT containing an otI site, blunt-ended with SalI hemikinase adapter, cut with NotI, roughly sized by gel electrophoresis and appropriate cloning vector (pRKB or pRK5D etc; pRK5B etc .;
Is a precursor of pRK5D that does not contain an SfiI site; Holmes et al., Science, 253.
: 1278-1280 (1991)) at the unique XhoI and NotI sites in the desired orientation. DNA sequencing of the clones isolated as described above revealed that the full length DN of UCP4
The A sequence [herein designated as DNA77568-1626] (Fig. 235, SEQ ID NO: 405) and the derived protein sequence of UCP4 were obtained. The entire coding sequence of UCP4 is shown in Figure 235 (SEQ ID NO: 405).
Clone DNA77568-1626 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 27-29, and an apparent stop codon at nucleotide positions 996-998 (see Figure 235; SEQ ID NO: 405). . The predicted polypeptide precursor is 323 amino acids long. UCP4 is a membrane bound protein and is now believed to contain at least 6 transmembrane regions. These putative transmembrane regions in the UCP4 amino acid sequence are F
ig236. Clone DNA77568-1626 contained in pcDNA3 vector (Invitrogen) has been deposited with ATCC, ATCC deposit no.
03134 is assigned. UCP4 polypeptide has been deposited ATTCC2
Obtained or obtainable by expressing a molecule encoded by the cDNA insert of the 03134 vector. Digestion of the vector with BamHI and EcoRI restriction enzymes results in an insert of approximately 972 plus 34 bp. Fig23
The full length UCP4 protein shown in 6 has a predicted molecular weight of about 36,061 and about 9.
It has an estimated pI of 28.

Example 122: Isolation of a cDNA clone encoding human PRO193 [0568] As described in Example 1 above, conrap was used to assemble consensus DNA sequences for other ESTs. Based on this consensus sequence, 1) to identify a cDNA library containing the sequence of interest by PCR, and 2) PRO
Oligonucleotides were synthesized for use as probes to isolate a clone of the 193 full length coding sequence. PCR primers (forward and reverse) were synthesized :: forward PCR primer 5'-GTTTGAGGAAGCTGGGATAC-3 '(SEQ ID NO: 411); and reverse PCR primer 5'-CCAAACTCGAGCACCTGTTC-3' (SEQ ID NO: 412). In addition, a synthetic oligonucleotide hybridization probe was made from a consensus sequence with the following nucleotide sequence: Hybridization probe 5'-ATGGCAGGCTTCCTAGATAATTTTCGTTGGCCAGAATGTG-3 '(SEQ ID NO: 413) To screen several libraries for a source of full length clones, DNA from the libraries was PCR amplified with the PCR primer pair identified above. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate a clone encoding the PRO193 gene with one of the primer pairs. RNA for preparing a cDNA library is a human retinal tissue (
LIB 94). By DNA sequencing of the clones isolated as described above, the full-length DNA sequence of PRO193 [herein designated as DNA23322-1393] (SEQ ID NO: 409)
And the derived protein sequence of PRO193 was obtained. The entire nucleotide sequence of DNA23322-1393 is shown in Figure 237 (SEQ ID NO: 409). Clone DNA23322-1393 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 138-140, and ending at the apparent stop codon at nucleotide positions 612-614 (Fig237). The predicted polypeptide precursor is 158 amino acids long (Figure 238). The full-length PRO193 protein shown in Figure 238 has a predicted molecular weight of approximately 17,936 daltons and a pI of approximately 5.32. Clone DNA23322-1393 has been deposited with the ATCC. Regarding the sequence, it is understood that the deposited clone contains the correct sequence and the sequences presented here are based on known sequencing methods. Further analysis of the amino acid sequence of SEQ ID NO: 410 reveals that the transmembrane domain is about amino acids 23-42, 60-80, 97-117 and 128-1 of SEQ ID NO: 410.
48. The cell attachment sequence is at about amino acids 81-83 of SEQ ID NO: 410.
The peroxidase proximal heme-ligand domain is located at about amino acids 81-83 of SEQ ID NO: 410. The corresponding nucleotides can be routinely determined given the sequences provided herein.

Example 123: Isolation of a cDNA clone encoding human PRO1130 As described in Example 1 above, consensus DNA sequences were assembled using phrap with other ESTs. This consensus sequence is now referred to as DNA3436
Name it 0. Based on the DNA34360 consensus sequence, 1) to identify a cDNA library containing the sequence of interest by PCR, and 2) PRO1.
Oligonucleotides were synthesized for use as probes to isolate 130 full length coding sequence clones. PCR primers (forward and reverse) were synthesized :: Forward PCR primer (34360.f1) 5'-GCCATAGTCACGACATGGATG-3 '(SEQ ID NO: 416) Forward PCR primer (34360.f2) 5'-GGATGGCCAGAGCTGCTG-3' (SEQ ID NO: 4
17) Forward PCR primer (34360.f3) 5'-AAAGTACAAGTGTGGCCTCATCAAGC-3 '(SEQ ID NO: 418) Reverse PCR primer (34360.r1) 5'-TCTGACTCCTAAGTCAGGCAGGAG-3' (SEQ ID NO: 419) Reverse PCR primer (34360.r2) 5'-ATTCTCTCCACAGACAGCTGGTTC-3 '(SEQ ID NO: 420) Further, a synthetic oligonucleotide hybridization probe was prepared from the consensus DNA34360 sequence having the following nucleotide sequence. Hybridization probe (34360.p1) 5'-GTACAAGTGTGGCCTCATCAAGCCCTGCCCAGCCAACTACTTTGCG-3 '(SEQ ID NO: 421) To screen several libraries for a source of full-length clones, the DNA from the libraries was paired with the PCR primer pairs identified above. PCR amplified. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate clones encoding the PRO1130 gene with one of the primer pairs. RNA for making a cDNA library was isolated from human aortic endothelial cell tissue. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO1130 (herein designated as DNA59814-1486 [Fig239, SEQ ID NO: 414]); and the derived protein sequence for PRO1130. The entire nucleotide sequence of DNA59814-1486 is shown in Figure 239 (SEQ ID NO: 414). Clone DNA59814-1486 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 312-314 and ending at the apparent stop codon at nucleotide positions 984-986 (Fig239). The predicted polypeptide precursor is 224 amino acids long (Fig240). The full-length PRO1130 protein shown in Figure 240 has a predicted molecular weight of approximately 24,963 daltons and a pI of approximately 9.64. Fig
Analysis of full length PRO1130 set forth in 240 (SEQ ID NO: 415) demonstrates the presence of the following: a signal peptide from about amino acid 1 to about amino acid 15,
ATP / GTP-binding site motif A from about amino acid 184 to about amino acid 191
And potential N-glycosylation sites from about amino acid 107 to about amino acid 110.
Clone DNA59814-1486 was deposited with the ATCC on October 20, 1998 and was assigned ATCC deposit no. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 240 (SEQ ID NO: 415) and the amino acid sequence of PRO1130
Dayhoff array: P_W06547, 216_HUMAN, D87120_1, MMU72677_1, LAU04889_1, and
Significant homology with D69319 was demonstrated.

Example 124: Isolation of a cDNA clone encoding human PRO1335 As described in Example 1 above, phrap was used to assemble consensus DNA sequences for other ESTs. This consensus sequence is now DNA3572
Name it 7. Based on the DNA35727 consensus sequence, 1) to identify a cDNA library containing the sequence of interest by PCR, and 2) PRO1.
Oligonucleotides were synthesized for use as probes to isolate clones of the 335 full length coding sequence. PCR primers (forward and reverse) were synthesized :: Forward PCR primer (35727.f1) 5'-GTAAAGTCGCTGGCCAGC-3 '(SEQ ID NO:
424) Forward PCR primer (35727.f2) 5'-CCCGATCTGCCTGCTGTA-3 '(SEQ ID NO:
425) Reverse PCR primer (35727.r1) 5'-CTGCACTGTATGGCCATTATTGTG-3 '(SEQ ID NO: 426) Furthermore, a synthetic oligonucleotide hybridization probe was made from the consensus DNA35727 sequence having the following nucleotide sequence: Hybridization probe (35727.p1) 5'-CAGAAACCCATGATACCCTACTGAACACCGAATCCCCTGGAAGCC-3 '(SEQ ID NO: 427) In order to screen several libraries for a source of full-length clones, DNA from the libraries with the PCR primer pair identified above. PCR amplified. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate clones encoding the PRO1335 gene with one of the primer pairs. RNA for making a cDNA library was isolated from human retinal tissue. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO1335 (herein designated as DNA62812-1594 [Fig241, SEQ ID NO: 422]); and the derived protein sequence for PRO1335. The entire nucleotide sequence of DNA62812-1594 is shown in Figure 241 (SEQ ID NO: 422). Clone DNA62812-1594 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 271-273 and ending at the stop codon at nucleotide positions 1282-1284 (Fig 241). The predicted polypeptide precursor is 337 amino acids long (Figure 242). The full-length PRO1335 protein shown in Figure 242 has a predicted molecular weight of approximately 37,668 daltons and a pI of approximately 6.27. Fig24
2 (SEQ ID NO: 423) analysis of full length PRO1335 demonstrates the presence of the following: a signal peptide of about amino acids 1 to about amino acids 15, a transmembrane domain of about amino acids 291 to about amino acids 310, about amino acids. 213 to about amino acid 216 potential N-glycosylation sites and homology with eukaryotic decarboxylase proteins from about amino acid 197 to about amino acid 245, about amino acid 104 to about amino acid 140 and about amino acid 22 to about amino acid 69. An amino acid sequence block having Clone DNA62812-1594 was AT 9 September 1998
It has been deposited with the CC and has been assigned ATCC deposit no. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in FIG.
Dayhoff array: AF037335_1, I38013, PTPG_MOUSE, CAH2_HUMAN, 1CAC, CAH7_HUMA
Significant homology between N, CAH3_HUMAN, CAH1_HUMAN, CAH5_HUMAN and P_R41746 was proved.

Example 125: Isolation of a cDNA clone encoding human PRO1329 By using the signal sequence algorithm described in Example 3 above, IncyteE
It is named ST cluster SEQ ID NO: 167544, where "DNA10680"
It is now possible to identify EST cluster sequences from the LIFESEQ (trade name) database, which is also called. This EST cluster sequence is then converted into a public database (eg GenBank) and a company EST DNA database (LIFESEQ (trade name), Incy
te Pharmaceuticals, Palo Alto, CA) and compared with various expressed sequence tag (EST) databases to identify existing homologies. The homology search is performed by the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-
480 (1996)). A comparison that does not encode a known protein and has a BLAST score of 70 (sometimes 90) or higher is the program "phrap".
(Phil Green, University of Washington, Seattle, Washington) to construct a consensus DNA sequence. CDN made from RNA isolated from synovial tissue removed from the elbow of one or more of the ESTs in a woman with rheumatoid arthritis
Retrieved from the A library. The consensus sequence obtained therefrom is herein designated "DNA58836". In light of the sequence homology between the DNA58836 sequence and the sequence contained in Incyte's EST clone number 368774, EST clone number 368774 was purchased and the cDNA insert was obtained and sequenced. The sequence of this cDNA insert is
243 and is herein designated as DNA66660-1585. The full-length clone shown in Figure 243 contains a single open reading frame, has an apparent translational initiation site at nucleotide positions 90-92, and ends at the stop codon at nucleotide positions 717-719 (Fig243; SEQ ID NO: 428). . Predicted polypeptide precursor (Figure 244, SEQ ID NO: 429)
) Is 209 amino acids long and the signal sequence is from about amino acids 1-16. PR
O1329 has a calculated molecular weight of about 21,588 daltons and an estimated pI of about 5.50. Clone DNA66660-1585 is ATC on September 22, 1998.
Deposited at C and assigned ATCC Deposit No. 203279. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method of the full length sequence shown in Figure 244 (SEQ ID NO: 429) and the amino acid sequence of PRO1329 and the following:
Dayhoff array: CELK06A9_3, PROA_XANCP, CXU21300_4, MTV037_17, SYN1_RAT, I5
Some homology with 6542, S60743, BN0LE3_1, AB001573_1, and P_P80671 was revealed.

Example 126: Isolation of a cDNA clone encoding human PRO1550 By using the signal sequence algorithm described in Example 3 above, CELT
Mercc, which is named 15B7_12 and is also called "DNA10022" here
It was possible to identify EST sequences from the k database. This EST sequence is then converted into public and corporate EST databases (eg GenBank and LIFESEQ (trade name)).
Existing homology was identified by comparison with various expressed sequence tag (EST) databases, including The homology search is performed by the computer program BLAST or BLAST2 (Altsc
hul et al., Methods in Enzymology 266: 460-480 (1996)). Comparables that do not encode a known protein and have a BLAST score of 70 (sometimes 90) or higher are those of the program "phrap" (Phil Green, University of Washing
ton, Seattle, Washington) to construct a consensus DNA sequence.
The consensus sequence obtained therefrom is herein designated "DNA55708". In view of the sequence homology between the DNA55708 sequence and the sequence contained in Incyte's EST clone no. 3411659, EST clone 3411659 was purchased and the cDNA insert was obtained and sequenced in its entirety. The sequence of this cDNA insert is shown in Figure 245 and is herein designated as "DNA76393-1664." The full-length clone shown in Figure 245 contains a single open reading frame, has an apparent translational initiation site at nucleotide positions 138-140, and terminates at the stop codon found at nucleotide positions 867-869 (Fig.
245; SEQ ID NO: 430). The predicted polypeptide precursor (Fig246,
SEQ ID NO: 431) is 243 amino acids long. Other features of the PRO1550 protein include a signal sequence at about amino acids 1-30; a hydrophobic domain at about amino acids 195-217; and a potential N-glycosylation site at about amino acids 186-189. PRO1550 has a calculated molecular weight of approximately 26,266 Daltons and approximately 8.43.
With an estimated pI of Clone DNA76393-1664 was deposited with the ATCC on October 6, 1998 and was assigned ATCC deposit no. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 246 (SEQ ID NO: 431) and the amino acid sequence of PRO1550
Dayhoff array: CELF59E12_11; CA24_ASCSU; AF018082_1; CA13_BOVIN; CA54_HUMA
N; CA34_HUMAN; HUMCOL7A1X_1; P_W09643; AF053538_1; and some homology with HSEMCXIV2_1 was revealed.

Example 127: Use of PRO as a hybridization probe The following method describes the use of a nucleic acid sequence encoding PRO as a hybridization probe. The DNA containing the full-length or mature PRO coding sequence disclosed herein is homologous DNA (PR) in human tissue cDNA library or human tissue genomic library.
Used as a probe for screening of naturally occurring variants of O polypeptides, etc.). Hybridization and washing of filters containing either library DNA was performed under the following high stringency conditions. Hybridization of radiolabeled PRO-derivatized probe to the filter consisted of 50% formamide, 5x SSC, 0.1% SDS, 0.1% sodium pyrophosphate, 50 mM sodium phosphate, pH 6.8, 2x Denhard's solution, and 10%.
It was carried out at 42 ° C. for 20 hours in a solution of dextran sulfate. The filter was washed at 42 ° C. in an aqueous solution of 0.1 × SSC and 0.1% SDS. DNAs having the desired sequence identity with the DNA encoding the full length native sequence PRO can then be identified using standard methods known in the art.

Example 128: Expression of PRO in E. coli This example illustrates preparation of the desired non-glycosylated form of PRO by recombinant expression in E. coli. The DNA sequence encoding PRO was first amplified using selected PCR primers. The primer must have a restriction enzyme site corresponding to the restriction enzyme site of the selected expression vector. Various expression vectors can be used. An example of a suitable vector is pBR322 (derived from E. coli; Boliva
r et al., Gene, 2:95 (1977)) and includes genes for ampicillin and tetracycline resistance. The vector is digested with restriction enzymes and dephosphorylated. The PCR amplified sequence is then ligated into the vector. The vector preferably contains an antibiotic resistance gene, a trp promoter, a polyhis leader (including the first 6 STII codons, polyhis sequences, and an enterokinase cleavage site), a PRO coding region, a lambda transcription terminator, and an argU gene. . The ligation mixture is then used to transform a selected E. coli strain using the method described by Sambrook et al., Supra. Transformants are identified by their ability to grow on LB plates and then antibiotic resistant clones are selected. Plasmid DNA is isolated and confirmed by restriction analysis and DNA sequence analysis. Selected clones can be grown overnight in liquid media such as LB broth supplemented with antibiotics. The overnight culture is subsequently used to seed large scale cultures.
The cells are then grown to optimal optical density, during which the expression promoter activates. After culturing for a few more hours, the cells can be harvested and centrifuged. The cell pellet obtained by centrifugation is solubilized using various reagents known in the art and then the solubilized PRO protein is purified using metal chelation columns under conditions that allow for tight protein binding. be able to. The following procedure may be used to express PRO in E. coli in the poly-His tagged form. DNA encoding PRO is first amplified using selected PCR primers. Primers provide restriction enzyme sites corresponding to those of the selected expression vector, and efficient and reliable translation initiation, rapid purification on metal chelate columns, and proteolytic removal with enterokinase. Includes other useful sequences. The PCR-amplified poly-His tag sequence was then ligated into an expression vector which was used to strain 52 (W3110 fuhA (tonA) lon galE rpoHts (htpRts) clpP (la.
cIq)) based transformation of E. coli host. Transformants are initially 50 mg / m
in LB containing 1 carbenicillin at 30 ° C. with shaking at an OD of 3-5. D. 600
Grow until it reaches. The culture was then cultivated in CRAP medium (3.57 g (NH ₄ ) ₂ S
O ₄ , 0.71 g sodium citrate 2H 2 O, 1.07 g KCl, 5.36 g Difco yeast extract, 5.36 g Shefield hycase SF in 500 mL water, and 110 mM MPOS, pH 7.3.
, 0.55% (w / v) glucose and 7 mM MgSO ₄ ) in 100)
Diluted twice and grown at 30 ° C. with shaking for about 20-30 hours. Take out the sample and S
Expression was confirmed by DS-PAGE and bulk cultures were centrifuged to pellet cells. The cell pellet was frozen until purification and refolding.

E. coli paste from 0.5 to 1 L of fermentation (6-10 g pellets) was resuspended at 10 volumes (w / v) in 7M guanidine, 20 mM Tris, pH 8 buffer. Solid sodium sulfate and sodium tetrathionate were added to give final concentrations of 0.1M and 0.02, respectively.
M and the solution was stirred at 4 ° C. overnight. This step resulted in a denatured protein with all cysteine residues blocked by sulfite. Beckman solution
Centrifuge for 30 minutes at 40,000 rpm in an Ultracentrifuge. Dilute the supernatant with 3-5 volumes of metal chelate column buffer (6 M guanidine, 20 mM Tris, pH 7.4) and
Clarified by filtration through a 22 micron filter. The clarified extract was loaded onto a 5 ml Qiagen Ni-NTA metal chelate column equilibrated with the metal chelate column buffer. The column was washed with additional buffer containing 50 mM imidazole (Calbiochem, Utrol grade), pH 7.4. The protein was eluted with a buffer containing 250 mM imidazole. Fractions containing the desired protein were pooled and stored at 4 ° C. The protein concentration was estimated by its absorption at 280 nm using the extinction coefficient calculated on the basis of its amino acid sequence. The protein was diluted by gradually diluting the sample into a freshly prepared refolding buffer consisting of 20 mM Tris, pH 8.6, 0.3 M NaCl, 2.5 M urea, 5 mM cysteine, 20 mM glycine and 1 mM EDTA. Was refolded. Refolding volume is 50-100 micrograms / ml for final protein concentration
Selected to be. The refolding solution was gently stirred at 4 ° C for 12-36 hours. The refolding reaction was stopped by adding TFA at a final concentration of 0.4% (pH of about 3). Before further purifying the protein, the solution was filtered through a 0.22 micron filter and acetonitrile was added to a final concentration of 2-10%. The refolded protein was loaded onto a Poros R1 / H reverse phase column with 0.1% TFA.
Chromatographed using 10% migration buffer and elution with a 10-80% acetonitrile gradient. Aliquots of fractions with A280 absorption were analyzed on SDS polyacrylamide gels and fractions containing homologous refolded proteins were pooled. In general, the correctly refolded species of most proteins elute at the lowest concentration of acetonitrile because these species are the most compact and their hydrophobic inner surface is shielded from interaction with reverse phase resin. To be done. Aggregated species are usually eluted at higher acetonitrile concentrations. In addition to removing the misfolded form of the protein from the desired form, the reverse phase step also removes endotoxin from the sample. Fractions containing the desired folded PRO polypeptide were pooled and the acetonitrile removed using a gentle stream of nitrogen directed at the solution. Proteins were subjected to dialysis or gel filtration on G25 Superfine (Pharmacia) resin equilibrated with preparation buffer and sterile filtration to 20 mM containing 0.14 M sodium chloride and 4% mannitol.
Hepes, pH 6.8. Many PRO polypeptides disclosed herein were successfully expressed as described above.

Example 129: Expression of PRO in Mammalian Cells This example illustrates preparation of a potentially glycosylated form of PRO by recombinant expression in mammalian cells. The vector pRK5 (see EP 307,247 published on Mar. 15, 1989) was used as an expression vector. In some cases, pRK5 with a restriction enzyme that selected PRODNA
And PRODNA is inserted using the ligation method as described in Sambrook et al., Supra. The resulting vector is called pRK5-PRO. In one embodiment, the host cell selected can be 293 cells. Human 293 cells (ATCC CCL 1573) were grown to confluence in tissue culture plates in media such as DMEM supplemented with fetal bovine serum and optionally nutrients and / or antibiotics. About 10 μg of pRK5-PRO polypeptide DNA was added to about 1
μg of VA RNA gene-encoding DNA [Thimmappaya et al., Cell, 31: 543 (1982
))] And mixed with 500 μl of 1 mM Tris-HCl, 0.1 mM EDTA, 0.227M CaCl ₂
Dissolved in. To this mixture was added dropwise 500 μl of 50 mM HEPES (pH 7.35), 280 mM NaCl, 1.5 mM NaPO ₄ ,
A precipitate was formed at 25 ° C for 10 minutes. The precipitate was suspended, added to 293 cells, and fixed at 37 ° C. for about 4 hours. The medium was aspirated and 2 ml of 20% glycerol in PBS was added for 30 seconds. The 293 cells were then washed with serum free medium, fresh medium was added and the cells were incubated for about 5 days. Approximately 24 hours after transfection, the medium was removed and the medium (only) or 200 μCi / ml ³⁵ S-
The medium was replaced with a medium containing cysteine and 200 μCi / ml ³⁵ S-methionine. After a 12 hour incubation, the conditioned medium is harvested, concentrated on a spin filter and 15%
Loaded on SDS gel. The treated gel was dried and exposed to film for a selected time that revealed the presence of PRO polypeptide. The medium containing the transformed cells was subjected to a further incubation (in serum-free medium) and the medium was tested in the selected bioassay. In an alternative technique, PRO is based on Somparyac et al., Proc. Natl. Acad. Sci.
., 12: 7575 (1981) and transiently introduced into 293 cells using the dextran sulfate method. 293 cells were grown to maximum density in spinner flasks,
Add 700 μg of pRK5-PRODNA. The cells were first concentrated from the spinner flask by centrifugation and washed with PBS. The DNA-dextran precipitate was incubated on the cell pellet for 4 hours. Treat cells with 20% glycerol for 90 seconds, wash with tissue culture medium, tissue culture medium, 5 μg / ml bovine insulin and 0.1 μg / ml.
The spinner flask containing bovine transferrin was reintroduced. After about 4 days, the conditioned medium was centrifuged and filtered to remove cells and cell debris. Then expressed P
The RO-containing sample was concentrated and purified by a selected method such as dialysis and / or column chromatography. In another embodiment, PRO can be expressed in CHO cells. pRK5
-PRO can be transfected into CHO cells using known reagents such as CaPO ₄ or DEAE- dextran. As described above, the cell culture medium can be incubated and the medium replaced with culture medium (only) or medium containing a radiolabel such as ³⁵ S-methionine. After identifying the presence of PRO polypeptide, the medium may be replaced with serum free medium. Preferably, the medium is incubated for about 6 days and then the conditioned medium is collected. The medium containing the expressed PRO can then be concentrated and purified by any selected method. The epitope tag PRO may also be expressed in host CHO cells.
PRO may be subcloned from the pRK5 vector. The subclone insert can be subjected to PCR to fuse in frame with a selected epitope tag such as a poly-his tag in a baculovirus expression vector. The poly-his tagged PRO insert can then be subcloned into an SV40 driven vector containing a selectable marker such as DHFR for selection of stable clones. Finally, change the CHO cells to SV4
Transfected with 0-derived vector (as above). Labeling may be performed as described above to confirm expression. The culture medium containing the expressed poly -his tagged PRO can then be concentrated, Ni 2+ ^- can be purified by any selected method, such as chelate affinity chromatography. Alternatively, PRO may be expressed in CHO and / or COS cells by a transient expression method and in CHO cells by another stable expression method.

Stable expression in CHO cells was performed using the following method. Proteins are IgG constructs (immunoadhesins) in which the soluble sequences of the respective proteins are fused to a constant region sequence containing the hinge, CH2 and CH2 domains of the coding sequence (eg extracellular domain), or poly-. It was expressed as a His-tagged form. Following PCR amplification, the corresponding DNA was prepared using Ausubel et al., Current Protocols of
Subcloned into CHO expression vector using standard techniques as described in Molecular Biology, Unit 3.26, John Wiley and Sons (1997). The CHO expression vector has restriction sites compatible with the 5'and 3'of the DNA of interest, and has a cD
It is created so that NA can be conveniently shuttled. Vectors are Lucas et al., Nuc
cDNAs of interest and dihydrofolate reductase (DHFR) using expression in CHO cells as described in L. Acids res. 24: 9, 1774-1779 (1996).
The SV40 early promoter / enhancer is used to control the expression of (1). DHFR
Expression allows selection for stable maintenance of the plasmid following transfection. Twelve micrograms of the desired plasmid DNA is transferred to the commercial transfection reagent Superfec
t® (Quiagen), Dosper® and Fugene® (Boehringer M
annheim) introduced into about 10 million CHO cells. Cells were grown as described in Lucas et al., Supra. About 3x10 ^-7 cells are frozen in an ampule for further growth and production as described below. The ampoule containing the plasmid DNA was placed in a water bath, thawed, and mixed by vortexing. The contents were pipetted into a centrifuge tube containing 10 mL of medium and centrifuged at 1000 rpm for 5 minutes. The supernatant is aspirated and the cells are mixed with 10 mL of selective medium (0.2 μm filtered PS20, 5%
0.2 μm diafiltered fetal bovine serum) was added). The cells are then split into 100 ml spinners containing 90 ml of selective medium. After 1-2 days, cells are transferred to a 250 mL spinner filled with 150 mL selective medium and incubated at 37 ° C. After another 2-3 days, 250 mL
, 500 mL and 2000 mL spinner were seeded at 3 × 10 ⁵ cells / mL. The cell medium was replaced with fresh medium by centrifugation and resuspended in production medium. Although any suitable CHO medium may be used, in practice the production medium described in US Pat. No. 5,122,469 issued Jun. 16, 1992 was used. A 3 L production spinner was seeded at 1.2 × 10 ⁶ cells / mL. On day 0, cell number and pH were measured. On day 1, spinners were sampled and sprayed with filtered air. On the second day, sample the spinner, change the temperature to 33 ° C and add 500 g / L glucose and 0.6 mL 10% antifoam (eg 35% polydimethylsiloxane emulsion, 30 mL of Dow Corning 365 Medical Grade Emulsion) with 30 mL. did. The pH was adjusted and maintained at around 7.2 throughout the production. After 10 days, or until viability was below 70%, cell culture medium was collected by centrifugation and filtered through a 0.22 μm filter.
The filtrate was either stored at 4 ° C or immediately loaded on a purification column.

For poly-His tagged constructs, proteins were purified using a Ni-NTA column (Qiagen). Prior to purification, imidazole was added to the conditioned medium to a concentration of 5 mM.
Conditioned medium containing 20 mM Hepes, pH 7 containing 0.3 M NaCl and 5 mM imidazole.
A 6 ml Ni-NTA column equilibrated with 0.4 buffer was pumped at 4 ° C at a flow rate of 4-5 ml / min. After packing, wash the column with additional equilibration buffer to remove protein.
Elution was done with equilibration buffer containing 0.25M imidazole. The highly purified protein was subsequently desalted with 25 ml G25 Superfine (Pharmacia) in a storage buffer containing 10 mM Hepes, 0.14 M NaCl and 4% mannitol, and -80
Stored at ° C. The immunoadhesin (Fc containing) construct was purified from conditioned medium as follows. Conditioned medium was pumped to a 5 ml protein A column (Pharmacia) equilibrated with 20 mM sodium phosphate buffer, pH 6.8. After packing, the column was washed extensively with equilibration buffer and then eluted with 100 mM citric acid, pH 3.5. The eluted protein was immediately neutralized by collecting 1 ml fractions in a tube containing 275 μl of 1 M Tris buffer, pH 9. The highly purified protein was subsequently desalted in storage buffer as described above for poly-His tagged proteins. Homogeneity was tested on SDS polyacrylamide gels and N-terminal amino acid sequenced by Edman degradation. Many of the PRO polypeptides disclosed herein have been successfully expressed as described above.

Example 130: Expression of PRO in Yeast The following method describes recombinant expression of PRO in yeast. First, create a yeast expression vector for intracellular production or secretion of PRO from the ADH2 / GAPDH promoter. DNA encoding PRO and a promoter are inserted into the appropriate restriction enzyme sites of the selected plasmid to direct intracellular expression of PRO. A DNA encoding the ADH2 / GAPDH promoter, a native PRO signal peptide or other mammalian signal peptide, or a yeast alpha factor or invertase secretion signal / leader, for example, is selected on a plasmid of choice for the DNA encoding PRO for secretion. Sequence and PR (if necessary)
It can be cloned with a linker sequence for the expression of O. Yeast cells, such as yeast strain AB110, can then be transformed with the expression plasmids described above and cultured in selected fermentation media. The transformed yeast supernatant can be analyzed by precipitation with 10% trichloroacetic acid and separation by SDS-PAGE, followed by staining of the gel with Coomassie blue stain. Recombinant PRO can then be isolated and purified by removing yeast cells from the fermentation medium by centrifugation and then concentrating the medium using selected cartridge filters. The concentrate containing PRO may be further purified using a selected column chromatography resin. Many of the PRO polypeptides disclosed herein have been successfully expressed as described above.

Example 131: Expression of PRO in Baculovirus-Infected Insect Cells The following method describes recombinant expression of PRO in Baculovirus-infected insect cells. The PRO coding sequence was fused upstream of an epitope tag contained in a baculovirus expression vector. Such epitope tags include poly-his tags and immunoglobulin tags (such as the Fc region of IgG). pVL1393 (Navo
Various plasmids can be used, including plasmids derived from commercially available plasmids such as gen). Briefly, certain portions of PRO or PRO-encoding sequences, such as sequences encoding the extracellular domain of transmembrane proteins or sequences encoding mature proteins when the protein is extracellular, have 5'and 3'regions. Amplified by PCR with primers complementary to. The 5'primer may include flanking (selected) restriction enzyme sites. The product is then digested with the selected restriction enzymes and subcloned into the expression vector. Recombinant baculovirus was obtained by using Spodoptera frugiperda (“Sf9”) cells (ATCC) containing the above-mentioned plasmid and BaculoGold (trade name) viral DNA (Pharmingen).
CRL 1711) by co-transfection with lipofectin (commercially available from GIBCO-BRL). After 4-5 days of incubation at 28 ° C, released virus was collected and used for further amplification. Viral infection and protein expression are
illey et al., Baculovirus expression vectors: A laboratory Manual, Oxford: Ox
Performed as described in ford University Press (1994). The expressed poly-his tagged PRO is then purified as follows, eg by Ni ²⁺ -chelate affinity chromatography. Extraction is Rupert et al.,
Prepared from virus-infected recombinant Sf9 cells as described in Nature, 362: 175-179 (1993). Briefly, Sf9 cells were washed and sonicated buffer (25 mM Hepes, pH 7.9; 12.5 mM MgCl ₂ ; 0.1 mM EDTA; 10
% Glycerol; 0.1% NP-40; 0.4M KCl) and resuspended twice on ice 20
Sonicated for 2 seconds. The sonicate was clarified by centrifugation, the supernatant was diluted 50-fold with loading buffer (50 mM phosphate, 300 mM NaCl, 10% glycerol, pH 7.8) and filtered through a 0.45 μm filter. Ni ²⁺ -NTA agarose column (Qiagen
Commercially available) was prepared in a total volume of 5 mL, washed with 25 mL of water and equilibrated with 25 mL of loading buffer. The filtered cell extract was loaded onto the column at 0.5 mL / min. The column was washed with loading buffer to the baseline of A ₂₈₀ , which is the point where fraction collection begins. The column was then washed with a secondary wash buffer (50 mM phosphate; 300 mM NaCl, 10% glycerol, pH 6.0) that elutes non-specifically bound proteins. After reaching the A ₂₈₀ baseline again, the column was placed in the secondary wash buffer.
The gradient was developed from 0 to 500 mM imidazole. Fractions of 1 mL were collected and SDS-PAG
E and Ni 2 ⁺ -NT complexed with silver stain or alkaline phosphatase (Qiagen)
Analyzed by Western blot at A. Fractions containing the eluted His10-tagged PRO were pooled and dialyzed against loading buffer. Alternatively, purification of IgG tag (or Fc tag) PRO can be performed using known chromatographic techniques, including, for example, protein A or protein G column chromatography. Many of the PRO polypeptides disclosed herein have been successfully expressed as described above.

Example 132: Preparation of Antibodies that Bind PRO This example illustrates preparation of monoclonal antibodies that can specifically bind PRO. Techniques for the production of monoclonal antibodies are known in the art and are described, for example, in Goding, supra. Immunogens that can be used are purified PRO, PRO
And a fusion protein containing recombinant PRO on the cell surface. The choice of immunogen can be made by one of ordinary skill in the art without undue experimentation. Mice, such as Balb / c, are immunized with PRO immunogen emulsified in complete Freund's adjuvant and injected subcutaneously or intraperitoneally at 1-100 micrograms. Alternatively, the immunogen was replaced with MPL-TDM adjuvant (Ribi Immunochemical Researh, Hamil).
ton, MT) and injected into the hind footpad of the animal. The immunized mice are then boosted 10-12 days later with an additional immunogen emulsified in the selected adjuvant. The mice are then boosted with additional immunization injections for several weeks. Anti PR
Serum samples from retro-orbital hemorrhage may be taken periodically from mice for testing in an ELISA assay for detection of O antibodies. After a suitable antibody titer has been detected, the animals "positive" for the antibody are
The final infusion of RO intravenous injection can be given. After 3 to 4 days, the mice were sacrificed and spleen cells were removed. The spleen cells were then (using 35% polyethylene glycol) P3X63AgU.P3, available from ACTT under the number CRL1597. Fused to selected mouse myeloma cell lines such as 1. Hybridoma cells were generated by the fusion and then plated on 96-well tissue culture plates containing HAT (hypoxanthine, aminopterin, and thymidine) medium to inhibit the growth of unfused cells, myeloma hybrids, and spleen cell hybrids. Hybridoma cells are screened in an ELISA for reactivity against PRO. The determination of "positive" hybridoma cells secreting the desired monoclonal antibody against PRO is within the skill of the art. Positive hybridoma cells were injected intraperitoneally into syngeneic Balb / c mice for anti-PR
Ascites fluid containing O monoclonal antibody is generated. Alternatively, hybridoma cells can be grown in tissue culture flasks or roller bottles. Purification of the monoclonal antibody produced in the ascites can be performed using ammonium sulfate precipitation followed by gel exclusion chromatography. Alternatively, affinity chromatography based on the affinity of the antibody for protein A or protein G can be used.

Example 133: Purification of PRO Polypeptides Using Specific Antibodies Native or recombinant PRO polypeptides can be purified by a variety of standard protein purification methods in the art. For example, the pro-PRO polypeptide, mature polypeptide, or pre-PRO polypeptide is purified by immunoaffinity chromatography using an antibody specific for the PRO polypeptide of interest. In general, immunoaffinity columns are made by covalently attaching an anti-PRO polypeptide antibody to an activated chromatography resin. Polyclonal immunoglobulins are prepared from immune sera by either precipitation with ammonium sulfate or purification with immobilized Protein A (Pharmacia LKB Biotechnology, Piscataway, NJ). Similarly, monoclonal antibodies are prepared from mouse ascites fluid by ammonium sulfate precipitation or chromatography on immobilized Protein A. The partially purified immunoglobulin is covalently bound to a chromatography resin such as CnBr-activated Sepharose (trade name) (Pharmacia LKB Biotechnology). The antibody is bound to the resin, the resin is blocked, and the derivative resin is washed according to the manufacturer's instructions. Such immunoaffinity columns are utilized in the purification of PRO polypeptide by preparing fractions from cells containing soluble form of PRO polypeptide. This preparation is derived by the addition of detergents or the solubilization of whole cells or subcellular fractions obtained via differential centrifugation by methods known in the art. Alternatively, soluble PRO polypeptide containing a signal sequence is secreted in useful quantity into the medium in which the cells are grown. The solubilized PRO polypeptide-containing preparation is passed through an immunoaffinity column and the column is washed under conditions that allow for favorable adsorption of PRO polypeptide (eg, high ionic strength buffer in the presence of detergent). The column is then eluted under conditions that cleave the antibody / PRO polypeptide bond (eg, a low pH, such as about 2-3, a high concentration of chaotrope such as urea or thiocyanate ion) to recover PRO polypeptide. . Example 134: Drug Screening The present invention is particularly useful for screening compounds by using PRO polypeptides or binding fragments thereof in various drug screening techniques. The PRO polypeptide or fragment used in such a test may be free in solution, immobilized on a solid support, carried on the cell surface or located intracellularly. One method of drug screening utilizes eukaryotic or prokaryotic host cells that are stably transfected with recombinant nucleic acids expressing PRO polypeptides or fragments. Agents are screened against such transfected cells in a competitive binding assay. Such cells, either in viable or immobilized form, can be used for standard binding assays. For example, the formation of complexes between the PRO polypeptide or fragment and the reagent being tested may be measured. Alternatively, the reduction in complex formation between the PRO polypeptide and its target cells caused by the agent being tested can be tested. Accordingly, the present invention provides agents or agents that can affect PRO polypeptide-related diseases or disorders. A method for screening any other reagent is provided. These methods involve contacting the reagent with a PRO polypeptide or fragment, (I) for the presence of a complex between the reagent and the PRO polypeptide or fragment, or (ii) between the PRO polypeptide or fragment and the cell. Including assaying for the presence of a complex between. In these competitive binding assays, the PRO polypeptide or fragment is typically labeled. After appropriate incubation, the free PRO polypeptide or fragment is separated from the bound form and the amount of free or unconjugated label is such that the particular reagent binds to the PRO polypeptide or PRO polypeptide / cell complex. Is a measure of the ability to inhibit. Other techniques for drug screening provide high throughput screening for compounds with suitable binding affinity for polypeptides, 1984 9
It is described in detail in WO 84/03564 published 13th March. Briefly, a number of different small peptide test compounds are synthesized on a solid support such as plastic pins or some other surface. When applied to a PRO polypeptide, the peptide test compound is reacted with the PRO polypeptide and washed. Bound PRO polypeptide is detected by methods well known in the art. Purified PRO polypeptide can also be coated directly onto plates for use in the drug screening techniques described above. In addition, non-neutralizing antibodies can be used to capture the peptide and immobilize it on a solid support. The present invention also contemplates competitive drug screening assays in which a neutralizing antibody capable of binding to a PRO polypeptide specifically competes with a test compound for a PRO polypeptide or fragment thereof. In this way, the antibody can be used to detect the presence of any peptide in the PRO polypeptide which carries one or more antigenic determinants.

Example 135: Rational Drug Design The purpose of rational drug design is to identify biologically active polypeptides of interest (eg, P
RO polypeptides) or small molecules with which they interact, eg, structural analogs of agonists, antagonists, or inhibitors. Any of these examples can be used to create more active and stable forms of the PRO polypeptide or to create agents that enhance or inhibit the function of the PRO polypeptide in vivo (reference,
Hodgson, Bio / Technology, 9: 19-21 (1991)). In one method, the three-dimensional structure of a PRO polypeptide, or PRO polypeptide-inhibitor complex, is determined by x-ray crystallography, computer modeling, and most typically by a combination of the two methods. Both the shape and charge of the PRO polypeptide must be confirmed in order to elucidate the structure of the molecule and determine the active site. Although small in number, useful information regarding the structure of PRO polypeptides may sometimes be obtained by modeling based on the structure of homologous proteins. In both cases, the relevant structural information is used to design similar PRO polypeptide-like molecules or to identify effective inhibitors. Useful examples of rational drug design include molecules with improved activity or stability as shown in Braxton and Wells, Biochemistry, 31: 7796-7801 (1992), or Athauda et al., J. Biochem. , 11
3: 742-746 (1993), including molecules that act as inhibitors, agonists, or antagonists of natural peptides. It is also possible to isolate the target-specific antibody selected by the functional assay as described above and elucidate its crystal structure. This method in principle produces a pharmacore upon which subsequent drug design can be based. Protein crystallography can be bypassed by generating anti-idiotypic antibodies (anti-ids) to functional, pharmacologically active antibodies. As a mirror image of a mirror image, the binding site of anti-ids can be expected to be an analog of the first receptor. Anti-id
Can then be used to identify and isolate peptides from banks of chemically or biologically produced peptides. The isolated peptide will function as the pharmacore. In accordance with the present invention, sufficient amounts of PRO polypeptides are available to carry out analytical experiments such as X-ray crystallography. Further, the knowledge of the PRO polypeptide amino acid sequence provided herein provides the knowledge used in computer modeling techniques in place of, or in addition to, x-ray crystallography.

Material Deposits The following materials have been deposited with the American Type Culture Collection, 10801 University Boulevard, Manassas, Virginia 20110-2209, USA (ATCC): Table 2 Material ATCC Deposit No. Deposit Date DNA19902-1669 ATCC 203454 November 3, 1998 DNA26846-1397 ATCC 203406 October 27, 1998 DNA56107-1415 ATCC 203405 October 27, 1998 DNA56406-1704 ATCC 203478 November 17, 1998 DNA56529-1647 ATCC 203293 September 29, 1998 DNA56531-1648 ATCC 203286 September 29, 1998 DNA56862-1343 ATCC 203174 September 1, 1998 DNA57254-1477 ATCC 203289 September 29, 1998 DNA57841-1522 ATCC 203458 November 3, 1998 DNA58727-1474 ATCC 203171 1998 September 1, 1998 DNA58730-1607 ATCC 203221 September 15, 1998 DNA58732-1650 ATCC 203290 September 29, 1998 DNA58828-1519 ATCC 203172 September 1, 1998 DNA58852-1637 ATCC 203271 September 22, DNA59212 -1627 ATCC 203245 September 9, 1998 DNA 59218-1559 ATCC 203287 September 29, 1998 DNA 59219-1613 ATCC 203220 September 15, 1998 DNA 59586-1520 ATCC 203288 September 29, 1998 DNA 59817-1703 ATCC 203470 November 17, 1998 DNA60278-1530 ATCC 203170 September 1, 1998 DNA60608-1577 ATCC 203126 August 18, 1998 DNA60611-1524 ATCC 203175 1998 September 1, 1998 DNA60618-1557 ATCC 203292 September 29, 1998 DNA60740-1615 ATCC 203456 November 3, 1998 DNA60764-1533 ATCC 203452 November 10, 1998 DNA60775-1532 ATCC 203173 September 1, 1998 DNA61185 -1646 ATCC 203464 November 17, 1998 DNA61608-1606 ATCC 203239 September 9, 1998 DNA62808-1326 ATCC 203358 October 20, 1998 DNA62809-1531 ATCC 203237 September 9, 1998 DNA62815-1578 ATCC 203247 1998 September 9 DNA62845-1684 ATCC 203361 October 20, 1998 DNA64842-1632 ATCC 203278 September 22, 1998 DNA64849-1604 ATCC 203468 November 17, 1998 DNA64863-1573 ATCC 203251 September 9, 1998 DNA64881- 1602 ATCC 203240 September 9, 1998 DNA64883-1526 ATCC 203253 September 9, 1998 DNA64885-1529 ATCC 203457 November 3, 1998 DNA64886-1601 ATCC 203241 September 9, 1998 DNA64888-1542 ATCC 203249 September 1998 9th May DNA64889-1541 ATCC 203250 9th September 1998 D NA64897-1628 ATCC 203216 September 15, 1998 DNA64902-1667 ATCC 203317 October 6, 1998 DNA64903-1553 ATCC 203223 September 15, 1998 DNA64905-1558 ATCC 203233 September 15, 1998 DNA64950-1590 ATCC 203224 1998 September 15, 1998 DNA64952-1568 ATCC 203222 September 15, 1998 DNA65402-1540 ATCC 203252 September 9, 1998 DNA65403-1565 ATCC 203230 September 15, 1998 DNA65404-1551 ATCC 203244 September 9, 1998 DNA65405 -1547 ATCC 203476 November 17, 1998 DNA65406-1567 ATCC 203219 September 15, 1998 DNA65408-1578 ATCC 203217 September 15, 1998 DNA65409-1566 ATCC 203232 September 15, 1998 DNA65410-1569 ATCC 203231 1998 September 15 DNA65423-1595 ATCC 203227 September 15, 1998 DNA66304-1546 ATCC 203321 October 6, 1998 DNA66511-1411 ATCC 203228 September 15, 1998 DNA66512-1564 ATCC 203218 September 15, 1998 DNA66519- 1535 ATCC 203236 September 15, 1998 DNA66520-1536 ATCC 203226 September 15, 1998 DNA66521-1583 ATCC 203225 September 15, 1998 DNA66526-1616 ATCC 203246 September 9, 1998 DNA66658-1584 ATCC 203229 September 1998 May 15 DNA66659-1593 ATCC 203269 September 1998 22nd DNA66663-1598 ATCC 203268 22nd September 1998 DNA66669-1597 ATCC 203272 22nd September 1998 DNA66672-1586 ATCC 203265 22nd September 1998 DNA66674-1599 ATCC 203281 22nd September 1998 DNA66675-1587 ATCC 203282 September 22, 1998 DNA67962-1649 ATCC 203291 September 29, 1998 DNA68836-1656 ATCC 203455 November 3, 1998 DNA68864-1629 ATCC 203276 September 22, 1998 DNA68866-1644 ATCC 203283 September 22, 1998 Day DNA68871-1638 ATCC 203280 September 22, 1998 DNA68874-1622 ATCC 203277 September 22, 1998 DNA68880-1676 ATCC 203319 October 6, 1998 DNA68885-1570 ATCC 203311 October 6, 1998 DNA71166-1685 ATCC 203355 October 20, 1998 DNA71169-1709 ATCC 203467 November 17, 1998 DNA71180-1655 ATCC 203403 October 27, 1998 DNA71184-1634 ATCC 203266 September 22, 1998 DNA71213-1659 ATCC 203401 October 27, 1998 DNA71234-1651 ATCC 203402 October 27, 1998 DNA71277-1636 ATCC 203285 September 22, 1998 DNA71282-1668 ATCC 203312 October 6, 1998 DNA71286-1604 ATCC 203357 October 20, 1998 DNA71883-1660 ATCC 203475 1998 November 17, 2012 DNA73401-1633 ATCC 203 273 September 22, 1998 DNA73492-1671 ATCC 203324 October 6, 1998 DNA73727-1673 ATCC 203459 November 3, 1998 DNA73730-1679 ATCC 203320 October 6, 1998 DNA73734-1680 ATCC 203363 October 20, 1998 Day DNA73735-1681 ATCC 203356 October 20, 1998 DNA73736-1657 ATCC 203466 November 17, 1998 DNA73737-1658 ATCC 203412 October 27, 1998 DNA73739-1645 ATCC 203270 September 22, 1998 DNA73742-1662 ATCC 203316 October 6, 1998 DNA73744-1665 ATCC 203322 October 6, 1998 DNA73746-1654 ATCC 203411 October 27, 1998 DNA73760-1672 ATCC 203314 October 6, 1998 DNA76396-1698 ATCC 203417 November 17, 1998 DNA76398-1699 ATCC 203474 November 17, 1998 DNA76399-1700 ATCC 203472 November 17, 1998 DNA76401-1683 ATCC 203360 October 20, 1998 DNA76510-2504 ATCC 203477 November 17, 1998 DNA76522-2500 ATCC 203469 1998 November 17, 1998 DNA76529-1666 ATCC 203315 October 6, 1998 DNA76531-1701 ATCC 203465 November 17, 1998 DNA76532-1702 ATCC 203473 November 17, 1998 DNA76538-1670 ATCC 203313 October 6, 1998 DNA76541 -1675 ATCC 203409 October 27, 1998 DNA77301-1708 ATCC 203407 October 27, 1998 DNA77303-2502 ATCC 203479 November 17, 1998 DNA77648-1688 ATCC 203408 October 27, 1998 DNA77652-2505 ATCC 203480 November 17, 1998 DNA83500-2506 ATCC 203391 1998 October 29, DNA77568-1626 ATCC 203134 August 18, 1998 DNA23322-1393 ATCC 203400 October 27, 1998 DNA59814-1486 ATCC 203359 October 20, 1998 DNA62812-1594 ATCC 203248 September 9, 1998 DNA66660 -1585 ATCC 203279 22nd September 1998 DNA76393-1664 ATCC 203323 6th October 1998

These deposits were made in accordance with the provisions of the Budapest Treaty and its Regulations (Budapest Treaty) on the international recognition of deposits of microorganisms under the patent procedure. This guarantees that the viable culture of the deposit will be maintained for 30 years from the date of deposit. The deposit may be obtained from the ATCC in accordance with the terms of the Budapest Treaty and in accordance with the agreement between Genentech and ATCC, whichever is first, at the time of issuance of the relevant U.S. patent or at any time. At the time of publication of a U.S. or foreign patent application, we ensure that the progeny of the deposited culture will be permanently and unrestrictedly available, and will be subject to United States Patent Law Section 122 and the Patent Office Commissioner's Regulations accordingly (especially reference number 886OG638
(Including 37 CFR §1.14) of this document, guaranteeing that descendants will be available to those who have been determined by the US Patent Office Commissioner to have rights. The assignee of the present application agrees that if the deposited culture dies or is lost or destroyed if cultured under the proper conditions, the material will be replaced immediately with the same at the time of notification. To do. The availability of deposited material is not to be construed as a license to practice the invention in breach of any rights recognized under any governmental authority under patent law. The written specification given above is considered sufficient to enable one skilled in the art to practice the invention. The deposited embodiment is intended as an illustration of one of the aspects of the invention and any functionally equivalent construct is within the scope of the invention, so that the deposited deposits may It is not limited. No deposit of material herein is admitted that the written description contained therein is sufficient to enable the practice of any aspect of the invention, including its best mode. It is not to be construed as limiting the scope of the claims to the particular illustrations presented. Indeed, various modifications of the invention in addition to those shown and described herein will be apparent to those skilled in the art from the foregoing description and fall within the scope of the appended claims.

[Brief description of drawings]

FIG. 1 shows the nucleotide sequence of the native sequence PRO1560 (UNQ767) cDNA (SEQ ID NO: 3). SEQ ID NO: 3 is referred to here as "DNA1990
2-1669 ". Start and stop codons are shown in bold and underlined font.

[Figure 2] This shows the amino acid sequence (SEQ ID NO: 4) derived from the coding sequence of SEQ ID NO: 3 shown in Figure 1.

[Figure 3] This shows the nucleotide sequence of the native sequence PRO444 (UNQ328) cDNA (SEQ ID NO: 5). SEQ ID NO: 5 is referred to here as "DNA26846
-1397 ". Start and stop codons are shown in bold and underlined font.

FIG. 4 shows the amino acid sequence (SEQ ID NO: 6) derived from the coding sequence of SEQ ID NO: 5 shown in FIG.

[Figure 5] Shows the nucleotide sequence of the native sequence PRO1018 (UNQ501) cDNA (SEQ ID NO: 7). SEQ ID NO: 7 is here "DNA5610
It is a clone named "7-1415". Start and stop codons are shown in bold and underlined font.

[Figure 6] This shows the amino acid sequence (SEQ ID NO: 8) derived from the coding sequence of SEQ ID NO: 7 shown in Figure 5.

[Figure 7] This shows the nucleotide sequence (SEQ ID NO: 9) of the native sequence PRO1773 (UNQ835) cDNA. SEQ ID NO: 9 is here "DNA5640
6-1704 ”. Start and stop codons are shown in bold and underlined font.

FIG. 8 shows the amino acid sequence (SEQ ID NO: 10) derived from the coding sequence of SEQ ID NO: 9 shown in FIG.

[Figure 9] This shows the nucleotide sequence (SEQ ID NO: 11) of the native sequence PRO1477 (UNQ747) cDNA. SEQ ID NO: 11 is here "DNA56
529-1647 ". Start and stop codons are shown in bold and underlined font.

FIG. 10 shows the amino acid sequence (SEQ ID NO: 12) derived from the coding sequence of SEQ ID NO: 11 shown in FIG.

Figure 11 shows the nucleotide sequence of the native sequence PRO1478 (UNQ748) cDNA (SEQ ID NO: 16). SEQ ID NO: 16 is here "DNA5
6531-1648 ". Start and stop codons are shown in bold and underlined font.

[Figure 12] This shows the amino acid sequence (SEQ ID NO: 17) derived from the coding sequence of SEQ ID NO: 16 shown in Figure 11.

[Figure 13] This shows the nucleotide sequence of the native sequence PRO831 (UNQ471) cDNA (SEQ ID NO: 21). SEQ ID NO: 21 is here "DNA56
862-1343 ". Start and stop codons are shown in bold and underlined font.

[Figure 14] This shows the amino acid sequence (SEQ ID NO: 22) derived from the coding sequence of SEQ ID NO: 21 shown in Figure 13.

FIG. 15 shows the nucleotide sequence (SEQ ID NO: 23) of the native sequence PRO1113 (UNQ556) cDNA. SEQ ID NO: 23 is here "DNA5
7254 to 1477 ”. Start and stop codons are shown in bold and underlined font.

[Figure 16] This shows the amino acid sequence (SEQ ID NO: 24) derived from the coding sequence of SEQ ID NO: 23 shown in Figure 15.

[Figure 17] This shows the nucleotide sequence (SEQ ID NO: 28) of the native sequence PRO1194 (UNQ607) cDNA. SEQ ID NO: 28 is here "DNA5
This is a clone designated "7841-1522". Start and stop codons are shown in bold and underlined font.

FIG. 18 shows the amino acid sequence (SEQ ID NO: 29) derived from the coding sequence of SEQ ID NO: 28 shown in FIG.

Figure 19 shows the nucleotide sequence (SEQ ID NO: 30) of the native sequence PRO1110 (UNQ553) cDNA. SEQ ID NO: 30 is here "DNA5
8727-1474 ". Start and stop codons are shown in bold and underlined font.

FIG. 20 shows the amino acid sequence (SEQ ID NO: 31) derived from the coding sequence of SEQ ID NO: 30 shown in FIG.

[Figure 21] This shows the nucleotide sequence of the native sequence PRO1378 (UNQ715) cDNA (SEQ ID NO: 32). SEQ ID NO: 32 is here "DNA5
8730-1607 ". Start and stop codons are shown in bold and underlined font.

[Figure 22] This shows the amino acid sequence (SEQ ID NO: 33) derived from the coding sequence of SEQ ID NO: 32 shown in Figure 21.

Figure 23 shows the nucleotide sequence of the native sequence PRO1481 (UNQ750) cDNA (SEQ ID NO: 40). SEQ ID NO: 40 is here "DNA5
8732-1650 ". Start and stop codons are shown in bold and underlined font.

[Figure 24] This shows the amino acid sequence (SEQ ID NO: 41) derived from the coding sequence of SEQ ID NO: 40 shown in Figure 23.

[Figure 25] This shows the nucleotide sequence of the native sequence PRO1189 (UNQ603) cDNA (SEQ ID NO: 42). SEQ ID NO: 42 is here "DNA5
8828-1519 ". Start and stop codons are shown in bold and underlined font.

[Figure 26] This shows the amino acid sequence (SEQ ID NO: 43) derived from the coding sequence of SEQ ID NO: 42 shown in Figure 25.

[Figure 27] This shows the nucleotide sequence (SEQ ID NO: 49) of the native sequence PRO1415 (UNQ731) cDNA. SEQ ID NO: 49 is here "DNA5
8852-1637 ". Start and stop codons are shown in bold and underlined font.

FIG. 28 shows the amino acid sequence (SEQ ID NO: 50) derived from the coding sequence of SEQ ID NO: 49 shown in FIG.

[Figure 29] This shows the nucleotide sequence of the native sequence PRO1411 (UNQ729) cDNA (SEQ ID NO: 51). SEQ ID NO: 51 is here "DNA5
9212-1627 ". Start and stop codons are shown in bold and underlined font.

[Figure 30] This shows the amino acid sequence (SEQ ID NO: 52) derived from the coding sequence of SEQ ID NO: 51 shown in Figure 29.

Figure 31 shows the nucleotide sequence (SEQ ID NO: 53) of the native sequence PRO1295 (UNQ664) cDNA. SEQ ID NO: 53 is here "DNA5
9218-1559 ". Start and stop codons are shown in bold and underlined font.

[Figure 32] This shows the amino acid sequence (SEQ ID NO: 54) derived from the coding sequence of SEQ ID NO: 53 shown in Figure 31.

Figure 33 shows the nucleotide sequence of the native sequence PRO1359 (UNQ708) cDNA (SEQ ID NO: 55). SEQ ID NO: 55 is here "DNA5
9219-1613 ". Start and stop codons are shown in bold and underlined font.

[Figure 34] This shows the amino acid sequence (SEQ ID NO: 56) derived from the coding sequence of SEQ ID NO: 55 shown in Figure 33.

[Figure 35] This shows the nucleotide sequence of the native sequence PRO1190 (UNQ604) cDNA (SEQ ID NO: 57). SEQ ID NO: 57 is here "DNA5
9586-1520 ". Start and stop codons are shown in bold and underlined font.

[Figure 36] This shows the amino acid sequence (SEQ ID NO: 58) derived from the coding sequence of SEQ ID NO: 57 shown in Figure 35.

Figure 37 shows the nucleotide sequence (SEQ ID NO: 62) of the native sequence PRO1772 (UNQ834) cDNA. SEQ ID NO: 62 is here "DNA5
9817-1703 ". Start and stop codons are shown in bold and underlined font.

[Figure 38] This shows the amino acid sequence (SEQ ID NO: 63) derived from the coding sequence of SEQ ID NO: 62 shown in Figure 37.

[Figure 39] This shows the nucleotide sequence (SEQ ID NO: 67) of a native sequence PRO1248 (UNQ631) cDNA. SEQ ID NO: 67 is here "DNA6
It is a clone designated as "0278-1530". Start and stop codons are shown in bold and underlined font.

[Figure 40] This shows the amino acid sequence (SEQ ID NO: 68) derived from the coding sequence of SEQ ID NO: 67 shown in Figure 39.

[Figure 41] This shows the nucleotide sequence of the native sequence PRO1316 (UNQ682) cDNA (SEQ ID NO: 69). SEQ ID NO: 69 is here "DNA6
It is a clone named "0608-1577". Start and stop codons are shown in bold and underlined font.

[Figure 42] This shows the amino acid sequence (SEQ ID NO: 70) derived from the coding sequence of SEQ ID NO: 69 shown in Figure 41.

[Figure 43] This shows the nucleotide sequence of the native sequence PRO1197 (UNQ610) cDNA (SEQ ID NO: 71). SEQ ID NO: 71 is here "DNA6
0611-1524 ". Start and stop codons are shown in bold and underlined font.

[Figure 44] This shows the amino acid sequence (SEQ ID NO: 72) derived from the coding sequence of SEQ ID NO: 71 shown in Figure 43.

[Figure 45] This shows the nucleotide sequence of the native sequence PRO1293 (UNQ662) cDNA (SEQ ID NO: 76). SEQ ID NO: 76 is here "DNA6
0618-1557 ". Start and stop codons are shown in bold and underlined font.

[Figure 46] This shows the amino acid sequence (SEQ ID NO: 77) derived from the coding sequence of SEQ ID NO: 76 shown in Figure 45.

[Figure 47] This shows the nucleotide sequence (SEQ ID NO: 78) of the native sequence PRO1380 (UNQ717) cDNA. SEQ ID NO: 78 is here "DNA6
0740-1615 ". Start and stop codons are shown in bold and underlined font.

[Figure 48] This shows the amino acid sequence (SEQ ID NO: 79) derived from the coding sequence of SEQ ID NO: 78 shown in Figure 47.

Figure 49 shows the nucleotide sequence (SEQ ID NO: 83) of the native sequence PRO1265 (UNQ636) cDNA. SEQ ID NO: 83 is here "DNA6
0764-1533 ". Start and stop codons are shown in bold and underlined font.

FIG. 50 shows the amino acid sequence (SEQ ID NO: 84) derived from the coding sequence of SEQ ID NO: 83 shown in FIG.

[Figure 51] This shows the nucleotide sequence of the native sequence PRO1250 (UNQ633) cDNA (SEQ ID NO: 85). SEQ ID NO: 85 is here "DNA6
0775-1532 ". Start and stop codons are shown in bold and underlined font.

[Figure 52] This shows the amino acid sequence (SEQ ID NO: 86) derived from the coding sequence of SEQ ID NO: 85 shown in Figure 51.

[Figure 53] This shows the nucleotide sequence of the native sequence PRO1475 (UNQ746) cDNA (SEQ ID NO: 87). SEQ ID NO: 87 is here "DNA6
The clone is designated as "1185-1646". Start and stop codons are shown in bold and underlined font.

[Figure 54] This shows the amino acid sequence (SEQ ID NO: 88) derived from the coding sequence of SEQ ID NO: 87 shown in Figure 53.

[Figure 55] This shows the nucleotide sequence (SEQ ID NO: 94) of the native sequence PRO1377 (UNQ714) cDNA. SEQ ID NO: 94 is here "DNA6
1608-1606 ”. Start and stop codons are shown in bold and underlined font.

[Figure 56] This shows the amino acid sequence (SEQ ID NO: 95) derived from the coding sequence of SEQ ID NO: 94 shown in Figure 55.

Figure 57 shows the nucleotide sequence of the native sequence PRO1326 (UNQ686) cDNA (SEQ ID NO: 99). SEQ ID NO: 99 is here "DNA6
2808-1582 ". Start and stop codons are shown in bold and underlined font.

[Figure 58] This shows the amino acid sequence (SEQ ID NO: 100) derived from the coding sequence of SEQ ID NO: 99 shown in Figure 57.

[Figure 59] This shows the nucleotide sequence (SEQ ID NO: 101) of the native sequence PRO1249 (UNQ632) cDNA. The sequence number: 101 is "DN
It is a clone designated as "A62809-1531". Start and stop codons are shown in bold and underlined font.

[Figure 60] This shows the amino acid sequence (SEQ ID NO: 102) derived from the coding sequence of SEQ ID NO: 101 shown in Figure 59.

[Figure 61] This shows the nucleotide sequence (SEQ ID NO: 103) of a native sequence PRO1315 (UNQ681) cDNA. SEQ ID NO: 103 is "DN
A62815-1578 ". Start and stop codons are shown in bold and underlined font.

[Figure 62] This shows the amino acid sequence (SEQ ID NO: 104) derived from the coding sequence of SEQ ID NO: 103 shown in Figure 61.

[Figure 63] This shows the nucleotide sequence of the native sequence PRO1549 (UNQ782) cDNA (SEQ ID NO: 110). SEQ ID NO: 110 is here "DN
The clone is designated as A62845-1684 ". Start and stop codons are shown in bold and underlined font.

[Figure 64] This shows the amino acid sequence (SEQ ID NO: 111) derived from the coding sequence of SEQ ID NO: 110 shown in Figure 63.

Figure 65 shows the nucleotide sequence (SEQ ID NO: 115) of native sequence PRO1430 (UNQ736) cDNA. SEQ ID NO: 115 is "DN
It is a clone designated as A64842-1632. Start and stop codons are shown in bold and underlined font.

[Figure 66] This shows the amino acid sequence (SEQ ID NO: 116) derived from the coding sequence of SEQ ID NO: 115 shown in Figure 65.

[Figure 67] This shows the nucleotide sequence of the native sequence PRO1374 (UNQ711) cDNA (SEQ ID NO: 117). SEQ ID NO: 107 is here "DN
A clone named A64849-1604 ". Start and stop codons are shown in bold and underlined font.

[Figure 68] This shows the amino acid sequence (SEQ ID NO: 118) derived from the coding sequence of SEQ ID NO: 117 shown in Figure 67.

[Figure 69] This shows the nucleotide sequence (SEQ ID NO: 122) of the native sequence PRO1311 (UNQ677) cDNA. SEQ ID NO: 122 is "DN
A clone named A64863-1573 ". Start and stop codons are shown in bold and underlined font.

[Figure 70] This shows the amino acid sequence (SEQ ID NO: 123) derived from the coding sequence of SEQ ID NO: 122 shown in Figure 69.

[Figure 71] This shows the nucleotide sequence of the native sequence PRO1357 (UNQ706) cDNA (SEQ ID NO: 127). SEQ ID NO: 127 is here "DN
The clone is designated as "A64881-1602". Start and stop codons are shown in bold and underlined font.

[Figure 72] This shows the amino acid sequence (SEQ ID NO: 128) derived from the coding sequence of SEQ ID NO: 127 shown in Figure 71.

Figure 73 shows the nucleotide sequence (SEQ ID NO: 129) of the native sequence PRO1244 (UNQ628) cDNA. SEQ ID NO: 129 is here "DN
A clone designated as A64883-1526 ". Start and stop codons are shown in bold and underlined font.

[Figure 74] This shows the amino acid sequence (SEQ ID NO: 130) derived from the coding sequence of SEQ ID NO: 129 shown in Figure 73.

[Figure 75] This shows the nucleotide sequence (SEQ ID NO: 131) of the native sequence PRO1246 (UNQ630) cDNA. SEQ ID NO: 131 is "DN
It is a clone designated as "A64885-1529". Start and stop codons are shown in bold and underlined font.

[Figure 76] This shows the amino acid sequence (SEQ ID NO: 132) derived from the coding sequence of SEQ ID NO: 131 shown in Figure 75.

Figure 77 shows the nucleotide sequence of the native sequence PRO1356 (UNQ705) cDNA (SEQ ID NO: 133). SEQ ID NO: 133 is "DN
A clone named A64886-1601 ". Start and stop codons are shown in bold and underlined font.

[Figure 78] This shows the amino acid sequence (SEQ ID NO: 134) derived from the coding sequence of SEQ ID NO: 133 shown in Figure 77.

[Figure 79] This shows the nucleotide sequence (SEQ ID NO: 135) of the native sequence PRO1275 (UNQ645) cDNA. SEQ ID NO: 135 is "DN
It is a clone designated as "A64888-1542". Start and stop codons are shown in bold and underlined font.

[Figure 80] This shows the amino acid sequence (SEQ ID NO: 136) derived from the coding sequence of SEQ ID NO: 135 shown in Figure 79.

Figure 81 shows the nucleotide sequence of the native sequence PRO1274 (UNQ644) cDNA (SEQ ID NO: 137). SEQ ID NO: 137 is here "DN
A clone designated as A64889-1542 ". Start and stop codons are shown in bold and underlined font.

[Figure 82] This shows the amino acid sequence (SEQ ID NO: 138) derived from the coding sequence of SEQ ID NO: 137 shown in Figure 80.

FIG. 83 shows the nucleotide sequence of native sequence PRO1412 (UNQ730) cDNA (SEQ ID NO: 139). SEQ ID NO: 139 is here "DN
A 64897-1628 ". Start and stop codons are shown in bold and underlined font.

[Figure 84] This shows the amino acid sequence (SEQ ID NO: 140) derived from the coding sequence of SEQ ID NO: 139 shown in Figure 83.

Figure 85 shows the nucleotide sequence of the native sequence PRO1557 (UNQ765) cDNA (SEQ ID NO: 141). SEQ ID NO: 141 is here "DN
It is a clone designated as "A64902-1667". Start and stop codons are shown in bold and underlined font.

[Figure 86] This shows the amino acid sequence (SEQ ID NO: 142) derived from the coding sequence of SEQ ID NO: 141 shown in Figure 85.

[Figure 87] This shows the nucleotide sequence of the native sequence PRO1286 (UNQ655) cDNA (SEQ ID NO: 143). SEQ ID NO: 143 is here: "DN
It is a clone designated as "A64903-1667". Start and stop codons are shown in bold and underlined font.

FIG. 88 shows the amino acid sequence (SEQ ID NO: 144) derived from the coding sequence of SEQ ID NO: 143 shown in FIG.

Figure 89 shows the nucleotide sequence of the native sequence PRO1294 (UNQ663) cDNA (SEQ ID NO: 145). SEQ ID NO: 145 is here "DN
A64905-1558 ". Start and stop codons are shown in bold and underlined font.

FIG. 90 shows the amino acid sequence (SEQ ID NO: 146) derived from the coding sequence of SEQ ID NO: 145 shown in FIG. 89.

FIG. 91 shows the nucleotide sequence (SEQ ID NO: 147) of the native sequence PRO1347 (UNQ702) cDNA. SEQ ID NO: 147 is here "DN
It is a clone designated as "A64950-1590". Start and stop codons are shown in bold and underlined font.

FIG. 92 shows the amino acid sequence (SEQ ID NO: 148) derived from the coding sequence of SEQ ID NO: 147 shown in FIG. 91.

[Figure 93] This shows the nucleotide sequence of the native sequence PRO1305 (UNQ671) cDNA (SEQ ID NO: 152). SEQ ID NO: 152 is "DN
It is a clone designated as "A64952-1568". Start and stop codons are shown in bold and underlined font.

[Figure 94] This shows the amino acid sequence (SEQ ID NO: 153) derived from the coding sequence of SEQ ID NO: 152 shown in Figure 93.

Figure 95 shows the nucleotide sequence (SEQ ID NO: 157) of the native sequence PRO1273 (UNQ643) cDNA. The sequence number: 157 is here "DN
A65402-1540 ". Start and stop codons are shown in bold and underlined font.

FIG. 96 shows the amino acid sequence (SEQ ID NO: 158) derived from the coding sequence of SEQ ID NO: 157 shown in FIG.

Figure 97 shows the nucleotide sequence of the native sequence PRO1302 (UNQ668) cDNA (SEQ ID NO: 159). SEQ ID NO: 159 is here "DN
A65403-1565 ". Start and stop codons are shown in bold and underlined font.

FIG. 98 shows the amino acid sequence (SEQ ID NO: 160) derived from the coding sequence of SEQ ID NO: 159 shown in FIG.

Figure 99 shows the nucleotide sequence of the native sequence PRO1283 (UNQ653) cDNA (SEQ ID NO: 161). SEQ ID NO: 161 is here "DN
A65404-1551 ". Start and stop codons are shown in bold and underlined font.

FIG. 100 shows the amino acid sequence (SEQ ID NO: 162) derived from the coding sequence of SEQ ID NO: 161 shown in FIG.

Figure 101 shows the nucleotide sequence of the native sequence PRO1279 (UNQ649) cDNA (SEQ ID NO: 169). SEQ ID NO: 169 is here "D
NA65405-1547 ". Start and stop codons are shown in bold and underlined font.

[Figure 102] This shows the amino acid sequence (SEQ ID NO: 170) derived from the coding sequence of SEQ ID NO: 169 shown in Figure 101.

Figure 103 shows the nucleotide sequence of the native sequence PRO1304 (UNQ670) cDNA (SEQ ID NO: 179). SEQ ID NO: 179 is here "D
NA65406-1567 ". Start and stop codons are shown in bold and underlined font.

FIG. 104 shows the amino acid sequence (SEQ ID NO: 180) derived from the coding sequence of SEQ ID NO: 179 shown in FIG.

Figure 105 shows the nucleotide sequence of the native sequence PRO1317 (UNQ683) cDNA (SEQ ID NO: 188). SEQ ID NO: 188 is here "D
NA65408-1578 ". Start and stop codons are shown in bold and underlined font.

FIG. 106 shows the amino acid sequence (SEQ ID NO: 189) derived from the coding sequence of SEQ ID NO: 188 shown in FIG. 105.

Figure 107 Shows the nucleotide sequence of the native sequence PRO1303 (UNQ669) cDNA (SEQ ID NO: 193). SEQ ID NO: 193 is here "D
NA65409-1566 ". Start and stop codons are shown in bold and underlined font.

FIG. 108 shows the amino acid sequence (SEQ ID NO: 194) derived from the coding sequence of SEQ ID NO: 193 shown in FIG. 107.

FIG. 109 shows the nucleotide sequence of native sequence PRO1306 (UNQ672) cDNA (SEQ ID NO: 195). SEQ ID NO: 195 is set forth here as "D
It is a clone designated as "NA65410-1569". Start and stop codons are shown in bold and underlined font.

FIG. 110 shows the amino acid sequence (SEQ ID NO: 196) derived from the coding sequence of SEQ ID NO: 195 shown in FIG. 109.

[Fig111A-B] Natural sequence PRO1336 (UNQ649) cDN
1 shows the nucleotide sequence of A (SEQ ID NO: 197). SEQ ID NO: 197 is the clone designated herein "DNA65423-1595". Start and stop codons are shown in bold and underlined font.

FIG. 112 shows the amino acid sequence (SEQ ID NO: 198) derived from the coding sequence of SEQ ID NO: 197 shown in FIG. 111A-B.

Figure 113 shows the nucleotide sequence (SEQ ID NO: 202) of the native sequence PRO1278 (UNQ648) cDNA. SEQ ID NO: 202 is "D
NA66304-1546 ". Start and stop codons are shown in bold and underlined font.

[Figure 114] This shows the amino acid sequence (SEQ ID NO: 203) derived from the coding sequence of SEQ ID NO: 202 shown in Figure 113.

[Figure 115] This shows the nucleotide sequence of the native sequence PRO1298 (UNQ666) cDNA (SEQ ID NO: 209). SEQ ID NO: 209 is "D
It is a clone designated as "NA66511-1563". Start and stop codons are shown in bold and underlined font.

[Figure 116] This shows the amino acid sequence (SEQ ID NO: 210) derived from the coding sequence of SEQ ID NO: 209 shown in Figure 115.

[Figure 117] This shows the nucleotide sequence of the native sequence PRO1301 (UNQ667) cDNA (SEQ ID NO: 211). SEQ ID NO: 211 is "D
NA66512-1564 ". Start and stop codons are shown in bold and underlined font.

[Figure 118] This shows the amino acid sequence (SEQ ID NO: 212) derived from the coding sequence of SEQ ID NO: 211 shown in Figure 117.

FIG. 119 shows the nucleotide sequence of the native sequence PRO1268 (UNQ638) cDNA (SEQ ID NO: 213). SEQ ID NO: 213 is "D
NA66519-1535 ". Start and stop codons are shown in bold and underlined font.

[Figure 120] This shows the amino acid sequence (SEQ ID NO: 214) derived from the coding sequence of SEQ ID NO: 213 shown in Figure 119.

[Figure 121] This shows the nucleotide sequence of the native sequence PRO1269 (UNQ639) cDNA (SEQ ID NO: 215). SEQ ID NO: 215 is "D
It is a clone designated as "NA66520-1536". Start and stop codons are shown in bold and underlined font.

[Figure 122] This shows the amino acid sequence (SEQ ID NO: 216) derived from the coding sequence of SEQ ID NO: 215 shown in Figure 121.

[Figure 123] This shows the nucleotide sequence of the native sequence PRO1327 (UNQ687) cDNA (SEQ ID NO: 217). SEQ ID NO: 217 is "D
It is a clone designated as "NA66521-1583". Start and stop codons are shown in bold and underlined font.

[Figure 124] This shows the amino acid sequence (SEQ ID NO: 218) derived from the coding sequence of SEQ ID NO: 217 shown in Figure 123.

Figure 125 shows the nucleotide sequence of the native sequence PRO1382 (UNQ718) cDNA (SEQ ID NO: 219). SEQ ID NO: 219 is "D
A clone designated as "NA66526-1616". Start and stop codons are shown in bold and underlined font.

[Figure 126] This shows the amino acid sequence (SEQ ID NO: 220) derived from the coding sequence of SEQ ID NO: 219 shown in Figure 125.

Figure 127 shows the nucleotide sequence (SEQ ID NO: 224) of the native sequence PRO1328 (UNQ688) cDNA. SEQ ID NO: 224 is "D
NA66658-1584 ". Start and stop codons are shown in bold and underlined font.

[Figure 128] This shows the amino acid sequence (SEQ ID NO: 225) derived from the coding sequence of SEQ ID NO: 224 shown in Figure 127.

FIG. 129 shows the nucleotide sequence of the native sequence PRO1325 (UNQ685) cDNA (SEQ ID NO: 226). SEQ ID NO: 226 is "D
The clone is designated as "NA66659-1593". Start and stop codons are shown in bold and underlined font.

[Figure 130] This shows the amino acid sequence (SEQ ID NO: 227) derived from the coding sequence of SEQ ID NO: 226 shown in Figure 129.

Figure 131 shows the nucleotide sequence (SEQ ID NO: 228) of the native sequence PRO1340 (UNQ695) cDNA. SEQ ID NO: 228 is "D
NA66663-1598 ". Start and stop codons are shown in bold and underlined font.

[Figure 132] This shows the amino acid sequence (SEQ ID NO: 229) derived from the coding sequence of SEQ ID NO: 228 shown in Figure 131.

[Figure 133] This shows the nucleotide sequence of the native sequence PRO1339 (UNQ694) cDNA (SEQ ID NO: 233). SEQ ID NO: 233 is "D
NA66669-1597 ". Start and stop codons are shown in bold and underlined font.

[Figure 134] This shows the amino acid sequence (SEQ ID NO: 234) derived from the coding sequence of SEQ ID NO: 233 shown in Figure 133.

Figure 135 shows the nucleotide sequence (SEQ ID NO: 235) of native sequence PRO1337 (UNQ692) cDNA. SEQ ID NO: 235 is "D
NA66672-1586 ". Start and stop codons are shown in bold and underlined font.

[Figure 136] This shows the amino acid sequence (SEQ ID NO: 236) derived from the coding sequence of SEQ ID NO: 235 shown in Figure 135.

FIG. 137 shows the nucleotide sequence of the native sequence PRO1342 (UNQ697) cDNA (SEQ ID NO: 242). SEQ ID NO: 242 is "D
NA66674-1599 ". Start and stop codons are shown in bold and underlined font.

[Figure 138] This shows the amino acid sequence (SEQ ID NO: 243) derived from the coding sequence of SEQ ID NO: 242 shown in Figure 137.

Figure 139 shows the nucleotide sequence of native sequence PRO1343 (UNQ698) cDNA (SEQ ID NO: 247). SEQ ID NO: 247 is "D
The clone is designated as NA66675-1587 ". Start and stop codons are shown in bold and underlined font.

[Figure 140] This shows the amino acid sequence (SEQ ID NO: 248) derived from the coding sequence of SEQ ID NO: 247 shown in Figure 139.

[Figure 141] This shows the nucleotide sequence of the native sequence PRO1480 (UNQ749) cDNA (SEQ ID NO: 252). SEQ ID NO: 252 is "D
It is a clone designated as "NA67962-1649". Start and stop codons are shown in bold and underlined font.

[Figure 142] This shows the amino acid sequence (SEQ ID NO: 253) derived from the coding sequence of SEQ ID NO: 252 shown in Figure 141.

[Fig143A-B] Natural sequence PRO1487 (UNQ756) cDN
1 shows the nucleotide sequence of A (SEQ ID NO: 259). SEQ ID NO: 259 is the clone herein designated "DNA68836-1656". Start and stop codons are shown in bold and underlined font.

[Figure 144] This shows the amino acid sequence (SEQ ID NO: 260) derived from the coding sequence of SEQ ID NO: 259 shown in Figure 143A-B.

FIG. 145 shows the nucleotide sequence of native sequence PRO1418 (UNQ732) cDNA (SEQ ID NO: 264). SEQ ID NO: 264 is "D
NA68864-1629 ". Start and stop codons are shown in bold and underlined font.

[FIG. 146] This shows the amino acid sequence (SEQ ID NO: 265) derived from the coding sequence of SEQ ID NO: 264 shown in FIG.

[Fig. 147] This shows the nucleotide sequence of the native sequence PRO1472 (UNQ744) cDNA (SEQ ID NO: 266). SEQ ID NO: 266 is where "D
NA68866-1644 ". Start and stop codons are shown in bold and underlined font.

[FIG. 148] This shows the amino acid sequence (SEQ ID NO: 266) derived from the coding sequence of SEQ ID NO: 266 shown in FIG.

FIG. 149 shows the nucleotide sequence of native sequence PRO1461 (UNQ742) cDNA (SEQ ID NO: 268). SEQ ID NO: 268 is "D
NA68871-1638 ". Start and stop codons are shown in bold and underlined font.

[Figure 150] This shows the amino acid sequence (SEQ ID NO: 269) derived from the coding sequence of SEQ ID NO: 268 shown in Figure 149.

[Figure 151] This shows the nucleotide sequence of the native sequence PRO1410 (UNQ728) cDNA (SEQ ID NO: 270). SEQ ID NO: 270 is here "D
NA68874-1622 ". Start and stop codons are shown in bold and underlined font.

[Figure 152] This shows the amino acid sequence (SEQ ID NO: 271) derived from the coding sequence of SEQ ID NO: 270 shown in Figure 151.

[Fig. 153] This shows the nucleotide sequence of the native sequence PRO1568 (UNQ774) cDNA (SEQ ID NO: 272). SEQ ID NO: 272 is here "D
NA68880-1676 ". Start and stop codons are shown in bold and underlined font.

[FIG. 154] This shows the amino acid sequence (SEQ ID NO: 273) derived from the coding sequence of SEQ ID NO: 272 shown in FIG.

[FIG. 155] This shows the nucleotide sequence of the native sequence PRO1570 (UNQ776) cDNA (SEQ ID NO: 274). SEQ ID NO: 274 is here "D
The clone is designated as NA68885-1678 ". Start and stop codons are shown in bold and underlined font.

[FIG. 156] This shows the amino acid sequence (SEQ ID NO: 275) derived from the coding sequence of SEQ ID NO: 274 shown in FIG.

[Fig. 157] This shows the nucleotide sequence of the native sequence PRO1317 (UNQ783) cDNA (SEQ ID NO: 276). SEQ ID NO: 276 is here "D
It is a clone designated as "NA71166-1685". Start and stop codons are shown in bold and underlined font.

[FIG. 158] This shows the amino acid sequence (SEQ ID NO: 277) derived from the coding sequence of SEQ ID NO: 276 shown in FIG.

[Fig. 159] This shows the nucleotide sequence of the native sequence PRO1780 (UNQ842) cDNA (SEQ ID NO: 281). SEQ ID NO: 281 is "D
NA71169-1709 ". Start and stop codons are shown in bold and underlined font.

[Figure 160] This shows the amino acid sequence (SEQ ID NO: 282) derived from the coding sequence of SEQ ID NO: 281 shown in Figure 159.

[Fig. 161] This shows the nucleotide sequence (SEQ ID NO: 286) of the native sequence PRO1486 (UNQ755) cDNA. SEQ ID NO: 286 is "D
NA71180-1655 ". Start and stop codons are shown in bold and underlined font.

[FIG. 162] This shows the amino acid sequence (SEQ ID NO: 287) derived from the coding sequence of SEQ ID NO: 286 shown in FIG.

[FIG. 163] This shows the nucleotide sequence of the native sequence PRO1433 (UNQ738) cDNA (SEQ ID NO: 291). SEQ ID NO: 291 is "D
The clone is designated as NA71184-1634 ". Start and stop codons are shown in bold and underlined font.

[Figure 164] This shows the amino acid sequence (SEQ ID NO: 292) derived from the coding sequence of SEQ ID NO: 291 shown in Figure 163.

FIG. 165 shows the nucleotide sequence of the native sequence PRO1490 (UNQ759) cDNA (SEQ ID NO: 296). SEQ ID NO: 296 is set forth here as "D
The clone is designated as "NA71213-1659". Start and stop codons are shown in bold and underlined font.

[FIG. 166] This shows the amino acid sequence (SEQ ID NO: 297) derived from the coding sequence of SEQ ID NO: 296 shown in FIG.

[Fig. 167] This shows the nucleotide sequence of the native sequence PRO1482 (UNQ751) cDNA (SEQ ID NO: 301). The sequence number: 301 is "D
NA71234-1651 ". Start and stop codons are shown in bold and underlined font.

[FIG. 168] This shows the amino acid sequence (SEQ ID NO: 302) derived from the coding sequence of SEQ ID NO: 301 shown in FIG.

[FIG. 169] This shows the nucleotide sequence of the native sequence PRO1446 (UNQ740) cDNA (SEQ ID NO: 303). SEQ ID NO: 303 is "D
NA71277-1636 ". Start and stop codons are shown in bold and underlined font.

FIG. 170 shows the amino acid sequence (SEQ ID NO: 304) derived from the coding sequence of SEQ ID NO: 303 shown in FIG.

[FIG. 171] This shows the nucleotide sequence of the native sequence PRO1558 (UNQ766) cDNA (SEQ ID NO: 305). SEQ ID NO: 305 is "D
It is a clone designated as "NA71282-1668". Start and stop codons are shown in bold and underlined font.

[FIG. 172] This shows the amino acid sequence (SEQ ID NO: 306) derived from the coding sequence of SEQ ID NO: 305 shown in FIG.

[Fig. 173] This shows the nucleotide sequence (SEQ ID NO: 307) of the native sequence PRO1604 (UNQ785) cDNA. SEQ ID NO: 307 is "D
NA71286-1687 ". Start and stop codons are shown in bold and underlined font.

[Figure 174] This shows the amino acid sequence (SEQ ID NO: 308) derived from the coding sequence of SEQ ID NO: 307 shown in Figure 173.

[FIG. 175] This shows the nucleotide sequence of the native sequence PRO1491 (UNQ760) cDNA (SEQ ID NO: 309). SEQ ID NO: 309 is "D
It is a clone designated as NA71883-1660 ". Start and stop codons are shown in bold and underlined font.

[FIG. 176] This shows the amino acid sequence (SEQ ID NO: 310) derived from the coding sequence of SEQ ID NO: 309 shown in FIG.

[Fig. 177] This shows the nucleotide sequence of the native sequence PRO1431 (UNQ737) cDNA (SEQ ID NO: 314). SEQ ID NO: 314 is "D
NA73401-1633 ". Start and stop codons are shown in bold and underlined font.

[FIG. 178] This shows the amino acid sequence (SEQ ID NO: 315) derived from the coding sequence of SEQ ID NO: 314 shown in FIG.

[Fig179A-B] Natural sequence PRO1563 (UNQ769) cDN
1 shows the nucleotide sequence of A (SEQ ID NO: 316). SEQ ID NO: 316 is the clone designated herein "DNA73792-1671". Start and stop codons are shown in bold and underlined font.

[Figure 180] This shows the amino acid sequence (SEQ ID NO: 317) derived from the coding sequence of SEQ ID NO: 316 shown in Figure 179A-B3.

[FIG. 181] This shows the nucleotide sequence of the native sequence PRO1565 (UNQ771) cDNA (SEQ ID NO: 321). SEQ ID NO: 321 is "D
It is a clone designated as "NA73727-1673". Start and stop codons are shown in bold and underlined font.

[FIG. 182] This shows the amino acid sequence (SEQ ID NO: 322) derived from the coding sequence of SEQ ID NO: 321 shown in FIG.

[Fig. 183] This shows the nucleotide sequence of the native sequence PRO1571 (UNQ777) cDNA (SEQ ID NO: 323). SEQ ID NO: 323 is "D
NA73730-1679 ". Start and stop codons are shown in bold and underlined font.

[Figure 184] This shows the amino acid sequence (SEQ ID NO: 324) derived from the coding sequence of SEQ ID NO: 323 shown in Figure 183.

[FIG. 185] This shows the nucleotide sequence of the native sequence PRO1572 (UNQ778) cDNA (SEQ ID NO: 325). SEQ ID NO: 325 is "D
It is a clone designated as "NA73734-1680". Start and stop codons are shown in bold and underlined font.

[FIG. 186] This shows the amino acid sequence (SEQ ID NO: 326) derived from the coding sequence of SEQ ID NO: 325 shown in FIG.

[Fig. 187] This shows the nucleotide sequence of the native sequence PRO1573 (UNQ779) cDNA (SEQ ID NO: 327). SEQ ID NO: 327 is "D
NA73735-1681 ". Start and stop codons are shown in bold and underlined font.

[Figure 188] This shows the amino acid sequence (SEQ ID NO: 328) derived from the coding sequence of SEQ ID NO: 327 shown in Figure 187.

Figure 189 shows the nucleotide sequence of native sequence PRO1488 (UNQ757) cDNA (SEQ ID NO: 329). SEQ ID NO: 329 is "D
It is a clone designated as "NA73736-1657". Start and stop codons are shown in bold and underlined font.

[Figure 190] This shows the amino acid sequence (SEQ ID NO: 330) derived from the coding sequence of SEQ ID NO: 329 shown in Figure 189.

[Fig. 191] This shows the nucleotide sequence of the native sequence PRO1489 (UNQ758) cDNA (SEQ ID NO: 331). SEQ ID NO: 331 is here "D
It is a clone designated as "NA73737-1658". Start and stop codons are shown in bold and underlined font.

[Figure 192] This shows the amino acid sequence (SEQ ID NO: 332) derived from the coding sequence of SEQ ID NO: 331 shown in Figure 191.

[Fig. 193] This shows the nucleotide sequence of the native sequence PRO1474 (UNQ745) cDNA (SEQ ID NO: 333). SEQ ID NO: 333 is "D
NA73739-1645 ". Start and stop codons are shown in bold and underlined font.

[FIG. 194] This shows the amino acid sequence (SEQ ID NO: 334) derived from the coding sequence of SEQ ID NO: 333 shown in FIG.

FIG. 195 shows the nucleotide sequence of the native sequence PRO1508 (UNQ761) cDNA (SEQ ID NO: 335). SEQ ID NO: 335 is "D
A clone designated as "NA7374-21662". Start and stop codons are shown in bold and underlined font.

[FIG. 196] This shows the amino acid sequence (SEQ ID NO: 336) derived from the coding sequence of SEQ ID NO: 335 shown in FIG.

FIG. 197 shows the nucleotide sequence of the native sequence PRO1555 (UNQ763) cDNA (SEQ ID NO: 337). SEQ ID NO: 337 is here "D
It is a clone designated as "NA73744-1665". Start and stop codons are shown in bold and underlined font.

[Figure 198] This shows the amino acid sequence (SEQ ID NO: 338) derived from the coding sequence of SEQ ID NO: 337 shown in Figure 197.

FIG. 199 shows the nucleotide sequence of the native sequence PRO1485 (UNQ754) cDNA (SEQ ID NO: 339). SEQ ID NO: 339 is "D
NA73746-1654 ". Start and stop codons are shown in bold and underlined font.

[FIG. 200] This shows the amino acid sequence (SEQ ID NO: 340) derived from the coding sequence of SEQ ID NO: 339 shown in FIG.

Figure 201 shows the nucleotide sequence of the native sequence PRO1564 (UNQ770) cDNA (SEQ ID NO: 346). SEQ ID NO: 346 is "D
It is a clone designated as "NA73760-1672". Start and stop codons are shown in bold and underlined font.

[Figure 202] This shows the amino acid sequence (SEQ ID NO: 347) derived from the coding sequence of SEQ ID NO: 346 shown in Figure 201.

[Figure 203] This shows the nucleotide sequence of the native sequence PRO1755 (UNQ828) cDNA (SEQ ID NO: 351). SEQ ID NO: 351 is "D
NA76396-1698 ". Start and stop codons are shown in bold and underlined font.

[Figure 204] This shows the amino acid sequence (SEQ ID NO: 352) derived from the coding sequence of SEQ ID NO: 351 shown in Figure 203.

Figure 205 shows the nucleotide sequence of the native sequence PRO1757 (UNQ830) cDNA (SEQ ID NO: 353). SEQ ID NO: 353 is "D
NA76398-1699 ". Start and stop codons are shown in bold and underlined font.

[Figure 206] This shows the amino acid sequence (SEQ ID NO: 354) derived from the coding sequence of SEQ ID NO: 353 shown in Figure 205.

Figure 207 shows the nucleotide sequence of native sequence PRO1758 (UNQ831) cDNA (SEQ ID NO: 355). SEQ ID NO: 355 is "D
NA76399-1700 ". Start and stop codons are shown in bold and underlined font.

[Figure 208] This shows the amino acid sequence (SEQ ID NO: 356) derived from the coding sequence of SEQ ID NO: 355 shown in Figure 207.

FIG. 209 shows the nucleotide sequence of the native sequence PRO1575 (UNQ781) cDNA (SEQ ID NO: 357). SEQ ID NO: 357 is "D
NA76401-1683 ". Start and stop codons are shown in bold and underlined font.

FIG. 210 shows the amino acid sequence (SEQ ID NO: 358) derived from the coding sequence of SEQ ID NO: 357 shown in FIG.

FIG. 211 shows the nucleotide sequence of native sequence PRO1787 (UNQ849) cDNA (SEQ ID NO: 363). SEQ ID NO: 363 is "D
NA76510-2504 ". Start and stop codons are shown in bold and underlined font.

[Figure 212] This shows the amino acid sequence (SEQ ID NO: 364) derived from the coding sequence of SEQ ID NO: 363 shown in Figure 211.

[Fig. 213] This shows the nucleotide sequence of the native sequence PRO1781 (UNQ843) cDNA (SEQ ID NO: 365). SEQ ID NO: 365 is "D
It is a clone named "NA76522-2500". Start and stop codons are shown in bold and underlined font.

[Figure 214] This shows the amino acid sequence (SEQ ID NO: 366) derived from the coding sequence of SEQ ID NO: 365 shown in Figure 213.

[Fig. 215] This shows the nucleotide sequence of the native sequence PRO1556 (UNQ764) cDNA (SEQ ID NO: 371). SEQ ID NO: 371 is here "D
NA76529-1666 ". Start and stop codons are shown in bold and underlined font.

[FIG. 216] This shows the amino acid sequence (SEQ ID NO: 372) derived from the coding sequence of SEQ ID NO: 371 shown in FIG.

[Fig. 217] This shows the nucleotide sequence of the native sequence PRO1759 (UNQ832) cDNA (SEQ ID NO: 373). SEQ ID NO: 373 is "D
NA76531-1701 ". Start and stop codons are shown in bold and underlined font.

[FIG. 218] This shows the amino acid sequence (SEQ ID NO: 374) derived from the coding sequence of SEQ ID NO: 373 shown in FIG.

[Figure 219] This shows the nucleotide sequence of the native sequence PRO1760 (UNQ833) cDNA (SEQ ID NO: 375). SEQ ID NO: 375 is here "D
NA76532-1702 ". Start and stop codons are shown in bold and underlined font.

[Figure 220] This shows the amino acid sequence (SEQ ID NO: 376) derived from the coding sequence of SEQ ID NO: 375 shown in Figure 219.

[Figure 221] This shows the nucleotide sequence of the native sequence PRO1561 (UNQ768) cDNA (SEQ ID NO: 377). SEQ ID NO: 377 is here "D
NA76538-1670 ". Start and stop codons are shown in bold and underlined font.

[Figure 222] This shows the amino acid sequence (SEQ ID NO: 378) derived from the coding sequence of SEQ ID NO: 377 shown in Figure 221.

Figure 223 shows the nucleotide sequence (SEQ ID NO: 382) of the native sequence PRO1567 (UNQ773) cDNA. SEQ ID NO: 382 is "D
NA76541-1675 ". Start and stop codons are shown in bold and underlined font.

[FIG. 224] This shows the amino acid sequence (SEQ ID NO: 383) derived from the coding sequence of SEQ ID NO: 382 shown in FIG.

[Figure 225] This shows the nucleotide sequence of the native sequence PRO1693 (UNQ803) cDNA (SEQ ID NO: 384). SEQ ID NO: 384 is "D
NA77301-1693 ". Start and stop codons are shown in bold and underlined font.

[Figure 226] This shows the amino acid sequence (SEQ ID NO: 385) derived from the coding sequence of SEQ ID NO: 384 shown in Figure 225.

Figure 227 shows the nucleotide sequence of native sequence PRO1784 (UNQ846) cDNA (SEQ ID NO: 389). SEQ ID NO: 389 is "D
NA77303-2502 ". Start and stop codons are shown in bold and underlined font.

[FIG. 228] This shows the amino acid sequence (SEQ ID NO: 390) derived from the coding sequence of SEQ ID NO: 389 shown in FIG.

Figure 229 shows the nucleotide sequence of the native sequence PRO1605 (UNQ786) cDNA (SEQ ID NO: 394). SEQ ID NO: 394 is "D
NA77648-1688 ". Start and stop codons are shown in bold and underlined font.

[Figure 230] This shows the amino acid sequence (SEQ ID NO: 395) derived from the coding sequence of SEQ ID NO: 394 shown in Figure 229.

Figure 231 shows the nucleotide sequence of native sequence PRO1788 (UNQ850) cDNA (SEQ ID NO: 396). SEQ ID NO: 396 is "D
It is a clone designated as "NA77652-2505". Start and stop codons are shown in bold and underlined font.

[FIG. 232] This shows the amino acid sequence (SEQ ID NO: 397) derived from the coding sequence of SEQ ID NO: 396 shown in FIG.

[FIG. 233] This shows the nucleotide sequence of the native sequence PRO1801 (UNQ852) cDNA (SEQ ID NO: 401). SEQ ID NO: 401 is "D
NA83500-2506 ". Start and stop codons are shown in bold and underlined font.

[FIG. 234] This shows the amino acid sequence (SEQ ID NO: 402) derived from the coding sequence of SEQ ID NO: 401 shown in FIG.

Figure 235 shows the nucleotide sequence of native sequence UCP4 cDNA (SEQ ID NO: 405). SEQ ID NO: 405 is set forth herein as "DNA77568-162.
6 ”is a clone named. Start and stop codons are shown in bold and underlined font.

[FIG. 236] This shows the amino acid sequence (SEQ ID NO: 406) derived from the coding sequence of SEQ ID NO: 405 shown in FIG.

Figure 237 shows the nucleotide sequence of native sequence PRO193 cDNA (SEQ ID NO: 409). SEQ ID NO: 409 is set forth herein as "DNA23322-1.
393 ". Start and stop codons are shown in bold and underlined font.

[Figure 238] This shows the amino acid sequence (SEQ ID NO: 410) derived from the coding sequence of SEQ ID NO: 409 shown in Figure 237.

[FIG. 239] Nucleotide sequence of native sequence PRO1130 cDNA (
SEQ ID NO: 414) is shown. SEQ ID NO: 414 is set forth herein as "DNA59814-
1486 ”. Start and stop codons are shown in bold and underlined font.

[FIG. 240] This shows the amino acid sequence (SEQ ID NO: 415) derived from the coding sequence of SEQ ID NO: 414 shown in FIG.

[FIG. 241] Nucleotide sequence of native sequence PRO1335 cDNA (
SEQ ID NO: 422) is shown. SEQ ID NO: 422 is set forth herein as "DNA62812-
1594 ”. Start and stop codons are shown in bold and underlined font.

[Figure 242] This shows the amino acid sequence (SEQ ID NO: 423) derived from the coding sequence of SEQ ID NO: 422 shown in Figure 241.

[Fig. 243] Nucleotide sequence of native sequence PRO1329 cDNA (
SEQ ID NO: 428) is shown. SEQ ID NO: 428 is set forth herein as "DNA66660-
1585 ". Start and stop codons are shown in bold and underlined font.

[Figure 244] This shows the amino acid sequence (SEQ ID NO: 429) derived from the coding sequence of SEQ ID NO: 428 shown in Figure 243.

[FIG. 245] Nucleotide sequence of native sequence PRO1550 cDNA (
SEQ ID NO: 430) is shown. SEQ ID NO: 430 is set forth herein as "DNA76393-
1664 ". Start and stop codons are shown in bold and underlined font.

[Figure 246] This shows the amino acid sequence (SEQ ID NO: 431) derived from the coding sequence of SEQ ID NO: 430 shown in Figure 245.

[Figure 247A-D] A hypothetical illustration using the following method to determine% amino acid sequence identity (Fig. 274A-B) and% nucleic acid sequence identity (Fig. 247C-D) using the ALIGN-2 sequence alignment computer program. "PRO" indicates the amino acid sequence of the hypothetical PEACH polypeptide of interest, "Comparative protein" indicates the amino acid sequence of the polypeptide to which the "PRO" polypeptide of interest is compared, and "PRO-DNA Is the target hypothetical PEAC
“H” -encoding nucleic acid sequence, “Comparative DNA” indicates the nucleotide sequence of the nucleic acid molecule to which the “PRO-DNA” nucleic acid molecule of interest is compared, “X”, “Y” and “
“Z” indicates different hypothetical amino acid residues, and “N”, “L”, and “V” indicate different hypothetical nucleotides.

FIG. 248A-D provides the complete source code for the ALIGN-2 sequence comparison computer program. This source code is routinely compiled for use with the UNIX operating system to give the ALIGN-2 sequence comparison computer program.

[Procedure for Amendment] Submission for translation of Article 34 Amendment of Patent Cooperation Treaty

[Submission date] June 14, 2000 (2000.6.14)

[Procedure Amendment 1]

[Document name to be amended] Statement

[Name of item to be amended] Claims

[Correction method] Change

[Contents of correction]

[Claims]

[Procedure Amendment 2]

[Document name to be amended] Statement

[Name of item to be corrected] 0354

[Correction method] Change

[Contents of correction]

123. PRO1550 In this application, a cDNA clone (DNA76393-1664) has been identified, designated "PRO1550" and encoding a novel secreted polypeptide. In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1550 polypeptide. In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1550 polypeptide having amino acid residue 1 of Figure 246 (SEQ ID NO: 232 ) or a sequence of about 31 to about 243, or (b) ( at least about 80% sequence identity, preferably at least about 85% sequence identity to the complement of the DNA molecule of a),
More preferably it comprises DNA having at least about 90% sequence identity, and most preferably at least about 95% sequence identity. In another aspect, the invention features about residue 228 of Figure 245 (SEQ ID NO: 231 ).
PRO1550 containing DNA that hybridizes to the complement of about 866 to about 866 nucleic acids
It relates to an isolated nucleic acid molecule encoding a polypeptide. Preferably, hybridization occurs under stringent hybridization and wash conditions. In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by the human protein cDNA (DNA76393-1664) of ATCC Deposit No. 203323, or (b) the complement of the DNA molecule of (a). To at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. To an isolated nucleic acid molecule comprising: In a preferred embodiment, the nucleic acid comprises a DNA encoding the same mature polypeptide encoded by the human protein cDNA in ATCC Deposit No. 203323 (DNA76393-1664).

[Procedure 3]

[Document name to be amended] Statement

[Name of item to be corrected] 0355

[Correction method] Change

[Contents of correction]

In a still further aspect, the invention provides (a) at least about 80% sequence identity, preferably at least about 85% sequence identity to the sequence of amino acid residues from about 31 to about 243 of Figure 246 (SEQ ID NO: 232 ). Sequence identity, more preferably at least about 90%
To a DNA encoding a polypeptide having sequence identity of, most preferably at least about 95% sequence identity, or (b) an isolated nucleic acid molecule comprising the complement of the DNA molecule of (a). In a further aspect, the invention provides a test DNA molecule comprising: (a) PRO155 having the sequence of amino acid residues from about 31 to about 243 of Figure 246 (SEQ ID NO: 232 ).
At least about 80 relative to (a) or (b) by hybridizing under stringent conditions with a DNA molecule encoding the 0 polypeptide, or (b) the complement of the DNA molecule of (a). Isolate a test DNA molecule if it has a% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. Produced by at least about 50 nucleotides, preferably at least about 100 nucleotides
It relates to an isolated nucleic acid molecule having nucleotides. In a particular aspect, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1550 polypeptide with or without an N-terminal signal sequence and / or an initiation methionine, or such a code. A complementary nucleic acid molecule. The signal peptide has been tentatively identified as extending from amino acid position 1 to about amino acid position 30 of Figure 246 (SEQ ID NO: 232 ). In another aspect, the invention provides (a) residue 31 of Figure 246 (SEQ ID NO: 232 ).
To at least about 80% positive when compared to the amino acid sequence of about 243,
Preferably at least about 85% positive, more preferably at least about 90%
A DNA molecule encoding a polypeptide positive, most preferably at least about 95% positive, or an isolated nucleic acid molecule comprising (b) (a) the complement of the DNA molecule. Another embodiment is a PR that finds use as a hybridization probe.
It relates to fragments of the O1550 polypeptide coding sequence. Such a nucleic acid fragment is
It is about 20 to about 80 nucleotides long, preferably about 20 to about 60 nucleotides long, more preferably about 20 to about 50 nucleotides long, and most preferably about 20 to about 40 nucleotides long. In another embodiment, the invention provides an isolated PRO1550 polypeptide encoded by any of the isolated nucleic acid sequences identified above. In a particular aspect, the invention provides an isolated native sequence PRO1550 polypeptide, which in one embodiment comprises an amino acid sequence comprising residues 31 to 243 of Figure 246 (SEQ ID NO: 232 ).

[Procedure amendment 4]

[Document name to be amended] Statement

[Name of item to be corrected] 0356

[Correction method] Change

[Contents of correction]

In another aspect, the invention features amino acid residue 3 of Figure 246 (SEQ ID NO: 232 ).
1 to about 243 sequences, at least about 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90%.
Of PRO1550 polypeptides comprising an amino acid sequence having sequence identity of, most preferably at least about 95% sequence identity. In a further aspect, the invention provides at least about 80% positive, preferably at least about 85% positive, more preferably at least about 90% positive when compared to the amino acid sequence of residues 31 to 243 of Figure 246 (SEQ ID NO: 232 ). It relates to an isolated PRO1550 polypeptide comprising an amino acid sequence with a positive, most preferably at least about 95% positive score. In a still further aspect, the invention provides an isolated sequence comprising the sequence of amino acid residues 31 to about 243 of Figure 246 (SEQ ID NO: 232 ), or a fragment thereof sufficient to bind an anti-PRO1550 antibody. It relates to PRO1550 polypeptides.
Preferably, the PRO1550 fragment retains the qualitative biological activity of the native PRO1550 polypeptide. In a still further aspect, the invention provides (i) a test DNA molecule, (a) Fig2
PR having a sequence of about 31 to about 243 amino acid residues of 46 (SEQ ID NO: 431)
A DNA molecule encoding the O1550 polypeptide, or (b) a complement of the DNA molecule of (a), is hybridized under stringent conditions such that the test DNA molecule is at least about (Ii) testing if it has 80% sequence identity, preferably at least about 85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95% sequence identity. DNA
A host cell containing the molecule is cultured under conditions suitable for expression of the polypeptide, and (i
ii) Providing the polypeptide produced by recovering the polypeptide from the cell culture medium.

[Procedure Amendment 5]

[Document name to be amended] Statement

[Name of item to be corrected] 0467

[Correction method] Change

[Contents of correction]

Example 16: Isolation of a cDNA clone encoding human PRO1189 The cDNA sequence isolated by the amylase screen described in Example 2 above is herein designated DNA41784. The DNA41784 sequence is then translated into public databases (eg GenBank) and corporate EST DNA databases (LIFES
Existing homology was identified by comparison with various expressed sequence tag (EST) databases, including EQ (trade name), Incyte Pharmaceuticals, Palo Alto, CA). The homology search is performed by the computer program BLAST or BLAST2 (Altschul et al., Methods in Enzy.
mology 266: 460-480 (1996)). A comparison that does not encode a known protein and has a BLAST score of 70 (sometimes 90) or higher is the program "phrap" (Phil Green, University of Washington, Seattle, Washingt.
on) to build a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated DNA45499. Oligonucleotide probes were made based on the DNA45499 sequence and used to screen a human bone marrow library prepared as described in paragraph 1 of Example 2 above. The cloning vector is pRK5B (pRK5B is a precursor of pRK5D that does not contain an SfiI site; Holmes et al., Science, 253:
1278-1280 (1991)), the size of the cleaved cDNA was less than 2800 bp. PCR primers (forward and reverse) were synthesized: Forward PCR primer (45499.f1): 5'-GAAAGACACGACACAGCAGCTTGC-3 '(SEQ ID NO: 44) Forward PCR primer (45499.f2): 5'-GGGAACTGCTATCTGATGCC-3 '(SEQ ID NO: 45) Forward PCR primer (45499.f3): 5'-CAGGATCTCCTCTTGCAGTCTGCAGC-3' (SEQ ID NO: 46) Reverse PCR primer (45499.r1): 5'-CTTCTCGAACCACATAAGTTTGAGGCAG-3 '(
SEQ ID NO: 47) Reverse PCR primer (45499.r2): 5'-CACGATTCCCTCCACAGCAACTGGG-3 '(SEQ ID NO: 48) Further, a synthetic oligonucleotide hybridization probe was prepared from the DNA45499 sequence having the following nucleotide sequence. Hybridization probe (45499.p1): 5'-CGCCTTACCGCGCAGCCCGAAGATTCACTATGGTGAAAATCGCCTTCAAT-3 '(SEQ ID NO: 230)
3.) To screen several libraries for a source of full length clones, DNA from the libraries was PCR amplified with the PCR primer pair identified above. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate clones encoding the PRO1189 gene with one of the primer pairs. A full-length clone was identified, containing a single open reading frame, with an apparent translational initiation site at nucleotide positions 79-81 and a stop codon at nucleotide positions 868-870 (Fig25; SEQ ID NO: 42). The predicted polypeptide precursor is 263 amino acids long, has a calculated molecular weight of approximately 29,741 daltons and an estimated pI of approximately 5.74. Additional features include a Type II transmembrane domain at about amino acids 53-75 and a potential N-glycosylation site at about amino acids 166-169. The Dayhoff database (version 35.45 Swis) using WU-BLAST-2 sequence alignment analysis of the full length sequence shown in FIG. 26 (SEQ ID NO: 43).
sProt 35) analysis revealed that the PRO1189 amino acid sequence and the following Dayhoff sequence: F
Significant homology was demonstrated between 017985_1, CBRG01D9_2, I79662, and CHPDRBAG_1. Clone DNA58828-1519 has been deposited with the ATCC and is assigned ATCC deposit no. 203172.

[Procedure correction 6]

[Document name to be amended] Statement

[Name of item to be corrected] 0519

[Correction method] Change

[Contents of correction]

Example 69: Isolation of a cDNA clone encoding human PRO1340 Using the method described in Example 1 Incyte EST number 878906 as a sequence of interest that does not encode a known protein and has a BLAST score of 70 or higher. Identified. The nucleotide sequence of EST No. 878906 and its complementary sequence are shown here as "
DNA42809 ". 1) PCR based on the DNA42809 sequence
To identify a cDNA library containing the sequence of interest, and 2) PR
Oligonucleotides were synthesized for use as probes to isolate clones of the O1340 full length coding sequence. PCR primers (forward and reverse) were synthesized: Forward PCR primer TCCAGGTGGACCCCACTTCAGG (42809.f1; SEQ ID NO: 430 )
Reverse PCR primer GGGAGGCTTATAGGCCCAATCTGG (42809.r1; SEQ ID NO: 431 ) Further, a synthetic oligonucleotide hybridization probe was prepared from the consensus DNA42809 sequence having the following nucleotide sequence. Hybridization probe GGCTTCAGCAGCACGTGTGAAGTCGAAGTCGCAGTCACAGATATC
AATGA (42809.p1; SEQ ID NO: 432 ) To screen several libraries for a source of full length clones, DNA from the libraries was PCR amplified with the PCR primer pair identified above. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate a clone encoding the PRO1340 gene with one of the primer pairs. RNA for making a cDNA library was isolated from human fetal kidney tissue. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PRO1340 (designated herein as DNA66663-1598 [Fig131, SEQ ID NO: 228]); and the derived protein sequence for PRO1340. The entire coding sequence of PRO1340 is shown in Figure 131 (SEQ ID NO: 228). Clone DNA66663-1598 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 128-130 and an apparent stop codon at nucleotide positions 2549-2551. The predicted polypeptide precursor is 807 amino acids long. Full length P shown in Fig132
The RO1340 protein has an estimated molecular weight of about 87,614 daltons and about 4.83.
Has a pI of Additional features include a signal peptide of about amino acids 1-18; a transmembrane domain of about amino acids 762-784; a cell attachment sequence of about amino acids 492-494; a potential of about amino acids 517-520, 602-605 and 700-703.
N-glycosylation site; and about amino acids 307-351, 324-348, 67-
It contains the cadherin extracellular repeat domains of 103, 97-141 and 114-138. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 132 (SEQ ID NO: 229) and the amino acid sequence of PRO1340 and Dayhof.
f Significant homology was revealed between SEQ ID NO: I46536. Homology is also PRO1
340 amino acid sequence and the following Dayhoff sequence: S55396, RATPDRPT_1, CADD_CHICK, CAD
Clarified between 1_CHICK, CADB_CHICK, I50180, CAD4_CHICK, G02878, and DSC1_MOUSE. Clone DNA66663-1598 has been deposited with the ATCC and is assigned ATCC deposit no.

[Procedure Amendment 7]

[Document name to be amended] Statement

[Correction item name] 0572

[Correction method] Change

[Contents of correction]

Example 126: Isolation of a cDNA clone encoding human PRO1550 By using the signal sequence algorithm described in Example 3 above, CELT
Mercc, which is named 15B7_12 and is also called "DNA10022" here
It was possible to identify EST sequences from the k database. This EST sequence is then converted into public and corporate EST databases (eg GenBank and LIFESEQ (trade name)).
Existing homology was identified by comparison with various expressed sequence tag (EST) databases, including The homology search is performed by the computer program BLAST or BLAST2 (Altsc
hul et al., Methods in Enzymology 266: 460-480 (1996)). Comparables that do not encode a known protein and have a BLAST score of 70 (sometimes 90) or higher are those of the program "phrap" (Phil Green, University of Washing
ton, Seattle, Washington) to construct a consensus DNA sequence.
The consensus sequence obtained therefrom is herein designated "DNA55708". In view of the sequence homology between the DNA55708 sequence and the sequence contained in Incyte EST clone no. 3411659, EST clone no. 3411659.
Was purchased and the cDNA insert was obtained and sequenced. The sequence of this cDNA insert is F
ig245 and designated herein as "DNA76393-1664." The full-length clone shown in Figure 245 contains a single open reading frame, has an apparent translational initiation site at nucleotide positions 138-140, and terminates at the stop codon found at nucleotide positions 867-869 (Fig.
245; SEQ ID NO: 231 ). The predicted polypeptide precursor (Fig246,
SEQ ID NO: 232 ) is 243 amino acids long. Other features of the PRO1550 protein include a signal sequence at about amino acids 1-30; a hydrophobic domain at about amino acids 195-217; and a potential N-glycosylation site at about amino acids 186-189. PRO1550 has a calculated molecular weight of approximately 26,266 Daltons and approximately 8.43.
With an estimated pI of Clone DNA76393-1664 was deposited with the ATCC on October 6, 1998 and was assigned ATCC deposit no. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in Figure 246 (SEQ ID NO: 232 ) and the amino acid sequence of PRO1550
Dayhoff array: CELF59E12_11; CA24_ASCSU; AF018082_1; CA13_BOVIN; CA54_HUMA
N; CA34_HUMAN; HUMCOL7A1X_1; P_W09643; AF053538_1; and some homology with HSEMCXIV2_1 was revealed.

[Procedure Amendment 8]

[Document name to be amended] Statement

[Name of item to be corrected] Brief description of the drawing

[Correction method] Change

[Contents of correction]

[Brief description of drawings]

FIG. 1 shows the nucleotide sequence of the native sequence PRO1560 (UNQ767) cDNA (SEQ ID NO: 3). SEQ ID NO: 3 is referred to here as "DNA1990
2-1669 ". Start and stop codons are shown in bold and underlined font.

[Figure 2] This shows the amino acid sequence (SEQ ID NO: 4) derived from the coding sequence of SEQ ID NO: 3 shown in Figure 1.

[Figure 3] This shows the nucleotide sequence of the native sequence PRO444 (UNQ328) cDNA (SEQ ID NO: 5). SEQ ID NO: 5 is referred to here as "DNA26846
-1397 ". Start and stop codons are shown in bold and underlined font.

FIG. 4 shows the amino acid sequence (SEQ ID NO: 6) derived from the coding sequence of SEQ ID NO: 5 shown in FIG.

[Figure 5] Shows the nucleotide sequence of the native sequence PRO1018 (UNQ501) cDNA (SEQ ID NO: 7). SEQ ID NO: 7 is here "DNA5610
It is a clone named "7-1415". Start and stop codons are shown in bold and underlined font.

[Figure 6] This shows the amino acid sequence (SEQ ID NO: 8) derived from the coding sequence of SEQ ID NO: 7 shown in Figure 5.

[Figure 7] This shows the nucleotide sequence (SEQ ID NO: 9) of the native sequence PRO1773 (UNQ835) cDNA. SEQ ID NO: 9 is here "DNA5640
6-1704 ”. Start and stop codons are shown in bold and underlined font.

FIG. 8 shows the amino acid sequence (SEQ ID NO: 10) derived from the coding sequence of SEQ ID NO: 9 shown in FIG.

[Figure 9] This shows the nucleotide sequence (SEQ ID NO: 11) of the native sequence PRO1477 (UNQ747) cDNA. SEQ ID NO: 11 is here "DNA56
529-1647 ". Start and stop codons are shown in bold and underlined font.

FIG. 10 shows the amino acid sequence (SEQ ID NO: 12) derived from the coding sequence of SEQ ID NO: 11 shown in FIG.

Figure 11 shows the nucleotide sequence of the native sequence PRO1478 (UNQ748) cDNA (SEQ ID NO: 16). SEQ ID NO: 16 is here "DNA5
6531-1648 ". Start and stop codons are shown in bold and underlined font.

[Figure 12] This shows the amino acid sequence (SEQ ID NO: 17) derived from the coding sequence of SEQ ID NO: 16 shown in Figure 11.

[Figure 13] This shows the nucleotide sequence of the native sequence PRO831 (UNQ471) cDNA (SEQ ID NO: 21). SEQ ID NO: 21 is here "DNA56
862-1343 ". Start and stop codons are shown in bold and underlined font.

[Figure 14] This shows the amino acid sequence (SEQ ID NO: 22) derived from the coding sequence of SEQ ID NO: 21 shown in Figure 13.

FIG. 15 shows the nucleotide sequence (SEQ ID NO: 23) of the native sequence PRO1113 (UNQ556) cDNA. SEQ ID NO: 23 is here "DNA5
7254 to 1477 ”. Start and stop codons are shown in bold and underlined font.

[Figure 16] This shows the amino acid sequence (SEQ ID NO: 24) derived from the coding sequence of SEQ ID NO: 23 shown in Figure 15.

[Figure 17] This shows the nucleotide sequence (SEQ ID NO: 28) of the native sequence PRO1194 (UNQ607) cDNA. SEQ ID NO: 28 is here "DNA5
This is a clone designated "7841-1522". Start and stop codons are shown in bold and underlined font.

FIG. 18 shows the amino acid sequence (SEQ ID NO: 29) derived from the coding sequence of SEQ ID NO: 28 shown in FIG.

Figure 19 shows the nucleotide sequence (SEQ ID NO: 30) of the native sequence PRO1110 (UNQ553) cDNA. SEQ ID NO: 30 is here "DNA5
8727-1474 ". Start and stop codons are shown in bold and underlined font.

FIG. 20 shows the amino acid sequence (SEQ ID NO: 31) derived from the coding sequence of SEQ ID NO: 30 shown in FIG.

[Figure 21] This shows the nucleotide sequence of the native sequence PRO1378 (UNQ715) cDNA (SEQ ID NO: 32). SEQ ID NO: 32 is here "DNA5
8730-1607 ". Start and stop codons are shown in bold and underlined font.

[Figure 22] This shows the amino acid sequence (SEQ ID NO: 33) derived from the coding sequence of SEQ ID NO: 32 shown in Figure 21.

Figure 23 shows the nucleotide sequence of the native sequence PRO1481 (UNQ750) cDNA (SEQ ID NO: 40). SEQ ID NO: 40 is here "DNA5
8732-1650 ". Start and stop codons are shown in bold and underlined font.

[Figure 24] This shows the amino acid sequence (SEQ ID NO: 41) derived from the coding sequence of SEQ ID NO: 40 shown in Figure 23.

[Figure 25] This shows the nucleotide sequence of the native sequence PRO1189 (UNQ603) cDNA (SEQ ID NO: 42). SEQ ID NO: 42 is here "DNA5
8828-1519 ". Start and stop codons are shown in bold and underlined font.

[Figure 26] This shows the amino acid sequence (SEQ ID NO: 43) derived from the coding sequence of SEQ ID NO: 42 shown in Figure 25.

[Figure 27] This shows the nucleotide sequence (SEQ ID NO: 49) of the native sequence PRO1415 (UNQ731) cDNA. SEQ ID NO: 49 is here "DNA5
8852-1637 ". Start and stop codons are shown in bold and underlined font.

FIG. 28 shows the amino acid sequence (SEQ ID NO: 50) derived from the coding sequence of SEQ ID NO: 49 shown in FIG.

[Figure 29] This shows the nucleotide sequence of the native sequence PRO1411 (UNQ729) cDNA (SEQ ID NO: 51). SEQ ID NO: 51 is here "DNA5
9212-1627 ". Start and stop codons are shown in bold and underlined font.

[Figure 30] This shows the amino acid sequence (SEQ ID NO: 52) derived from the coding sequence of SEQ ID NO: 51 shown in Figure 29.

Figure 31 shows the nucleotide sequence (SEQ ID NO: 53) of the native sequence PRO1295 (UNQ664) cDNA. SEQ ID NO: 53 is here "DNA5
9218-1559 ". Start and stop codons are shown in bold and underlined font.

[Figure 32] This shows the amino acid sequence (SEQ ID NO: 54) derived from the coding sequence of SEQ ID NO: 53 shown in Figure 31.

Figure 33 shows the nucleotide sequence of the native sequence PRO1359 (UNQ708) cDNA (SEQ ID NO: 55). SEQ ID NO: 55 is here "DNA5
9219-1613 ". Start and stop codons are shown in bold and underlined font.

[Figure 34] This shows the amino acid sequence (SEQ ID NO: 56) derived from the coding sequence of SEQ ID NO: 55 shown in Figure 33.

[Figure 35] This shows the nucleotide sequence of the native sequence PRO1190 (UNQ604) cDNA (SEQ ID NO: 57). SEQ ID NO: 57 is here "DNA5
9586-1520 ". Start and stop codons are shown in bold and underlined font.

[Figure 36] This shows the amino acid sequence (SEQ ID NO: 58) derived from the coding sequence of SEQ ID NO: 57 shown in Figure 35.

Figure 37 shows the nucleotide sequence (SEQ ID NO: 62) of the native sequence PRO1772 (UNQ834) cDNA. SEQ ID NO: 62 is here "DNA5
9817-1703 ". Start and stop codons are shown in bold and underlined font.

[Figure 38] This shows the amino acid sequence (SEQ ID NO: 63) derived from the coding sequence of SEQ ID NO: 62 shown in Figure 37.

[Figure 39] This shows the nucleotide sequence (SEQ ID NO: 67) of a native sequence PRO1248 (UNQ631) cDNA. SEQ ID NO: 67 is here "DNA6
It is a clone designated as "0278-1530". Start and stop codons are shown in bold and underlined font.

[Figure 40] This shows the amino acid sequence (SEQ ID NO: 68) derived from the coding sequence of SEQ ID NO: 67 shown in Figure 39.

[Figure 41] This shows the nucleotide sequence of the native sequence PRO1316 (UNQ682) cDNA (SEQ ID NO: 69). SEQ ID NO: 69 is here "DNA6
It is a clone named "0608-1577". Start and stop codons are shown in bold and underlined font.

[Figure 42] This shows the amino acid sequence (SEQ ID NO: 70) derived from the coding sequence of SEQ ID NO: 69 shown in Figure 41.

[Figure 43] This shows the nucleotide sequence of the native sequence PRO1197 (UNQ610) cDNA (SEQ ID NO: 71). SEQ ID NO: 71 is here "DNA6
0611-1524 ". Start and stop codons are shown in bold and underlined font.

[Figure 44] This shows the amino acid sequence (SEQ ID NO: 72) derived from the coding sequence of SEQ ID NO: 71 shown in Figure 43.

[Figure 45] This shows the nucleotide sequence of the native sequence PRO1293 (UNQ662) cDNA (SEQ ID NO: 76). SEQ ID NO: 76 is here "DNA6
0618-1557 ". Start and stop codons are shown in bold and underlined font.

[Figure 46] This shows the amino acid sequence (SEQ ID NO: 77) derived from the coding sequence of SEQ ID NO: 76 shown in Figure 45.

[Figure 47] This shows the nucleotide sequence (SEQ ID NO: 78) of the native sequence PRO1380 (UNQ717) cDNA. SEQ ID NO: 78 is here "DNA6
0740-1615 ". Start and stop codons are shown in bold and underlined font.

[Figure 48] This shows the amino acid sequence (SEQ ID NO: 79) derived from the coding sequence of SEQ ID NO: 78 shown in Figure 47.

Figure 49 shows the nucleotide sequence (SEQ ID NO: 83) of the native sequence PRO1265 (UNQ636) cDNA. SEQ ID NO: 83 is here "DNA6
0764-1533 ". Start and stop codons are shown in bold and underlined font.

FIG. 50 shows the amino acid sequence (SEQ ID NO: 84) derived from the coding sequence of SEQ ID NO: 83 shown in FIG.

[Figure 51] This shows the nucleotide sequence of the native sequence PRO1250 (UNQ633) cDNA (SEQ ID NO: 85). SEQ ID NO: 85 is here "DNA6
0775-1532 ". Start and stop codons are shown in bold and underlined font.

[Figure 52] This shows the amino acid sequence (SEQ ID NO: 86) derived from the coding sequence of SEQ ID NO: 85 shown in Figure 51.

[Figure 53] This shows the nucleotide sequence of the native sequence PRO1475 (UNQ746) cDNA (SEQ ID NO: 87). SEQ ID NO: 87 is here "DNA6
The clone is designated as "1185-1646". Start and stop codons are shown in bold and underlined font.

[Figure 54] This shows the amino acid sequence (SEQ ID NO: 88) derived from the coding sequence of SEQ ID NO: 87 shown in Figure 53.

[Figure 55] This shows the nucleotide sequence (SEQ ID NO: 94) of the native sequence PRO1377 (UNQ714) cDNA. SEQ ID NO: 94 is here "DNA6
1608-1606 ”. Start and stop codons are shown in bold and underlined font.

[Figure 56] This shows the amino acid sequence (SEQ ID NO: 95) derived from the coding sequence of SEQ ID NO: 94 shown in Figure 55.

Figure 57 shows the nucleotide sequence of the native sequence PRO1326 (UNQ686) cDNA (SEQ ID NO: 99). SEQ ID NO: 99 is here "DNA6
2808-1582 ". Start and stop codons are shown in bold and underlined font.

[Figure 58] This shows the amino acid sequence (SEQ ID NO: 100) derived from the coding sequence of SEQ ID NO: 99 shown in Figure 57.

[Figure 59] This shows the nucleotide sequence (SEQ ID NO: 101) of the native sequence PRO1249 (UNQ632) cDNA. The sequence number: 101 is "DN
It is a clone designated as "A62809-1531". Start and stop codons are shown in bold and underlined font.

[Figure 60] This shows the amino acid sequence (SEQ ID NO: 102) derived from the coding sequence of SEQ ID NO: 101 shown in Figure 59.

[Figure 61] This shows the nucleotide sequence (SEQ ID NO: 103) of a native sequence PRO1315 (UNQ681) cDNA. SEQ ID NO: 103 is "DN
A62815-1578 ". Start and stop codons are shown in bold and underlined font.

[Figure 62] This shows the amino acid sequence (SEQ ID NO: 104) derived from the coding sequence of SEQ ID NO: 103 shown in Figure 61.

[Figure 63] This shows the nucleotide sequence of the native sequence PRO1549 (UNQ782) cDNA (SEQ ID NO: 110). SEQ ID NO: 110 is here "DN
The clone is designated as A62845-1684 ". Start and stop codons are shown in bold and underlined font.

[Figure 64] This shows the amino acid sequence (SEQ ID NO: 111) derived from the coding sequence of SEQ ID NO: 110 shown in Figure 63.

Figure 65 shows the nucleotide sequence (SEQ ID NO: 115) of native sequence PRO1430 (UNQ736) cDNA. SEQ ID NO: 115 is "DN
It is a clone designated as A64842-1632. Start and stop codons are shown in bold and underlined font.

[Figure 66] This shows the amino acid sequence (SEQ ID NO: 116) derived from the coding sequence of SEQ ID NO: 115 shown in Figure 65.

[Figure 67] This shows the nucleotide sequence of the native sequence PRO1374 (UNQ711) cDNA (SEQ ID NO: 117). SEQ ID NO: 107 is here "DN
A clone named A64849-1604 ". Start and stop codons are shown in bold and underlined font.

[Figure 68] This shows the amino acid sequence (SEQ ID NO: 118) derived from the coding sequence of SEQ ID NO: 117 shown in Figure 67.

[Figure 69] This shows the nucleotide sequence (SEQ ID NO: 122) of the native sequence PRO1311 (UNQ677) cDNA. SEQ ID NO: 122 is "DN
A clone named A64863-1573 ". Start and stop codons are shown in bold and underlined font.

[Figure 70] This shows the amino acid sequence (SEQ ID NO: 123) derived from the coding sequence of SEQ ID NO: 122 shown in Figure 69.

[Figure 71] This shows the nucleotide sequence of the native sequence PRO1357 (UNQ706) cDNA (SEQ ID NO: 127). SEQ ID NO: 127 is here "DN
The clone is designated as "A64881-1602". Start and stop codons are shown in bold and underlined font.

[Figure 72] This shows the amino acid sequence (SEQ ID NO: 128) derived from the coding sequence of SEQ ID NO: 127 shown in Figure 71.

Figure 73 shows the nucleotide sequence (SEQ ID NO: 129) of the native sequence PRO1244 (UNQ628) cDNA. SEQ ID NO: 129 is here "DN
A clone designated as A64883-1526 ". Start and stop codons are shown in bold and underlined font.

[Figure 74] This shows the amino acid sequence (SEQ ID NO: 130) derived from the coding sequence of SEQ ID NO: 129 shown in Figure 73.

[Figure 75] This shows the nucleotide sequence (SEQ ID NO: 131) of the native sequence PRO1246 (UNQ630) cDNA. SEQ ID NO: 131 is "DN
It is a clone designated as "A64885-1529". Start and stop codons are shown in bold and underlined font.

[Figure 76] This shows the amino acid sequence (SEQ ID NO: 132) derived from the coding sequence of SEQ ID NO: 131 shown in Figure 75.

Figure 77 shows the nucleotide sequence of the native sequence PRO1356 (UNQ705) cDNA (SEQ ID NO: 133). SEQ ID NO: 133 is "DN
A clone named A64886-1601 ". Start and stop codons are shown in bold and underlined font.

[Figure 78] This shows the amino acid sequence (SEQ ID NO: 134) derived from the coding sequence of SEQ ID NO: 133 shown in Figure 77.

[Figure 79] This shows the nucleotide sequence (SEQ ID NO: 135) of the native sequence PRO1275 (UNQ645) cDNA. SEQ ID NO: 135 is "DN
It is a clone designated as "A64888-1542". Start and stop codons are shown in bold and underlined font.

[Figure 80] This shows the amino acid sequence (SEQ ID NO: 136) derived from the coding sequence of SEQ ID NO: 135 shown in Figure 79.

Figure 81 shows the nucleotide sequence of the native sequence PRO1274 (UNQ644) cDNA (SEQ ID NO: 137). SEQ ID NO: 137 is here "DN
A clone designated as A64889-1542 ". Start and stop codons are shown in bold and underlined font.

[Figure 82] This shows the amino acid sequence (SEQ ID NO: 138) derived from the coding sequence of SEQ ID NO: 137 shown in Figure 80.

FIG. 83 shows the nucleotide sequence of native sequence PRO1412 (UNQ730) cDNA (SEQ ID NO: 139). SEQ ID NO: 139 is here "DN
A 64897-1628 ". Start and stop codons are shown in bold and underlined font.

[Figure 84] This shows the amino acid sequence (SEQ ID NO: 140) derived from the coding sequence of SEQ ID NO: 139 shown in Figure 83.

Figure 85 shows the nucleotide sequence of the native sequence PRO1557 (UNQ765) cDNA (SEQ ID NO: 141). SEQ ID NO: 141 is here "DN
It is a clone designated as "A64902-1667". Start and stop codons are shown in bold and underlined font.

[Figure 86] This shows the amino acid sequence (SEQ ID NO: 142) derived from the coding sequence of SEQ ID NO: 141 shown in Figure 85.

[Figure 87] This shows the nucleotide sequence of the native sequence PRO1286 (UNQ655) cDNA (SEQ ID NO: 143). SEQ ID NO: 143 is here: "DN
It is a clone designated as "A64903-1667". Start and stop codons are shown in bold and underlined font.

FIG. 88 shows the amino acid sequence (SEQ ID NO: 144) derived from the coding sequence of SEQ ID NO: 143 shown in FIG.

Figure 89 shows the nucleotide sequence of the native sequence PRO1294 (UNQ663) cDNA (SEQ ID NO: 145). SEQ ID NO: 145 is here "DN
A64905-1558 ". Start and stop codons are shown in bold and underlined font.

FIG. 90 shows the amino acid sequence (SEQ ID NO: 146) derived from the coding sequence of SEQ ID NO: 145 shown in FIG. 89.

FIG. 91 shows the nucleotide sequence (SEQ ID NO: 147) of the native sequence PRO1347 (UNQ702) cDNA. SEQ ID NO: 147 is here "DN
It is a clone designated as "A64950-1590". Start and stop codons are shown in bold and underlined font.

FIG. 92 shows the amino acid sequence (SEQ ID NO: 148) derived from the coding sequence of SEQ ID NO: 147 shown in FIG. 91.

[Figure 93] This shows the nucleotide sequence of the native sequence PRO1305 (UNQ671) cDNA (SEQ ID NO: 152). SEQ ID NO: 152 is "DN
It is a clone designated as "A64952-1568". Start and stop codons are shown in bold and underlined font.

[Figure 94] This shows the amino acid sequence (SEQ ID NO: 153) derived from the coding sequence of SEQ ID NO: 152 shown in Figure 93.

Figure 95 shows the nucleotide sequence (SEQ ID NO: 157) of the native sequence PRO1273 (UNQ643) cDNA. The sequence number: 157 is here "DN
A65402-1540 ". Start and stop codons are shown in bold and underlined font.

FIG. 96 shows the amino acid sequence (SEQ ID NO: 158) derived from the coding sequence of SEQ ID NO: 157 shown in FIG.

Figure 97 shows the nucleotide sequence of the native sequence PRO1302 (UNQ668) cDNA (SEQ ID NO: 159). SEQ ID NO: 159 is here "DN
A65403-1565 ". Start and stop codons are shown in bold and underlined font.

FIG. 98 shows the amino acid sequence (SEQ ID NO: 160) derived from the coding sequence of SEQ ID NO: 159 shown in FIG.

Figure 99 shows the nucleotide sequence of the native sequence PRO1283 (UNQ653) cDNA (SEQ ID NO: 161). SEQ ID NO: 161 is here "DN
A65404-1551 ". Start and stop codons are shown in bold and underlined font.

FIG. 100 shows the amino acid sequence (SEQ ID NO: 162) derived from the coding sequence of SEQ ID NO: 161 shown in FIG.

Figure 101 shows the nucleotide sequence of the native sequence PRO1279 (UNQ649) cDNA (SEQ ID NO: 169). SEQ ID NO: 169 is here "D
NA65405-1547 ". Start and stop codons are shown in bold and underlined font.

[Figure 102] This shows the amino acid sequence (SEQ ID NO: 170) derived from the coding sequence of SEQ ID NO: 169 shown in Figure 101.

Figure 103 shows the nucleotide sequence of the native sequence PRO1304 (UNQ670) cDNA (SEQ ID NO: 179). SEQ ID NO: 179 is here "D
NA65406-1567 ". Start and stop codons are shown in bold and underlined font.

FIG. 104 shows the amino acid sequence (SEQ ID NO: 180) derived from the coding sequence of SEQ ID NO: 179 shown in FIG.

Figure 105 shows the nucleotide sequence of the native sequence PRO1317 (UNQ683) cDNA (SEQ ID NO: 188). SEQ ID NO: 188 is here "D
NA65408-1578 ". Start and stop codons are shown in bold and underlined font.

FIG. 106 shows the amino acid sequence (SEQ ID NO: 189) derived from the coding sequence of SEQ ID NO: 188 shown in FIG. 105.

Figure 107 Shows the nucleotide sequence of the native sequence PRO1303 (UNQ669) cDNA (SEQ ID NO: 193). SEQ ID NO: 193 is here "D
NA65409-1566 ". Start and stop codons are shown in bold and underlined font.

FIG. 108 shows the amino acid sequence (SEQ ID NO: 194) derived from the coding sequence of SEQ ID NO: 193 shown in FIG. 107.

FIG. 109 shows the nucleotide sequence of native sequence PRO1306 (UNQ672) cDNA (SEQ ID NO: 195). SEQ ID NO: 195 is set forth here as "D
It is a clone designated as "NA65410-1569". Start and stop codons are shown in bold and underlined font.

FIG. 110 shows the amino acid sequence (SEQ ID NO: 196) derived from the coding sequence of SEQ ID NO: 195 shown in FIG. 109.

[Fig111A-B] Natural sequence PRO1336 (UNQ649) cDN
1 shows the nucleotide sequence of A (SEQ ID NO: 197). SEQ ID NO: 197 is the clone designated herein "DNA65423-1595". Start and stop codons are shown in bold and underlined font.

FIG. 112 shows the amino acid sequence (SEQ ID NO: 198) derived from the coding sequence of SEQ ID NO: 197 shown in FIG. 111A-B.

Figure 113 shows the nucleotide sequence (SEQ ID NO: 202) of the native sequence PRO1278 (UNQ648) cDNA. SEQ ID NO: 202 is "D
NA66304-1546 ". Start and stop codons are shown in bold and underlined font.

[Figure 114] This shows the amino acid sequence (SEQ ID NO: 203) derived from the coding sequence of SEQ ID NO: 202 shown in Figure 113.

[Figure 115] This shows the nucleotide sequence of the native sequence PRO1298 (UNQ666) cDNA (SEQ ID NO: 209). SEQ ID NO: 209 is "D
It is a clone designated as "NA66511-1563". Start and stop codons are shown in bold and underlined font.

[Figure 116] This shows the amino acid sequence (SEQ ID NO: 210) derived from the coding sequence of SEQ ID NO: 209 shown in Figure 115.

[Figure 117] This shows the nucleotide sequence of the native sequence PRO1301 (UNQ667) cDNA (SEQ ID NO: 211). SEQ ID NO: 211 is "D
NA66512-1564 ". Start and stop codons are shown in bold and underlined font.

[Figure 118] This shows the amino acid sequence (SEQ ID NO: 212) derived from the coding sequence of SEQ ID NO: 211 shown in Figure 117.

FIG. 119 shows the nucleotide sequence of the native sequence PRO1268 (UNQ638) cDNA (SEQ ID NO: 213). SEQ ID NO: 213 is "D
NA66519-1535 ". Start and stop codons are shown in bold and underlined font.

[Figure 120] This shows the amino acid sequence (SEQ ID NO: 214) derived from the coding sequence of SEQ ID NO: 213 shown in Figure 119.

[Figure 121] This shows the nucleotide sequence of the native sequence PRO1269 (UNQ639) cDNA (SEQ ID NO: 215). SEQ ID NO: 215 is "D
It is a clone designated as "NA66520-1536". Start and stop codons are shown in bold and underlined font.

[Figure 122] This shows the amino acid sequence (SEQ ID NO: 216) derived from the coding sequence of SEQ ID NO: 215 shown in Figure 121.

[Figure 123] This shows the nucleotide sequence of the native sequence PRO1327 (UNQ687) cDNA (SEQ ID NO: 217). SEQ ID NO: 217 is "D
It is a clone designated as "NA66521-1583". Start and stop codons are shown in bold and underlined font.

[Figure 124] This shows the amino acid sequence (SEQ ID NO: 218) derived from the coding sequence of SEQ ID NO: 217 shown in Figure 123.

Figure 125 shows the nucleotide sequence of the native sequence PRO1382 (UNQ718) cDNA (SEQ ID NO: 219). SEQ ID NO: 219 is "D
A clone designated as "NA66526-1616". Start and stop codons are shown in bold and underlined font.

[Figure 126] This shows the amino acid sequence (SEQ ID NO: 220) derived from the coding sequence of SEQ ID NO: 219 shown in Figure 125.

Figure 127 shows the nucleotide sequence (SEQ ID NO: 224) of the native sequence PRO1328 (UNQ688) cDNA. SEQ ID NO: 224 is "D
NA66658-1584 ". Start and stop codons are shown in bold and underlined font.

[Figure 128] This shows the amino acid sequence (SEQ ID NO: 225) derived from the coding sequence of SEQ ID NO: 224 shown in Figure 127.

FIG. 129 shows the nucleotide sequence of the native sequence PRO1325 (UNQ685) cDNA (SEQ ID NO: 226). SEQ ID NO: 226 is "D
The clone is designated as "NA66659-1593". Start and stop codons are shown in bold and underlined font.

[Figure 130] This shows the amino acid sequence (SEQ ID NO: 227) derived from the coding sequence of SEQ ID NO: 226 shown in Figure 129.

Figure 131 shows the nucleotide sequence (SEQ ID NO: 228) of the native sequence PRO1340 (UNQ695) cDNA. SEQ ID NO: 228 is "D
NA66663-1598 ". Start and stop codons are shown in bold and underlined font.

[Figure 132] This shows the amino acid sequence (SEQ ID NO: 229) derived from the coding sequence of SEQ ID NO: 228 shown in Figure 131.

[Figure 133] This shows the nucleotide sequence of the native sequence PRO1339 (UNQ694) cDNA (SEQ ID NO: 233). SEQ ID NO: 233 is "D
NA66669-1597 ". Start and stop codons are shown in bold and underlined font.

[Figure 134] This shows the amino acid sequence (SEQ ID NO: 234) derived from the coding sequence of SEQ ID NO: 233 shown in Figure 133.

Figure 135 shows the nucleotide sequence (SEQ ID NO: 235) of native sequence PRO1337 (UNQ692) cDNA. SEQ ID NO: 235 is "D
NA66672-1586 ". Start and stop codons are shown in bold and underlined font.

[Figure 136] This shows the amino acid sequence (SEQ ID NO: 236) derived from the coding sequence of SEQ ID NO: 235 shown in Figure 135.

FIG. 137 shows the nucleotide sequence of the native sequence PRO1342 (UNQ697) cDNA (SEQ ID NO: 242). SEQ ID NO: 242 is "D
NA66674-1599 ". Start and stop codons are shown in bold and underlined font.

[Figure 138] This shows the amino acid sequence (SEQ ID NO: 243) derived from the coding sequence of SEQ ID NO: 242 shown in Figure 137.

Figure 139 shows the nucleotide sequence of native sequence PRO1343 (UNQ698) cDNA (SEQ ID NO: 247). SEQ ID NO: 247 is "D
The clone is designated as NA66675-1587 ". Start and stop codons are shown in bold and underlined font.

[Figure 140] This shows the amino acid sequence (SEQ ID NO: 248) derived from the coding sequence of SEQ ID NO: 247 shown in Figure 139.

[Figure 141] This shows the nucleotide sequence of the native sequence PRO1480 (UNQ749) cDNA (SEQ ID NO: 252). SEQ ID NO: 252 is "D
It is a clone designated as "NA67962-1649". Start and stop codons are shown in bold and underlined font.

[Figure 142] This shows the amino acid sequence (SEQ ID NO: 253) derived from the coding sequence of SEQ ID NO: 252 shown in Figure 141.

[Fig143A-B] Natural sequence PRO1487 (UNQ756) cDN
1 shows the nucleotide sequence of A (SEQ ID NO: 259). SEQ ID NO: 259 is the clone herein designated "DNA68836-1656". Start and stop codons are shown in bold and underlined font.

[Figure 144] This shows the amino acid sequence (SEQ ID NO: 260) derived from the coding sequence of SEQ ID NO: 259 shown in Figure 143A-B.

FIG. 145 shows the nucleotide sequence of native sequence PRO1418 (UNQ732) cDNA (SEQ ID NO: 264). SEQ ID NO: 264 is "D
NA68864-1629 ". Start and stop codons are shown in bold and underlined font.

[FIG. 146] This shows the amino acid sequence (SEQ ID NO: 265) derived from the coding sequence of SEQ ID NO: 264 shown in FIG.

[Fig. 147] This shows the nucleotide sequence of the native sequence PRO1472 (UNQ744) cDNA (SEQ ID NO: 266). SEQ ID NO: 266 is where "D
NA68866-1644 ". Start and stop codons are shown in bold and underlined font.

[FIG. 148] This shows the amino acid sequence (SEQ ID NO: 266) derived from the coding sequence of SEQ ID NO: 266 shown in FIG.

FIG. 149 shows the nucleotide sequence of native sequence PRO1461 (UNQ742) cDNA (SEQ ID NO: 268). SEQ ID NO: 268 is "D
NA68871-1638 ". Start and stop codons are shown in bold and underlined font.

[Figure 150] This shows the amino acid sequence (SEQ ID NO: 269) derived from the coding sequence of SEQ ID NO: 268 shown in Figure 149.

[Figure 151] This shows the nucleotide sequence of the native sequence PRO1410 (UNQ728) cDNA (SEQ ID NO: 270). SEQ ID NO: 270 is here "D
NA68874-1622 ". Start and stop codons are shown in bold and underlined font.

[Figure 152] This shows the amino acid sequence (SEQ ID NO: 271) derived from the coding sequence of SEQ ID NO: 270 shown in Figure 151.

[Fig. 153] This shows the nucleotide sequence of the native sequence PRO1568 (UNQ774) cDNA (SEQ ID NO: 272). SEQ ID NO: 272 is here "D
NA68880-1676 ". Start and stop codons are shown in bold and underlined font.

[FIG. 154] This shows the amino acid sequence (SEQ ID NO: 273) derived from the coding sequence of SEQ ID NO: 272 shown in FIG.

[FIG. 155] This shows the nucleotide sequence of the native sequence PRO1570 (UNQ776) cDNA (SEQ ID NO: 274). SEQ ID NO: 274 is here "D
The clone is designated as NA68885-1678 ". Start and stop codons are shown in bold and underlined font.

[FIG. 156] This shows the amino acid sequence (SEQ ID NO: 275) derived from the coding sequence of SEQ ID NO: 274 shown in FIG.

[Fig. 157] This shows the nucleotide sequence of the native sequence PRO1317 (UNQ783) cDNA (SEQ ID NO: 276). SEQ ID NO: 276 is here "D
It is a clone designated as "NA71166-1685". Start and stop codons are shown in bold and underlined font.

[FIG. 158] This shows the amino acid sequence (SEQ ID NO: 277) derived from the coding sequence of SEQ ID NO: 276 shown in FIG.

[Fig. 159] This shows the nucleotide sequence of the native sequence PRO1780 (UNQ842) cDNA (SEQ ID NO: 281). SEQ ID NO: 281 is "D
NA71169-1709 ". Start and stop codons are shown in bold and underlined font.

[Figure 160] This shows the amino acid sequence (SEQ ID NO: 282) derived from the coding sequence of SEQ ID NO: 281 shown in Figure 159.

[Fig. 161] This shows the nucleotide sequence (SEQ ID NO: 286) of the native sequence PRO1486 (UNQ755) cDNA. SEQ ID NO: 286 is "D
NA71180-1655 ". Start and stop codons are shown in bold and underlined font.

[FIG. 162] This shows the amino acid sequence (SEQ ID NO: 287) derived from the coding sequence of SEQ ID NO: 286 shown in FIG.

[FIG. 163] This shows the nucleotide sequence of the native sequence PRO1433 (UNQ738) cDNA (SEQ ID NO: 291). SEQ ID NO: 291 is "D
The clone is designated as NA71184-1634 ". Start and stop codons are shown in bold and underlined font.

[Figure 164] This shows the amino acid sequence (SEQ ID NO: 292) derived from the coding sequence of SEQ ID NO: 291 shown in Figure 163.

FIG. 165 shows the nucleotide sequence of the native sequence PRO1490 (UNQ759) cDNA (SEQ ID NO: 296). SEQ ID NO: 296 is set forth here as "D
The clone is designated as "NA71213-1659". Start and stop codons are shown in bold and underlined font.

[FIG. 166] This shows the amino acid sequence (SEQ ID NO: 297) derived from the coding sequence of SEQ ID NO: 296 shown in FIG.

[Fig. 167] This shows the nucleotide sequence of the native sequence PRO1482 (UNQ751) cDNA (SEQ ID NO: 301). The sequence number: 301 is "D
NA71234-1651 ". Start and stop codons are shown in bold and underlined font.

[FIG. 168] This shows the amino acid sequence (SEQ ID NO: 302) derived from the coding sequence of SEQ ID NO: 301 shown in FIG.

[FIG. 169] This shows the nucleotide sequence of the native sequence PRO1446 (UNQ740) cDNA (SEQ ID NO: 303). SEQ ID NO: 303 is "D
NA71277-1636 ". Start and stop codons are shown in bold and underlined font.

FIG. 170 shows the amino acid sequence (SEQ ID NO: 304) derived from the coding sequence of SEQ ID NO: 303 shown in FIG.

[FIG. 171] This shows the nucleotide sequence of the native sequence PRO1558 (UNQ766) cDNA (SEQ ID NO: 305). SEQ ID NO: 305 is "D
It is a clone designated as "NA71282-1668". Start and stop codons are shown in bold and underlined font.

[FIG. 172] This shows the amino acid sequence (SEQ ID NO: 306) derived from the coding sequence of SEQ ID NO: 305 shown in FIG.

[Fig. 173] This shows the nucleotide sequence (SEQ ID NO: 307) of the native sequence PRO1604 (UNQ785) cDNA. SEQ ID NO: 307 is "D
NA71286-1687 ". Start and stop codons are shown in bold and underlined font.

[Figure 174] This shows the amino acid sequence (SEQ ID NO: 308) derived from the coding sequence of SEQ ID NO: 307 shown in Figure 173.

[FIG. 175] This shows the nucleotide sequence of the native sequence PRO1491 (UNQ760) cDNA (SEQ ID NO: 309). SEQ ID NO: 309 is "D
It is a clone designated as NA71883-1660 ". Start and stop codons are shown in bold and underlined font.

[FIG. 176] This shows the amino acid sequence (SEQ ID NO: 310) derived from the coding sequence of SEQ ID NO: 309 shown in FIG.

[Fig. 177] This shows the nucleotide sequence of the native sequence PRO1431 (UNQ737) cDNA (SEQ ID NO: 314). SEQ ID NO: 314 is "D
NA73401-1633 ". Start and stop codons are shown in bold and underlined font.

[FIG. 178] This shows the amino acid sequence (SEQ ID NO: 315) derived from the coding sequence of SEQ ID NO: 314 shown in FIG.

[Fig179A-B] Natural sequence PRO1563 (UNQ769) cDN
1 shows the nucleotide sequence of A (SEQ ID NO: 316). SEQ ID NO: 316 is the clone designated herein "DNA73792-1671". Start and stop codons are shown in bold and underlined font.

[Figure 180] This shows the amino acid sequence (SEQ ID NO: 317) derived from the coding sequence of SEQ ID NO: 316 shown in Figure 179A-B3.

[FIG. 181] This shows the nucleotide sequence of the native sequence PRO1565 (UNQ771) cDNA (SEQ ID NO: 321). SEQ ID NO: 321 is "D
It is a clone designated as "NA73727-1673". Start and stop codons are shown in bold and underlined font.

[FIG. 182] This shows the amino acid sequence (SEQ ID NO: 322) derived from the coding sequence of SEQ ID NO: 321 shown in FIG.

[Fig. 183] This shows the nucleotide sequence of the native sequence PRO1571 (UNQ777) cDNA (SEQ ID NO: 323). SEQ ID NO: 323 is "D
NA73730-1679 ". Start and stop codons are shown in bold and underlined font.

[Figure 184] This shows the amino acid sequence (SEQ ID NO: 324) derived from the coding sequence of SEQ ID NO: 323 shown in Figure 183.

[FIG. 185] This shows the nucleotide sequence of the native sequence PRO1572 (UNQ778) cDNA (SEQ ID NO: 325). SEQ ID NO: 325 is "D
It is a clone designated as "NA73734-1680". Start and stop codons are shown in bold and underlined font.

[FIG. 186] This shows the amino acid sequence (SEQ ID NO: 326) derived from the coding sequence of SEQ ID NO: 325 shown in FIG.

[Fig. 187] This shows the nucleotide sequence of the native sequence PRO1573 (UNQ779) cDNA (SEQ ID NO: 327). SEQ ID NO: 327 is "D
NA73735-1681 ". Start and stop codons are shown in bold and underlined font.

[Figure 188] This shows the amino acid sequence (SEQ ID NO: 328) derived from the coding sequence of SEQ ID NO: 327 shown in Figure 187.

Figure 189 shows the nucleotide sequence of native sequence PRO1488 (UNQ757) cDNA (SEQ ID NO: 329). SEQ ID NO: 329 is "D
It is a clone designated as "NA73736-1657". Start and stop codons are shown in bold and underlined font.

[Figure 190] This shows the amino acid sequence (SEQ ID NO: 330) derived from the coding sequence of SEQ ID NO: 329 shown in Figure 189.

[Fig. 191] This shows the nucleotide sequence of the native sequence PRO1489 (UNQ758) cDNA (SEQ ID NO: 331). SEQ ID NO: 331 is here "D
It is a clone designated as "NA73737-1658". Start and stop codons are shown in bold and underlined font.

[Figure 192] This shows the amino acid sequence (SEQ ID NO: 332) derived from the coding sequence of SEQ ID NO: 331 shown in Figure 191.

[Fig. 193] This shows the nucleotide sequence of the native sequence PRO1474 (UNQ745) cDNA (SEQ ID NO: 333). SEQ ID NO: 333 is "D
NA73739-1645 ". Start and stop codons are shown in bold and underlined font.

[FIG. 194] This shows the amino acid sequence (SEQ ID NO: 334) derived from the coding sequence of SEQ ID NO: 333 shown in FIG.

FIG. 195 shows the nucleotide sequence of the native sequence PRO1508 (UNQ761) cDNA (SEQ ID NO: 335). SEQ ID NO: 335 is "D
A clone designated as "NA7374-21662". Start and stop codons are shown in bold and underlined font.

[FIG. 196] This shows the amino acid sequence (SEQ ID NO: 336) derived from the coding sequence of SEQ ID NO: 335 shown in FIG.

FIG. 197 shows the nucleotide sequence of the native sequence PRO1555 (UNQ763) cDNA (SEQ ID NO: 337). SEQ ID NO: 337 is here "D
It is a clone designated as "NA73744-1665". Start and stop codons are shown in bold and underlined font.

[Figure 198] This shows the amino acid sequence (SEQ ID NO: 338) derived from the coding sequence of SEQ ID NO: 337 shown in Figure 197.

FIG. 199 shows the nucleotide sequence of the native sequence PRO1485 (UNQ754) cDNA (SEQ ID NO: 339). SEQ ID NO: 339 is "D
NA73746-1654 ". Start and stop codons are shown in bold and underlined font.

[FIG. 200] This shows the amino acid sequence (SEQ ID NO: 340) derived from the coding sequence of SEQ ID NO: 339 shown in FIG.

Figure 201 shows the nucleotide sequence of the native sequence PRO1564 (UNQ770) cDNA (SEQ ID NO: 346). SEQ ID NO: 346 is "D
It is a clone designated as "NA73760-1672". Start and stop codons are shown in bold and underlined font.

[Figure 202] This shows the amino acid sequence (SEQ ID NO: 347) derived from the coding sequence of SEQ ID NO: 346 shown in Figure 201.

[Figure 203] This shows the nucleotide sequence of the native sequence PRO1755 (UNQ828) cDNA (SEQ ID NO: 351). SEQ ID NO: 351 is "D
NA76396-1698 ". Start and stop codons are shown in bold and underlined font.

[Figure 204] This shows the amino acid sequence (SEQ ID NO: 352) derived from the coding sequence of SEQ ID NO: 351 shown in Figure 203.

Figure 205 shows the nucleotide sequence of the native sequence PRO1757 (UNQ830) cDNA (SEQ ID NO: 353). SEQ ID NO: 353 is "D
NA76398-1699 ". Start and stop codons are shown in bold and underlined font.

[Figure 206] This shows the amino acid sequence (SEQ ID NO: 354) derived from the coding sequence of SEQ ID NO: 353 shown in Figure 205.

Figure 207 shows the nucleotide sequence of native sequence PRO1758 (UNQ831) cDNA (SEQ ID NO: 355). SEQ ID NO: 355 is "D
NA76399-1700 ". Start and stop codons are shown in bold and underlined font.

[Figure 208] This shows the amino acid sequence (SEQ ID NO: 356) derived from the coding sequence of SEQ ID NO: 355 shown in Figure 207.

FIG. 209 shows the nucleotide sequence of the native sequence PRO1575 (UNQ781) cDNA (SEQ ID NO: 357). SEQ ID NO: 357 is "D
NA76401-1683 ". Start and stop codons are shown in bold and underlined font.

FIG. 210 shows the amino acid sequence (SEQ ID NO: 358) derived from the coding sequence of SEQ ID NO: 357 shown in FIG.

FIG. 211 shows the nucleotide sequence of native sequence PRO1787 (UNQ849) cDNA (SEQ ID NO: 363). SEQ ID NO: 363 is "D
NA76510-2504 ". Start and stop codons are shown in bold and underlined font.

[Figure 212] This shows the amino acid sequence (SEQ ID NO: 364) derived from the coding sequence of SEQ ID NO: 363 shown in Figure 211.

[Fig. 213] This shows the nucleotide sequence of the native sequence PRO1781 (UNQ843) cDNA (SEQ ID NO: 365). SEQ ID NO: 365 is "D
It is a clone named "NA76522-2500". Start and stop codons are shown in bold and underlined font.

[Figure 214] This shows the amino acid sequence (SEQ ID NO: 366) derived from the coding sequence of SEQ ID NO: 365 shown in Figure 213.

[Fig. 215] This shows the nucleotide sequence of the native sequence PRO1556 (UNQ764) cDNA (SEQ ID NO: 371). SEQ ID NO: 371 is here "D
NA76529-1666 ". Start and stop codons are shown in bold and underlined font.

[FIG. 216] This shows the amino acid sequence (SEQ ID NO: 372) derived from the coding sequence of SEQ ID NO: 371 shown in FIG.

[Fig. 217] This shows the nucleotide sequence of the native sequence PRO1759 (UNQ832) cDNA (SEQ ID NO: 373). SEQ ID NO: 373 is "D
NA76531-1701 ". Start and stop codons are shown in bold and underlined font.

[FIG. 218] This shows the amino acid sequence (SEQ ID NO: 374) derived from the coding sequence of SEQ ID NO: 373 shown in FIG.

[Figure 219] This shows the nucleotide sequence of the native sequence PRO1760 (UNQ833) cDNA (SEQ ID NO: 375). SEQ ID NO: 375 is here "D
NA76532-1702 ". Start and stop codons are shown in bold and underlined font.

[Figure 220] This shows the amino acid sequence (SEQ ID NO: 376) derived from the coding sequence of SEQ ID NO: 375 shown in Figure 219.

[Figure 221] This shows the nucleotide sequence of the native sequence PRO1561 (UNQ768) cDNA (SEQ ID NO: 377). SEQ ID NO: 377 is here "D
NA76538-1670 ". Start and stop codons are shown in bold and underlined font.

[Figure 222] This shows the amino acid sequence (SEQ ID NO: 378) derived from the coding sequence of SEQ ID NO: 377 shown in Figure 221.

Figure 223 shows the nucleotide sequence (SEQ ID NO: 382) of the native sequence PRO1567 (UNQ773) cDNA. SEQ ID NO: 382 is "D
NA76541-1675 ". Start and stop codons are shown in bold and underlined font.

[FIG. 224] This shows the amino acid sequence (SEQ ID NO: 383) derived from the coding sequence of SEQ ID NO: 382 shown in FIG.

[Figure 225] This shows the nucleotide sequence of the native sequence PRO1693 (UNQ803) cDNA (SEQ ID NO: 384). SEQ ID NO: 384 is "D
NA77301-1693 ". Start and stop codons are shown in bold and underlined font.

[Figure 226] This shows the amino acid sequence (SEQ ID NO: 385) derived from the coding sequence of SEQ ID NO: 384 shown in Figure 225.

Figure 227 shows the nucleotide sequence of native sequence PRO1784 (UNQ846) cDNA (SEQ ID NO: 389). SEQ ID NO: 389 is "D
NA77303-2502 ". Start and stop codons are shown in bold and underlined font.

[FIG. 228] This shows the amino acid sequence (SEQ ID NO: 390) derived from the coding sequence of SEQ ID NO: 389 shown in FIG.

Figure 229 shows the nucleotide sequence of the native sequence PRO1605 (UNQ786) cDNA (SEQ ID NO: 394). SEQ ID NO: 394 is "D
NA77648-1688 ". Start and stop codons are shown in bold and underlined font.

[Figure 230] This shows the amino acid sequence (SEQ ID NO: 395) derived from the coding sequence of SEQ ID NO: 394 shown in Figure 229.

Figure 231 shows the nucleotide sequence of native sequence PRO1788 (UNQ850) cDNA (SEQ ID NO: 396). SEQ ID NO: 396 is "D
It is a clone designated as "NA77652-2505". Start and stop codons are shown in bold and underlined font.

[FIG. 232] This shows the amino acid sequence (SEQ ID NO: 397) derived from the coding sequence of SEQ ID NO: 396 shown in FIG.

[FIG. 233] This shows the nucleotide sequence of the native sequence PRO1801 (UNQ852) cDNA (SEQ ID NO: 401). SEQ ID NO: 401 is "D
NA83500-2506 ". Start and stop codons are shown in bold and underlined font.

[FIG. 234] This shows the amino acid sequence (SEQ ID NO: 402) derived from the coding sequence of SEQ ID NO: 401 shown in FIG.

Figure 235 shows the nucleotide sequence of native sequence UCP4 cDNA (SEQ ID NO: 405). SEQ ID NO: 405 is set forth herein as "DNA77568-162.
6 ”is a clone named. Start and stop codons are shown in bold and underlined font.

[FIG. 236] This shows the amino acid sequence (SEQ ID NO: 406) derived from the coding sequence of SEQ ID NO: 405 shown in FIG.

Figure 237 shows the nucleotide sequence of native sequence PRO193 cDNA (SEQ ID NO: 409). SEQ ID NO: 409 is set forth herein as "DNA23322-1.
393 ". Start and stop codons are shown in bold and underlined font.

[Figure 238] This shows the amino acid sequence (SEQ ID NO: 410) derived from the coding sequence of SEQ ID NO: 409 shown in Figure 237.

[FIG. 239] Nucleotide sequence of native sequence PRO1130 cDNA (
SEQ ID NO: 414) is shown. SEQ ID NO: 414 is set forth herein as "DNA59814-
1486 ”. Start and stop codons are shown in bold and underlined font.

[FIG. 240] This shows the amino acid sequence (SEQ ID NO: 415) derived from the coding sequence of SEQ ID NO: 414 shown in FIG.

[FIG. 241] Nucleotide sequence of native sequence PRO1335 cDNA (
SEQ ID NO: 422) is shown. SEQ ID NO: 422 is set forth herein as "DNA62812-
1594 ”. Start and stop codons are shown in bold and underlined font.

[Figure 242] This shows the amino acid sequence (SEQ ID NO: 423) derived from the coding sequence of SEQ ID NO: 422 shown in Figure 241.

[Fig. 243] Nucleotide sequence of native sequence PRO1329 cDNA (
SEQ ID NO: 428) is shown. SEQ ID NO: 428 is set forth herein as "DNA66660-
1585 ". Start and stop codons are shown in bold and underlined font.

[Figure 244] This shows the amino acid sequence (SEQ ID NO: 429) derived from the coding sequence of SEQ ID NO: 428 shown in Figure 243.

[FIG. 245] Nucleotide sequence of native sequence PRO1550 cDNA (
SEQ ID NO: 231 ) is shown. SEQ ID NO: 231 is referred to herein as "DNA76393-
1664 ". Start and stop codons are shown in bold and underlined font.

Figure 246 shows the amino acid sequence (SEQ ID NO: 232 ) derived from the SEQ ID NO: 231 coding sequence shown in Figure 245.

[Figure 247A-D] A hypothetical illustration using the following method to determine% amino acid sequence identity (Fig. 274A-B) and% nucleic acid sequence identity (Fig. 247C-D) using the ALIGN-2 sequence alignment computer program. "PRO" indicates the amino acid sequence of the hypothetical PEACH polypeptide of interest, "Comparative protein" indicates the amino acid sequence of the polypeptide to which the "PRO" polypeptide of interest is compared, and "PRO-DNA Is the target hypothetical PEAC
“H” -encoding nucleic acid sequence, “Comparative DNA” indicates the nucleotide sequence of the nucleic acid molecule to which the “PRO-DNA” nucleic acid molecule of interest is compared, “X”, “Y” and “
“Z” indicates different hypothetical amino acid residues, and “N”, “L”, and “V” indicate different hypothetical nucleotides.

FIG. 248A-D provides the complete source code for the ALIGN-2 sequence comparison computer program. This source code is routinely compiled for use with the UNIX operating system to give the ALIGN-2 sequence comparison computer program.

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁷ Identification code FI theme code (reference) A61P 25/00 101 A61P 43/00 111 25/16 C07K 14/47 25/28 16/18 35/00 19 / 00 43/00 111 C12N 1/19 C07K 14/47 1/21 16/18 C12P 21/02 C 19/00 21/08 C12N 1/19 C12R 1:91 1/21 1: 645 5/10 1: 19 15/02 C12N 15/00 ZNAA C12P 21/02 5/00 B // C12P 21/08 15/00 C (C12P 21/02 A61K 37/02 C12R 1:91) 37/48 (C12P 21/02 37 / 64 C12R 1: 645) (C12P 21/02 C12R 1:19) (31) Priority claim number 60/106, 905 (32) Priority date November 3, 1998 (November 3, 1998) (33) ) Priority claim country United States (US) (31) Priority claim number 60 / 098,749 (32) Priority date September 1, 2010 (September 1, 1998) (33) Priority claiming country United States (US) (31) Priority claim number 60/106, 919 (32) Priority date November 3, 1998 (1998) .11.3) (33) Priority claiming country United States (US) (31) Priority claim number 60/106, 932 (32) Priority date November 3, 1998 (November 3, 1998) (33) Priority claiming United States (US) (31) Priority claiming number 60 / 098,750 (32) Priority date September 1, 1998 (September 1998) (33) Priority claiming United States (US) (31) Priority claim number 60/106, 934 (32) Priority date November 3, 1998 (November 3, 1998) (33) Country of priority claim United States (US) (31) Priority claim number 60 / 098,803 (32) Priority date September 2, 1998 (September 1998) (33) Country of priority claim United States (US) (31) Priority claim number 60 / 107,783 (32) Priority Date November 10, 1998 (November 10, 1998) (33) Priority claim countries United States (US) (31) Priority claim No. 60 / 098,821 (32) Priority date September 2, 1998 (September 1998) (33) Country of priority claim United States (US) (31) Priority claim number 60 / 108,775 (32) ) Priority date November 17, 1998 (November 17, 1998) (33) Country of priority claim United States (US) (31) Priority claim number 60 / 098,843 (32) Priority date September 1998 2 (1998.9.2) (33) Priority claiming country United States (US) (31) Priority claim number 60 / 108,779 (32) Priority date November 17, 1998 (November 17, 1998) ) (33) Priority claiming country United States (US) (31) Priority claiming number 60 / 099,536 (32) Priority date September 9, 1998 (September 1998) (33) Priority claiming country United States (US) (31) Priority claim number 60 / 108,787 (32) Priority date November 17, 1998 (November 17, 1998) (33) Priority claim country United States (US) (31) Priority Claim number 60 / 099,596 (32) Priority date September 9, 1998 (September 1998) (33) Priority claiming country United States (US) (31) Priority claim number 60 / 108,788 (32) Priority date November 17, 1998 (November 17, 1998) (33) Priority claiming country United States (US) (31) Priority claim number 60 / 099,598 (32) Priority date September 9, 1998 (September 1998) (33) Country of priority claim United States (US) (31) Priority claim number 60 / 108,801 (32) Priority date November 17, 1998 (November 17, 1998) (33) Priority claiming country United States (US) (31) Priority claim number 60 / 099,602 (32) Priority Date September 9, 1998 (September 1998) (33) Priority claiming country United States (US) (31) Priority claim number 60 / 108,802 (32) Priority date November 17, 1998 (November 17, 1998) (33) Country of priority claim United States (US) (31) Number of priority claim 60 / 099,642 (32) Priority date September 9, 1998 (September 1998) 33) Priority claiming country United States (US) (31) Priority claiming number 60 / 108,806 (32) Priority date November 17, 1998 (November 17, 1998) (33) Priority claiming country United States (US) (31) Priority claim number 60 / 099,741 (32) Priority date 1998 September 10 (September 10, 1998) (33) Priority claiming country United States (US) (31) Priority claim number 60 / 108,807 (32) Priority date November 17, 1998 (November 11, 1998) 17) (33) Priority claiming country United States (US) (31) Priority claim number 60 / 099,754 (32) Priority date September 10, 1998 (September 10, 1998) (33) Priority Claiming country United States (US) (31) Priority claim number 60 / 108,867 (32) Priority date November 17, 1998 (November 17, 1998) (33) Priority claiming country United States (US) (31) ) Priority claim number 60 / 099,763 (32) Priority date September 10, 1998 (September 10, 1998) (33) Country of priority claim United States (US) (31) Priority claim number 60/099 , 792 (32) Priority date September 10, 1998 (September 10, 1998) (33) Priority claiming countries United States (US) (31) Priority claim number 60 / 108,925 (32) Priority date November 17, 1998 (November 17, 1998) (33) Country of priority claim United States (US) (31) Priority claim number 60 / 108,848 (32) Priority date November 18, 1998 (November 18, 1998) (33) Priority claim country United States (US) (31) Priority claim number 60 / 099,808 (32) Priority Date September 10, 1998 (September 10, 1998) (33) Priority claiming country United States (US) (31) Priority claim number 60 / 108,849 (32) Priority date November 18, 1998 (November 18, 1998) (33) Priority claiming country United States (US) (31) Priority claim number 60 / 099,812 (32) Priority date September 10, 1998 (September 10, 1998) ( 33) Priority claiming United States (US) (31) Priority claiming number 60 / 108,850 (32) Priority date November 18, 1998 (November 18, 1998) (33) Priority claiming United States ( (US) (31) Priority claim number 60 / 099,815 (32) Priority date September 10, 1998 ( September 10, 1998 (33) Country of priority claim United States (US) (31) Priority claim number 60 / 108,851 (32) Priority date November 18, 1998 (November 18, 1998) (33) ) Priority claiming country United States (US) (31) Priority claiming number 60 / 099,816 (32) Priority date September 10, 1998 (September 10, 1998) (33) Priority claiming country United States (US ) (31) Priority claim number 60 / 108,852 (32) Priority date November 18, 1998 (November 18, 1998) (33) Country of priority claim United States (US) (31) Priority claim number 60 / 100,385 (32) Priority date September 15, 1998 (September 15, 1998) (33) Priority claiming country United States (US) (31) Priority claim number 60 / 108,858 (32) Priority date November 18, 1998 (November 18, 1998) (33) Priority claiming country United States (US) (31) Priority claim number 60 / 100,388 (32) Priority date September 15, 1998 Date (September 15, 1998) (33) Priority claim country United States (US) (31) Priority claim number 60 / 08,904 (32) Priority date November 18, 1998 (November 18, 1998) (33) Priority claiming country United States (US) (31) Priority claim number 60 / 100,390 (32) Priority date September 15, 1998 (September 15, 1998) (33) Priority claiming country United States (US) (31) Priority claim number 60 / 100,584 (32) Priority date September 16, 1998 ( September 16, 1998 (33) Priority claiming country United States (US) (31) Priority claim number 60 / 100,627 (32) Priority date September 16, 1998 (September 16, 1998) (33) ) Priority claiming country United States (US) (31) Priority claiming number 60 / 100,661 (32) Priority date September 16, 1998 (September 16, 1998) (33) Priority claiming country United States (US) ) (31) Priority claim number 60 / 100,662 (32) Priority date September 16, 1998 (September 16, 1998) (33) Priority claiming country United States (US) (81) Designated country EP ( AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, T, LU, MC, NL, PT, SE), OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, SD, SL, SZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AE, AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, CA, CH, CN, CR, CU, CZ, DE, DK, EE, ES, FI, GB, G D, GE, GH, GM, HR, HU , ID, IL, IN, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MD, MG, MK, MN, MW, MX, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR TT, UA, UG, US, UZ, VN, Y U, ZA, ZW (72) inventor Goddard, Audrey California 94131, San Francisco, Congo Street 110 (72) inventor Gurnee, Austin El. United States California 94002, Belmont, Debby Lane 1 (72) Inventor Smith, Victoria United States California 94010, Burlingame, Dwight Road 19 (72) Inventor Watanabe, Colin, Kay. Corris Drive, Moraga, California 94556, USA 128 (72) Inventor Wood, William Eye. United States California 94010, Hillsborough, Southdown Court 35F Term (reference) 4B024 AA01 AA11 BA44 CA04 DA02 DA06 DA12 EA02 EA04 GA11 HA01 HA11 4B064 AG01 AG27 CA02 CA06 CA10 CA19 CA20 CC24 DA01 4B065 AA26X AA72 CA44A04 CAA 4A0A4ACA4 CAA4XAA4XAA4XAA90X AA90X AA90XAA90X AA07 AA13 BA01 CA53 CA56 CA59 DA01 DA12 DB52 DC01 DC32 NA14 ZA03 ZA16 ZB26 ZC20 4H045 AA10 AA11 AA20 AA30 BA10 CA40 DA76 EA20 EA50 FA72 FA74

Claims (27)

[Claims] 1. Fig2 (SEQ ID NO: 4), FIG4 (SEQ ID NO: 6), F
ig6 (SEQ ID NO: 8), Fig8 (SEQ ID NO: 10), Fig10 (SEQ ID NO: 12), Fig12 (SEQ ID NO: 17), Fig14 (SEQ ID NO: 22), F
ig16 (SEQ ID NO: 24), FIG18 (SEQ ID NO: 29), FIG20 (SEQ ID NO: 31), Fig22 (SEQ ID NO: 33), FIG24 (SEQ ID NO: 41)
), FIG26 (SEQ ID NO: 43), FIG28 (SEQ ID NO: 50), FIG3
0 (SEQ ID NO: 52), FIG32 (SEQ ID NO: 54), FIG34 (SEQ ID NO: 56), FIG36 (SEQ ID NO: 58), FIG38 (SEQ ID NO: 63), F
ig40 (SEQ ID NO: 68), Fig42 (SEQ ID NO: 70), Fig44 (SEQ ID NO: 72), Fig46 (SEQ ID NO: 77), Fig48 (SEQ ID NO: 79)
), FIG50 (SEQ ID NO: 84), FIG52 (SEQ ID NO: 86), FIG5
4 (SEQ ID NO: 88), FIG56 (SEQ ID NO: 95), FIG58 (SEQ ID NO: 100), Fig60 (SEQ ID NO: 102), FIG62 (SEQ ID NO: 104)
), FIG64 (SEQ ID NO: 111), FIG66 (SEQ ID NO: 116), Fi
g68 (SEQ ID NO: 118), FIG70 (SEQ ID NO: 123), FIG72 (
SEQ ID NO: 128), FIG74 (SEQ ID NO: 130), FIG76 (SEQ ID NO: 132), FIG78 (SEQ ID NO: 134), FIG80 (SEQ ID NO: 136)
), FIG82 (SEQ ID NO: 138), FIG84 (SEQ ID NO: 140), Fi
g86 (SEQ ID NO: 142), Fig88 (SEQ ID NO: 144), Fig90 (
SEQ ID NO: 146), Figure 92 (SEQ ID NO: 148), Figure 94 (SEQ ID NO: 153), Figure 96 (SEQ ID NO: 158), Figure 98 (SEQ ID NO: 160)
), FIG100 (SEQ ID NO: 162), FIG102 (SEQ ID NO: 170),
Figure 104 (SEQ ID NO: 180), Figure 106 (SEQ ID NO: 189), Fi
g108 (SEQ ID NO: 194), Fig110 (SEQ ID NO: 196), Fig1
12 (SEQ ID NO: 198), FIG114 (SEQ ID NO: 203), FIG116
(SEQ ID NO: 210), FIG118 (SEQ ID NO: 212), FIG120 (SEQ ID NO: 214), FIG122 (SEQ ID NO: 216), FIG124 (SEQ ID NO: 218), FIG126 (SEQ ID NO: 220), FIG128 (array) number:
225), FIG130 (SEQ ID NO: 227), FIG132 (SEQ ID NO: 22)
9), Fig134 (SEQ ID NO: 234), Figure 136 (SEQ ID NO: 236)
, Figure 138 (SEQ ID NO: 243), Figure 140 (SEQ ID NO: 248), F
ig142 (SEQ ID NO: 253), FIG144 (SEQ ID NO: 260), FIG
146 (SEQ ID NO: 265), FIG148 (SEQ ID NO: 267), FIG15
0 (SEQ ID NO: 269), FIG152 (SEQ ID NO: 271), FIG154 (
SEQ ID NO: 273), FIG 156 (SEQ ID NO: 275), FIG 158 (SEQ ID NO: 277), FIG 160 (SEQ ID NO: 282), FIG 162 (SEQ ID NO: 287), FIG 164 (SEQ ID NO: 292), FIG 166 (SEQ ID NO:). : 2
97), FIG168 (SEQ ID NO: 302), FIG170 (SEQ ID NO: 304)
), FIG172 (SEQ ID NO: 306), FIG174 (SEQ ID NO: 308),
Figure 176 (SEQ ID NO: 310), Figure 178 (SEQ ID NO: 315), Fi
g180 (SEQ ID NO: 317), Fig182 (SEQ ID NO: 322), Fig1
84 (SEQ ID NO: 324), FIG186 (SEQ ID NO: 326), FIG188
(SEQ ID NO: 328), FIG190 (SEQ ID NO: 330), FIG192 (SEQ ID NO: 332), FIG194 (SEQ ID NO: 334), FIG196 (SEQ ID NO: 336), FIG198 (SEQ ID NO: 338), FIG200 (SEQ ID NO: 338). number:
340), FIG202 (SEQ ID NO: 347), FIG204 (SEQ ID NO: 35)
2), Figure 206 (SEQ ID NO: 354), Figure 208 (SEQ ID NO: 356)
, Figure 210 (SEQ ID NO: 358), Figure 212 (SEQ ID NO: 364), F
ig214 (SEQ ID NO: 366), FIG216 (SEQ ID NO: 372), FIG
218 (SEQ ID NO: 374), FIG220 (SEQ ID NO: 376), FIG22
2 (SEQ ID NO: 378), Figure 224 (SEQ ID NO: 383), Figure 226 (
Sequence number: 385), Figure 228 (sequence number: 390), Figure230 (sequence number: 395), Figure232 (sequence number: 397), Figure234 (sequence number: 402), Figure236 (sequence number: 406), Figure238 (sequence number: SEQ ID NO: 403). : 4
10), FIG240 (SEQ ID NO: 415), FIG242 (SEQ ID NO: 423)
), FIG. 244 (SEQ ID NO: 429) and FIG. 246 (SEQ ID NO: 431)
An isolated nucleic acid having at least 80% sequence identity to a nucleotide sequence encoding a polypeptide comprising an amino acid sequence selected from the group consisting of the amino acid sequences set forth in. 2. The nucleotide sequences are FIG1 (SEQ ID NO: 3) and Fi.
g3 (SEQ ID NO: 5), Fig5 (SEQ ID NO: 7), Fig7 (SEQ ID NO: 9)
, Fig9 (SEQ ID NO: 11), Fig11 (SEQ ID NO: 16), Fig13 (
SEQ ID NO: 21), FIG15 (SEQ ID NO: 23), FIG17 (SEQ ID NO: 2)
8), Fig19 (SEQ ID NO: 30), Fig21 (SEQ ID NO: 32), Fig
23 (SEQ ID NO: 40), FIG25 (SEQ ID NO: 42), FIG27 (SEQ ID NO: 49), FIG29 (SEQ ID NO: 51), FIG31 (SEQ ID NO: 53),
Figure 33 (SEQ ID NO: 55), Figure 35 (SEQ ID NO: 57), Figure 37 (
SEQ ID NO: 62), Fig39 (SEQ ID NO: 67), Fig41 (SEQ ID NO: 6)
9), Figure 43 (SEQ ID NO: 71), Figure 45 (SEQ ID NO: 76), Figure
47 (SEQ ID NO: 78), FIG49 (SEQ ID NO: 83), FIG51 (SEQ ID NO: 85), FIG53 (SEQ ID NO: 87), FIG55 (SEQ ID NO: 94),
Figure 57 (SEQ ID NO: 99), Figure 59 (SEQ ID NO: 101), Figure 61
(SEQ ID NO: 103), FIG63 (SEQ ID NO: 110), FIG65 (SEQ ID NO: 115), FIG67 (SEQ ID NO: 117), FIG69 (SEQ ID NO: 12)
2), Fig71 (SEQ ID NO: 127), Fig73 (SEQ ID NO: 129), F
ig75 (SEQ ID NO: 131), Fig77 (SEQ ID NO: 133), Fig79
(SEQ ID NO: 135), FIG81 (SEQ ID NO: 137), FIG83 (SEQ ID NO: 139), FIG85 (SEQ ID NO: 141), FIG87 (SEQ ID NO: 14)
3), Fig89 (SEQ ID NO: 145), Fig91 (SEQ ID NO: 147), F
ig93 (SEQ ID NO: 152), Fig95 (SEQ ID NO: 157), Fig97
(SEQ ID NO: 159), FIG99 (SEQ ID NO: 161), FIG101 (SEQ ID NO: 169), FIG103 (SEQ ID NO: 179), FIG105 (SEQ ID NO: 188), FIG107 (SEQ ID NO: 193), FIG109 (sequence) Number: 1
95), Fig111 (SEQ ID NO: 197), Fig113 (SEQ ID NO: 202)
), FIG115 (SEQ ID NO: 209), FIG117 (SEQ ID NO: 211),
Figure 119 (SEQ ID NO: 213), Figure 121 (SEQ ID NO: 215), Fi
g123 (SEQ ID NO: 217), Fig125 (SEQ ID NO: 219), Fig1
27 (SEQ ID NO: 224), Fig129 (SEQ ID NO: 226), Fig131
(SEQ ID NO: 228), FIG133 (SEQ ID NO: 233), FIG135 (SEQ ID NO: 235), Fig137 (SEQ ID NO: 242), FIG139 (SEQ ID NO: 247), FIG141 (SEQ ID NO: 252), FIG143 (SEQ ID NO: 252). number:
259), Figure 145 (SEQ ID NO: 264), Figure 147 (SEQ ID NO: 26).
6), Figure 149 (SEQ ID NO: 268), Figure 151 (SEQ ID NO: 270)
, Figure 153 (SEQ ID NO: 272), Figure 155 (SEQ ID NO: 274), F
ig157 (SEQ ID NO: 276), FIG159 (SEQ ID NO: 281), FIG
161 (SEQ ID NO: 286), FIG163 (SEQ ID NO: 291), FIG16
5 (SEQ ID NO: 296), FIG167 (SEQ ID NO: 301), FIG169 (SEQ ID NO: 301)
SEQ ID NO: 303), Figure 171 (SEQ ID NO: 305), Figure 173 (SEQ ID NO: 307), Figure 175 (SEQ ID NO: 309), Figure 177 (SEQ ID NO: 314), Figure 179 (SEQ ID NO: 316), Figure 181 (SEQ ID NO:). : 3
21), Figure 183 (SEQ ID NO: 323), and Figure 185 (SEQ ID NO: 325).
), FIG187 (SEQ ID NO: 327), FIG189 (SEQ ID NO: 329),
Figure 191 (SEQ ID NO: 331), Figure 193 (SEQ ID NO: 333), Fi
g195 (SEQ ID NO: 335), Fig197 (SEQ ID NO: 337), Fig1
99 (SEQ ID NO: 339), FIG201 (SEQ ID NO: 346), FIG203
(SEQ ID NO: 351), FIG205 (SEQ ID NO: 353), FIG207 (SEQ ID NO: 355), FIG209 (SEQ ID NO: 357), FIG211 (SEQ ID NO: 363), FIG213 (SEQ ID NO: 365), FIG215 (sequence) number:
371), Figure 217 (SEQ ID NO: 373), and Figure 219 (SEQ ID NO: 37).
5), Figure 221 (SEQ ID NO: 377), Figure 223 (SEQ ID NO: 382)
, Figure 225 (SEQ ID NO: 384), Figure 227 (SEQ ID NO: 389), F
ig229 (SEQ ID NO: 394), Fig231 (SEQ ID NO: 396), FIG
233 (SEQ ID NO: 401), Figure 235 (SEQ ID NO: 405), Figure 23
7 (SEQ ID NO: 409), Fig239 (SEQ ID NO: 414), and Figure 241 (
The nucleic acid according to claim 1, comprising a nucleotide sequence selected from the group consisting of the sequences set forth in SEQ ID NO: 422), Figure 242 (SEQ ID NO: 428) and Figure 245 (SEQ ID NO: 430). 3. The nucleotide sequences are FIG1 (SEQ ID NO: 3) and Fi.
g3 (SEQ ID NO: 5), Fig5 (SEQ ID NO: 7), Fig7 (SEQ ID NO: 9)
, Fig9 (SEQ ID NO: 11), Fig11 (SEQ ID NO: 16), Fig13 (
SEQ ID NO: 21), FIG15 (SEQ ID NO: 23), FIG17 (SEQ ID NO: 2)
8), Fig19 (SEQ ID NO: 30), Fig21 (SEQ ID NO: 32), Fig
23 (SEQ ID NO: 40), FIG25 (SEQ ID NO: 42), FIG27 (SEQ ID NO: 49), FIG29 (SEQ ID NO: 51), FIG31 (SEQ ID NO: 53),
Figure 33 (SEQ ID NO: 55), Figure 35 (SEQ ID NO: 57), Figure 37 (
SEQ ID NO: 62), Fig39 (SEQ ID NO: 67), Fig41 (SEQ ID NO: 6)
9), Figure 43 (SEQ ID NO: 71), Figure 45 (SEQ ID NO: 76), Figure
47 (SEQ ID NO: 78), FIG49 (SEQ ID NO: 83), FIG51 (SEQ ID NO: 85), FIG53 (SEQ ID NO: 87), FIG55 (SEQ ID NO: 94),
Figure 57 (SEQ ID NO: 99), Figure 59 (SEQ ID NO: 101), Figure 61
(SEQ ID NO: 103), FIG63 (SEQ ID NO: 110), FIG65 (SEQ ID NO: 115), FIG67 (SEQ ID NO: 117), FIG69 (SEQ ID NO: 12)
2), Fig71 (SEQ ID NO: 127), Fig73 (SEQ ID NO: 129), F
ig75 (SEQ ID NO: 131), Fig77 (SEQ ID NO: 133), Fig79
(SEQ ID NO: 135), FIG81 (SEQ ID NO: 137), FIG83 (SEQ ID NO: 139), FIG85 (SEQ ID NO: 141), FIG87 (SEQ ID NO: 14)
3), Fig89 (SEQ ID NO: 145), Fig91 (SEQ ID NO: 147), F
ig93 (SEQ ID NO: 152), Fig95 (SEQ ID NO: 157), Fig97
(SEQ ID NO: 159), FIG99 (SEQ ID NO: 161), FIG101 (SEQ ID NO: 169), FIG103 (SEQ ID NO: 179), FIG105 (SEQ ID NO: 188), FIG107 (SEQ ID NO: 193), FIG109 (sequence) Number: 1
95), Fig111 (SEQ ID NO: 197), Fig113 (SEQ ID NO: 202)
), FIG115 (SEQ ID NO: 209), FIG117 (SEQ ID NO: 211),
Figure 119 (SEQ ID NO: 213), Figure 121 (SEQ ID NO: 215), Fi
g123 (SEQ ID NO: 217), Fig125 (SEQ ID NO: 219), Fig1
27 (SEQ ID NO: 224), Fig129 (SEQ ID NO: 226), Fig131
(SEQ ID NO: 228), FIG133 (SEQ ID NO: 233), FIG135 (SEQ ID NO: 235), Fig137 (SEQ ID NO: 242), FIG139 (SEQ ID NO: 247), FIG141 (SEQ ID NO: 252), FIG143 (SEQ ID NO: 252). number:
259), Figure 145 (SEQ ID NO: 264), Figure 147 (SEQ ID NO: 26).
6), Figure 149 (SEQ ID NO: 268), Figure 151 (SEQ ID NO: 270)
, Figure 153 (SEQ ID NO: 272), Figure 155 (SEQ ID NO: 274), F
ig157 (SEQ ID NO: 276), FIG159 (SEQ ID NO: 281), FIG
161 (SEQ ID NO: 286), FIG163 (SEQ ID NO: 291), FIG16
5 (SEQ ID NO: 296), FIG167 (SEQ ID NO: 301), FIG169 (SEQ ID NO: 301)
SEQ ID NO: 303), Figure 171 (SEQ ID NO: 305), Figure 173 (SEQ ID NO: 307), Figure 175 (SEQ ID NO: 309), Figure 177 (SEQ ID NO: 314), Figure 179 (SEQ ID NO: 316), Figure 181 (SEQ ID NO:). : 3
21), Figure 183 (SEQ ID NO: 323), and Figure 185 (SEQ ID NO: 325).
), FIG187 (SEQ ID NO: 327), FIG189 (SEQ ID NO: 329),
Figure 191 (SEQ ID NO: 331), Figure 193 (SEQ ID NO: 333), Fi
g195 (SEQ ID NO: 335), Fig197 (SEQ ID NO: 337), Fig1
99 (SEQ ID NO: 339), FIG201 (SEQ ID NO: 346), FIG203
(SEQ ID NO: 351), FIG205 (SEQ ID NO: 353), FIG207 (SEQ ID NO: 355), FIG209 (SEQ ID NO: 357), FIG211 (SEQ ID NO: 363), FIG213 (SEQ ID NO: 365), FIG215 (sequence) number:
371), Figure 217 (SEQ ID NO: 373), and Figure 219 (SEQ ID NO: 37).
5), Figure 221 (SEQ ID NO: 377), Figure 223 (SEQ ID NO: 382)
, Figure 225 (SEQ ID NO: 384), Figure 227 (SEQ ID NO: 389), F
ig229 (SEQ ID NO: 394), Fig231 (SEQ ID NO: 396), FIG
233 (SEQ ID NO: 401), Figure 235 (SEQ ID NO: 405), Figure 23
7 (SEQ ID NO: 409), Fig239 (SEQ ID NO: 414), and Figure 241 (
The nucleic acid according to claim 1, comprising a nucleotide sequence selected from the group consisting of full-length coding sequences of the sequence set forth in SEQ ID NO: 422), Figure 242 (SEQ ID NO: 428) or Figure 245 (SEQ ID NO: 430). . 4. An isolated nucleic acid comprising the full length coding sequence of the DNA deposited under the ATCC accession number shown in Table 2. 5. A vector comprising the nucleic acid according to claim 1. 6. The vector according to claim 5, which is operably linked to a control sequence recognized by a host cell transformed with the vector. 7. A host cell comprising the vector of claim 5. 8. The host cell according to claim 7, wherein the cell is a CHO cell. 9. The host cell according to claim 7, wherein the cell is Escherichia coli. 10. The host cell according to claim 7, wherein the cell is a yeast cell. 11. Production of PRO polypeptide comprising culturing the host cell of claim 7 under conditions suitable for expression of the PRO polypeptide and recovering the PRO polypeptide from cell culture. Method. 12. A fig2 (SEQ ID NO: 4), a fig4 (SEQ ID NO: 6),
Fig6 (SEQ ID NO: 8), Fig8 (SEQ ID NO: 10), Fig10 (SEQ ID NO: 12), Fig12 (SEQ ID NO: 17), Fig14 (SEQ ID NO: 22),
FIG16 (SEQ ID NO: 24), FIG18 (SEQ ID NO: 29), FIG20 (
SEQ ID NO: 31), FIG22 (SEQ ID NO: 33), FIG24 (SEQ ID NO: 4)
1), Fig26 (SEQ ID NO: 43), Fig28 (SEQ ID NO: 50), Fig
30 (SEQ ID NO: 52), FIG32 (SEQ ID NO: 54), FIG34 (SEQ ID NO: 56), FIG36 (SEQ ID NO: 58), FIG38 (SEQ ID NO: 63),
Figure 40 (SEQ ID NO: 68), Figure 42 (SEQ ID NO: 70), Figure 44 (
SEQ ID NO: 72), FIG46 (SEQ ID NO: 77), FIG48 (SEQ ID NO: 7)
9), Figure 50 (SEQ ID NO: 84), Figure 52 (SEQ ID NO: 86), Figure
54 (SEQ ID NO: 88), FIG56 (SEQ ID NO: 95), FIG58 (SEQ ID NO: 100), Fig60 (SEQ ID NO: 102), FIG62 (SEQ ID NO: 10)
4), FIG64 (SEQ ID NO: 111), FIG66 (SEQ ID NO: 116), F
ig68 (SEQ ID NO: 118), FIG70 (SEQ ID NO: 123), Fig72
(SEQ ID NO: 128), FIG74 (SEQ ID NO: 130), FIG76 (SEQ ID NO: 132), FIG78 (SEQ ID NO: 134), FIG80 (SEQ ID NO: 13)
6), Fig82 (SEQ ID NO: 138), Fig84 (SEQ ID NO: 140), F
ig86 (SEQ ID NO: 142), FIG88 (SEQ ID NO: 144), Fig90
(SEQ ID NO: 146), FIG92 (SEQ ID NO: 148), FIG94 (SEQ ID NO: 153), FIG96 (SEQ ID NO: 158), FIG98 (SEQ ID NO: 16)
0), FIG100 (SEQ ID NO: 162), FIG102 (SEQ ID NO: 170)
, Figure 104 (SEQ ID NO: 180), Figure 106 (SEQ ID NO: 189), F
ig108 (SEQ ID NO: 194), Fig110 (SEQ ID NO: 196), Fig
112 (SEQ ID NO: 198), Fig114 (SEQ ID NO: 203), Fig11
6 (SEQ ID NO: 210), FIG118 (SEQ ID NO: 212), FIG120 (
Sequence number: 214), Figure122 (sequence number: 216), Figure124 (sequence number: 218), Figure126 (sequence number: 220), Figure128 (sequence number: 225), Figure130 (sequence number: 227), Figure132 (sequence number). : 2
29), Fig134 (SEQ ID NO: 234), Fig136 (SEQ ID NO: 236)
), FIG138 (SEQ ID NO: 243), FIG140 (SEQ ID NO: 248),
Figure 142 (SEQ ID NO: 253), Figure 144 (SEQ ID NO: 260), Fi
g146 (SEQ ID NO: 265), FIG148 (SEQ ID NO: 267), FIG1
50 (SEQ ID NO: 269), FIG152 (SEQ ID NO: 271), FIG154
(SEQ ID NO: 273), FIG156 (SEQ ID NO: 275), FIG158 (SEQ ID NO: 277), FIG160 (SEQ ID NO: 282), FIG162 (SEQ ID NO: 287), FIG164 (SEQ ID NO: 292), FIG166 (sequence) number:
297), FIG168 (SEQ ID NO: 302), FIG170 (SEQ ID NO: 30)
4), FIG172 (SEQ ID NO: 306), FIG174 (SEQ ID NO: 308)
, Figure 176 (SEQ ID NO: 310), Figure 178 (SEQ ID NO: 315), F
ig180 (SEQ ID NO: 317), FIG182 (SEQ ID NO: 322), FIG
184 (SEQ ID NO: 324), FIG186 (SEQ ID NO: 326), FIG18
8 (SEQ ID NO: 328), FIG190 (SEQ ID NO: 330), FIG192 (
SEQ ID NO: 332), Figure 194 (SEQ ID NO: 334), Figure 196 (SEQ ID NO: 336), Figure 198 (SEQ ID NO: 338), Figure 200 (SEQ ID NO: 340), Figure 202 (SEQ ID NO: 347), Figure 204 (SEQ ID NO:). : 3
52), FIG206 (SEQ ID NO: 354), FIG208 (SEQ ID NO: 356)
), FIG210 (SEQ ID NO: 358), FIG212 (SEQ ID NO: 364),
Figure 214 (SEQ ID NO: 366), Figure 216 (SEQ ID NO: 372), Fi
g218 (SEQ ID NO: 374), Fig220 (SEQ ID NO: 376), Fig2
22 (SEQ ID NO: 378), Figure 224 (SEQ ID NO: 383), Figure 226
(SEQ ID NO: 385), Figure 228 (SEQ ID NO: 390), Figure 230 (SEQ ID NO: 395), Figure 232 (SEQ ID NO: 397), Figure 234 (SEQ ID NO: 402), Figure 236 (SEQ ID NO: 406), Figure 238 (array) number:
410), FIG240 (SEQ ID NO: 415), FIG242 (SEQ ID NO: 42)
3), Figure 244 (SEQ ID NO: 429) and Figure 246 (SEQ ID NO: 431)
) An isolated PRO polypeptide having at least 80% sequence identity to an amino acid sequence selected from the group consisting of: 13. An isolated PRO polypeptide having at least 80% sequence identity to the amino acid sequence encoded by the nucleic acid molecule deposited under the ATCC accession number shown in Table 2. 14. A chimeric molecule comprising the polypeptide of claim 12 fused to a heterologous amino acid sequence. 15. The chimeric molecule according to claim 14, wherein the heterologous amino acid sequence is an epitope tag sequence. 16. The chimeric molecule according to claim 14, wherein the heterologous amino acid sequence is an immunoglobulin Fc region. 17. An antibody that specifically binds to the PRO polypeptide of claim 12. 18. The antibody according to claim 17, wherein the antibody is a monoclonal antibody. 19. The antibody according to claim 17, wherein the antibody is a humanized antibody. 20. The antibody according to claim 17, wherein the antibody is an antibody fragment. 21. Fig1 (SEQ ID NO: 3), Fig3 (SEQ ID NO: 5),
Fig5 (SEQ ID NO: 7), Fig7 (SEQ ID NO: 9), Fig9 (SEQ ID NO :)
11), Fig11 (SEQ ID NO: 16), Fig13 (SEQ ID NO: 21), Fi
g15 (SEQ ID NO: 23), Fig17 (SEQ ID NO: 28), Fig19 (SEQ ID NO: 30), Fig21 (SEQ ID NO: 32), Fig23 (SEQ ID NO: 40)
, Fig25 (SEQ ID NO: 42), Fig27 (SEQ ID NO: 49), Fig29
(SEQ ID NO: 51), FIG31 (SEQ ID NO: 53), FIG33 (SEQ ID NO :)
55), Fig35 (SEQ ID NO: 57), Fig37 (SEQ ID NO: 62), Fi
g39 (SEQ ID NO: 67), Fig41 (SEQ ID NO: 69), Fig43 (SEQ ID NO: 71), Fig45 (SEQ ID NO: 76), Fig47 (SEQ ID NO: 78)
, Fig49 (SEQ ID NO: 83), Fig51 (SEQ ID NO: 85), Fig53
(SEQ ID NO: 87), FIG55 (SEQ ID NO: 94), FIG57 (SEQ ID NO :)
99), Fig59 (SEQ ID NO: 101), Fig61 (SEQ ID NO: 103),
Figure 63 (SEQ ID NO: 110), Figure 65 (SEQ ID NO: 115), Figure 6
7 (SEQ ID NO: 117), FIG69 (SEQ ID NO: 122), FIG71 (SEQ ID NO: 127), FIG73 (SEQ ID NO: 129), FIG75 (SEQ ID NO: 1)
31), Fig77 (SEQ ID NO: 133), Fig79 (SEQ ID NO: 135),
Fig81 (SEQ ID NO: 137), Fig83 (SEQ ID NO: 139), Fig8
5 (SEQ ID NO: 141), FIG87 (SEQ ID NO: 143), Fig89 (SEQ ID NO: 145), Fig91 (SEQ ID NO: 147), FIG93 (SEQ ID NO: 1)
52), Fig95 (SEQ ID NO: 157), Fig97 (SEQ ID NO: 159),
Figure 99 (SEQ ID NO: 161), Figure 101 (SEQ ID NO: 169), Figure
103 (SEQ ID NO: 179), Fig105 (SEQ ID NO: 188), Fig10
7 (SEQ ID NO: 193), FIG109 (SEQ ID NO: 195), Fig111 (
Sequence number: 197), Figure113 (sequence number: 202), Figure115 (sequence number: 209), Figure117 (sequence number: 211), Figure119 (sequence number: 213), Figure121 (sequence number: 215), Figure123 (sequence number :). : 2
17), Fig125 (SEQ ID NO: 219), Fig127 (SEQ ID NO: 224)
), FIG129 (SEQ ID NO: 226), FIG131 (SEQ ID NO: 228),
Figure 133 (SEQ ID NO: 233), Figure 135 (SEQ ID NO: 235), Fi
g137 (SEQ ID NO: 242), Fig139 (SEQ ID NO: 247), Fig1
41 (SEQ ID NO: 252), Figure 143 (SEQ ID NO: 259), Figure 145
(SEQ ID NO: 264), FIG147 (SEQ ID NO: 266), FIG149 (SEQ ID NO: 268), FIG151 (SEQ ID NO: 270), FIG153 (SEQ ID NO: 272), FIG155 (SEQ ID NO: 274), FIG157 (sequence) number:
276), Figure 159 (SEQ ID NO: 281), and Figure 161 (SEQ ID NO: 28).
6), Figure 163 (SEQ ID NO: 291), Figure 165 (SEQ ID NO: 296)
, Figure 167 (SEQ ID NO: 301), FIG 169 (SEQ ID NO: 303), F
ig171 (SEQ ID NO: 305), FIG173 (SEQ ID NO: 307), FIG
175 (SEQ ID NO: 309), Fig177 (SEQ ID NO: 314), FIG17
9 (SEQ ID NO: 316), FIG181 (SEQ ID NO: 321), Fig183 (
SEQ ID NO: 323), Figure 185 (SEQ ID NO: 325), Figure 187 (SEQ ID NO: 327), Figure 189 (SEQ ID NO: 329), FIG 191 (SEQ ID NO: 331), FIG 193 (SEQ ID NO: 333), FIG 195 (SEQ ID NO:). : 3
35), Figure 197 (SEQ ID NO: 337), and Figure 199 (SEQ ID NO: 339).
), FIG201 (SEQ ID NO: 346), FIG203 (SEQ ID NO: 351),
Figure 205 (SEQ ID NO: 353), Figure 207 (SEQ ID NO: 355), Fi
g209 (SEQ ID NO: 357), Fig211 (SEQ ID NO: 363), Fig2
13 (SEQ ID NO: 365), Figure 215 (SEQ ID NO: 371), Figure 217
(SEQ ID NO: 373), FIG 219 (SEQ ID NO: 375), FIG 221 (SEQ ID NO: 377), FIG 223 (SEQ ID NO: 382), FIG 225 (SEQ ID NO: 384), FIG 227 (SEQ ID NO: 389), FIG 229 (sequence) number:
394), FIG. 231 (SEQ ID NO: 396), and FIG. 233 (SEQ ID NO: 40).
1), Figure 235 (SEQ ID NO: 405), Figure 237 (SEQ ID NO: 409)
, Figure 239 (SEQ ID NO: 414), Figure 241 (SEQ ID NO: 422), F
An isolated nucleic acid having at least 80% sequence identity to a nucleic acid sequence selected from the group consisting of those shown in ig242 (SEQ ID NO: 428) and Fig245 (SEQ ID NO: 430). 22. Fig1 (SEQ ID NO: 3), Fig3 (SEQ ID NO: 5),
Fig5 (SEQ ID NO: 7), Fig7 (SEQ ID NO: 9), Fig9 (SEQ ID NO :)
11), Fig11 (SEQ ID NO: 16), Fig13 (SEQ ID NO: 21), Fi
g15 (SEQ ID NO: 23), Fig17 (SEQ ID NO: 28), Fig19 (SEQ ID NO: 30), Fig21 (SEQ ID NO: 32), Fig23 (SEQ ID NO: 40)
, Fig25 (SEQ ID NO: 42), Fig27 (SEQ ID NO: 49), Fig29
(SEQ ID NO: 51), FIG31 (SEQ ID NO: 53), FIG33 (SEQ ID NO :)
55), Fig35 (SEQ ID NO: 57), Fig37 (SEQ ID NO: 62), Fi
g39 (SEQ ID NO: 67), Fig41 (SEQ ID NO: 69), Fig43 (SEQ ID NO: 71), Fig45 (SEQ ID NO: 76), Fig47 (SEQ ID NO: 78)
, Fig49 (SEQ ID NO: 83), Fig51 (SEQ ID NO: 85), Fig53
(SEQ ID NO: 87), FIG55 (SEQ ID NO: 94), FIG57 (SEQ ID NO :)
99), Fig59 (SEQ ID NO: 101), Fig61 (SEQ ID NO: 103),
Figure 63 (SEQ ID NO: 110), Figure 65 (SEQ ID NO: 115), Figure 6
7 (SEQ ID NO: 117), FIG69 (SEQ ID NO: 122), FIG71 (SEQ ID NO: 127), FIG73 (SEQ ID NO: 129), FIG75 (SEQ ID NO: 1)
31), Fig77 (SEQ ID NO: 133), Fig79 (SEQ ID NO: 135),
Fig81 (SEQ ID NO: 137), Fig83 (SEQ ID NO: 139), Fig8
5 (SEQ ID NO: 141), Fig87 (SEQ ID NO: 143), Fig89 (SEQ ID NO: 145), Fig91 (SEQ ID NO: 147), Fig93 (SEQ ID NO: 1)
52), Fig95 (SEQ ID NO: 157), Fig97 (SEQ ID NO: 159),
Figure 99 (SEQ ID NO: 161), Figure 101 (SEQ ID NO: 169), Figure
103 (SEQ ID NO: 179), Fig105 (SEQ ID NO: 188), Fig10
7 (SEQ ID NO: 193), FIG109 (SEQ ID NO: 195), Fig111 (
Sequence number: 197), Figure113 (sequence number: 202), Figure115 (sequence number: 209), Figure117 (sequence number: 211), Figure119 (sequence number: 213), Figure121 (sequence number: 215), Figure123 (sequence number :). : 2
17), Fig125 (SEQ ID NO: 219), Fig127 (SEQ ID NO: 224)
), FIG129 (SEQ ID NO: 226), FIG131 (SEQ ID NO: 228),
Figure 133 (SEQ ID NO: 233), Figure 135 (SEQ ID NO: 235), Fi
g137 (SEQ ID NO: 242), Fig139 (SEQ ID NO: 247), Fig1
41 (SEQ ID NO: 252), Figure 143 (SEQ ID NO: 259), Figure 145
(SEQ ID NO: 264), FIG147 (SEQ ID NO: 266), FIG149 (SEQ ID NO: 268), FIG151 (SEQ ID NO: 270), FIG153 (SEQ ID NO: 272), FIG155 (SEQ ID NO: 274), FIG157 (sequence) number:
276), Figure 159 (SEQ ID NO: 281), and Figure 161 (SEQ ID NO: 28).
6), Figure 163 (SEQ ID NO: 291), Figure 165 (SEQ ID NO: 296)
, Figure 167 (SEQ ID NO: 301), FIG 169 (SEQ ID NO: 303), F
ig171 (SEQ ID NO: 305), FIG173 (SEQ ID NO: 307), FIG
175 (SEQ ID NO: 309), Fig177 (SEQ ID NO: 314), FIG17
9 (SEQ ID NO: 316), FIG181 (SEQ ID NO: 321), Fig183 (
SEQ ID NO: 323), Figure 185 (SEQ ID NO: 325), Figure 187 (SEQ ID NO: 327), Figure 189 (SEQ ID NO: 329), FIG 191 (SEQ ID NO: 331), FIG 193 (SEQ ID NO: 333), FIG 195 (SEQ ID NO:). : 3
35), Figure 197 (SEQ ID NO: 337), and Figure 199 (SEQ ID NO: 339).
), FIG201 (SEQ ID NO: 346), FIG203 (SEQ ID NO: 351),
Figure 205 (SEQ ID NO: 353), Figure 207 (SEQ ID NO: 355), Fi
g209 (SEQ ID NO: 357), Fig211 (SEQ ID NO: 363), Fig2
13 (SEQ ID NO: 365), Figure 215 (SEQ ID NO: 371), Figure 217
(SEQ ID NO: 373), FIG 219 (SEQ ID NO: 375), FIG 221 (SEQ ID NO: 377), FIG 223 (SEQ ID NO: 382), FIG 225 (SEQ ID NO: 384), FIG 227 (SEQ ID NO: 389), FIG 229 (sequence) number:
394), FIG. 231 (SEQ ID NO: 396), and FIG. 233 (SEQ ID NO: 40).
1), Figure 235 (SEQ ID NO: 405), Figure 237 (SEQ ID NO: 409)
, Figure 239 (SEQ ID NO: 414), Figure 241 (SEQ ID NO: 422), F
An isolated nucleic acid having at least 80% sequence identity to the full length coding sequence of a nucleotide sequence selected from the group consisting of those shown in ig242 (SEQ ID NO: 428) or FIG245 (SEQ ID NO: 430). . 23. An isolated extracellular domain of a PRO polypeptide. 24. An isolated PRO polypeptide lacking a related signal peptide. 25. An isolated polypeptide having at least about 80% amino acid sequence identity to the extracellular domain of a PRO polypeptide. 26. An isolated polypeptide having at least about 80% amino acid sequence identity to a PRO polypeptide lacking a related signal peptide. 27. An isolated nucleic acid encoding the polypeptide of any one of claims 23-26.