JP2003516148A - Use of recombinant PIV as a vector to protect against infections and diseases caused by parainfluenza virus (PIV) and human pathogens - Google Patents

Abstract

(57) Abstract A chimeric parainfluenza virus (PIV) comprising a PIV vector genome or antigenome and one or more antigenic determinants of a heterologous PIV or non-PIV is provided. These chimeric viruses are infectious or attenuated in humans or other animals and form vaccines to elicit a disease response against one or more PIVs or against PIV and non-PIV pathogens It is useful in In addition, complete or partial PIV vector genomes or one or more heterologous genes or genomic segments encoding antigenic determinants of a heterologous PIV or non-PIV pathogen, matched or integrated with the complete or partial PIV vector genome Provided are polynucleotides and vectors comprising a chimeric PIV genome or antigenome, including a PIV vector genome or antigenome. In a preferred aspect of the invention, the chimeric PIV is a partially or fully human, bovine, human bovine chimera, PIV matched to one or more heterologous genomes or genomic segments from a heterologous PIV or non-PIV pathogen. The vector genome or antigenome, wherein the chimeric virus is attenuated for use as a vaccine by any of the mutations and nucleotide modifications introduced into the chimeric or antigenome.

Description

Detailed Description of the Invention

BACKGROUND OF THE INVENTION Human parainfluenza virus type 3 (HPIV3) is a common cause of severe lower respiratory tract infections in infants and children under the age of 1 year. It is next to the RS virus (RSV) as the leading cause of hospitalization for viral lower respiratory tract disease in this age group (Collins et al., P. 1205-1243. In BN Fields (Knipe
, Eds.), Field Virology, 3 ^rd ed., Vol. 1. Lippincott-Raven Publishe
rs, Philadelphia, 1996; Crowe et al., Vaccine 13: 415-421, 1995; Marx et al.,
J. Infect. Dis. 176: 1423-1427, 1997). Infection with this virus results in substantial morbidity in children under 3 years.

[0002] HPIV1 and HPIV2 are the principal etiologic agent of laryngotracheitis (croup) and also also causes severe pneumonia and bronchitis (Collins ^{like., 3 rd ed. In "} Fie
kds Virology, ”BN Fields, DM Knipe, PM Howley, RM Chanock, J.
L. Melnick, TP Monath, B. Roizman, and SE Straus, Eds., Vol. 1, pp
. 1205-1243. Lippincott-Raven Publishers, Philadelphia, 1996). In studies as long as 20 years or more, HPIV1, HPIV2 and HPIV3 were identified as etiological agents in 6.0, 3.2 and 11.5% of hospital admissions for airway patients, respectively, which is 18% of overall hospitalization, and for this reason: There is a need for effective vaccines (Murphy et al., Virus Res. 11: 1-15, 1988).

Parainfluenza virus has also been identified in a significant proportion in patients with virus-induced middle ear exudation in children with otitis media (Heikkinen et al.
, N. Engl. J. Med. 340: 260-4, 1999). Therefore, there is a need to generate a vaccine against these viruses that can prevent otitis media associated with severe lower respiratory tract disease and their HPIV infection. HPIV1, HPIV2 and HPIV3 are significantly crossed-
It is a clear serotype that does not elicit protective immunity.

Despite considerable efforts to develop effective vaccine therapies against HPIP, acceptable vaccines for either HPIV serotype or for ameliorating HPIV-related diseases are still available. Absent. To date, only two attenuated lives
PIV vaccine candidates have received particular attention. One of those candidates is HPI
A bovine PIV (BPIV3) strain that is antigenically related to V3 and has been shown to protect animals against HPIV3. BPIV3 is attenuated, genetically stable, and immunogenic in human infants and children (Karron et al., J. Inf. Dis. 17).
1: 1107-14, 1995a; Karron et al., J. Inf. Dis. 172: 1445-1450, 1995b). A second PIV3 vaccine candidate, JS cp45, is a cold-adapted variant of the JS wild type (wt) strain of HPIV3 (Karrn et al., J. Inf. Dis. 172: 1445-1450, 1995b.
Belshe et al., J. Med. Virol. 10: 235-42, 1982).

This viable, attenuated, cold-passaged (cp) PIV3 vaccine candidate is stable after viral replication in vivo, being temperature-sensitive (ts), cold-adapted ( ca)
, And an attenuated (att) phenotype. cp45 virus causes human PIV in experimental animals
3 Protected against attack, attenuated, genetically stable, and immunogenic in seronegative human infants and children (Hall et al., Virus Res.
22: 173-184, 1992; Karron et al., J. Inf. Dis. 172: 1445-1450, 1995b). The most prominent prospects to date are live attenuated viruses, because
Because they have been shown to be effective in non-human primates even in the presence of passively transferred antibodies, similar experimental conditions
Present in very young infants with antibodies obtained from their mother (Crowe et al.,
Vaccine 13: 847-855, 1995; Durbin et al., J. Infect. Dis. 179: 1345-1351,
1999).

Two attenuated live PIV3 vaccine candidates, a temperature-sensitive (ts) derivative of the wild-type PIV3 JS strain (designated PIV3 cp45) and a bovine PIV3 (BPIV3) strain, were evaluated clinically. Receiving (Karron et al., Pediatr. Infect. Dis. J. 15: 650-654, 19
96; Karron et al., J. Infect. Dis. 171: 1107-1114, 1995a; Karron et al., J.
Infect. Dis. 172; 1445-14450, 1995b). The attenuated live PIV3 cp45 vaccine candidate was derived from the JS strain of HPIV3 through successive passages in cell culture at low temperature, and was protective against HPIV3 challenge in experimental animals, and satisfactorily. Attenuated, genetically stable, and found to be immunogenic in seronegative human infants and children

(Belshe et al., J. Med. Virol. 10: 235-242, 1982; Belshe et al., Infect. Im
mun. 37: 160-5, 1982; Clements et al., J. Clin. Microbiol. 29: 1175-82, 19
91; Crookshanks et al., J. Med. Virol. 13: 243-9, 1984; Hall et al., Virus
Res. 22: 173-184, 1992; Karron et al., J. Infect. Dis. 172: 1445-1450, 1995.
b). Since those PIV3 candidate vaccine viruses are biologically derived, there is no proven method to regulate the level of attenuation, and thus this method is needed from ongoing clinical trials. It should be found.

Recombinant DNA technology has recently enabled the recovery of infectious negative-strand RNA from cDNAs to facilitate the progression of PIV vaccine candidates (Conzelmann, J. Gen. Virol. 77:
381-89, 1996; Palese et al., Proc. Natl. Acad. Sci. USA. 93: 11354-58, 19
96). In this situation, recombinant rescue is required in the presence of the necessary viral proteins.
Infectious RS virus (RSV), rabies virus (RaV), simian virus 5 (SV5), rinderpest virus, Newcastle disease virus (NDV), vesicular stomatitis virus (VSV) from cDNA-encoded antigenomic DNA Measles virus (MeV) and Sendai virus (SeV) have been reported

(For example, Garcin et al., EMBO J. 14: 6087-6094, 1995; Lawson et al., Proc.
Natl. Acad. Sci. USA 92: 4477-81, 1995; Radecke et al., EMBO J. 14: 577.
3-5784, 1995; Schnell et al., EMBO J. 13: 4195-203, 1994; Whelan et al., Pr.
oc. Nati. Acad. Sci. USA 92: 8388-92, Hoffman et al., J. Virol. 71. 427.
2-4277, 1997; Kato et al., Genes to Cells 1: 569-579, 1996, Roberts et al.,
Virology 247: 1-6, 1998; Baron et al., J. Virol. 71: 1265-1271, 1997; International Publication Number WO97 / 06270; Collins et al., Proc, Natl. Acad. Sci. USA 92: 1156
3-11567, 1995; U.S. Patent No. 08 / 892,403, filed July 15, 1997 (published International Application No. WO98 / 02530, and the following provisional priority US application No. 60 / 047,6
No. 34 (filed on May 23, 1997), No. 60/046, 141 (filed on May 9, 1997) and No. 60 / 021,773 (filed on July 15, 1996) );

US Patent Application No. 09 / 291,894 filed April 13, 1999: April 12, 2000
International Application No. PCT / US00 / 09695 filed on Apr. 9, claiming priority of provisional US Patent Application No. 6.0 / 129,006 filed on Apr. 13, 1999; Jun. 23, 2000 International application number PCT / US00 / 17755 filed (claiming priority of provisional US patent application 60 / 143,132 filed by Bucholz et al. On July 9, 1999); Ju
hasz et al., J. Virol, 71: 5814-5819, 1997; He et al., Virology 237: 249-260.
, 1997; Peters et al., J. Virol. 23: 5001-5009, 1999; Baron et al., J. Viro
l. 71: 1265-1271, 1997; Whitehead et al., Virology 247: 232-9, 1998a; Whitc
head et al., J. Virol. 72: 4467-4471, 1998b; Jin et al., Virology 251: 206-2.
14, 1998; Bucholz et al., J. Virol. 73: 251-259, 1999; and Whitehead et al.
, J. Virol. 73: 3438-3442, 1999, each of which is incorporated herein by reference).

With respect to the present invention, a method for producing HPIV with a wt phenotype from cDNA was recently developed for the recovery of infectious recombinant HPIV3 JS strains (eg Durbin et al.
., Viroogy 235: 323-332, 1997; US Patent Application No. 09 / 083,793 filed May 22, 1998 (Tentative US Patent Application No. 60/059 filed September 19, 1997)
, 385); and provisional US patent application filed May 23, 1997
60 / 047,575 (corresponding to International Patent Publication No. WO98 / 53078), each incorporated herein by reference). In addition, those disclosures include, for example, HPIV3 cp4
Mutations in 5 viruses identified their ts, ca and att phenotypes, and BPIV3
Allows the genetic engineering of the viral cDNA cone to determine the genetic basis of phenotypic changes in biological mutations, whose genes or genomic segments specify its attenuated phenotype.

[0012] Moreover, those and related disclosures enable the construction of novel PIV vaccine candidates with a wide variety of different mutations and assessment of their levels of attenuation, immunogenicity and phenotypic stability. (US patent application No. 09 / 586,479 filed on June 1, 2000 (tentative US patent application No. 60/143 filed on July 9, 1999)
, 134); and US patent application Ser. No. 09 / 350,821, filed by Durbin et al. On Jul. 9, 1999; each incorporated herein by reference).

Therefore, infectious wild type recombinant PIV3, (r) PIV3, and many ts derivatives are
, And a reverse gene system has been used to study the genetic basis of the attenuation of existing vaccine viruses, producing infectious viruses carrying defined attenuating mutations. It was For example, alone or in combination,
Three amino acid substitutions found in the L gene of cp45 were found to specify the ts and attenuated phenotype. Additional ts and attenuating mutations are present in other regions of PIV3 cp45. In addition, the chimeric PIV1 vaccine candidate contains a PIV1 open reading frame (ORF) in the PIV3 cDNA of sufficient length that contains three attenuating mutations in L.
) By replacing the PIV3 HN and F open reading frames by
It was generated using the PIV3 cDNA rescue system.

A recombinant chimeric virus derived from this cDNA is designated as rPIV3-1, cp45L (Skiadopoulos et al., J. Virol. 72: 1762-8, 1998; Tao et al., J.
Virol. 72: 2955-2961, 1998; Tao et al., Vaccine 17: 1100-1108, 1999; they are incorporated herein by reference). rPIV3-1, cp45L was attenuated in hamsters and elicited high levels of resistance to PIV1 challenge.
Yet another recombinant chimeric virus, designated rPIV3, cp45, containing 12 15 cp45 mutations, ie eliminating the mutations present in HN and F, was generated. This recombinant vaccine candidate is highly attenuated in the upper and lower respiratory tract of hamsters and induces high levels of protection against HPIV1 infection (Skiadopo
Ulos et al., Vaccine 18: 503-510, 1999).

Recently, much research has focused on the possible use of viral vectors to express foreign antigens for the development of vaccines against pathogens where other vaccines have been shown to be unsuccessful. Came. In this case, many reports suggest that exogenous genes can be conveniently inserted into recombinant negative-strand RNA viral genomes or antigenomes with different effects (Bukreyev et al., J. . Virol
70: 6634-41, 1996: Bukreyev et al., Proc, Natl. Acad. Sci. USA 96:23
67-72, 1999; Finke et al., J. Virol. 71: 7281-8, 1997; Hasan et al., J. Gen
Virol. 78: 2813-20, 1997; He et al., Virology 237: 249-60, 1997; Jin et al.
., Virology 251: 206-14, 1998; Johnson et al., J. Virol. 71: 5060-8, 1997;
Kahn et al., Virology 254: 81-91, 1999; Kretzschmar et al., J. Vorol. 71: 5.
982-9, 1997;

Mebatsion et al., Proc. Natl. Acad. Sci. USA 93: 7310-4, 1996; Moriya
Et al., FEBS Lett. 425: 105-11, 1998; Roberts et al., J. Virol. 73: 3723-32.
, 1999; Roberts et al., J. Virol. 72: 4704-11, 1998; Roberts et al., Virolo
gy 247: 1-6, 1998; Sakai et al., FEBS Lett 456: 221-226, 1999; Schnell et al.
., Proc. Natl. Acad. Sci. USA 93: 11359-65, 1996a; Schnell et al., J. V.
irol. 70: 2318-23, 1996b; Schnell et al., Cell 90: 849-57, 1997; Singh et al.
., J. Gen. Virol. 80: 101-6, 1999; Singh et al., J. Virol. 73: 4823-8, 199.
9; Spielhofer et al., J. Virol. 72: 2150-9, 1998, Yu et al., Genes to Cells.
2: 457-66 et al., 1999; US patent application Ser. No. 09/614, filed July 12, 2000.
, 285 (corresponding to provisional US patent application No. 60 / 143,425 filed July 13, 1999);

Each is incorporated herein by reference). When inserted into the viral genome under the control of viral transcription gene-initiation and gene-termination signals,
The foreign gene can be transcribed as another mRNA and produces significant protein expression. Surprisingly, it is often reported that the exogenous sequence is stable and capable of expressing a functional protein during many passages in vitro.

However, in order to conveniently develop a vector for vaccine use,
Simply showing a high and stable level of protein expression is insufficient. For example, this has been enabled by recombinant vaccine viruses and adenoviruses since the early to mid 1980s, and further, those vectors have been shown to be disappointing in the development of vaccines for human use. Similarly, most non-segmented negative chain viruses that have been developed as vectors are
It has no properties or immunization measures that can be used in humans.

An example of this case is the vesicular gastritis virus, except for a few experimental accidents,
Ungulate pathogens with no history of human administration; Sendai virus, mouse pathogens without history of human administration; Simian virus 5, canine pathogens with no history of human administration; And should be administered systemically, and is attenuated by measles virus that is neutralized by measles-specific antibodies present in almost all humans due to the widespread use of maternal antibodies and commercialized vaccines. Including strains.

Furthermore, some of these conventional vector candidates have the opposite effect, eg immunoregulation, which is not directly consistent with their use as vectors. Therefore, vectors should be identified whose growth characteristics, tropism and other biological properties make them suitable as vectors for human use. There is a further need to develop viable immunization methods, such as immunogenicity and effective routes of administration.

The three human mononegaviruses currently considered as vaccine vectors, measles, mumps and rabies virus, make them weak candidates for additional development as vectors. Have additional restrictions to combine. For example, the measles virus has been regarded as a vector for protective antigens of hepatitis B virus (Singh et al., J. Virol. 73: 4823-8, 1999). However, this combined measles virus-hepatitis B virus vaccine, such as the measles measles virus vaccine for commercial use, is given only after 9 months of age, whereas the current B
Hepatitis C virus vaccine is recommended for earlier infant use.

This is because the current commercial-use measles virus vaccine is parenterally administered and is very sensitive to maternal antibody neutralization and immunosuppression, and is therefore 9-15 months old. When administered in, it is not effective. Therefore, it cannot be used for vector antigens that cause disease in early infants, and thus for viruses such as RSV and HPIV. Another well-known characteristic effect of measles virus infection is virus-mediated immunosuppression, which can last for months. Immunosuppression is not a desired feature for vectors.

Attenuated measles virus vaccines, when administered at high doses, are associated with altered immune responses and excessive mortality, at least in part due to virus-induced immunosuppression, And this means that even the attenuated measles virus
Suggests that it is not suitable as a vector. Moreover, the use of measles virus as a vector is not consistent with the overall effect to eradicate this pathogen. In fact, for those reasons, the PIV vector terminating the use of live measles virus, and expressing the measles virus protective antigen, as described herein, provides the current measles virus vaccine. It is desired to replace.

Rabies virus, a rare cause of human infection, has been considered for use as a vector (Mebatsion et al., Proc. Natl. Acad. Sci.
USA. 93: 7310-4, 1996), but vectors that are 100% fatal to humans, particularly against the non-ubiquitous human pathogen rabies virus, are not required for the general population Therefore, it is unlikely that it could be developed for use as a viable, attenuated viral vector. Mumps and measles virus are of low pathogenicity, but infection with these viruses involves undesirable characteristics. Mumps virus infects the parotid gland and spreads to the testicles,
Sometimes it leads to infertility. The measles virus establishes viremia and the spreading features of its infection are exemplified by the associated spread rash. Parotitis and mild encephalitis during measles infection are not uncommon.

The measles virus is also associated with a rare progressive lethal neurological disease called subacute sclerosing encephalitis. In contrast, PIV infections and diseases in normal individuals are restricted to the respiratory tract, a site that is more favorable for immunization than the parenteral route. Viremia and spread to the second site occur in severely immunocompromised laboratory animals and humans, but this is not characteristic of typical PIV infection. Acute airway disease is the only disease associated with PIV. Therefore, the use of PIV as a vector, on the basis of their biological characteristics, may lead to complications, such as immunosuppression, interactions between peripheral lymphocytes and viruses, or secondary organs such as other complications. It will avoid leading to testicular or central nervous system infections.

The host of human pathogens for which a vector-based vaccine approach is desired is measles virus. Live attenuated vaccines have been available for over 30 years and have been very successful in eradicating measles disease in the United States. However, the World Health Organization causes more than 45 million measles patients each year, especially in developing countries, and the measles virus contributes to the death of about one million people daily. Presumed to be present.

Measles virus is a member of the genus Morbillivirus of the Paramyxoviridae family (Griffin et al., In “Fields Virol
ogy ”, BN Fields, DM Knipe, PM Howley, RM Chanock, JL Mel
nick, TP Monath, B. Roizman, and SE Straus, Eds., Vol. 1, p. 1267-
1312, Lippincott-Raven Publishers, Philadelphia, 1996). It is one of the most infectious agents known to humans and is transmitted from person to person through the respiratory tract (Griffin et al., In “Fields Virology”, BN Fields
, DM Knipe, PM Howley, RM Chanock, JL Melnick, TP Monath,
B. Roizman, and SE Straus, Eds., Vol. 1, p. 1267-1312, Lippincott-Ra.
ven Publishers, Philadelphia, 1996).

The measles virus has a complex etiology involving replication in both the respiratory tract and various systemic sites (Griffin et al., In “Fields Virology”, BN Fields,
DM Knipe, PM Howley, RM Chanock, JL Melnick, TP Monath, B
. Roizman, and SE Straus, Eds., Vol. 1, p. 1267-1312, Lippincott-Rave
n Publishers, Philadelphia, 1996).

Mucosal IgA and serum IgG measles virus-specific antibodies can participate in the control of measles virus, but in very young infants with measles virus-specific antibodies obtained from their mother. The absence of measles virus disease identifies serum antibodies as a major mediator of disease resistance (Griffin et al., In “Fields Virology”,
BN Fields, DM Knipe, PM Howley, RM Chanock, JL Melnick, T
P. Monath, B. Roizman, and SE Straus, Eds., Vol. 1, p. 1267-1312, L
ippincott-Raven Publishers, Philadelphia, 1996).

Two measles virus glycoproteins, hemagglutinin (HA) and fusion (
F) protein is a major neutralizing and protective antigen (Griffin et al., In “Fields V
irology ”, BN Fields, DM Knipe, PM Howley, RM Chanock, JL
Melnick, TP Monath, B. Roizman, and SE Straus, Eds., Vol. 1, p. 1
267-1312, Lippincott-Raven Publishers, Philadelphia, 1996).

The currently available live attenuated measles vaccines are administered parenterally (Griffin et al., In “Fields Virology”, BN Fields, DM Knipe, PM.
Howley, RM Chanock, JL Melnick, TP Monath, B. Roizman, and S.
E. Straus, Eds., Vol. 1, p. 1267-1312, Lippincott-Raven Publishers, Phil
adelphia, 1996). Both wild-type measles virus and vaccine virus are very easily neutralized by antibodies, and measles virus vaccine is non-neutralized by measles virus-specific neutralizing antibodies obtained from very low levels of mothers. Made infectious (
Halsey et al., N. Engl. J. Med. 313: 544-9, 1985; Osterhaus et al., Vaccine
16: 1479-81, 1998). Therefore, the vaccine virus is not given until the passively obtained maternal antibody is reduced to undetectable levels.

In the United States, measles virus vaccines are not given until 12 to 15 months of age, that is, until almost all children are easily infected with the measles virus vaccine. In developing countries, the measles virus
High mortality continues to occur in children aged 6-12 months (Gellin et al., J. Infect. Dis. 170: S 3-14, 1994; Taylor et al., Am. J. Epidemiol127.
: 788-94, 1988). This occurs because the measles virus, which is highly prevalent in those areas, can infect infants whose measles virus-specific antibody levels from mothers have been reduced to unprotected levels.

Therefore, there is a need for a measles virus vaccine that can elicit a protective immune response, even in the presence of measles virus neutralizing antibodies, to eradicate measles virus diseases that occur within 6 months of age. There have been many attempts to develop immunization measures to protect 6-12 month old infants against measles virus, but to date none of them is effective.

The first means for developing an early measles vaccine is to use a commercially attenuated live measles virus vaccine for infants around 6 months of age by one of two methods: Administration was included (Cutts et al., Biologicals 25: 323-38, 1997). In one common protocol, the live attenuated measles virus is introduced intranasally by droplets to initiate infection of the respiratory tract (Black et al., New Eng. J. Med.
263: 165-169, 1960; Kok et al., Trans. R. Soc. Trop. Med. Hyg. 77: 171-6, 1
983; Simasathien et al., Vaccine 15: 329-34, 1997) or by aerosol in the lower respiratory tract (Sabin et al., J. Infect. Dis. 152: 1231-7, 1985). In the second protocol, measles virus was administered parenterally at higher doses than those used for current vaccines.

Administration of vaccines capable of replicating on mucosal surfaces has been successfully achieved in early infants with attenuated live poliovirus and rotavirus vaccines (Melnick et al., In “Fields Virology”, BN Knipe. , PM Howley, RM
Chanock, JL Melnick, TP Monath, B. Roizman, and SE Straus, Eds.,
Vol. 1, p. 655-712. 2 vols. Lippencott-Raven Publishers, Philadelphia, 19
96; Perez-Schael et al., N. Engl. J. Med. 337: 1181-7, 1997). Perhaps this is because the passively obtained IgG antibodies are closer to the mucosal surface than to the systemic site of viral replication. In this case, the live attenuated polyvirus vaccine virus can infect the gastrointestinal tract or mucosal surface of the respiratory tract of infants with maternal antibodies, leading to the induction of a protective immune response.

Therefore, a suitable method is to immunize an infant through the respiratory tract with an attenuated live measles virus vaccine, as this is the natural route of infection by the measles virus. However, the attenuated live measles virus that is transmitted by the parenteral route is not consistently transmitted by the intranasal route (Black et al., New Eng. J. Med. 263: 165-169, 1960; Cutts et al. ., Biologicals 25: 32
3-38, 1997; Kok et al., Trans. R. Soc. Trop. Med. Hyg. 77: 171-16, 1983; Si
masathien et al., Vaccine 15: 329-34, 1997), and this reduced infectivity was particularly apparent for the current vaccine strain, the Schwarts strain of the measles virus vaccine.

Presumably, during the attenuation of this virus by passage in tissue culture cells of avian origin, the virus loses a significant amount of infectivity due to the human upper respiratory tract. In fact, a hallmark of measles virus biology is that the virus undergoes rapid changes in its biological properties when grown in vitro. Since this relatively simple route of immunization has not been successful, a second approach was attempted involving the administration of a viable viral vaccine by aerosol into the lower respiratory tract (Cutts et al., Biological.
s 25: 323-38, 1997; Sabin et al., J. Infect. Dis. 152: 1231-7, 1985).

Infection of infants with aerosol administration of the measles virus vaccine was achieved in a highly suppressed experimental study, but reproducible with the aerosol attenuated live measles virus vaccine in non-cooperative infants. It was impossible to supply to (Cutts et al., Biologicals 25: 323-38, 1997). In another attempt to immunize 6-month-old infants, a measles virus vaccine was given parenterally at a 10-100 fold elevated dose (Markowitz et al., N. Engl. J. Med. .322
: 580-7, 1990). High-titer survival measles vaccination improved seroconversion in 4-6 month old infants, but there was an associated increase in mortality in later high-titer vaccine recipients (Gellin et al. , J. Infect. Dis. 170: S3-14, 1994;
Holt et al., J. Infect. Dis. 168: 1087-96, 1993; Markowitz et al., N. Engl.
J. Med. 322: 580-7, 1990), and this immunization approach was abandoned.

The second means so far studied for measles virus vaccines is the inactivated measles virus, especially the formalin inactivated whole measles virus or sub-prepared from measles virus. Was the use of a unit virus vaccine (
Griffin et al., In “Fields Virology”, BN Fields, DM Knipe, PM H
owley, RM Chanock, JL Melnick, TP Monath, B. Roizman, and SE
Straus, Eds., Vol. 1, p. 1267-1312, Lippincott-Raven Publishers, Philad
elphia, 1996). However, the clinical use of vaccines in the 1960s
Viral vaccines that represent a very severe complication, ie inactivated, enhanced the disease rather than prevent it (Fulginiti et al., JAMA 202: 1075-80.
, 1967). This was first observed with a formalin-inactivated measles virus vaccine (Fulginiti et al., JAMA 202: 1075-80, 1967).

Initially, the vaccine prevented measles, but after a few years, the vaccine lost their resistance to infection. When subsequently infected by naturally circulating measles virus, the vaccine developed an atypical disease with exacerbated systemic symptoms and pneumonia (Fulginiti et al., JAMA 202: 1075-80. , 1967; Nade
r et al., J. Pediatr. 72: 22-8, 1968; Rauh et al., Am. J. Dis. Child 109: 23.
2-7, 1965). A retrospective analysis showed that formalin inactivation destroyed the ability of the measles fusion (F) protein to elicit hemolytic-inhibitory antibodies, but it
It was shown that the ability of the HA (hemagglutinin or binding) protein to induce neutralizing antibodies was not disrupted (Norrby et al., J. Infect. Dis. 132: 262-9, 1975; Norrby et al., Infect. . Immun. 11: 231-9, 1975).

If the immunity induced by the HA protein is weak enough to allow massive infection by wild-type measles virus, it is altered, and sometimes more severe disease at the site of measles virus replication. Seen (Bellanti, Pediatrics 48: 715-29, 19
71; Buser, N. Engl. J. Med, 277: 250-1, 1967). This atypical disease is Th
-2 cells appear to be mediated in part by an altered cell-mediated immune response that is selectively elicited to lead to enhanced disease manifestation at the site of viral replication (Polack et al.,. Nat. Med. 5: 629-34, 1999). For this experiment with non-viable measles virus vaccines, and also in human infants, the immunogenicity of such parenterally administered vaccines can be reduced by passively infected antibodies. There was considerable reluctance to evaluate the vaccine. It should be noted that the exacerbation of the disease seems to be associated only with the killed vaccine.

Yet another means that has been studied to develop a vaccine against measles for use in infants is the use of viral vectors to express protective antigens of measles virus. (Drillien et al. Proc. Natl: Acad. Sci. USA85:
1252-6, 1988; Fooks et al., J. Gen. Virol. 79: 1027-31, 1998, Schnell et al.
, Proc. Natl. Acad. Sci. USA 93: 11359-65, 1996a; Taylor et al., Virology
187: 321-8, 1992; Wild et al., Vaccine 8: 441-2, 1990; Wild et al., J. Gen.
Virol. 73: 359-67, 1992).

Various vectors have been studied, for example poxviruses, such as replication competent vaccinia virus or replication-defective modified vaccinia virus Ankara (MVA) strains. Replication-competent vaccinia recombinants expressing the measles virus F or HA glycoproteins were effective in immunologically pure vaccines. However, their immunogenicity and protective efficacy were greatly diminished when they were parenterally administered in the presence of passive antibodies against measles virus (Gall.
etti et al., Vaccine 13: 197-201, 1995; Osterhaus et al., Vaccine 16: 1479-81.
, 1998; Siegrist et al., Vaccine 16: 1409-14, 1998; Siegrist et al., Dev. Bio
l. Stand. 95: 133-9, 1998).

Replication-competent vaccia recombinants expressing RSV protective antigens have also been shown to be ineffective in eliciting protective immune responses when parenterally administered in the presence of passive antibodies. (Murphy et al., J. Virol. 62: 3907-10, 1988a), but they readily protected such hosts when administered intranasally. Unfortunately, replication-competent vaccinia virus recombinants are not effectively attenuated for use in immunocompromised hosts, such as individuals with human immunodeficiency virus (HIV) infection (Fenner Et al., World Health Organization, Geneva, 19
88; Redfield et al., N. Engl. J. Med. 316: 673-676, 1987), and intranasal administration to immunocompetent individuals is problematic. Therefore, they are not pursued as vectors for use in human infants, some of whom are infected with HIV.

MVA vector obtained by more than 500 passages in chick embryo cells (Mayr et al., I
nfection 3: 6-14, 1975; Meyer et al., J. Gen. Virol. 72: 1031-1038, 1991).
Has also been evaluated as a potential vaccine vector for several paramyxovirus protective antigens (Durbin et al., J. Infect. Dis. 179: 1345-51, 19).
99a; Wyatt et al., Vaccine 14: 1451-1458, 1996).

MVA is a highly attenuated host range mutant that replicates well in avian cells, but not in cells from most mammalian cells, such as monkeys and humans (Blanchard et al., J. Gen. Virol. 79: 1159-1167, 1998; Carroll et
al., Virology 238: 198-211, 1997; Drexier et al., J. Gen. Virol. 79: 347-3.
52, 1998; Sutter et al., Proc. Natl. Acad. Sci. USA 89: 10847-10851, 1
992).

Avian pox vaccine vector with host range restriction similar to MVA was also constructed to express the measles virus protective antigen (Taylor et al., Virology 187: 321-8, 1992).
). MVA is avirulent in immunocompromised hosts and has been administered to large numbers of humans without incidental events (Mayer et al., Zentralbl. Bakteriol. [B]) 167: 37.
5-90, 1978; Stickle et al., Dtsch. Med. Wochenschr. 99: 2386-92, 1974; We
rner et al., Archives of Virology 64: 247-256, 1980).

Unfortunately, the immunogenicity and potency of MVA expressing paramyxovirus protective antigens, whether delivered by the parenteral route or by the topical route, is
Inhibited in passively immunized rhesus monkeys (Durbin et al., Virology 23
5: 323-332, 1999). DNA expressing the measles virus protective antigen delivered parenterally
The immunogenicity of the vaccine was also reduced in passively immunized hosts (Siegrist et al.,
Dev. Biol. Stand. 95: 133-9, 1998). Replication-defective vectors expressing measles virus protective antigens, such as adenovirus-measles virus HA recombinants, are currently being evaluated (Fooks et al., J. Gen. Virol. 79: 1027-31, 1998).

In this context, MVA recombinants expressing parainfluenza virus antigens, unlike replication competent vaccinia virus recombinants, are administered by mucosal route to animals with passively acquired antibodies. , Which lack protective efficacy, or similar pox vectors, can be used in infants with measles virus antibodies acquired from the mother.

Based on the reports summarized above, replication-competent or replication-defective poxviruses expressing the measles virus protective antigen, or DNA vaccines, carry measles virus-specific antibodies from a passively acquired mother. It does not appear to be reasonably immunogenic or effective in infants.

A replication-competent virus vector expressing measles virus HA, which has been recently developed and replicates in the respiratory tract of an animal host, is vesicular stomatitis virus, which is La grape rus that naturally infects cattle but not humans. (VSV) developed (Roberts
et al., J. Virol. 73: 3723-32, 1999; Schnell et al., Proc. Natl. Acad. S
ci. USA 93: 11359-65, 1996a). Since VSV is an animal virus that can cause disease in humans, the development of this recombinant for use in humans requires that a VSV backbone that is well attenuated in human infants be first identified ( Rober
ts et al., J. Virol. 73: 3723-32, 1999), but clinical trials have not started.

While many advances have been made towards the development of effective vaccines against PIV and other pathogens, such as measles, however, there are serious health problems due to these pathogens, especially among young infants. Clearly there is still a need in the art for additional tools and methods for engineering safe and effective vaccines for mitigation.

The remaining challenge in this context is the additional tool of generating appropriately attenuated immunogenic and genetically stable vaccine candidates for use in diverse clinical settings against one or more pathogens. Is the need of. To facilitate these goals, existing methods for identifying and incorporating attenuating mutations in recombinant vaccine strains and for developing vector-based vaccines and immunization strategies must be expanded. I won't. Surprisingly, the present invention fulfills these needs and provides additional advantages as described herein below.

SUMMARY OF THE INVENTION The present invention is directed to PIV and one or more PIV in a host that is infectious in humans and other mammals and is suspected of being infected with or from one or more PIVs. Provided are chimeric parainfluenza viruses (PIV) that are useful in various compositions to generate the desired immune response against additional pathogens. In a preferred aspect, the present invention designs and produces attenuated chimeric PIVs that are useful as vaccine agents for preventing and / or treating infections by PIV and one or more additional pathogens and associated disease symptoms. Provide a new method for

Included within these aspects of the invention is merging with one or more heterologous genes or genomic segments encoding single or multiple antigenic determinants of one heterologous pathogen or of multiple heterologous pathogens. Partial or complete
Novel isolated polynucleotide molecules and vectors incorporating such molecules, including chimeric PIV genomes or antigenomes, including PIV vector genomes or antigenomes. Further provided within the invention are methods and compositions incorporating a selected PIV and one or more heterologous pathogens, such as a heterologous PIV or a non-PIV pathogen, such as a chimeric PIV for the prevention and treatment of infection by a measles virus. It is a thing.

The invention thus provides a chimera-based livestock based on subinfluenza particles that are recombinantly modified to incorporate one or more antigenic determinants of a parainfluenza virus or heterologous pathogen (s). Methods and compositions for developing vaccine candidates are included. The chimeric PIV of the present invention is constructed by a cDNA-based virus recovery system. Recombinant chimeric PIV made from cDNA replicates separately and is propagated in a manner similar to the biologically derived virus.

Recombinant virus is a vector (ie, “recipient” or “background”) PIV genome or antigene, and one of the different PIV or heterologous pathogens.
It is engineered to incorporate nucleotide sequences from both one or more heterologous "donor" sequences that encode one or more antigenic determinants to produce an infectious chimeric virus or subviral particle. In this manner, candidate vaccine viruses are recombinantly engineered to generate an immune response against one or more PIVs in a suspected infected mammalian host, or a multispecific response against selected PIVs and non-PIV pathogens. Withdraw.

Preferably a PI from which a heterologous sequence encoding the antigenic determinant (s) is obtained
The V and / or non-PIV pathogen (s) is a human pathogen and the host is a human host. More preferably, the vector PIV is human PIV, but non-human
PIV, such as bovine PIV (BPIV), can be used as a vector to incorporate antigenic determinants of human PIV and other human pathogens. The chimeric PIV of the invention may elicit an immune response against a particular PIV, such as HPIV1, HPIV2, HPIV3, or a multispecific immune response against multiple PIVs, such as HPIV1 and HPIV2. Alternatively,
The chimeric PIV of the invention can elicit a multispecific immune response against one or more PIV and non-PIV pathogens, such as measles virus.

An exemplary chimeric PIV of the present invention incorporates a chimeric PIV genome or antigenome as described above, as well as a major nucleocapsid (N) protein, nucleocapsid phosphoprotein (P) and large polymerase protein (L). Additional PIV proteins are included in various combinations to provide a range of infectious subviral particles up to complete viral particles, or viral particles containing extra proteins, antigenic determinants or other additional components. You can

The chimeric PIV of the present invention comprises one or more heterologous gene (s) or genomic segment (s) of different PIV or other pathogens to produce a chimeric PIV genome or antigenome. It comprises a partial or complete “vector” PIV genome or antigenome obtained from or subsequently patterned from the combined human or non-human PIV. In a preferred aspect of the present invention, chimeric P
IV is a partial or fully human PIV vector genome combined with a secondary human PIV or non-PIV pathogen, eg, one or more heterologous gene (s) or genomic segment (s) from measles virus or Incorporate antigenome.

The PIV “vector” genome or antigenome is typically one of the heterologous pathogens.
Acts as a recipient or carrier to which is added or incorporated one or more "donor" genes or genomic segments. Typically, a polynucleotide encoding one or more antigenic determinants of a heterologous pathogen is added to or substituted in the vector genome or antigenome to form the chimeric
It produces PIV and thus acquires the ability to elicit an immune response in the host of choice against a heterologous pathogen. In addition, chimeric viruses may exhibit other novel phenotypic characteristics compared to one or both of vector PIV and heterologous pathogens.

For example, the addition or substitution of a heterologous gene or genomic segment within the vector PIV strain results in increased attenuation, growth changes or other The desired phenotypic changes are produced additionally or separately. In one aspect of the invention, the chimeric PIV incorporates a large polynucleotide insert that specifies the level of attenuation in the resulting chimeric virus, depending on the size of the insert, for greater potency as a vaccine candidate. Is attenuated.

Preferred chimeric PIV vaccine candidates of the invention are human PIVs such as HPIV1, HPIV2.
Alternatively, it harbors one or more major antigenic determinants of HPIV3 and thus elicits an effective immune response against the selected PIV in the human host. An antigenic determinant that is specific to a selected human PIV can be encoded by the vector genome or antigenome, or can be inserted into or linked to the PIV vector genome or antigenome as a heterologous polynucleotide sequence from a different PIV. . The major protective antigens of human PIV are their HN and F glycoproteins, but other proteins may also be involved in protective or therapeutic immune responses.

In this context, both humoral and cell-mediated immune responses are beneficially elicited by the representative vaccine candidates within the present invention. Thus, a polynucleotide encoding an antigenic determinant that is present in the vector genome or antigenome, or that can be integrated therewith as a heterologous gene or h-segment-free segment, is
One or more PIV N, P, C, D, V, M, F, HN and / or from human PIV
Alternatively, it may encode L protein (s) or selected immunogenic fragment (s) or epitope (s) thereof.

In addition to having one or more selected major antigenic determinants of human PIV, preferred chimeric PIV vaccine viruses of the present invention include one or more secondary human PIV or non-PIV pathogens. Possesses the major antigenic determinants of. In a favorable case, chimeric PIV
Includes a partial or fully human PIV (HPIV) genome or antigenome, such as a vector genome or antigenome that is a genome or antigenome of HPIV3, and further comprises an antigen determination of at least one heterologous PIV, such as HPIV1 and / or HPIV2. It comprises one or more heterologous gene (s) or genomic segment (s) encoding a group.

Preferably the vector genome or antigenome is a partial or complete HPIV3
A heterologous gene (1) that is genomic and encodes the antigenic determinant (s)
Or multiple) or genomic segment (s) is of one or more heterologous HPIV (s). In an alternative embodiment, the one or more genes or genomic segments encoding one or more antigenic determinants of HPIV1 are added to or in a partially or complete HPIV3 genome or antigenome. Can be replaced.

Preferably, the HPIV1 antigenic determinant (s) is selected from HPIV1 HN and F glycoproteins and comprises one or more antigen domains, HN and / or F.
It includes fragments or epitopes of glycoproteins. In various preferred embodiments, the HPIV1 genes encoding HN and F glycoproteins are both replaced in place of the counterpart HPIV3 HN and F genes in the HPIV3 vector genome or antigenome. These constructs yield chimeric PIV that elicit a mono- or multi-specific immune response in humans against HPIV3 and / or HPIV1.

In an additional embodiment, one encoding one or more antigenic determinants of HPIV2
One or more genes or genomic segments are added to or incorporated into the partial or complete HPIV3 genome or antigenome to degenerate the resulting chimera against HPIV2 alone or against HPIV3 and HPIV2. Generates additional immunospecificity. In a more detailed aspect, one or more
One or more HPIV2 genes or genomic segments encoding HN and / or F glycoproteins, or antigenic domains, fragments or epitopes thereof, may be added to or part of the partial or complete HPIV3 vector genome or antigenome. Incorporated into.

In yet another aspect of the invention, a multiple heterologous gene or genomic segment encoding an antigenic determinant of multiple heterologous PIV is attached to a partial or complete PIV vector genome or antigenome, preferably an HPIV vector genome or antigenome. Or incorporated therein. In a preferred embodiment HPIV1 and HPIV2
A heterologous gene or genomic segment encoding an antigenic determinant from both of. Is added to or incorporated into the partial or complete HPIV3 vector genome or antigenome.

In a more detailed aspect, one or more HPIV1 genes or genomic segments (or antigenic domains, fragments or epitopes thereof) encoding one or more HN and / or F glycoproteins, and HN And / or one or more HPIV2 genes or genomic segments encoding F-glycoprotein, their antigenic domains, fragments or epitopes may be partial or complete HPIV
3 Added to or integrated into the vector genome or antigenome.

In one example, the HPIV1 gene encoding HN and F glycoproteins has a pair of partial HPIV3
Substitution in place of the HN and F genes to form a chimeric HPIV3-1 vector genome or antigenome, which further comprises one or more genes or gene segments encoding single or multiple antigenic determinants of HPIV2 Are modified by the addition or incorporation of This is readily accomplished within the present invention, for example by adding or substituting transcription units that include the open reading frame (ORF) of HPIV2 HN in the chimeric HPIV3-1 vector genome or antigenome. In accordance with this method, the invention is exemplified to produce chimeric PIVs having HPIV1 and HPIV2 antigenic determinants, as exemplified by vaccine candidates rPIV3-1.2HN and rPIV3-1cp45.2HN described herein below. Specific constructs are provided.

In another aspect of the invention, the chimeric PIV of the invention is based on the human PIV vector genome or antigenome used as a recipient for the incorporation of major antigenic determinants from non-PIV pathogens. Chimeras with one or more antigenic determinants
Pathogens that can be adapted to PIV vaccine candidates include measles virus, RS virus of subgroups A and B, mumps virus, human papilloma virus, human immunodeficiency virus types 1 and 2, herpes simplex virus, Examples include, but are not limited to, cytomegalovirus, rabies virus, Epstein-Barr virus, filovirus, bunyavirus, flavivirus, alphavirus and influenza virus.

This population of pathogens that can thus be targeted for vaccine development by the methods of the present invention is only an example, and the use of PIV to carry antigenic determinants indicates that additional pathogens are large in size. Those of skill in the art understand that it extends widely to the host.

Thus, in various alternative aspects of the invention, the human PIV genome or antigenome may be used as a vector for the incorporation of one or more major antigenic determinants from a wide range of non-PIV pathogens. . Representative major antigens that can be incorporated into the chimeric PIV of the invention include measles virus HA and F proteins, subgroup A
And subgroup B RS virus F, G, SH and M2 proteins, mumps HN and F proteins, human papillomavirus L1 protein, human immunodeficiency virus type 1 and 2 gp160 protein, herpes simplex virus and Cytomegalovirus gB, gC, gD, gE, gG, gH, gI, gJ, gK, gL and gM proteins, rabies virus G protein, Epstein-Barr virus gp350 protein, filovirus G protein, bunyavirus G protein, flavi Viral E and NS1 proteins, and alphavirus E proteins are included, but are not limited to.

Various human PIV vectors elicit one or more specific humoral or cell-mediated immune responses against the antigenic determinant (s) carried by the chimeric vaccine virus and are therefore sensitive It can be used to carry a heterologous antigenic determinant of a non-PIV pathogen to elicit an effective immune response against a wild-type "donor" pathogen in the host. In a preferred embodiment, one or more heterologous genes or genomic segments from the donor pathogen are linked or inserted into the partial or complete HPIV3 genome or antigenome.

Alternatively, the heterologous gene or genome segment is integrated within a chimeric HPIV vector genome or antigenome, eg, a partial or complete HPIV3 genome or antigenome carrying one or more genes or genome segments of a heterologous PIV. obtain. For example, the gene (s) or genomic segment (s) encoding the antigenic determinant (s) of the non-PIV pathogen are replaced by HN and F glycoproteins in place of the paired HPIV3HN and F genes. Can be combined with a partially or fully chimeric HPIV3-1 vector genome or antigenome, eg, having one or both of the HPIV1 genes encoding

Alternatively, the gene (s) encoding the antigenic determinant (s) of the non-PIV pathogen (
One or more) or genomic segment (s) as described above
1 or HPIV3 vector genome or antigenome, or a chimeric HPIV3-1 vector genome or antigenome within a single or multiple antigenic determinants of HPIV2, such as H
It can be combined with a partial or complete chimeric genome or antigenome incorporating the PIV2HN gene. The heterologous gene (s) or genomic segment (s) encoding one or more measles antigenic determinant (s) may be a PIV vector or chimeric PIV vector disclosed herein. Can be merged with either.

In the examples provided herein, the vector genome or antigenome is
Partial or complete HPIV3 genome or antigenome, or partial or complete HPIV3 genome having one or more genes or genomic segments encoding antigenic determinant (s) of a heterologous HPIV added or incorporated therein Or a chimeric HPIV genome or antigenome containing antigenome. In one such chimeric construct, the open reading frame (ORF) of the measles virus HA gene is used.
) Is added to the HPIV3 vector genome or antigenome in various ways to obtain a good chimeric PIV / measles vaccine candidate rPIV3 (HA HN-L), rPIV3 (HA N
-P), rcp45L (HA NP), rPIV3 (HA PM) or rcp45L (HA PM).

In an additional embodiment, the PIV vector genome or antigenome is one or more encoding one or more antigenic determinant (s) of HPIV added or incorporated therein. Is a chimeric HPIV genome or antigenome containing a partial or complete HPIV3 genome or antigenome with the gene (s) or genome segment (s) of. This construct can be used, for example, as a vector for measles virus, wherein the heterologous antigenic determinant (s) is / are selected from measles virus HA and F proteins and their antigenic domains, fragments and epitopes. ..

In one example, the transcription unit containing the open reading frame (ORF) of the measles virus HA gene is HPI.
HPIV3 with both HN and F ORF replaced by HN and F ORF of V1 HPIV3-1
Added to or integrated into the vector genome or antigenome. Recombinants in this category are vaccine candidates identified herein below as rPIV3-1HAP-M or rPIV3-1HAP-Mcp45L.

In another detailed embodiment of the invention, the partial or complete PIV vector genome or antigenome is one or more “extra” (ie present or mutant in the wild type vector, Chimera PIV genome or antigenome, eg, combined with heterologous gene (s) or genomic segment (s) (additional to the full complement of genes, whether present in the chimeric vector backbone) To form. Vector genomes or antigenomes are often complete HPIV3 or HPIV3-1 chimeric genomes or antigenomes, and extra heterologous gene (s) or genomic segment (s) are HPIV1HN, HPIV1F, HPI
It is selected from V2HN, HPIV2F, measles HA and / or translationally asymptomatic synthetic gene units.

In one embodiment, one or both of HPIV1HN and / or HPIV2HN ORF (s) is inserted into the HPIV3 vector genome or antigenome, respectively. In a more detailed embodiment, HPIV1HN, HPIV2HN and measles virus HA ORF
Are inserted between the N / P, P / M and HN / L genes, respectively. Or HP
The IV1HN and / or HPIV2HN genes are inserted between the N / P and P / M genes, respectively, and the 3918-ntGU insert is added between the HN and L genes.

Recombinants of this category are rPIV3 1HNN-P, rHPIV3 1HNP-M, rHPIV3 2HNN-P, rHPI.
V3 2HNP-M, rHPIV3 1HNN-P 2HNP-M, rHPIV3 1HNN-P 2HNP-M HAHN-L and rHPIV3
Vaccine candidate identified herein below as 1HNN-P 2HNP-M3918GUHN-L.

Thus, the contemplated and constructed chimeric PIV of the present invention may contain 1, 2, 3, 4 or more protective antigens from different pathogens. For example, HPIV3, H
Vaccine candidates containing protective antigens from 1 to 4 pathogens selected from PIV1, HPIV2 and measles virus are provided. To construct such multispecific vaccine candidates, 30% to 50% or more (eg 15,462 nt wild type)
One or more extra heterologous gene (s) or genomic segment (s) capable of adding the full length of the extra foreign sequence (compared to the HPIV3 genome length) to the recombinant genome or antigenome Can be added.

Addition of one or more extra heterologous gene (s) or genomic segment (s) in this context often results in at least 10-100 minutes of replication in the upper and / or lower respiratory tract. 1, often 100-1,000 times less,
We then identify chimeric PIVs with an attenuated phenotype that show reductions of up to 1,000-10,000 fold or less.

To construct the chimeric PIV clones of the invention, a heterologous gene or genomic segment of the donor PIV or non-PIV pathogen is added or replaced at any operable position in the vector genome or antigenome. To be done. Often, the position of the gene or gene segment substitution corresponds to the wild type gene order position of the counterpart gene or genomic segment within the partial or complete PIV vector genome or antigenome. In other embodiments, the heterologous gene or genome segment is located at a position that is more proximal to or more distal to the promoter than the wild-type gene order position of the counterpart gene or genome segment in the background genome or antigenome. Added or substituted to enhance or reduce expression of a heterologous gene or genomic segment, respectively.

In a more detailed aspect of the invention, a heterologous genomic segment, eg, a genomic segment encoding an immunogenic ectodomain of a heterologous PIV or non-PIV pathogen, is a PIV
Cytoplasmic tails and / or membranes of one PIV substituted for the corresponding genomic segment in the counterpart gene in the vector genome or antigenome and fused to a chimeric protein, eg, the ectodomain of another PIV or non-PIV pathogen This results in a construct that encodes a fusion protein with a transmembrane domain. In an alternative embodiment, the chimeric PIV genome or antigenome may encode a multispecific chimeric glycoprotein in a recombinant virus or subviral particle that has immunogenic glycoprotein domains or epitopes from two different pathogens. Can be engineered.

In yet another embodiment, a heterologous gene or genomic segment from one PIV or non-PIV pathogen is added within the PIV vector genome or antigenome (ie, without replacement) and the resulting clone It may give rise to new immunogenic properties. In these cases, the heterologous gene or genome segment was added as an extra gene or genome segment, in combination with the complete PIV vector genome or antigenome, for the additional purpose of attenuating the resulting chimeric virus. Can be done. Alternatively, a heterologous gene or genome segment can be added with a deletion of the selected gene or genome segment in the vector genome or antigenome.

In a preferred embodiment of the invention, the heterologous gene or genomic segment is added at an intergenic position within the partial or complete PIV vector genome or antigenome. Alternatively, the gene or genome segment can be inserted within other non-coding regions of the genome, such as within the 5'or 3'non-coding regions, or at other positions where non-coding nucleotides occur within the vector genome or antigenome. In some cases, a heterologous gene or genome within the vector genome or antigenome at a non-coding site corresponding to or overlapping with a cis-acting regulatory sequence within, for example, a sequence required for efficient replication, transcription and / or translation. It is desirable to insert a segment. These regions of the vector genome or antigenome represent target sites for disruption or modification of regulatory functions associated with the introduction of heterologous genes or genomic segments.

For the preferred purpose of constructing candidate vaccine viruses for clinical use, the chimeric PI of the invention by introducing additional mutations that increase or decrease the level of attenuation in the recombinant virus. It is often desirable to adjust the site's attenuated phenotype. Therefore, in an additional aspect of the invention, the chimeric genome or antigenome is further enhanced by introducing one or more attenuating mutations that specify the attenuating phenotype in the resulting virus or subviral particle. A modified, attenuated chimeric PIV is generated. These attenuating mutations are generated de novo and tested for well-known rational design mutagenesis strategies and thus attenuating effects. Alternatively, the attenuating mutation is an existing biologically derived mutant PIV.
Alternatively, it may be identified in other viruses and thus incorporated into the chimeric PIV of the invention.

A preferred attenuating mutation in the latter situation is to insert the mutation in the vector genome or antigenome, or to clone the vector genome or antigenome to include the attenuating mutation. Alternatively, it can be easily identified and incorporated into a chimeric PIV by mutagenizing it. Preferably, the attenuating mutations are engineered within the vector genome or antigenome and transferred or copied from the biologically derived attenuated PIV mutants.

It is recognized that these include, for example, cold passage (cp), cold adaptation (ca), host range restriction (hr), small plaque (sp) and / or temperature sensitive (ts) PIV mutants. It In a preferred embodiment, the one or more attenuating mutations present in the well characterized JS HPIV3 cp45 mutant strain are Tyr ₉₄₂ , Leu ₉₉₂ or Thr _{1558 of} JS.
At positions corresponding to, preferably including one or more mutations identified in the polymerase L protein, are incorporated into the chimeric PIV of the invention. Alternatively or additionally, the attenuation or mutation present in the JS HPIV3 cp45 mutant strain may be due to, for example, an amino acid substitution at the position corresponding to residue Val ₉₆ or Ser ₃₈₉ of JS (
One or more of the chimeric PIV clones encoding the N protein.

[0093] Still other useful attenuating mutations, for example in the C protein at a corresponding position to Ile ₉₆ of JS, and, for example, M protein at a corresponding position to Pro ₁₉₉ (for example, Pro ₁₉₉ -Thr mutation) Encodes the amino acid substitution (s) in. Other mutations identified in PIV3JScp45 that can be adapted to modulate the attenuation of the chimeric PIV of the invention include, for example, F at the position corresponding to Ile ₄₂₀ or Ala ₄₅₀ of JS.
It is found in proteins as well as in the HN protein, for example at the position corresponding to residue Val ₃₈₄ of JS.

Attenuating mutations from biologically derived PIV mutants for incorporation into the chimeric PIV of the invention include, for example, non-coding portions of the PIV genome or antigenome in the 3'leader sequence. Including mutations in. In this context, an exemplary mutation may be engineered at a position in the recombinant viral 3'leader at the position corresponding to nucleotides 23, 24, 28 or 45 of JScp45. Yet another good example mutation is
It can be engineered in the N gene start sequence, for example by changing one or more nucleotides in the N gene start sequence, for example at the position corresponding to nucleotide 62 of JScp45.

PIV3JScp45 and other biologically derived PIV mutants provided large “menu” attenuating mutations, each mutation of which is a chimera of the invention.
It can be combined with any other mutation (s) to fine tune the level of attenuation in PIV vaccine candidates. In a preferred embodiment, a chimeric PIV is constructed containing one or more, preferably two or more mutations in JScp45.

Accordingly, chimeric PIVs of the present invention selected for vaccine use often include two, sometimes three or more, biologically derived PIV mutants or similar model sources. Having the above attenuating mutations achieves a satisfactory level of attenuation for widespread clinical use. Preferably, these attenuating mutations incorporated into the recombinant chimeric PIV mutants of the present invention are stabilized by multiple nucleotide substitutions in the codons specifying the mutation.

Attenuation and introduction of other desired phenotypic mutations into selected PIV vectors, including chimeric bovine-human PVI vectors, can be accomplished by introducing heterologous genes or genomic segments containing mutations, such as mutant L proteins. This can be accomplished by transferring the gene encoding P. or a portion thereof into the PIV vector genome or antigenome. Alternatively, the mutation may be present in the selection vector genome or antigenome and the transgene or the genomic segment may carry no mutation or may carry one or more additional different mutations.

In certain embodiments, the vector genome or antigenome is a heterologous “donor”.
Modified at one or more sites corresponding to the site of mutation in the virus (eg, a heterologous bovine or human PIV or non-PIV negative strand RNA virus) to identify the same mutations identified in the donor virus or Contain or encode a conservatively related mutation (eg, a conservative amino acid substitution) (PCT / US00 / 09695 (
Filed on April 12, 2000 and its priority US provisional application No. 60 / 129,006 (April 1999)
13th filed) Reference (the contents of these descriptions are included herein by reference)). In one preferred embodiment, the PIV vector genome or antigenome is modified at one or more sites corresponding to the site of mutation in HPIV3JScp45 as listed above.

Preferred mutant PIV strains for identifying and incorporating attenuating mutations in the PIV vectors of the present invention include cold passage (cp), cold adaptation (ca), host range restriction (hr).
), Small plaque (sp) and / or temperature sensitive (ts) mutants, eg JSHP
IV cp45 cp45 mutant strain. Attenuating mutations from biologically derived PIV mutants for incorporation into the human-bovine chimeric PIV of the invention can be obtained, for example, in the PIV genome in the 3'leader sequence or in the noncoding portion of the antigenome. Including the mutation of.

A good example mutation in this context is nucleotides 23, 24, 28 or 45 of JScp45.
Can be engineered at a position in the recombinant viral 3'leader at the position corresponding to. Yet another favorable mutation can be engineered in the N gene start sequence, for example by changing one or more nucleotides in the N gene start sequence, at a position corresponding to nucleotide 62 of JScp45, for example.

Additional mutations that may be employed or transferred to the PIV vectors of the present invention include non-P
Identified in a IV non-segmented negative strand RNA virus and incorporated into the PIV mutants of the invention. It maps mutations identified in heterologous negative-strand RNA viruses to corresponding homologous sites in the recipient PIV genome or antigenome and mutates existing sequences in the recipient to mutated genotypes. Can be easily accomplished (by the same or conservative mutations) (
PCT / US00 / 09695 (filed April 12, 2000) and its priority US provisional application 60/129,
See No. 006 (filed April 13, 1999) (the contents of which are included herein by reference).

In accordance with this disclosure, additional attenuating mutations are identified in other viruses, particularly other non-segmented negative-strand RNA viruses, of the chimeric P of the invention.
It can be easily adopted or engineered into the IV.

In yet another aspect of the invention, the chimeric PIV may or may not have an attenuating mutation formed after the biologically obtained attenuating mutant virus. With additional nucleotide modification (s) to produce a phenotypic, structural or functional change in. Typically, the selected nucleotide modification will be a partial or complete PIV.
It is made in the vector genome, but such modifications may well be further made in any heterologous gene or genomic segment involved in the chimeric clone.
These modifications preferably identify the desired phenotypic alteration, eg, altered growth characteristics, attenuation, temperature sensitivity, cold adaptation, plaque size, limited host range or immunogenicity. Structural changes in this context include the introduction or deletion of restriction V in the PIV-encoding cDNA to facilitate manipulation and identification.

In a preferred embodiment, the nucleotide changes within the genome or antigenome of the chimeric PIV comprise a partial or complete deletion of the gene, or modification of the viral gene by reducing or deleting its expression (knockout). Target genes for mutations in this context include any of the PIV genes, such as nucleocapsid protein N, phosphoprotein P, large polymerase subunit L, matrix protein M, hemagglutinin-neuraminidase protein HN, fusion protein F, and C, D and V open reading frame (ORF) products are included.

To the extent that the recombinant virus is viable and infectious, each of these proteins may be selectively deleted and replaced in whole or in part, alone or in combination with other desired modifications. , Or can be rearranged to achieve new deletions or knockout mutants. For example, one or more C, D and / or V genes may be deleted, in whole or in part, and the expression may be reduced or deleted (eg, by the introduction of a stop codon to create an RNA editing site). Because of the mutation
Targeted by mutations that change the amino acids specified by the start codon, or
Due to frameshift mutations in ORF (s)).

In one embodiment, mutations can be made at editing sites that interfere with editing and whose mRNA abrogates expression of proteins produced by RNA editing (Kato et al., EMBO 16).
: 578-587, 1997 and Schneider et al., Virology 227: 314-322, 1997) (the contents of which are incorporated herein by reference). Alternatively, one or more C, D and / or V ORF (s) may be deleted in whole or in part to alter the phenotype of the resulting recombinant clone, resulting in growth, attenuation. , May improve immunogenicity or other desired phenotypic properties (US patent application Ser. No. 09 / 350,821).
No. (Durbin et al., Submitted Jul. 9, 1999) (the contents of which are included herein by reference).

Alternative nucleotide modifications in the chimeric PIV of the invention include deletions, insertions, additions or rearrangements of cis-acting regulatory sequences for selected genes in the recombinant genome or antigenome. In one example, a cis-acting regulatory sequence of one PIV gene is altered to correspond to a heterologous regulatory sequence that is a paired partial cis-acting regulatory sequence of the same gene in a different PIV or a cis-acting regulatory sequence of a different PIV gene. For example, the gene end signal can be modified by conversion or substitution of different genes in the same PIV strain into gene end signals. In other embodiments, nucleotide modifications include insertions, deletions, substitutions or substitutions of translation start sites in the recombinant genome or antigenome, eg, to delete alternative translation start sites in place of selected forms of the protein. It may include rearrangement.

In addition, a variety of other genetic alterations are employed in chimeric PI site genomes or antigenomes, either alone or from biologically derived mutant PI sites.
It can be produced with one or more attenuating mutations. For example, genes or genomic segments from non-PIV sources can be inserted in whole or in part. In one such aspect, the invention provides a human of one or more gene (s) or genomic segment (s), eg, from a non-human PIV.
Methods are provided for the attenuation of chimeric PIV vaccine candidates based on host range effects by introduction into PIV vector-based chimeric viruses.

For example, host range attenuation can be imparted to HPIV-vector based chimeric constructs by the introduction of nucleotide sequences from bovine PIV (BPIV) (eg US provisional application 60 / 143,134 (July 1999). US patent application No. 09 / 586,479 (submitted on the 9th)
No. (submitted June 1, 2000)) (the contents of these descriptions are incorporated herein by reference). These effects are due to structural and functional differences between the vector and the donor virus and provide a stable basis for attenuation.

For example, between HPIV3 and BPIV3, the% amino acid identity for each of the N proteins is 86%, 65% for P, 83% for F, 77% for HN,
And L is 91%. Therefore, all of these proteins were engineered to produce an attenuated chimeric virus that could not be easily altered by backmutation.
It is a candidate for introduction into the HPIV vector. In a preferred embodiment, the vector genome or antigenome is HPIV3 genome or antigenome and the heterologous gene or genome segment is N ORF obtained from the selected BPIV3 strain.

Thus, within the scope of the present invention there is provided a chimeric PIV on the basis of a vector genome or antigenome which is a human-bovine chimeric PIV genome or antigenome. In certain embodiments, the human-bovine chimeric vector genome or antigenome comprises measles virus, RS virus of subgroup A and subgroup B, mumps virus, human papilloma virus, human immunity type 1 and type 2. One or more antigenic determinants of a heterologous pathogen selected from defective virus, herpes simplex virus, cytomegalovirus, rabies virus, Epstein-Barr virus, filovirus, Bunyavirus, flavivirus, alphavirus and influenza virus ( One or more) encoding one or more heterologous genes (1
Or multiple) or genomic segment (s).

In an alternative aspect of the invention, the human-bovine chimeric vector genome or antigenome has been combined with one or more heterologous gene (s) or genomic segment (s) from BPIV. Contains partial or complete HPIV genome or antigenome. In one preferred embodiment, the transcription unit containing the open reading frame (ORF) of the BPIV3N ORF is replaced in the vector genome or antigenome in place of the corresponding N ORF of the HPIV3 vector genome. Using this construct and similar constructs, the vector genome or antigenome is used as an extra gene insert, measles virus HA, as exemplified by vaccine candidates identified below, such as rHPIV3-NB HAP-M. It is combined with the gene, or with a selected antigenic determinant of another pathogen.

In another aspect of the invention, the human-bovine chimeric vector genome or antigenome has been combined with one or more heterologous gene (s) or genomic segment (s) from BPIV. Contains partial or complete HPIV genome or antigenome. For example, one or more HPIVs encoding HN and / or F glycoproteins or one or more immunogenic domain (s), fragment (s) or epitope (s) thereof. Gene (1
Or multiple) or genomic segment (s) added to or incorporated into a partial or complete bovine genome or antigenome,
Generate a vector genome or antigenome.

In certain embodiments, HPIV3 encoding HN and F glycoproteins are both replaced in place of the companion BPIV3HN and F genes to produce a vector genome or antigenome. Using this and similar constructs, the vector genome or antigenome is treated with RSV as an extra gene insert, as exemplified by vaccine candidates identified below such as rBPIV3-G1 or rB / HPIV3-F1. It is combined with the F and / or G genes, or with selected antigenic determinants of another pathogen.

In a more detailed embodiment, the chimeric human-bovine vector encodes one or more immunogenic domain (s), fragment (s) or epitope (s) thereof. The vector further comprises one or more HPIV1 HN and / or F gene (s) or genomic segment (s), the vector further comprising one or more immunogenic domain (s),
HPIV1 and HPIV2 incorporating one or more HPIV2 HN and / or F genes (one or more) or genomic segment (s) encoding its fragment (s) or epitope (s) Modified by forming a chimeric genome or antigenome that expresses protective antigen (s) from both. Chimeric PIVs in this category are rB / HPIV3.1-2F, rB / HPIV3.1-2HN
Or is exemplified by various vaccine candidates identified below, such as rB / HPIV3.1-2F, 2HN.

In yet an additional aspect of the invention, the order of genes can be altered to cause attenuation or reduce or enhance expression of particular genes. Alternatively, the PIV genomic promoter can be replaced with its antigenomic counterpart to obtain additional desirable phenotypic changes. Different or additional modifications of the recombinant genome or recombinant antigenome can be made to facilitate manipulations such as inserting unique restriction sites at various intergenic regions or elsewhere. Untranslated gene sequences can be removed to increase the capacity to insert heterologous sequences.

In yet an additional aspect, the polynucleotide molecule or vector encoding the genome or antigenome of the chimeric PIV is modified to include non-PIV sequences, such as cytokines, T helper epitopes, restriction site markers, or target host. A protein or immune epitope of a microbial pathogen (eg, virus, bacterium or fungus) capable of inducing a protective immune response can be encoded. In one such embodiment, a chimeric PI incorporating a gene encoding a cytokine
V is constructed to give the resulting chimera a novel phenotypic immunogenic effect.

The present invention provides chimeric PIVs for use in vaccines, as well as providing a genomic or antigenome of the PIV vector and single or multiple heterologous polynucleotides encoding one or more heterologous antigenic determinants. Provided are related cDNA clones and vectors that incorporate, optionally with mutations and associated modifications that identify one or more attenuating mutants or other phenotypic changes as described above. take in.

An isolated polymorphism in which the heterologous sequences encoding the antigenic determinants and / or which identify the desired phenotypic alterations are in selected combinations, eg the genome or antigenome of the vector of recombinant cDNA. Introduced into a nucleotide to produce an appropriately attenuated infectious virus or subviral particle according to the methods described herein. These methods, combined with routine phenotypic evaluation, can be used to identify desirable properties such as attenuation, temperature sensitivity, altered immunogenicity, cold adaptation, small plaque size, host range restriction, and genetic stability. Provide a large population of chimeric PIVs. Preferred vaccine viruses among these candidates are attenuated yet sufficiently immunogenic to elicit a protective immune response in the vaccinated mammalian host.

In related aspects of the invention, compositions and methods for producing isolated infectious chimeric PIVs (eg, isolated polynucleotides and vectors incorporating a cDNA encoding the chimeric PIV) and methods. Will be provided. These aspects of the invention include:
Included are novel isolated polynucleotide molecules and vectors that incorporate molecules containing the chimeric PIV genome or antigenome. Also provided are the same or different expression vectors containing one or more isolated polynucleotide molecules encoding N, P and L proteins.

These proteins can instead be expressed directly from the genomic or antigenomic cDNA. Said one or more vectors are preferably expressed in a cell or in a cell-free lysate or co-expressed (co
express) to produce infectious chimeric parainfluenza virus particles or subviral particles.

The above methods and compositions for producing chimeric PIV produce infectious viral particles or subviral particles or derivatives thereof. The infectious virus is similar to the reference PIV particle and is as infectious as it is. Infectious virus directly infects fresh cells. Infectious subviral particles are generally subcomponents of viral particles that can initiate infection under appropriate conditions.

Examples of subviral particles capable of initiating infection when, for example, a genomic or antigenomic RNA and a nucleocapsid containing N, P and L proteins are introduced into the cytoplasm of the cell. Is.
The subviral particles provided by the present invention include viral particles lacking viral components such as one or more proteins and protein segments that are not essential for infectivity.

In another embodiment, the invention provides an expression vector having an isolated polynucleotide molecule containing the chimeric PIV genome or antigenome described above, and PIV.
Or a cell-free lysate containing an expression vector (same or different vector) containing one or more isolated polynucleotide molecules encoding the N, P and L proteins of. In addition, one or more of these proteins can be expressed from the genomic or antigenomic cDNA. Said genome or antigenome and N protein,
Upon expression, the P and L proteins combine to produce an infectious chimeric parainfluenza virus or subviral particle.

In another embodiment of the invention, an expression vector containing an isolated polynucleotide molecule encoding a chimeric PIV and one or more isolated polynucleotides encoding the N, P and L proteins of PIV. Cellular or cell-free expression systems incorporating expression vectors containing nucleotide molecules are provided.
When expressed, the genomic or antigenomic and N proteins, P proteins and L proteins are infectious like viral particles or subviral particles.
Produces PIV particles.

The chimeric PIVs of the present invention are useful in a variety of compositions to generate a desired immune response against one or more PIV or PIV and non-PIV pathogens in a host susceptible to these pathogens. Chimeric PIV recombinants are capable of eliciting a mono- or poly-specific protective immune response in infected mammalian hosts, yet are sufficiently attenuated so that the immunized host does not develop intolerable symptoms of the disease. Has been done. The attenuated virus or subviral particle is present in the supernatant of the cell culture and either isolated from the culture or partially or fully purified. The virus may also be lyophilized and stored or combined with various other ingredients for delivery to the host when needed.

Furthermore, the present invention provides a novel vaccine containing a physiologically acceptable carrier and / or adjuvant and the isolated attenuated chimeric parainfluenza virus or subviral particle described above. . In a preferred embodiment, the vaccine of the invention is a chimeric PIV with at least one and preferably two or more additional mutants or other nucleotide modifications that identify a suitable balance of attenuation and immunogenicity. It is composed of.

The vaccine of the present invention can be formulated with the attenuated virus at a dose of 10 ³ to 10 ⁷ PFU. The vaccine of the present invention may be used for single strain PIV or multiple strains or multiple groups.
It may contain an attenuated chimeric PIV that elicits an immune response against PIV. In this regard, the chimeric PIV may combine viruses of other PIV vaccine strains or other viral vaccines, such as RSV, in a vaccine formulation.

In a related aspect, the invention provides a method of stimulating an individual's immune system to elicit an immune response in a mammalian subject against one or more PIV or PIV and non-PIV pathogens. It is a thing. In this method, a formulation containing an immunologically sufficient amount of the chimeric PIV is administered in a physiologically acceptable carrier and / or adjuvant.
In one embodiment, the immunogenic composition of the invention comprises a desired phenotype and / or
Or a vaccine containing a chimeric PIV with at least one and preferably two or more attenuating mutants or other nucleotide modifications that specify the level of attenuation.

The vaccine of the present invention may contain a dose of 10 ³ to 10 ⁷ PFU of the attenuated virus. The vaccine of the present invention comprises a single PIV, multiple PIVs such as HPIV1 and HPIV3,
It may also contain one or more PIV and non-PIV pathogens such as measles or an attenuated chimeric PIV that elicits an immune response against RSV. In this regard, chimeric PIVs can elicit a monospecific or polyspecific immune response against multiple PIVs or one or more PIV and non-PIV pathogens.

Alternatively, chimeric PIVs with different immunogenic properties can be incorporated into a vaccine mixture or coordinated treatmen protocol.
can be administered separately to induce more effective protective effects against a single PIV, multiple PIVs, or more than one PIV and non-PIV pathogens such as measles or RSV. it can. The immunogenic composition of the invention is preferably administered to the upper respiratory tract, eg by spraying, drops or aerosol. The immunogenic composition of the invention is preferably administered to the upper respiratory tract, for example as a spray, drops or aerosol.

The present invention also provides novel combinatorial vaccines and coordinated vaccination protocols against multiple pathogens, including multiple PIV and / or PIV and non-PIV pathogens. is there. For example, selected targets for early vaccination with these compositions include RSV and PIV3, which each cause severe illness within the first four months after birth, while With PIV1
Most of the diseases caused by PIV2 occur after 6 months of age (Lippincott-Raven Publishers, Philadelphia, USA, "Fields Virology" Vol.
Collins et al., P. 1243; Reed et al., J. Infect. Dis., 175, 807-813 1997).
.

A preferred immunization procedure utilizing a live attenuated RSV and PIV vaccine is given as early as 1 month of age (eg at 1 and 2 months of age), followed by 4 months and 6 months.
This is a procedure to administer a bivalent vaccine of PIV1 and PIV2 at the age of months. Thus, a method of the invention wherein multiple PIV vaccines, including one or more chimeric PIV vaccines, are administered in a defined time series (eg daily or weekly), in admixture or separately, in concert, eg simultaneously. Preferably, and the viruses of each vaccine preferably express different heterologous protective antigens. Such coordinate / sequential immunization methods can elicit a secondary antibody response against multiple viral respiratory tract pathogens, which in early infants is immunized against each of the three PIV viruses and other pathogens. It provides a very powerful and extremely adaptive immunization method depending on the need for immunization.

Importantly, there are multiple PIV serotypes, and the unique epidemiological nature of those serotypes against the disease of PIV3 occurring at a younger age than PIV1 and PIV2 is similar to measles virus HA. It would be desirable to sequentially immunize an infant with different PIV vectors, each expressing a heterologous antigenic determinant. This sequential immunization method can induce high titers of antibodies to the heterologous proteins, which is characteristic of the secondary antibody response. In a first embodiment, early infants (eg, infants 2-4 months of age) are immunized and adapted with an attenuated chimeric virus of the invention, such as chimeric HPIV3 expressing the HA protein of measles virus, and rcp45L (HA Induces an immune response against HIPV3 such as PM).

Subsequently, for example at 4 months of age, the infant is re-immunized but with a different secondary vector construct, eg the measles virus HA gene, the PIV3-1cp45L virus and the functionality of said vector. Is immunized again with the HPIV1 antigenic determinant as the absolute glycoprotein of. Those who received the vaccination from the first vaccination should have PI
It elicits a primary antibody response against both V3HN and F proteins and measles virus HA protein, but not PIV1 HA and F protein.

Upon secondary immunization with rPIV3-1cp45L, which expresses the measles virus HA, those who received the vaccine were easily infected with the vaccine because they lacked antibodies against PIV1HN and the F protein. , Both PIV1HN and F protective antigens, and a high titer secondary antibody response to the heterologous measles virus HA protein. Simultaneous stimulation of early and secondary high titer protective responses against measles or other non-PIV pathogens using one or more of the chimeric vaccine viruses disclosed herein, and immunizing against HPIV3 Similar sequential immunizations can be performed with sequential induction against HPIV2.

This sequential immunization method, which utilizes PIVs of different serotypes as the primary and secondary vectors, preferably limits the immunity induced by the primary vector, ie the usefulness of a vector with only one serotype. Effectively avoid the factors that do. RP as described above
Successful sequential immunization with IV3 and rPIV3-1 virus vaccine candidates has been demonstrated (Tao et al., Vaccine 117: 1100-1108 1999).

Description of Specific Embodiments The present invention provides methods and compositions for the manufacture and use of the novel chimeric parainfluenza virus (PIV) and related vaccines. The chimeric viruses of the present invention are infectious and immunogenic in humans and other animals, and
, For example, to raise an immune response against one or more human PIV (HPIV). Alternatively, a chimeric PIV that elicits an immune response against a selected PIV and one or more additional pathogens, such as both HPIV and measles virus.
Will be provided. The immune response elicited can include either or both humoral and / or cell mediated responses. Preferably, the chimeric PIV of the invention is attenuated to provide the desired attenuation balance and immunogenicity for vaccine use.

The present invention thus provides a novel method for designing and producing an attenuated chimeric PIV useful as a vaccine agent for protecting and / or treating the symptoms of infection with PIV and other pathogens and related diseases. To provide a simple method. According to the method of the present invention, a chimeric parainfluenza virus or subviral particle
le) is constructed using a PIV “vector” genome or antigenome that has been recombinantly modified to incorporate one or more antigenic determinants of a heterologous pathogen. The genome or antigenome of the vector consists of part or all of the PIV genome or antigenome, which itself may incorporate nucleotide modifications, such as attenuating mutations.

The genome or antigenome of the vector is modified to form a chimeric structure by the integration of heterologous genes or genomic segments. More specifically, the chimeric PIV of the present invention was constructed by a cDNA-based virus recovery system, which comprises a portion, linked to one or more "donor" nucleotide sequences encoding heterologous antigenic determinants. Or generate a recombinant virus that integrates the entire vector or "background" PIV genome or antigenome.

Preferably, the PIV vector comprises an HPIV genome or antigenome, but a non-human PIV, such as bovine PIV (BPIV), is used as a vector to incorporate antigenic determinants of human PIV and other human pathogens. be able to. In an exemplary embodiment described herein, the human PIV3 (HPIV3) vector genome or antigenome comprises one or more heterologous PIV (eg, HPIV1 and / or HPIV2), and / or a non-PIV pathogen. It is modified to incorporate one or more genes or genomic segments that encode antigenic determinants (eg, measles virus).

The chimeric PIV of the present invention thus constructed is capable of eliciting an immune response against a particular PIV, for example HPIV1, HPIV2 and / or HPIV3, or against a non-PIV pathogen. Alternatively, compositions and methods are provided for eliciting a multispecific immune response against multiple PIVs, such as HPIV1 and HPIV3, or against one or more HPIV and non-PIV pathogens, such as measles virus.

An exemplary chimeric PIV of the invention incorporates a chimeric PIV genome or antigenome, as well as a major nucleocapsid (N) protein, nucleocapsidrin protein (P) and large polymerase protein (L), as described above. Additional PIV proteins are included in various combinations, up to complete viral particles or viral particles containing extra proteins, antigenic determinants or other additional components,
A range of infectious subviral particles can be provided. Additional PIV proteins are included in various combinations to cover a range of infectious subviral particles, up to complete viral particles or viral particles containing extra proteins, antigenic determinants or other additional components. Can be provided.

In a preferred embodiment of the invention, the chimeric PIV is a second human PIV or a non-PIV.
Incorporate the genome or antigenome of part or all of the human PIV vector linked to one or more heterologous genes or genomic segments from a pathogen, such as measles virus. A PIV "vector" genome or antigenome is typically
Act as a recipient or carrier to which one or more "donor" genes or genomic segments of a heterologous pathogen have been added or integrated.

[0145] Typically, a polynucleotide encoding one or more antigenic determinants of a heterologous pathogen is added or replaced within the genome or antigenome of the vector to heterologous pathogens in the host of choice. Resulting in a chimeric PIV that thus acquires the ability to elicit an immune response against. Furthermore, the chimeric virus may exhibit other novel phenotypic characteristics compared to one or both of the vector PIV and the heterologous pathogen.

The genome or antigenome of some or all of the vectors generally behaves as a backbone in which the heterologous genes or genomic segments of different pathogens are integrated. Often, a heterologous pathogen is a different PIV in which one or more genes or genomic segments has, is associated with, or is replaced in, the genome or antigenome of the vector.

In addition to providing novel immunogenic properties, the addition or replacement of heterologous genes or genomic segments in the vector PIV strain compared to the unmodified vector and the corresponding phenotype of the donor virus Attenuation, proliferative changes or other desired phenotypic changes can be increased or decreased. Heterologous genes and genomic segments from other PIVs that can be selected as inserts or additives in the chimeric PIVs of the invention include PIV N, P, C, D, V, M, F, HN and / or L protein or a gene or genomic segment encoding one or more of its antigenic determinants.

A heterologous gene or genomic segment of one PIV can be added as an extra genomic element to part or all of the genome or antigenome of a different PIV. Alternatively, one or more heterologous genes or genomic segments of a PIV corresponds to the wild-type gene order position of the countergene or genomic segment that is deleted in the genome or antigenome of the PIV vector. Can be replaced by position. In yet a further embodiment, the heterologous gene or genomic segment is in a position that is more promoter-proximal or promoter-distal than the wild-type gene order position of the countergene or genomic segment in the genome or antigenome of the vector. Are added or replaced to enhance or decrease the expression of heterologous genes or genomic segments, respectively.

The introduction of heterologous immunogenic proteins, protein domains and immunogenic epitopes to produce chimeric PIVs is particularly useful in generating a novel immune response in the immunized host. Addition or replacement of an immunogenic gene or genomic segment from one donor pathogen within the recipient PIV vector genome or antigenome results in an immune response to the donor pathogen, the PIV vector, or both the donor pathogen and the vector. Can be generated.

To this end, chimeric proteins, such as different PIV or non-PIV
Vector-specific cytoplasmic tail (t) fused to the heterologous ectodomain of the pathogen
chimeric PIV expressing immunogenic glycoproteins with ail) and / or transmembrane domains can be constructed to provide fusion proteins that elicit an immune response against heterologous pathogens. For example, a heterologous genomic segment encoding a glycoprotein ectodomain from the human PIV1 HN or F glycoprotein has the corresponding HP
It can be combined with genomic segments encoding the cytoplasmic and transmembrane domains of IV3 HN or F glycoproteins to form HPIV3-1 chimeric glycoproteins that elicit an immune response against HPIV1.

Briefly, a PIV of the invention expressing a chimeric glycoprotein is such that it encodes the major nucleocapsid (N) protein, nucleocapsidulin protein (P), large polymerase protein (L), and chimeric glycoprotein. Qualified HPI
Includes V vector genome or antigenome. The chimeric glycoprotein incorporates one or more heterologous antigenic domains, fragments or epitopes of a second antigenically distinct HPIV. Preferably, this is achieved by replacement within the HPIV vector genome or antigenome of one or more heterologous genomic segments of a second HPIV encoding one or more antigen domains, fragments or epitopes, whereby the genome is Alternatively, the antigenome encodes a chimeric glycoprotein that is antigenically distinct from the parental vector virus.

In a more detailed aspect, the heterologous genomic segment preferably encodes a glycoprotein ectodomain or immunogenic protein or epitope thereof, and optionally other portions of a heterologous or “donor” glycoprotein. , Including both ecto- and transmembrane regions, which are used in place of the ecto- and transmembrane domains of the paired glycoproteins, eg, in the genome or antigenome of the vector.
Preferred chimeric glycoproteins in the present invention can be selected from HPIV HN and / or F glycoproteins, and the vector genome or antigenome can be modified to encode multiple chimeric glycoproteins.

In a preferred embodiment, the HPIV vector genome or antigenome is
Partial HPIV3 genome or antigenome, the second antigenically distinct HPIV is HPI
It is V1 or HPIV2. In one exemplary embodiment described below, HPI
The glycoprotein ectodomains of both V2 HN and F glycoproteins are used in place of the corresponding HN and F glycoprotein ectodomains in the HPIV3 vector genome or antigenome. In another exemplary embodiment, the PIV2 ectodomain and transmembrane region of one or both HN and / or F glycoproteins are fused to one or more corresponding PIV3 cytoplasmic tail regions to form chimeric glycoproteins. Form.

Further details regarding these aspects of the invention can be found in the construction and use of recombinant parainfluenza virus expressing chimeric glycoproteins (CONSTRUCTION AND USE).
OF RECOMBINANT PARAINFLUENZA VIRUSES EXPRESSING A CHIMERIC GLYCOPROTEIN
) Filed Dec. 10, 1999 by Tao et al. And identified by Attorney's Case No. 17634-000340 (incorporated herein by reference) Is given to.

To construct a chimeric PIV of the invention having a non-homologous antigenic determinant of a non-PIV pathogen, a heterologous gene or genomic segment of the donor pathogen is added at any functional position in the vector genome or antigenome. Or it can be replaced. In one embodiment, a heterologous gene or genomic segment from a non-PIV pathogen is added within the PIV vector genome or antigenome (ie, no replacement) to create novel immunogenic properties in the resulting clone. be able to.

In these cases, the heterologous gene or genome segment may serve as an extra gene or genome segment, optionally with the complete PIV vector genome or anti-virus, for the further purpose of attenuating the resulting chimeric virus. It can be added in combination with the genome. Alternatively, a heterologous gene or genome segment can be added in association with the deletion of the selected gene or genome segment in the vector genome or antigenome.

In a preferred embodiment of the invention, a heterologous gene or genome segment is added at an intergenic position within some or all of the PIV vector genome or antigenome. Alternatively, the gene or genome segment may be inserted within other non-coding regions of the genome, such as within the 5'or 3'non-coding regions, or at other locations where non-coding nucleotides occur within the vector genome or antigenome. You can In one embodiment, the heterologous gene or genomic segment overlaps a cis-acting regulatory sequence within the vector genome or antigenome, eg, a sequence required for efficient replication, transcription and / or translation. Inserted at non-coding site. These regions of the vector genome or antigenome represent target sites for disruption or modification of regulatory functions associated with the introduction of heterologous genes or genomic segments.

As used herein, the term “gene” refers to a portion of the subject genome that generally encodes mRNA, such as the PIV genome, beginning at the upstream end with the gene start (GS) signal, It ends at the downstream end with a gene end (GE) signal.
The term gene also uniquely refers to proteins such as the C protein of PIV.
When expressed from an additional ORF rather than from RNA, it is compatible with the term "open reading frame for translation" or ORF. Genomic In a typical example of HPIV3 is 15462 nucleotides of negative-sense RNA of single strand length (nt) (Galinski like articles, Vi rology 165: 499~510,1988; paper Stokes like, Virus Res . 25 : 91-103, 1992).

At least 8 proteins are encoded by the HPIV3 genome. That is, nucleocapsid protein N, phosphoprotein P, C and D proteins of unknown function, matrix protein M, fusion glycoprotein F, hemagglutinin neuraminidase glycoprotein HN, and large polymerase protein L.
(Papers by Collins et al., 3rd ed., " Fields Virology ", BNFields, DM, Kn
Co-edited with ipe, PM, Howley, RM, Chanock, JL, Melnick, TP, Monath, B.Roizman, and SEStraus, Vol.1, pp.1205-11243, Lippincott-Raven Publishers, Phil
adelphia, 1996).

The viral genome of all PIVs also contains non-coding and intergenic regions, as well as extragenic leader and trailer regions with all or part of the promoter required for viral replication and transcription. The PIV genetic map is therefore represented as the 3'leader-NP / C / D / VMMF-HN-L-5 'trailer. Transcription begins at the 3'end and proceeds by a continuous start-stop mechanism guided by short conserved motifs found at gene boundaries. The upstream end of each gene contains a gene start (GS) signal that directs the initiation of its respective mRNA. The downstream end of each gene contains a gene end (GE) motif that directs polyadenylation and termination.

Typical gene sequences are found in human PIV3 strain JS (GenBank Accession No. Z11575, which is incorporated herein by reference) and Washington (Galinski MS, Ed., Kingsbury, DW, “ The Paramyxoviruses ”). , Pp.537-568, Plenum Press, New
York, 1991, which is incorporated herein by reference), and also for bovine PIs.
V3 strain 910N (GenBank accession number D80487, which is incorporated herein by reference).

To construct the chimeric PIV of the invention, one or more PIV genes or genomic segments may be wholly or partially deleted, inserted or replaced. This means that partial or complete deletions, insertions, and substitutions include open reading frames and / or cis-acting regulatory sequences of any one or more PIV genes or genomic segments. “Genome segment” means a continuous nucleotide of arbitrary length derived from the PIV genome, which may be a part of ORF, a gene, or an extragenic region, or a combination thereof.

When the subject genomic segment encodes an antigenic determinant, the genomic segment encodes at least one immunogenic epitope capable of eliciting a humoral or cell-mediated immune response in a mammalian host. To do. The genomic segment can also encode a domain of the immunogenic fragment or protein. In another embodiment, the donor genomic segment can encode multiple immunogenic domains or epitopes that include recombinantly synthesized sequences, including multiple, repeated, or different immunogenic domains or epitopes.

Another chimeric PIV of the invention contains protective antigenic determinants of HPIV1, HPIV2, and / or HPIV3. This is preferably achieved by the expression of one or more HN and / or F genes or genomic segments by the vector PIV, or as an extra gene or replacement gene from a heterologous donor pathogen. In certain embodiments, HPIV3-1 or HPIV3-2 chimeric viruses can be constructed for use as strains in vaccines or vectors, where HPIV1 or HPIV2
The HN and / or F genes replace one of the PIV3 pairs (Skiadopoul
os et al., Vaccine , 18 : 503 to 510, 1999; Tao et al., Vaccine , 17 : 1100 to 1108,
1999; US patent application No. 09 / 083,793 filed May 22, 1998 (and corresponding international application published as WO 98/53078); US patent application No. filed December 10, 1999 09 / 458,813, US patent application Ser. No. 09 / 459,062 filed Dec. 10, 1999, each of which is incorporated herein by reference).

In this context, a candidate for a chimeric PIV1 vaccine is the PIV3 cDNA rescue system, which uses a PIV3 cDNA rescue system to
Generated by replacing the HN and F open reading frames (ORFs) of PIV3 with those of PIV1. The recombinant chimeric virus derived from this cDNA is called rPIV3-1.cp45L (Skiadopoulos et al ., J.Virol . 72 : 1762-8, 1998; Tao et al ., JV irol . 72 : 2955-2961, 1998; Tao et al., Vaccine 17 : 1100-1108, 1999, which are incorporated herein by reference).

RPIV3-1.cp45L is attenuated in hamsters and induces high levels of resistance to counter PIV1. It also produced a recombinant chimeric virus called rPIV3-1.cp45L that contained 12 of 15 cp45L mutations, ie, no mutations in HN and F, and was highly expressed in the upper and lower respiratory tracts of hamsters. Attenuate to (Sk
iadopoulos et al., Vaccine 18 : 503-510, 1999, which is incorporated herein by reference).

In a preferred embodiment of the invention, the chimeric PIV carries one or more major antigenic determinants of human PIV or counters multiple human PIVs containing HPIV1, HPIV2, or HPIV3. These preferred vaccine candidates elicit an effective human immune response against one or more selected HPIVs. HPIV as mentioned above
The determinant that elicits an immune response against can be encoded by the genome or antigenome of the vector, or can be inserted or joined to the genome or antigenome of the PIV vector as a heterologous gene or gene segment. it can. The major protective antigens of human PIV are their HN and F glycoproteins. However, all PIV genes, eg PIV genes, including internal protein genes that can encode determinants such as CTL epitopes, are candidates for encoding the antigenic determinant of interest.

The preferred chimeric PIV vaccine viruses of the present invention transfer one or more major antigenic determinants from multiple HPIVs, respectively, or from HPIV and non-PIV pathogens. The chimeric PIV thus constructed may include, for example, a partial or complete HPIV genome or antigenome of HPIV3 and one or more non-homologous genes encoding heterologous PIV, eg, HPIV1 or HPIV2 antigenic determinants, or And a genome segment. In another embodiment, one or more genes or genomic segments encoding one or more antigenic determinants of HPIV1 or HPIV2 are added to or in a partial or complete HPIV3 genome or antigenome. Can be replaced.

In various exemplary embodiments described below, both HPIV1 genes encoding HN and F glycoproteins are expressed in one pair of HPIV3 in the chimeric PIV vaccine candidate.
HN and F genes of These as well as other constructs produce chimeric PIVs that elicit in humans either a single or a multispecific immune response against one or more HPIVs. A more detailed embodiment of the present invention, 1999 12
"CONSTRUCTION AND USE OF RECOMBINANT PARAINFLUENZA VIRUSES EXPRESSING A" by Tao et al.
US patent application entitled "CHIMERIC GLYCO PROTEIN" and Murphy et al. "USE filed December 10, 1999 and identified by Patent Attorney Docket 17634-000330
OF RECOMBINANT PARAINFLUENZA VIRUS (PIV) AS A VECTOR TO PROTECT AGAINST DI
SEASE CAUSED BY PIV AND RESPIRATORY SYNCYTIAL VIRUS (RSV) "is provided in the U.S. patent application, each of which is incorporated herein by reference.

In an exemplary embodiment of the invention, a heterologous gene or genomic segment encoding an antigenic determinant from both HPIV1 and HPIV2 is added to the genome or antigenome of a partial or complete HPIV3 vector. Done or incorporated into it. For example, one or more HPIV1 genes or genomic segments encoding HN and / or F glycoproteins or antigenic determinants thereof and one or more HPIV2 genes encoding HN and / or F glycoproteins or antigenic determinants. Alternatively, a genomic segment is added to or incorporated into the genome or antigenome of a partial or complete HPIV3 vector.

In one example described below, both HPIV1 genes encoding HN and / or F glycoproteins have been replaced with the HN and F genes of one pair of HPIV3 to generate the genome of the chimeric HPIV3-1 vector or Form an antigenome. This vector construct can be further modified by the addition or incorporation of one or more genes or genomic segments encoding HPIV2 antigenic determinants. Thus, the vaccine candidates rPIV3-1.2HN and rPIV3-1cp45.2 described below herein.
Chimeric PIV with both HPIV1 and HPIV2 antigenic determinants as exemplified by HN
Specific constructs are provided which exemplify the invention and which produce

In another preferred embodiment of the invention, the chimeric PIV is a HP modified to express one or more major antigenic determinants of a non-PIV pathogen, eg measles virus.
Incorporate the IV vector genome or antigenome. The methods of the invention are generally applicable to incorporating a wide range of additional pathogen-derived antigenic determinants into candidates for chimeric PIV vaccines. In this regard, the present invention also provides, among other pathogens, respiratory syncytial virus (RSV) subgroup A and subgroup B, mumps virus, human papillomavirus genus, human immunodeficiency virus genus type 1 and 2 Mold,
It will help develop vaccine candidates against herpes simplex virus, cytomegalovirus, rabies virus, Epstein-Barr virus, filovirus, bunyavirus, flavivirus, alphavirus, and influenza virus.

In this regard, potential target pathogens for vaccine development by the methods of the present invention include viral and bacterial pathogens, as well as protozoa and multicellular pathogens. In this context, useful antigenic determinants from many important human pathogens are known and have already been identified for incorporation into the chimeric PIV of the invention.

Thus, the major antigens are the measles virus HA and F proteins, and RSV F and G.
, SH, and M2 proteins, mumps virus HN and F proteins, human papillomavirus L1 protein, human immunodeficiency virus type 1 and 2 gp16
0 protein, herpes simplex virus and cytomegalovirus gB, gC, gD
, GE, gG, gH, gI, gJ, gK, gL, and gM proteins, G protein of rabies virus, gp350 protein of Epstein-Barr virus, G of filovirus
The above typical pathogens have been identified, including proteins, the Bunyavirus G protein, the Flavivirus E and NS1 proteins, and the Alphavirus E protein.

These major antigens, as well as other antigens known in the art against the listed pathogens and other pathogens, include antigenic domains, fragments and epitopes of standard length proteins and their components. Many of these antigenic determinants, including, have been well characterized enough to be identified, mapped, and characterized for their respective immunogenic effects.

Many typical mapping studies that identify and characterize major antigens of various pathogens used in the present invention include HPIV3 hemagglutination neuraminidase (HN
) There is a mapping study of epitopes directed to genes (van Wyke Coelingh
Et al ., J. Virol . 61 : 1473-1477, 1987, which is incorporated herein by reference). This report provides a detailed antigen structural analysis of 16 HPIV3 variant serotypes selected using monoclonal antibodies (MAbs) against HN proteins that inhibit neuraminidase, hemagglutination, or both. Are offered. Each variant has a single point mutation in the HN gene and encodes a substitution of only one amino acid in the HN protein.

Practical positional relationship maps of HN proteins correlate well with the relative positions of substitutions. Computer-aided analysis of HN proteins predicted a secondary structure consisting primarily of hydrophobic β-sheets interconnected by random hydrophilic helical structures. The HN epitope was located in the predicted helical region. An epitope recognized by MAbs that inhibits the neuraminidase activity of the virus is a region that appears to be structurally conserved in some HN proteins of paramyxovirus and represents the sialic acid binding site of the HN molecule. It was located in an area that may have

This exemplary study using conventional antigen mapping methods identified only one amino acid important for the integrity of the HN epitope. The majority of these epitopes are located at one C-terminus of the molecule and are anchored at their N-termini as expected in proteins (Elango et al ., J. Virol . 57 : 481-489, 1986) . ). A previously published PIV3 HN Practical Location Map shows that the MAbs used were two bridged sites (A and B) partially bridged by a third site (C). It was shown to recognize 6 distinct groups (I to VI) of epitopes organized in.

These groups of epitopes are representative of useful candidates for antigenic determinants that can be incorporated alone or in various combinations into the chimeric PIV of the invention (
Coelingh et al., Virology 143 : 569-58, each incorporated herein by reference.
2,1985; Coelingh et al ., Virology 162 : 137 to 143,1988; Ray et al ., Virolog y 148 : 232 to 236,1986; Rydbeck et al ., J. Gen. Virol . 67 : 1531 to 1542, See also 1986).

An additional study by Wyke Coelingh et al . ( J. Virol . 63 : 375-382,1989) provides further information relating to the selection of PIV antigenic determinants used in the present invention. In this study, 26 monoclonal antibodies (MAbs) (14 neutralizing, 12 non-neutralizing)
It was used to study the antibody structure, biological properties, and spontaneous mutations of the fusion (F) glycoprotein of HPIV3.

Results of analysis of laboratory-selected antigen variants and analysis of clinical isolates of PIV3,
A panel of MAbs recognized at least 20 epitopes, 14 of which were shown to be associated with neutralization. Competitive binding assays organized 14 neutralizing epitopes into three non-overlapping major antigenic regions (A, B, and C) and one bridge site (AB), with six non-neutralizing epitopes at four sites ( It was confirmed that D, E, F, and G) were formed. The majority of neutralizing MAbs are associated with non-reciprocal competitive binding reactions, suggesting that they induce a conformational change in another neutralizing epitope.

Another antigenic determinant used in the present invention is respiratory syncytial layer virus (RSV).
Were identified and characterized. Beel, for example, incorporated herein by reference
er et al ., J. Virol . 63 : 2941-2950,1989, to construct a practical map of the detailed positional relationship of the epitopes involved in RSV neutralization and fusion, of RSV A2 strain. Eighteen neutralizing monoclonal antibodies (MAbs) specific for the fusion glycoprotein were used. Competitive binding assays revealed that three non-overlapping antigenic regions (A, B,
And C) and one bridge site (AB) was identified. Thirteen MAb resistant mutants (MARMs) were selected and the neutralization pattern of MAbs with either MARM or RSV clinical strains was identified for at least 16 epitopes.

MARMs selected by antibodies to the six epitopes at sites A and AB exhibit a small plaque phenotype, consistent with changes in the biologically active regions of the F molecule. Analysis of MARM also showed that these neutralizing epitopes occupy a spatially distinct but conformationally free region with unique biological and immunological properties. Mutations of the antigen in epitope F were then tested by cross-neutralization assay with 18 anti-F MAbs using 23 clinical isolates (18 for subgroup A, 5 for subgroup B). This analysis identifies the constant, variable, and hypervariable regions of the molecule,
It was shown that mutations of the antigen in the neutralizing epitope of the RSV F glycoprotein are the result of non-cumulative genetic heterogeneity.

Eight of the 16 epitopes were conserved on all but one of the 23 subgroup A or subgroup B clinical isolates or all. All of these antigenic determinants, including antigenic domains, fragments, and epitopes of standard length proteins and their components, are incorporated into the chimeric PIV of the invention to elicit the novel immune response described above. (See Anderson et al ., J. Infect . Dis . 151 : 626-633, 1985; C, each of which is incorporated herein by reference ) .
paper such oelingh, J.Virol 63:. 375~382,1989; Fenner et al, Scand.J.Immuno l 24:. 335~340,1986; Fernie like paper, Proc.Soc.Exp.Biol. Med 171:. 266~271,19
82; Sato et al, J.Gen.Virol 66:. 1397~1409,1985; paper Walsh like, J.Gen.Vir ol 67:. 505~513,1986; Olmsted like paper, J. Virol. 63 : 411-420,1989).

The present invention provides a number of human or non-human PIV vectors, including bovine PIV (BPIV) vectors for expressing heterologous PIV and non-PIV pathogen antigenic determinants.
These vectors are used herein to carry heterologous antigenic determinants and to elicit one or more humoral or cell-mediated specific immune responses against heterologous pathogens and PIV vectors. It is easily modified by the recombinant method described in 1. In an exemplary embodiment, one or more heterologous genes or genome segments from the donor pathogen are combined with the HPIV3 vector genome or antigenome.

In another exemplary embodiment, a heterologous gene or genomic segment is added to the genome or antigenome of the chimeric HPIV vector, eg, to one of its pairs.
Incorporation into the genome or antigenome of a chimeric HPIV3-1 vector carrying one or both HPIV1 genes encoding HN and F glycoproteins replaced with the HN and / or F genes of HPIV3. In a more detailed embodiment, a transcriptional unit containing the open reading frame (ORF) of the HA gene of measles virus is introduced into the HPI at various positions.
Added to the genome or antigenome of V3 vector, typical chimeric PIV / measles vaccine candidates rPIV3 (HA HN-L), rPIV3 (HA NP), rcp45L (HA NP), rPIV3
(HA PM), or rcp45L (HA PM). Alternatively, the chimeric PIV for use in a vaccine comprises one or more antigenic determinants of HPIV2, such as HN of HPIV2.
The gene can be incorporated into the genome or antigenome of the chimeric HPIV3-1 vector.

In another detailed embodiment of the invention, a heterologous nucleotide sequence encoding a protective antigen from respiratory syncytial virus (RSV) for the production of infectious, attenuated vaccine candidates. Design a chimeric PIV that incorporates Cloning of the RSV cDNA and other disclosures are provided in: US Provisional Application No. 60 / 007,083 filed September 27, 1995; US Patent Application No. 08 / 720,132 filed September 27, 1996
No .; US provisional application No. 60 / 021,773 filed on July 15, 1996; US provisional application No. 60 / 046,141 filed on May 9, 1997; US provisional application No. filed on May 23, 1997 60/047
, 634; U.S. Patent Application No. 08 / 892,403 filed July 15, 1997 (International Publication No. 98/025
No. 09 / 291,894 filed April 13, 1999; April 2000
International Publication No. PCT / US00 / 09696 filed on 12th (US provisional application No. 13 filed April 13, 1999)
Corresponding to No. 60 / 129,006);

[0188] paper such as collins, Proc.Nat.Acad.Sci.USA 92:. 11563~11567,1995; Bukreyev
Et al ., J. Virol . 70 : 6634 ~ 41,1996; Juhasz et al ., J. Virol . 71 : 5814 ~ 5819 .
, 1997; Durbin et al., Virology 235 : 323 to 332, 1997; He et al., Virology 23 7 : 249 to 260, 1997; Baron et al ., J. Virol . 71 : 1265 to 1271, 1997; Whitehead Et al ., Virology 247 : 232-9, 1998a; Whitehead et al . J. Virol . 72 : 4467-4471.
, 1998b; Jin et al., Virology 251 : 206 to 214, 1998; Whitehead et al., J. Viro l . 73 : 3438 to 3442, 1999; Bukreyev et al., Proc . Nat. Acad . Sci . USA . 96 : 2367 ~
72,1999, each of which is incorporated herein by reference in its entirety for all purposes. Other reports and discussions incorporated or described herein identify and characterize RSV antigenic determinants useful within the invention.

The PIV chimera incorporating one or more RSV antigenic determinants is preferably
Human PIV (eg, HPIV1, HPIV2, HPI) with a heterologous gene or genomic segment that encodes an antigenic RSV glycoprotein, protein domain (eg, glycoprotein ectodomain) or one or more immunogenic epitopes.
V3) comprising the vector genome or antigenome. In one embodiment,
One or more genes or genomic segments derived from RSV F and / or G genes can be combined with the vector genome or antigenome to produce chimeric PI
Form V vaccine candidates. Some of these constructs express chimeric proteins, such as fusion proteins with a cytoplasmic tail and / or transmembrane domain fused to the ectodomain of RSV, and elicit a polyvalent immune response against both PIV and RSV. Produces a virus.

As mentioned above, it is often desirable to adjust the phenotype of the chimeric PIV for vaccines or to change the phenotype of the chimeric virus by introducing additional mutations that increase or decrease the attenuation. A detailed description of materials and methods for making recombinant PIV from cDNA and materials and methods for making and testing various mutant and nucleotide modifications set forth herein as a complementary aspect of the invention includes, for example: Dubrin et al., Virology, 235: 323-332, 1997; US Patent Application No. 09 / 083,793 filed on May 22, 1998; US Patent Application No. No. filed on December 10, 1999 09 / 458,813; US patent application Ser. No. 09 / 459,062 filed December 10, 1999
Issue: US Provisional Patent Application No. 60 / 047,575 filed on May 23, 1997 (International Publication
WO98 / 53078); and US Provisional Patent Application No. 60 / 059,385, filed September 19, 1997, each of which is incorporated herein by reference.

In particular, these documents refer to attenuated mutant strains (eg temperature sensitive (ts), cold passage (cp), cold adapted (ad), small plaque (sp) and host range restricted (hr) mutations). Strains) to mutate, isolate and characterize PIV to obtain a strain) and to determine the genetic alterations that define the attenuated phenotype. In connection with these methods, the above-mentioned document describes the replication, immunization of biologically derived recombinantly engineered attenuated human PIV in permissive model systems, including murine and non-human primate model systems. It details the procedures for determining the origin, genetic stability and protective efficacy.

In addition, these documents describe general methods for developing and testing immunogenic compositions, including monovalent and bivalent vaccines, for preventing and treating PIV infections. Methods for making infectious recombinant PIVs by construction and expression of cDNAs encoding PIV genomes or antigenomes expressed with essential PIV proteins are also described in the documents incorporated above, which are infectious PIV clones. The following exemplary plasmids that can be used to make: p3 / 7 (131) (ATCC97990); p3 / 7 (131) 2
G (ATCC97889); and p218 (131) (ATCC97991), each of which is subject to the provisions of the Budapest Treaty, American Type Culture Collection (10801) American Type Culture Collection, University of Boulevard, Virginia 20110-2209, Manassas. It has been deposited with the ATCC) and has been given the confirmed deposit number above.

References incorporated above include biologically derived PIV mutants such as cold passage (cp), cold adaptation (ad), host range restriction (hr), small plaque (sp). )
And / or a method for constructing and evaluating infectious recombinant PIV modified to incorporate a phenotype-specific mutation identified in a temperature-sensitive (ts) mutant, eg, JS HPIV3 cp45 mutant Is also disclosed. The mutations identified in these mutants can be readily incorporated into the chimeric PIV of the invention.

In an exemplary embodiment, one or more attenuating mutations occur at positions corresponding to polymerase L proteins, eg, Tyr ₉₄₂ , Leu ₉₉₂ or Thr ₁₅₅₈ of JS cp45. These mutations are preferably incorporated into the chimeric PIV of the invention by the same or conservative amino acid substitutions identified in the biological mutants. In a more detailed embodiment, the chimeric PIV for vaccine incorporates one or more mutations with Tyr ₉₄₂ replaced by His, Leu ₉₉₂ replaced by Phe, and / or Thr ₁₅₅₈ replaced by Ile.

Conservative substitutions of these amino acid substitutions are also useful in achieving the desired attenuation in the chimeric vaccine candidate. The HPIV3 JS cp45 strain is an American Type Culture Collection (A) of the University of Boulevard 10801 of Manassas, Virginia 20110-2209, Virginia, USA under the Patent Deposit Designation PTA-2419 under the terms of the Budapest Treaty (A
Has been deposited with the TCC).

Other exemplary mutations that can be employed in chimeric PIVs derived from biologically derived PIV mutants include specific mutations at positions corresponding to residues Val ₉₆ or Ser ₃₈₉ of JS cp45. There are one or more mutations in the N protein, including mutations. In a more detailed embodiment, these mutations are designated as Val ₉₆ to Ala or Ser ₃₈₉ to Ala or as conservative substitutions therefor. The is still useful chimeric PIV of the invention, the amino acid substitution in the C protein, e.g., a mutation at a position corresponding to Ile ₉₆ of JS cp45, identical or conservative preferably from Ile ₉₆ to Thr Represented by substitution.

Further exemplary mutations that may be employed from biologically derived PIV mutants include mutations employed from JS cp45 at positions corresponding to residues Ile ₄₂₀ or Ala ₄₅₀ of JS cp45. There is one or more mutations in the F protein, including
Preferably, it is represented by amino acid substitution of Ile ₄₂₀ to Val or Ala ₄₅₀ to Thr, or conservative substitution therewith. Alternatively or additionally, the chimera of the invention
PIV can employ one or more amino acid substitutions in the NH protein, exemplified by a mutation at the position corresponding to residue Val _{384 of} JS cp45, preferably indicated by the substitution Val ₃₈₄ to Ala.

Yet another embodiment of the present invention is a non-coding portion of the PIV genome or antigenome that defines a desired phenotypic change, such as attenuation, such as one or more abruptions in the 3'leader sequence. Includes a chimeric PIV that incorporates the mutation. Exemplary mutations in this sense can be carried out at positions in the 3'leader of the chimeric virus at positions corresponding to nucleotides 23, 24, 28 or 45 of JS cp45.

Still additional exemplary mutations are made in the N gene start sequence, eg, JS cp4
It can be carried out at the position corresponding to nucleotide 62 of 5 by, for example, changing one or more nucleotides in the N gene start sequence. In a more detailed embodiment, the chimeric PIV has a T to C change at nucleotide 23, nucleotide 2
It incorporates a C to T change at 4, a G to T change at nucleotide 28 and / or a T to A change at nucleotide 45. An additional mutation in the extragenic sequence is exemplified by an A to T change in the N gene start sequence at the position corresponding to nucleotide 62 of JS.

The above exemplary mutations that can be carried out in the chimeric PIV of the invention include rcp45, rcp45L,
rcp45F, rcp45M, rcp45HN, rcp45C, rcp45F, rcp45 3'N, rcp3'NL and rcp45
Recombinant PIV clone called 3'NCMFHN (Dubrin et al., Virology, 235: 32
3-332, 1997; Skiadopoulos et al., J. Virol. 72: 1762-1768, 1998; Skiadopoulos et
al., J. Virol. 73: 1374-1381, 1999; US Patent Application No. 09 / 083,793 filed on May 22, 1998; US Patent Application No. No. filed on December 10, 1999. 09 / 458,813
No .; US Patent Application No. 09 / 459,062 filed Dec. 10, 1999; May 1997
US Provisional Patent Application No. 60 / 047,575 filed on 23rd (corresponds to WO98 / 53078); and US Provisional Patent Application No. 60 / 059,385 filed September 19, 1997.
No., each of which is incorporated herein by reference), and has been successfully performed and recovered in recombinant PIV.

Furthermore, the references incorporated above refer to, for example, the HN and F genes of HPIV1 being replaced in a partial HPIV3 background genome or antigenome, HPIV3
The construction of a chimeric PIV recombinant that has been further modified to carry one or more attenuating mutations identified in JS cp45 is described. One such chimeric recombinant incorporates all the attenuating mutations identified in the L gene of cp45. All cp45 mutations outside the heterologous (HPIV1) HN and F genes have been shown to be incorporated into HPIV3-1 recombinants to confer attenuated chimeric vaccine candidates.

JS cp45 and other biologically derived PIV mutants provided a vast “menu” of attenuating mutations, each of which was attenuated, immunogenic in the chimeric PIV of the invention. And can be combined with any other mutation to adjust the level of genetic stability. Many chimeric PIVs in this sense have one or more mutations from biologically derived PIV mutants, such as any of the mutations identified in JS cp45 or combinations thereof. , Preferably two or more. Preferred chimeric PIVs within the invention incorporate multiple or all mutations present in JS cp45 or a biologically derived PIV mutant strain. These mutations are stabilized against backmutations in chimeric PIV by multiple nucleotide substitutions in the codons that define each mutation.

Further additional mutations that can be incorporated into the chimeric PIV of the invention are mutations such as, for example, the attenuating mutations found in heterologous PIV or other non-segmented negative-strand RNA viruses. Attenuation and other desirable mutations, especially those found in certain negative-strand RNA viruses, may be "metastased", eg, copied to corresponding positions within the genome or antigenome of the chimeric PIV. Briefly, a heterologous negative chain RN
The desired mutation in the A virus is transferred to the chimeric PIV recipient (in the vector genome or antigenome or in the heterologous donor genome or genome segment).

This is an international application number filed on April 12, 2000 corresponding to US provisional patent application number 60 / 129,006 filed on April 13, 1999, which is incorporated herein by reference.
As described in PCT / US00 / 09695, mapping mutations in a heterologous mutant virus and identifying corresponding sites in the recipient PIV by routine sequence alignment to identify the native sequence in the PIV recipient (identical or (Due to conservative mutation)
It changes to a mutant genotype.

As taught by this disclosure, modifying the recipient chimeric PIV genome or antigenome to encode a change at the site of the mutation that conservatively corresponds to the change identified in the heterologous mutant virus. Is preferred. For example, if an amino acid substitution marks a mutation site in a mutant virus compared to the corresponding wild type sequence, a similar substitution may be made at the corresponding residue in the recombinant virus. It is preferred that the substitutions define amino acids that are identical or conservative to the substitution residues present in the mutant viral protein.

However, for the replacement residues in the mutant protein (by using other amino acids to disrupt or impair the function of the wild-type residue), non-conservative natural amino acid residues are conserved at the mutation site. It is also possible to change. The original negative-strand RNA viruses that confirmed the exemplary mutations and transferred to the recombinant PIV of the invention include, inter alia, other PIV (
For example HPIV1, HPIV2, HPIV3, BPIV and MPIV), RSV, Sendai virus (SeV
), Newcastle disease virus (NDV), simian virus 5 (SV5), measles virus (MeV), rinderpest virus, canine distemper virus (CDV), rabies virus (RaV) and vesicular stomatitis virus (VSV).

Position 521 of the RSV L protein that corresponds to the substitution of phenylalanine (or a conservatively related amino acid) at position 456 of the HPIV3 L protein and is therefore transferable thereto.
Various exemplary mutations are disclosed, including but not limited to amino acid substitutions of phenylalanine in. In the case of mutations marked by deletions or insertions, they can be introduced into the recombinant virus as corresponding deletions or insertions, but the size and amino acid sequence of the deleted or inserted protein fragment differs. Sometimes.

Attenuating mutations in biologically derived PIV and other non-segmented negative-strand RNA viruses for incorporation into the chimeric PIV of the invention may occur naturally, but known mutagenesis methods are known. Can also be introduced into a wild-type PIV strain. For example, as described in the references incorporated above, by selecting viruses that were passaged at sub-optimal temperatures to introduce growth-limiting mutations, or in cell cultures, small plaques (sp). By selecting the mutant virus that makes
Incompletely attenuated parental PIV strains can be made by chemical mutagenesis during virus growth in cell cultures supplemented with chemical mutagens.

By “biologically-derived PIV” is meant any PIV that has not been produced by recombinant means. Thus, a biologically-derived PIV defines a naturally occurring PIV having, for example, a wild-type genomic sequence and a PIV having an allelic or mutated genomic alteration from a reference wild-type PIV sequence, such as an attenuated phenotype. Includes all naturally occurring PIVs, including PIVs with mutations. Similarly, biologically derived PIVs include PIV mutants derived from parental PIVs, inter alia by artificial mutagenesis and selection methods.

As mentioned above, the production of fully attenuated, biologically derived PIV mutants can be achieved by several known methods. One such method is to pass the partially attenuated virus in cell culture at progressively lower temperatures. For example, partially attenuated mutants are produced by passage in subculture at sub-optimal temperatures. Therefore, cp mutants or other partially attenuated PIV strains are adapted for efficient growth at lower temperatures by passage in culture. This selection of mutant PIV during cold passage significantly reduces residual virulence in the derivative strain compared to the partially attenuated parent.

Alternatively, the partially attenuated parental virus is exposed to a chemical mutagen to introduce, eg, a ts mutation, and in the case of a virus that is already ts, of the ts phenotype of the attenuated derivative. Specific mutations can be introduced in biologically-induced PIV by introducing sufficient additional ts mutations to confer increased attenuated and / or stability. A means of introducing ts mutations into PIV involves replication of the virus in the presence of mutagens such as 5-fluorouridine by commonly known procedures.

Other chemical mutagens may be used. Attenuation results from ts mutations in almost all PIV genes, but the polymerase (L) gene has been found to be a particularly sensitive target for this purpose. The level of temperature sensitivity of replication in an exemplary attenuated PIV for use in the present invention is determined by comparing replication at any temperature to replication at several limiting temperatures.
The shut-off temperature is the lowest temperature at which virus replication is reduced by a factor of 100 or less as compared to replication at any temperature. PIV in laboratory animals and humans
Replication and toxicity are correlated with the shutoff temperature of the mutant.

The JS cp45 HPIV3 mutant is genetically relatively stable and highly immunogenic,
It is known to be sufficiently attenuated. Nucleotide sequence analysis of recombinant viruses incorporating this biologically derived virus and the various mutations found therein, either individually or in combination, revealed that each level of increased attenuation was associated with specific nucleotide and amino acid substitutions. Has been shown to be related to. The incorporated references cited above, by introducing mutations separately or in various combinations into the genome or antigenome of an infectious PIV clone,
It also discloses a method for routinely distinguishing accidental silence mutations from mutations that give rise to phenotypic differences.

This method, combined with the assessment of phenotypic properties of parental and derived viruses, identifies mutations responsible for desirable properties such as attenuation, temperature sensitivity, cold adaptation, small plaque size, host range restriction. The mutations thus identified were edited in a "menu" and introduced alone or in combination as desired, to introduce the chimeric PIV of the invention to appropriate levels of an attenuated, immunogenic, attenuated phenotype. Adjust as desired for genetic resistance to back mutations from. Due to the ability to produce infectious PIV from cDNA as described above,
The specific changes carried out in the chimeric PIV are introduced.

In particular, infectious recombinant PIV can be used to identify specific mutations in biologically induced attenuated PIV strains, such as ts, ca, att and other phenotypic defining mutations. Used. The desired mutation is thus identified and introduced into the chimeric PIV vaccine strain. The ability to produce virus from cDNA allows these mutations to be routinely incorporated into full-length cDNA clones, either individually or in various selected combinations, and subsequently to rescued recombinant virus containing the introduced mutations. The phenotype can be easily determined.

By defining and incorporating in the infectious chimeric PIV clone a particular mutation associated with the desired phenotype, eg, the cp or ts phenotype, the present invention provides close proximity to or at the identified mutation. To provide other site-specific modifications. Most of the attenuating mutations made in biologically-induced PIV are single nucleotide changes, but other "site-specific" mutations are also chimeric by recombinant techniques.
Can be incorporated into PIV. As used herein, site-specific mutations include 1 to 3, about 5 to 15 or more (eg, wild-type PIV sequences, selected PIV mutant strains, or exposed to mutagens). Included altered nucleotide insertions, substitutions, deletions or rearrangements (from the parental recombinant PIV clone).

Such site-specific mutations may be incorporated at selected biologically-derived point mutations or within that region. Alternatively, the mutation is PI
It may be introduced in various other contexts within V clones, for example at or near cis-acting regulatory or nucleotide sequences encoding protein active sites, binding sites, immunogenic epitopes and the like. Site-specific PIV mutants typically have the desired attenuating phenotype, but have altered phenotypic characteristics unrelated to attenuation, such as enhanced or broadened immunogenicity and / or improvement It may also show further growth.

Further examples of desirable site-specific mutants are recombinant PIVs designed to incorporate additional stabilizing nucleotide mutations in the codons that define the attenuating point mutation. Where possible, two or more nucleotide substitutions were introduced at the codons that define the attenuating amino acid changes in the parental mutant or recombinant PIV clones, making them highly genetically resistant to backmutations from the attenuating phenotype. Results in PIV. In other embodiments, the site-specific nucleotide substitutions, additions, deletions or rearrangements may be upstream (N-terminal direction) or downstream (C-terminal direction), eg, 1-3, 5-10 relative to the target nucleotide position. And 15 nucleotides or more introduced at 5'or 3 ', for example to build or remove existing cis-acting regulatory elements.

In addition to one or more point mutations and site-specific mutations, the changes to the chimeric PIV disclosed herein include deletions, insertions, substitutions or rearrangements of one or more genes or genomic segments. including. Deletions involving one or more genes or genomic segments have been particularly useful and it has been shown that such deletions produce additional desirable phenotypic effects.

Accordingly, US Patent Application No. 09 / 350,821, filed by Durbin et al. On Jul. 9, 1999, which is incorporated herein by reference, modifies the PIV genome or antigenome to specify the coding designation of the start codon. One or more HPIVs by incorporating mutations that alter or introduce one or more stop codons.
Methods and compositions are described in which expression of a gene, eg, one or more C, D and / or V ORFs is reduced or eliminated. Alternatively, one or more C,
The D and / or V ORFs can be completely or partially abolished so that the corresponding protein is partially or completely non-functional, or protein expression is completely inhibited.

Chimeric PIVs with such mutations in C, D and / or V or other non-essential genes have highly desirable phenotypic properties for vaccine development. For example, these modifications may include (i) altered growth characteristics in cell culture, (ii) attenuation in the upper and / or lower respiratory tract of mammals, (iii) altered viral plaque size, (iv) cytopathic effect. One or more desirable phenotypic changes, including changes in (v) and immunogenicity. An exemplary “knockout” mutant PIV, lacking C ORF expression, termed γC-KO, despite its beneficial attenuated phenotype, was shown to resist wild-type HPIV3 attack in a non-human primate model. Could trigger a protective immune response.

Therefore, in a more detailed aspect of the invention, the chimeric PIV is C, D and / or
Alternatively, it incorporates a deletion or knockout mutation in the V ORF or other nonessential gene that alters or eliminates expression of the selected gene or genomic segment. This may, for example, introduce a frameshift mutation or stop codon in the selected coding sequence, alter the translation initiation site, alter the position of the gene or introduce an upstream initiation codon to alter the rate of expression. , GS and / or GE transcription signals to alter phenotype and modify RNA editing sites (eg, growth, temperature limitation for transcription, etc.).

In a more detailed embodiment of the present invention, the gene or segment thereof is modified, for example by introducing multiple translation stop codons in the translational open reading frame (ORF), changing the start codon or modifying the editing site. A chimeric PIV is provided in which the expression of one or more genes, such as C, D and / or V ORFs, has been removed at the translational or transcriptional level without the deletion of Such forms of knockout virus often exhibit reduced growth rates and small plaque sizes in cell culture.

Thus, these methods provide an additional novel type of attenuating mutation that eliminates expression of viral genes that are not one of the major viral protective antigens.
In this sense, knockout virus phenotypes created without the deletion of a gene or genomic segment may otherwise be modified by deletion mutagenesis to restore target protein synthesis as described above. It can be created by effectively eliminating mutations. Several other C, D and / or V ORF deletion gene knockouts and knockout mutants can be made using other designs and methods known in the art (as described above, eg, Kretschmer. et
al., Virology, 216: 309-316,1996; Radecke et al., Virology, 217: 418-421,1996; K
ato et al., EMBO J. 16: 578-587,1987; and Schneider et al., Virology, 277: 314-
322, 1996, each incorporated herein by reference).

Nucleotide modifications introduced into the chimeric PIV constructs of the invention may be introduced in the vector genome or antigenome or a heterologous donor gene or genome segment depending on the nature of the change (ie inserting or removing an immunogenic epitope or A small number of bases are changed to change a small genome segment, whereas a large block of bases is involved when a gene or large genome segment is added and replaced, deleted, rearranged), a few bases (For example, 15-30 bases,
35-50 bases or more), large blocks of nucleotides (eg 50-
100, 100-300, 300-500, 500-1,000 bases) or almost complete or complete genes (e.g. 1,000-1,500 nucleotides, 1,500-2,500 nucleotides, 2,50)
0-5,000 nucleotides, 5,000-65,000 nucleotides or more) may be changed.

In a related embodiment, the invention is employed in a chimeric PIV clone from a biologically derived PIV with additional types of mutations involving the same or different genes in the further modified PIV clone. Different mutations such as cp and ts mutations. Each of the PIV genes, either fully or in part, alone or in combination with other desired modifications, is selectively altered in terms of expression level, added, deleted, substituted or rearranged to produce a novel vaccine. Chimeric PI showing characteristics
Can give rise to V. Thus, in addition to or in combination with the attenuating mutations employed from biologically derived PIV mutants, the present invention provides a chimeric PIV phenotype based on recombinant technology of infectious PIV clones. A range of additional methods for attenuating or modifying are also provided.

Making Various Alterations in Isolated Polynucleotide Sequences Encoding a Target Gene or Genome Segment, Including a Donor or Recipient Gene or Genome Segment in a Chimeric PIV Genome or Antigenome for Incorporation into Infectious Clones be able to. More specifically, mutations that delete, replace, introduce or rearrange selected nucleotides or nucleotide sequences from the parental genome or antigenome to achieve the desired structural and phenotypic changes in recombinant PIV. The present invention contemplates the introduction and introduction of mutations that delete, replace, introduce or rearrange all genes or genomic segments in a chimeric PIV clone.

Thus, for example, by introducing a stop codon into the selected PIV coding sequence or changing the translation initiation site or RNA editing site to change the position of the PIV gene relative to the operably linked promoter, Phenotype by introducing start codons to alter the rate of expression and modify GS and / or GE transcription signals (by changing position, changing existing sequences and replacing existing sequences with heterologous sequences) A variety of other deletions, substitutions, additions and re-sequents that define quantitative or qualitative changes in (eg, growth, temperature restrictions on transcription, etc.) and viral replication, transcription of selected genes or translation of selected proteins. Altering the sequence provides a modification in the chimeric PIV of the invention that simply alters or eliminates expression of the selected gene.

In this regard, any PIV gene or genomic segment that is not essential for growth may be deleted or modified in recombinant PIV to have desirable effects on virulence, pathogenicity, immunogenicity and other phenotypic traits. Can be generated. Regarding coding sequences, non-coding leader, trailer and intergenic regions are likewise deleted, substituted or modified and their phenotypic effects are easily analyzed, for example by the use of minireplicons and recombinant PIV.

In addition, a variety of other genetic alterations, such as growth, attenuation, immunogens, along with one or more attenuating mutations taken from mutant PIV alone or biologically derived. Made in the PIV genome or antigenome for incorporation into chimeric PIV to regulate sex, genetic stability and provide other beneficial structural and / or phenotypic effects. Additional types of these mutations are disclosed in the references incorporated above and can be readily implemented in the chimeric PIV of the invention. For example, restriction site markers can be routinely introduced into the chimeric PIV to facilitate cDNA construction and manipulation.

In addition to these changes, the order of genes in a chimeric PIV construct can be altered, the PIV genomic promoter replaced with its antigenomic counterpart, a portion of the gene removed or replaced, and the entire gene removed. There is. Different or additional modifications in the sequence can be made to facilitate manipulations such as insertion of unique restriction sites in various intergenic regions or elsewhere. Untranslated gene sequences are removed to increase capacity for inserting foreign sequences.

Other mutations that are incorporated into the chimeric PIV constructs of the invention include, for example, mutations that target a cis-motion signal that can be readily identified by mutational analysis of the PIV minigenome. For example, insertion and deletion analysis of initiation and termination and flanking sequences identify viral promoters and transcriptional signals, resulting in a series of mutations involved in different stages of RNA replication or meiosis of transcription.

Saturation mutagenesis of these cis-acting signals, which in turn alters each position to that of nucleotide substitutions, has also identified many mutations that affect RNA replication or transcription. Any of these mutations can be inserted into the chimeric PIV antigenome or genome, as described herein. Evaluation and regulation of trans-acting protein and cis-acting RNA sequences using the complete antigenomic cDNA is aided by the use of the PIV minigenome, as described in the references above.

Additive mutations within the chimeric PIVs of the invention can also include replacement of the 3'end of the genome involved in RNA replication and transcriptional changes with its equivalent from the antigenome. . In one exemplary embodiment, the level of expression of a particular PIV protein, such as the protected HN and / or F antigen, is a sequence designed to match the native sequence to synthetically produced, efficient translation. Can be increased by substituting In this regard, codon usage has been shown to be a major factor in the level of mammalian viral protein translation (Haas et al., Current Biol.
.6: 315-324,1996, incorporated herein by reference). Optimization of the codon usage of the mRNAs encoding the PN HN and F proteins by a recombinant approach results in improved expression for these genes.

In another exemplary embodiment, the sequences surrounding the translation start site (preferably including the nucleotide at position -3) of the selected PIV gene are alone or in combination with the introduction of an upstream start codon. Are modified to regulate PIV gene expression by specifying up- or down-regulation of translation. Alternatively, or in combination with other recombinant modifications disclosed herein, the gene expression of chimeric PIV can be modulated by altering the GS or GE signal of transcription of any selected gene of the virus. It is possible.

In an alternative embodiment, the level of gene expression in the chimeric PIV vaccine candidate is altered at the level of transcription. In one embodiment, the position of the selected gene in the PIV genetic map can be further changed to the promoter base or the promoter end position, whereby the gene is expressed more or less efficiently, respectively. .

According to this aspect, the regulation of expression for a particular gene is adjusted to 2 compared to the wild type level with a corresponding decrease in the expression level often associated with the replacement gene in the opposite position. It is possible to produce a decrease or increase in gene expression that is 2-fold, and more typically 4-fold, up to 10-fold, or more. These and other metastatic changes have an attenuated phenotype due to, for example, reduced expression of selected viral proteins that are integrated into RNA replication, or have other desirable properties, such as increased antigen expression. Produces a novel chimeric PIV vector having.

In other embodiments, chimeric PIVs useful in vaccine formulations can be conveniently modified to provide antigen flow in a circulating virus. In general, metamorphosis is HN
And / or is present in the F protein. From one PIV strain or group, the entire HN or F genes encoding their particular immunogenic regions, or genomic segments, may be replaced by replacement of corresponding regions in receptor clones of different PIV strains or groups, or It is incorporated into the chimeric PIV genome or antigenomic cDNA by adding duplicates of one or more genes so that the morphology is expressed. The progeny virus generated from the modified PIV clone can then be used in a vaccination protocol for emerging PIV strains.

Replacement of human PIV coding or non-coding sequences (eg, promoters, gene ends, gene ends, intergenic or other cis-acting elements) with heterologous equivalents can result in a wide variety of possible attenuations. And produce chimeric PIV with other phenotypic effects. For example, a heterologous sequence or protein with a biologically bidirectional human PIV sequence or protein (ie, a sequence or protein normally associated with a sequence or protein that has been replaced for viral transcription, translation, assembly, etc.). In a human cell, or more generally, in a host range limitation with cellular proteins that differ between permissive and less permissive hosts, or some other aspect of the cellular environment, bovine or murine genes are By substituting bovine PIV (BPIV) or murine PIV (MPIV) proteins, protein regions, genes or genomic segments that have been transferred into the human PIV background that do not function efficiently, in particular, host range and other The desired effect occurs.

In an exemplary embodiment, bovine PIV sequences are selected for introduction into human PIV based on known aspects of bovine and human PIV structure and function.

In a more detailed embodiment, the present invention provides HPIV and non-human PIVs such as HPIV3
And BPIV3 (eg Schmidt et al., US Patent Application No. 09/5, dated June 1, 2000).
86,479, Schmidt et al., J. Virol. 74: 8922-9, 2000, each of which is incorporated herein by reference), based on a more detailed chimeric structure between Provide a method to attenuate the candidate. This method of attenuation is based on the host range effect of introducing one or more genes or genomic segments of non-human PIV into a human PIV vector-based chimeric virus.

For example, there are numerous nucleotide and amino acid sequence differences between BPIV and HPIVs that appear in different host ranges. Between HPIV3 and BPIV3, the amino acid% identities for the following proteins were: N (86%), P (65%), M (93%), F (83%).
%), HN (77%), and L (91%). The host range differences are represented by comparing the highly tolerable growth of HPIV3 in rhesus monkeys with the limited replication of two different strains of BPIV3 in the same animal (van Wyke Coelingh et al., JI.
nfect.Dis.157: 655-662,1988, incorporated herein by reference). HPIV3 and
The basis of host range differences between BPIV3s remains to be determined, but they are likely to contain more than one gene and multiple amino acid differences.

The integration of polygenes and possibly cis-acting regulatory sequences, each containing multiple amino acid or nucleotide differences, provides a very broad basis for attenuation that cannot be easily altered by backmutation. This is unlike the situation with other live attenuated HPIV3 viruses which are attenuated by one or a few mutations. In this case, reversion of any individual mutation can result in significant reacquisition of virulence or, if only a single residue determines attenuation, complete reacquisition of virulence. .

In an exemplary embodiment of the invention, the vector genome or antigenome is
HPIV3 genome or antigenome, the heterologous gene or genome segment is alternatively the NORF derived from Ka or SF strains of BPIV3 (related to 99% amino acid sequence). The HPIV3 background antigenomic NORF is replaced by the equivalent BPIV3NORF, which yields a novel recombinant chimeric PIV clone.

Substitution of HPIV3NORF of HPIV3 with that of BPIV3Ka or SF results in a protein with about 70 amino acid differences (depending on the integrated strain) from that of HPIV3N. N is one of the more conserved proteins and substitution of other proteins such as P, alone or in combination, will result in more amino acid differences. The integration of polygenic and genomic segments, which respectively confer multiple amino acid or nucleotide differences, provides a broad basis for attenuation that is highly stable to back mutations. This mode of attenuation contrasts sharply with HPIV vaccine candidates that are attenuated by one or more mutations in which reversion of individual mutations can result in significant or complete reacquisition of virulence. In addition, several known attenuating mutations in HPIV generally result in a temperature sensitive phenotype. One problem with attenuation associated with temperature sensitivity is that the virus is attenuated in the upper respiratory tract while being overly limited to replication in the lower respiratory tract. This is because there is a temperature gradient in the respiratory airways with higher (and more limited) temperatures in the lower respiratory airways and lower (less restrictive) temperatures in the upper respiratory airways.

The ability of the attenuated virus to replicate in the upper respiratory tract can lead to complications including congestion, rhinitis, fever and otitis media. Thus, the attenuation achieved alone by temperature-sensitive mutations may not be ideal. In contrast, the host range mutations present in the chimeric PIV of the invention do not confer temperature sensitivity in most cases. Thus, the novel methods of PIV attenuation provided by these types of modifications are genetically and phenotypically more stable and have residual toxicity in the upper respiratory tract compared to other known PIV vaccine candidates. The relationship is almost unlikely.

The references included above indicate that both Ka and SF HPIV3 / BPIV3 chimeric recombinants are viable and that the chimeric recombinants do not show genetic incompatibility limiting replication in vitro, It is disclosed to replicate as efficiently in cell culture as either the HPIV3 parent or the BPIV3 parent. The property of this efficient replication in test tubes is important because it allows the efficient manufacture of this biologic.
In addition, Ka and SF HPIV3 / BPIV3 chimeric recombinants containing only one bovine gene (called cKa and cSF) were found in the respiratory airways of rhesus monkeys to the extent that their host range was limited to those of their BPIV3 parents. Is equivalent.

In particular, the cKa and cSF viruses show an approximately 60-fold or 30-fold reduction in replication in the upper respiratory tract of rhesus monkeys, respectively, compared to replication of HPIV3. Based on this finding, other BPIV3 genes are also expected to confer desirable levels of host range limitation within the chimeric PIV of the invention. Thus, by the methods herein, a list of attenuated determinants provides a range of host range limits and other desirable levels of immunogenicity for BPIV and chimeric PIVs selected for vaccine use in appropriate combinations. Easily identified in the heterologous gene of human PIVs, and a genomic segment.

Chimeric human-bovine PIV for use as a vector within the invention is human-bovine.
Derived from, or derived from, a human or bovine PIV strain or subgroup virus in combination with one or more heterologous genes or genomic segments of different PIV strains or subgroup viruses to form a bovine chimeric PIV genome or antigenome Includes a tailor-made partial or complete "background" PIV genome or antigenome. In a preferred embodiment of the present invention,
A chimeric PIV incorporates a partial or complete human PIV background genome or antigenome in combination with one or more heterologous genes or genomic segments from bovine PIV.

A partial or complete background genome or antigenome generally functions as a receptor backbone or vector into which the equivalent, a heterologous gene or genomic segment of human or bovine PIV is transferred. An equivalent, a heterologous gene or genomic segment from human or bovine PIV, combined with or substituted within the background genome or antigenome,
Humans exhibiting novel phenotypic characteristics compared to one or both contributing PIVs-
1 depicts a "donor" gene or polynucleotide that results in a bovine chimeric PIV.

For example, the addition or replacement of a heterologous gene or genomic segment within a selected receptor PIV lineage will result in attenuating less than the corresponding phenotype (s) of the unmodified receptor and / or donor. It can result in increased or decreased, altered growth, altered immunogenicity, or other desirable phenotypic changes (Schmidt et al., 2000 6
US Patent Application Serial No. 09 / 586,479, Schmidt et al., J. Virol. 74: 8922-9, 200, dated Jan. 1.
Each of which is hereby incorporated by reference).

Genes and genomic segments that can be selected for use as heterologous substitutions or additions in human-bovine chimeric PIV vectors include PIVN, P, C, D
, V, M, F, SH (where appropriate), HN and / or L protein (s) or portions thereof (s) encoding the gene or genomic segment. In addition, genes and genomic segments encoding non-PIV proteins, such as the SH protein as found in mumps and SV5 viruses,
It can be incorporated into the human-bovine PIV of the invention. Extragenic 3'initial or 5'terminal region, and gene start, gene end, intragenic region, or 3
Regulatory regions such as the'or 5'non-coding regions are also useful as heterologous substitutions or additions.

Certain human-bovine chimeric PIV vectors for use within the invention include one or more BPI.
It contains one or more major antigenic determinants of HPIV3 in the background that are attenuated by replacement or addition of the V3 gene or genome segment. The major protective antigens of PIVs are their HN and F glycoproteins, although other proteins may also contribute to the protective immune response. In certain embodiments, the background genome or antigenome is HPIV genome or antigenome, for example, preferably
From BPIV3 is a background genomic or antigenome of HPIV3, HPIV2, or HPIV1 in which one or more BPIV genes or genomic segments have been added or replaced in.

In one exemplary embodiment described below, the ORF of the N gene of BPIV3 is replaced with that of HPIV. Alternatively, the background genome or antigenome is a BPIV genome or antigenome combined with one or more genes or genome segments encoding HPIV3, HPIV2, or HPIV1 glycoproteins, glycoprotein regions or other antigenic determinants. Can be

By the method of the present invention, any BPIV gene or genomic segment, alone or in combination with one or more other BPIV genes, can cause a human-bovine chimeric PIV vaccine candidate in combination with HPIV sequences. It is possible. Specific HP
IV serotypes, such as any HPIV, including different strains of HPIV3, are rational receptors for attenuating the BPIV gene (s). Generally, the gene (s) or genomic segment (s) of HPIV3 selected for cell content in a human-bovine chimeric PIV for use as a vaccine against human PIV is
It contains one or more HPIV protective antigens such as N or F glycoproteins.

In an exemplary embodiment of the invention, a human-bovine chimeric PIV containing one or more bovine genes or genomic segments is provided in, for example, the respiratory tract of a mammalian model of human PIV infection, such as a non-human primate, in the respiratory tract. Indicates a high degree of host range limitation.

In an exemplary embodiment, human PIV is added to a partial or complete human of one or more bovine genes, or genomic segments, eg, to HPIV3, PIV background genome or antigenome. Or it is attenuated by substitution. In one example, the HPIV3N gene is replaced by the BPIV3N gene, resulting in a novel human-bovine chimeric PIV vector in which the measles HA gene has been replaced to produce the recombinant rHPIV3-described below. Generates multivalent HPIV / measles vaccine candidates as represented by N _B HA _FM .

[0258] Preferably, a human-bovine chimeric PIV for generating a vaccine candidate of the present invention.
The extent of host range limitation exhibited by the vector is comparable to the degree of host range limitation exhibited by the respective BPIV parental or "donor" strain. Preferably, the limitation should have a true host range phenotype, ie it should be unique to the host in question, limiting replication in vitro and vaccine production in suitable cell lines. Should not In addition, human-bovine chimeric PIV vectors containing one or more bovine genes or genomic segments elicit high levels of resistance in hosts susceptible to PIV infection. Thus, the present invention provides a new basis for attenuating live viral vectors for generating vaccines against PIV and other pathogens based on host range effects.

In a related embodiment of the invention, the human-bovine chimeric PIV vector comprises a BPIV receptor or backbone virus that incorporates one or more heterologous genes encoding HPIVHN and / or F glycoprotein (s). Including. Alternatively, chimeric PIV
Incorporates an external region (and, alternatively, a cytoplasmic region and / or a transmembrane region) of HPIVHN and / or F glycoprotein (s), or one or more genomic segments encoding immunogenic determinants It is possible. These immunogenic proteins, regions and determinants are particularly useful within the human-bovine chimeric PIV as they generate a novel immune response in the immune host. Especially, H in it
The N and F proteins, and immunogenic regions and determinants, provide the major protective antigens.

In one embodiment of the invention, one or more immunogenic genes or genomic segments from a human PIV subgroup or strain are added to a bovine background,
Or to, or within, a receptor, genome or antigenome against human donor virus comprising one or more particular human PIV subgroups or strains Recombinant, chimeric viruses or polymeric particles smaller than viral particles that produce an immune response, while the bovine backbone confers an attenuated phenotype, making the chimera a useful candidate for vaccine development. Eggplant

In one exemplary embodiment, one or more human PIV glycoprotein genes, such as HN and / or F, are added to or part of a partial or complete bovine genome or antigenome. To produce an attenuated, infectious human-bovine chimera that elicits an anti-human PIV immune response in susceptible hosts. In one such representative vector (carrying HPIV3JSHN and F glycoprotein genes in the BPIV3 background), RSVA glycoprotein genes G and F were added heterologous OR.
Effectively inserted as F to generate a multivalent, HPIV / RSV vaccine candidate represented by recombinant viruses rB / HPIV3-G1 and rB / HPIV3-F1 described below.

In another embodiment, the human-bovine chimeric PIV vector comprises an immunogenic protein, protein domain or epitope (eg HPIV) derived from multiple human PIV strains.
1 or 2 additionally incorporates a gene or genomic segment encoding two HN or F proteins or immunogenic portions thereof, each derived from a different HPIV such as HPIV2. Alternatively, one glycoprotein or immunogenic determinant from the first HPIV and a second glycoprotein or immunogenic determinant from the second HPIV, respectively, is replaced by an additional glycoprotein or determinant-encoding polynucleotide. It may be supplied without addition to the genome or antigenome.

The addition or substitution of HPIV glycoproteins or antigenic determinants can be accomplished by constructing a genome or antigenome encoding the chimeric glycoprotein in a recombinant virus or subviral particle, eg, immunogenic epitopes of the first HPIV, antigen It may be achieved by fusing a region or complete ectodomain to the cytoplasmic domain of a heterologous HPIV. For example, encoding a heterologous genomic segment encoding a glycoprotein ectodomain from the HPNV or HIV2 HN or F glycoprotein, encoding the cytoplasmic / endodomain of the HPIV3 HN or F glycoprotein in the background genome or antigenome. May be attached to a genomic segment that

In another embodiment, the human or bovine chimeric PIV vector genome or antigenome encodes a replacement, addition or chimeric glycoprotein or antigenic determinant thereof in a recombinant virus or subviral particle, It will produce viral recombinants with both human and bovine glycoproteins, glycoprotein domains or immunogenic epitopes.

A heterologous genomic segment encoding a glycoprotein ectodomain derived from a human PIV HN or F glycoprotein, eg, in the background genome or antigenome, is replaced by the corresponding cytoplasmic / endodomain of the bovine HN or F glycoprotein. May be attached to the genomic segment encoding Alternatively, human PIV HN or F
The glycoprotein or portion thereof may be linked to a genomic segment encoding an HN or F glycoprotein or portion thereof from another PIV strain or serotype.

Modulating the attenuating phenotype by introducing additional mutations that either enhance or attenuate the attenuation of the chimeric virus, in combination with the host range phenotypic effects provided for the human-bovine chimeric PIV of the present invention. Is often desirable. Thus, in an additional aspect of the invention, an attenuated human-bovine chimeric PIV vector is produced where the chimeric genome or antigenome is attenuated phenotype in the resulting virus or subviral particle. Is further modified by introducing one or more attenuating mutations that specify

These mutations may include mutations in RNA regulatory sequences or encoded proteins. Such an attenuating mutation may be newly generated according to a rational design mutation strategy, and its attenuating effect may be investigated. Alternatively, an attenuating mutation may be identified in the existing biologically derived mutant PIV and incorporated into the human-bovine chimeric PIV of the invention.

In a preferred chimeric vaccine candidate of the present invention, in humans, as recorded by upper / lower respiratory tract replication in permissive animal models such as hamsters and rhesus monkeys.
The overall attenuation for PIV replication (as measured, for example, between 3 and 8 days post infection) was at least about 2-fold greater than the growth of the corresponding wild-type or mutant parental PIV strain, and more Frequently about 5 fold or 20 fold, and preferably 50-100 fold to 1000 fold or more can be progressed.

Infectious chimeric PIV vector clones of the invention have also been generated relying on the methods and compositions disclosed herein to enhance immunogenicity and wild-type parental (ie, vector or heterologous host) PIV or non-human. It can also be designed to elicit higher levels of protection than that provided by infection with PIV pathogens. For example, from a heterologous PIV strain or type, or from a non-PIV pathogen such as measles virus or RSV 1
Additional immunogenic epitopes, protein domains or proteins of one or more species can be added to the chimeric PIV by modifying the appropriate nucleotides in the chimeric genome or antigenome.

Alternatively, chimeric PIVs of the invention can be made to add or remove (eg, by amino acid insertions, substitutions or deletions) immunogenic proteins, protein domains, or specific proteins associated with a desired or undesired immune response. You can also do it.

Within the scope of the method of the invention, additional genes or genomic segments can be inserted in or near the genome or antigenome of the chimeric PIV vector. These genes may be under common control with receptor genes or under the control of independent transcription signal sets. Genes important in this context include genes encoding antigenic determinants and genomic segments, as well as cytokines such as interleukin [
Interleukin 2 (IL-2), Interleukin 4 (IL-4), Interleukin 5 (I
L-5), interleukin 6 (IL-6), interleukin 18 (IL-18), etc.], major necrosis factor alpha (TNFα), interferon gamma (IFNγ), granulocyte-macrophage colony-stimulating factor (CM-CSF) , And IL-2 to IL-18 especially IL-2, IL-6, IL-12
, Genes encoding IL-18 and γ interferon, etc. (1999 7
See US Application No. 09 / 614,285 filed July 12, 2000, which corresponds to US Provisional Application No. 60 / 143,425 filed March 13, 2000. This is incorporated herein by reference). The co-occurrence of these additional proteins provides the ability to qualitatively and quantitatively modify the immune response to the chimeric PIV of the invention.

Deletions, insertions, substitutions, and other mutations involving changes in all viral genes or genomic segments within the chimeric PIV of the present invention produce highly stable vaccine candidates of particular importance to immunocompromised individuals. It These changes will often lead to attenuation of the resulting vaccine strain, and some may specify various desirable phenotypic modifications. For example, accessory (ie, not essential for in vitro growth) genes are potential candidates for encoding proteins that specifically interfere with host immunity (eg, Kato et al., EMBO.J. 16: 578-. 87, 1997, which is incorporated herein by reference). Removal of such genes in the vaccine virus is expected to reduce toxicity and pathogenicity and improve immunogenicity.

The introduction of the defined mutations into infectious chimeric PIV clones can be achieved by various well-known methods. An "infectious clone", in the context of DNA, is a synthetic, naturally occurring cDNA or product thereof that is capable of transcription into a genomic or antigenomic RNA that can function as a template for replicating the genome of an infectious virus or subviral particle. It means without distinction. Thus, the defined mutations can be introduced into the genomic or antigenomic cDNA copy by conventional techniques (such as site-directed mutagenesis).

Assembly of a complete antigenomic or genomic cDNA by the use of small fragments of antigenomic or genomic cDNA as described herein allows for individual regions to be engineered separately (smaller cDNAs than larger ones). It is easy) and then the simple assembly allows the complete cDNA. Thus, the complete antigenome or genomic cDNA or any small fragment thereof can be used as a template for oligonucleotide directed mutagenesis.

Mutagenesis is mediated by intermediates in the form of single-chain fasmids, eg Bio-
Using the Muta-gene ™ kit from Rad Laboratories (Richmond, Calif.) Or Chameleon from Stratagene (La Jolla, Calif.)
This can be accomplished using methods that directly use double-stranded plasmids as templates, such as mutagenesis kits, or by PCR employing primers or templates of oligonucleotides incorporating the mutation of interest.

The mutated small fragments are then assembled to form a complete antigenome or genomic cDNA. Various other mutagenesis techniques are well known and can be used to induce mutations of interest in PIV antigenome or genomic cDNA. Mutations can range from single nucleotide changes to replacement of large cDNA fragments containing more than one gene or genomic region.

Thus, in one example, mutations are introduced by use of the Muta-gene fasmid in vitro mutagenesis kit from Bio-Rad. Briefly, cDNA encoding a portion of the PIV genome or antigenome is cloned using plasmid pTZ18U and used to transform CJ236 cells (Life Technologies, Gaithersburg, MD). Follow the manufacturer's instructions to prepare the fasmid. An oligonucleotide for mutagenesis is prepared by introducing a modified nucleotide into a desired position of the genome or antigenome. A plasmid containing this small fragment of the genetically modified genome or antigenome is amplified, and then the mutant fragment is reintroduced into the full-length genome or antigenome.

The present invention also provides methods for making an infectious chimeric PIV from one or more isolated polynucleotides, eg, one or more cDNAs. In the present invention, a cDNA encoding the PIV genome or antigenome is produced for intracellular or in vitro co-expression with viral proteins required for the production of infectious PIV. "PIV Antigenome" is
By isolated positive-sense polynucleotide molecule that functions as a template for synthesizing the resulting PIV genome.

[0279] Preferably, a cDNA that is a positive-sense version of the PIV genome corresponding to the replication intermediate RNA, ie, the antigenome, is prepared, and the complementary sequence encoding the protein required for generation of the nucleocapsid for transcription / replication, that is, N Try to minimize the possibility of hybridizing with the positive sense transcripts of the sequences encoding the P, L and P proteins.

For the purposes of the present invention, the recombinant PIV genome or antigenome of the present invention comprises only the gene or part thereof necessary to render the virus or subviral particle encoded thereby infectious. Is enough. Furthermore, this gene or part thereof may be supplied by one or more polynucleotide molecules. That is, a gene may be supplied from separate nucleotide molecules, such as by complementation, or it may be expressed directly from genomic or antigenomic cDNA.

Recombinant PIV means a PIV or PIV-like virus or subviral particle, either directly or indirectly derived from a recombinant expression system, or augmented from a virus or subviral particle produced from the expression system . This recombinant expression system would use a recombinant expression vector, which contains at least one genetic element () that is responsible for the regulatory function of PIV gene expression.
For example, an operably linked transcription unit containing an assembly of promoters and structural or coding sequences transcribed into PIV RNA, appropriate transcription initiation and termination sequences, etc.).

To generate an infectious PIV from a cDNA-expressed genome or antigenome, the genome or antigenome is generated (i) by generating a nucleocapsid capable of RNA replication, and (ii) the resulting nucleocapsid by RNA. It is co-expressed with the PIV protein, which is required to make it suitable for both copying and transcription. Transcription by genomic nucleocapsids results in other PIV proteins and also initiates productive infection.
Alternatively, co-expression can provide additional PIV proteins required for productive infection.

The infectious PIV of the invention is one encoding a viral protein required for the production of a nucleocapsid for transcription / replication of one or more isolated polynucleotide molecules encoding a PIV genomic or antigenomic RNA. It is produced by intracellular or cell-free coexpression with the above polynucleotide. Viral proteins that are effective for co-expression to generate infectious PIV include major nucleocapsid (N) protein, nucleocapsidrin (P) protein, large polymerase (L) protein, fusion
(F) protein, hemagglutinin-neuramidase (HN) glycoprotein, substrate (M) protein and the like. The products of C, D and V ORFs of PIV are also effective in this context.

A cDNA encoding the PIV genome or antigenome is produced for intracellular or in vitro co-expression with viral proteins necessary for the production of infectious PIV. "PIV antigenome" means an isolated positive-sense polynucleotide molecule that functions as a template for synthesizing the resulting PIV genome. Preferably, the replication intermediate RNA, ie, the positive sense version of the PIV genome corresponding to the antigenome, cD
NA is made to minimize the possibility of hybridizing with a positive-sense transcript of a complementary sequence encoding a protein required for generation of transcription / replication nucleocapsid.

In some embodiments of the invention, the recombinant PIV (rPIV) genome or antigenome comprises a gene or portion thereof that is required to render the virus or subviral particle encoded thereby infectious. You only need to include it. The gene or part thereof may be supplied by one or more polynucleotide molecules.
That is, a gene may be supplied from separate nucleotide molecules such as by complementation. In another embodiment, the PIV genome or antigenome encodes various functions necessary for the growth, replication, or infection of the virus without the participation of the helper virus or the viral functions provided by the plasmid or helper cell lines.

A “recombinant PIV” is a PIV or PIV-like virus or subviral particle that is derived directly or indirectly from a recombinant expression system or is augmented from a virus or subviral particle produced from the expression system. means. This recombinant expression system would use a recombinant expression vector, which contains at least one or more genetic elements responsible for the regulatory function of PIV gene expression (eg, structural sequences transcribed into a promoter or PIV RNA). Alternatively, an operably linked transcription unit containing an assembly of coding sequences, appropriate transcription initiation and termination sequences, etc.).

To generate infectious PIV from a cDNA-expressed genome or antigenome, the genome or antigenome is generated (i) by generating a nucleocapsid capable of RNA replication, and (ii) the resulting nucleocapsid by RNA. Is co-expressed with the PIV N, P and L proteins required for proper replication and transcription. Transcription by genomic nucleocapsids results in other PIV proteins and also initiates productive infection. Alternatively, co-expression can provide additional PIV proteins required for productive infection.

Synthesis of PIV antigenome or genome by the viral proteins is performed in vitro
Even o (cell-free) can be achieved using, for example, a coupled transcription-translation reaction followed by introduction into cells. Alternatively, in genomic or genomic RNA
It can also be synthesized in vitro and introduced into PIV-expressing cells.

In certain embodiments of the invention, complementary sequences encoding proteins required for the production of transcriptional and replication PIV nucleocapsids are provided by one or more helper viruses. Such helper virus may be wild type or mutant type. The helper virus is preferably phenotypically distinguishable from the virus encoded by the PIV cDNA. For example, it is desirable to provide a monoclonal antibody that does not immunoreact to the virus encoded by the PIV cDNA, but to the helper virus.

Such an antibody may be a neutralizing antibody. In some embodiments, antibodies can be used in affinity chromatography to separate helper virus from recombinant viruses. To facilitate the procurement of such antibodies, it is possible to introduce mutations in the PIV cDNA so that the helper virus confers the antigenic diversity found in the HN or F glycoprotein genes.

In another embodiment of the invention, the N, P, L and other desired PIV proteins are encoded by one or more non-viral expression vectors, which may be the same as the vector encoding the genomic or antigenome. But it's okay. Additional proteins can be included if desired, but each additional protein can be encoded in its own vector,
It may be a vector encoding one or more N, P, L and other desired PIV proteins, or the complete genome or antigenome. Expression of the genome or antigenome and the protein from the introduced plasmid can be realized by, for example, each cDNA under the control of the T7 RNA polymerase promoter.

T7 RNA polymerase is supplied by infection, transfection or transduction with a T7 RNA polymerase expression system, eg, vaccinia virus MVA strain recombinant expressing T7 RNA polymerase (Wyatt et al., Virology 210).
: 202-205, 1995. It is incorporated by reference in its entirety). Viral proteins and / or T7 RNA polymerase can also be supplied by transformed mammalian cells or by transfection of preformed mRNA or protein.

A PIV antigenome for use in the present invention may be obtained by, for example, assembling fragments of the cloned cDNA that together make up the complete antigenome, to allow PCR (PCR: reverse transcription copy of PIV mRNA or genomic RNA, eg, reverse transcripted copies). U.S. Pat.No. 4,683,195 and
4,683,202 and PCR Protocols: A Guide to Methods and Applications, Innis e
t al., eds., Academic Press, San Diego, 1990 etc. All of these are incorporated herein by reference in their entirety) and the like.

The first construct, for example, contains the left-hand end of the antigenome and contains a suitable promoter (
For example, T7 RNA polymerase promoter) is used as a starting point, and it is produced by including cDNAs assembled in an appropriate expression vector such as a plasmid, cosmid, phage, or DNA virus vector. The vector may be altered by mutagenesis and / or by the insertion of synthetic polylinkers with unique restriction sites designed to facilitate assembly. To make it easier,
The N, P, L and other desired PIV proteins can be assembled in one or more separate vectors.

The right-hand end of the antigenome plasmid may optionally contain additional sequences such as flanking ribozymes and tandem T7 transcription terminators. This ribozyme is a hammerhead type that produces a 3'end containing a single non-viral nucleotide (see, eg, Grosfeld et al., J. Virol. 69: 5677-5686, 1995).
However, any other suitable ribozyme, such as the delta hepatitis virus ribozyme (Perrotta et al., Natur, which produces a 3'end without non-PIV nucleotides).
e 350: 434-436, 1991. This is incorporated by reference in its entirety)
And so on.

Various nucleotide insertions, deletions and rearrangements can be made to the PIV genome or antigenome during or after cDNA production. For example, a particular desired nucleotide sequence can be synthesized and inserted into the appropriate region of the cDNA using convenient restriction enzyme recognition sites. Alternatively, techniques such as site-directed mutagenesis, alanine scanning, PCR mutagenesis and the like well known in the art can be used to introduce mutations into the cDNA.

Alternative means for producing cDNA encoding the genome or antigenome include:
A reverse transcription PCR method that employs improved PCR conditions to reduce the number of subunit cDNA components to only 1-2 (see, for example, Che, incorporated herein by reference).
ng et al., Proc. Natl. Acad. Sci. USA 91: 5695-5699, 1994). In another embodiment, a different promoter (eg T3
, SP6) or different ribozymes (such as that of hepatitis delta virus) can be used. If different DNA vectors (such as cosmid) are used for propagation,
Larger size genomes or antigenomes can be made accessible.

An isolated polynucleotide (eg, cDNA) encoding a genome or antigenome
Is used to transfect, electroporate, mechanically insert, transform, etc., into a suitable host cell, a cell capable of supporting proliferative PIV infection, such as HEp-2.
, FRhL-DBS2, LLC-MK2, MRC-5 and Vero cells.

Introduction of isolated polynucleotide sequences into cultured cells by transfection is eg carried out by the calcium phosphate method (Wigler et al., Cell 14: 725, 1978; Cor.
saro and Pearson, Somatic Cell Genetics 7: 603, 1981; Graham and Van der
Eb, Virology 52: 456, 1973), electroporation (Neumann et al., EMB)
O J. 1: 841-845, 1982), DEAE-dextran method (Ausubel et al., Ed., Curren)
t Protocols in Molecular Biology, John Wiley and Sons, Inc., NY, 1987)
, Cationic lipid method (Hawley-Nelson et al., Focus 15: 73-79, 1993), or Li
Commercially available transfection reagents such as pofectACE ™ (Life Technologies) can be used (each of the above references is hereby incorporated by reference in its entirety).

As mentioned above, in some embodiments of the invention, the N, P, L and other desired PIV proteins are one or more phenotypically distinguishable from the virus encoding the genome or antigenome. Coded by the helper virus. The N, P, L and other desired PIV proteins may also be encoded by one or more expression vectors, which may be the same or different from the vector encoding the genome or antigenome, and various combinations thereof. Additional proteins may be included if desired, either by their own vector or by one or more N, P, L and other desired
It is encoded by a vector encoding the PIV protein or the complete genome or antigenome.

The present invention recombinantly produces extensive alterations within the PIV genome (or antigenome) by providing infectious PIV clones, resulting in defined mutations that specify the desired phenotypic alteration. be able to. An “infectious clone” is a cDNA or its cDNA that can be directly integrated into an infectious virion capable of transcription into a genomic or antigenomic RNA that can serve as a template for replicating the genome of an infectious virus or subviral particle. Product RNA means both synthetic and natural. As mentioned above, the defined mutations can be introduced into the genomic or antigenomic cDNA copy by a variety of conventional techniques, such as site-directed mutagenesis.

Assembly of a complete antigenomic or genomic cDNA by use of a small fragment of antigenomic or genomic cDNA as described herein involves the manipulation of individual regions separately (for smaller cDNAs the larger ones It is easier to work with) and then has the advantage that it can be made into a complete cDNA by simple assembly. Thus
The complete antigenome or genomic cDNA or any small fragment thereof can be used as a template for oligonucleotide directed mutagenesis.

Mutagenesis is mediated by intermediates in the form of single-chain fasmids, eg Bio-
With MUTA-gene ™ kit from Rad Laboratories (Richmond, Calif.) Or Chameleon from Stratagene (La Jolla, Calif.)
(Trademark) mutagenesis kits and the like using a double-stranded plasmid directly as a template, or by PCR employing primers or templates of oligonucleotides incorporating the mutation of interest. it can. Then
Assembling mutant small fragments creates a complete antigenome or genomic cDNA. Various other mutagenesis techniques are well known and can be routinely adapted for use in inducing a desired mutation in the PIV antigenome or genomic cDNA of the invention.

Therefore, in one example, the MUTA-gene ™ fasmid from Bio-Rad is in vitro.
Mutations are introduced by the use of mutagenesis kits. Briefly, the cDNA encoding the PIV genome or antigenome is cloned using plasmid pTZ18U and used to transform CJ236 cells (Life Technologies). Fasmid is produced according to the manufacturer's instructions. An oligonucleotide for mutagenesis is prepared by introducing a modified nucleotide into a desired position of the genome or antigenome. Next, a plasmid containing this genetically modified genome or antigenome is amplified.

Mutations can range from single nucleotide changes to the introduction, deletion or replacement of large cDNA segments containing one or more gene or genomic segments. Genomic segments are structural and / or functional domains, such as active sites, epitope sites, such as cytoplasmic domains of proteins, transmembrane or ectodomains, sites that mediate binding to other proteins or other biochemical interactions, etc. For example, they may correspond to sites that stimulate antibody binding and / or humoral or cell-mediated immune responses. The size of a useful genomic segment in this sense is from about 15-35 nucleotides to about 50, 75, 100, 200-500 and 500-1, in the case of a genomic segment encoding a small functional domain of a protein, e.g. an epitope site. 50
Spans 0 or more nucleotides.

The ability to introduce such defined mutations into infectious PIV has numerous uses, including manipulation of PIV pathogenesis and immunogenic machinery. The function of PIV proteins, including, for example, N, P, M, F, HN and L proteins and C, D and V ORF products, may be such that mutations that reduce protein expression levels or produce mutant proteins. Can be operated by introduction.

Various structural features of genomic RNA, such as promoters, intergenic regions, transcription signals, can also be routinely adapted within the scope of the methods and compositions of the invention. The effects of trans-acting protein and cis-acting RNA sequences can be readily measured, for example by using the complete antigenome cDNA in a parallel assay using the PIV minigenome (Dimock et al., J. Virol. 67: 2722-. 8, 1993, which is incorporated by reference in its entirety). Its rescue dependence is useful in characterizing mutants that are too suppressive for incorporation into infectious viruses unrelated to replication.

Certain substitutions, insertions of genes or genomic segments within the recombinant PIV of the invention,
Deletion or rearrangement [replacement of a genomic segment encoding a specific protein or protein region (eg cytoplasmic tail, transmembrane or ectodomain, epitope site or region, binding site or region, active site or region containing active site, etc.) Etc.] in a structural or functional relationship to an existing “counterpart” gene or genomic segment from the same or different PIV or other source.

This type of modification produces new recombinants that are causing the desired phenotypic changes compared to wild-type or parental PIV or other viral strains. For example, this type of recombinant may express a chimeric protein in which the cytoplasmic tail and / or transmembrane domain of one PIV is fused to the ectodomain of another PIV. Also,
Some may express dual protein regions, such as dual immunogenic regions.

A “counterpart” gene, genomic segment, protein or protein region herein is generally derived from a heterologous source (eg derived from a different PIV gene, or the same (ie homologous or opposite) in different PIV types or strains). Represents a gene or genomic segment). The representative counterparts selected in this context share all the structural features. For example, each counterpart may encode a similar protein or protein structural domain (cytoplasmic domain, transmembrane domain, ectodomain, binding site or region, epitope site or region, etc.). The counterpart domain and the genomic segment that encodes it encompass a collection of species with size and sequence variations in the range defined by the biological activities common to the domain or genomic segment variants.

Counterpart genes and genomic segments, as well as other polynucleotides disclosed herein for recombinant PIV production within the scope of the present invention, are often referred to as "reference sequences" for particular polynucleotides, such as other particular counterpart sequences. , Share substantial sequence identity. As used herein, "reference sequence" refers to a defined sequence used as a basis for sequence comparison, such as a full length cDNA or gene, or a complete cDNA or gene sequence. Generally, a reference sequence is 20 nucleotides or more in length, often
25 nucleotides or more, and often 50 nucleotides or more.

Each of the two polynucleotides includes (1) a sequence similar to each other between the two polynucleotides (that is, a part of the complete polynucleotide sequence), and (2) further includes a sequence different from each other between the two polynucleotides. Sequence comparison of two (or more) polynucleotides is generally performed by comparing the sequences of the two polynucleotides through a "comparison window" to identify local regions of similar sequence and compare. As used herein, the "comparison window" refers to a conceptual segment consisting of 20 or more adjacent nucleotide portions,
Wherein the polynucleotide sequence is compared to a reference sequence consisting of 20 or more contiguous nucleotide portions, and the polynucleotide sequence portion in the comparison window (without additions or deletions) to achieve optimal alignment of both sequences No more than 20% additions or deletions (ie gaps) when compared to the reference sequence.

The optimal sequence alignment for matching the comparison windows was performed by the local homology algorithm of Smith & Waterman (Adv. Appl. Math. 2: 482, 1981) Needleman & Wuns.
According to the homologous alignment algorithm of ch company (J. Mol. Biol. 48: 443, 1970
), By the similarity search method of Pearson & Lipman (Proc. Natl. Acad. Sci. USA
85: 2444, 1988) (the above references are incorporated herein by reference) and how these algorithms are implemented on a computer (Wisconsin Genetics Softw.
GAP, BESTFIT, FASTA and TFASTA included in are Package Release 7.0. Gene
tics Computer Group, 575 Science Dr. Madison, WI. The best alignments produced by various methods (i.e., those that give the highest percentage sequence identity over the comparison window) are selected.

“Sequence identity” means that two polynucleotide sequences are identical (ie, matched on an individual nucleotide-by-nucleotide basis) over the comparison window. "Sequence identity" compares two sequences through an optimal sequence alignment through a comparison window, and determines the number of positions where the nucleobases (A, T, C, G, U or I) in both sequences match. The number of matching positions is set, and the number of matching positions is divided by the total number of positions in the comparison window frame (that is, the size of the window)
Calculate by multiplying the quotient by 100.

As used herein, “substantial identity” refers to a characteristic of a polynucleotide sequence in which the polynucleotide is often 25 nucleotides or more in length over a comparison window of 20 nucleotides or more in length.
~ 50 nucleotides or more is meant to have a sequence having a sequence identity of 85% or more, preferably 90 to 95% or more compared to the reference sequence through a comparison window. Sequences are calculated relative to a nucleotide sequence that contains no more than 20% total deletions or additions of the reference sequence compared over a comparison window. The reference array may be a subset of a larger array.

In addition to these polynucleotide sequence relationships, the proteins and protein regions encoded by the recombinant PIVs have conservative relationships with, eg, a given reference polypeptide, ie, substantial sequence identity or sequence similarity. Also selected to have. "Sequence identity", when applied to a polypeptide, means that the peptides share the same amino acid at corresponding positions. "Sequence similarity" means that peptides share the same or similar amino acids at corresponding positions.

“Substantial sequence identity” means that two peptide sequences have a sequence identity of 80% or more, preferably 90% or more, in an optimal sequence alignment such as by the GAP or BESTFIT programs using default gap weights. It is meant to share sequence identity, more preferably greater than 95% (eg, 99%) sequence identity. "Substantial sequence similarity" means that two peptide sequences share a corresponding percentage of sequence similarity. Preferably, non-identical residue positions differ by conservative amino acid substitutions.

Conservative amino acid substitutions refer to the interchangeability of residues with similar side chains. For example, the amino acids with aliphatic side chains are glycine, alanine, valine, leucine and isoleucine, the amino acids with aliphatic-hydroxyl side chains are serine and threonine, and the amino acids with amide-containing side chains are asparagine. , Glutamine, amino acids having aromatic side chains are phenylalanine, tyrosine and tryptophan, amino acids having basic side chains are lysine, arginine and histidine, and amino acids having sulfur-containing side chains are cysteine. It is methionine.

Preferred conservative amino acid substitution groups are valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, and asparagine-glutamine. Abbreviations of the twenty naturally occurring amino acids used herein follow conventional (Immunology -.. A Synthesis, 2 nd ed, ES Golub & DR Gren, eds, Sin
auer Associates, Sunderland, MA, 1991. This is incorporated herein by reference).

The stereoisomers of the 20 conventional amino acids (such as D-amino acids), non-natural amino acids (α, α-disubstituted amino acids, N-alkyl amino acids, lactic acid and other non-conventional amino acids) are also It is a suitable component of the polypeptide of the invention. Examples of unusual amino acids include 4-hydroxyproline, γ-carboxyglutamate, ε-N, N, N-trimethyllysine, ε-N-acetyllysine, O-phosphoserine, N-acetylserine, N-formylmethionine, 3 -Methylhistidine, 5-hydroxylysine, ω-N-methylarginine and other similar amino acids and imino acids such as 4-hydroxyproline. Further, the amino acid may be modified by glycosylation, phosphorylation and the like.

In order to select a candidate vaccine according to the present invention, selection criteria for viability, attenuation and immunogenicity are established by a well-known method. The most desirable viruses for the vaccines of the present invention are viable, have a stable, attenuated phenotype, show replication (albeit at low levels) in the immunized host, and are future-proof from the wild-type virus. The vaccine must effectively elicit an immune response sufficient to confer protection against the serious illness caused by S.

Not only is the recombinant PIV of the invention viable and more appropriately attenuated than previous vaccine candidates, it is also genetically more stable in vivo. Moreover, it protects the immune response and, in some cases, extends it by a number of modifications, or expands the defense by different immune bases such as secretory vs. serum immunoglobulins, cell-mediated immunity (eg various viruses). Retains the ability to induce infection protection against strains or subgroups.

Recombinant PIVs of the invention have been tested in a variety of well-known and generally accepted in vivo and in vitro models to show proper attenuation, resistance to phenotypic reversion, and vaccine immunogenicity. Can be confirmed. In vitro assays include mutant viruses (eg, significantly attenuated, biologically derived, or recombinant PIs).
V) is examined for temperature sensitive ts phenotype of virus replication, small plaques or other desired phenotypes.

Mutant viruses are also tested in a PIV-infected animal model. Various animal models have been described and are also summarized in various references incorporated herein. PI
The PIV model system for assessing the attenuation and immunogenic activity of V vaccine candidates has been widely accepted in the art, including rodents and non-human primates, and the data obtained from it is indicative of PIV infection in humans. , Well correlated with attenuation and immunogenicity.

As explained above, the present invention also provides an isolated infectious recombinant PI for vaccines.
A V composition is provided. The attenuated virus that is a component of the vaccine is in isolated, generally purified form. The isolated type refers to PIV that exists in the environment other than the wild type natural environment. More generally, isolated form means including an attenuated virus as a component of cell culture or other synthetic medium, in which the attenuated virus is propagated in a controlled environment and characterized. You can For example, the attenuated PIV of the invention may be produced in infected cell culture, separated from the medium and added to a stabilizer.

For vaccines, the recombinant PIV produced according to the invention can be used directly in a vaccine formulation or, if desired, can be lyophilized by lyophilization protocols well known in the art. Lyophilized virus will generally be maintained at about 4 ° C. The lyophilized virus should be stored in a stable solution (eg saline or
In a solution containing SPG, Mg ⁺⁺ and HEPES), with or without an adjuvant, is reduced as described below.

The PIV vaccine of the present invention comprises as an active ingredient an immunologically effective amount of PIV produced as described herein. This mutant virus is introduced into the host together with a physiologically acceptable carrier and / or adjuvant. Effective carriers are well known in the art,
For example, water, buffer, 0.4% saline, 0.3% glycine, hyaluronic acid, etc. are included. The obtained aqueous solution may be packed in a container and used as it is, or may be freeze-dried. The lyophilized formulation is administered after mixing with the sterile solution as described above.

If necessary, a pharmaceutically acceptable auxiliary substance may be added to the pharmaceutical composition in order to approximate physiological conditions. Auxiliary substances are pH adjusting agents, buffering agents, tonicity adjusting agents, wetting agents and the like (for example, sodium acetate, sodium lactate, sodium chloride, potassium chloride, sorbitan monolaurate, triethanolamine oleate, etc.). Acceptable adjuvants include Freund's incomplete adjuvant, MPL ^™ (3-o-
Deacrelated-monophosphoryl lipid A; RIBI ImmunoChem Research, Inc., Ha
There are many known in the art, such as milton, MT) and IL-12 (Genetics Institute, Cambridge, MA).

When vaccinated with a PIV composition as described herein, the host's immune system responds to the vaccine by producing antibodies specific to the PIV proteins, eg, F and HN glycoproteins. . PI generated as described in this document
When administered as a vaccine, an effective amount of V results in the host becoming at least partially or completely immunized to PIV infection, particularly resistant to moderate or severe PIV infection of the lower respiratory tract.

The vaccinated host is any mammal susceptible to infection by PIV or a closely related virus, or capable of producing a protective immune response against the antigen of the smallpox strain. Accordingly, the present invention provides methods for creating a variety of human and animal vaccines.

Vaccine compositions incorporating the PIV of the invention are administered to a host susceptible to or at risk of PIV infection to enhance the host's own immune response function. The necessary amount therefor is called "immunologically effective amount". In this usage, the exact dose of PIV depends on the health condition and weight of the host, the dosage form, the nature of the composition, etc.
Generally, about 10 ³ to 10 ⁴ plaque forming units (PFU) of virus per host,
It would be virus more generally the host per about 10 ⁴ to 10 ⁶ plaque forming units (PFU). In any case, the vaccine formulation should provide a sufficient amount of the mutant PIV of the invention to effectively protect the host of the patient from severe or life-threatening PIV infection.

PIVs produced in accordance with the present invention can be mixed with viruses of other PIV serotypes or strains to provide protection against multiple PIV serotypes or strains. Alternatively, protection against multiple PIV serotypes or strains can be achieved by combining the protective epitopes of multiple serotypes or strains into a single virus, as described herein. Generally, when various viruses are administered, they will be mixed and administered simultaneously, but they may be administered separately. Immunization with one strain may result in protection against different strains of the same or different serotypes.

In some cases it may be desirable to mix the PIV vaccine of the invention with a vaccine that elicits a protective response against other agents, especially other pediatric viruses. In another aspect of the invention, PIV is used as a vector for protective antigens of other pathogens such as the RS virus (RSV) or measles virus, and the sequences encoding these protective antigens are described in the procedures described herein. And can be integrated into the PIV genome or antigenome used to generate infectious PIV.

An accurate amount of the recombinant PIV vaccine was administered to all the subjects, and the timing and repetition of the administration were determined based on the patient's health condition, body weight, administration form, formulation characteristics, etc. Dosages are generally about 10 ⁷ plaque forming units (PFU) per patient
Or more viruses, more usually about 10 ^{4 to} about 10 ⁶ PFU virus / patient.

In each case, the vaccine formulation may include, for example, complement fixation, Lark neutralization, and / or
Alternatively, one must provide a sufficient amount of attenuated PIV to effectively enhance or induce an anti-PIV immune response as can be determined by enzyme-linked immunosorbent assay and other methods. In this regard, each individual is also monitored for signs and symptoms of upper respiratory disease. When administered to chimpanzees, the attenuated virus of the vaccine is about 10 times or more lower than the wild-type virus in the nasopharynx of vaccinated subjects, or about 10 times the level of incompletely attenuated PIV. Or it grows at lower levels.

For newborns and infants, multiple doses are required to elicit sufficient levels of immunity. Administration should begin within 1 month of childbirth and be administered at intervals of 2 months, 6 months, 1 year and 2 years during childhood to maintain a sufficient level of protection against native (wild type) PIV infection Is. Similarly, recurrent or severe PIs, such as healthcare professionals, day care staff, families of young children, the elderly, or those with impaired cardiopulmonary function.
In adults who are particularly susceptible to V infection, multiple doses are required to establish and / or maintain a protective immune response.

The level of immunity induced can be monitored by measuring the amount that neutralizes secretory and serotype recession, and the dose can be adjusted as necessary, and repeated vaccinations can achieve the desired level of protection. Can be maintained. Furthermore, PIV strains genetically engineered to express additional proteins enriched in cytokines or T cell epitopes would be particularly beneficial to adults rather than infants.

The PIV vaccines made according to the invention can be combined with viruses expressing antigens of another subgroup or strain of PIV to establish protection against multiple PIV subgroups or strains. Alternatively, the vaccine virus may incorporate protective epitopes of multiple engineered PIV strains or subgroups within one clone of PIV, as described herein.

The PIV vaccine of the invention provokes the development of an immune response that protects against severe lower respiratory tract diseases such as pneumonia and bronchitis when the individual is subsequently infected with wild-type PIV. Although naturally circulating viruses still have the potential to infect, especially the upper respiratory tract, rhinitis as a result of vaccination and subsequent promotion of resistance by infection with wild-type virus. The chances of getting sick are greatly reduced. Vaccination results in detectable levels of serum and secreted antibodies from the host that are capable of neutralizing homologous (same subgroup) wild-type virus in vitro and in vivo. In many instances, host antibodies will also neutralize different, non-vaccine subgroups of wild-type virus.

The preferred invention PIV vaccine candidates exhibit a much greater reduction in virulence as compared to the wild type virus which naturally circulates in the human body. The virus is sufficiently attenuated that no infection will appear in many immunized individuals. In some cases, the attenuated virus will still be capable of seeding unvaccinated individuals. However, the virulence is sufficiently attenuated that a severe lower respiratory tract infection will not occur in a vaccinated or accidentally infected host.

The level of attenuation of PIV vaccine candidates can be determined, for example, by quantifying the viral load present in the respiratory tract of the immunized host and by other attenuated PIVs evaluated as wild-type PIV or candidate vaccine strains. It can be determined by comparison with the amount produced. For example, the attenuated virus of the invention is more restricted in replication in highly sensitive hosts, eg chimpanzees, compared to the level of replication of the wild-type virus, eg 10 to 1000 times less. To further reduce the incidence of rhinitis associated with viral replication in the upper respiratory tract, an ideal vaccine candidate virus should be replication-restricted in both the upper and lower respiratory tract. However, the attenuated virus of the invention is both infectious and immunogenic in humans to the extent that it confers protection to the individual vaccinated with the individual.

The level of immunity induced by the vaccines of the invention can also be monitored by measuring the amount neutralizing secretory and serum antibodies. Based on these measured values, the vaccine dose can be adjusted as necessary, or the vaccine administration can be repeated to maintain a desired protection level. Furthermore, different vaccine viruses may be beneficial for different recipient groups. For example, genetically engineered lower PIVs expressing additional proteins abundant in T cell epitopes would be particularly beneficial to adults rather than infants.

In yet another aspect of the invention, PIV is utilized as a vector for airway transient gene therapy. According to the invention, the recombinant PIV genome or antigenome incorporates a sequence capable of encoding the desired gene product. The desired gene product is
It is under the control of a promoter that is the same or different than the one that controls PIV expression. An infectious PIV produced by co-expressing a recombinant PIV genome or antigenome with N, P, L and other desired PIV proteins, and containing a sequence encoding a desired gene product, is introduced into a patient. Is administered.

Administration will typically be by the aerosol, nebulizer or other topical application to the respiratory tract of the patient to be treated. Recombinant PIV is administered in an amount sufficient to result in therapeutic or prophylactic levels of expression of the desired gene product. Representative gene products administered by this method are preferably suitable for transient expression, eg interleukin-2.
, Interleukin-4, gamma-interferon, GM-CSF, G-CSF, erythropoietin and other cytokines, glucocerebrosidase, phenylalanine hydroxylase, cystic fibrosis transmembrane conductance regulator (CFTR),
Includes hypoxanthine-guanine phosphoribosyl transferase, cytotoxins, tumor suppressor genes, antisense RNAs and vaccine antigens.

The following examples are provided by way of illustration and not limitation. These examples depict representative chimeric PIVs constructs having one or more heterologous antigenic determinants by the methods described above. In one example, the measles virus HA gene is external to one of the three gene junctions of the JS wild type or HPIV3 attenuated virus, ie, one of the N / P, P / M or HN / L junctions. It is inserted as a gene and the recombinant chimeric virus is recovered.

Insertion of the measles HA gene at three positions in the HPIV3 gene exemplifies a range of useful constructs for transferring antigenic determinants from exopathogenicity into the PIV vector. Furthermore, considering the proximity modification of heterologous gene expression, inserted gene units closer to the 3'leader are transcribed at higher levels than the same gene unit located more distally,
Will be expressed (Collins et al., 3rd edition, In “Fields Virology”, BNFields,
DMKinpe, PM HOwley, RMChanock, JL Melnick, TP Monath, B. Roizm
an, and SEStaus, Editing, Vol.1, pp.1205-1243, Lippincott-Raven Publisher
s, Philadelphia, 1996).

Chimeric rHPI with measles virus HA insertion in the background of wild-type rHPIV3
V replicated efficiently in vitro, but in the hamster it was derived from rHP
Replication was restricted compared to the IV3 virus. Similarly, a recombinant chimeric HPIV3 with a measles virus HA insert with a background of attenuated or rHPIV3 also replicates in vitro, but its level is slightly lower in the hamster body compared to the attenuated rHPIVcp45L mutant virus from which it is derived. It was

Attenuated rHPIV3 measles virus HA with a measles virus HA insert at the N / P or P / M junction
The amount of HA protein expressed by recombinantly infected cells is extremely high, much higher than that found in cells infected with native measles virus. In the upper respiratory tract of hamsters, the replication level of rHPIV3cp45L, which has a measles virus HA insert at the N / P or P / M junction, was 10 times lower than that of the rHPIV3-cp45L parental virus, suggesting gene insertion unexpectedly.
It was suggested that it could contribute to the attenuation of 3 vectors. These results of identifying a specific host range were unexpected.

Importantly, each of the recombinant chimeric viruses tested induced high levels of antibodies to HPIV3 and measles virus. Animals immunized with the attenuated recombinant chimeric HPIV3 with HA insertion were extremely resistant to replication of HPIV3 challenge virus. Although wild-type measles virus does not replicate efficiently in hamsters and is therefore not available for challenge, the protective efficacy of attenuated recombinant chimeric vaccines is more readily seen than induction of high levels of neutralizing antibodies. These levels are associated with high levels of resistance to measles in humans (Chen et al., I. Infect. Dis. 162 .1036-42, 1990).
.

In addition, an attenuated chimeric recombinant HPIV vector having a combination of the HPIV3 backbone and one or more HPIV1 antigenic determinants may be combined with additional foreign antigens (eg HPIV2
Alternatively, it can be used as a vector for expressing a non-PIV virus). This aspect of the invention takes advantage of the efficient growth and excellent attenuation properties of the HPIV3 backbone,
It carries antigenic determinants of multiple pathogens, as exemplified by PIV1 and HPIV2.

RPIV3-1 (non-attenuated recombinant with HPIV1 major antigen) or rPIV3-1cp45 (HPIV1
The cDNA encoding the attenuated recombinant (having the major antigen) was used as the OR of HPIV1 F and HN.
The gene unit containing the ORF of HPIV2 was inserted and modified between the gene units containing F. rPIV3
Recombinant chimeric viruses designated -2HN and rPIV3-1cp45.2HN were easily recovered and efficiently replicated in tissue culture. Each virus has its rPIV3-1 or rPIV3-1cp
It showed the same level of temperature sensitivity of replication in vitro as the 45 parent viruses.

The PIV2HN insertion was attenuated in hamsters for both rPIV3-1 and rPIV-cp45 viruses, but this finding was similar to that of measles virus HA in rJS and rPIV3cp45. Infection of hamsters with these antigenic rPIV3-1 recombinants carrying the PIV2HN gene insert induced a serum antibody response that was reactive against both HPIV1 and HPIV2.

That is, the attenuated rHPIV3 or rHPIV3-1 vaccine candidate infects the upper respiratory tract of a susceptible host, thereby inducing a strong antibody response against the foreign protective antigen expressed from the external gene unit and the HPIV vector itself. May be available as
Since there are three antigenic serotypes in HPIV that do not provide significant cross protection, each has the same or different heterologous antigenic determinants, such as protective antigen, measles virus or one or more different viruses. In short, human infants can be immunized more efficiently and continuously by utilizing antigenically different variants of HPIV having an antigenic domain or epitope of a bacterial pathogen.

Sequential immunization allows the generation of a primary immune response against foreign proteins, which response may be due to one or more heterologous antigenic determinants, such as measles virus, or one or more different viral or bacterial pathogens. It is further promoted by subsequent infection with a secondary, antigenically distinct HPIV carrying protective antigens, antigenic domains or epitopes. In this way, immunity induced against one type of HPIV vector can be bypassed by boosting with antigenically different HPIV vectors.

Immunization of animals immunized against PIV3 in this sense has been successfully achieved by attenuated PIV3-1 vaccine candidates, for example these PIVs share proteins other than HN and F. In some cases, it was confirmed that serial immunization with serologically different PIV viruses was possible (Tao et al., Vaccine 17 : 1100-8, 1999). In this study, the immunogenicity and efficacy of rPIV3-1.cp45L against PIV1 challenge was verified in hamsters with and without prior immunization with PIV3. rPIV1-1.cp45L efficiently infected hamsters pre-infected with wild-type or attenuated PIV3, whereas replication of rPIV3-1.cp45L virus was reduced by about 5-fold in PIV3 immunized animals.

However, immunization of PIV3-immunized animals with rPIV3-1.cp45L induces various serum antibodies that react with PIV1, and replication of PIV1-challenged virus is 1000 times in the lower respiratory tract and 200 times in the upper respiratory tract. Fell. These results indicate that the recombinant chimeric rPIV3-1.cp45L candidate vaccine can induce immunity to PIV1 even in animals immunized against PIV3. This established the effectiveness of utilizing a continuous immunization schedule in which the live attenuated PIV3 vaccine is followed by recombinant chimeric rPIV3-1.cp45L or other PIV vaccine virus.

Since rPIV3-1.cp45L readily induced protective immunity against itself, it would also induce an effective immune response against other vectorized protective antigens it possesses. Also, PIVs and RSV have the unusual property of being able to reinfect the respiratory tract, but reinfection is generally not associated with severe illness. That is, a vector based on the vaccine construct of the invention is the same HPIV vector as the second, third or fourth.
It is useful for promoting immune response by administration or continuous use of different vectors.

In a preferred method of continuous vaccination of the invention, it is desirable that the infants be sequentially immunized with various PIV vectors, each expressing the same heterologous antigenic determinant, such as measles virus HA. This continuous immunization can induce a high titer of antibody against a heterologous protein that is characteristic of the secondary antibody reaction. In one embodiment, an early infant (eg, 2-
4-month-old infants are immunized with a heterologous antigenic determinant, such as the attenuated chimeric HPIV3 expressing the measles virus HA protein, and at the same time adapted to induce an immune response against HPIV3. One example of a vaccine candidate useful for this purpose is the rcp45L (HA PM) recombinant.

Then, for example, at the age of 4 months, the baby is again treated with a secondary species of another species having an antigenicity different from the initial one.
Immunize with the PIV vector construct. An example of a vaccine candidate for this purpose is the rPIV3-1cp45L virus which expresses the measles virus HA gene and HPIV1 antigenic determinant as a functional, true glycoprotein of the vector. After the first vaccination, the vaccine
It elicits a primary antibody response against both PIV3 HN and F proteins and measles HA protein, but not against PIV1 HN and F proteins. Lack of antibodies to PIV1 HN and F proteins, vaccinated individuals were easily infected by secondary immunization with rPIV3-1cp45L expressing measles virus HA, resulting in primary antibody response to PIV1 HN and F protective antigens and xenogenic measles. Induces both high titer secondary antibody responses to the viral HA protein.

HPIV3 immunized with one or more chimeric vaccine viruses described herein,
A continuous immunization schedule can then be developed that simulates primary, then secondary, high-titer protective responses against measles or other non-PIV pathogens that are subsequently elicited against HPIV2. This serial immunization method, preferably using different serotypes PIV as primary and secondary vectors, provides immunity induced against the primary vector which is the factor ultimately limiting the efficacy of vectors with only one serotype. Detour effectively.

Further in accordance with this aspect of the invention, a typical coordinated vaccination protocol comprises two, three, four and six or more independent chimeric HPIV vaccines administered simultaneously in a primary vaccination step, eg, one. Will be incorporated at 2 or 4 months of age (eg multispecific vaccine mix). For example, selected from RSV subgroup A G protein, RSV subgroup A F protein, RSV subgroup B G protein, RSV subgroup B F protein, measles virus HA protein, and / or measles virus F protein. Vaccine virus with two or more separately expressing one or more antigenic determinants (ie, whole antigen, immunogenic domain, or epitope) and whole panel of HPIV it can.

Coordinated booster administration of these same PIV3-based vaccine constructs was 2
It can be repeated at the age of the moon. Subsequently, another panel of live attenuated HPIV-based vaccine viruses can be administered at the secondary vaccination stage, for example at age 4 months with 2-6 or more different antigenicities (see vector antigen specificity). . For example, secondary vaccination is RSV G from subgroup A, R from subgroup A
SV F, RSV F from subgroup B, RSV G from subgroup B, measles virus HA
And / or measles virus F, or a mixture comprising multiple HPIV3-1 vaccine constructs that collectively express antigenic determinants derived from any combination of these proteins, or co-administration of multiple formulations Will be.

This secondary immunization provides a boost to immunity against each of the heterologous RSV and the measles virus protein, or its antigenic determinants. At 6 months of age, RSV G from subgroup A, RSV F from subgroup A, RSV G from subgroup B,
1-6 or more different live attenuated PIV3-2 vector bases expressing RSV F from subgroup B, measles virus HA and / or measles virus F, or their antigenic determinants separately or collectively A third vaccination stage, which involves administering the vaccine recombinant, can be administered coordinately.

Optionally, the rPIV3 and rPIV3-1 vaccines may be administered in a booster formulation at this stage of the vaccine protocol. Thus, during the first 6 months of infancy, PIV1
, PIV2, PIV3, RSV A, RSV B and secondary antibodies to measles virus all elicit strong immunological properties, which can induce secondary antibody responses to multiple viral respiratory pathogens and in early infancy. It provides a very potent and extremely flexible immunization method required for immunization against each of the three PIV viruses and other pathogens.

In another aspect of the invention, a heterologous nucleotide sequence is inserted into a HPIV vaccine candidate,
The level of attenuation of the candidate vaccine recombinant is varied separately, eg with respect to the upper respiratory tract. That is, a candidate vaccine virus can be attenuated by inserting into the rHPIV a nucleotide sequence that both expresses the foreign protein and attenuates the virus in the animal host, or by utilizing the nucleotide insertions separately. To define some of the rules governing the effect of gene insertion on attenuation, we inserted gene units of various lengths into the wild-type HPIV3 backbone and investigated the effect of gene unit length on attenuation. . The insertion of these novel gene units is designed so as not to contain a significant ORF so that the effect of the length of the gene unit can be evaluated independently of the effect of the expressed protein of the gene.

These heterologous sequences were inserted between the HN and L genes as an external gene with a size of 169 nt to 3918 nt. In addition, inserts of similar size were inserted in the 3'non-coding region of the HN gene, thus creating control cDNA constructs and viruses without the addition of foreign genes. We made these viruses and examined the effects of increasing gene length and number of genes on attenuation. Insertion of an external anionic unit is believed to reduce transcription of genes downstream of the insertion site, which in turn will affect both total amount and percentage of expressed protein.

As shown here, inserts or extensions greater than or equal to about 3000 nts attenuated live virus with respect to the upper and lower respiratory tract of hamsters. A gene insertion of approximately 2000 nts in length further attenuated the rHPIV3cp45L vaccine candidate in the upper respiratory tract. Taken together, gene insertion can have a dual effect on both the attenuation of candidate vaccine viruses and the induction of protective effects against secondary viruses. Gene extension in the 3'-untranslated region of a gene that is unable to express additional proteins also attenuates its interior and itself. In these methods of the invention, the length of gene insertion is a determinant of attenuation.

The GU and NCR insertions in the recombinant PIV of the invention result in attenuating the phenotype characterized by efficient replication in vitro and reduced replication in vivo, although this phenotype is not compatible with other paramyxos. There have been no previous reports of virus insertion. The mechanism of attenuation resulting from GU incorporation may be the result of one or more of the following predominantly in vivo acting factors: The addition of an external gene unit will reduce the transcription level of downstream genes, because there is a transcriptional gradient in which genes closer to the promoter are transcribed at a higher rate than genes farther from the promoter. Reduced expression of downstream genes is due to a decrease in their mRNAs levels, resulting in either restricted or attenuated changes in the specific ratio of gene products required for efficient replication. Will it happen?

Transcriptional gradients are believed to be the result of shedding of the transcription complex during transcription and translocation across gene junctions. Alternatively, the increased total length of transcribed genomic and external mRNAs will result in increased levels of viral double-stranded RNA, which will result in higher levels of antiviral activity of the interferon system. Finally,
The overall level of genome replication will decrease with increasing genomic and antigenomic length. This is considered to be the result of the replicase complex being shed from the template during replication of genomic RNA or antigenomic RNA. A reduction in the amount of genome that can be packaged in the virion would lead to a reduction in virus yield and consequent attenuation.

The mechanism of attenuation that results from NCR recruitment may be the result of one or more of the following factors. NCR insertion resulted in extra length at the 3'end of NH mRNA
NA will be destabilized, which will reduce HN protein expression. Alternatively, a viral double-stranded RNA produced by an increase in the full-length HN mRNA genome and an extra length
, Which may increase the antiviral activity of the interferon system.

Alternatively or additionally, the overall level of genomic replication may be reduced by the increased length of the genome and antigenome. As a result, shedding of the replicase complex may occur except during replication of genomic RNA or antigenomic RNA. As a result of the reduced amount of genome that can be packaged in the virion, viral yields are also reduced and may be attenuated as a result. Finally, the addition of extra nucleotides to the 3'end of the HN genome could cause the transcription complex to fall off during transcription of the extra nucleotides at the 3'end of the HN gene. , The transcription level of downstream genes may decrease.

The in vitro and in vivo growth properties of GU and NCR insertions into PIV3 are described in 1 above.
This is different from the conventional findings regarding this differential minus-sense RNA virus. As a result of validating the expressed proteins for insertions tested thus far, the independent effect of insert length on viral growth in vivo could not be determined. Recent findings indicate that GU and NCR insertions of size 3 kb and above define an attenuated phenotype independent of expressed protein. Shorter insertions, such as those larger than about 2 kb, define further attenuation in the partially weakened recipient.

Also, unexpectedly, the insertion of GU and NCR is limiting replication in vivo without limiting replication in vitro. Furthermore, the in vivo attenuated phenotype is
It was found to be in the form of either a GU or NCR insertion-the only other reported insertion is the GU type. Thus, the reduced in vivo replication manifested by the insertion of a GU or NCR that does not encode a protein represents a unique way of attenuating members of the mononegavirus in vivo.

[0374]   Example 1   Construction of a cDNA clone encoding the chimeric HPIV3 / measles virus-HA antigenome
And recovery of infectious virus   Full-length c encoding the 15462 nucleotide antigenome of the JSPIV3wt virus
Three types of cp45-specific temperature sensations in L ORF of DNA clone, p3 / 7 (131) 2G +, and PIV3
PFLCcp45L, which encodes the JSwt derivative antigenome containing the passive mutation,
It has already been described (Durbin et al.Virology 235: 323-332, 1997a; Skiadopoulos
,J. Virol.72: 1762-8, 1998, also referenced and incorporated here).

These clones were used as a vector suitable for insertion of the measles virus HA gene, and an attenuated HPIV3 chimeric construct expressing a heterologous antigenic determinant of the measles virus represented by wild type and HA protein was prepared. Was done. The size of each insert containing the measles HA gene was a multiple of 6, and the chimeric virus recovered from the cDNA followed the rules of 6 (Durbin et al., Virology 234: 74-83, 1997b, incorporated herein by reference). Has been).

[0376]   A full-length chimeric HP that encodes the measles virus HA protein at the N / P or P / M junction. Construction of IV3 cDNAs   The BamHI fragment from PmlI of p3 / 7 (131) 2G + (nt1215-3903 of PIV3 antigenome) was cloned into
A plasmid pUC119 {pU modified to contain a PmlI site within the multi-cloning region
C119 (PmlI-BamHI)}. Using the Kunkel method (Kunkel et al.
Methods Enzymol. 154: 367-382, 1987, referenced and incorporated herein) pUC1
Two independent single-chain mutagenesis reactions were performed on 19; the first reaction was
By mutating the CTAAAT sequence in nts1677-1682 of nom to CTTAG (pAFlIIM-P)
AflII site was introduced within the 3 '(downstream) -noncoding region of the gene, and the second
In another reaction, CTTAAG (pAflIIP-M) was added to the TCAATC sequence in nts3693-3698 of the antigenome.
To introduce an AflII site in the 3 '(downstream) -noncoding region of the P gene by mutating to
did.

The HA ORF of the measles virus Edmonston strain was amplified from Edmonston wild type virus using the reverse transcription polymerase chain reaction (RT-PCR). The nt sequence of the open reading frame (ORF) of Edmonston wild type HA is Gene Bank Accession No. U03669, and is incorporated herein by reference (this sequence is an ORF containing only the upstream 3 nts or stop codon). Note). Measles virus RNA was purified from clean media using TRIzol-LS (Life Technologies, Geiserburg, MD) according to the manufacturer's recommendations. RT-PCR is Advantage RT-for-PC
R and Advantage-HF PCR kits (Clontech, Palo Alto, CA) were used according to the recommended protocol.

The primers were used to generate a PCR fragment covering the entire ORF of the measles virus HA gene linked to the PIV3 non-coding sequence and the AflII restriction enzyme site. Forward Plummer 5'-TTAATCTTAAG AATATACAAATAAGAAAAACTTAGGATTAAAGA GCGATGTCACCACAACGAGA
CCGGATAAATGCCTTCTAC-3 '(SEQ ID NO: 13) is measles HA preceded by GE, IG and GS sequences (Fig. 1A) and three types of non-HPIV3 and non-measles virus nts specified in the primer.
P from the N / P gene junction nts3699-3731 (underlined) including the start of ORF (bold)
It encodes an AflII site (italics) downstream of the IV3 noncoding region.

Reverse primer 5'-ATTATTGCTTAAG GTTTGTTCGGTGTCGTTTCTTTGTTGGATC CTATCTG
CGATTGGTTCCATCTTC-3 '(SEQ ID NO: 14) has an AflII site (italicized) downstream of the PIV3 non-coding sequence derived from the P gene of nt3594-3623 (underlined), and measles H.
It encodes A's ORF (bold). The resulting PCR fragment was then digested with AflII and p (
AflII NP) and p (AflII PM) were cloned into pUC119 (HAN-P) and pUC119 (HAP-M), respectively.

PUC119 (HA NP) and pUC119 (HA PM) are dRhodamine Terminator Cycle Sequencing Ready R
eaction) (ABI Prism, PE Applied Biosystems, Foster City,
CA) and all AflII inserts were sequenced and the sequence was confirmed to be correct.

The PmlI to BamHI fragments of PUC119 (HA NP) and pUC119 (HA PM) were separately inserted into the full-length antigenome cDNA plasmid p3 / 7 (131) 2G + as previously reported (Durbin
Et al., Virology 235: 323-332, 1997a, referenced and incorporated herein), pFLC (
HA NP) and pFLC (HA PM) (Fig. 1) were generated. Next, the XhoI-NgoMI fragment of PFLCcp45L (nt7437-15929) was cloned into both pFLC (HA NP) and pFLC (HA PM) Xho-I-NgoMI windows to obtain pFLCcp45 (HA NP) and (pFLCcp45L (HA PM). Created. PCLC
cp45L is in the L gene of PIV3 cp45 and confers most of the temperature sensitivity and attenuation of the cp45 vaccine candidate virus (Skiadopoulos et al., J. Virol. 72: 1762-8, 1998,
3 amino acid changes (referenced and incorporated here) (amino acid position, 942, 992)
And 1558), and the XhoI-NgoMI fragment transferred with these mutations.

[0382]   A full-length HPIV3 chimeric cDNA encoding the measles HA protein at the HN / L junction.
Construction   The HPIV3 chimeric cDNA encodes a measles virus heterologous antigenic determinant.
The heterologous polynucleotide sequence exemplified by the HA gene
It was constructed using PCR so as to align with the non-coding region of the IV3NH gene. This cDNA is
Designed to be combined with rPIV3 vector as an external gene following the next HN gene
Was done. First, Kunkel's mutation induction method (Kunkel et al., MethodsEnzymol.154: 367-3
82, 1987, referred to and incorporated herein), using the antigenomic nt8598-860
Introduce a mutation in the AGACAA sequence at position 3 to position the StuI site at the 3'-non-coding region of the HN gene.
The plasmid p3 / 7 (131) 2G-Stu (Fig. 1B) was obtained by introducing the plasmid into the coding region.

A cDNA containing the ORF of measles HA in parallel with the HPIV3 sequence (see FIG. 1B) was then constructed in 3 pieces using PCR. The first PCR synthesized the left hand, upstream part of the gene. Forward primer 5'-GACAATAGGCCT AAAAGGGAAATATAAAAAACTTAGGAGTAAAGTTACGCAATCC -3 '
(SEQ ID NO: 15) contains the downstream end of HN gene, intergenic region, and gene start signal (HPIV3nts8602-8620) StuI site (italic) followed by HPIV3 sequence (underlined)
And a sequence derived from the upstream end of the HN gene (HPIV3nt6733-6753).

The reverse primer 5'-GTAGAACGCGTTTATCCGGTCTCGTTGTGGTGACAT CTCGAATTTGGATT TGTCTATTGGGTCCTTCC -3 '(SEQ ID NO: 16) is followed by a complementary sequence (underlined) to HPIV3nts6744-6805 which is part of the upstream HN non-coding region, measles HA ORF. (
It contains an MluI site (italics) downstream of the start of (bold). The MluI site in the introduced measles virus ORF is nt27 from T (wild type Edmonston HA gene)
Created by changing C to C and 30 from C to G.

All of these changes are non-coding within the measles virus ORF. PCR is p3 / 7
It was carried out using (131) 2G-Stu as a template. The product designated as PCR fragment 1 has a StuI site at the 5'end and an MluI site at the 3'end in parallel, and the first 36 nt of measles HA ORF located downstream of the non-coding sequence derived from the HPIV3HN gene. Including.

The second PCR reaction synthesized the right hand of the HN gene. Forward primer GTAGAACGCGTTT
ATCCGGTCTCGTTGTGGTGACAT CTCGAATTTGGATTTGTCTATTGGGTCCTTCC -3 '(SEQ ID NO: 16
) Contains XmaI (italics) and the end of the measles hyaluronan ORF (bold), which also contains HN
Followed by HPIV3nts8525-8566 (underlined), which represents part of the downstream untranslated region of the gene. The reverse primer 5'-CCATGTAATTGAATCCCCCAACACTAGC-3 '(SEQ ID NO: 17) covers HPIV3nts11475 in the L gene.

The PCR template was p3 / 7 (131) 2G-Stu. The PCR fragment 2 obtained from this reaction contains the terminal 35 nt of the measles hyaluronan ORF and approximately 2800 nt of the PIV3 L ORF, and the XmaI site and SphI site are linked thereto (these naturally occur at HPIV position 11317). . The third PCR reaction amplified the largest middle part of the measles HA ORF from the template cDNA pTM-7, which is a plasmid containing the HA ORF of Edmonston strain of measles virus to which ATCC was donated. Sequence analysis of this plasmid showed that the measles virus HA ORF contained in PTM-7 used for insertion into the NP and MP junction contained two amino acids that differed from pTM-7 in the Edmonstone wild type HA sequence. , And that they are at amino acid position 46 (F to S) and position 481 (Y to N).

Forward primer 5'-CGGATAAACGCGTTCTACAAAGATAACC-3 '(SEQ ID NO: 18) (Ml
uI site italic) and reverse primer 5'-CGGATAAACGCGTTCTACAAAGATAACC-3
'(SEQ ID NO: 18) (XmaI site italic) is PCR containing nts19-1838 of measles HA ORF
Fragment 3 was amplified.

To assemble this fragment, PCR fragment 1 was digested with StuI and MluI and PCR fragment 3
Was digested with MluI and XmaI. These two digested fragments were then cloned by triple ligation into the StuI-XmaI window of pUC118 modified to have a StuI site within its multicloning region. The resulting plasmid pUC118 (HA1 + 3) contains Stu1 and Xma
PCR fragment 2 was digested with XmaI and SphI.

The two digestion products were then cloned into the StuI-SphI window of p3 / 7 (131) 2G-Stu, yielding plasmid pFLC (HA HN-L). The StuI-SphI fragment containing the total measles HA ORF was then transferred to the dRhodamine Terminator sequencing ready reaction (dRhodamine Ter).
Minator Cycle Sequencing Ready Reaction) (ABI prism, PE Applied Biosystem, Foster City, CA) was used for sequence revision. The sequence of the chimeric construct was confirmed. In this way, the measles virus HA is aligned with the HPIV3 transcription signal.
N / P, P of the antigenomic cDNA vector containing wild type HPIV3 with ORF as an external gene
It was inserted into the / M or HN / L junction, or into the N / P or P / M junction of an anti-genomic cDNA vector containing attenuated HPIV3.

[0391]   Recovery of rcp45L expressing chimeric rPIV3 wild-type and measles virus HA proteins
  5 full-length vector cDNAs with measles HA ORF as independent genes
Support plasmid on well plate (Coaster, Cambridge, MA)
pTM (N), pTM (P no C) and pTM (L)} and LipofectA (LifofectA)
(Knologies) into Hep-2 cells, and as previously reported.
(Durbin et al.Virology 235: 323-332, 1997; Durbin et al.,Virology 234: 74-83,
1997, each referred to and incorporated herein), to cells containing bacteriophage T7 poly.
MV, a replication-deficient vaccinia virus recombinant that encodes a merase protein
Co-infected with A-T7.

PTM (P no C) is a derivative of pTM (P) in which C ORF expression is silenced by mutation of the C start codon (Durbin et al., Virology 261 : 319-330, 1999). After incubating at 32 ° C for 3 days, the transfection harvest was subcultured to new monolayer Vero cells in a T25 flask, and further incubated at 32 ° C for 5 days (passage 1). The presence of HPIV3 during passage 1 was as previously reported (Durbin et al., Virology 235 :
323-332, 1997, referenced and incorporated herein) HPIV3 HN-specific, and measles.
Plaque titer determination of LC-MK2 monolayer cultures was performed using immunoperoxidase with HA-specific monoclonal antibody to determine.

The rPIV3 (HA HN-L) virus present in suitable passage 1 harvest supernatants was
Plaque purification was biologically cloned in triplicate on LLC-MK2 cells as previously reported (Hall et al., Virus Res . 22 : 173-184, 1992, referenced and incorporated herein). RPIV3 (HA NP), rcp45L (HA NP), rPIV3 (HA PM) and rcp45L (HA PM)
Biologically cloned from each passage 1 harvest by final dilution utilizing serial 2-fold dilutions of Vero cell monolayers in 96-well plates (12 wells per dilution).

Then, the biologically cloned recombinant virus obtained by repeating the plaque purification three times or the final dilution two or three times at 32 ° C. was used for LLC-MK2 cell {rPIV3 (HA HN-L) or Vero cells (rPIV3 (HA NP), rcp45L (HA NP), rPIV3 (HA
PM), rcp45L (HA PM)} was amplified twice to prepare a virus for subsequent analysis. As a first step to identify and analyze recombinant chimeric PIV3s expressing the HA glycoprotein of measles virus, nuclear passage 1 harvest with 3 different primer pairs:
Each position of the HA ORF insert was analyzed by RT-PCR using one pair. The first primer pair contains nucleotides 1596-1968 of the full length HPIV3 genome containing the N / P insertion site.
A fragment of PIV3 covering A. was amplified.

The size of this fragment increased to 2298 nucleotides due to the HA ORF inserted between the N and P genes. The second primer amplified a fragment of PIV3 covering nucleotides 3438-3866 of the full length HPIV3 genome containing the P / M insertion site. The measles HA ORF inserted between P and M increased the size of this fragment to 2352 nucleotides. The third primer pair amplified the PIV3 fragment covering nucleotides 8466-8649 of the full length antigenome. The measles HA ORF inserted between the HN and L genes increased the size of this fragment to 2211 nucleotides containing the HN / L insertion site. All five viruses recovered contained inserts of the appropriate size at the appropriate sites. Each PCR
The production of the product was dependent on the inclusion of reverse transcriptase, suggesting that each was from RNA and not from contaminating cDNA.

LLC-MK2 cell monolayers in T25 flasks were rcp45L (HA NP), rcp45L (HA PM), RJS
At a multiplicity (MOI) of 5, or mock infection. Ve in T25 flask
Ro cell monolayers were infected with the Edmonston wild type strain of measles virus at MOI5. Since measles virus does not grow well in LLC-MK2 cells, Vero cell monolayers were selected for measles-edmonstone virus infection. 24 hours after infection, the monolayer was washed with methionine-free DMEM (Life Technologies). ³⁵ S methionine was added to DMEM-free medium at a concentration of 10 uCi / ml, and 1 ml was added to each flask, followed by incubation at 32 ° C for 6 hours. The cells were collected and washed 3 times with PBS.

The cell pellet was mixed with 1 ml of RIPA buffer {1% (w / v) sodium oxycholic acid, 1% (v
/ v) Triton X-100 (Sigma), 0.2% (w / v) SDS, 150 mM NaCl, 50 mM Tris-HCl, pH7.4
}, And freeze-thaw, and it was clarified by centrifugation at 6500X for 5 minutes. Transfer the cell extract to a new Eppendorf tube and recognize the measles virus HA glycoprotein (79-XV-V17, 80-III-B2, 81-1-366) (Hummel et al., J. Virol . 69 ; 1913- 1913. 6
, 1995; Sheshbcradaran et al., Arch, Virol . 83 ; 251-68, 1985, which are respectively referred to and incorporated herein) or recognize the HN protein of PIV3 (101/1, 402/7, 166/11)
A mixture of monoclonal antibodies (van Wyke Coelingh et al., Virology 160 : 465-72, 1987, incorporated herein by reference) was added to each sample and incubated at 4 ° C. for 2 hours with constant mixing.

Immune complex is 10% of protein A Sepharose beads (Sigma, St. Louis, MO)
The suspension was precipitated by adding 200 μl to each sample, followed by constant mixing overnight at 4 ° C. Each sample was suspended in 90 μl of IX loading buffer and 10 μl of reducing agent was added. After heating at 70 ° C for 10 minutes, 20 µl of each sample was applied to a 4-12% polyacrylamide gel (NuPAGE, Novex, Sanjego, CA) according to the manufacturer's recommended method. The gel was dried and autoradiographed (Figure 2). Rcp45L (HA PM
) And rcp45L (HA NP) are the same size as the legitimate measles HA protein, anti-measles HA.
It encoded the protein precipitated by the monoclonal antibody.

Rcp45L (HA PM) and rcp45L (HA NP) express the measles virus HA protein in a large amount as compared to the Edmonston wild strain of measles virus, and these constructs efficiently attenuated strains of N / P and P. The / M junction was shown to express measles virus HA. rc
p45L (HA NP) and rcp45L (HA PM) were confirmed to be HPIV3 based on their reactivity with PIV3 anti-HN monoclonal antibody.

[0400]   Temperature of RPIV3 parental virus and rPIV (HA) chimeric virus replication in vitro
Sensitivity   To investigate the temperature-sensitive level of replication of chimeric rPIV3s with measles virus HA insert
, HA insertion gain is higher in chimeric virus than parental vector virus at various temperatures
It was examined whether or not the replication level was changed (Table 1). Rcp45L, rcp45L (N-P), r
cp45L (HA P-M) and rPIV3 (HA HN-L), rPIV3 (HA P-M) or rJS with 96
Source of 5% FBS, 4 mM glutamine, and 50 μg / ml on LLC-MK2 cell monolayers in culture
Dilute 10-fold serially in L-15 supplemented with Taiga Susumu to 32, 36, 37, 38, 39 or 40 ℃
And incubated for 6 days.

Virus was detected by erythrocyte adsorption and reported as log ₁₀ TCID ₅₀ / ml. Interestingly, chimeric derivatives of both wild-type vector viruses carrying the measles virus HA gene, rPIV3 (HA HN-L) and rPIV (HA PM), were slightly restricted in replication at 40 ° C (
(Table 1). Two attenuated rPIV3s with rcp45L (NP) and rcp45L (HA PM) are the parent rcp4
The temperature sensitivity level was almost the same as that of 5L, but rcp45L (HA PM) showed slightly higher temperature sensitivity than its parent.

That is, the virus with the insert is the parental vector rP from which it is derived in tissue culture.
It replicated as well as IV3, with a slight increase in temperature sensitivity. These results are rPIV3
Show that the rPIV3 (HA) chimeric virus can be easily used as a vector to adapt the HA insertion to various sites without causing a significant change in replication in vitro, and further addition of one or more attenuating mutations It shows that it can easily adapt to.

[0403]

[Table 1]

[0404]   Example II   Efficiently replicates measles virus in hamsters for both HPIV3 and measles
Chimeric rPIV3s with antigenic determinants that induce high antibody titers   Determination of rPIV3 (HA) virus replication and immunogenicity levels in hamsters.   The replication levels of chimeric rPIV3s bearing measles virus antigenic determinants were determined by their parent rPIV
Acquisition of determinants exemplified by HA inserts in vivo compared to that of 3s
It was determined whether they significantly changed their replication ability and immune response inducing ability. Two kinds of fruits
10 in a group of 6 or 7-8 week old Golden Syrian hamsters^6.9PFU
RJS, rcp45L, rcp45L (HA P-M), rcp45L (HA N-P), rPIV3 (HA HN-L) or rPIV3 (H
0.1 ml of EMEM (Life Technologies) containing A P-M was inoculated intranasally (Tables 2 and 3)
).

Four days after inoculation, hamsters were sacrificed and lungs and turbinates were collected. 10 for turbinates and lungs
The samples were homogenized (Quality Biologicals, Gaitherburg, MD) in suspensions of 15% or 20% w / v L-15 respectively and the samples were snap frozen. The virus present in the samples was titrated on 96-well plates of LCC-MK2 cell monolayers and incubated at 32 ° C for 7 days. The virus was detected by blood cell absorption and the average log ₁₀ TCID ₅₀ / g was calculated for each hamster group. Insertion of the HA gene into wild-type rJS (Table 2) restricted replication in the upper respiratory tract by 4 to 20 fold and replication in the lower respiratory tract by up to 5 fold. It was suggested that the effect of the wild-type rJS virus on replication was minimal.

The replication of each of the two rcp45 (HA) antigenic chimeras was 10-fold lower in the upper respiratory tract compared to rcp45L, which has three attenuating ts mutations in the L protein (Table 3). The lower respiratory tract was the same as rec45L. That is, in each of the two rcp45 (HA) antigenic chimeras, a slight but statistically significant decrease in replication was observed in the upper respiratory tract of hamsters, and acquisition of the HA gene by rcp45L enhanced attenuation in the upper respiratory tract. However, it was shown that this was not seen in the lower respiratory tract. Thus, the effect of HA gene insertion on replication of wild-type or attenuated PIV3 was comparable for the upper respiratory tract.

[0407]

[Table 2]

[0408]

[Table 3]

Next, the ability of the chimeric rHPIV3 (HA) virus to induce an immune response to HPIV3 and measles virus was examined. In a group of 6-24 Golden Syrian hamsters (4-6 weeks old) 106.0 PFU of rJS, rPIV3 (HA PM), rcp45L, rcp45L (HA PM) or
rcp45L (HA NP) was infected on day 0 (Table 4). Serum was collected from each hamster on day -1 and day 25 post inoculation. Serum response to HPIV3 has been reported previously (van
Wyke Coelingh et al., Virology 143 : 569-582, 1985, incorporated herein by reference) and assessed by hemagglutination inhibition (HAI) assay, and serum antibody response to measles virus as previously reported (Goates et al., Am. J. Epidemiol. 83: 299-3
13, 1996, incorporated herein by reference) and evaluated by the 60% plaque reduction assay.

These results were compared to the results of an additional control group of cotton rats that received 10.5.0 live attenuated measles virus (Moraten strain) intramuscularly on day 0. Since measles virus only weakly infects hamsters, cotton rats were used instead of hamsters. As shown in Table 4, each PIV3 (HA) chimeric virus was able to induce a large serum neutralizing antibody response against measles virus. No significant difference was observed between the serum neutralizing antibody levels elicited by the attenuated derivative rcp45L (HA PM) and its wild type counterpart, rPIV3 (HA PM). In addition, rPIV3 (HA
) The levels of recombinantly induced measles virus-neutralizing serum antibodies were on average 5 times higher than the average levels when immunized intramuscularly with the live attenuated measles virus vaccine.

Furthermore, the serum antibody response to HPIV3 produced by all chimeric viruses was also relatively large, comparable to that produced by infection with wild type rJS.

[0412]

[Table 4]

At day 25, 66.0 hamster biologically-derived HPIV3 wild-type virus 106.0 pfu from each group and also a control group also infected with RSV.
Was administered intranasally as 0.1 ml of inoculum. Lungs and turbinates were collected on day 4 and processed as described above. The virus present in the samples was titrated on 96-well plates of LLC-MK2 cell monolayers and incubated for 7 days at 32 ° C. Virus was detected by red blood cell absorption and log ₁₀ TCID ₅₀ / ml was calculated for each hamster group. As shown in Table 5, these chimeric virus-treated hamsters, whether attenuated or wild-type backbone, are highly protected against replication of inoculated wild-type HPIV3 in the upper and lower respiratory tract. It had been.

[0414] That is, although the measles HA gene-acquiring has a slight attenuation effect on the replication of the rep45 (HA) chimeric virus, infection with either rcp45L (HA PM) or rcp45L (HA NP) was observed in the upper part of the hamster and It induced a high level of protection against HPIV3 as shown by reducing its replication in the lower respiratory tract by about 1000-fold. Since the wild-type measles virus does not replicate efficiently in hamsters, it cannot be used to attack this host. However, the attenuated chimeric rcp45L (HA) vaccine candidate is expected to be highly effective against measles virus, as it induces high levels of neutralizing antibodies, ie, mean titers greater than 1: 5000. In hamsters, comparable levels of measles virus antibodies are associated with strong resistance to measles virus disease (Chen et al., J. Infect . Dis . 162 : 1036-42, 1990, incorporated herein by reference).

[0415]

[Table 5]

[0416]   Example III   Chimera having HPIV2HN gene as an external transcription / translation unit inserted between F and HN genes Construction of antigenomic cDNA encoding HPIV3-1 vector and round of infectious virus
Income   rPIV3-1 h Recombinant chimeric HPIV3 in which HN and F genes are relaxed to those of HPIVI
(Skiadopoulos et al.,Vaccine 18: 503-510, 1999; Tao et al., Vaccine 17: 1100.
-1108, 1999; US patent application serial number 09 / 083,793, filed May 22, 1998; US patent
Application Serial No. 09 / 458,813, filed Dec. 10, 1999; US Patent Application Serial No. 09 / 459,0
62, filed Dec. 10, 1999, each referenced and incorporated herein).

In this example, the HN gene of HPIV2 functions as a vector for producing a chimeric inducing virus, has an introduced heterologous antigenic determinant derived from HPIV2, and is inserted into an rPIV3-1 chimeric virus capable of preventing both HPIV1 and HPIV2. Was done. HPIV2HN gene is also rPIV3-1cp4
Fifteen different cp45 mutations, named 5, were inserted into the rPIV3 backbone
It was also inserted into an attenuated derivative of rPIV3-1 containing 12 of the mutations in genes other than HN and F (Skiadopoulos et al., Vaccine 18: 503-510, 1999). The source of HPIV2 wild-type virus was Ver isolated from nasal lavage fluid obtained in 1994 from children with natural HPIV2 infection
The cell is the wild type strain V9412-6 (designated PIV2 / V94) (Tao et al., Vaccine 17: 1100-1108, 1999).

HPIV2 / V94 was plaque-purified 3 times on Vero cells prior to the second round of amplification on Vero cells utilizing OptiMEM tissue culture medium without FBS. The cDNA clone for the HN gene of PIV2 / V94 was cloned by reverse transcription (RT) using a random hexamer and the Superscript Preamplification system.
), Followed by the Advantage cDNA Synthesis Kit (Clontech, Palo Alto,
CA) and HN cDNA in parallel with each other to prepare an NcoI-HindIII site by PCR using a synthetic primer (FIG. 3A).

The sequences of these primers were: (HPIV-specific sequences in uppercase, underlined restriction enzymes, nts non-HPIV in lowercase or modified from wt, and start and stop in bold. Codon), upstream HPIV2HN5'-ggg ccATGG AAGATTACAGCAAT-3 '(
SEQ ID NO: 19); downstream HPIV HN5'-caat aagcTT AAAGCATTAGTTCCC-3 '(SEQ ID NO: 20)
. The HN PCR fragment was digested with NcoI-HindIII and cloned into pLit.PIV31HNhc to generate pLit.32HNhc (Fig. 3B). HPIV2HN heterologous gene inserts in pLit.32HNhc is ThermoSequenase kit and ³² P- labeled terminators (Pharmacia Amersham, Piscataway, NJ) using the fully sequenced, it contains an array of legitimate PIV2 / 94HN coding region It was confirmed.

The HPIV2HN gene in pLit.32GNhe was further modified by PCR and Deep Vent thermostable DNA polymerase (New England Biolabs, Burberry, MA) to provide a specific PpuMI site within p38'ΔPIV31hc. PpuMI site for the purpose of cloning within is introduced, FIG. 3C (Skiadopoulos et al., Vaccine 18: 50
3-510, 1999). The sequences of these primers (HPIV specific sequences are in uppercase, relevant restriction sites are underlined, nt altered from non-HPIVnt or wt are in lowercase): upstream HPIVHN5'-gcgatggcccGAGGA AGGACCC AATAGACA-3 '(sequence No. 21) Downstream HPIV2HN5
'-ccc gggtcctg ATTTCCCGAGCACGCTTTG-3' (SEQ ID NO: 22).

The modified cDNA with the HPIV2 HN ORF (from left to right) is HPIV containing a PpuMI site at the 5'end.
Part of 3 HN 5'-untranslated region (5'-UTR), HPIV2 HN ORF, HPIV3 HN 3'-UTR, HPIV3 transcription signal whose sequence matches the sequence of HPIV3 HN and L gene junction Complete set (ie gene start, intragenic region and gene end sequences), HPIV3 L
It consists of a 5'-UTR and a PpuMI site added to the 3'end (Fig. 3C). This fragment was digested with PpuMI and inserted into p38'ΔPIV31hc.2HN digested with PpuMI to generate p38'ΔPIV31hc.2HN (Fig. 3D).

The inserted PpuMI cassette was fully sequenced and found to be as designed. The insert derived from p38'ΔPIV31hc.2HN was isolated as a 8.5 kb BspEI-SphI fragment, and was introduced into the BspEI-SphI window of pFLC.2C + .hc or pFLCcp45, and each p
FLC.31hc.2HN or pFLC.31hc.cp45.2HN was produced (Fig. 3, E and F). pFLC.2G +
.hc and pFLCcp45 are full-length antigenic clones containing wt rPIV3-1 and rPIV3cp45, respectively, as previously reported (Skiadopoulos et al., J. Virol . 73 : 1374-81, 1999; T
ao et al., J. Virol . 72 : 2955-2961, 1998, each referenced and incorporated herein).

The fusogenic HEp-2 cells were transformed into pFLC.31hc.2HN or pFLC.3-1hc.cp45.2HN using pTM (N), pTM (P
no C) and pTM (L) support plasmids and transfected in the presence of MVA-T7 as previously reported (Durbin et al., Virology 235 : 325-332, 1997, incorporated herein). ). Recombinant chimeric virus recovered from transfection haTPCK trypsin (catalog number 3741, Warrington Biochemical Corp., Freehold, NJ) was added to activate and passaged all, and virus with HPIV1HN and F glycoprotein according to previous report A titer test was performed (Tao et al., J. Virol . 72 : 2955-2961, 1998, referenced and incorporated herein). The recovered chimeric recombinant viruses rPIV3-1.2HN and rPIV3-1cp45.2HN were purified by plaque-plaque-plaque passage on LLC-MK2 monolayers covered with agarose according to previous reports (Tao et al., Vaccine . 17 : 1100-1108, 1999, referenced and incorporated herein).

Viral RNA recovered from each recovered recombinant chimeric virus to determine if the rPIV3-1.2HN and rPIV3-1cp45.2HN recombinants contained a heterologous HPIV2HN gene.
Was amplified on LLC-MK2 cells and concentrated by polyethylene glycol (PEG) precipitation (Mb
iguino et al., J. Virol. Methods 31 : 161-170, 1991, referenced and incorporated herein). Virion RNA (vRNA) is extracted with Trizol (Life Technologies),
First-strand cDNA was synthesized using the Superscript Preamplification System (Life Technologies, Kaiserburg, MD) and random hexamers as templates, as described above.

The synthesized cDNAs were the Advantage cDNA Synthesis Kit (Clontech, Palo Alto, CA) and the HPIV1F and HPIV1HN coding regions (5'-AGTGGCT for IPIV1F).
5'-GCCGTCTGCATG for AATTGCATTGCATCCACAT-3 (SEQ ID NO: 23) and HPIV1HN
GTGAATAGCAAT-3 ') (SEQ ID NO: 24) was amplified by PCR using specific primers. The relative positions of the PIV1F and NF primers are indicated by the middle arrows in Figures 3 and 4. The amplified DNA fragment was digested and analyzed on an agarose gel (
(Fig. 4). Data for rPIV3-1cp45.2HN are similar, though not shown, and also confirmed in the structure. rPIV3-1.2HN and rPIV3-1cp45.2HN each contained an insert having the expected size, and the identity and authenticity of the insert were confirmed by digestion patterns with multiple restriction enzymes. The presence of the cp45 mutation in rPIV3-1 cp45.2HN was also confirmed.

To confirm HPIV1HN expression by the rPIV3-1cp45.2HN chimeric virus, LLC-MK2 monolayers in T25 flasks were treated with MOI5 PIV2 / 94, 5 ml serum-free OptiMEM containing 0.5 μg / ml TPCK trypsin. The cells were infected with rPIV3-1 or rPIV3-1.2NH. 18 hours, 32 ° C
After incubating the flask with 5 ml of methionine and cysteine deficient D
It was washed 3 times with MEM (Bio-Whitker, Walkerville, MD). The cells were then supplemented with 120 μCi of ProMix 35S-methionine and 35S-cysteine mixture in methionine and cysteine deleted DMEM (Pharmacia Amersham, Piscataway, NJ
) 1 ml was added and incubated at 32 ° C. for 18 hours. The cells were stripped from the medium, briefly centrifuged in a microcentrifuge to precipitate, and washed 3 times with cold PBS.

Each cell pellet was treated with 1 ml RIPA buffer (1 unit containing 250 Units / ml Benzonase (Sigma)).
% Sodium deoxycholic acid, 1% (v / v) TritonX-100 (Sigma), 0.2% (w / v) SDS,
It was resuspended in 150 mM NaCl, 50 mM Tris-HCl, pH 7.4}, freeze-thawed, and centrifuged at 12,000 × for 5 minutes in a microcentrifuge for clarification. Transfer the clarified supernatant to a clean microfuge tube and add 50 μl of anti-HPIV2HN monoclonal antibody (mAb) 150S.
1 (Tsurudome et al., Virology 171 : 38-48, 1989, incorporated herein by reference) and mixed and incubated at 4 ° C. for 3 hours with mixing.

0.2 ml of 10% Protein A Sepharose suspension (RIPA buffer) was added to each tube to precipitate the monoclonal antibody, and the mixture was incubated for 18 hours at 4 ° C. with mixing. The beads were washed 3 times with RIPA buffer and briefly centrifuged in a microcentrifuge to precipitate. Suspend each sample in 90 μl of 1X loading buffer and
μl was analyzed on a 4-12% SDS polyacrylamide gel (PAGE; NOVEX, Sanjego, CA). A PIV2HN-specific mAb precipitated a protein with the expected size of HPIV2 86kDHN protein from both rPIV3-1.2HN and PIV2 / V94-infected LLC-MK2 cells.
No precipitation occurred from V3-1 infected cells (Rydbeck et al., J. Gen. Virol . 69 : 931-5
, 1988, referenced and incorporated herein).

[0429]   Example IV   RPIV3-1 viruses with HPIV2 antigenic determinants are similar to their parental vector viruses Shows the temperature-sensitive phenotype of   Temperature-sensitive replication of rPIV3-1.2HN and rPIV3-1.cp45.2HN replication in LLC-MK2 cells
Bell was assessed and rPIV3-1 wild type or attenuated virus used as a vector was HPI
A chimeric derivative having a heterologous antigenic determinant of HPIV2 generated by acquiring V2 HNORF
Determine whether temperature sensitivity for replication changes compared to their parental vector viruses
(Table 6). rPIV3-1.2HN and rPIV3-1cp45.2HN together with control virus
Serially diluted 1:10 in 1XL15 supplemented with 0.5 μg / ml TPCK trypsin.
This was used to infect LLC-MK2 monolayers in quadruplicate in 96 well plates.

Infected plates were placed at various temperatures for 7 days before virus titer determination by red blood cell absorption with 0.2% guinea pig red blood cells (in 1X PBS). Viral titers were expressed as log ₁₀ TCI ₅₀ ± standard error (SE). As shown in Table 6, rPIV3-1.2HN and rPIV3-1cp45.2HN showed similar temperature sensitivity levels to their parent vector viruses, namely rPIV3-1 and rPIV3-1cp45 lacking the HPIV2 insert, respectively. . This indicates that the introduction of one extra transcription / translation unit within rPIV3-1.2HN and rPIV3-1cp45.2HN does not significantly change the temperature sensitivity level of replication in vitro.

[0431]

[Table 6]

[0432]   Example V   Replication and immunogenicity of rHPIV3-1.2HN chimeric virus in animals   To determine the level of replication of the chimeric virus in vivo, the golden
10 groups of 6 hamsters^5.3TCID50 (or 10⁶pfu) virus
0.1 ml of 1 × L-15 medium containing was inoculated intranasally (Table 7). 4 days after inoculation, add hamsters
They were sacrificed and their lungs and turbinates were collected. Average log_TenTCID₅₀/ Expressed as organization g
The virus titer was determined (Table 7). RPIV-1.2HN expressing the PIVHN gene
Designated rPIV3-1 is more restricted in replication and ham than its parent rPIV3-1.
The virus titers in the upper and lower respiratory tracts of the star were reduced 30-fold.

That is, when the transcription / translation unit expressing the PIVHN protein was inserted into rPIV3-1,
The virus is attenuated in hamsters. The attenuating effect of the insertion of transcription / translation units containing the PIV2HN ORF into rPIV3-1 is similar to that of wild type PI containing the measles HA ORF.
It was slightly higher than that observed when the recombinant JS strain of V3 was inserted. Replication of pRIV3-1cp45.2HN virus was restricted 1000 times or more as compared with its parent rPIV3-1cp45, indicating that the PIV2HN insertion and the cp45 mutation attenuating effect are additive. If desired, the level of attenuation could be adjusted by adding fewer than the 12 mutations present in rPIV3-1.cp45.2HN.

[0434]

[Table 7]

Since a single rPIV3-1.2HN virus expresses protective antigens for PIV1 (F and HN glycoproteins) and PIV2 (HN glycoprotein only), infection with this virus resulted in PIV1 or PIV2
Will induce resistance to infection with either wild-type virus. To confirm this, a group of 12 golden hamsters was immunized intranasally with 10 ^5.3 TCID ₅₀ of the virus. Half of the hamsters were infected with PIV2 on day 29 and the other half were infected with PIV1 on day 32. Hamster lung and turbinate tissues were collected 4 days after infection and the titer of infectious virus was determined as described above (Table 8). Before immunization and
Sera were obtained after 28 days and tested for neutralizing antibody titers against PIV1 and PIV2.

[0436]

[Table 8]

As expected, PIV3 did not confer resistance to either PIV1 or PIV2 (Ta
o, Vaccine 17 : 1100-1108, 1999), preinfection with PIV2 wild-type virus and rPIV3-1 induced complete resistance to replication of PIV2 and PIV1 infected viruses. In contrast to these viruses, which provide protection against one virus, rPIV3-1.2HN
Induces antibodies against both PIV1 and PIV2, and reduces both viral replication by 1,000- to 10,000-fold in the upper and lower respiratory tracts of rPIV3-1.2HN-immunized hamsters, indicating both PIV1 and PIV2. Including strong resistance.

This indicates that a single recombinant chimeric PIV can induce resistance to two human viral pathogens. However, derivatives of rPIV3-1.2HN with the cp45 mutation failed to induce significant resistance to replication of wild-type PIV1 or PIV2-infected viruses, so this particular recombinant chimeric virus was over-attenuated in hamsters. It was suggested that The attenuation level of rPIV3-1.2HN can be adjusted to an appropriate level by introducing one or more selected cp45 mutations into rPIV3-1.2HN rather than all 12 mutations.

[0439]   Example VI   Construction of cDNA encoding rHPIV3 virus containing a nucleotide insert   As discussed above, the N / P or attenuated (weakened) vector virus rPIV3cp45L
Between the P / M gene boundaries and at the N / P, P / M, and HN / L boundaries of wild-type PIV3
Insertion of the measles HA ORF in mice further restricted its replication in the upper trachea of hamsters
. This means that additional gene insertions at any position within the HPIV3 genome
Shows that the attenuation of candidate vaccines / viruses can be enhanced
. In the above exemplary aspects of the invention, the gene insert is relatively large.
It was about 1900nts.

Further examples are provided herein showing that the size of the insert identifies the selective level of attenuation of the resulting recombinant virus. This is HPIV3 HN
Was evaluated by introducing sequences of different lengths obtained from a heterologous virus, as exemplified by the RSV A2 strain, as a single genetic unit (GUs) between the L ORFs. The insert above is specially designed to lack any meaningful ORF,
Thereby, any observed effect will not be complicated by the possible contribution of the expressed protein.

In order to distinguish between the factor effect on the length of the stretched genome and the expression of additional mRNA, a second series of constructs, with similar size inserts, were used to insert non-genes downstream of the HN gene. Those introduced into the coding region (NCR) were prepared. Therefore, two series of rPIV3s containing inserts with stretched length were generated: in the GU series the insert was added as an extra gene encoding an extra mRNA, while in the NCR series, The insert was made such that its gene number did not change.

[0442]   Construction of cDNAs encoding rHPIV3 virus containing GU and 3'-NCR insert   The insertion mutant was cloned into XhoI ~ Sp with full-length HPIV3 cloning p3 / 7 (131) 2G-Stu.
pUC-based plasmid, pUC118-Stu, containing the hI fragment (HPIV3nts 7437-11317)
Built in. Two separate plasmids were inserted into the 3'-NCR extension of the GU and HN genes.
It was constructed as a receptive plasmid for entry (Fig. 6). In each, poly kroni
Inserting a synthetic oligonucleotide duplex containing the coding site into the unique StuI site
It was The inserted sequence for the GU insertion plasmid is the HN gene-terminal (GE) sequence.
Signal sequence, conserved intergenic (IG) trinucleotide sequence, and L gene-
The start (GS) signal sequence, the end of the HN gene transcription and the sequence inserted above, respectively.
It contained a cis-acting sequence that directs transcription initiation (FIG. 6).

Additional unique restriction endonuclease sites were included within the multiple cloning region to facilitate subsequent screening and subcloning. Three
The'-NCR extension acceptor plasmid was similarly designed and constructed, but lacked the cis-acting GE, IG, and GS sequences at its 5'end (Figure 6B, Table 9). RSV anti-genomic plasmid d53RSV and subgenomic plasmid pUC118FM2 sites were digested with appropriate restriction enzymes and a fragment of the desired size was prepared.
It was isolated by electrophoresis on an agarose gel and ligated separately within the unique HpaI site of the GU or HN gene 3'-NCR extension acceptor plasmid (Fig. 6; Table 9).

Clones were screened to identify clones in which the RSV restriction fragment was inserted in the reverse orientation, that is, such that all reading frames contained multiple stop codons (FIG. 7). . In addition, a short synthetic oligonucleotide double strand in the size range of 13 to 17 nucleotides is optionally inserted into the GU or 3'-NCR acceptor plasmid, and the gene is matched so as to meet the "rule of six". Was changed (Table 9). The sizes of the specific RSV sequences and the added short synthetic oligonucleotides are summarized in Table 9.

Clathmid clones were sequenced through all the restriction enzyme sites used for subcloning, and as either GU or HN gene NCR extension, rule
An XhoI-SphI fragment containing an insertion mutation that fits in six was cloned into the full length PIV3 cDNA plasmid p3 / 7 (131) 2G +. 1 insert, including 1908GU insert,
It was placed in an antigenomic cDNA carrying 45 three L mutations.

[0446]

[Table 9]

[0447]   Recovery of recombinant PIV3s carrying insertion mutants   A full-length antigenomic cDNA derivative carrying the above insertion mutant and three supporting plasmids
Sumid pTM (N), pTM (PnoC), and pTM (L) (Durbin et al.,Virology 235: 323
-332, 1997; Durbin et al.,Virology 261: 319-330, 1999, each specification
6 wells using Lipofect ACE (Life Technologies, MD).
Transfect HEp-2 monolayer in plates (Coster, MA) and
Were infected with MVA-T7 as previously described (Durbin et al.,Virology 235: 3
23-332, 1997; Skiadopoulos et al., J.Virol.72: 1762-8, 1998, each book
Incorporated in the description). After incubating at 32 ° C for 4 days,
Harvested crops were passaged on LLC-MK2 cells in T-25 flasks for 4-8 days.
Incubated at ° C.

Clarified media supernatant was subjected to plaque purification on LLC-MK2 cells as previously described (Durbin et al., Virology 235 : 323-332, 1987; Hall et al., Virus . Res , 22 : 173-184, 1992; Skiadopoulous et al., J. Virol. 72 : 1762-8, 199
8, each incorporated herein by reference). Each biologically cloned recombinant virus was amplified twice in LLC-MK2 cells at 32 ° C. to generate the virus for further characterization. Virus was concentrated from clarified medium by polyethylene glycol precipitation (Mbiguino et al., J. Virol . Methods 31: 161-170, 1991, incorporated herein), and viral RNA (vRNA) was Trizol. Exam (Life Technologies)
Was extracted with.

Reverse transcription was performed using Superscript II Pream with random hexamer primers.
Performed on vRNA using the plification System (Life Technologies). Avda
ntage cDNA PCR kit (Clontech, CA), and sense (PIV3 nt 7108-7137),
And antisense primers (PIV3nt 10605-10576) were used to amplify the fragments for restriction endonuclease digestion or sequence analysis. PCR fragment
It was analyzed by agarose gel electrophoresis (Fig. 8) and sequencing. Each of the rPIV3 insertion mutants recovered contained inserts of the intended size, and they were evaluated for their biological properties.

[0450]   Example VII    Replication of rHPIV3 virus containing GU or NCR inserts in animals and in tissue culture   Multi-step growth curve   The growth curves of rPIVGU and NCR insertion mutants were analyzed using rPIV3 wt and rcp45_LAnd in vitro
I made a comparison. RPIV containing either GU or NCR inserts, as shown in FIG.
The replication rate and peak virus titer of each of 3 are distinct from those of rPIV3 wt.
could not. This means that insertion of a sequence of at least 3918nts in
It does not affect the virus replication in the.

[0451]   Replication of rPIVs containing GU inserts in hamsters   Hamster, 10^6.0TCID₅₀ rPIV3wt, rcp45_L, Or above carrying a GU insert
One of the mutant rPIV3s was inoculated intranasally (Table 10). Infect lungs and turbinates
Harvested on day 4 and the replication level of each virus was measured. Size 168nt ~ 19
Insertion of GUs in the 08nt range significantly reduced viral replication in the hamster trachea.
I didn't. However, the 3918nt gene unit between the HN and L ORFs of wild-type PIV3
Insertion results in 5-25 fold reduction in viral replication in turbinate and lung respectively
did. This indicates that a gene unit insertion of this size was attenuated for the wild-type virus.
And, on the other hand, shorter sizes, say about 2000 nt,
It shows little effect on the replication of wild-type virus. Servant
Therefore, the GU director determined the desired level of attenuation in the PIV vaccine virus.
Can be changed for

[0452]

[Table 10]

As described above, insertion of the measles virus HA gene into rJS wild-type and attenuated cp45L virus further attenuated each virus for hamsters. Since the measles virus HA gene is 1936 in length, we investigated the effect of a similarly sized gene insert (1908 nt) on rcp45L replication. The 1908 gene insertion differs from the measles virus HA gene insertion in that it is unable to synthesize large polypeptides. 1908 nt GU insertion resulted in cp45L polymerase amino acid substitution (r in Table 10)
When combined with 1908 nt GU insert / cp45 _L ), the weakening is about 20 times stronger in the upper trachea.

Taken together, these findings indicate that a GU insert of approximately 3918 nts in length can weaken the wild-type PIV3 virus for hamsters, and a GU insert of approximately half this size is weakened. It shows that PIV3 vaccine candidates can be further weakened. Therefore, GU insertion should be used in the design of recombinant vaccines.
It can have a double role. The first role is to encode a protective antigen of etiology and the second role is to confer an attenuated phenotype.

[0455]   Replication of rPIVs containing HN gene 3'-NCR insert in hamster   Hamsters carry an insertion mutation that extends to the length of the HN gene 3'-NCR.
The virus or rPIV3 control virus was inoculated intranasally (Table 11). After inoculation of lungs and turbinates
Harvested on day 4, and the level of virus replication within each tissue was previously described.
It was measured as HN gene NCR insertions ranging in length from 258 nt to 1404 nt were found in hamsters.
It did not significantly reduce viral replication in the trachea (Table 3). However, 31
The 26nt insertion was associated with viral titers in the upper and lower trachea of infected hamsters.
16-fold reduction, and the 3894nt HN gene NCR insertion was found in the upper and lower trachea.
It resulted in a 12-fold reduction in Ilus replication. This means that the increase in the genome length is
It has been suggested to impart a dampening effect on ruth replication.

[0456]

[Table 11]

[0457]   Evaluation of temperature sensitivity levels of GU and NCR inserts   rPIVs plaque rate at allowable and non-acceptable temperatures
ng (EOP)) was measured on LLC-MK2 monolayers as previously described (Table 12). 32
GU inserts ranging in size from 168 nt to 3918 nt and sizes from 258 nt to 3894 at ℃
Viruses carrying NCR inserts in the nt range showed plaques similar to those of rPIV3 wt.
Had a morphology. However, at 39 ° C and higher temperatures
All of the above viruses carrying mutations had a small plaque phenotype (No.
Table 12). GU inserts ranging in size from 996nt to 3918nt are non-ts at 40 ° C.
Created Ruth.

However, the virus carrying the HN gene NCR insertion of 1404 nts or larger produced a virus that was only ts at 40 ° C. with a temperature-sensitive slope that was directly proportional to the size of the insertion. Addition of a 1908 nt GU insertion to the cp45 _L backbone produced a virus that was almost 100-fold more ts at 38 ° C than rcp45 _L. This indicates that the ts phenotype identified by the 1908 nt GU insertion and the L gene ts mutation is additive.

[0459]

[Table 12]

Because the r3918nt GU mutant and the r3126 and r3894nt NCR insertion mutants replicated efficiently in vitro but were restricted to replication in the trachea of hamsters, these recombinants were found to be novel, host-ranged. It shows a weakened phenotype.

Based on previous examples, recombinant HPIV3 (rHPIV3) is effective for foreign virus protective antigens expressed as a postscript overgene, as exemplified by the measles virus hemagglutinin (HA) glycoprotein gene. It is proved to provide a good vector. In another embodiment, the rHPIV3-1 antigenic chimeric virus, the recombinant HPIV3 where the PIV3 F and HN genes are replaced by their HPIV1 counterparts,
An efficient vector for the IV2 hemagglutinin-neuraminidase (HN) glycoprotein is provided.

In each case, the exogenous coding sequence was designed and constructed to be under the control of the HPIV3 gene initiation and gene termination transcription signal set and inserted into the vector genome as an additional excess gene, Then, it is expressed as a separate mRNA by HPIV3 polymerase.

Measles virus from excess gene inserts with the above rHPIV3 or rHPIV3-1 vectors
Expression of HA or HPIV2 HN glycoproteins was determined to be stable during multiple rounds of replication. Hamsters infected with the rHPIV3 vector expressing the measles virus HA or the rHPIV3-1 vector expressing the HPIV2 HN glycoprotein showed HPIV3
And induced a protective immune response against measles virus or HPIV1 and HPIV2. Therefore, one rHPIV3 vector expressing a protective antigen of measles virus contains HPIV3 via an immune response to two human pathogens, glycoproteins present in the vector backbone, and an extra gene inserted into rHPIV3. 1 induced a protective immune response against measles virus via the HA protective antigen expressed from.

The measles virus glycoprotein is not incorporated into the infectious HPIV3 vector virus, and therefore its expression is not expected to alter the tropism of the vector as well as it is mediated by measles virus-specific antibodies. It will not make it easy to be harmonized. Similarly, one rHPIV3-1 vector expressing the protected HN antigen of HPIV2
Against two human pathogens, HPIV1 via an immune response to glycoproteins present in the vector backbone, and HPIV2 via an HN-protected antigen expressed from an extra gene inserted in rHPIV3-1. 1 induced a protective immune response.

[0465]   Example VIII    Up to 3 single rHPIV3s expressing up to 3 excess exogenous viral glycoproteins Induce protective antibodies against the virus   Modification of a single recombinant vaccine virus to induce immunity against multiple pathogens
Has several advantages. We will develop a separate weakened vaccine for each pathogen
However, it is more practical to develop a single weakened scaffold that expresses an antigen for multiple pathogens.
It is highly feasible and convenient. Each pathogen is manipulated, weakened, and safe
And provide different tasks for proof of effect, and weakening each of a series of pathogens.
Attempting to develop a version would be a daunting task. Some different
Prepare a single vaccine virus rather than attempting the above activity with an attenuated virus
It is easier and easier to handle, handle, and administer.

Reducing the number of vaccine viruses would also help simplify the crowded schedule of childhood immunity. Some attenuated viruses can be administered as a mixture, which complicates vaccine development. Because
This is because each component must be shown separately to be safe and then also to be safe and effective as a mixture. One particular problem with administration of mixtures of viruses is the general phenomenon of viral interference, where one or more of the viruses in the mixture interfere with the replication of one or more of the other components.

This can result in reduced replication and immunogenicity for one or more components. This general problem is circumvented by the use of a single vector backbone. Also, some viruses, such as the measles virus, have special safety concerns, so that each of them must be developed and proven separately, as opposed to a mixture of separately weakened viruses. It would be safer to use a single, relatively benign virus, such as PIV, as a vector carrying multiple excess antigens.

In this example, recombinant HPIVs were constructed and shown to serve as vectors for two or more overgenes with satisfactory characteristics of replication and immunogenicity for the development of vaccine viruses. Was done. In particular, this example describes the design, construction, recovery, and characterization of rHPIV3s expressing 1, 2, or 3 overgenes from the following list: (i) HPIV1 (Washington / 20993/1964 strain). Hemagglutinin-neuraminidase (HN); (ii) HPIV2 (V9412 strain) HN; (iii) measles virus wild-type Edmonston strain hemagglutinin (HA); and (iv) gene unit (GU)
A 3918 nt translationally silent synthetic gene called (see above).

The above-mentioned added gene was replaced with a nuclear protein (N) gene and a phosphoprotein (P
Between the P gene and the membrane protein (M) gene, or between the HN
An insert was made between the gene and the large polymerase (L) gene. Thus, the present disclosure has been modified to bivalent, trivalent, or tetravalent vaccine recombinants that are capable of inducing multivalent immunity, for example, against the vector itself and one or two additional pathogens. HPIV
3 Demonstrate the successful use of the vector.

[0470]   Insertion of HPIV1 HN gene and HPIV2 HN gene between N / P gene and P / M gene
Was performed as follows: pramised pUC119 (AflII N-P), HPIV3 antigenome
cDNA subclones (Durbin,J.Virol. 74: 6821-31, 2000, incorporated herein
Is modified by site-directed mutagenesis to create a unique AflII site (i
) HPIV3 N gene downstream non-coding region (CTAAAT~CTTAAG, HPIV3 nts 16
77-1682), or (ii) a non-coding region downstream of the HPIV3P gene (TCAATC~ CTTAAG , HPIV3 nts 3693-3698).

Next, each AflII site was modified by insertion of an oligonucleotide double strand to generate the intermediate plasmids pUC (GE / GS-NH) _NP and pUC (GE / GS-NH) _PM , respectively. This inserted double strand is the HPIV3 gene termination (GE) sequence, the conserved intergenic (IG) trinucleotide sequence, and the HPIV3 gene-start (GS) sequence, which direct the termination and initiation of transcription, respectively. Included those that were cis-acting signals (Figure 10).

Additional unique restriction endonuclease sites were included within the polycloning region to facilitate subsequent subcloning and screening. This region contained NcoI and HindIII sites for addition of HPIV1 and HPIV2 HN ORFs. Therefore, the foreign ORF inserted in the above-mentioned multiple cloning site is a set of HPIV.
3 is under the control of transcription signals and will be expressed as a separate mRNA by HPIV3 polymerase. In this multi-cloning site as well, the entire inserted sequence
It contained an MluI site for inserting oligonucleotides of different lengths to meet the rule of six (Calain et al., J. Virol. 67 : 4822-3 ).
0, 1993; Durbin et al., Virology 234 : 74-83, 1997b; 1999a Skiadopoulos e
t al., Virology 272 : 225-34, 2000).

HPIV1 HN ORF (Ta available as NcoI to HindIII restriction fragment of p38′Δ31hc # 6
o et al., J. Virol . 72 : 2955-2961, 1998) for pUC (GE / GS-NH) _NP and pUC (GE /
GS-NH) _PM was inserted into the NcoI to HindIII sites to generate pUC 1HN _NP and pUC 1H, respectively.
N _PM was produced. A short oligonucleotide duplex was inserted within the unique MluI restriction site described above and the sequence was adjusted to fit the rule of six. These chimeric subgenomic cDNAs were then cloned into the full-length HPIV3 antigenomic cDNA p3 / 7 (131) 2G +, referred to herein as pFLC HPIV3 wt, and designated pFLC HPIV3 and pFLC HPIV3, respectively.
pFLC HPIV3 1HN _PM was generated (FIG. 11, a plasmid from which the second and third recombinant viruses from above were isolated).

P32Hnhc # 3 HPIV2 HN ORF (Ta available within the NcoI to HindIII restriction fragment of 31hc
o et al., J. Virol. 72 : 2955-2961, 1998, incorporated herein by reference), pUC
(GE / GS-HN) _NP and pUC (GE / GS-HN) _PM were inserted into the NcoI to HindIII sites to prepare pUC 2HN _NP and pUC 2HN _PM , respectively. Short oligonucleotide duplexes were inserted within the unique MluI restriction site and their sequences were adjusted to follow the rule of six. Inadvertently, the inserted oligonucleotide was one nucleotide shorter than that required to identify that the recovered viral genome would follow the rule of six. Therefore, all of the cDNAs carrying the HIV2 HN gene insert did not follow the rule of six. However, the virus is
Recovered from each of the. These chimeric subgenomic cDNAs were transformed into full-length PIV3 antigenomic cDNA pFLC HPIV3
Cloning in wt produced pFLC PIV3 2HN _(NP) and pFLC PIV3 2HN _(PM) , respectively (Fig. 11, plasmids from which the 4th and 5th recombinant viruses from above were isolated).

Additional recombinant HPIV3 antigenomic cDNAs containing up to three excess foreign genes in various combinations and positions within the HPIV3 backbone were assembled (FIG. 11). These antigenomic cDNAs, in which the HNs of HPIV1 or HPIV2 are inserted between the N and P genes or between the P and M genes
Assembled from cDNA. The other subclones used for assembly contained the measles virus HA gene between P / M genes or between HN / L genes as described above. The other subclones used for assembly contained the 3918 nt GU between the HN and L genes, as described above.

Recombinants containing 2 or 3 overinserts were as follows: rHPIV3 1
HN _NP 2HN _PM (FIG. 11, sixth recombinant from the top) contained HPIV1 HN gene and HPIV2 HN gene between N / P gene and P / M gene respectively; rHPIV3 1HN _{N- P} 2HN _PM HA _HN-L (7th recombinant in FIG. 11) is N / P gene, P
/ M gene and HN / L gene contained HPIV1 HN, HPIV2 HN, and measles virus HA; rPIV3 1HN _NP 2HN _PM 3918GU _HN-L (Fig. 11, bottom) respectively showed N /
It contained the HPIV1 HN gene and the HPIV2 HN gene between the P gene and the P / M gene, and further contained the 3918 nt GU insert between the HN and L genes.

The second from the bottom of the construct, rHPIV3 1HN _NP 2HN _PM HA _HN-L (FIG. 11, top 7).
The second construct) has four pathogens: HPIV3 (NH and F), HPIV1 (HN), HPIV2 (HN),
It is worth noting that it contained a protective antigen for measles virus (HA). The total length of the foreign sequences inserted in this recombinant is approximately 5.5 kb, which is
It is 36% of the entire HPIV3 genome having 15,462 nt. The last recombinant, rHPIV3-1HN _{N- P} 2HN _PM GU _HN-L (Fig. 11, bottom), was approximately 23 kb in length. It was 50% shorter than wild type HPIV3 and longer than any of the biologically derived or recombinant paramyxoviruses described above.

[0478]   In vitro recombinant rHPIV3 carrying 1, 2, or 3 excess gene inserts Collection and reproduction in   Full-length HPIV carrying a single or multiple excess gene for the displaced paramyxovirus protective antigen
3 Antigenome cDNA, supporting plasmid pTM (N), pTM (PnoC), and pTM (L),
6 wells with Lipofect ACE (Life Technologies, Gaithersburg, MD)
-Transfer separately to HEp-2 monolayer culture on plates (Costar, Cambridge, MA) and then
These cells were then subjected to the technique described previously (Durbin et al.,Virology 235: 323-3
32, 1997a; Skiadopoulos et al.,Virology 272: 225-34, 2000, respectively
Bacteriophage T7 polymerase protein
Simultaneously sensed with MVA-T7, a replication-defective vaccinia virus recombinant encoding quality
Dyed. After incubation at 32 ° C for up to 4 days, the transfection
25 cm² Pass on LLC-MK2 monolayer culture in flask, and
Were incubated at 32 ° C for 5 days.

[0479]   The virus recovered from the above cell supernatant was further subcultured on LLC-MK2 cells at 32 ° C.
Instead, the virus was amplified. Carries one or many foreign gene inserts
rHPIV3 was biologically purified by plaque purification on LLC-MK2 cells as previously described.
Cloned in (Skiadopoulos et al.,J.Virol. 73: 1374-81, 1999a, book
Incorporated in the description). Wii obtained from a biologically cloned virus.
Ruth suspensions were amplified on LLC-MK2 cells and typically obtained for wt rHPIV3.
Similar to the range of titers given, 10⁷ And 10⁹TCID₅₀ / Ml final titer was obtained. Recombination
Viruses were assayed for their ability to grow at 39 ° C. Surprisingly
In particular, some rHPIV3s carrying one or many foreign gene inserts (rHPIV
3 1HN_NP, rHPIV3 1HN_NP 2HN_PM HA_HN-L , And rHPIV3 1HN_NP 2HN_PM 3918 GU _HN-L ) Is 100 for replication at 39 ° C compared to replication at its permissive temperature.
~ 1000 times limited.

Viral RNA (vRNA) was isolated from a recombinant chimeric virus that was biologically cloned as previously described (Skiadopoulos et al., J. Virol. 73 : 1374 ).
-81, 1999a, incorporated herein by reference). This was reverse-transcribed and polymerase chained using specific primers bordering the insertion site.
Used as a template for reactions (RT-PCR). The amplified product was analyzed by restriction endonuclease digestion and partial DNA sequencing of the junction region to confirm the presence and identity of each exogenous insert. In all cases the expected correct sequence was confirmed.

[0481]   RHPIV3s hamster trachea expressing 1, 2 or 3 excess foreign protective antigens Replication within   RHPIV3 or rHPIV3-1 virus expressing one excess viral protective antigen gene
Efficiently replicated in vivo and in vitro, and the vector virus
Protection against both Rus and viruses presented by its excess antigen gene
It was previously shown to induce an epidemiological response. However, if rHPIV exceeds 2
Is adapted to redundant genes and replicates efficiently in vitro and in vivo,
Inducing a protective immune response against both the vector and the expressed excess antigen
It was not known if they could retain the ability to do. In this example,
This shows that this is actually possible.

[0482] into 8 groups of hamsters, one or a number of excess foreign gene inserts each rHPIV3 of 10 ⁶ TCID _{5 0} carrying the or control virus were inoculated intranasally (Table 13). Nasal turbinates and lungs were harvested 4 days post-infection and virus present in tissue homogenates was quantified by serial dilution on LLC-MK2 monolayer cultures at 32 ° C as previously described (
See also Skiadopoulos et al., J. Virol. 73 : 1374-81, 1999a). Virus was detected by haemosorption on guinea pig porcine erythrocytes and the average virus titer for each group is expressed as log ₁₀ TCID ₅₀ (50% tissue culture infectious dose / gram tissue ± SE).

[0483]

[Table 13]

HPIV3 rHPIV3 expressing measles virus HA from overgene inserts between HN and L genes, between N and P genes, or between P and M genes was moderately (
Replication was restricted within the upper and lower trachea of the hamster. This was confirmed in this experiment. Here, rHPIV3 containing measles virus HA as a single overgene between the N / P, P / M, or HN / L genes was attenuated up to 10-fold (Table 13, groups 5, 6 and 7). Similarly, insertion of the HPIV2 HN gene between the HPIV3 N gene and the P gene or between the P gene and the M gene also showed moderate (about 10-20 fold) replication in the trachea of hamsters. In contrast, insertion of the HPIV1 HN gene between the P and M genes or between the N and P genes resulted in approximately 100-fold reduction in replication in the upper and lower trachea of hamsters (Table 13). , Groups 1 and 2).

Since the HPIV1 HN, HPIV2 HN, and measles virus HA gene inserts all had approximately the same size (1794nt, 1781nt, and 1926nt, respectively), this does not appear to be due to the length of the insert. Met. Therefore, this greater weakening level conferred by the introduction of the HPIV1 HN gene was associated with
It appears to be due to an additional weakening effect specific to the expression of the IV1 HN protein. Therefore,
In some cases, using HPIV1 HN, for example, excess antigen can weaken rHPIV3 in hamsters beyond the moderate weakening above due to additional genes.

Looking at the data in Table 13, the site of insertion also shows the chimeric rH in the trachea of hamsters.
It can be seen that it plays a role in the limiting level of replication of PIV3. rHPIV3 N gene and P
Insertion of the measles virus HA gene or the HPIV2 HN gene between the genes resulted in a greater reduction in replication in the upper and lower trachea of hamsters than did the insertion between the P and M genes (Table 13, Group 3). And 4 and groups 5 and 6). HPIV3
This site-specific weakening effect on vector replication was not apparent for the HPIV1 HN gene insertion. This is probably because it is masked by the more substantial attenuation (weakening) effects specific to HPIV1 HN.

The rHPIV3 chimeric recombinant virus showed a slope of weakening as a function of the number of excess gene inserts. The virus carrying three additional genes showed the highest effect and reduced replication approximately 10,000 to 108,000 fold in the upper and lower trachea of infected hamsters (Table 13, groups 9 and 10). The rHPIV3 chimeric recombinant virus carrying the two gene inserts showed moderate levels of weakening and decreased approximately 12-80 fold (No.
Table 13, group 8).

RHPIV3 carrying one excess gene (except those carrying the HPIV1 NH gene)
The chimeric recombinant virus reduced only about 10 to 25 times (Table 3 group 3 to
7). Importantly, the rHPIV3 chimeric recombinant virus carrying 1, 2, or 3 excess gene inserts was replicated in all animals. The most weakened of these viruses, those carrying the three overgenes, were substantially weaker than rcp45 (group 11) for replication in the upper and lower trachea.

[0489]   In rHPIV3s hamsters expressing 1, 2, or 3 excess exogenous protective antigens Immunogenicity   Hamsters were loaded with 1, 2, or 3 excess gene inserts as described above.
The cells were infected with HPIV1 wt, HPIV2 wt, rHPIV3 wt, or rHPIV3s carried. Serum service
Samples were taken 3 days before immunization and 28 days after immunization, and HPIV1 or
By a virus neutralization assay specific for either measles virus, or HPIV3
Alternatively, HPIV2 HN-specific antibodies were tested for hemagglutination inhibition (HAI) assay to determine HP
Assayed for IV1, HPIV2, HPIV3 or measles virus specific antibodies (Table 14).
). All rHPIV3 viruses elicited strong immune responses against the HPIV3 scaffold. However
The virus carrying the three excess gene inserts. rHPIV3 1HN_NP 2HN_NP  HA_HN-L Or rHPIV3 1HN_NP 2HN_NP 3918 GU_HN-LInfected with any of the
Diminished or absent immune response in the
Seems to be the result of over-weakening of replication in.

Similarly, the immune response to the antigens carried within the virus carrying the three foreign genes was either low or undetectable. In response, viruses carrying one or two foreign gene inserts induced an immune response against each of these additional antigens. This means that the vectored foreign gene is immunogenic in the hamster, and as in the case of rHPIV3 1HN _NP 2HN _NP (see
Table 14; group 11) demonstrating that it can be used to induce a strong immune response against three different viruses: HPIV1, HPIV2, and HPIV3.

[0491]

[Table 14]

[0492]   Example IX   Use of rHPIV3-N _B as attenuated vector for measles virus HA protein   Limiting host range as a vaccine against antigenically related humans
The use of animal viruses that have been attenuated in humans is a threat to vaccine development.
Based on the approach of. Kans of bovine parainfluenza virus type 3 (BPIV3)
The as (Ka) strain is more common than the human parainfluenza virus type 3 (HPIV3).
It was found to be 100-1000 times more restricted in replication in monkeys and in humans
It was also shown to be attenuated (Coel, each incorporated herein by reference.
ingh et al., J. Infect. Dis. 157: 655-62, 1988; Karron et al., J. Infect.D.
is. 171: 1107-14, 1995b).

Viable chimeric recombinant human parainfluenza virus type 3 (HPIV3)
An HPIV3 N ORF containing a nucleoprotein (N) open reading frame (ORF) from BPIV3 Ka was previously made in place. This chimeric recombinant was previously referred to as cKa-N (Bailly et al., J. Virol. 74 : 3188, incorporated herein by reference ).
~3195, 2000a), is referred to herein as rHPIV3-N _B. Further work began with the exchange of N ORFs. Because among PIV3 proteins, BPIV3 and HPIV3 N proteins have intermediate levels of amino acid sequence identity (85%) (Bailly et al., Virus Genes 20 : 173-82, 2000b, incorporated herein by reference). ), Such a BPIV
This is because the 3 / HPIV3 N recombinant was shown to be viable (Bailly et al., J. Virol. 74 : 188-3195, 2000a, incorporated herein by reference).

This represents a “modified Genner” approach, where a subset of genes in the vaccine virus is obtained from animals. rHPIV3-N _B is, LLC-MK2
It grew to a titer comparable to that of rHPIV3 and BPIV3 present in monkey kidney and Madin Darby bovine kidney cells (Bailly et al., J. Virol. 74: 3188-3195, 20).
00a). Thus, the heterologous nature of the N protein did not interfere with rHPIV3-Na replication in vitro. However, rHPIV3-N _B replication in rhesus monkeys was limited to the extent similar to that BPIV3 parental viruses (Bailly et al, J.Virol 74: .. 31
88-3195, 2000a). This identified the BPIV3N protein as a determinant of host range restriction of BPIV3 replication in primates.

[0495] Thus, rHPIV3-N _B chimeric virus antigenic determinants of HPIV3, combined with the host range restriction and attenuated phenotype of BPIV9. There are a total of 79 differences of 515 amino acids between HPIV3 and BPIV3 N proteins (Bailly et al., Virus Genes 20 : 173-82, 2000b). Many of the differences of these 79 amino acids seem to contribute to the host range attenuation phenotype of rHPIV3-N _B. Since host range restriction is expected to be based on the difference between the number of amino acids, attenuated phenotype of rHPIV3-N _B, even after prolonged replication in vivo is expected that it would be genetically stable, rhesus Despite its restricted replication in, rHPIV3-N _B induced a high level of resistance to the monkey challenge with wild-type (wt) HPIV3, the level of this resistance, immunization with wt HPIV3 It was indistinguishable from that given by infectious rHPIV3-N _B, attenuated and immunogenic suggests (Bailly et al that this new chimeric virus is an excellent candidate as a HPIV3 vaccine, J.Virol 74:. 3188~3195, 2000a ).

Furthermore, as described below, such chimeric vaccines are shown herein to be good candidates to serve as attenuated vectors for the expression of hyperprotective antigens, such as HA of measles virus. The resulting chimeric virus vector components induce an immune response against HPIV3, and the added excess gene induces an immune response against their respective heterologous pathogens. In this particular embodiment, a bivalent attenuated vaccine virus is produced that simultaneously induces an immune response against HPIV3 and measles virus.

RHPIV3 can be used as a vector for expression of the measles virus hemagglutinin (HA) protein. Two examples, rcp45 _L HA (NP) and rcp45 HA (HN-L
In (), it was previously shown that an attenuated vector expressing the measles virus HA gene has three attenuating amino acid point mutations in its vector backbone. RHPI of the present invention
V3-N _B vector further would be stable even more than vectors with an attenuated phenotype based on 3 amino acid point mutation. As mentioned above, HA as an excess gene
Insertion into rHPIV3 attenuated some replication of both HPIV3 and attenuated HPIV3 cp45 _L for hamsters. Furthermore, insertion into HPIV3 the 1908-nt gene is attenuated wild-type skeleton, increased the level of attenuation of the backbone with a cp45 _L mutations for replication in hamsters.

[0498] Therefore, insertion into the host range restriction of rHPIV3-N _B virus measles virus HA gene was designed so as to further attenuate the growth in vitro and / or in vivo. Insert affecting replication or within a biological vitro can be a problem for the development of specific vaccines such as rHPIV3-N _B. In particular, candidate viruses that are highly restricted in vitro will be difficult to produce, and those that are highly restricted in vivo will be too attenuated to be useful as vaccines. . Since all previous studies with HPIV3 expressing HA were conducted in a rodent model, rHPIV3
-N _B HA _(PM) , a measles virus HA glycoprotein-expressing rHPIV3-N _B chimeric virus may have satisfactory immunogenicity in primates against both HPIV3 and measles virus. Didn't.

This example, which details the generation of rHPIV3-N _B HA _(PM) using reverse gene technology, surprisingly shows that insertion of the HA gene into rHPIV3-N _B does not further limit its replication in rhesus monkeys. Indicates that. Possibly the attenuating effect of the insertion is masked by genetic elements present in the N _B gene that specify host range restriction of replication in primates. Rather,
rHPIV3-N _B HA _(PM) was satisfactorily attenuated in rhesus monkeys. rHPIV3
-N _B HA _(PM) immunization of rhesus monkeys induces resistance to replication of wt HPIV3 challenge virus and high levels of neutralizing antibodies against measles virus, known to be protective in humans Levels were stimulated (Chen et al., J. Infect. Dis. 162 : 1036-42, 1990, incorporated herein by reference).

[0500]   BPIV3 N gene ORF instead of rHPIV3 N gene ORF and rHPIV3 P and M residues Encodes the measles virus HA gene as an excess gene inserted between genes Kimeraushi / generation of human PIV3 are antigen _{cDNA pFLC HPIV3-N B HA (} PM)   Full-length antigenic cDNA plasmid pFLC HPIV3-N_B HA_(PM) (Figure 12) 2 steps
It was made in. First, the pLeft-N created earlier_BThe plasmid is that of BPIV3
3'half of HPIV3 antigenic cDNA (HPIV3nts 1 with HPIV3 N ORF replaced)
-7437, the posterior position is the XhoI site within the HN gene).
Bailly et al., J. Vriol. 74: 3188-3195, 2000a). This program
The PshAI-NgoMIV fragment was excised from Rasmid.

The PshAI site is located at position 2147 within the HPIV3 antigenome sequence (see Figure 12), Ng
Note that the oMIV site is within the vector sequence, thus it removes all of the HPIV3 sequence downstream of the PshAI site. This fragment was replaced by the PshAI-NgoMIV fragment from the previously constructed plasmid pLeft HA _(PM) , which generated HP
IV3 is under the control of the transcription signals, including the inserted measles virus HA ORF between HPIV3 N and P genes (Durbin, incorporated herein by reference, J.Virol 7 4:. 6821 ~31 , 2000) .

This creates pLeft-N _B HA _PM . Next, a 3 'half of the HPIV3 antigenomic cDNA containing the BPIV3 N gene ORF and measles virus HA gene insert, the fragment XhoI from 11899Nt NgoMIV of Pleft N _B HA _PM, HPIV3 antigenomic cDNA
Ngo of pRight, a plasmid that encodes the 5'half of PIV3nts 7462-15462
Clone from MIV to XhoI window (Durbin et al, Virology 235 : 323-332, 1
997a). This, HPIV3 location of N ORF contains from BPIV3, plasmid with the HPIV3 full-length antigenomic cDNA, including measles virus HA gene as excessive gene inserted between the P and M genes of HPIV3, pFLC HPIV3-N _B HA _{Created PM} .

[0503]   Recovery of chimeric rHPIV3 expressing bovine N gene and measles virus HA gene   rHPIV3-N_B HA_PM , PFLC HPIV3-N_B HA_PM HEp-2 cells transfected with
Recovered from the cell. To do this, pFLC HPIV3-N_B HA_PM Support plus
Mido pTM (N), pTM (PnoC), and pTM (L) and LipofectACE (Life Technologies
, Gaithersburg, MD) 6-well plate (Costar, Cambridge, MA)
Transfect the above HEp-2 cells and incubate the cells with the bacterium as described above.
Replication-deficient vaccinia virus encoding the phage T7 polymerase protein
Recombinant MVA-T7 was co-infected.

After 4 days of incubation at 32 ° C., the transfection harvest was incubated at 25
LLC-MK2 cells were subcultured in cm ² flasks and the cells were incubated for 5 days at 32 ° C. The virus recovered from the cell supernatant was amplified by further passage on LLC-MK2 cells at 32 ° C. rHPIV3-N _B HA _PM was biologically cloned by plaque purification on LLC-MK2 monolayer cultures as described above. Viral supernatants from biologically cloned viruses were amplified at 32 ° C on LLC-MK2 monolayer cultures. Viral RNA (vRNA) was isolated from a recombinant chimeric virus that was biologically cloned as described above. RT-PCR was performed with specific oligonucleotide primer pairs penetrating the BPIV3 N ORF or measles virus HA gene and the amplified cDNA was analyzed by restriction endonuclease digestion and partial DNA sequencing as described above. This is BP
The presence of IV3 N ORF substitutions and measles virus HA hypergene inserts were confirmed.

Expression of the measles virus HA protein was determined as described previously (Durbin, J. Viol. 74 : 6821-31, 2000), as described above, in mice specific for the measles virus HA protein. It was first confirmed by immunostaining plaques formed by _{rHPIV3-N B HA PM LLC-} MK2 monolayer culture supernatant infected with using monoclonal antibodies and goat anti-mouse peroxidase conjugated antibody.

[0506]   rHPIV3-N _B HA _PM was compounded to the same level as rHPIV3-N _B in rhesus monkey airways. To make.   Acquisition of the measles virus HA insert is a weak gene lacking the bovine chimeric construct with an overgene
RH in the upper and lower respiratory tract, as observed when inserted into the poisoned HPIV3 skeleton
PIV3-N_B It was next determined whether to significantly reduce the replication of B. rHPIV3-N_B HA_PM But
Sufficient to induce an in vivo immune response against both HPIV3 and measles virus
I also decided whether or not to duplicate. RHPIV3-N in the upper and lower respiratory tract of rhesus monkeys_B 
HA_PM A duplicate of that rHPIV3-N_B Compared to that of the parent and wt HPIV3 and wt HPIV3
(Table 15).

Rhesus monkeys seronegative for both HPIV3 and measles virus were given intranasal (
IN) and intratracheal (IT) routes, as previously described (Bailly et al., J. Vriol. 74 : 31
88-3195, 2000a), L15 medium containing 10 ⁵ TCID ₅₀ of virus suspension was inoculated at 1 milliliter per site. Nasopharyngeal (NP) wipe samples were collected 1-10 days post infection and tracheal lavage (TL) samples were collected 2, 4, 6, 8 and 10 days post infection. The virus present in NP and TL samples was quantified by serial dilution on LLC-MK2 cell monolayers at 32 ° C. and the titers obtained were expressed as log ¹⁰ TLID ₅₀ / mL (Table 15).

This comparison showed that the rHPIV3-N _B NA _(PM) chimeric virus replicates to the same level as its rHPIV3-N _B parent virus in the upper and lower respiratory tract of rhesus monkeys. This level of replication was comparable to that of the BPIV3 viral parent, which indicated that rHPI
V3-N _B HA _(PM) retains the attenuated expression of rHPIV3-N _B and BPIV3, and, unexpectedly, insertion of the measles virus HA gene into the rHPIV3-N _B genome was found in the respiratory tract of rhesus monkeys. Proof that this virus does not attenuate the replication of the virus.

[0509]

[Table 15]

[0510]   a. This study is based on rHPIV3-N_B HA_(PM) Of 4 monkeys fed rHPIV3 wt, rHP
IV3-N_B, Or 2 monkeys in each group given BPIV3 Ka. rHPIV3-N_B HA _(PM)  Except for the group given, the data are from Bailey et al.,J.Virol 74: 3188
~ 3195, 2000, and Schmidt et al.,J. Virol. 74: 8922-8929, reported in 2000
Includes historical data from studies conducted.   b. Schmidt et al.,J.Virol. 74: 8922-8929, 2000 historical data.

C. Monkeys were inoculated intranasally and respiratory tract with 10 ⁵ TCID ₅₀ of virus in 1 mL of inoculum at each site. Nasopharyngeal (NP) swab samples were collected 1-10 days post infection.
Tracheal lavage (TL) samples were collected 2, 4, 6, 8 and 10 days post infection. The average peak virus titer for each animal in the group is independent of sampling date. SE = standard error. Viral titration was performed on LLC-MK2 cells at 32 ° C. The limit of virus titer was 10 TCD ₅₀ / mL.

D. In this study, serum was collected from monkeys 31 days after immunization and then animals were HP
Attacked with IV3. In two previous studies, monkey samples were taken and immunized 28
Attacked on the day. e. Sera collected for this study and from the previous two studies were assayed simultaneously. Serum HAI titer is expressed as mean reciprocal log ₂ ± standard error SE. f. Animals, parenterally administered measles virus Moraten vaccine (IM) 10 ⁶ pfu
Immunized on day 59. Serum was then collected on day 28 (ie 87 days after the first immunization). Data were collected only from the animals in this study. The average neutralizing antibody titer against wt measles virus is expressed as the average reciprocal log ₂ standard error. PRN = plaque reduction neutralization.

G. 28 or 31 days after immunization, the monkeys, the wt HPIV3 of 10 ⁶ TCID _{5 0} of 1mL inoculum were inoculated intranasally and intratracheally to each site. NP and TL samples are 0,2 after the attack
, 4, 6 and 8 days. The titers obtained for NP and TL samples on day 0 were less than 2.0 log ₁₀ TCID ₅₀ / mL. h. Except for group 5, data are from this study.

[0514]   Rhesus monkey immunization with rHPIV3-N _B HA _(PM) is associated with both HPIV3 and measles virus. Induces high titers of antibodies to ss and protects monkeys from HPIV3 challenge   rHPIV3-N_B HA_PM Rhesus macaques immunized with HPV3 and measles virus
Developed high levels of serum antibodies against it (Table 15). Serum HPIV3 antibody is described above.
(Durbin, incorporated herein by reference,J. Virol. 74: 6821 ~ 31, 2000
) As described above, a hemagglutination inhibition test (HAI) was performed using guinea pig red blood cells.
Quantify, the titer is the average reciprocal log₂Expressed as ± SE.

[0515]   High levels of serum HAI antibody to HPIV3 are associated with rHPIV3-N_B HA_PM And rHPIV3-N_B 
, Both of which were attenuated recombinants of the HPIV3 vector.
We show that it is possible to induce a strong immune response against skeletal antigens. rHPIV3-N _B  HA_PM Rhesus macaques immunized with high levels of serum measles virus 31 days after immunization
Develops neutralizing antibodies and their levels protect humans against infection with measles virus
It was also found to be the excess needed to
Chen et al., Incorporated inJ. Infect. Dis. 162: 1036-42, 1990). Wild type hemp
The serum neutralizing antibody titer against herpes virus was previously described (Durbin,J. Virol. 74: 6
821-31, 2000), and its titer is the reciprocal average log.₂Expressed as ± SE
(Table 15).

[0516]   wt HPIV3 protection, live attenuated rHPIV3-N_B HA_PM And rHPIV3-N _B  To compare the ability of infection with the virus, monkeys were treated 31 days after the first infection,
Ten⁶TCID₅₀ Attacked by IN and IT with wt HPIV3 (Table 15). Nasopharyngeal swag and trachea
Wash samples were collected 2, 4, 6 and 8 days post challenge. Present in the sample
Virus was quantified by serial dilution on LLC-MK2 monolayer cultures as described above.
rHPIV3-N_B HA_PM And rHPIV3-N_B Is involved in wt HPIV3 replication in the respiratory tract of immunized monkeys.
Relative to an attack with wt HPIV3, as shown by a 100-1000 fold reduction in
Gave a high level of protection to the chimeric bovine / human measles virus HA gene.
The insertion into PIV3 is due to the HPIV3 glycoprotein present in the backbone of the attenuated viral vector.
It was shown not to reduce the level of protection induced by Yin.

Next, the immunogenicity of rHPIV3-N _B HA _PM was confirmed to be that of a licensed Moraten strain of a live attenuated virus vaccine in rhesus monkeys, a species in which both PIV3 and measles virus replicate effectively. Compared with. Rhesus monkeys previously infected with rHPIV3 virus or rHPIV3-N _B HA _{P- M} were parenterally (IM) immunized with Moratan strain 10 ⁶ pfu of live attenuated measles virus vaccine on day 59. And serum samples were taken on day 87 and analyzed for neutralizing antibodies against measles virus (Table 15).

Animals untreated for measles virus prior to receiving the Moraten vaccine (15th
Table, in groups 1 and 2), the titer of measles-specific antibodies induced by the Moraten vaccine, rHPIV3-N _B HA _PM immunized animals (Table 15, was similar to that seen in group 2) . Thus, rHPIV3-N _B HA _PM vector expressing HA glycoprotein measles virus, in this primate model was equivalent to Moraten vaccine in its ability to induce virus neutralizing antibodies.

An important advantage of rHPIV3-N _B HA _PM as a vaccine against measles virus over the Moraten vaccine is that the live attenuated measles virus vaccine, while its PIV vector can be administered by the intranasal route, Perhaps as a result of their attenuation and adaptation to cell culture, this pathway is not consistently infectious. This is because rHPIV3-N _B HA in the early infancy, an age group that cannot be immunized with currently live attenuated measles virus vaccines such as the Moraten strain due to the neutralizing and immunosuppressive effects of maternal antibodies. It is possible to immunize with _PM (Durbin, J. Virol. 74 : 6821-31 , 2000, incorporated herein by reference). Other advantages, as mentioned above, are the excellent growth of the PIV vector in cell culture and the lack of measles virus HA integration in the virions, which eliminates the tropic changes of the PIV vector and induces measles virus. It should eliminate immunosuppression.

[0520]   Lack of effective vaccination against measles virus infection exceeds 2700 daily daily
It causes the death of the child. rHPIV3-N_B HA_(PM) Candidate vaccines for severe children
Unique to immunize against two major causes of disease: HPIV3 and measles virus
Give the opportunity. Unlike currently licensed measles virus vaccines, we
Chimeric rHPIV3-N expressing major antigenic determinants of measles virus, measles virus or other heterologous pathogens _B  HA_(PM) And other human-bovine chimera vectors were used in infants and 6 months of age
Used in children to induce a strong immune response against eg measles virus
Expect to be able to. Effective immunization strategies for infants and children
Needed to meet World Health Organization objectives to eradicate measles by 2010
Will be In particular, use measles virus vaccine that is not related to infectious measles virus.
Presence will be effective for eradication.

[0521]   Example X   Recombinant bovine-human as a vector for RSV glycoprotein excess gene Use of parainfluenza virus type 3 (rB / HPIV3)   A set of BPIV3 F and HN genes replaced with those of HPIV3 for use in the present invention.
A recombinant chimeric human-bovine PIV was prepared. This recombinant chimeric bovine-human virus rB
/ HPIV3 has been shown to be fully competent for replication in cell culture
However, in rhesus monkeys, it has a host-range-restricted, attenuated phenotypic signature of BPIV3.
And were highly immunogenic and protective (each is incorporated herein by reference).
US Patent Serial No. 09 / 586,479 filed June 1, 2000; Sc
hmidt et al.,J. Virol. 74: 8922-9, 2000). This is the composition and method of the present invention.
Another example of an "improved Jenner" approach that is useful in law
In some cases, the entire set of viral “internal” genes was obtained from BPIV3 and
Only groups are obtained from HPIV3.

As mentioned above, in contrast to a binding mixture of different viruses, each of which must be separately attenuated and identified, and which can interact in unpredictable ways.
There are numerous practical and safety considerations that favor vaccines based on the PIV3 backbone. Furthermore,
Host range restriction of BPIV3 confers an attenuated phenotype that should be extremely highly safe. In this example, a recombinant chimeric human-bovine PIV3 (rB / HPIV3) was designed, rescued, and characterized as encoding respiratory rash virus (RSV), the major RSV neutralizing and protective antigen. This example shows that rB / HPIV3 is a promising candidate vaccine and vector by readily accepting the foreign RSV gene without significant reduction in its replication efficiency in vitro or in vivo. This vector
There will be no problems of poor growth in vitro and the instability that is another hallmark of RSV.

[0523]   Recombinant chimera with RSV subgroup AG or F ORF as a further overgene Construction of antigenic cDNA encoding rB / HPIV3 virus   BPIV3 Kansas strain full-length cDNA was cloned into bovine virus F and HN glycoprotein
The offspring were constructed so as to be replaced with the corresponding genes of the HPIV3 JS strain (rB / HPIV3) (each
Filed June 1, 2000, by Schmidt et al., Each of which is incorporated herein by reference.
US Patent Application Serial No. 09 / 586,479; Schmidt et al.,J.Virol 74: 8922-9
, 2000). For use in the present invention, this cDNA was labeled with three additional unique restriction enzymes.
It was modified to include the recognition site.

[0524]   For more information,BlpIThe site is introduced before N ORF (nucleotide (nt) 103-109), AscI The site is introduced before the N gene terminal sequence, andNotISite is P gene end sequence
Introduced before. These restriction enzyme recognition sites allow chimeric B / HP
It was introduced to facilitate the insertion of the IV3 viral genome into the genome. Those departments
The positions are designed so that they do not disrupt either BPIV3 replication or transcription cis-acting factors.
Zine This particular example isBlaIIt will describe the insertion into the site (Figure 13).

RSV subgroup A glycoprotein genes G and F (GenBan described above)
k accession no. M74568) was modified for insertion into the BlpI site near the promoter of B / HPIV3 (Fig. 13). The strategy is to express each heterologous ORF as an additional distinct mRNA, and therefore, to put it in the rB / HPIV3 genome so that it is after the BPIV3 gene start signal and then the BPIV3 gene end signal. It was important to introduce. The BlpI insertion site was after the gene start signal of the N gene (Fig. 13). Therefore, for insertion at this site, the RSV ORF is modified by insertion of a BlpI site at its upstream and addition of a BPIV3 gene end signal, intergenic region, gene start signal, and BlpI site at its downstream end. Was necessary.

For the RSV AG ORF, the positive PCR primer used was (5 ′ → 3 ′) AATTC GCTTAGC GATGTCCAAAAACAAGGACCAACGCACCGC (SEQ ID NO: 30) and the reverse primer was (5
'→ 3') AAAAA GCTAAGC GCTAGCCTTTAATCCTAAGTTTTTCTTACTTTTTTTACTACTGGCGTGGT
GTGTTGGGTGGAGATGAAGGTTGTGATGGG (SEQ ID NO: 31) (BlpI site underlined, ORF translation start and end triplets bold). Positive PC used for RSV AF ORF
R primer is (5 '→ 3') AAAGGCCT GCTTAGC AAAAAGCTAGCACAATGGAGTTGCTAATC
CTCAAAGCAAATGCAATTACC (SEQ ID NO: 32), the reverse primer is (5 '→ 3'
) AAAA GCTAAGCG CTAGCTTCTTTAATCCTAAGTTTTTCTTACTTTTATTAGTTACTAAATGCAATATTAT
TTATACCACTCAGTTGATC (SEQ ID NO: 33) (BlpI site underlined, ORF translation start and end triplets bold).

The PCR product was digested with BlpI and modified full length using standard molecular cloning techniques.
It was cloned into a cDNA clone. The obtained full-length cDNA containing RSV AG ORF was transformed into pB / HPI
The plasmid containing V ORG was called V3-G _A 1 and the plasmid containing F ORF was called pB / HPIV3-F _A 1. The nucleotide sequence of each inserted gene was confirmed by restriction enzyme digestion and automated sequencing. All constructs were designed such that the final genomic nucleotide length was a multiple of 6, which has been shown to be a prerequisite for efficient RNA replication (Calain et al., Incorporated herein by reference). al., J. Virol. 67: 4822-30, 1993).

[0528]   Recovery of rB / HPIV3-G1 and rB / HPIV3-F1 chimeric viruses from cDNA   rB / HPIV3-G1 and rB / HPIV3-F1 viruses were isolated from each cDNA, rB / HPIV3-G_A1 and rB
/ HPIV3-F_ARecovered from 1. This is for HEp-2 cells to support BPIV3 N, P and L
Transfecting each antigenomic cDNA with Smid described previously
By the method. Recombinant expression of T7 RNA polymerase gene in those cells
Vaccinia virus strain MVA was simultaneously infected.

The recovered recombinant virus was biologically cloned in Vero cells by serial endpoint dilutions. Inserted RS in the skeleton of each recovered recombinant virus
RT-PCR of viral RNA isolated from infected cells due to the presence of VG or F gene
It was confirmed by the following restriction enzyme digestion and DNA sequencing. The sequences of the inserted gene and flanking regions in the recovered recombinant virus were identical to those of the starting antigenome cDNA.

The multicycle growth rates of rB / HPIV3-G1 and rB / HPIV3-F1 in rB / HPIV3-G1 and rB / HPIV3-F1 viruses or LLC-MK2 cells that replicate efficiently in cell culture were determined by the LLC-MK2. Infect cell monolayers in triplicate with a multiplicity of infection (MOI) of 0.01,
Described above (Bailly et al., J. Virol. 74:31 , incorporated herein by reference ).
88-3195, 2000a), by collecting samples at 24-hour intervals over 7 days. These two viruses are called BPIV3 Ka, HPIV3 JS, rBIV
Comparison was made with 3 Ka and rB / HPIV3 (Fig. 14). The two parental viruses with HPIV3 glycoproteins, HPIV3 and rB / HPIV3, appeared to replicate somewhat faster than the others. However, the final titers achieved for each of the six viruses were similar except for one: rB / HPIV3-F1 was approximately 8-fold and less in its replication capacity than the other viruses. (Fig. 14).

This may be the effect of having this large gene in the vicinity of the promoter, the effect of the expression of the second fusogenic protein, or both. This latter possibility is comparable to that observed with rB / HPIV3-F1 in wild-type RSV infection,
The findings suggest that they induce larger large-scale syncytia observed with rB / HPIV3 or other parental viruses. In comparison, rB / HPIV3-G1 is LLC-MK
In 2 cells, a less cytotoxic effect comparable to rB / HPIV3 and less syncytium was introduced. However, rB / HPIV3-F1 and rB / HPIV3-G1 did not bind to LLC-MK2 cells and Ve
Growing to a final titer of at least 10 ⁷ TCID ₅₀ / mL in ro cells. this is,
We show that each virus is well tolerated for growth that would allow cost-effective vaccine production.

[0532]   rB / HPIV3-G1 and rB / HPIV3-F1 viruses replicate efficiently in the airways of hamsters It   Replicate rB / HPIV3-G1 and rB / HPIV3-F1 in the upper and lower respiratory tract of hamsters.
Ability to rB / HPIV3 parent virus, and BPIV3 and HPIV3 biology
The derivatized viruses were compared in parallel as controls (Table 16). Each
10 viruses⁶TCID₅₀ Nasal dose of rB / HPIV3-G
Both 1 and rB / HPIV3-F1 were given.

Animals from each group were sacrificed 4 and 5 days post infection and virus titers in the turbinates and lungs were determined by serial dilution. The levels of rB / HPIV3-G1 replication in the respiratory tract were very similar to those of HPIV3 JS and BPIV3 Ka and were statistically indistinguishable. Replication of rB / HPIV3-F1 was somewhat diminished at 4 and 5 days relative to the others, but this difference suggests that previous primates and clinical studies have replicated well to produce a protective immune response. It was not statistically significant compared to the induced biological BPIV virus (Coelingh et al., Virology 162 : 137-143, 19 each incorporated herein by reference).
88: Karron et al, Pediatr-Infect . Dis.J. 15: 650-654, 1996).

Also, viral titers from mixed rB / HPIV3-G1 and rB / HPIV3-F1 infections appeared to be somewhat reduced in the lower respiratory tract at day 4, which was not statistically significant. It was One replication of the control virus BPIV3 Ka was somewhat reduced in the lower respiratory tract on day 5: it was also not statistically significant and these small differences appear insignificant. This indicates that the rB / HPIV3-G1 and rB / HPIV3-F1 viruses appear to be sufficiently competent for replication in vivo, despite the presence of the 0.9 kb G or 1.8 kb F excess gene flanking the promoter. there were.

[0535]

[Table 16]

[0536]   rB / HPIV3-G1 and rB / HPIV3-F1 viruses are associated with both HPIV3 and RSV Induces clear antibody.   Hamsters were infected with rB / HPIV3-G1, rB / HPIV3-F1, or rB / HPIV3 as described above.
Let Additional groups were given both rB / HPIV3-G1 and rB / HPIV3-F1, and
Group was infected intranasally with RSV. Serum samples were collected 5 days after infection and RS
RSV specific by ELISA test specific for V F protein or RSV G protein
Antibodies (Table 17) and HPIV by hemagglutination inhibition (HAI) antibody assay
Assayed for 3 HN-specific antibodies (Table 18).

The titers of F-specific or G-specific antibodies induced by rB / HPIV3-F1 or rB / HPIV3-G1 virus, respectively, were 2-4 fold higher than those induced by wild-type RSV. Animals inoculated with both rB / HPIV3-F1 and rB / HPIV3-G1 were also F-specific and G.
-Has a high titer of specific antibody. In addition to the high ELISA titers against RSV G and F, rB / HPIV3-G1 and rB / HPIV3-F1 also induced higher RSV neutralizing serum antibody titers induced by wt RSV (Table 18). Each virus induced a PIV3-specific antibody titer indistinguishable from that of its parental virus rB / HPIV3 (Table 18). Thus, the rB / HPIV3 vector carrying the RSV F or G gene induced a strong immune response against both the RSV insert and the PIV vector.

[0538]

[Table 17]

[0539]

[Table 18]

[0540]   rB / HPIV3-G1 and rB / HPIV3-F1 viruses are HPIV3 and RSV challenge viruses Induces resistance to replication.   rB / HPIV3, rB / HPIV3-G1, rB / HPIV3-F1, or rB / HPIV3-G1 + rB / HPIV3-F1
Hamsters immunized with the candidate⁶TCID₅₀ HP IV3 or 10⁶PFU
Attacked by intranasal inoculation with RSV. The animals were killed 5 days later, the turbinates and lungs were collected,
Viral titer was measured (Table 19). Parental rB / HPIV3 virus or G1 and F1 induction
Fed animals develop a high level of resistance to HPIV3 challenge virus replication.
Shown, there were no significant differences between the experimental groups.

Animals given the rB / HPIV3-G1 or rB / HPIV3-F1, or both viruses were
It showed a high level of resistance to V challenge virus replication. The level of protection efficacy of the rB / HPIV3-F1 virus against RSV attack is the rB / HPIV3-G1 virus or RSV.
It seemed to be slightly less than that of the control. However, this difference did not differ significantly. As a result, rB having either the F or G gene of RSV
The / HPIV3 vector elicited a level of protective efficacy comparable to that of fully infectious RSV.

[0542]

[Table 19]

[0543]   Example XI   RB / HPI as a vector for hemagglutinin HN and F proteins of PIV2 Use of V3.1   HPIV3 HN and F genes are replaced by their HPIV1 counterparts in the HPIV3 backbone.
The chimeric rHPIV3-1 virus that has the HPIV2 HN protein as an overgene
Bears a useful vector. This chimeric vector rHPIV3-1.2HN smells like hamster
It was demonstrated here that it induces resistance to both HPIV1 and HPIV2 replication.
It was These findings demonstrate the surprising diversity of PIV expression systems. For example, rHPIV3-1.2
HN recombinant virus is an element derived from each of the three serotypes of HPIV that cause prominent disease
, That is, the internal repertoire of serotype 3 in combination with the serotype 1 HN and F glycoprotein genes
The gene, as well as the serotype 2 HN protective antigen as an excess gene.

This example provides yet another approach to deriving PIV-based vector vaccines for protection against both PIV1 and PIV2. In this example, rB / HPIV3 was modified by replacement of human PIV3 HN and F proteins with HPIV1 by them. rB
This virus, designated /HPIV3.1, contains PIV1 HN and F glycoproteins as part of the vector backbone with the intention of inducing neutralizing antibodies and immunity to HPIV1. This virus is used in this example as a vector to express the HN and F proteins of HPIV2 alone or together as an overgene. Three viruses were recovered and shown to be fully alive. rB / HPIV3.1-2F; rB / HPIV3.1-
2HN; or rB / HPIV3.1-2F, 2HN. Each expresses the PIV2F and / or HN gene as one or more overgenes.

Therefore, rB / HPIV3.1-2F, 2HN, which expresses PIV2F and / or HN proteins from two excess genes and expresses PIV1 F and HN genes from the vector backbone, is It expresses both major protective antigens of PIV2, namely the F and HN glycoproteins. This approach optimizes the protective efficacy of the vaccine and minimizes manufacturing costs because this enhanced immunogenicity is achieved utilizing only one virus. Also, immunizing infants and children with a single polyvalent virus would be simpler, safer, and more effective than a mixture of multiple viruses.

[0546]   Recombinant chimeric rB / HPIV3 carrying HPIV2F and HN genes as additional excess genes .1 Construction of Antigenome cDNA encoding virus   The bovine virus F and HN glycoprotein genes are the corresponding genes of the HPIV3 JS strain (rB
/ HPIV3) replaced with full-length cDNA of BPIV3 Kansas strain.
And constructed (Schmidt et al., Incorporated herein,J.Virol. 74: 8922-9, 2
000). This DNA was modified to contain three additional unique restriction enzyme recognition sites (
(Figure 15). Specifically, the BlpI site is introduced before the N ORF (nucleotide (nt) 103-109).
Introduce an AscI site (nt 1676-83) before the N gene end sequence, and
Position (nt 3674-3681) was introduced before the P gene end sequence.

Next, the F and HN glycoprotein genes of rB / HPIV3 were replaced with the corresponding genes of HPIV1. To accomplish this, the previously published subclone 3.1hcR6 of rHPIV3-1 full-length cDNA (Tao et al., J. Virol . 72 : 2955, incorporated herein by reference ) .
~ 2961, 1998) (This is HPIV1 F and HN under the control of HPIV3 transcription signal.
(Including the ORF of the glycoprotein gene) was modified by PCR mutagenesis to generate rB / HPI
Vgr (Schmidt et al . , J. Virol. 74 : 8922-9, 2000) mimicked the position of the SgrAI and BsiWI sites previously introduced into the SgrAI restriction enzyme recognition site before the F gene and the BsiWI restriction site. The site was constructed to precede the HN gene.

The mutagenic forward primer used to construct the SgrAI site was (5
From'to 3 ') CGGCCGTGACGCGTCTCCG CACCGGTG TATTAAGCCGAAGCAAA (SEQ ID
NO.34) (SgrAI site underlined), and mutagenesis reverse primer (5 '
From 3 to 3 ') CCCGAGCACGCTTTGCTCCTAAGTTTTTTATATTTCC CGTACG TCTATTGTCTG
ATTGC (SEQ ID NO.35) (BsiWI site underlined). HPIV3 F and HN in rB / HPIV3
The SgrAI and BsiWI sites were used as single-stranded DNA fragments to replace the gene with the HPIV1 F and HN genes from the modified 3.1hcR6 plasmid. This is BPIV3
HP under the control of HPIV3 transcription signal in the background derived from
Full-length antigenomic cDNA pB / consisting of IV1 F and HN open reading frames
Brings HPIV3.1.

In the following steps, the previously announced HPIV2 F and HN open reading frames (GenBank accession numbers AF213351 and AF213352) were cloned into pB / HPIV3.1 (Fig. 15).
Modified for insertion into the NtoI and AscI sites respectively. This strategy is based on PIV2 F and HN
To realize each of the ORFs as an additional independent mRNA, and
It is important that it be introduced into the rB / HPIV3 genome, preceded by the PIV3 gene start signal and followed by the PIV3 gene end signal. The NotI insertion site precedes the gene end signal of the P gene (Figure 15). Therefore, due to the insertion at this site, HPIV2 F ORF inserts NotI site, BPIV3 gene end signal at its upstream,
It requires modification by the addition of an intergenic region and a gene start signal, and a NotI site at its downstream end.

For the HPIV2 F ORF, the forward PCR primers used (5 'to 3') are AAAATATA GCGGCCGC AAGTAAGAAAAACTTAGGATTAAAGGCGGATGGATCACCTGCATCCAA.
TGATAGTATGCATTTTTGTTATGTACACTGG (SEQ ID NO: 36), and the reverse primer (from 5 ′ to 3 ′) AAAATATA GCGGCCGC TTTTACTAAGATATCCCATATATGTT
TCCATGATTGTTCTTGGAAAAGACGGCAGG (SEQ ID NO: 37) (NotI site underlined: OR
F The translation start and end triplets are in bold).

For the HPIV2 HN ORF, the same cis-acting elements as described above for HPIV2 F were added, but instead of NotI, an AscI site was added to either side of the insert to clone into the NP gene junction. Promoted. The forward PCR primers used (from 5'to 3 ') are GGAAA GGCGCGCC AAAGTAAGAAAAACTTAGGATTAAA
GGCGGATGGAAGATTACAGCAATCTATCTCTTAAATCAATTCC (SEQ ID NO: 38) and the reverse primer (from 5 ′ to 3 ′) GGAAA GGCGCGCC AAAATTAAAGCATTAGTTCCCTT
It was designated as AAAAATGGTATTATTTGG (SEQ ID NO: 39).

PCR products were labeled with NotI (HPIV2 F insert) or Asc1 (HPIV 2 HN insert).
Digested with and cloned into a modified full-length cDNA clone utilizing standard molecular cloning techniques. The resulting full-length cDNA containing HPIV2 ORF was named pB / HPIV3.1-2F, the full-length cDNA containing HPIV2 HN ORF was named pB / HPIV3.1-2HN, and F and HN
The plasmid containing both inserts was named pB / HPIV3.1-2F, 2HN. The nucleotide sequence of each inserted gene was confirmed by restriction enzyme digestion and automatic sequencing. All constructs were designed so that the final genomic nucleotide length was 6 times as long as shown to be necessary for efficient RNA replication (Calain et al., Incorporated herein by reference). J. Virol. 67 : 4822-30, 1993). The genomic nucleotide length of the recovered chimeric virus was as follows: pB / HPIV3.1: 15492; pB / HPIV3.1-
2HN: 17250; pB / HPIV3.1-2F: 17190; pB / HPIV3.1-2HN, 2F: 18948.

[0553]   rB / HPIV3.1, rB / HPIV3.1-2F, rB / HPIV3.1-2HN and rB / HPIV3.1-2F, 2 from cDNA HN recovery   Chimera of rB / HPIV3.1, rB / HPIV3.1-2F, rB / HPIV3.1-2HN and rB / HPIV3.1-2F, 2HN
Viruses were cloned into cDNAs pB / HPIV3.1, pB / HPIV3.1-2F, pB / HPIV3.1-2HN and pB / HPIV respectively.
Recovered from 3.1-2F, 2HN. This is a corresponding antigenomic cDNA for HEp-2 cells, BPI
Already published for transfection with V3 N, P and L support plasmids
I went the same way. Recombinant cells expressing T7 RNA polymerase gene in cells at the same time
It was infected with the senior virus, MVA strain. As previously announced (Tao et al.
,J.Virol.72: 2955-2961, 1998), porcine trypsin was added to the cell culture medium, and HP
The IV1 F protein was activated. The recovered recombinant virus was serially terminated in Vero cells.
Biologically cloned by point dilution.

All recombinant viruses replicate efficiently and induce CPE in Vero cells within 5 days,
The cell monolayer was then made positive for heme adsorption. The presence of the inserted HPIV2F and HN genes in the skeleton of each recovered recombinant virus was confirmed by the presence of viral RNA isolated from infected cells.
Was confirmed by RT-PCR, followed by restriction enzyme digestion and DNA sequencing. The sequences of the inserted gene and the flanking region in the recovered recombinant virus were the same as those of the starting antigenomic cDNA.

[0555]   Example XII    RHPIV3-1 as a vector for the measles virus hemagglutinin (HA) protein Utilization of cp45 _L : Continuous immunization strategy   HPIV3 HN and F genes have been replaced by their HPIV1 counterparts in the HPIV3 backbone.
The chimeric rHPIV3-1 virus possesses the HPIV2 HN protein as an excess gene as described above.
Responsible for quality effective vector. This chimeric vector rHPIV3-1.2HN is used in hamsters.
Thus, resistance to replication of both HPIV1 and HPIV2 can be induced. this
The findings show a surprising diversity of PIV expression systems. For example, this particular virus rHPIV3
-1.2HN is an element derived from each of the three HPIV serotypes, namely serotype 1 HN and F sugars.
Serotype 3 internal gene in combination with protein, as well as serum as an excess gene
Contains type 2 HN protection proteins. A further derivative, rHPIV3-1.2HN cp45_LWell, cp45 H
Attenuating mutations from the PIV3 vaccine candidate were included.

Thus, the PIV vector has three components: an internal vector backbone gene that may contain an attenuating mutation if desired; a vector glycoprotein gene that may be the same or a different serotype; and a protective antigen against another pathogen. It may be provided as comprising one or more coding excess genes. In most cases these excess antigens are not incorporated into the virion and therefore do not alter the neutralizing or tropic properties of the virus. Thus, each PIV vector is a bivalent or multivalent vaccine in which the vector itself elicits immunity to important human pathogens and each excess antigen elicits immunity to another pathogen.

In this example, the diversity of the PIV vector system is further demonstrated by using the rHPIV3-1 virus and its attenuated rHPIV3-1 cp45 _L derivative as a vector expressing measles virus HA as an overgene. It provides a new bivalent vaccine candidate for HPIV1 and measles virus. Thus, measles virus HA may be delivered by rHPIV3 and its attenuated derivatives carrying serotype 3 antigenic determinants, or by rHPIV3-1 and its attenuated derivatives carrying serotype 1 antigenic determinants.

It is noteworthy that the three serotypes of HPIV (1, 2 and 3) do not provide significant cross protection and each presents a significant human pathogen in need of a vaccine. This increases the probability that the three serotypes can be used to serially immunize infants against PIV and the protective antigens carried against heterologous pathogens. Specifically, immunization with a PIV vector containing one serotype antigenic determinant should be affected little or no by pre-immunization with one or more vectors containing heterologous serotype antigenic determinants. This indicates serial immunization and enhancement against excess antigen and against three HPIV serotypes in which the gene can be expressed from within the vector backbone or as an excess gene (
Preferably at intervals of 4-6 weeks or longer).

This example demonstrates that the major measles virus protective antigen, HA glycoprotein (Durbin, J. Virol . As an overgene , for use in infants and children to induce immune responses to both measles virus and HPIV1. 74 : 6821-31, 2000; live attenuated HPVI1 candidate vaccine, rHPIV3-1 H, which is incorporated herein by reference).
Details the use of reverse genetics technology for the development of A _PM cp45 _L.

We also developed a continuous immunization schedule in which the attenuated rHPIV3 HA _PM cp4
Immunize with 5 _L candidate vaccine (carrying serotype 3 antigenic determinant) and then rHPIV3-1 H
Immunization is performed with the N _PM cp45 _L candidate vaccine (carrying a serotype 1 antigenic determinant). Hamsters immunized with these viruses have HPIV3 and
Antibodies were raised against the HPIV1 antigen and maintained a high titer of antibody against the measles virus HA, a delivered antigen expressed as an excess antigen from both HPIV3 and HPIV1 candidate vaccine viruses.

[0561]   RHPIV3-1 HA _(PM) and rHPIV3-1 H expressing measles virus HA as an excess gene Construction of wild type and attenuated versions of A _(PM) cp45 _L , rHPIV3-1   Two full-length plasmids pFLC HPIV3-1 HA as described above_(PM)And pFLC HPIV3
-1 HA_(PM) cp45_L (Figure 16) was constructed (Durbin,J.Virol. 74: 6821-31, 2000;
 Skiadopoulos et al.,J.Virol. 72: 1762-8, 1998; Tao et al.,J.Virol.72 : See 2955-2961, 1998. Incorporated herein by reference. p
FLC HPIV3-1 HA_(PM)Above pFLC HPIV3 HA_(PM)Build with and smell
As for the wild type measles virus Edmonston strain HA gene ORF, the P and M genes of rHPIV3
It was inserted as an excess gene in between.

PFLC HPIV3 HA _(PM) was digested with BspEI-SphI and a 6487 bp cDNA fragment lacking the BspEI-SphI sequence was isolated. Then, instead of HPIV3, PIN1 F and H
A pFLC 2G + .hc full-length antigenomic cDNA plasmid (Tao et al., J. Virol . 72 : 2955-2961, 1998) carrying N ORF was digested with BspEI and SphI, and HHP3 in the HPIV3 backbone.
A 6541 bp fragment containing the PIV1 glycoprotein gene (plasmid nts 4830-11
371) into the BspEI ~ SphI window of pFLC HPIV3 HA _PM and pFLC HPIV3-1 H
A _PM (Fig. 15) was obtained.

Cp45L mutant existing in L gene ORF (Ser-942 → His, Leu-992 → Phe
, And a point mutation encoding an amino acid substitution of Thr-1558 → Ile) is HPIV3 cp45
Major ts and att determinants of candidate vaccines (Skiadopoulos et al., J. Virol . 72 :
1762-8, 1998), and has been previously shown to provide replication attenuation to rHPIV3-1 cp45 _L in the hamster trachea (Tao et al., Vaccine 17 : 1100-8, 1999).

Next, pFLC HPIV3-1 HA _PM was modified to encode these three ts mutations and
LC HPIV3-1 HA _PM cp45 _L was supplied (Fig. 16). This is the pFLC HPIV3 cp45L SphI ~ Ng
oMIV restriction endonuclease fragment (plasmid nts 11317-15929) (Ski
adopoulos et al . , J. Virol. 72 : 1762-8, 1998) pFLC HPIV3-1 HA _PM SphI-Ng.
Done by inserting it into the MIV window.

[0565]   Recovery of rHPIV3-1 HA _(PM) and rHPIV3-1 HA _(PM) cp45 _L   pFLC HPIV3-1 HA_(PM)Or pFLC HPIV3-1 HA_(PM) cp45_L6-hole plate (Cost
HEp-2 cells on ar, Cambridge, MA) and support plasmids pTM (N), pT
M (PnoC) and pTM (L) and Lipofect ACE (Life Techonologies, Gaithersburg
, MD) and transfect these cells as previously published.
(Skiadopoulos et al.Vaccine 18: 503-10, 1999b, herein by reference
Replication that encodes the bacteriophage T7 polymerase protein.
Co-infection with defective vaccinia virus MVA-T7. Among other cultures including trypsin
After incubating for 4 days at 32 ° C, the transfection product is collected to 25 cm. ²  LLC-MK2 cells in flask were subcultured and cells were incubated at 32 ° C for 5 days.
I made a decision.

The virus recovered from the cell supernatant was further passaged to LLC-MK2 monolayer culture with trypsin at 32 ° C. to amplify the virus. rPIV3-1 HA _PM and rPIV _3-1 HA _PM
Make cp45 _L as previously announced (Skiadopoulos et al., Vaccine 18 : 503-10
, 1999b) Biologically cloned by end-point dilution on LLC-MK2 monolayer cultures at 32 ° C. Virus suspension of biologically cloned virus derived from LLC-MK
2 Amplified on monolayer culture.

Viral RNA (vRNA) was isolated from recombinant chimeric virus by biological cloning as described above. RT-PCR, rHPIV3-1 HA _PM or rHPIV3-1 as template
It was performed utilizing specific oligonucleotide primers that span the HA _PM cp45 _L vRNA, HA gene insert or the cp45 mutation in the L gene. RT-PCR products were analyzed by restriction endonuclease digestion and partial DNA sequencing of PCR products as described above. This confirmed the presence of the measles virus HA gene inserted between the P and M genes of rHPIV3-1 and its attenuated derivative of the cp45L gene.

[0568]   Demonstration of the attenuated phenotype of rHPIV3-1 HA _(PM) cp45 _L in hamsters   10 in 6 groups of Golden Syrian hamsters⁶TCID₅₀RHPIV3-1, rHPIV3-
1 HA_PM, rHPIV3-1 cp45_L Or rHPIV3-1 HA_PM cp45_LWas intranasally inoculated. 4 of inoculation
After a day, the lungs and turbinates were removed and virus titers were previously reported.
(Skiadopoulos et al.,Vaccine 18: 503-10, 1999b). Its titer
Average log_TenTCID₅₀ / Gram as tissue (Table 20).

Recombinant rHPIV3-1 HA _PM and its parent rHPIV3-1 wt replicate to comparable levels and insertion of an additional transcription unit encoding the HA gene ORF does not further attenuate the virus to hamsters. Suggest that. rHPIV3-1 HA _PM cp45 _L and its rHPIV3
-1 cp45 _L parental strain replicated to similar levels in the upper and lower trachea and rHPI
V3-1 HA _PM cp45 _L is sufficiently attenuated for replication in hamsters, suggesting that the insertion of the measles virus HA gene ORF does not further attenuate the chimeric rHPIV3-1 cp45 _L parent virus.

[0570]

[Table 20]

[0571]   Attenuated rHPIV3 HA _PM cp45 _L chimeric vaccine candidate followed by attenuated rHPIV3-1 HA _PM Vector immunization is a continuous immunization schedule that employs immunization with the cp45 _L vaccine candidate Antigens that induce antibodies against HPIV3 and HPIV1 antigens and are delivered in a distributed manner, Maintain high titers of antibodies against measles virus HA   rHPIV3-1 HA_PM cp45_LImmunization of a group of hamsters with HPIV1 and measles
Induces a strong immune response to both irs (Table 21, Group 6), rHPIV-3
Could be an effective vector for measles virus HA, similar to rHPIV3
Suggest.

Next, the possibility of continuous immunization of hamsters with rHPIV3 HA _PM cp45 _L and rHPIV3-1 HA _PM cp45 _L was examined. Hamster group 10 ⁶ TCID ₅₀ rHPIV3 HA _PM cp4
The mice were immunized with 5 _L (Table 21, groups 1, 2 and 3), rHPIV3 cp45 _L (Group 4) or L15 medium control (Group 5) (Table 5). 59 days after the first immunization, hamster groups were treated with 10 ⁶ TCID ₅₀ of rHPIV3-1 HA _PM cp45 _L (groups 1 and 4), rHPIV3-1 cp45 _L (groups 2 and 5), or L15 medium group (group). Immunized with 3). Blood samples were collected from the first immunization before the first immunization 58
They were collected day and 35 days after the second immunization. Animals immunized with rHPIV3 cp45 _L (Table 21, Group 4) show a strong antibody response to HPIV3, and rHPIV3
Animals immunized with HA _PM cp45 _L (groups 1, 2 and 3) showed strong antibody responses against both HPIV3 and measles virus.

Group 4 animals pre-immunized with rHPIV3 cp45 _L were then challenged on day 59 with rHPIV3-1.
It was immunized with HA _PM cp45 _L. When assayed at day 94, these animals had high antibody titers against HPIV3 and measles virus, and low to moderate antibody titers against HPIV1. This means that HPIV3-1 chimeric vaccine virus
3 shows that even in the presence of immunity to 3, the vector can elicit an immune response against both the HPIV1 antigen and the delivered HA protein, but there is some reduction in its immunogenicity in animal immunity to HPIV3. . The rHPIV3-1 HA _PM cp45 _L vaccine was clearly immunogenic in animals previously immunized against HPIV3 as shown by the hamster response in group 4.

Animals immunized with rHPIV3 cp45 _L on day 0 showed slightly higher neutralizing antibody titers against measles on day 94, 35 days after immunization with rHPIV3-1 HA _PM cp45 _L on day 59. It was
Significantly, immunized first with rHPIV3 HA _PM cp45 _L , then rHPIV3-1 HA _PM cp4
Hamsters immunized with 5 _L (Group 1, Table 21) were rHPIV3 HA _PM cp4 on day 94.
A higher measles virus serum neutralizing antibody titer was achieved than in the hamster group immunized with only 5 _L (group 3), and rHPIV3-1 HA _PM cp45 _L was in high serum against measles after immunization with rHPIV3 HA _PM cp45 _L. It suggests that it can be used to maintain the sum antibody titer. To demonstrate such a high antibody titer against measles virus HA after hamsters Group 1 of the first by rHPIV3 HA _PM cp45 _L immunization, rHPIV3-1 HA _PM cp45 _L by these after immunization titers of more than four times the No rise could be detected.

In humans, HPIV3 vaccines such as rHPIV3 HA _PM cp45 _L appear to be given within 4 months of age and HPIV1 vaccines such as rHPIV3-1 HA _PM cp45 _L after 2 months of age (Skiadopoulos et al. Vaccine 18 : 503-10, 1999b, incorporated herein by reference). In contrast to rodents, human infants have low antibody titers against viral glycoprotein antigens administered within 6 months of age, based on immunological immaturity, immunosuppression by maternal antibodies and other factors. (Karron et al . , Pediatr.Infect.Dis.J. 14: 10-6, 1995a; Karron et al . , J. Infect.Dis. 172: 1 .
445-1450, 1995b; Murphy et al . , J. Clin. Microbiol. 24 : 894-8, 1986, each incorporated herein by reference).

[0576]   Therefore, rPIV3-1 HA to antibody titers against measles virus HA_PM cp45_L Enhancement effect of
Very likely to require fruits, and within 6 months of birth rPIV3 HA_PM cp45 _L  It will be easily observed in infants immunized with. In this example, each is measles
By two serologically distinct live attenuated PIV vaccines expressing viral HA
Animals are serially immunized to generate antibodies against the HPIV3 and HPIV1 antigens of the vector backbone.
It is possible to maintain a high antibody titer against the antigen that has been elicited and delivered and measles virus HA.
Suggest that it is Noh.

[0577]

[Table 21]

[0578]   Example XIII   Construction and characterization of chimeric HPIV3-2 vaccine recombinant expressing chimeric glycoprotein Decision   This example is used in infants and children using reverse genetics technology.
Details the development of a live attenuated PIV2 candidate vaccine virus for HPIV3-1 Chimeric anti
Carry full-length PIV2 glycoprotein within the wild-type PIV3 backbone as described above for the body
Prior attempts to recover recombinant chimeric PIV3-PIV2 virus yielded infectious virus
Didn't. However, rather than the full-length PIV2 ORF, the ORF of chimeric HN and F
A live PIV2-PIV3 chimeric virus was recovered when used to construct the full-length cDNA.

A recovered virus designated rPIV3-2CT in which the PIV2 ectodomain and transmembrane domain were fused to the PIV3 cytoplasmic domain, and the PIV2 ectodomain was PIV3.
RPIV3-2TM fused to the transmembrane and cytoplasmic tail domains had a similar, but not identical, in vitro and in vivo phenotype. Thus, for PIV3
Only the cytoplasmic tail of HF or F glycoprotein appears to be required for successful recovery of PIV2-PIV3 chimeric virus.

The rPIV3-2 recombinant chimeric viruses show a strong host range phenotype, ie they are in v
It replicates efficiently in itro, but replication is strongly restricted in vivo. This attenuation in vivo occurs in the absence of any additional mutation from cp45. Although rPIV3-2CT and rPIV3-2TM replicate efficiently in vitro, they are extremely attenuated in both the upper and lower trachea of hamsters and African green monkeys (AGM), leading to PIV2 and PIV2
It is suggested that the chimerization of H3 and F proteins of V3 itself identifies an in vivo attenuated phenotype.

A phenotype involving efficient replication in vitro and highly suppressed amplification in vivo is highly desirable for vaccine candidates. Despite this attenuation, they were highly immunogenic and protective against challenge with PIV2 wild type virus in both species. rPIV3-2CT and rPIV3-2TM were placed outside the HN and F coding sequences 12
Further modification by the introduction of PIV3 cp45 mutations, rPIV3-2CTcp45 and rPIV3-2TMcp4
5 was induced. These derivatives replicated efficiently in vitro, but were further attenuated in hamsters and AGM, suggesting that this attenuation, identified by glycoprotein chimerism and the cp45 mutation, is additive. These findings identify rPIV3-2CT and rPIV3-2TM recombinants as suitable candidates for use in live attenuated PIV2 vaccines.

[0582]   Viruses and cells   The wild-type PIV1 strain used in this study, PIV1 / Washington / 20993/1964 (PIV1
/ Wash64) (Murphy et al.,Infect.Immun. 12: 62-68, 1975, herein by reference
(Included in the book) as already announced (Tao et al.,J.Virol. 72: 2955-
2961, 1998, incorporated herein by reference) LLC-MK2 cells (ATCC CCL 7.1
A). The PIV wild type virus, strain V9412-6, designated PIV2 / V94
In calibrated Vero cells from nasal washes of sick children in 994
Isolated. PIV2 / V94 was plaque purified 3 times on Vero cells and then Op-excluded with FBS.
It was amplified twice in Vero cells using tiMEM.

Wild-type cDNA-induced recombinant PIV3 / JS strain (rPIV3 / JS) as previously published (Durbin et al., Virology 235: 323-332, 1997, incorporated herein by reference). Propagated. A modified vaccinia Ankara virus (MVA) recombinant expressing bacteriophage T7 RNA polymerase was kindly provided by Drs. L. Wyatt and B. Moss (Wyatt et al., Virology 210: 202-205, 1995, cited. Incorporated herein).

HEp-2 cells (ATCC CCL 23) were grown in MEM (Life Technologies, Gaithersburg, 10% fetal bovine serum, 50 μg / ml gentamicin sulfate and 2 mM glutamine).
MD). Vero cells that had not been passaged for 150 passages were subjected to serum-free medium VP-SFM (Formula No.96-03) containing 50 μg / ml gentamicin sulfate and 2 mM glutamine.
53 SA, Life Technologies).

[0585]   Virion RNA isolation, viral gene reverse transcription and PCR amplification, and automated sequencing Decision   For cloning viral genes or for genetic chimeras of recombinant chimeric viruses
To verify the car, as previously announced (Mbiguino et al., J, Virol.Me
thods 31: 161-170, 1991, incorporated herein by reference)
Proliferated on cell culture and concentrated by polyethylene glycol precipitation. Bili
Is on-RNA a virus pellet using Trizol reagent (Life Technologies)?
Extracted from Superscript Preamplification system (Life Technologies)
Used as a template for reverse transcription (RT).

This cDNA was further PCR amplified using the Advantage cDNA kit (Clontech, Palo Alto, CA). RT-PCR amplified DNA is used for cloning or sequencing purposes.
Purified from agarose gel using NA45 DEAE membrane according to the manufacturer's suggestion (Schleicher & Schuell, Keene, NH). Sequencing was performed with the dRhodamine dye terminator cycling sequencing kit (Perkin Elmer, Forster City, CA) and ABI 310.
It carried out by Gene Analyzer (Perkin Elmer, Forster City, CA).

[0587]   Complete PIV2 F containing PIV2-derived ectodomain and PIV3-derived cytoplasmic tail domain And HN proteins or chimeric PIV3-PIV2 encoding chimeric F and HN proteins Construction of antigenomic cDNA   Full-length PIV3 antigenome RN with PIV3 F and HN ORF replaced by its PIV2 counterpart
The DNA encoding A was previously published for PIV3-PIV1 (Tao et al.,J. Viro l.  72: 2955-2961, 1998).

Details of this construction are shown in FIG. PIV2 / V94 grown in Vero cells were concentrated and virion RNA (vRNA) was extracted from the viral pellet using Trizol reagent. PIV2 / V94 F and HN ORFs with random hexamer primers and Super Scri
Reverse transcribed from vRNA using the pt Preamplification System and then cDNA Advan
tage kit and PIV2 F and HN gene specific primer pairs (
1, 2 and 3, 4; Table 22).

The amplified cDNA fragment of the PIV2 F ORF was digested with NcoI and BamHI, and pLit
.PIV31.Fhc NcoI-BamHI window (Tao et al . , J. Virol. 72: 2955-2961, 1998,
Incorporated herein by reference), pLit.PIV32Fhc
Made up. The BspEI site within the PIV3 full length cDNA is unique and we planned to use it to exchange segments between cDNAs (see Figures 17-19). Therefore, the BspEI site found in the PIV2 F ORF was removed by site-directed mutagenesis without affecting the amino acid sequence. CDNA fragment of PIV2 HN ORF
Digested with NcoI and HindIII and ligated into the NcoI-HindIII window of pLit.PIV31.HNhc (Tao et al . , J. Virol. 72: 2955-2961, 1998) and pLit.PIV32HN.
I made hc.

The PIV2 ORF within pLit.PIV32Fhc and pLit.PIV32HNhc was sequenced and the sequence was found to be as designed. The nucleotide sequences of PIV2 F and HN ORF were submitted to GenBank. Let pLit.PIV32Fhc and pLit.PIV32HNhc be PpuMI and
Digested with SpeI and assembled to make pLit.PIV32hc. pLit.PIV32hc 4
The kb BspEI-SpeI fragment was cloned into the p38′ΔPIV31hc BspEI-SpeI window (Skiado
poulos et al., Vaccine 18: 503-510, 1999, incorporated herein by reference).
Introduced into p38'ΔPIV32hc. A 6.5 kb fragment containing the PIV2 full-length F and HN ORF constructed by digesting p38'ΔPIV32hc with BspEI and SphI was used as pFLC.2.
It was introduced into the BspEI-SphI window of G + .hc (Tao et al . , J. Virol. 72 : 2955-2961, 1998) to construct pFLC.PIV32hc (Fig. 17; Table 23: SEQ ID NO: 60).

[0591]

[Table 22]

[0592]

[Table 23]

[0593]

[Table 24]

[0594]

[Table 25]

[0595]

[Table 26]

[0596]

[Table 27]

[0597]

[Table 28]

[0598]

[Table 29]

[0599]

[Table 30]

[0600]

[Table 31]

[0601]

[Table 32]

In the second strategy (FIG. 18), chimeric PIV3-PIV2 F rather than complete ORF exchange was used.
And HN ORF were constructed. In that, the regions of PIV2 F and HN ORF encoding the ectodomain were isolated from pLit.PIV32Fhc and pLit.PIV32HNhc respectively by PCR, Ven
t DNA polymerase (NEB, Beverly, MA), and PIV2 F specific primer pairs (5, 6 in Table 22) and HN specific primer pairs (7, 8 in Table 22)
) Was used for amplification. In parallel, PIV3 F and HN encoding the ectodomain
From each of its cDNA subclones pLit.PIV3.F3a and pLit.PIV3.HN4 (Tao et al . , J. Virol. 72: 2955-2961, 1988, incorporated herein by reference). PCR, Vent DNA polymerase, and PIV3 F specific primer pairs (9, 10 in Table 22) and HN specific primer pairs (11, 12 in Table 22).
) Was used for removal.

Amplified F and HN cDNA fragments of PIV2 and PIV3 were purified from agarose gel and ligated to make pLit.PIV32FTM and pLit.PIV32HNTM, respectively. The chimeric F and HN constructs were digested with PpuMI and SpeI and assembled to make pLit.PIV32 ™. It was then sequenced over its PIV-specific region with the dRhodamine dye terminator sequencing kit and found to be as designed.

The 4 kb BspEI-SpeI fragment from pLit.PIV32TM was then transformed into Bs of p38'ΔPIV31hc.
Introduced into the pEI-SpeI window to create p38'ΔPIV32TM. A 6.5 kb BspEI-SphI fragment derived from p38'ΔPIV32TM containing the PIV3-PIV2 chimeric F and HN genes was
pFLC.2G + .hc and pFLCcp45 were introduced into the BspEI-SphI window (Skiadopoulos et al . , J. Virol. 73: 1374-81, 1999, incorporated herein by reference), and pFLC.PIV.
32TM (Table 24, SEQ ID NO: 61) and pFLC.PIV32TMcp45 were constructed respectively.
The nucleotide sequence of the BspEI-SpeI fragment containing the chimeric PIV3-PIV2 F and HN genes was submitted to GenBank.

[0605]

[Table 33]

[0606]

[Table 34]

[0607]

[Table 35]

[0608]

[Table 36]

[0609]

[Table 37]

[0610]

[Table 38]

[0611]

[Table 39]

[0612]

[Table 40]

[0613]

[Table 41]

In the third strategy (FIG. 19), chimeric PIV3-PIV2 F and HN genes were constructed. In this, the regions of the PIV2 F and HN ORFs encoding the ectodomain and transmembrane domain were isolated from pLit.PIV32Fhc and pLit.PIV32HNhc, respectively, using primers specific for PCR, Vent DNA polymerase, and PIV2 F (22nd Amplification was carried out from primers 13 and 14 in the table) and primers specific to PIV2 HN (15 and 16 in Table 22). In parallel, code ectodomain and transmembrane brand main
The partial ORFs of the PIV3 F and HN genes were cloned into their cDNA subclones pLit, PIV3.F3a and pLit
.PIV3.HN4 (Tao et al . , J. Virol. 72: 2955-2961, 1988, incorporated herein by reference) for each of PCR, Vent DNA polymerase, and primers specific for PIV3 F ( It was deleted using primers specific to PIV3 HN (17, 18 in Table 22) (19, 20 in Table 22).

The F and HN cDNA fragments of PIV2 and PIV3 were gel purified and ligated to make pLit.PIV32FCT and pLit.PIV32HNCT, respectively. The chimeric F and HN constructs were digested with PpuMI and SpeI and assembled to create pLit.PIV32CT. It was sequenced across the PIV-specific region and found to be Tezyne. The 4 kb BspEI-SpeI fragment from pLit.PIV32CT
Introduced into the BspEI-SpeI window of p38'ΔPIV31hc to create p38'ΔPIV32CT. 6.5 kb BspE from p38'ΔPIV32CT containing PIV3-PIV2 F and HN chimeric genes
The I-SphI fragment was introduced into the BspEI-SphI window of pFLC.2G + .hc and pFLCcp45 to create pFLC.PIV32CT (Table 25, SEQ ID NO.62) and pFLC.PIV32CTcp45, respectively. The nucleotide sequence of this BspEI-SpeI fragment was submitted to GenBank.

[0616]

[Table 42]

[0617]

[Table 43]

[0618]

[Table 44]

[0619]

[Table 45]

[0620]

[Table 46]

[0621]

[Table 47]

[0622]

[Table 48]

[0623]

[Table 49]

[0624]

[Table 50]

The cDNA manipulation was designed so that the final PIV3-2 antigenome fits the sixth law (
Calain et al . , J. Virol. 67: 4822-30, 1993; Durbin et al., Virology 234: 74-83, 199.
7, incorporated herein by reference). The PIV3-2 insert in pFLC.PIV32TM is 15498nt long and the insert in pFLC.PIV32CT is 15474nt long.
Is. These full lengths do not contain the two 5'terminal G residues contributed by the T7 promoter, as they are presumed to have been removed during recovery. Transfection and recovery of recombinant chimeric PIV3-PIV2 virus

HEp-2 cell monolayers were grown to confluency in 6-well plates and transfections were performed essentially as described (Tao et al., 72: 2955-2961, 1988, cited herein). Incorporated in the specification). 5μg of HEp-2 monolayer in one hole
PIV3-PIV2 antigenomic cDNA, as well as three support plasmids, 0.2 μg
pTM (N), 0.2 μg pTM (PnoC), 0.1 μg pTM (L), 12 μl Lipofect A
Transfection was carried out in 0.2 ml MEM containing CE (Life Technologies).
These cells were simultaneously infected with MVA-T7 at a multiplicity of infection (MOI) of 3 in 0.8 ml serum-free MEM containing 50 μg / ml gentamicin and 2 mM glutamine. Chimeric antigenomic cDNA pFLC.2G + .hc (Tao et al . , J. Virol. 72: 2955-2961, 199.
8) was transfected in parallel as a positive control.

After 12 hours incubation at 32 ° C., the transfection medium is 50 μg / ml.
Was replaced with 1.5 ml fresh serum-free MEM containing gentamicin and 2 mM glutamine. The transfected cells were incubated for another 2 days at 32 ° C. Gamma-irradiated porcine trypsin (p-trypsin; T1311, Sigma, St. Louis)
, MO) was added 3 days after transfection to a final concentration of 0.5 μg / ml. Cell culture supernatant was harvested and passaged into fresh Vero cell monolayers in T25 flasks (designated passage 1). After overnight adsorption, the transfection harvest was replaced with fresh VP-SFM containing 0.5 μg / ml p-trypsin.

Cultures from passage 1 were incubated at 32 ° C. for 4 days, and the amplified virus was harvested and in the presence of 0.5 μg / ml p-trypsin for a further 4 days at 32 ° C.
Vero cells were further passaged (designated passage 2). The presence of virus in passage 2 cultures was determined by heme adsorption with 0.2% guinea pig red blood cells (RBC). The virus was further purified by three serial endpoint dilutions performed with Vero cells maintained in VP-SFM containing 2 mM glutamine, 50 μg / ml gentamicin and 0.5 μg / ml p-trypsin. After the third endpoint dilution, the virus was amplified in Vero cells three more times and this virus suspension was used for further characterization in vitro and in vivo.

[0629]   Confirmation of chimeric properties of vRNA using sequencing and restriction analysis of PCR products   Recombinant PIVs were enriched in LLC-MK2 cells for analysis of the genetic structure of vRNAs.
Width and concentrated. Extract vRNAs from viral pellet and
-Reverse transcription was performed using a script preamplification system. RT
-PCR with the Advantage cDNA Synthesis Kit and PIV2 or PIV3 specific primer pairs
(21, 22 or 23, 24 in Table 22). Restrict the digestion of RT-PCR products
Were analyzed by either gel purification and then by sequencing.

[0630]   Replication of PIVs in LLC-MK2 cells   Propagation of PIV virus in tissue culture was performed in triplicate at 6 wells with an infection efficiency of 0.01.
Evaluation by infecting confluent monolayer LLC-MK2 cells on rate
. The inoculum was removed after absorption at 32 ° C for 1 hour. Cells are treated with OptiMEMI without serum
Washed 3 times and added with 50 μg / ml gentamicin and 0.5 μg / ml p-trypsin,
2 ml / well OptiMEM I was given and incubated at 32 ° C.

Every 24 hours, a 0.5 ml aliquot of medium was taken from each well and snap frozen, and 0.5 ml of fresh medium containing p-trypsin was added to the culture. The virus in aliquots was titrated in monolayer LLC-MK2 cells at 32 ° C. with the liquid overlay (Tao et al., J. Virol. 72: 2955-2961,1998, incorporated herein). , And the end point of the titration was determined by haemosorption. The titer is expressed in log _{1 0} TCID ₅₀ / ml.

[0632]   Replication of recombinant chimeric PIV3-PIV2 virus at various temperatures   Virus in 1x L15 supplemented with 2 mM glutamine and 0.5 μg / ml p-trypsin.
Diluted serially. Dilute the virus with a single layer of LLC-MK2 in 96-well plates.
Used to infect cells. Infected plates at various temperatures as described.
And incubated for 7 days (Skiadopouls et al.,Vaccine 18: 503-510,1999
Incorporated herein by reference). The virus titer was determined as above.

[0633]   Replication, immunogenicity of recombinant chimeric PIV3-PIV2 virus in hamster trachea,
And protective effect   10 to 6 Golden Syrian hamsters in the flock^5.3TCID₅₀Recombinant virus
Virus or virus of biological origin was inoculated intranasally. 4 days after inoculation, hamster
, And prepare their lungs and turbinates to be harvested for viral load.
(Skiadopoulos et al.,Vaccine 18: 503-510, 1999, incorporated herein by reference).
The titer is the average log of 6 hamsters in each group._TenTCID₅₀/ Expressed in grams of tissue
It

Twelve hamsters in the county were infected intranasally with 10 ^5.3 TCID ₅₀ of virus on day 0, and 4 weeks later, 6 hamsters in each group were treated with 10 ⁶ TCID ₅₀ of PIV1 or 10 ⁶ TC.
Inoculated with PIV2 with ID ₅₀ . Four days after challenge, hamsters were sacrificed and their lungs and turbinates were harvested. The titer of the attacking virus in the collected tissues was determined in the same manner as above (Tao et al., J. Virol. 72: 2955-2961, 1998, incorporated herein by reference).
. The virus titer is expressed as the mean log ₁₀ TCID ₅₀ / gram of tissue of 6 hamsters in each group. Serum samples were collected 3 days before and 28 days after inoculation,
And the titer of hemagglutination inhibitory antibody (HAI) against PIV1, PIV2, and PIV3 was determined in the same manner as above (van Wyke Coelingh et al., Virology 143: 569-582, 1985, incorporated herein by reference). . The titer is expressed as the reciprocal of the average log ₂ .

[0635]   Replication of recombinant chimeric PIV3-PIV2 virus in African green monkeys (AGMs)
, Immunogenicity, and protective effect   10 on 4 AGMs in the county on day 0^FiveTCID₅₀Viruses in the nasal cavity and trachea
I was infected with this. Nose / pharyngeal (NT) swab sample and tracheal lavage fluid for 12 days each
For the same time and for 5 days, it was recovered as above (van Wyke Coelingh et al.,Virology 14
3: 569-582, 1985). On day 29, immunize 10 AGMs^FiveTCID₅₀Nasal cavity at PIV2 / V94
It was inoculated to each of the inside and the trachea.

Swab samples of NT and tracheal lavage fluid were collected for 10 and 5 days, respectively. Pre-immunization, post-immunization, and post-challenge serum samples were collected at -3, 28, and 60 days, respectively. The virus titer in the swab sample of NT and the tracheal lavage fluid was determined in the same manner as above (Tao et al., J. Virol. 72: 2955-2961, 1998,). Titer is log ₁₀ TCID ₅₀ / ml
It is represented by. Titers of serum neutralizing antibodies against PIV1 and PIV2 were determined as above (van Wyke Coelingh et al., Virology 143: 569-582, 1985). The titer is expressed as the reciprocal of the average log ₂ .

[0637]   Replication and immunogenicity of recombinant chimeric PIV3-PIV2 virus in chimpanzees
Effectiveness   10 on 4 chimpanzees in the county on day 0^FiveTCID₅₀Nasal cavity with PIV2 / V94 or rPIV3-2TM
Intratracheal and tracheal infections as before (Whitehead et al.,J.Virol. 72: 4467
-4471,1998, incorporated herein by reference). Collect NT swab samples daily for 12 days
To obtain tracheal lavage fluids on days 2, 4, 6, 8, and 10. The virus titer in the sample
Determined as above (Tao et al.,J.Virol. 72: 2955-2961,1998, herein
Incorporated into). The peak virus titer is log_TenTCID₅₀Expressed in / ml. Pre-immunization
And post-immunization serum samples were collected at -3 and 28 days, respectively. For PIV1 and PIV2
Titers of serum neutralizing antibodies against them were determined as described above (van Wyke Coelingh et al.
,Virology 143: 569-582, 1985). And the titer is the average log₂Represented by the reciprocal of
.

[0638]   Recovery from PIV3-PIV2 chimeric cDNAs encoding complete PIV2F and HN proteins Viable recombinant chimeric virus   Replaced the F and HN translation regions of JS wild strain PIV3 with the F and HN translation regions of PIV2 / V94
The structure of the new PIV3-PIV2 chimeric cDNA has been previously described and is summarized in Figure 17.
Has been done. The final plasmid construct, pFLC.PIV32hc (Figure 17), contains 15492 nt P
It encodes IV3-PIV2 chimeric antigenomic RNA,
Follow the rules.

Monolayer HEp-2 cells were transfected with three carrier plasmids pTM (N), pTM (PnoC), and pTM (L
) With pFLC.PIV32hc with LipofectACE and the cells were co-infected with MVA-T7 as before (Ta.
o et al., J. Virol. 72: 2955-2961, 1998, incorporated herein by reference). The virus did not recover from each initial transfection with pFLC.PIV32hc. on the other hand,
The chimeric virus did not recover from all transfections with the control plasmid pFLC.2G + .hc.

These results show that rPIV3-2 from cells transfected with this cDNA clone.
Consistent with the possibility that the mutation, which prevented viral recovery, occurred outside the 4 kb BspEI-SpeI segment of pFLC.PIV32hc. To explore this possibility, p38 '
The BspEI-SpeI fragments of ΛPIV31hc and p38'ΛPIV32hc were exchanged. Played p38'ΛPI
V31hc and p38'ΛPIV32hc were completely identical to those in Figure 17, except that the SpeI-SphI fragment containing the PIV3L gene sequence was replaced.

The BspEI-SphI fragment of these two regenerated cDNAs was cloned into PIV3 full-length clone p3 / 7- (
131) 2G + BspEI-SphI opening with 10 types of pFLC.2G + .hc clone and pF respectively
LC.PIV32hc clones (2 clones selected from each ligation) were introduced in 5 separate independent ligations (p3 / 7- (131) 2G +,
(Note that the PIV3 sequences outside the BspEI-SphI opening of pFLC.2G + .hc and pFLC.PIV32hc are perfectly matched). Therefore, this would replace the PIV3 backbone sequence which could undergo false mutations to sequences known to be functional. Moreover,
The functionality of the backbone was reassessed at the same time. Ten pFLC.PIV32hc cDNA clones did not yield any viable virus, but ten pFLC.2G + .hc cD
NA clones produced viable viruses in each.

The virus was a PIV3C knock-out recombinant with a large deletion used upon successful recovery (Durbin et al., Virology 261: 319-30, 1999, incorporated herein by reference). ) And tentatively did not recover from pFLC.PIV32hc despite culturing the same transfection product. Each unique component used in the production of pFLC.PIV32hc was used in the successful production of other recombinant viruses, except for the cytoplasmic tail domains of F and HN. In this case, the major causative error in the cDNA that does not result in recombinant virus is highly suspicious. Rather, the preferred interpretation is that the full length of PIV2F and HN glycoproteins is incompatible with one or more PIV3 proteins required for viral growth.

[0643]   PIV3-PIV2 chimeric cDNA encoding chimeric PIV3-PIV2F and HN proteins
Of chimeric virus from   The ectodomain or ectodomain of PIV3F and HN glycoproteins, using two different theories.
Domains and transmembrane domains replaced by their PIV2 equivalents
A new chimeric PIV3-PIV2 anti-genomic cDNAs was constructed. Four full length cDNAs
Construct, in other words pFLC.PIV32TM, pFLC.PIV32TMcp45, pFLC.PIV32CT, and pF
LC.PIV32CTcp45 has been previously described and is summarized in Figures 18, 19 and 20. Most
The PIV3-2 inserts in the final plasmids pFLC.PIV32TM and pFLC.PIV32CT are, respectively,
15498 nt and 15474 nt long and followed six rules (Calain et al.
,J.Virol. 67: 4822-30,1993; Durbin et al.,Virology 234: 74-83,1997, it
Incorporated herein by reference). BspEI-SphI Regi
This was confirmed by Sequencing and restriction analysis.

The recombinant chimeric virus was cloned into full-length clones pFLC.PIV32TM, pFLC.PIV32CT, pFLC.P.
Recovered from IV32TMcp45 or pFLC.PIV32CTcp45, and rPIV3-2TM and rPI respectively
They were called V3-2CT, rPIV3-2TMcp45, and rPIV3-2CTcp45. The viruses were biologically cloned into Vero cells by 3 consecutive final dilutions,
And then amplified three times in Vero cells.

[0645]   Genetic characterization of recombinant chimeric PIV3-PIV2 viruses   Biologically cloned chimeric PIV3-PIV2 virus, rPIV3-2TM, rPIV3-2C
T, rPIV3-2TMcp45, and rPIV3-2CTcp45 were grown in LLC-MK2 cells and then
Concentrated. Viral RNAs extracted from virus pellets are PIV2- or PIV3-specific
Gene segment using different primer pairs (21, 22 or 23, 24 in Table 22)
Used for RT-PCR amplification of menthol. rPIV3-2TM, rPIV3-2CT, rPIV3-2TMcp45, and rPI
Restriction of RT-PCR products amplified from V3-2CTcp45 with PIV2-specific primer pairs
The enzymatic digestion patterns differed from those obtained from PIV2 / V94, respectively, and EcoRI
, MfeI, NcoI, or those patterns using PpuMI are different from the designed cDNA.
It was what was expected of them.

The nucleotide sequences of eight different PIV3-PIV2 junctions in the F and HN genes of rPIV3-2TM and rPIV3-2CT are given in Figure 20. In addition, except for the cp 45 label in the first gene of the 3 'leader region and NP, rPIV3-2TMcp45 and rPIV3-2CT
The cp 45 labels given in cp45 was confirmed by digestion with the same RT-PCR and restriction enzyme and the (Skiadopoulos et al, J.Virol 73: .. 1374-81,1999, incorporated herein by reference). The results show that PIV3-P recovered as well as the presence of the introduced cp45 mutation.
The chimeric properties of the IV2 virus were confirmed.

[0647]   Efficiency of PIV3-PIV2 recombinant chimeric virus in LLC-MK2 cells in vitro Duplication   Kinetics and regulation of in vitro replication of PIV3-PIV2 recombinant chimeric virus
The model was evaluated by multi-cycle replication of LLC-MK2 cells (Fig. 21). 6-well
RPIV3-2TM, rPIV3-2CT, rPIV3-2TMcp4 in triplicate on LLC-MK2 cells in monolayer in plate
5, or rPIV3-2CTcp45 with p-trypsin (0.5 μg / ml) present at an infection efficiency of 0.01
Infected below. Samples were taken every 24 hours for 6 days from the culture supernatant.

Each recombinant chimeric virus except rPIV3-2CTcp45 (clone 2A1) replicates at the same rate, and PIV3-PIV2 chimerization of the F and HN proteins alters the rate of growth of the recombinant chimeric virus. They replicated at a level similar to their PIV2 / V94 parental virus, indicating that they did not, and all viruses reached titers above 10 ⁷ TCID ₅₀ / ml. Only the rPIV3-2CTcp45 grew slightly faster and reached its maximum titer faster than PIV2 / V94 in each of the two experiments. This enhanced growth pattern was likely the result of unidentified mutations in this clone, as sister clones did not display this growth pattern. rPIV3-2CTcp45 clone 2A1 was used in the studies described below.

[0649]   Level of temperature sensitivity of rPIV3-2 chimeric virus and its cp45 derivative   Examining the temperature-sensitive level of replication of the PIV3-PVI2 recombinant chimeric virus, rPIV
Determining whether the 3-2TM and rPVI3-2CT viruses exhibit a ts phenotype, and
Acquisition of 12 cp45 mutations by the virus carries those 12 PIV3 cp45 mutations
It was determined whether they showed a level of temperature sensitivity characteristic of cp45 derivatives (Skia
dopoulos et al., J. Virol. 73: 1374-81, 1999). Temperature sensitivity of the virus
Levels were determined in monolayers of LLC-MK2 cells as described previously (Skiadopoulos et
al., Vaccine 18: 503-510, 1999) (Table 26).

The titers of rPIV3-2TM and rPVI3-2CT were fairly constant at the permissive temperature (32 ° C) and at the various limiting temperatures tested. This indicates that these recombinants were ts ⁺ . In contrast, their cp45 derivatives, rPIV3-2TMcp45 and rPIV3-
2CTcp45 was ts, and its temperature sensitivity level was similar to that of rPIV3-1cp45. rPIV3-1cp45 is a PIV3-PIV1 chimeric virus, which has the complete PIV1F and HN glycoproteins and the same set of 12 cp45 mutations. Therefore rPIV3-2TM and rPVI
In vitro characterization of 3-1CT virus, and their cp45 derivatives, was demonstrated by rPIV, respectively.
3-1 and rPIV3-1 cp45, which suggest that the in vivo properties of rPIV3-2 and rPIV3-1 viruses may also be similar, but surprisingly this is not the case. There wasn't.

[0651]

[Table 51]

[0652]   rPIV3-2TM and rPVI3-2CT are attenuated in hamsters and show immunogenicity. Is highly protective, and the introduction of the cp45 mutation greatly reduces the virus. Weakened and less protective.   In groups of 6 hamsters, 10 intranasally^5.3TCID₅₀ RPIV3-2TM, rPIV3-2
CT, rPIV3-2TMcp45, rPIV3-2CTcp45 or control virus was inoculated. Before
In addition, the rPIV3-1 virus, as in its parental PIV3 and PIV1
It was found to replicate in the upper and lower respiratory tracts (Skiadopoulos et al., Vaccine
 18: 503-510, 1999; Tao et al., J. Virol. 72: 2955-2961, 1998).

The PIV2 virus replicates efficiently in hamsters, but is not compatible with rPIV3-2TM and rPIV3-2C.
Each T virus replicated 50-100 fold lower in the upper trachea than parental PIV3 and PIV2 and 320-2000 fold lower in the lower respiratory tract (Table 27). This is the chimera PIV3
-Means that PIV2F and HN glycoproteins show an unexpected attenuated phenotype in hamsters. The derivatives rPIV3-2TMcp45 and rPIV3-2CTcp45 having the cp45 mutation are
It was 50-100 fold weaker than its parent rPIV3-2, with little detectable replication in the turbinates and no replication in the lungs. These rPIV3-2cp45 viruses are rPIV3-1c
It was clearly attenuated compared to p45 and showed a further 50-fold lower replication in the turbinate. Therefore F
And the attenuating effect of the chimerization of HN glycoprotein and the attenuating effect of the cp45 mutation are additive.

[0654]

[Table 52]

To determine the immunogenicity and protective effect of the PIV3-PIV2 chimeric virus, hamsters in groups of 12 were treated with 10 ^5.3 TCID ₅₀ of rPIV3-2TM, rPIV3-2CT, rPIV3-2TMc.
P45, rPIV3-2CTcp45 or control virus was immunized on day 0. Each group 6
Sixty hamsters were challenged on day 29 with 10 ⁶ TCID ₅₀ of PIV1 and the remaining six hamsters were challenged on day 32 with PIV2. The lungs and turbinates were removed from the hamsters 4 days after the aggressive inoculation. Serum samples were taken on day -3 and day 28 and the titers of HAI antibodies against PIV1, PIV2, and PIV3 were determined.

As shown in Table 28, rPIV3-, despite attenuated growth in hamsters
By immunization with 2TM or rPIV3-2CT, HAI antibody in serum against PIV2
It was induced at levels comparable to those induced by infection with wild-type PIV2 / V94.
Immunization of hamsters with rPIV3-2TM and rPIV3-2CT completely restricted replication of aggressively administered PIV2 virus. rPIV3-2TMcp45 and rPIV3-2CTcp4
5 failed to induce a detectable serum antibody response. And immunization of hamsters with either of these two viruses reduced replication of aggressively administered PIV2 virus in the lower respiratory tract by only 10-100 fold.

[0657]

[Table 53]

[0658]   rPIV3-2TM and rPIV3-2CT are attenuated in AGM and show immunogenicity. And is highly protective, while the introduction of the cp45 mutation causes the virus to be highly reduced. It is weakened and less protective.   Certain recombinant PIV3 and RSV viruses differ in Geshes and primates.
Levels of attenuation (Skiadopoulos et al., Vaccine 18: 503-510, 19
99; Skiadopoulos et al., J. Virol. 73: 1374-81, 1999a; Skiadopoulos et al.
., Virology 272: 225-34, 2000; Whitehead et al., J. Virol. 73: 9773-9780,
 1999). This means that the attenuation can be somewhat species-specific.
Therefore, rPIV3-2 virus was replicated and immunized in AGM (African green monkey).
Evaluate for level of epidemiology.

[0659] In a group of four, AGM was treated with 10 ⁵ TCID ₅₀ per site of rPIV3-2TM, rPIV3 on day 0.
-2CT, rPIV3-2TMcp45, rPIV3-2CTcp45, PIV2 / V94, or rPIV3-1 was administered intranasally and intratracheally. Virus titers in nasal turbinate (NT) swab specimens (collected on days 1-12) and tracheal lavage specimens (collected on days 2, 4, 5, 8 and 10) were determined conventionally ( van Wyke Coelingh et al., Virology 143: 569-582, 1985). As shown in Table 29, rPIV3-2TM and rPIV3-2CT showed that the peak titers of released virus were lower than that of the parental PIV2 / V94 virus in both the upper and lower respiratory tracts, It was clearly attenuated in the trachea of AGM.

The cp45 mutation bearing derivatives rPIV3-2TMcp45 and rPIV3-2CTcp45 were detected at very low, if any, levels in NT swab and tracheal lavage preparations. This suggests that the attenuating effect of F and HN glycoprotein chimerization and the effect of cp45 mutation are additive in AGM as in hamsters.

In order to determine whether immunization of AGM with the PIV3-PIV2 chimeric virus protects against PIV2 challenge, AG previously infected with rPIV3-2 virus was determined.
M was challenged with PIV2 at 10 ⁵ TCID ₅₀ on day 28 (Table 29). NT swab specimen (29
Virus titers present in ~ 38 days) and in tracheal lavage fluids (30, 32, 34, 36, 38 days) were routinely determined (Durbin et al., Virology).
261: 319-30, 1999). As shown in Table 29, immunization with rPIV3-2TM and rPIV3-2CT restricted replication of aggressively administered PIV2 / V94 virus at high levels.

In contrast, immunization of AGM with rPIV3-2TMcp45 and rPIV3-2CTcp45 did not limit replication of aggressively administered PIV2 / V94 virus. The animals were then maintained at very low levels in serum prior to challenge with neutralizing antibodies against PIV2. Complete restriction of replication of aggressively administered PIV2 / V94 in rPIV3-2CT-immunized AGM confers incomplete protection, rPIV3-2TM-immunized AG
There was a pre-challenge serum level of neutralizing antibodies to PIV2 of 2.5 times that of M compared to that of M.

[0663]

[Table 54]

[0664]   rPIV3-2TM is attenuated in its replication in the chimpanzee trachea .   Chimpanzees in groups of four, 10^FiveTCID₅₀ RPIV3-2TM or rPIV2 / V94
, Day 0, intranasal and intratracheal inoculation. NT swab specimens (days 1-12) and tracheal cleaning
Specimens (Days 2, 4, 6, 8 and 10) were collected. Determine virus titer as before
(Durbin et al., Virology 261: 319-30, 1990) and log the results._TenTC
ID₅₀Expressed as / ml. As shown in Table 30, rPIV3-2TM is associated with its parental wild-type PIV2.
It had a lower peak titer compared to / V94 and was released for a significantly shorter period.
This indicates that rPIV3-2TM is attenuated in chimpanzees. PIV2 / 9
4 Wild-type virus is lower in chimpanzees than in hamsters and AFG
Duplicate at level. The rPIV3-2TM virus, on the other hand, is found in each of these model hosts.
Was weakened.

[0665]

[Table 55]

As mentioned above, the major protective antigens against PIV are HN and F glycoproteins.
Thus, in an exemplary embodiment of the invention, attenuated live vaccine virus candidates for use in infants and young children include full-length PIV1 and partial PIV2 sugars in the underlying PIV3 genome or antigenome. HPIV3-1 and HPIV3-2 having proteins respectively
Chimeric viruses are included. In the latter case, to construct the full-length cDNA,
Chimeric HN and F ORFs are used rather than full-length PIV2. The recovered viruses were rPIV3-2CT in which the extracellular and transmembrane domains of PIV2 were fused to the cytoplasmic domain of PIV3, and rPIV3-, in which the extracellular domain of PIV2 was fused to the transmembrane and cytoplasmic tail domains of PIV3. 2TM, which had similar phenotypes in vitro and in vivo.

In particular, the rPIV3-2 recombinant chimeric virus exhibits a host range phenotype. That is, they replicate efficiently in vitro but have limited replication in vivo. This in vivo attenuation occurs even without the additional mutation from cp45. This is a highly desirable effect for vaccine purposes, partly because of its unexpected host range effect, in part because its phenotype is not due to point mutations that can revert to wild type. At the same time, unlimited growth in vitro is very advantageous for efficient vaccine production.

RPIV3-2CT and rPIV3-2TM replicate efficiently in vitro but are highly attenuated in both the upper and lower respiratory tracts of hamsters and African green monkeys. This indicates that the chimerization of PIV2 and PIV3 HN and F proteins defines the in vivo attenuation phenotype. Despite this attenuation, they show high immunogenicity in both species and the wild-type virus PIV2
Protect against the attack of. rPIV3-2CT and rPIV3-2TM were further modified by the introduction of twelve PIV3 cp45 mutations outside the HN and F coding sequences to produce rPV3-2CT and rPIV3-2TM.
IV3-2CTcp45 and rPIV3-2TMcp45 were formed. They replicated efficiently in vitro but were even more attenuated in hamsters and AGM. This indicates that the attenuation by the glycoprotein and the attenuation by the cp45 mutation are additive.

The development of an antigenic chimeric virus with a protective antigen of one virus and an attenuating mutation of the other virus was carried out by the influenza virus (Belshe et al., N. Eng.
lJMed. 338: 1405-1, 1998; Murphy et al., Infections Diseases in Clinic.
al Practice 2: 174-181, 1993) and rotavirus (Pevez-Schael et al., NE
ngl.J.Med. 337: 1181-7, 1997), already reported by others. Attenuated antigenic chimeric vaccines are more easily made in these viruses with segmented genomes. Because rearrangement of segments of the genome occurs frequently during coinfection.

[0670] The attenuated live influenza virus vaccine candidate is antigenic by replacing the HA and NA genes of the attenuated donor virus with those of the newly localized or global pandemic virus each year. Will be updated. Recombinant DNA technology has also been actively used to produce live, attenuated antigen chimeric virus vaccines in flaviviruses and paramyxoviruses. In the case of flaviviruses, by replacing the premembrane region (prM) and the envelope region (E) of the attenuated yellow fever virus (YFV) with those derived from an attenuated strain of Japanese encephalitis virus (JEV), Attenuated live viral vaccine candidates for Japanese encephalitis virus have been generated (Guirakhoo et al., Virology 257: 363-72, 1999).

This JEV-YFV antigen chimeric recombinant vaccine candidate was attenuated in vivo and was immunogenic (Guirakhoo et al., Virology 257: 363-72, 1999). Both the structural and non-structural proteins of this chimeric virus were derived from attenuated live vaccine virus. An antigenic chimeric vaccine was also created between a naturally attenuated tick-borne flavivirus (Langat virus) and a wild-type mosquito-borne dengue 4 virus. The resulting recombinant was significantly more attenuated than the parental tick-borne virus (Pletnev et al., Proc. Natl. Acad. Sci. US
A. 95: 1746-51, 1998), but this chimeric virus had very limited replication in Vero cells in vitro.

This is an example of an attenuating effect resulting from a partial incompatibility between the evolutionarily divergent structural proteins defined by Langat virus and the non-structural proteins of dengue virus. A third strategy is pursued for the production of tetravalent Dengue virus. In that case, the backbone of dengue 4 virus containing an attenuating deletion mutation in the 3'non-coding region is used to construct an antigen chimera virus containing dengue 1, 2 or a protective antigen of the virus ( Bray et al., Proc.Natl.Acad.Sci. USA 8
8: 10342-6, 1991; J. Virol. 70: 3930-7, 1996).

Antigenic chimeric virus was also produced for the single-stranded negative-sense RNA virus. For example, antigenic chimeric PIV1 vaccine candidates may be prepared by substituting full-length HN and F proteins of parainfluenza virus type 1 for those of PIV3 in attenuated PIV3 vaccine candidates according to the methods disclosed in this invention. It can be constructed and this recombinant is attenuated and protected against the induction of PIV1 in laboratory animals. Similarly, exemplary antigenic chimeric respiratory syncytial virus (RSV) vaccine candidates include one or more RSV F and G protective antigens, or subgroup B viruses whose antigenic determinants are attenuated RSV Exchanged for those in attenuated RSV subgroup A viruses that generate group B vaccine candidates

(International Publication No. WO97 / 06270; Callins et al., Proc. Natl. Acad. Sci. USA 92:
11563-11567 (1995); US Patent Application No. 08 / 892,403 filed July 15, 1997.
(Publication International Application No. WO98 / 02530 and priority US provisional patent applications, 60 / 047,634 filed May 23, 1997, 60 / 046,141 filed May 9, 1997, and 1996
Corresponding to 60 / 021,773 filed on July 15, 1993; Collins on April 13, 1993
U.S. Patent Application No. 09 / 291,894 filed on April 13, 1993; U.S. Provisional Patent Application No. 60 / 129,006 filed on April 13, 1993; U.S. Provisional Patent Application No. filed on July 9, 1999 by Bucholz et al. 60/143, 132; and Whitehead et al., J. Virol. 73: 977 .
See also 3-9780, 1999.

Each of which is incorporated herein by reference). When exchange of glycoproteins between PIV1 and PIV3 viruses, and between RSV subgroup A and RSV subgroup B viruses was performed in the wild-type virus background, the antigenic chimeric virus was expressed in vitro and in vitro. Replicated in vivo to wild-type virus levels. These findings indicate that high levels of tautomerism existed between the recipient and donor viruses, and very little, if any, attenuation was obtained as a result of the chimerization process. Showing. These findings for the exchange of PIV1 and PIV3 and RSV A and B glycoproteins are contrasted in various ways for the exchange of PIV2 and PIV3 disclosed herein.

In the present disclosure, the viable recombinant viruses used for the full-length PIV2 HN or F proteins to replace those of PIV3 revealed the same mutation introduced during the construction of the cDNA. Not recovered in this possible case, while this is PIV-1-
Successfully achieved due to glycoprotein exchange of PIV3. This is PIV2 HN or F
It shows that the glycoprotein is almost incompatible with the one or more PIV3 proteins encoded by the cDNA. Two viable PIV2-PIV3 chimeric viruses were obtained when chimeric HF and F ORFs, rather than full-length PIV2 ORFs, were used to construct full-length cDNA.

One of these chimeric viruses contains the chimeric HN and F glycoproteins in which the ectodomain of PIV2 is fused to the transmembrane and cytoplasmic tail regions of PIV3, and the other, the ectodomain of PIV2. And the transmembrane region contained the chimeric HN and F glycoproteins fused to the cytoplasmic tail region of PIV3. Both rPIV3-2 recombinants are similar but not identical. It had an in vitro and in vivo phenotype. Therefore,
It was revealed that only the cytoplasmic tail of PIV3 HN or F glycoprotein was required for successful recovery of PIV2-PIV3 chimeric virus.

In previous work on protein structure-function analysis, chimeric HN or F
Glycoprotein has been constructed and expressed in vitro, and was used to map various functional domains of the protein (Bousse et al.,
Virology 204: 506-14, 1994; Deng et al., Arch.Virol.Suppl. 13: 115-30,
1997; Deng et al., Virology 253: 43-54, 1999; Deng et al., Virology 209:
457-69, 1995; Mebatsion et al., J. Virol. 69: 1444-1451; Takimoto et al.
, J. Virol. 72: 9747-540, 1998; Tanabayashi et al., J. Virol. 70: 6112-611 .
8, 1996; Tsurudome et al., J. Gen. Virol. 79: 279-87, 1998; Tsurudome et a.
l., Virology 213: 190-203, 1995; Yao et al., J. Virol. 69: 704005-53, 199.
Five ).

In one report, a chimeric protein consisting of the measles virus F cytoplasmic tail fused to the transmembrane and ectodomain of the vesicular stomatitis virus G protein was:
It was inserted into a measles virus-infected clone instead of the measles virus F and HN virus glycoproteins (Spielhofer et al., J. Virol. 72: 2150-9, 1998). A replication competent chimeric virus was obtained, which was highly restricted to replication in vitro, as indicated by delayed growth and low virus yield, which showed a high degree of attenuation in vitro. It was This finding is clearly different from the phenotype exhibited by the recombinant PIV of the present invention expressing the chimeric glycoprotein, eg, the PIV2-PIV3 chimera that replicates efficiently in vitro.

Efficient in vitro replication of the rPIV3-2 and other chimeric PIV viruses of the invention in vitro is an important property for candidate live attenuated vaccines required for large scale vaccine production. In contrast to rPIV3-2CT and rPIV3-2TM, rPIV3-1 is not attenuated in vivo. Therefore, chimerization of HN and F proteins of PIV2 and PIV3 itself is
A new finding for single-stranded, negative-sense RNA viruses has resulted in reduced ivo replication.

The mechanism for this limited host range of replication in vivo is unknown. Importantly, infection with these attenuated rPIV3-2CT and rPIV3-2TM vaccine candidates resulted in PIV2
Induces a high level of resistance to the induction by C., indicating that the antigenic structure of the chimeric glycoprotein is large or completely intact. Thus, the function of rPIV3-2CT and rPIV3-2TM as candidates for live attenuated PIV2 represents the desired balance between attenuation and immunogenicity in both AGM and hamsters.

The attenuating effect of PIV3-PIV2 chimerization of F and HN glycoproteins is in addition to that specified by the cp45 mutation. rPIV3-2 recombinants containing the cp45 mutation were
It is highly attenuated at o and provides incomplete hamster protection against PIV2-induced and slight protection in AGM. This is in contrast to the finding by rPIV3-1cp45 that it was well attenuated in vivo and protected animals against PIV1-induced.

The chimerization of the PIV3-PIV2 glycoprotein and the additional attenuating effect of the 12cp45 mutation was
Attenuation in vivo was also revealed. Clearly, if it was found that candidates for the rPIV3-2CT and rPIV3-2TM vaccines were not sufficiently attenuated in humans, the attenuating mutation in cp45 should be the attenuated version of the live attenuated PIV2 vaccine for human use. And 12 rather than 12 combinations may be added additionally to achieve the desired balance between and immunogenicity.

Therefore, the findings presented herein have identified a novel means for attenuating paramyxoviruses, and these PIV3-PIV2 chimeric attenuated live PIs in humans.
It provides the criteria for evaluating V2 vaccine candidates. Importantly, rPIV3-2CT or rPIV3-
The 2TM virus can also be used as a vector for other PIV antigens or other viral protective antigens such as the measles virus HA protein or immunogenic portions thereof.

Briefly summarizing the above description and examples, recombinant chimeric PIV constructed as a vector with a heterologous viral gene or genomic segment was generated and the cDNA
Was characterized using a virus recovery system based on. Recombinant viruses generated from the cDNAs replicate independently and can grow as if they were biologically derived viruses. In a preferred embodiment, recombinant chimeric human PIV
(HPIV) vaccine candidates have one or more major HPIV antigenic determinants, preferably in the background of being attenuated by modification of one or more nucleotides.

Preferably, the chimeric PIV of the invention also express one or more protective antigens of another pathogen, eg a microbial pathogen. In these cases, HPIV acts as an attenuated viral vector and is used for the dual purpose of inducing a protective immune response against one or more HPIVs and against the pathogen from which said foreign protective antigen is derived. . As mentioned above, the major protective antigens of PIV are their HN and F glycoproteins.

The major protective antigens of other enveloped viruses, such as those that infect the human respiratory tract and can be expressed by HPIV vectors from one or more external transcription units, referred to as genetic units, are those It is an adhesion protein, for example RSV G protein, measles virus HA protein, mumps virus HN protein, or a fusion (F) protein thereof, such as RSV, measles virus or mumps F protein.

It is also possible to express the protective antigens of the virus without envelopes, such as the human papillomavirus L1 protein, which is capable of forming virus-like particles in infected hosts (Roden et al., J. Virol. 70: 5875 ). -83, 1996). According to these techniques, large sequences of protective antigens from diverse pathogens and their constitutive antigenic determinants can be incorporated into the chimeric PIV of the invention to generate novel, effective immune responses. .

The present invention overcomes the inherent difficulties in previous approaches to the development of vector-based vaccines, and the unique immunity of immunization of infants during the first year of life against various human pathogens. To provide Earlier studies of developing live attenuated PIV vaccines have unexpectedly shown that rPIV and their attenuated chimeric derivatives are non-fragmented negative-chain as vectors for expressing foreign proteins as vaccines against various human pathogens. RNA viruses have the property of optimizing them respectively.

Those skilled in the art tend to grow less substantially than unfragmented negative-strand viral forms, and are not typically represented for molecular studies in human PIV.
Would prove to have highly desirable properties as a vector.
The intranasal route of administration of these vaccines is based on the vector and expressed heterologous antigen,
It is also surprising that it proved to be a very effective means of stimulating a strong local and systemic immune response to both. In addition, this route offers the additional benefit of immunization against xenopathogens that infect the respiratory tract or elsewhere.

The characteristics of the PIV vector are: (i) the major neutralizing antigen of measles virus expressed as separate genes in the wild type and the attenuated background, or (ii) also the major neutralizing antigen of HPIV2. Produces a major neutralizing antigen of HPIV1 instead of the neutralizing antigen of PIV3
It was described above using the example of the rPIV3 vector. These rPIV vectors were constructed using wild type and attenuated background. Furthermore, the description herein demonstrates the ability of PIV vectors to be readily enhanced in their level of attenuation. According to one of these methods, the alteration of the length of the genomic insert in the chimeric PIV of the invention allows the regulation of the attenuated phenotype apparent only in the wild-type derivative with a very long insert.

The present invention provides six major advantages over previous attempts to immunize young infants against measles virus or other microbial pathogens. First, PIV recombinant vectors into which the protective antigen or measles virus or other microbial pathogenic antigens are inserted are known to attenuate the virus due to the respiratory tract of very young human infants 1 Or an attenuated rPIV with multiple attenuated genetic factors (Karron e
t al., Pediatr.Infect.Dis.J. 15: 650-654, 1996; Karron et al., J. Infect. Dis. 171, 1107-1114, 1995a; Karron et al., J. Infect.Dis. 172: 1445-1450,
1995b). This extensive history of previous clinical evaluations and practices greatly facilitates the evaluation of these recombinant derivatives that give rise to foreign protective antigens in very young human infants.

The second advantage is that the rPIV backbone with measles HA or other protective antigens of another human pathogen
(1) Mandatory independent PIV for vaccines mentioned above, and (
2) Protective antigens induce two protective immune responses against heterologous viruses or other microbial pathogens expressed by the vector. This is the VSV described above, which induces immunity to only one human pathogen, namely measles virus, and at the most inappropriate or potentially disadvantageous immune response to the vector itself.
Compare with measles virus HA recombinant.

The coding sequences of foreign genes inserted into the viruses of various members of the order Mononegavirales are found after multiple replication cycles in tissue culture cells.
It remains intact in the genome of many recombinant viruses, indicating that members of this group of viruses are excellent candidates for use as vectors (Bukreyer et al., J. Virol. 70: 6634-41, 1996; Schnell et al., Proc . Natl . Acad . Sci . USA 93: 11359-65, 1996a; Singth et al., J. Gen. Virol. 80: 1
01-6; Yu et al., Genes Cells 2: 457-66, 1997).

Another advantage provided by the present invention is the use of such a live attenuated viral vector for the immunization program of early childhood, when the use of human pathogenic backbones necessary for vaccines is already crowded. Is to like the introduction of. Moreover, immunization via the mucosal surface of the respiratory tract provides various advantages. Live attenuated PIV3 has been shown to replicate in the airways of rhesus monkeys and to induce a protective immune response against itself in the presence of large amounts of maternally acquired PIV3 antibody.

The ability of two PIV3 vaccine candidates to infect and replicate efficiently in the upper respiratory tract of very young infants with maternally acquired antibodies was also demonstrated (Karron e
t al., Pediatr.Infect.Dis.J. 15: 650-654, 1996; Karron et al., J. Infect. Dis. 171: 1107-1114, 1995a; Karron et al., J. Infect.Dis. 172: 1445-1450,
1995b).

This is in line with the currently licensed measles virus vaccine, which is highly infectious when administered to the upper respiratory tract of humans and highly neutralizing susceptibility when administered parenterally to young children. In contrast (Black et al., New Eng. J. Med. 263 : 165-
169, 1960; Kok et al., Trars.R.Soc.Trop.Med.Hyg. 77 : 171-6, 1983; Simasa
thien et al., Vaccine 15 : 329-34, 1997). Replication of HPIV vectors in the respiratory tract will stimulate the production of both mucosal IgA and systemic immunity to HPIV vectors and expressed foreign antigens. Due to its subsequent natural exposure to wild-type viruses, such as measles virus, the presence of vaccine-induced local and systemic immunity limits its replication at its entry points, namely the respiratory tract, and systemic sites of replication, both Should play a role.

Yet another advantage of the present invention is that the chimeric HPIV bearing heterologous sequences replicates efficiently in vitro, demonstrating the potential for large scale production of vaccines. This indicates that multiple single-stranded negative-sense RNs can be inhibited in vitro by the insertion of foreign genes.
In contrast to A virus replication (Bukreyev et al., J. Virol. 70 : 6634-41, 1
996).

In addition, the three antigenic serotypes of HPIV each cause significant disease in humans, and may therefore simultaneously play a role as vectors and vaccines, each of which carries the same foreign protein. Produced, antigenically different HP
It presents a unique opportunity to immunize over time with IV variants. Thus, immunization over time may result in a booster immunization during a subsequent infection with HPIV that is antigenically different from the antigen that also produces one or more proteins that are the same or different, ie measles virus or another microbial pathogenic protective antigen. It will allow the generation of a primary immune response against the foreign proteins that may be present.

Re-administration of the homologous HPIV vector also increases the response of both HPIV and foreign antigens, although the ability to cause multiple re-infections in humans is unusual but characterized by HP
This may be due to IV (Collins et al., In “Fields Virology” , BN
.Fields, DMKnipe, PMHomley, RMChanock, JLMelnick, TPMonath, B.
Roizman, and SEStrans, Eds., Vol.1, pp.1205-1243. Lippincott-Raven Pub
lishers, Philadelphia, 1996).

Yet another advantage is that the introduction of the genetic unit into the PIV vector has unexpected but highly desirable multiple effects on the production of attenuated virus. First, for example, the insertion of a gene unit expressing HA of measles virus or HN of PIV2 can identify a host-range phenotype for a previously unrecognized PIV vector, i.e. the resulting PIV vector is replicates efficiently in vitro, but in v
In ivo it is limited to the upper and lower respiratory tract. These findings identify the insertion of a genetic unit expressing a viral protective antigen as an attenuator for the PIV vector, a desired property of the live attenuated virus vaccine of the invention.

[0702]   The PIV vector system is a single-stranded rugate sense virus of the order Mononegavirus.
It has unique advantages over all other members of. First, use it as a vector
Many other mononegaviruses that have been used do not originate from human pathogens (eg,
Mouse HPIV1 (Sendai virus) (Sakai et al,FEBS Lett. 456: 221-6, 1999
), Vesicular stomatitis virus (VSV), a pathogen of cattle (Roberts et al.,J.Virol.  72 : 4704-11, 1998), and canine PIV2 (SVS) (He et al.,Virology 217: 249-60
, 1997)).

For these non-human viruses, weak or weak immunity would be conferred against either of the human viruses by the antigens present in the vector backbone. Therefore, a non-human viral vector expressing an excess gene for human pathogenesis is
It will induce resistance only to a single human pathogen. In addition, viruses such as
Use of VSV, SVS, rabies virus or Sendai virus as a vector will expose the vaccine to viruses that they will not encounter elsewhere during their lifetime. Infection with such non-human viruses, and the immune response thereto, is less profitable and claims safety issues because of the small experience of infection with these viruses in humans.

An important and specific advantage of the PIV vector system is that its preferred intranasal route, which mimics natural infection, induces both mucosal and systemic immunity, and maternally derived serum present in infants. It is to reduce IgG neutralization and immunosuppressive effects. At the same time, these same advantages could theoretically allow the use of RSV as a vector, for example we found that RSV replication was strongly inhibited by inserts of approximately 500 bp or more (Bukreyev et al. , Proc.Natl.Acad.Sci . USA 96 : 2167-72, 19
99). In contrast, as described herein, HPIV3 can easily accommodate multiple large gene inserts. The finding that recombinant RSV is unsuitable for the production of large inserts or recombinant PIV is highly suitable represents an unexpected result.

It is proposed that some of the other viral vectors could be administered intranasally to obtain similar benefits as shown for the PIV vector, but this has not been successful so far. For example, MV of a vaccine virus expressing the protective antigen of HPIV3
Strain A was evaluated as a live attenuated intranasal vaccine against HPIV3. Although this vector appears to be a very efficient expression system in cell culture, it is inexplicably insufficient to induce resistance in the upper respiratory tract of primates.

(Durbin et al., Vaccine 16 : 1324-30, 1998), and, inexplicably, were insufficient to induce a protective response in the presence of passive serum antibodies (Durbin et al.
., J. Infect. Dis. 179 : 1345-51, 1999). In contrast, PIV3 and RSV vaccine candidates were found to be protective in the upper and lower respiratory tracts of non-human primates, even in the presence of passive serum antibodies (Crowe et al. , Vaccine 13 : 847-
855, 1995; Durbin et al., J. Infect. Dis. 179: 1345-51, 1999).

The use of PIV3, especially as a vector, provides further additional advantages. For example, RS
10-1000 times greater than can be achieved with viruses such as V and measles virus,
Conditions have been established to obtain high titers of PIV3 in microcarrier cultures. Also, the infectivity of RSV is unstable, which complicates propagation, shipping, storage and handling. These problems will be eliminated by the development of the PIV vectored RSV vaccine.

Importantly, the two PIV3s are candidate vaccines that are injected intranasally, namely
It has undergone extensive clinical evaluation as a BPIV3 and attenuated HPIV3 cp45 strain. It was found to be safe, immunogenic, and phenotypically stable in children and infants, respectively. Other candidate engineered vectors have not been evaluated in children and infants, and especially other available vectors have not been evaluated for intranasal administration in this age group.

Another advantage of the PIV vector system is that many attenuating mutations using HPIV3 as a model have been identified, which can be single or multiple in the backbone of the vector to obtain the desired degree of attenuation. It can be introduced. For example, specific mutations conferring an attenuated phenotype on HPIV3 cp45 have been identified by direct sequence analysis and introduction into wild-type recombinant virus. Additional attenuating mutations have been developed by "importing" the attenuating point mutations from Sendai virus and RSV.

In some cases, it is possible to introduce a point mutation into the recombinant virus using a change of two nucleotides instead of one, which stabilizes the mutation upon reversion to wild type. It was Loss of C, D and V ORF expression was shown to attenuate the virus. In addition, HPIV3 and bovine (B) PIV3 chimeric viruses have been developed to use the natural host range restriction of BPIV3 in primates as a means of attenuation. It has also been shown that certain sequence combinations weaken the replacement of the ectodomains of HPIV3 HN and F, for example, by their HPIV2-derived counterparts. As a result, there is a huge list of PIV attenuating mutations that can attenuate the backbone of the vector as desired.

Thus, an aspect of the invention disclosed herein is that recombinant PI selected as a vector for expressing one or more protective antigens of a heterologous pathogen as an excess gene.
Regarding the method of using V. The heterologous pathogens described herein include heterologous PIV, measles virus, and RSV. In the above example, rHIPV3 was engineered as a vector to express up to three separate, excess gene inserts, each expressing different viral protective antigens.

Furthermore, rHIPV3 was readily housed in inserts that were fully assembled of at least 50% of the wild type genome in length. Constacts are the backbones of several different PIV vectors, namely: HPIV3 wild type; HPIV3 with the N ORF replaced by that of BPIV3.
Attenuated version of HPIV3; HPIV3-1 chimeric virus in which HN and F ORF of HPIV3 have been replaced by their counterparts from HPIV1; HPIV3-attenuated by the presence of three independent attenuating cp45 point mutations in one gene 1; and BPIV3 in which the HN and F genes were replaced by their counterparts from HPIV3.

The three vectors with one or more excess genes replicate efficiently in vitro, which shows their potential for commercial development, and they replicate and the vector and insert, It induced a strong immune response in vivo against both. In this way, it is possible to construct a single recombinant PIV-based virus which is capable of inducing an immune response against at least four pathogens, ie the PIV vector itself and the pathogen which means an excess of genes.

A second aspect of the invention is to use the superior properties of PIV as a vaccine and vector against RSV. RSV is a less proliferative pathogen than PIV, is unstable, and tends to induce a less protective immune response for reasons that have not been fully understood. The development of a live attenuated RSV vaccine has taken over 35 years, indicating that for this human pathogen it is difficult to achieve a proper balance between immunogenicity and attenuation. Thus, there are unavoidable reasons for developing live attenuated RSV vaccines that are not based on infectious RSV. The major protective F and G antigens of RSV are expressed as an excess gene from the PIV vector, in which case it is clear that BPIV3 is required to generate a live attenuated vaccine based on infectious RSV .

A third aspect described herein is a PI having determinants of different PIV serotypes.
It was to develop a vector based on V. This is a common PIV altering protective antigenic determinant since there is essentially no cross-protection between serotypes.
It makes it possible to develop methods for immunization over time with vectors.
Thus, a single attenuated PIV vector with excess gene as described above, for example from rHPIV3, can be used for the first immunization. Preferably 4 to 6 from the first time
Subsequent immunizations after a week or more may be achieved using the same PIV vector in which the glycoprotein gene is of a heterologous PIV serotype, eg, rHPIV3-1.

The vector may then contain the same excess gene, or provide different combinations, which provide boosts to the excess antigen. Second immunization is heterogeneous PIV
Since it is carried out with a vector containing glycoproteins of the serotypes of M. Alternatively, the second
Immunizations are of serotypes in which all vector genes are different, eg HPIV1 or HPUV.
It can be done with a PIV vector that is 2.

However, the advantage of using common combinations of internal genes, such as HPIV3-based rPIV3 and rPIV3-1, is that a single combination of attenuating mutations can be applied in each construct, and that of each PIV serotype. Therefore, it is not necessary to develop separately attenuated strains. Importantly, immunization over time follows a multivalent strategy: at each immunization, the vector itself induces immunity to important human pathogens, and each excess insert immunizes against additional pathogens. Induce.

While the invention has been described in detail by way of example for clarity of understanding, it will be apparent to those skilled in the art that certain changes and modifications are made in the claims, which are represented by non-limiting illustrations. Would be obvious. In this text, various publications and other references are cited within the disclosure for omission of description. Each of these references is incorporated herein by reference in its entirety for all purposes.

Deposits of Biological Materials The following materials were deposited under the American Type Culture Coll under the agreement of the Budapest Treaty.
ection (10801 University Boulevard, Manassas, VA 20110-2209). Virus Deposit Number Deposit Date p3 / 7 (131) 2G (ATCC 97989) April 18, 1997 p3 / 7 (131) (ATCC 97990) April 18, 1997 p218 (131) (ATCC 97991) April 1997 18th HPIV3 JS cp45 (ATCC PTA-2419) August 24, 2000

[Sequence list]

[Brief description of drawings]

FIG. 1A shows the insertion of the measles virus HA gene into the HPIV3 genome (Note: All figures and associated legends in this application refer to HPIV3, 5′-3 ′ positive-sense antigenomes). (Applicable to positive-sense antigenome). FIG. 1A shows a 1926 nt containing the complete open reading room of the hemagglutinin (HA) gene of the Edmonston wild type strain of measles virus engineered to express measles virus HA from an extra transcription unit. Shown is a diagram of the insert [top; not to scale]. The insert contains, in order from 5'to 3 ', the AflII site;
3699-3731 nt portion from HPIV3 antigenome with / M gene junction; three additional nt (GCG); complete measles virus HA ORF; 3594-3623 nt HPIV3 from noncoding region downstream of P gene; and It contains a second AflII site. Panel 1 of FIG. 1A shows HP with an AflII site introduced into the 3′-noncoding region of the N gene before (top) and after (bottom) measles HA ORF insertion.
The complete antigenome of the JS wild type strain of IV3 (1PIV3) is shown. Panel 2 of FIG. 1A
JS wild type strain of HPIV3 (rPIV3) having an AflII site introduced in the 3'-noncoding region of P gene before (top) and after (bottom) insertion of measles HA ORF
Shows the complete antigenome of. SEQ ID NO: 1 and SEQ ID NO: 2 are shown in Figure 1A.

FIG. 1B shows the insertion of the measles virus HA gene into the HPIV3 genome (Note: All figures and associated descriptions in this application are for HPIV3, 5′-3 ′ positive sense antigenomes. (Applicable to positive-sense antigenome). FIG. 1B is a diagram (top; not to scale) of a 2028 nt insert containing the complete ORF of the measles virus HA gene. The insert is, in order from 5 ′ to 3 ′, a StuI site; a portion of 8602 to 8620 nt from HPIV3 antigenome consisting of a non-coding sequence downstream from the HN gene and a signal of its gene end; HPIV3 intergenic conserved trinucleotide A portion of 6733 to 6808 nt derived from HPIV3 antigenome (containing a non-coding region at the start and upstream of the HN gene); HA ORF of measles virus; nt8525 of HPIV3 which is a downstream non-coding sequence derived from the HN gene ~ 85
97; and a second StuI site. Its structure is designed to regenerate the HPIV3 HN gene containing the StuI site upon insertion and direct alignment of the measles virus ORF after it is flanked by transcription signals and noncoding regions of the HPIV3 HN gene. . The complete antigenome of HPIV3 JS wild type (rPIV3) with the StuI site introduced at nt position 8600 of the 3'-noncoding region of the HN gene is shown in the next (middle) diagram. Shown below is the HPIV3 antigenome expressing the measles HA protein inserted at the StuI site. The HA cDNA used for this insertion is derived from an existing plasmid, and the Edmonstone wild type used for insertion into the N / P region and P / M region is derived from measles virus. This cDNA differs in two amino acids from the HA protein inserted in FIG. 1A, and the position of those amino acids in the measles virus HA gene is indicated by an asterisk in FIG. 1B. SEQ ID NOs: 3 and 4 are shown in Figure 1B.

FIG. 2 shows the expression of measles virus HA protein by rHPIV3 measles virus chimeric virus in LLC-MK2 cells. This figure shows that the measles HA protein is expressed by the recombinant chimeric viruses rcp45L (HA PL) and rcp45L (HA NP) and the measles virus of the Edmonstone wild type strain of measles virus, The measurement result of the radioimmunoprecipitation assay (RIPA) demonstrating that rJS is not expressed by wild type HPIV3 (rJS) is shown. Lane A-- ³⁵ S-labeled infected cell lysates were immunoprecipitated with a mixture of three monoclonal antibodies specific for HPIV3 HN protein. A 64 KD band (white arrow) corresponding to the HN protein is present in each of the three HPIV3 infected cell lysates (lanes 3, 5 and 7), but a cell lysate infected with measles virus (lane 9). ) Does not exist. This confirms that the rcp45L (HA PM) and rcp45L (HA NP) chimera is indeed HPIV3 and expresses similar levels of HA protein. Lane (b)-immunize ³⁵ S-labeled infected cell lysates with a mixture of monoclonal antibodies (79-XV-V17, 80-III-B2, 81-1-366) that recognize the HA glycoprotein of measles virus. Settled (Hummel et al., J. Virol. 69: 1913-1916 1995; Shesh
Beradaran et al., Arch. Virol. 83: 251-268, 1985, each of which is incorporated herein by reference). The 76KD band (black arrow) corresponding to HA protein is rep4
Lysate derived from cells infected with 5L (HA) chimeric virus (lanes 6 and 8) and lysate derived from cells infected with measles virus (lane 10), but lysates derived from cells infected with rJS (Lane 4), a measles virus HA gene is not present in the lysate derived from the HPIV3 wild type virus that encodes the HA gene.

FIG. 3 shows rPIV3-as an extra transcription / translation unit of HPIV2 HN gene.
1 Antigenome encoding chimeric virus or rPIV3-1 cp45 chimeric virus
Insertion into cDNA (Note: rPIV3-1 is rPIV3 in which HN gene and F gene are replaced by those of HPIV1, and rPIV3-1 cp45 is an additional 12 variants of cp45 attenuated virus) Is a variant containing). The HPIV2 HN gene was amplified from HPIV2 vRNA using RT-PCR with HPIV2 HN gene-specific primers (panel A). It has an NcoI site introduced with a primer at the 5'end and at the 3'end
The amplified cDNA containing the HindIII site was digested with NcoI-HindIII and then NcoI-H
Ligation with pLit.PIV31HNhc digested with indIII generated pLit.PIV32HNhc (panel B). Using the pLit.PIV32Hhc plasmid as a template,
A modified PIV2 HN cassette with a PpuMI site and a PpuMI site introduced at the 3'end was prepared (panel C). This cassette runs from left to right at the 5'end.
PpuMI site, partial 5'-untranslated region (VTR) of PIV3 HN, PIV2 HN ORF, PIV3
HN N 3'-VTR, PIV3 HN and gene end present at L gene junction,
It contained an intergenic region, a gene initiation sequence, a part of the 5'untranslated region of PIV3 L, and a PpuMI site introduced at the 3'end. This cDNA cassette was digested with PpuMI and then ligated to PpuMI-digested p38'ΔPIV31hc to generate p38'ΔPIV31hc.2HN (panel D). The 8.5 kb BspEI-SphI fragment was added to pFLC.2G + .hc or pFLCcp.
The final full-length antigenome cDNA, pFLC.3-1hc.2HN (panel E) or pFLC.3-1hc.cp45.2HN (panel F), was assembled into 45 individual BspEI-SphI windows.
) Was generated. pFLC.2G + .hc and pFLCcp45 are the wild-type rPIV3- described above, respectively.
1 and rPIV3cp45 are full-length antigenome clones (Skiadopoulos et al., J. Virol. 73: 1374-1381 1999a; Tao et al., J. Virol. 72: 2955-2961).
1998, these documents are incorporated herein by reference).

[Fig. 4] Fig. 4 shows rP having a PIV2 HN ORF inserted between the PIV1F gene and the HN gene.
The construction of the IV3-1.2NH chimeric virus is detailed and demonstrated. Panel A is rPIV3-1,
And rPIV3-1 containing the PIV2 HN ORF insert between the PIV1F and HN ORF of rPIV3-1.
The structural difference of 2HN is shown. Arrows indicate the approximate position of the RT-PCR primers used to amplify the fragments analyzed in panels BD. Panels B and C show rPIV3-1
The expected size of the restriction enzyme-digested fragments produced with the restriction endonucleases of PpuMI or NcoI from the RT-PCR products obtained by amplification with rPIV3-1.2HN together with the size of the base pair fragment (bp). Shown and the results are shown in panel D. vRNA extracted from virus harvested from rPIV3-1.2HN or rPIV3-1 infected LLC-MK2 cells was used as template in the presence and absence of reverse transcriptase (RT) as a template to screen cDNA fragments. Use the primer shown in A
It was amplified by PCR. The PCR fragment was absent in RT-PCR reactions lacking RT. This indicates that the template used to amplify the DNA fragment is RNA and not contaminating cDNA (lanes A and C in panel D). RPIV3-1.2H when RT step included
N vRNA (lane B) generated a fragment (lane D) that was approximately 2 KD larger than its rPIV3-1 parent indicating the presence of the 2 KD insert. Furthermore, as a result of digesting this 3 kb fragment with several different restriction endonucleases, the RT-PCR fragment (odd numbered lane) derived from rPIV3-1.2HN was rPIV3-1 parent (even numbered) to each test restriction endonuclease. It has been shown that it has a pattern different from that of the numbered lane). The number of sites obtained by each digestion and the size of the fragment were in perfect agreement with the predicted sequences of the RT-PCR products of rPIV3-1 and rPIV3-1.2HN. A representative example is provided. First, digestion of the RT-PCR product from rPIV3-1.2HN with PpuMI (lane 1) yielded three bands of the expected size, indicating the presence of two PpuMI sites, and rPIV3- RT from 1
-As a result of digesting the PCR product with PpuMI, it shows that there is only one PpuMI site.
Two bands of the expected size were generated for rPIV3-1 (lane 2). Second, the result of digesting the RT-PCR product from rPIV3-1.2HN with NcoI (lane 5), HPIV
Generated four bands containing a 0.5 kb fragment representing the 2 HN gene, and r
The RT-PCR product from PIV3-1 was digested with NcoI (lane 6), resulting in the expected two fragments. M indicates the lane containing a 1 kb DNA ladder (Lite Technology) used as a nucleotide (nt) size marker. Similar results were obtained, confirming the presence of the HPIV2 HN insert in rPIV3-1cp45.2HN.

FIG. 5 demonstrates that rPIV3-1.HN expresses HPIV2 HN protein. LLC-MK
Two monolayers were infected with rPIV3-1, rPIV3-1.2HN or PIP2 / V94 wild type virus at MOI5. Infected monolayers were labeled with a mixture of ³⁵ S-met and ³⁵ S-cys 18-36 hr post infection. Cells were harvested, lysed and the protein was labeled with anti-HPIV2 HN mAb 150.
Immunoprecipitation with S1 (Durbin et al., Virology, 261: 319-330 1999; Tsurudom
e et al., Virology, 171, 38-48, 1989; these references are incorporated herein by reference. The immunoprecipitated samples were denatured, separated on a 4-12% SDS PAGE gel and autoradiographed (lane 1: rPIV3-1; lane 2: rPIV3-1.2HN).
, Lane 3: PIV2 / V9412-6). The mAb specific for HPIV2 HN is rPIV3-1.
2HN and PIV2 / V94 infected proteins from LLC-MK2 cells were precipitated,
Proteins from cells infected with rPIV3-1 were not precipitated. The predicted size of the HPN2 HN protein is 86 KD (Rydbeck et al., J. Gen, Virol. 69: 931-935 19).
In 1988, this document is incorporated into the present application).

FIG. 6 shows the position and organization of the insert of the gene unit (GU) or the extension of the 3′-noncoding region (NCR) of the HN gene. GU and NC
R The nucleotide sequence of each insertion site and the unique restriction enzyme cloning sites are shown in Panels A and B. A cis-acting transcription signal sequence or gene end (GE),
The intergenic (IG) and gene start (GS) signal sequences are shown. Panel A of FIG.
Contains the HN inserted at the introduced StuI restriction site (underlined nucleotides).
Shown are the oligonucleotide duplexes that identify the GE, IG and GS signal sequences and unique restriction enzyme recognition sequences (see Figure 1 for the location of the introduced StuI site.
B and Example I). Hp restriction fragments derived from RSV antigenome plasmid
It was cloned into the aI site. If desired, a short oligonucleotide duplex was inserted at the MluI site of the multiple cloning site so that the total length of the insert would fit the rule of 6. In FIG. 6, panel B, the 3'-NCR insert of the HN gene was cloned into the HpaI site of the 32 nt multiple cloning site shown in the figure, cloned into the StuI restriction site described in FIG. 6 panel A. . The inserted sequence was made to fit rule 6 by inserting a short oligonucleotide duplex into the MluI site of the multiple cloning site. SEQ ID NOs: 5 and 6 are shown in FIG.

FIG. 7 shows the open reading frame (ORF) within the 3079 bp RSV insert. Six possible reading frames in the 3079 bp RSV fragment are shown (three at each orientation; 3,2,1, -1, -2, -3). The short bar indicates the translation start codon. The long bar indicates the translation stop codon. The 3079 bp fragment was HN 3 ′ in the orientation corresponding to the reading frames of -3, −2 and −1 in the figure, which were encountered in the PIV3 translation machinery.
A gene unit (GUins) in NCR (NCRins) or between HN and L genes
Inserted as. These reading frames do not produce functional proteins as they contain multiple stop codons over the entire length of the sequence.

FIG. 8 shows that the rPIV3 insert and extension mutants contain inserts of the appropriate size. RT-PCR was performed using a PIV3-specific primer pair flanking the insertion site and the RT-PCR products were then separated by agarose gel electrophoresis. The expected size of the RT-PCR fragment for rPIV3wt (also called rJS) is
3497 bp, the expected size of each of the other rPIV3 GU or NCR variants increases in length with insert size. Panel A, GU insert (ins) variant: 1. r
PIV3wt; 2.r168ntGUins; 2.r678ntGUins; 3.r996ntGUins; 4.r1428ntGUins;
5. r1908ntGUins; 6. Indicates r3918ntGUins. M represents the digestion product of λ phage DNA with HindIII restriction enzyme. The size of the relevant size markers are indicated.
Panel B shows NCR insertion mutants: 1. rPIV3wt; 2. r258ntNCRins; 3. r972ntNCRins
4. r1404ntNCRins; 5. r3126ntNCRins; 6. r3894ntNCRins. M represents the digestion product of λ phage DNA with HindIII restriction enzyme. The size of the relevant size markers are indicated.

FIG. 9A shows multi-step growth curves of insertion mutants of GU and NCR compared to rHPIV3wt and rcp45L. LLC-MK2 monolayer in a 6-well plate on each HPIV3,
The cells were infected 3 times each with a multiplicity of infection (moi) of 0.01, and the supernatant of the virus was removed, followed by washing 4 times. At 0 hr post infection and at 24 hr intervals, 0.5 ml of virus medium was harvested from each well for 6 days and then 0.5 ml of fresh medium was added to each well. The harvested samples were stored at -80 ° C. The virus present in these samples was
Quantitation was performed by titrating LLC-MK2 monolayers in 96-well plates incubated at ° C. The virus titer is expressed as TCID ₅₀ / ml. 3 obtained from the experiment
The average value of 4 independent infections is shown. The lower limit of detection is 0.7 log ₁₀ TCID ₅₀ / ml. FIG. 9A shows a GU insertion mutant.

FIG. 9B   FIG. 9B is the same as FIG. 9A but shows NCR insertion mutants.

FIG. 9C   FIG. 9C is the same as FIG. 9A, but shows the cp45L / GU insertion mutant.

FIG. 10 illustrates a method for placing an extra gene insert between the P and M genes of rHPIV3. The downstream (3 ') NCR of the rHPIV3 P gene is
ic) was modified to include an AflII restriction site at sequence positions 3693-3698 (Durb
in), J. Virol. 74: 6821-31, 2000, incorporated herein by reference). This site then inserts an HPIV3 cis-acting transcriptional signal sequence, an oligonucleotide duplex (shown above) containing gene ends (GE), intergenic (IG) and gene start (GS) motifs (motif). Used to The duplex also contains a series of restriction enzyme recognition sequences available for insertion of foreign ORFs. HPIV1 and HP
In the case of the IV2 HN ORF, the cloning sites were NcoI and HindIII. Insertion of the foreign ORF into the multiple cloning site puts it under the control of a set of HPIV3 transcription signals, so that in the final recombinant virus, the gene
Transcribed by a polymerase into another mRNA. When required, a short oligonucleotide duplex was inserted into the MluI site of the multiple cloning site and regulated so that the final length of the genome was even a multiple of 6, which was required for efficient RNA replication. (Calain et al., J. Virol. 67: 4822-30, 199).
3; Durbin et al., Virology 234: 74-83, 1997b). In positions 1677-1682 9,
A similar method was used to place the HPIV1 and HPIV2 gene inserts between the N and P genes of rHPIV3 using the introduced AflII restriction site (SEQ ID NO.7).

FIG. 11. Genomic (out-of-scale) of a series of chimeric rHPIV3s containing one, two or three extra gene inserts, each of which encodes a protective antigen of PIV1, PIV2 or measles virus. It is a figure. A schematic diagram (not to scale) of rHPIV3 shows HN (of HPIV1 () or HPIV2 () inserted in rHPIV3 main chain ().
Hemagglutinin-neuraminidase) glycoprotein or measles virus ()
Figure 3 shows the relative position of the added inserts encoding the HA (hemagglutinin) glycoproteins. The rHPIV3 construct illustrated at the bottom shows the 3918-nt insert (GU)
, Which does not encode the protein () (Skiadopoulos (Skiado
poulos) et al., Virology 272: 225-34, 2000, incorporated herein by reference). Each exogenous insert is under the control of a set of HPIV3 gene start and gene end transcription signals and is expressed as a separate mRNA. a. LLC-MK2 monolayers on 6-well plates (Costar) were separately infected in triplicate with each of the indicated viruses at a moi of 0.01. The supernatant is 5 days, 6 days and 7 days
Virus was collected daily and quantified as described above (Skiadpoulos (Sk
iadopoulos) et al., Virology 272: 225-34, 2000). The average peak titer obtained for each virus is shown as log ₁₀ TCID ₅₀ / ml. b. Average of two experiments. Serially diluted virus was incubated in LLC-MK2 monolayer cultures at 32 ° C and 39 ° C for 7 days, and the presence of virus was determined by haematopoiesis using guinea pig erythrocytes. Shown is the average titer loss at 39 ° C compared to 32 ° C.

Figure 12 is extra RHPIV3 backbone gene insert, HPIV3 N ORF provides (here FIG (not to scale) illustrating the insertion into rHPIV3-N _B, in its BPIV3 counterpart Has been replaced), which confers an attenuated phenotype due to host range restriction (
Bailly et al., J. Virol. 74: 3188-3195, 2000a, incorporated herein by reference). rHPIV3 (top) and biologically derived BPIV
A brief description of 3 (bottom) is shown. Kansas of BPIV3 in the main chain of PIV3 (Kansa
The relative positions of the N ORF sequence () and the measles virus hemagglutinin gene () derived from the s) strain are shown. In each case, the exogenous sequence is under the control of a set of HPIV3 transcription signals. A portion of the plasmid vector containing the NgoMIV site is shown (). Names are given for the antigenomic cDNA clones (left) and their encoded recombinant viruses (right).

FIG. 13: RSV G as an additional extra gene in the promoter-proximal position.
Or, describe the insertion of F into the genome of rB / HPIV3. rB / HPIV3 is BPIV3 F and HN
BPIV3 in which genes have been replaced by their HPIV3 counterparts (F _H and HN _H, respectively)
Is a recombinant version of. The BlpI site is located in B / immediately upstream of the ATG start codon of the N ORF.
Made in the HPIV3 backbone. RSV G or F open reading frame (ORF)
It was inserted into this BlpI site. The downstream ends of both RSV inserts contain the intergenic sequence CTT.
Was designed to contain the PIV3 gene end (GE) and gene start (GS) sequences (AAGTAAGAAAAA (SEQ ID NO.8) and AGGATTAAAG, respectively, in positive sense) separated by. Each insert also contained a NheI site that could serve as an insertion site for additional extra genes. AGGATTAAAGAACTTTACCGAAAGGTAAGG
GGAAAGAAATCCTAAGAGCTTAGCGATG (SEQ ID NO: 9). GCTTAGCGATG (SEQ ID NO: 10
). AAGCTAGCGCTTAGC (SEQ ID NO: 11). GCTTAGCAAAAAGCTAGCACAATG (SEQ ID NO: 12).

FIG. 14 illustrates multicycle replication of rB / HPIV3-G1, rB / HPIV3-F1 and their recombinant and biological parental viruses in monkey LLC-MK2 cells. Triplicate monolayer cultures were treated with rB / HPIV3-G1, rB / HPIV3-F1 or the following control viruses: rBPIV3 K
a (recombinant version of BPIV3 strain Ka); rB / HPIV3 (version of rBPIV3 in which the BPIV3 F and HN glycoprotein genes have been replaced by their HPIV3 counterparts); HPIV3 J
S (biologically-derived HPIV3 strain JS); and BPIV3 Ka (biologically-derived version of BPIV3 strain Ka) were used at an input MOI of 0.01 TCID ₅₀ per cell. Viral titers are presented as the mean log ₁₀ TCID ₅₀ / ml of triplicate samples. The lower limit of detection for this assay is 10 ^1.45 TCID ₅₀ / ml.

FIG. 15 is a genome representation (not to scale) of rBPIV3 (# 1) and a series of chimeric rB / HPIV3 (# 2-6), HPIV3 (# 2) or HPIV1 (# 3-6). ) Gene for BPIV3 F
And one or two extra gene inserts containing substitutions of the HN gene
Code F and / or HN ORF of IV2 (# 4-6). A schematic description of the rB / HPIV3.1 chimeric virus (not to scale) shows the relative positions of the extra genes encoding the F or HN glycoprotein of HPIV2 (F2 and HN2, respectively). Each exogenous insert is under the control of a set of HPIV3 gene start and gene end transcriptional signals and is designed to be expressed as a separate mRNA.

FIG. 16 provides a diagram (not to scale) illustrating the insertion of the measles virus HA coding sequence into several different rPIV3 backbones. Three backbones are depicted: wild-type rHPIV3 (top construct); HPIV3 F and HN glycoprotein genes have been replaced by genes for HPIV1, wild-type rHPIV3-1 (second from top). Structure) (Tao (T
ao) et al., J. Virol. 72: 2955-2961, 1998, incorporated herein by reference); and containing three attenuated amino acid point mutations in the L gene derived from the cp45 vaccine strain. RHPIV3-1cp45L (the third derivative of wild-type rHPIV3-1)
(Skiadopoulos et al., J. Virol. 72: 1762-8, 19)
98, incorporated herein by reference). The relative positions of the HPIV1 F and HN ORF sequences () and the measles virus HA gene () in the rPIV3 backbone () are indicated. In each case, each foreign ORF is under the control of a set of HPIV3 transcription signals. The relative arrangement of three cp45 L amino acid point mutations in the L gene is shown (*). A portion of the plasmid vector containing the unique NgoMIV site is shown ().

FIG. 17 shows the construct of PIV3-PIV2 chimeric antigenomic cDNA pFLC.PIV32hc encoding full-length PIV2 HN and F proteins. A cDNA fragment containing the full length PIV2 F ORF flanked by the indicated restriction sites (A1) was amplified from PIV2 / V94 vRNA using RT-PCR and PIV2 F specific primer pairs (22nd Table 1, 2). This fragment was digested with Ncol and BamHI (C1) and ligated into the Ncol-BamHI window of pLitPIV31.fhc (B1) resulting in pLit.PIV32Fhc (D1). In parallel, a cDNA fragment containing the full length PIV2 HJN ORF flanked by the indicated restriction sites (A2) was detected in RT-PC.
Amplified from PIV2 / V94 vRNA using R and PIV2 HN-specific primer pairs (
22 Tables 3 and 4). This fragment was digested with Ncol and HindIII (C2), pLitPIV31.HNh
Bound to the Ncol-HindIII window of c (B2), resulting in pLit.PIV32HNhc (D2).
pLit.PIV32Fhc and pLit.PIV32HNhc were digested with PpuMI and SpeI and assembled together to yield pLit.PIV32hc (E). pLit.PIV32hc also contains BspEI and SpeI
Digested with p38'ΔPIV31hc (F) and introduced into the BspEI-SpeI window, p38'Δ
This gave rise to PIC32hc (G). The chimeric PIV3-PIV2 construct was introduced into the BspEI-Sphl window of pFLC.2G + hc, yielding pFLC.PIC32hc (H).

FIG. 18: Full length PIV3-PIV2 chimeric antigenomic cDNAs pFLC.PIV32TM and pFLC.PIV
Figure 32 shows the construct of 32TMcp45, which encodes F and HN proteins, including PIV2-derived ectodomain and PIV3-derived transmembrane and cytoplasmic domains. PIV3 F ORF in pLit.PIV3.F3a (A1) encoding ectodomain
Region was deleted by PCR using a PIV3 F-specific primer pair (C1) (22nd
9 and 10 in the table). The region of the PIV2 F ORF, which encodes the ectodomain, contains PCR and PIV2
Amplified from pLit.PIV32Fhc (B1) using F-specific primer pair (5 in Table 22,
6). The two resulting fragments (C1 and D1) were ligated to generate pLit.PIV32FTM (E1). In parallel, PI in pLit.PIV3.HN4 (A2), encoding the ectodomain
A region of the V3 HN ORF was deleted by PCR using a PIV3 HN-specific primer pair (
C2) (11, 12 in Table 22). The region of the PIV2 HN ORF encoding the ectodomain is PC
It was amplified from pLit.PIV32HNhc (B2) by the R and PIV2 HN specific primer pair (8, 9 in Table 22). These two DNA fragments (C2 and D2) are ligated together and p
This gave rise to Lit.PIV32HNTM (E2). pLit.PIV32FTM and pLit.PIV32HNTM were digested with PpuMI and SpeI and assembled to give pLit.PIV32TM (F). The BspEI-SpeI fragment from pLit.PIV32TM was ligated into the BspEI-SpeI window of p38'_PIV31hc (G),
This resulted in 38'_PIV32TM (H). The insert containing the chimeric PIV3-PIV2 F and HN is 6.5 kb
As a BspEI-SphI fragment of pFLC.2G + hc and pFLCcp45 into the BspEI-SphI window of pFLC.PIV32TM and pFLC.PIV32TMcp45 (I), respectively.

Figure 19: Full-length PIV3-PIV2 chimeric antigenomic cDNAs pFLC.PIV32CT and pFLC encoding F and HN proteins, including PIV2-derived ectodomain, PIV2-derived transmembrane domain and PIV3-derived cytoplasmic domain. Shows the construction of .PIV32Ctcp45. PIV3 in pLit.PIV3.F3a (A1), encoding ectodomain and transmembrane domain
Region of F ORF was deleted by PCR with PIV3 F specific primer pair (C1)
(17, 18 in Table 22). PIV2 FO encoding ectodomain and transmembrane domain
The region of RF was amplified from pLit.PIV32Fhc (B1) using PCR and PIV2 F specific primer pairs (13, 14 in Table 22). The two resulting fragments (C1 and D1) were ligated to generate pLit.PIV32FCT (E1). In parallel, the region of the PIV3 HN ORF in pLit.PIV3.HN4 (A2) encoding the ectodomain and transmembrane domain was deleted by PCR with the PIV3 HN-specific primer pair (C2) (22nd). Tables 19 and 20). Regions of the PIV2 HN ORF encoding the ectodomain and transmembrane domain were amplified from pLit.PIV32HNhc (B2) by PCR with a PIV2 HN-specific primer pair (Table 15, 15 and 16). These two DNA fragments (C2 and D2) are ligated together and pLit.PIV32HNC
This gave rise to T (E2). pLit.PIV32FCT and pLit.PIV32HNCT were digested with PpuMI and SpeI and assembled to give pLit.PIV32CT (F). BspEI-SpeI from pLit.PIV32CT
The fragment was ligated into the BspEI-SpeI window of p38'_PIV31hc (G) to give p38'_PIV32CT (
H) occurred. The insert containing the chimeric PIV3-PIV2 F and HN is a 6.5 kb BspEI-SphI
Introduced as a fragment into the BspEI-SphI window of pFLC.2G + .hc and pFLC.cp45,
This resulted in pFLC.PIV32CT and pFLC.PIV32CTcp45 (I), respectively.

FIG. 20 shows the gene structure of PIV3-PIV2 chimeric virus and rPIV3-2CT and rPIV3-.
The gene junction sequence for 2TM is detailed. Panel A shows the genetic structure of the rPIV3-2 chimeric virus (3 middle panels) compared to that of the rPIV3 (top panel) and rPIV3-1 (bottom panel) viruses. The cp45 derivative is indicated with an arrow indicating the relative position of the cp45 mutation. For the cp45 derivative, the rest of the genes, all from PIV3, remain the same, only the F and HN genes differ. From top to bottom, the three chimeric PIV3-PIV2 viruses have reduced levels of the PIV3 glycoprotein gene. Note that rPIV3-2 with complete PIV2 HN and F ORF was not recoverable. Panel B is a chimera for rPIV3-2TM given with protein translation
The nucleotide sequences of the junctions of the F and HN glycoprotein genes are provided. The shaded area indicates the sequence from PIV2. Amino acids are numbered with respect to their position in the corresponding wild type glycoprotein. Three extra nucleotides were inserted into PIV3-PIV2 HN ™ as indicated, making the construct obey rule of 6. Panel C, rPIV3, given with protein translation
2 shows the nucleotide sequence of the junction of the chimeric F and HN glycoprotein genes for -2CT. The shaded area indicates the sequence from PIV2. Amino acids are numbered with respect to their position in the corresponding wild type glycoprotein. GE
= Gene ends; I = intergenic; GS = gene start; ORF = open reading frame; TM = transmembrane domain; CT = cytoplasmic domain; * = stop codon.

FIG. 21. rPIV3-2 compared to that of rPIV3 / JS and PIV2 / V94 wild type parent virus.
The multi-cycle replication of the chimeric virus is detailed. Panel A‐rPIV3-2TM and rPIV3-2TMc
The p45 virus was used with rPIV3 / JS and PIV2 / V94 wt parental viruses to infect LLC-MK2 cells in triplicate wells in 6 well plates at a MOI of 0.01, respectively. All cultures were incubated at 32 ° C. After an adsorption time of 1 hour, the inoculum was removed and the cells were washed 3 times with serum-free OptiMEM. The culture was covered with 2 ml of the same medium per well. For rPIV3-2TM and rPIV3-2TM cp45 infected plates, 0.5 mg / ml p-trypsin was added to each well. Aliquots of 0.5 ml were taken from each well for 6 days at 24-hour intervals and snap frozen on dry ice, -80
Stored at ° C. As indicated above, each aliquot was replaced with 0.5 ml of fresh medium with or without p-trypsin. 32 viruses that are present in the aliquot
Titers were performed on liquid-covered LLC-MK2 plates for 7 days at ℃ and the end point was confirmed using hematocyte adsorption. Panels B‐rPIV3-2CT and rPIV3-2CTcp45 show rPIV3 / JS and P
Used with IV2 / V94 wt parental virus to infect LLC-MK2 in 6-well plates in triplicate, as described in panel A. Aliquots were taken and processed in the same manner as described in Panel A. Viral titers are expressed as log ₁₀ TCID ₅₀ / ml ± standard error for both experiments shown in panels A and B.

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁷ Identification code FI theme code (reference) A61K 48/00 A61P 37/02 A61P 37/02 C12N 7/00 C12N 7/00 C12R 1:93 // ( C12N 7/00 C12N 15/00 ZNAA C12R 1:93) (31) Priority claim number 09 / 459,062 (32) Priority date December 10, 1999 (1999.12.10) (33) Priority Claiming country United States (US) (81) Designated country EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE, TR), OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, MZ) , SD , SL, SZ, TZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AE, AG, AL, AM, AT, AU, AZ, BA, BB , BG, BR, BY, BZ, CA, CH, CN, CR, CU, CZ, DE, DK, DM, DZ, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MA, MD, MG, MK, MN, MW, MX, MZ , NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, TZ, UA, UG, US, UZ, VN, YU, ZA, ZW (72) Inventor Schmid, Alexander Sea. Washington, D., USA. C. 20009, Northwest, Belmont Road 1831 # 203 (72) Inventor Durbin, Annapie. Maryland 20912, Tacoma Park, Hudson Avenue 806 (72) Inventor Skiadpoulos, Mario H. USA. Akwact Road, Potomac 20854, Maryland, USA 8303 (72) Inventor Tao, Tao Maryland 20814, Weymouth Street, Bethesda, USA 10684 # 104 F term (reference) 4B024 AA01 BA31 CA04 DA02 EA02 FA02 GA11 HA17 4B065 AA95X AA95Y AA99Y AB01 BA02 CA24 CA45 4C084 AA13 BA35 CA01 NA11 NA14 ZB072 4C085 AA02 BA51 BA58 BA69 BA78 BA83 CC08 EE01 GG01 [Continued Summary], where the chimeric virus is a vaccine due to either mutations introduced into the chimeric ket or antigenome and nucleotide modifications Attenuated for use as a drug.

Claims (179)

[Claims] 1. A major nucleocapsid (N) protein, a nucleocapsidrin protein (P), a large polymerase protein (L), and one or more heterologous pathogens to form a chimeric parainfluenza virus (PIV) genome or antigenome. Isolated infectious chimeric influenza virus (PIV) comprising a partial or complete PIV vector genome or antigenome combined with one or more heterologous genes or genomic segments encoding one or more antigenic determinants of . 2. The extra gene adjacent to or within the non-coding region of the partial or complete PIV vector genome or antigenome, wherein the one or more heterologous genes or genomic segments encoding the antigenic determinant. Alternatively, the chimeric PIV according to claim 1, which is added as a genome segment. 3. The one or more heterologous genes or genome segments encoding the antigenic determinants are replaced by one or more counterpart genes or genome segments in the partial PIV vector genome or antigenome. Chimera PIV. 4. The one or more heterologous pathogens is a heterologous PIV, and the heterologous gene or genome segment is one or more PIV N, P, C, D, V, M, F, HN.
And / or L protein or a fragment thereof encoding the chimera according to claim 1.
PIV. 5. The vector genome or antigenome is partially or completely human PI.
The chimeric PIV of claim 1, which is a V (HPIV) genome or antigenome, and wherein the heterologous gene or segment encoding the antigenic determinant is of one or more heterologous PIVs. 6. The chimeric PIV of claim 5, wherein the one or more heterologous PIVs are selected from HPIV1, HPIV2 or HPIV3. 7. The vector genome or antigenome is a partial or complete HPIV genome or antigenome, and the heterologous gene or genome segment encoding the antigenic determinant is of one or more heterologous HPIVs. Chimera described
PIV. 8. The vector genome or antigenome is partially or completely HPIV3.
The chimeric PIV of claim 7, which is a genome or antigenome, and wherein the heterologous gene or genome segment encoding the antigenic determinant is of one or more heterologous HPIVs. 9. One or more genes or genomic segments encoding one or more antigenic determinants of HPIV1 selected from HPIV1 HN and F glycoproteins and antigenic domains, fragments and epitopes thereof, wherein said part or complete The chimeric PIV according to claim 8, which is added to or substituted within the HPIV3 genome or antigenome. 10. The vector genome or antigenome is partial or complete HPIV
9. The chimeric PIV according to claim 8, which is 3 JS genome or antigenome, and wherein the heterologous gene or genome segment encoding the antigenic determinant is of one or more heterologous HPIV. 11. One or more genes or genomic segments encoding one or more antigenic determinants of HPIV1 selected from HPIV1 HN and F glycoproteins and antigenic domains, fragments and epitopes thereof, wherein said part or complete HPIV3
The chimeric PIV according to claim 10, which is added to or substituted within the JS genome or antigenome. 12. Both HPIV1 genes encoding HN and F glycoproteins are partially
HPIV3 vector Genome or Antigenome counterpart HPIV3 HN and
The chimeric PIV according to claim 9, which is substituted by the F gene. 13. The chimeric genome or antigenome is Tyr942 of JS cp45,
L protein at the position corresponding to Leu992 or Thr1558; residues Val96 or S of JS cp45
N protein at position corresponding to er389; amino acid substitution in C protein at position corresponding to Ile96 of JS cp45, 3'leader sequence of chimeric virus at position corresponding to nucleotides 23, 24, 28 or 45 of JS cp45 Nucleotide substitutions in,
And / or incorporating at least one and the total number of attenuating mutations present in PIV3 JS cp45 selected from mutations identifying mutations in the N gene start sequence at a position corresponding to nucleotide 62 of JS cp45 The chimeric PI according to claim 9.
V. 14. The method of claim 8, wherein one or more genes or genomic segments encoding one or more antigenic determinants of HPIV2 are added to or integrated within a partial or complete HPIV3 genome or antigenome. Chimera PIV. 15. Whether one or more HPIV2 genes or genome segments encoding one or more HN and / or F glycoproteins or antigenic domains, fragments or epitopes thereof are added to a partial or complete HPIV3 vector genome Alternatively, the chimeric PIV according to claim 14, which is incorporated therein. 16. The method of claim 6, wherein many heterologous genes or genomic segments encoding multiple heterologous PIV antigenic determinants are added to or integrated within the partial or complete HPIV vector genome or antigenome. Chimera PIV. 17. A number of heterologous genes or genomic segments encoding antigenic determinants from both HPIV1 and HPIV2 are added to or integrated within the partial or complete HPIV vector genome or antigenome. Chimera described in 16
PIV. 18. One or more HN and / or F glycoproteins or antigenic domains, one or more HPIV1 genes or genomic segments encoding a fragment or epitope thereof, and one or more HN and / or F glycoproteins. Or one or more HPIV2 genes or genomic segments encoding antigenic domains, fragments or epitopes thereof, added to or integrated within said partial or complete HPIV3 vector genome or antigenome. Chimera PIV. 19. Both HPIV1 genes encoding HN and F glycoproteins are HPIV
In order to form a chimeric HPIV3-1 vector genome or antigenome which is further modified by the addition or integration of one or more genes or gene segments encoding one or more antigenic determinants of 2, the counterpart HPIV3 HN and 19. The chimeric PIV according to claim 18, which is replaced by the F gene. 20. HPIV2 HN gene open reading frame (ORF)
20. The chimeric PIV of claim 19, wherein the transcription unit comprising is added to or integrated within the chimeric HPIV3-1 vector genome or antigenome.
. 21. The chimeric PIV according to claim 20, which is selected from rPIV3-1.2HN or rPIV3-1cp45.2HN. 22. The vector genome or antigenome is a partially or fully human PIV (HPIV) genome or antigene, and the heterologous pathogen is measles virus, RS virus of subgroups A and B, pandemic ears. Mumps virus, human papilloma virus, type 1 and 2 human immunodeficiency virus, herpes simplex virus, cytomegalovirus, rabies virus, Epstein-Barr virus, filoviruses, bunyaviruses, flaviviruses ( The chimeric PIV according to claim 1, which is selected from flaviviruses, alphaviruses and influenza viruses. 23. The measles virus HA and F proteins, the RS virus F, G, SH and M2 proteins of subgroup A or B, wherein said one or more heterologous determinants are:
Mumps virus HN and F proteins, human papilloma virus L1 protein, type 1 or 2 human immunodeficiency virus gp160 protein, herpes simplex virus and cytomegalovirus gB, gC, gD, gE, gG, gH, gI , gJ, gK, gL and gM
Proteins, rabies virus G proteins, Epstein-Barr virus gp350 proteins, filovirus G proteins, buniavirus G proteins, flavivirus pre-M, E and NS1 proteins, and alphavirus E proteins and their antigenic domains, fragments and epitopes Claim 22 selected from
The described chimeric PIV. 24. The partial or complete HP of the vector genome or antigenome
IV3 genome or antigenome, or heterologous HPI added or integrated therein
Chimeric HPI comprising partial or complete HPIV3 genome or antigenome with one or more genes or genome segments encoding one or more antigenic determinants of V
The chimeric PIV according to claim 22, which is a V genome or an antigenome. 25. The heterologous pathogen is measles virus, and the heterologous antigenic determinants are measles virus HA and F proteins and antigenic domains thereof,
25. The chimeric PIV of claim 24, selected from fragments and epitopes. 26. The chimera according to claim 25, wherein a transcription unit comprising the open reading frame (ORF) of the measles virus HA gene is added to or integrated into the HPIV3 vector genome or antigenome. PIV. 27. rPIV3 (HA HN-L), rPIV3 (HA NP), rcp45L (HA NP), rP
The chimeric PIV according to claim 26, which is selected from IV3 (HA PM) or rcp45L (HA PM). 28. A partial or complete HPIV3 genome, wherein the vector genome or antigenome has one or more genes or genome segments encoding one or more antigenic determinants of HPIV1 added or integrated therein. 25. The chimeric PIV according to claim 24, which is a chimeric HPIV genome comprising an antigenome or an antigenome. 29. The heterologous pathogen is measles virus, and the heterologous antigenic determinants are measles virus HA and F proteins and antigenic domains thereof,
26. The chimeric PIV of claim 25 selected from fragments and epitopes. 30. HPIV3 H in which a transcription unit comprising the open reading frame (ORF) of the measles virus HA gene is replaced by HN and F ORF of HPIV1.
30. The chimeric PIV of claim 29, which is added to or integrated into the HPIV3-1 vector genome or antigenome with both N and F ORFs. 31. The chimeric PIV according to claim 30, which is selected from rPIV3-1 HA _PM or rPIV3-1 HA _PM cp45L. 32. The chimera of claim 1, wherein the partial or complete PIV vector genome or antigenome is combined with one or more extraheterologous genes or genome segments to form a chimeric PIV genome or antigenome. PIV. 33. The vector genome or antigenome is partially or completely HPIV.
3 genomes or antigenomes, and wherein said one or more extra heterologous genes or genome segments are HPIV1 HN, HPIV1 F, HPIV2 HN, HPIV2 F, measles HA and / or
33. The chimera according to claim 32, which is selected from translationally silent synthetic gene units.
PIV. 34. The chimeric PIV according to claim 33, wherein one or both of the HPIV1 HN and / or HPIV2 HN ORF is inserted into the HPIV3 vector genome or antigenome, respectively. 35. The chimeric PIV according to claim 33, wherein the HPIV1 HN, HPIV2 HN and measles virus HA ORF are inserted between N / P, P / M and HN / L genes, respectively. 36. The HPIV1 HN and HPIV2 HN genes are inserted between the N / P and P / M genes, respectively, and the 3918-ntGU insert is added between the HN and L genes. The described chimeric PIV. 37. rHPIV3 1HN_NP, rHPIV3 1HN_PM, rHPIV3 2HN_HP, rHPIV3
2HM_PM, rHPIV3 1HN_NP 2HN_PM, rHPIV3 1HN_NP 2HN_PM HA_HN-L And rHPIV3 1HN _NP  2HN_PM 3918GU_HN-L34. The chimeric PIV of claim 33 selected from 38. A method comprising a protective antigen from 1, 2, 3 or 4 pathogens.
The chimeric PIV described in 32. 39. The chimeric PIP according to claim 32, comprising protective antigens from 1 to 4 pathogens selected from HPIV3, HPIV1, HPIV2 and measles virus. 40. The one or more extraheterologous genes or genomic segments comprise 30% to 5% of the total length of the exogenous sequence compared to the wild type HPIV3 genome length of 15,462 nt.
33. The chimeric PIV of claim 32, which adds to 0% or more of the recombinant genome or antigenome. 41. A chimeric PI wherein said one or more extra heterologous genes or genomic segments show at least a 10-100 fold reduction in upper and / or lower airways.
33. The chimeric PIV of claim 32, which identifies the attenuated phenotype of V. 42. The chimeric PIV according to claim 1, wherein the vector genome or antigenome is a human-bovine chimeric PIV genome or antigenome. 43. The human-chimeric vector genome or antigenome is measles virus, RS virus of subgroups A and B, mumps virus, human papilloma virus, type 1 and 2 human immunodeficiency virus. 1 or encoding one or more antigenic determinants of a heterologous pathogen selected from, herpes simplex virus, cytomegalovirus, rabies virus, Epstein-Barr virus, filovirus, buniavirus, flavivirus, alphavirus and influenza virus. 43. The chimeric PIV of claim 42 combined with a plurality of heterologous genes or genomic segments. 44. The chimeric PIV of claim 42, wherein the vector genome or antigenome comprises a partial or complete HPIV genome or antigenome combined with one or more heterologous genes or genome segments from BPIV. 45. The chimeric PIV of claim 44, wherein a transcriptional unit comprising the open reading frame (ORF) of BPIV3 N ORF is replaced in the vector genome or antigenome by the corresponding N ORF of the HPIV3 vector genome. 46. The chimeric PIV of claim 45, wherein the vector genome or antigenome is combined with the measles virus HA gene as an extra gene insert. 47. The chimeric PIV according to claim 48, which is rHPIV3-N _B HA _PM . 48. Partial or complete BP in which the vector genome or antigenome is combined by one or more heterologous genes or genome segments from HPIV.
43. The chimeric PIV of claim 42, which comprises the IV genome or the antigenome. 49. One or more HPIV encoding HN and / or F glycoproteins
A gene or genome segment, or one or more immunogenic domains, fragments or epitopes thereof, are added to or integrated within a partial or complete bovine genome or antigenome to form a vector genome or antigenome 49. The chimeric PIV of claim 48. 50. The chimeric PIV of claim 49, wherein both HPIV3 genes encoding NH and F glycoproteins are replaced with corresponding BPIV3 HN and F genes to form a vector genome or antigenome. 51. The chimeric PIV of claim 50, wherein the vector genome or antigenome is combined with the RS virus (RSV) F or G gene as an extra gene insert. 52. The chimeric PIV of claim 51 selected from rBHPIV3-G1 or rB / HPIV3-F1. 53. One or more HPIV1 HN and / or F genes or genomic segments encoding one or more immunogenic domains, fragments or epitopes thereof, in order to form a vector genome or antigenome, in part or in whole. Integrated into the bovine genome or antigenome, which further encodes one or more immunogenic domains, fragments or epitopes thereof to form a chimeric genome or antigenome expressing protective antigens from both HPIV1 and HPIV2 50. The chimeric PIV of claim 49, which is modified by the integration of multiple HPIV2 HN and / or F genes or genomic segments. 54. rB / HPIV3.1-2F; rB / HPIV3.1-2HN; or rB / HPIV3.1-2F, 2H
54. The chimeric PIV of claim 53 selected from N. 55. A chimeric glycoprotein wherein said vector genome or antigenome incorporates one or more heterologous antigenic domains, fragments or epitopes of a heterologous PIV or non-PIV pathogen to form a chimeric genome or antigenome. The chimeric PIV of claim 1, which is modified to encode. 56. A chimeric glycoprotein wherein said vector genome or antigenome incorporates one or more antigenic domains, fragments or epitopes from an antigenically distinct second PIV to form a chimeric genome or antigenome. 56. The chimeric PIV of claim 55 modified to encode. 57. The chimeric PIV of claim 55, wherein the chimeric genome or antigenome encodes a chimeric glycoprotein having antigenic domains, fragments or epitopes from multiple HPIVs. 58. The chimeric PIV of claim 55, wherein the heterologous genomic segment encodes a glycoprotein ectodomain that is replaced by a corresponding glycoprotein ectodomain in the vector genome or antigenome. 59. An HPIV vector genome, wherein one or more heterologous genomic segments of antigenically distinct second HPIV encoding said one or more antigenic domains, fragments or epitopes encode said chimeric glycoprotein. 56. The chimeric PIV of claim 55, which is or is replaced within the antigenome. 60. The chimera of claim 55, wherein a heterologous genomic segment encoding both a glycoprotein ectodomain and a transmembrane region is replaced by a counterpart glycoprotein ecto- and transmembrane domain in the vector genome or antigenome. PIV. 61. The chimeric PIV of claim 55, wherein the chimeric glycoprotein is selected from HPIV HN or F glycoprotein. 62. The PIV vector genome or antigenome is a partial HPIV3 genome or antigenome, and the antigenically distinct second PIV is HPIV1 or HPIV.
57. The chimeric PIV of claim 56 selected from 2. 63. The HPIV vector genome or antigenome is a partial HPIV3.
63. The chimeric PIV of claim 62, which is genomic or antigenome and the antigenically distinct second HPIV is HPIV2. 64. The chimeric PIV of claim 63, wherein one or more glycoprotein ectodomains of HPIV2 are replaced by one or more corresponding glycoprotein ectodomains in the HPIV3 vector genome or antigenome. 65. The chimeric PIV of claim 64, wherein both glycoprotein ectodomains of HPIV2 HN and F glycoproteins are replaced by corresponding HN and F glycoprotein ectodomains in the HPIV3 vector domain or anti-domain. 66. The chimeric PIV of claim 65, which is rPIV3-2TM. 67. The chimeric PIV of claim 55, further modified to incorporate one or more and a sufficient number of attenuating mutations identified in HPIV3 JScp45.
. 68. The chimeric PIV according to claim 55, which is rPIV3-2TMcp45. 69. The chimeric PIV of claim 55, wherein the PIV2 ectodomain and transmembrane region of one or both HN and / or F glycoproteins are fused to one or more corresponding PIV3 cytoplasmic terminal regions. 70. The ectodomain and transmembrane region of both PIV2 HN and F glycoproteins are fused to the corresponding PIV3 HN and F cell terminal regions.
The described chimeric PIV. 71. The chimeric PIV according to claim 70, which is rPIV3-2CT. 72. The chimeric PIV of claim 71, further modified to incorporate one or more and up to a sufficient number of attenuating mutations identified in HPIV3 JScp45. 73. The chimeric PIV according to claim 72, which is rPIV3-2CTcp45. 74. At a position corresponding to Tyr942, Leu992 or Thr1558 of JS cp45
L protein; N protein at the position corresponding to residue Val96 or Ser389 of JS cp45;
Amino acid substitutions in the C protein at positions corresponding to Ile96 in JS cp45, JS cp45
A nucleotide substitution in the 3'leader sequence of the chimeric virus at the position corresponding to nucleotides 23, 24, 28 or 45 of and / or a mutation in the N gene start sequence at the position corresponding to nucleotide 62 of JS cp45 56. The chimeric PIV of claim 55, further modified to incorporate one or more and up to a sufficient number of attenuating mutations identified in PIV3 JS cp45 selected from the mutations. 75. A number of heterologous genes or genomic segments encoding multiple determinants of a heterologous PIV are added to or integrated within the partial or complete HPIV vector genome or antigenome. The described chimeric PIV. 76. A number of heterologous genes or genomic segments encoding antigenic determinants from both HPIV1 and HPIV2 are added to or integrated within the partial or complete HPIV vector genome or antigenome. Chimera described in 75
PIV. 77. The chimeric PIV genome or antigenome is bovine PIV3 (BPI
56. The chimeric PIV of claim 55, which is attenuated by the addition or integration of one or more genes or genomic segments from V3). 78. The chimeric PIV of claim 55, wherein the chimeric genome or antigenome is modified by the introduction of an attenuating mutation involving an amino acid substitution of phenylalanine at position 456 of the HPIV3 L protein. 79. The chimeric PIV of claim 78, wherein the phenylalanine at position 456 of the HPIV3 L protein is replaced by leucine. 80. The chimeric genome or antigenome is RS virus (RSV).
57.) or a measles virus, wherein the chimeric PIV incorporates one or more heterologous genes or genomic segments encoding one or more antigenic determinants. 81. The chimeric genome or antigenome imparts enhanced gene stability or alters attenuation, in vivo reactogenicity, or growth of the chimeric virus in culture 1 or The chimeric PIV according to claim 1, which is modified by addition or substitution of a plurality of heterologous genes or genomic segments. 82. Introduction of one or more attenuating mutations, wherein said chimeric genome or antigenome is identified in a biologically derived mutant PIV or non-segmented negative strand mutant RNA virus. The chimeric PIV according to claim 1, which is modified by 83. The chimeric PIV of claim 82, wherein the chimeric genome or antigenome incorporates at least one and up to a sufficient number of attenuating mutations present in PIV3 JScp45. 84. The chimeric genome or antigenome is JS cp45 Tyr942,
L protein at the position corresponding to Leu992 or Thr1558; residues Val96 or S of JS cp45
N protein at a position corresponding to er389; C protein at a position corresponding to Ile96 of JS cp45; F protein at a position corresponding to residue Ile420 or Ala450 of JS cp45;
An amino acid substitution in the HN protein at a position corresponding to residue Val 384 of JS cp45,
3 of chimeric viruses at positions corresponding to nucleotides 23, 24, 28 or 45 of JS cp45
'Nucleotide substitutions in the leader sequence and / or nucleotides 62 of JS cp45
83. The chimeric PIV of claim 82 incorporating at least one and up to a total number of attenuating mutations identifying mutations in the N gene start sequence at positions corresponding to
. 85. The chimeric genome or antigenome incorporates an attenuating mutation from a different biologically derived variant PIV, or other non-segmented negative strand variant RNA virus. The chimeric PIV described in 82. 86. The chimeric genome or antigenome is a heterologous negative chain mutant.
83. The chimeric PIV of claim 82, which incorporates an attenuating mutation at an amino acid position corresponding to the amino acid position of the attenuating mutation identified in the RNA virus. 87. The chimeric PIV of claim 86, wherein the attenuating mutation comprises an amino acid substitution of phenylalanine at position 456 of the HPIV3 L protein. 88. The chimeric PIV of claim 87, wherein the phenylalanine at position 456 of the HPIV3 L protein is replaced by leucine. 89. The chimeric PIV of claim 82, wherein the chimeric genome or antigenome comprises at least one attenuating mutation stabilized by multiple nucleotide changes in codons that specify the mutation. 90. A phenotypic change wherein the chimeric or antigenome is selected from growth characteristics, attenuation, temperature sensitivity, cold compatibility, plaque size, altered host range limits, or altered immunogenicity. The chimeric PIV of claim 1 comprising an additional nucleotide modification that specifies 91. The one or more PIV N, P, C, in the vector genome or antigenome, or in the heterologous gene segment, wherein said additional nucleotide modifications.
91. The chimeric PIV according to claim 90, wherein the D, V, M, F, HN and / or L genes and / or the 3'leader, the 5'end, and / or the intergenic region are altered. 92. One or more PIV genes may be completely or partially deleted, or expression of said genes may change mutations at RNA correction sites, frameshift mutations, amino acids specified by initiation codons. 92. The chimeric PIV of claim 91, which is reduced or eliminated by a mutating mutation, or the introduction of one or more stop codons in the open reading frame (ORF) of a gene. 93. The additional nucleotide modification is one or more C, D or V.
93. The chimeric PIV of claim 92, comprising a partial or complete deletion of the ORF, or one or more nucleotide changes that reduce or eliminate expression of said one or more C, D or V ORFs. 94. The chimeric PIV of claim 1, wherein the chimeric genome or antigenome is further modified to encode a cytokine. 95. The chimeric PIV of claim 1, which incorporates a heterologous gene or genomic segment from RS virus (RSV). 96. The heterologous gene or genomic segment comprises RSV F and / or
97. The chimeric PIV of claim 95, which encodes a G glycoprotein, or immunogenic domain, fragment or epitope thereof. 97. The chimeric PIV according to claim 1, which is a virus. 98. The chimeric PIV according to claim 1, which is a subviral particle. 99. A method for stimulating an individual's immune system to elicit protection against PIV, wherein the chimeric PIV of claim 1 in an immunologically sufficient amount, and a physiologically acceptable carrier. To the individual. 100. The method of claim 99, wherein said chimeric PIV is administered at a dose of 10 ³ -10 ⁷ PFU. 101. The method of claim 99, wherein said chimeric PIV is administered to the upper respiratory tract. 102. The method of claim 99, wherein the chimeric PIV is administered by nebulization, droplets or aerosol. 103. The vector genome or antigenome is human PIV3 (HPIV
100. The method of claim 99, which is of 3) and wherein said chimeric PIV elicits an immune response against HPIV1 and / or HPIV2. 104. The method of claim 99, wherein said chimeric PIV elicits a multispecific immune response against multiple human PIVs and / or against human PIVs and non-PIV pathogens. 105. The vector genome or antigenome is a partial or fully human PIV (HPIV) genome or antigenome, and the heterologous pathogen measles virus, RS virus of subgroups A and B, mumps Inflammation virus, human papilloma virus, type 1 and 2 human immunodeficiency virus, herpes simplex virus,
100. The method of claim 99, which is selected from cytomegalovirus, rabies virus, Epstein-Barr virus, filovirus, buniavirus, flavivirus, alphavirus and influenza virus. 106. The method of claim 99, wherein said chimeric PIV elicits a multispecific immune response against human PIV (HPIV) and measles virus. 107. The method of claim 106, wherein said chimeric PIV elicits a multispecific immune response against HPIV3 and measles virus. 108. The method of claim 99, wherein the first chimeric PIV and second PIV of claim 1 are administered sequentially or simultaneously to elicit a multispecific immune response. 109. The method of claim 108, wherein the second PIV is the second chimeric PIV of claim 1. 110. The method of claim 108, wherein said first chimeric PIV and second PIV are administered in admixture and simultaneously. 111. The method of claim 108, wherein said first chimeric PIV and second PIV are antigenically distinct variants of HPIV. 112. The first chimeric PIV comprises a partial or complete HPIV3 genome or antigenome linked by one or more heterologous genes or genomic segments encoding one or more antigenic determinants of different PIVs. The method of claim 111, which comprises. 113. The first chimeric PIV and the second PIV are one of non-PIV pathogens.
112. The method of claim 111, which incorporates, respectively, one or more heterologous genes or genomic segments encoding multiple antigenic determinants, respectively. 114. The method of claim 113, wherein said first and second chimeric PIV incorporate one or more heterologous genes or genomic segments encoding one or more antigenic determinants of said same non-PIV pathogen. 115. A continuous immunization method for stimulating an individual's immune system to elicit protection against multiple pathogens, the antigenic determinant of a non-PIV pathogen and one or more antigenic determinants of HPIV3. A group expressing an immunologically sufficient amount of the first attenuated chimeric HPIV is administered to a newborn to 4 month old infant, and subsequently a non-PIV pathogen antigenic determinant and HPIV1 or A method comprising administering an immunologically sufficient amount of a second attenuated chimeric HPIV expressing one or more antigenic determinants of HPIV2. 116. The first attenuated chimeric HPIV is HPIV3 which expresses a measles virus antigenic determinant, and the second attenuated chimeric HPIV.
115. The method of claim 115, wherein is a PIV3-1 chimeric virus expressing a measles virus antigenic determinant and incorporating one or more attenuating mutations of HPIV3 JScp45. 117. Following the first inoculation, the vaccine is HPIV1 or HPIV2.
Elicit a primary antibody response against both PIV3 and non-PIV pathogens, and against a second inoculation, the vaccine is readily infected with said second attenuated HPIV. , And primary antibody response to HPIV1 or HPIV2 and non-PIV
115. The method of claim 115, which develops a high titer second antibody response to the pathogen. 118. The first chimeric PIV induces an immune response against HPIV3,
And said second chimeric PIV elicits an immune response against HPIV1 or HPIV2, and said first and second chimeric PIV elicits an immune response against measles or RSV.
115. 119. The non-PIV pathogen is measles virus, subgroup A
And B RS virus, mumps virus, human papilloma virus, type 1
And 2 human immunodeficiency virus, herpes simplex virus, cytomegalovirus,
116. The method of claim 115 selected from rabies virus, Epstein-Barr virus, filovirus, buniavirus, flavivirus, alphavirus and influenza virus. 120. The second chimeric PIV comprises one or more HPIV1 and / or HPI
115. The partial or complete HPIV3 vector genome or antigenome combined by one or more genes or genomic segments encoding V2 HN and / or F glycoproteins or antigenic domains, fragments or epitopes thereof. Method. 121. The L protein at the position corresponding to Tyr942, Leu992 or Thr1558 of JS cp45, wherein the partial or complete vector genome or antigenome of the first chimeric PIV; the position corresponding to residue Val96 or Ser389 of JS cp45. N protein at JS
Amino acid substitution in the C protein at the position corresponding to Ile96 of cp45, nucleotide substitution in the 3'leader sequence of the chimeric virus at the position corresponding to nucleotides 23, 24, 28 or 45 of JS cp45, and / or nucleotides of JS cp45 116. Incorporating at least one and a total number of attenuating mutations present in PIV3 JS cp45 selected from mutations identifying mutations in the N gene start sequence at the position corresponding to 62. Method. 122. An immunogenic composition for eliciting an immune response against PIV, comprising an immunologically sufficient amount of the chimeric PIV of claim 1 and a physiologically acceptable carrier. 123. The composition of claim 122, which is formulated at a dose of 10 ³ to 10 ⁷ PFU. 124. The composition of claim 122, which is formulated for administration to the upper respiratory tract by nebulization, droplets or aerosol. 125. The composition of claim 122, wherein said chimeric PIV elicits an immune response against one or more viruses selected from HPIV1, HPIV2 and HPIV3. 126. The composition of claim 122, wherein said chimeric PIV elicits an immune response against HPIV3 and another virus selected from HPIV1 and HPIV2. 127. HPIV wherein said chimeric PIV is one or more, and measles virus, RS virus of subgroups A and B, mumps virus, human papilloma virus, human immunodeficiency virus types 1 and 2. Inducing a multispecific immune response against a heterologous pathogen selected from, a herpes simplex virus, a cytomegalovirus, a rabies virus, an Epstein-Barr virus, a filovirus, a buniavirus, a flavivirus, an alphavirus and an influenza virus. 12
The composition according to 2. 128. The composition of claim 127, wherein said chimeric PIV elicits a multispecific immune response against HPIV3 and measles virus RS virus. 129. The composition of claim 122, further comprising the second chimeric PIV of claim 1. 130. The composition of claim 129, wherein said first and second chimeric PIV are antigenically distinct variants of HPIV and carry the same or different heterologous antigenic determinants. 131. The partial or complete HPIV3 genome or antigenome, wherein said first chimeric PIV is combined with one or more heterologous genes or genomic segments encoding one or more antigenic determinants of a non-PIV heterologous pathogen. 130. The composition of claim 129, comprising. 132. The composition of claim 129, wherein said second chimeric PIV incorporates one or more heterologous genes or genomic segments encoding one or more antigenic determinants of the same non-PIV heterologous pathogen. 133. The first chimeric PIV induces an immune response against HPIV3,
And wherein the second chimeric PIV elicits an immune response against HPIV1 or HPIV2, and the first and second chimeric PIV elicits an immune response against a non-PIV pathogen.
The composition according to 129. 134. The heterologous pathogen is measles virus, RS virus of subgroups A and B, mumps virus, human papilloma virus, human immunodeficiency virus types 1 and 2, herpes simplex virus, site 130. The composition of claim 129, selected from megalovirus, rabies virus, Epstein-Barr virus, filovirus, buniavirus, flavivirus, alphavirus and influenza virus. 135. The composition of claim 129, wherein said heterologous pathogen is selected from measles virus or RSV. 136. A partial HPIV3 vector genome or antigen in which the second chimeric PIV is combined with one or more HPIV1 genes or genome segments encoding one or more antigenic determinants of HPIV1 HN and / or F glycoproteins. 130. The composition of claim 129, which comprises the genome. 137. The second chimeric PIV is one or more HPIV2 HNs and / or
Partial or complete HP combined with one or more genes or genomic segments encoding F-glycoprotein or antigenic domains, fragments or epitopes thereof
130. The composition of claim 129, comprising an IV3 vector genome or antigenome. 138. A partial or complete PIV vector combined with one or more heterologous genes or genomic segments encoding one or more antigenic determinants of one or more heterologous pathogens to form a chimeric PIV genome or antigenome. An isolated polynucleotide comprising a chimeric PIV genome or antigenome, including a genome or antigenome. 139. The one or more heterologous genes or genomic segments encoding the antigenic determinant are added adjacent to or within the non-coding region of the partial or complete PIV vector genome or antigenome. 141. The isolated polynucleotide of claim 138. 140. The method of claim 138, wherein the one or more heterologous genes or genomic segments encoding the antigenic determinant are replaced by one or more counterpart genes or genomic segments in a partial PIV vector genome or antigenome. An isolated polynucleotide of. 141. The one or more heterologous pathogens is a heterologous PIV, and the heterologous gene or genomic segment is one or more PIV N, P, C, D, V, M, F.
139. The isolated polynucleotide of claim 138, which encodes a HN and / or L protein or an immunogenic fragment, domain or epitope thereof. 142. wherein the vector genome or antigenome is a partially or fully human PIV (HPIV) genome or antigenome and the heterologous gene or genome segment encoding the antigenic determinant is of one or more heterologous PIV 139. The isolated polynucleotide of claim 138. 143. The partial or complete HP of said vector genome or antigenome
143. The isolated polynucleotide of claim 142, which is an IV3 genome or antigenome, and wherein the heterologous gene or genomic segment encoding an antigenic determinant is of HPIV1 and / or HPIV2. 144. The vector genome or antigenome is a partially or fully human PIV (HPIV) genome or antigenome, and the heterologous pathogen is measles virus, RS virus of subgroups A and B, pandemic ears. From mumps virus, human papilloma virus, type 1 and 2 human immunodeficiency virus, herpes simplex virus, cytomegalovirus, rabies virus, Epstein-Barr virus, filovirus, bunia virus, flavivirus, alphavirus and influenza virus 139. The isolated polynucleotide of claim 138, which is selected. 145. The measles virus HA, wherein said one or more heterologous antigenic determinants
And F proteins, RS virus F, G, SH and M2 proteins of subgroups A or B, mumps virus HN and F proteins, human papilloma virus L1 protein, human immunodeficiency virus type 1 or 2 gp160 protein , Herpes simplex virus and cytomegalovirus gB, gC, gD, gE, gG, gH, gI, gJ, gK, gL and g
M protein, rabies virus G protein, Epstein-Barr virus gp350
A protein, a filovirus G protein, a buniavirus G protein, a flavivirus pre-M, E and NS1 protein, and an alphavirus E protein, and their antigenic domains, fragments and epitopes.
144. The isolated polynucleotide according to 144. 146. The vector genome or antigenome is partially or completely
HPIV3 genome or antigenome, or heterologous H added or integrated therein
Chimeric H Comprising Partial or Complete HPIV3 Genome or Antigenome with One or More Genes or Genome Segments Encoding One or More Antigenic Determinants of PIV
139. The isolated polynucleotide of claim 138, which is PIV genome or antigenome. 147. The single molecule of claim 146, wherein said heterologous pathogen is measles virus and said heterologous antigenic determinant is selected from measles virus HA and F proteins and antigenic domains, fragments and epitopes thereof. Separated polynucleotide. 148. A single unit according to claim 147, wherein a transcriptional unit comprising the open reading frame (ORF) of the measles virus HA gene is added to or integrated within the HPIV3 vector genome or antigenome. Separated polynucleotide. 149. HPIV3, wherein the transcription unit comprising the open reading frame (ORF) of the measles virus HA gene is replaced by HN and F ORF of HPIV1.
148. The isolated polynucleotide of claim 147, which is added to or integrated within the HPIV3-1 vector genome or antigenome with both HN and FORF. 150. The single according to claim 138, wherein said partial or complete PIV vector genome or antigenome is combined with one or more extra heterologous genes or genome segments to form a chimeric PIV genome or antigenome. Separated polynucleotide. 151. The partial or complete HP of the vector genome or antigenome
IV3 genome or antigenome, and wherein said one or more extra heterologous genes or genome segments are HPIV1 HN, HPIV1 F, HPIV2 HN, HPIV2 F, measles HA and
151. The isolated polynucleotide of claim 150, which is / or is selected from translationally silent synthetic gene units. 152. One of HPIV1 HN, HPIV2 HN and measles virus HA ORF,
138. 138. Two or all are added to the vector genome or antigenome.
An isolated polynucleotide as described. 153. One or more of the HPIV1 HN and HPIV2 HN genes and 391
150. An 8-nt GU insert is added to the vector genome or antigenome.
An isolated polynucleotide as described. 154. The one or more extra heterologous genes or genomic segments comprise 30% of the total length of the exogenous sequence as compared to the wild type HPIV3 genome length of 15,462 nt.
151. The isolated polynucleotide of claim 150, which adds to 50% or more of the recombinant genome or antigenome. 155. The isolated polynucleotide of claim 138, wherein said vector genome or antigenome is a human-bovine chimeric PIV genome or antigenome. 156. The human-chimeric vector genome or antigenome is
Measles virus, RS virus of subgroups A and B, mumps virus,
Human papilloma virus, type 1 and 2 human immunodeficiency virus, herpes simplex virus, cytomegalovirus, rabies virus, Epstein-Barr virus,
156. The single molecule of claim 155, which is combined with one or more heterologous genes or genomic segments encoding one or more antigenic determinants of a heterologous pathogen selected from filovirus, buniavirus, flavivirus, alphavirus and influenza virus. Separated polynucleotide. 157. The vector genome or antigenome is 1 from BPIV.
162. The isolated polynucleotide of claim 156, which comprises a partial or complete HPIV genome or antigenome associated with a plurality of heterologous genes or genome segments. 158. The isolated of claim 157, wherein a transcription unit comprising an open reading frame (ORF) of BPIV3 N ORF is replaced in the vector genome or antigenome by the corresponding N ORF of the HPIV3 vector genome. Polynucleotides. 159. The isolated polynucleotide of claim 158, wherein said vector genome or antigenome is combined with the measles virus HA gene as an extra gene insert. 160. The vector genome or antigenome is derived from HPIV
Or part or complete combined by multiple heterologous genes or genomic segments
139. The isolated polynucleotide of claim 138, which comprises the BPIV genome or antigenome. 161. One or more HP encoding HN and / or F glycoproteins
The IV gene or genome segment, or one or more immunogenic domains, fragments or epitopes thereof, to form a vector genome or antigenome,
163. The isolated polynucleotide of claim 160, which is added to or integrated within a partial or complete bovine genome or antigenome. 162. The isolated poly of claim 161, wherein both HPIV3 genes encoding NH and F glycoproteins are replaced by corresponding BPIV3 HN and F genes to form a vector genome or antigenome. nucleotide. 163. The isolated polynucleotide of claim 162, wherein said vector genome or antigenome is combined with the RS virus (RSV) F or G gene as an extra gene insert. 164. The chimeric genome or antigenome is human PIV (HPIV
) And a heterologous pathogen, the isolated polynucleotide of claim 138 encoding a chimeric glycoprotein having an antigenic domain, fragment or epitope. 165. The isolated polynucleotide of claim 164, wherein said chimeric genome or antigenome encodes a chimeric glycoprotein having antigenic domains, fragments or epitopes from multiple HPIVs. 166. Introduction of one or more attenuating mutations, wherein the chimeric genome or antigenome is identified in a biologically derived mutant PIV or a non-segmented negative strand mutant RNA virus. Claim 138 modified by
An isolated polynucleotide as described. 167. The isolated polynucleotide of claim 138, wherein said chimeric genome or antigenome incorporates at least one and up to a sufficient number of attenuating mutations present in PIV3 JScp45. 168. The isolated polynucleotide of claim 138, wherein said chimeric genome or antigenome incorporates an attenuating mutation from a non-segmented negative strand heterologous RNA virus. 169. A phenotypic alteration wherein the chimeric or antigenome is selected from growth characteristics, attenuation, temperature sensitivity, cold compatibility, plaque size, altered host range limits, or altered immunogenicity. 138. The isolated polynucleotide of claim 138, which comprises an additional nucleotide modification that specifies 170. The one or more PIV N, P, in the vector genome or antigenome, or in the heterologous gene segment, wherein said additional nucleotide modification (s).
C, D, V, M, F, HN and / or L gene, and / or 3'leader, 5'end, and / or
139. The isolated polynucleotide of claim 138, which alters the intergenic region. 171. One or more PIV genes may be completely or partially deleted,
Or the expression of said gene, a mutation at the RNA correction site, a frameshift mutation, a mutation altering the amino acid specified by the start codon, or the introduction of one or more stop codons in the open reading frame (ORF) of the gene 138. The isolated polynucleotide of claim 138 which is reduced or removed by. 172. A method for producing said PIV from one or more isolated polynucleotide molecules encoding an attenuated infectious chimeric PIV, said chimeric PIV genome or antigenome, and PIV N. Partial or complete PIV of human or bovine PIV combined with one or more heterologous genes or genomic segments encoding one or more antigenic determinants of one or more heterologous pathogens to form P, L and P proteins A method comprising expressing in a cell or cell-free lysate an expression vector comprising an isolated polynucleotide comprising a vector genome or antigenome. 173. The chimeric PIV genome or antigenome, and N, P and L.
172. The method of claim 172, wherein the protein is expressed by a plurality of different expression vectors. 174. An operably linked transcription promoter, chimeric PIV
Partial or complete PIV vector of human or bovine PIV combined with one or more heterologous genes or genomic segments encoding one or more antigenic determinants of one or more heterologous pathogens to form a genome or antigenome An expression vector comprising a polynucleotide sequence encompassing a genome or antigenome, and a transcription terminator. 175. A major nucleocapsid (N) protein, a nucleocapsidrin protein (P), a large polymerase protein (L), and a genomic or antigenomic non-coding region (NCR) or in another gene isolation (GU).
) As a polynucleotide insert of 150 to 4,000 nucleotides (nt) in length (the polynucleotide insert is a complete open reading frame (ORF)
An isolated infectious recombinant parainfluenza virus (PIV), which comprises a PIV genome or an antigenome that lacks a) and identifies an attenuated phenotype in recombinant PIV). 176. The recombinant PIV of claim 175, wherein said polynucleotide insert is inserted into said PIV genome or antigenome in a reverse nonsense orientation, whereby said insert does not encode a protein. 177. The recombinant PIV of claim 175, wherein said polynucleotide insert is about 2,000 or more nt in length. 178. The recombinant PIV of claim 175, wherein said polynucleotide insert is nt of about 3,000 or more in length. 179. The recombinant PIV of claim 175, wherein said recombinant PIV replicates effectively in vitro and exhibits an attenuated phenotype in vivo.