JP2003515327A - HBV sequence - Google Patents

Abstract

  (57) [Summary] We report the complete nucleic acid sequence of a new human hepatitis B virus genotype, tentatively designated genotype G. This genotype is very prevalent in patients chronically infected with HBV and has been found to be present in Europe and the United States. Further, the present invention relates to a polypeptide encoded by the nucleic acid and an antibody recognizing the polypeptide. The invention also relates to the use of said nucleic acids, polypeptides and antibodies in HBV diagnosis, prevention and treatment.

Description

Detailed Description of the Invention

FIELD OF THE INVENTION The present invention relates to the field of diagnosis and treatment of hepatitis B virus (HBV). The present invention provides new HBV genotype G sequences and new mechanisms for HBeAg modulation for the diagnosis, prevention and treatment of HBV infection.

BACKGROUND OF THE INVENTION Human hepatitis B virus (HBV) is a prototype member of the Hepadnaviridae family, a circular, partially double-stranded DNA virus of approximately 3200 nucleotides (Magnius and Norder, 1995). This very compact genome consists of an envelope (preS1, preS2 and surface antigen HBsAg), core (pre
Core precursor proteins, HbeAg and HBcAg), polymerase (HBpo
l) and X (HBX) proteins, respectively, containing four major open reading frames (ORFs).

By using subtype-specific antibodies to HBsAg, nine different serological subtypes have been defined, reflecting the genetic diversity of HBV. One of the defined determinants is common to all subtypes (decision factor), but two pairs of mutually exclusive sub-determinants (d or y, w or r) are commonly seen. Was issued. Using this tool in epidemiological studies, nine serological subtypes were identified: ayw1, ayw2, ayw3, a.
yw4, ayr, adw2, adw4, adrq + and adrq- (Swenson
et al., 1991).

Genotypically, the HBV genome is divided into 6 groups, designated AF based on 8% or more intergroup divergence in the complete nucleotide sequence. (Okamoto et al., 1988; Norder et al., 1992;
Magnius and Norder, 1995). These six different genotypes show a characteristic geographical distribution: genotype A is pandemic, but most common in northwestern Europe, North America and Central Africa; genotype B is in Indonesia, China and Vietnam. Most common; genotype C is found in East Asia, South Korea, China, Japan, Polynesia and Vietnam; genotype D is also more or less pandemic, but predominantly in the Mediterranean and Middle East or India. Yes; genotype F is found in Native Americans and Polynesia (Van Geyt et al., Magnius
& Norder, 1995). Several studies have shown that higher HBV variability can be expected in certain populations in which HBV is endemic (Bowyer
et al., 1997; Carman et al., 1997). Studies on HBV genotypes currently underway in France and the United States have identified HBV strains that have failed unique type recognition.

OBJECT OF THE INVENTION It is an object of the present invention to provide a new HBV polynucleic acid sequence unique to an HBV genotype which has not been identified so far, that is, genotype G. It is phylogenetically distinct from the HBV genotypes A, B, C, D, E and F. It is another object of the invention to provide a fragment of the above HBV polynucleic acid, which is a previously unidentified HBV genotype, namely HBV genotype A, which is unique to genotype G, It comprises at least one nucleotide or a combination of nucleotides which differs from the B, C, D, E and F sequences, or the complementary sequence of said sequences. It is another object of the invention to provide fragments of the above HBV polynucleic acids that are universal for genotypes A, B, C, D, E, F and G. It is another object of the invention to provide a method for detecting the presence of HBV genotype G-specific polynucleic acid in a biological sample. It is another object of the invention to provide a universal method for detecting HBV genotypes A, B, C, D, E, F and G. It is another object of the present invention to provide an oligonucleotide primer capable of acting as a primer for specifically sequencing or specifically amplifying a nucleic acid or a part of a nucleic acid characteristic of HBV genotype G. . It is another object of the invention to provide universal primers that can act as primers for sequencing or amplifying nucleic acids from HBV genotypes A, B, C, D, E, F and G. It is another object of the present invention to provide an oligonucleotide probe capable of acting as a hybridization probe for specifically detecting a nucleic acid characteristic of HBV genotype G or a part of the nucleic acid. It is another object of the invention to provide a universal probe that can act as a hybridization probe for the universal detection of nucleic acids from HBV genotypes A, B, C, D, E, F and G. . It is another object of the invention to provide a method for HBV genotyping. It is another object of the invention to provide a diagnostic kit for detecting nucleic acids or parts of nucleic acids characteristic of HBV genotype G. It is another object of the invention to provide a diagnostic kit for the universal detection of HBV genotypes A, B, C, D, E, F and G. It is another object of the invention to provide a polypeptide specific for HBV genotype G. It is another object of the invention to provide universal peptides characteristic of genotypes A, B, C, D, E, F and G. It is another object of the invention to provide a method for the production of the polypeptides of the invention. It is another object of the invention to provide an expression vector allowing the expression of the peptides of the invention. It is another object of the invention to provide a host cell transformed with the expression vector of the invention. It is another object of the present invention to provide a method for detecting an HBV genotype-specific antibody or an antibody that recognizes HBV genotypes A, B, C, D, E, F and G, which has not been identified so far. Is the purpose. Provided is a diagnostic kit for detecting an antibody which has not been identified so far and which is specific to an HBV genotype or an antibody which recognizes an HBV genotype A, B, C, D, E, F and G. Another object of the present invention. It is another object of the invention to provide antibodies or ligands that specifically bind the peptides of the invention. Genotype G HBV polymerase, X protein, preCore, HBcAg, H
It is another object of the invention to provide an antibody or ligand that specifically recognizes a BeAg, preS1, preS2 or HBsAg protein. Genotypes A, B, C, D, E, F and G HBV polymerase, X protein, p
reCore, HBcAg, HBeAg, preS1, preS2 or HBs
It is another object of the invention to provide antibodies or ligands that recognize the Ag protein. It is another object of the present invention to provide a method for detecting the polypeptide of the present invention. It is another object of the invention to provide a diagnostic kit that allows the detection of the polypeptides of the invention. It is another object of the invention to provide monoclonal antibodies for preventing or treating HBV infection. It is another object of the invention to provide a vaccine or pharmaceutical composition for the prevention or treatment of HBV infection. It is another object of the invention to provide a method of identifying compounds or agents that can be used in the prevention or treatment of HBV infection. It is another object of the invention to provide HBV genotype G-infected clones for use in drug screening assays.

[0006]

[Table 1]

[Table 2]

[0007]

[Table 3]

DETAILED DESCRIPTION OF THE INVENTION The present invention is unique to previously unidentified HBV genotypes, the HBV
It relates to an isolated and / or purified HBV polynucleic acid having a nucleotide sequence phylogenetically different from genotypes A, B, C, D, E and F, said polynucleic acid comprising: (a) FIG. No .: 1) defined sequence; or (b) at least 90%, more preferably 91% relative to the sequence defined in FIG.
%, Most preferably 92% sequence identity; or (c) sequences characterized as a result of the degeneracy of the genetic code for the sequences defined in (a) and (b).

When one virus strain differs from all other HBV genomes by more than 8%,
HBV "individual genetic groups" or "phylogenetically distinct genotypes" can be defined (Okamoto et al., 1988; Norder et al., 1994). Thus,
Virus strains that differ by more than 8% with respect to the entire genome from other isolates (not restricted to possible deletions or insertions) are classified as new genotypes. Results from several epidemiological studies (Blitz et al., 1998; Norder et al., 199)
4; Magnius and Norder, 1995; Telenta et al., 1997; Alvarado-Esquivel et
based on the six major genetic groups of HBV (A, B, C, D, al., 1998).
E and F) were recognized. Apart from detecting these commonly found genotypes, in epidemics studies on samples from chronic HBV carriers from Atlanta, USA, Lyon, France, we found that at least 11.
7% (new genotype for genotype E), at most 15.3% (genotype F
A new viral HBV strain with a new genotype diversity against was isolated. Therefore, this new viral HBV strain was classified as a new HBV genotype G. Surprisingly, the epidemics of this virus in the United States account for over 11% of all infections, but have not been identified in all previous molecular epidemiologic studies. In addition to the predominant outbreak of this new genotype G virus in US samples, it was also found in samples obtained from France.

The term “isolated” refers to a substance that is free of coexisting components in its natural environment. However, it should be clear that the isolated nucleic acids of the invention may include heterologous cell components or labels and the like.

The terms “nucleic acid” or “polynucleic acid” are used interchangeably herein to refer to deoxyribonucleotide or ribonucleotide polymers in single-stranded or double-stranded form, and to nucleic acids in a manner similar to naturally occurring nucleotides. It may include known analogs of natural nucleotides that hybridize. The term particularly refers to the DNA sequence defined in Figure 1 and the DNA sequence given by SEQ ID NO: 1 or their complementary strands. It belongs to the new HBV genotype G and has a difference of 10%, more preferably 9%, most preferably 8% or less from the nucleotide sequence shown in Figure 1, or at least 90 relative to the sequence shown in Figure 1. All HBV nucleic acids that are%, more preferably 91% and most preferably 92% identical are within the scope of the invention.

A nucleic acid that "has 10%, 9%, 8% or less difference from another nucleic acid sequence" has 10%, 9%, 8% or less of each of its total nucleotides, A nucleic acid that differs from the nucleotides of the nucleic acid sequence with which it is being compared. A nucleic acid that is "at least 90%, 91%, or 92% identical to another nucleic acid sequence" has at least 90%, 91%, or 9 of each of its entire nucleotides.
2% are nucleic acids that are identical to the nucleotides of the nucleic acid sequence with which it is compared.

As a result of the degeneracy of the genetic code, nucleic acid sequences showing less than 90%, more preferably less than 91% and most preferably less than 92% identity to the sequences shown in FIG. It may encode the same protein as the protein encoded by the nucleotide sequence of the HBV strain belonging to genotype G. Therefore, these nucleic acid sequences as a result of the degeneracy of the genetic code are also within the scope of the invention.

In contrast to the known HBV genotypes, the complete genome of the HBV sequences of the invention belonging to the newly identified genotype G was found to be 3248 bp long (FIG. 4).
). The preCore region has translation stop codons at codon 2 (TAA instead of CAA) and codon 28 (TAG instead of TGG). That Core
The region is 585 nucleotides long and encodes a Core protein of 195 amino acids, the preCore region of which has a 36 bp nucleotide insert, which follows the Core translation start point (A at position 1901). It is present after this nucleotide. Like all genotypes except genotype A, the HBV sequences belonging to genotype G show a 6 nucleotide deletion in the carboxy-terminal portion of the HBcAg ORF (Figures 4 and 5). The preS1 region contains 354 bp (118 amino acids) and the preS2 region contains 165 bp (118 amino acids).
55 amino acids) and its HBsAg region contains 678 bp (226 amino acids) (FIG. 6). Similar to genotype E, the HBV sequences belonging to genotype G show a deletion of 3 nucleotides (1 amino acid at position 11; FIG. 6) in the amino-terminal part of preS1.

Accordingly, the present invention is particularly characterized in that the HBV polytype is further characterized in that it differs in nucleotide sequence from HBV genotype A, B, C, D, E or F in at least one of the following features: For nucleic acids: (a) having a length of 3248 base pairs; (b) encoding a translation stop codon at amino acids 2 and 28 of the preCore region; (c) a 36 nucleotide insert in the N-terminal portion of the Core region. (D) has a 6 nucleotide deletion in the C-terminal portion of the HBcAg ORF; (e) has a 3 nucleotide deletion in the N-terminal portion of the preS1 ORF. Thus, in this particular embodiment, the HBV polynucleic acid sequences of the invention have 1, 2, 3, 4 or 5 of the above features.

In a more particular embodiment, the invention relates to the above HBV polynucleic acid comprising at least one of the following sequences (FIGS. 7 and 8): SEQ ID NO: 44, SEQ ID NO: 4.
5, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 5
5, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60.

Furthermore, the present invention is unique to previously unidentified HBV genotype G and differs from known HBV genotypes A, B, C, D, E or F by at least one nucleotide or nucleotide. A fragment of the above polynucleic acid, or the complement of said fragment, characterized in that
However, the fragment is the preC / C gene sequence (SEQ ID NO: 7) shown in FIG.
Alternatively, it is not equal to the preS / S gene sequence (SEQ ID NO: 8) shown in FIG.

[0018] Tran et al. (1991) found that HBV recombinant strains preS / S and preC / C that happen to differ by less than 8% from the preS / S and preC / C sequences of the strain of the invention.
The C sequence is described. However, in contrast to the newly identified HBV genotype G of the present invention, this atypical virus strain contains preS / S and preC / C.
Appearance of HBV and takeover by HBV along with gene transposition
over) event context (Tran et al., 1991). This atypical HBV strain was never recognized as a new strain. To study the sequence of genotype G for such recombination events (as described in Tran et al. 1991), we examined the complete FR1 genome for such events at the nucleotide level and further known Genotype co-segregation (co
-segregation). No evidence of recombination was found. The absence of recombination events in the newly isolated strains and the high epidemicity of this new viral variant indicates that it is associated with the new HBV genotype. The by chance homologous HBV sequences described by Tran et al. (1991) were only the result of a recombination event and are excluded from the present invention. Therefore, the HBV preC / C gene sequence shown in FIG. 2 (SEQ ID NO: 7; accession number M)
74501; Tran et al. 1991) and the preS / S gene sequence shown in Figure 3 (SEQ ID NO: 8; accession number M74499; Tran et al. 1991) do not form part of the present invention. Similarly, the HBV preC / C gene sequence shown in FIG. 12 (SEQ ID NO: Bha
t et al. 1990) does not form part of the present invention. HBV pre by Bhat et al
The C / C sequence was disclosed and discussed in the context of chronic carriers lacking anti-HBc but having excessively high levels of HBV DNA in serum. For Tran et al (1991), there is never any association with the existence of a new genotype.

The present invention also relates to a fragment of the above polynucleic acid, characterized in that it is a universal fragment contained in the nucleic acid sequences of HBV genotypes A, B, C, D, E, F and G. Concerned. The present invention relates to nucleic acid alignment (alignmen) of seven genotypes.
For the first time, the present invention provides HBV genotypes A, B, C, D, E,
1 describes universal HBV nucleic acids characteristic of F and G.

The term “universal” as used herein means present, corresponding or characteristic of HBV genotypes A, B, C, D, E, F and G.

The fragments of the invention may be single-stranded or double-stranded. It is 5 to 3
It is 247 bp long. More preferably, this fragment is between 5 and 260
0 bp length, 5 to 1300 bp length, 5 to 700 bp length, 5 to 500 bp length, 5 to 300 bp length, and most preferably 5
To 200 bp in length. The fragments of the invention can be used for cloning and expression, or the fragments of the invention can be used as primers or probes in the HBV typing method.

The present invention therefore relates to an oligonucleotide primer comprising the above fragment, which primer is an HBV genotype G specific primer and is capable of specifically sequencing a nucleic acid or a portion of a nucleic acid characteristic of HBV genotype G or It can act as a primer for specific amplification. The present invention also relates to an oligonucleotide primer containing the above fragment, which is a universal primer,
It can act as a primer for sequencing or amplification of nucleic acids from BV genotypes A, B, C, D, E, F and G. The term "primer" refers to a single-stranded oligonucleotide sequence that can act as a starting point for the synthesis of primer extension products that are complementary to the nucleic acid strand being copied. The length and sequence of the primers must allow them to prime the synthesis of extension products. Preferably, the length of the primer is about 5 to 50 nucleotides. More preferably, the length of the primer is about 20-25 nucleotides. The individual lengths and sequences depend on the complexity of the DNA or RNA target required and the conditions under which the primer is used,
For example, depending on temperature and ionic strength.

The present invention also relates to an oligonucleotide probe containing the above fragment, which is an HBV genotype G-specific probe for specifically detecting a nucleic acid or a portion of a nucleic acid characteristic of HBV genotype G. It can act as a hybridization probe. The present invention also relates to an oligonucleotide probe comprising the above fragment, which probe is a universal probe and comprises HBV genotype A,
It can act as a hybridization probe for nucleic acids from B, C, D, E, F and G. The term "probe" is a single-stranded, sequence-specific oligonucleotide complementary to a target sequence in the HBV genome. Preferably, these probes are about 5 to 50 nucleotides in length, more preferably about 10 to 25 nucleotides in length. Particularly preferred lengths of the probes are 10, 11, 12, 13
, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides. The nucleotides used in the probes of the present invention may be ribonucleotides, deoxyribonucleotides as well as modified nucleotides such as inosine, or nucleotides containing modified groups which do not essentially alter their hybridization properties.

Cloning of a recombinant plasmid containing the corresponding nucleotide sequence, then, if necessary, excising the primer and / or probe from the cloned plasmid with sufficient nucleases and recovering the primer and / or probe, for example by fractionation by molecular weight By doing so, the probe and / or primer of the present invention can be produced. The primer and / or probe of the present invention may be chemically synthesized by, for example, a conventional phospho-triester method.
They are branched DNA capture or detection probes (Sanchez-Pescador et al., 1988;
Urdea et al., 1991).

The primers and / or probes of the present invention may be labeled. Labeling may be performed by methods known to those skilled in the art. The nature of the label may be isotopes ( ³² P, ³⁵ S, etc.) or non-isotopes (biotin, digoxigenin, etc.),
Alternatively, it may be on a branched DNA probe. The oligonucleotides used as primers and / or probes are
Phosphorothioate (Matsukura et al., 1987), alkyl phosphorothioate (Miller et al., 1979) or peptide nucleic acid (Nielsen et al., 1991; Nielsen
et al., 1993), or may consist of nucleotide analogues, or intercalation agents (Asseline e
al., 1984). The introduction of these modifications can be advantageous because it positively affects properties such as hybridization kinetics, reversibility of hybridization, biological stability, etc. of the oligonucleotide molecule.

As most other changes or modifications introduced into the original DNA sequence of the primer and / or probe, these changes are compatible with the conditions under which the oligonucleotide should be used to obtain the required specificity and sensitivity. Would be necessary. However, the final result of priming or hybridizing with these modified oligonucleotides should necessarily be the same as that obtained with unmodified oligonucleotides.

In a preferred embodiment of the invention, the probes and / or primers are
Recognize one of the target sequences shown in.

The term “target sequence” of the term probe and / or primer according to the invention is a sequence in the genome of a newly identified genotype G, which sequence itself is a newly identified genotype G. Containing one or more unique nucleotides or combinations, wherein the probe or primer is complementary or partially complementary (ie, up to 20%, more preferably up to 15%, more preferably up to 10%, or most preferably Sequences with up to 5% mismatch). It should be understood that the target sequence is also a suitable target sequence in some cases. A probe designed to specifically hybridize to a target sequence of a nucleic acid may be included in the target sequence or may be a long strand that overlaps with the target sequence (ie, outside the target sequence). And forms a duplex with the inner nucleotide).

In a very specific embodiment of the invention, the target sequence is C of HBV genotype G
Selected in the 36-nucleotide insert in the N-terminal portion of the ore region: TAGAACAACTTTGCCATATGGCCTTTTTGGCTTAGA (SEQ ID NO 61).

More specifically, the primers and / or probes of the invention recognize one or more of the following sequences: TAGAA (SEQ ID NO 62); AGAAC (SEQ ID NO 63); GAACA (SEQ ID NO 64). ); AACAA (SEQ ID NO 65); ACAAC (SEQ ID NO 66); CAACT (SEQ ID NO 67); AACTT (SEQ ID NO 68); ACTTT (SEQ ID NO 69); CTTTG (SEQ ID NO 70); TTTGC (SEQ ID NO 71); TTGCC (SEQ ID NO 72); TGCCA (SEQ ID NO 73); GCCAT (SEQ ID NO 74); CCATA (SEQ ID NO 75); CATAT (SEQ ID NO 76); ATATG ( SEQ ID NO 77); TATGG (SEQ ID NO 78); ATGGC (SEQ ID NO 79); TGGCC (SEQ ID NO 80); GGCCT (SEQ ID NO 81); GCCTT (SEQ ID NO 82); CCTTT (SEQ ID NO 83); CTTTT (SEQ ID NO 84); TTTTT (SEQ ID NO 85); TTTTG (SEQ ID NO 86); TTTGG (SEQ ID NO 87); TTGGC (SEQ ID NO 88); TGGCT (SEQ ID NO 89) ); GGCTT (SEQ ID NO 90); GCTTA (SEQ ID NO 91); CTTAG (SEQ ID NO 92); TTAGA (SEQ ID NO 93); TAGAAC (SEQ ID NO 94); AGAACA (SEQ ID NO 95); GAACAA (SEQ ID NO 96); AACAAC (SEQ ID NO 97); ACAACT (SEQ ID NO 98); CAACTT (SEQ ID NO 99 ); AACTTT (SEQ ID NO 100); ACTTTG (SEQ ID NO 101); CTTTGC (SEQ ID NO 102); TTTGCC (SEQ ID NO 103); TTGCCA (SEQ ID NO 104); TGCCAT (SEQ ID NO 105); GCCATA (SEQ ID NO 106); CCATAT (SEQ ID NO 107); CATATG (SEQ ID NO 108); ATATGG (SEQ ID NO 109); TATGGC (SEQ ID NO 110); ATGGCC (SEQ ID NO 111); TGGCCT ( SEQ ID NO 112); GGCCTT (SEQ ID NO 113); GCCTTT (SEQ ID NO 114); CCTTTT (SEQ ID NO 115); CTTTTT (SEQ ID NO 116); TTTTTG (SEQ ID NO 117); TTTTGG (SEQ ID NO 118); TTTGGC (SEQ ID NO 119); TTGGCT (SEQ ID NO 120); TGGCTT (SEQ ID NO 121); GGCTTA (SEQ ID NO 122); GCTTAG (SEQ ID NO 123); CTTAGA (SEQ ID NO 124) ); TAGAACA (SEQ ID NO 125); AGAACAA (SEQ ID NO 126); GAACAAC (SEQ ID NO 127); AACAACT (SEQ ID NO 128); ACAACTT (SEQ ID NO 129); CAACTTT (SEQ ID NO 130); AACTTTG (SEQ ID NO 131); ACTTTGC (SEQ ID NO 132); CTTTGCC (SEQ ID NO 133); TTTGCCA (SEQ ID NO 134); TTGCCAT (SEQ ID NO 135); TGCCATA (SEQ ID NO 136); GCCATAT ( SEQ ID NO 137); CCATATG (SEQ ID NO 138); CATATGG (SEQ ID NO 139); ATATGGC (SEQ ID NO 140 ); TATGGCC (SEQ ID NO 141); ATGGCCT (SEQ ID NO 142); TGGCCTT (SEQ ID NO 143); GGCCTTT (SEQ ID NO 144); GCCTTTT (SEQ ID NO 145); CCTTTTT (SEQ ID NO 146); CTTTTTG (SEQ ID NO 147); TTTTTGG (SEQ ID NO 148); TTTTGGC (SEQ ID NO 149); TTTGGCT (SEQ ID NO 150); TTGGCTT (SEQ ID NO 151); TGGCTTA (SEQ ID NO 152); GGCTTAG ( SEQ ID NO 153); GCTTAGA (SEQ ID NO 154);

The invention also relates to the use of the HBV genotype-specific primers and / or probes of the invention in a method for detecting the presence of new HBV genotype G in a biological sample. The invention also relates to the use of the universal primers and / or probes of the invention in a universal method for detecting the presence of HBV in a biological sample. The present invention further relates to the above method, wherein the present invention further comprises the following steps: (i) possibly extracting nucleic acids present in the biological sample; (ii) HBV genotype Amplifying a nucleic acid characteristic of G; (iii) detecting an amplified nucleic acid characteristic of HBV genotype G.

The primers used for amplification may be general primers or genotype G-specific primers. General primers allow amplification of DNA from strains belonging to genotype G as well as DNA from other strains belonging to other HBV genotypes. In contrast, genotype G-specific primers only allow amplification of nucleic acids from strains belonging to genotype G. These genotype G-specific primers are also within the scope of the invention.

The invention further relates to a universal detection method for the presence of HBV in a biological sample. More particularly, the invention relates to the above universal method, further characterized by the following steps: (i) possibly extracting nucleic acids present in the biological sample; (ii) Amplifying the nucleic acid; (iii) detecting the amplified nucleic acid. The primers used for amplification in the universal method are all genotype A,
It enables amplification of DNA derived from B, C, D, E, F and G.

The term “biological sample” according to the present invention refers to biological material (tissue or body fluid) taken directly from an infected human, or material obtained after culturing an organism containing an HBV nucleic acid sequence. . Biological materials include, for example, exudates of any kind, blood, skin tissue, biopsy, sperm, lymphocyte blood culture material, colonies, liquid cultures, fecal samples,
It may be urine, hepatocytes and the like. More specifically, "biological sample" refers to a serum or plasma sample.

Nucleic acids are released, concentrated and / or isolated from a biological sample by any method known in the art. Qiagen is currently used to isolate nucleic acids from blood samples.
QIAamp Blood Kit and High pure PCR Template Preparation Kit (Roche Di
Various commercial kits are available, such as agnosis, Belgium). Other well known methods for the isolation of DNA or RNA from biological samples may be used (
Sambrook et al., 1989).

Polymerase chain reaction (PCR; Saiki et al., 1988), ligase chain reaction (LCR
Landgren et al., 1988; Wu and Wallace, 1989; Barany, 1991), nucleic acid sequence-based amplification (NASBA; Guatelli et al., 1990; Compton, 1991), transcription-based amplification system (TAS; Kwoh et al. ., 1989), strand displacement reaction (SDA; Duck, 1990) or amplification with Qβ replicase (Lomeli et al., 1989), or any other suitable method known in the art. It is possible,
Those methods allow the amplification of nucleic acid molecules. In addition, TMA (Guatel
li et al., 1990) or bDNA (Sanchez-Pescador et al., 1988; Urdea et
al., 1991) can also be used in the method of the present invention.

The product of this amplification step is then used to detect the presence of nucleic acids present in the sample and / or
Or it can be used for typing. Analysis of the presence and typing of these nucleic acids was performed by double-stranded analysis of PCR products (Clay et al., 1994), PCR.
Single-stranded conformational polymorphism analysis of the product (PCR-SSCP; Yoshida et al., 1992
), Sequence-based typing (SBT; Santamaria et al., 1992 and 1993), P
Use of sequence-specific primers in CR reactions (PCR-SSP; Olerup and Zetterqu)
ist, 1991), PC in combination with sequence-specific oligonucleotide probing
Use of R (PCR-SSOP; Saiki et al., 1986), TMS or any of the methods known in the art such as the bDNA method. Sanger et al (19
Sequencing can be performed by any known sequencing method such as the enzymatic dideoxy method of 77) or the chemical method of Maxam and Gilbert (1977, 1980). Kits and / or tools for thermal-cycle sequencing, solid phase sequencing and automated sequencing are commercially available. Recently, simultaneous sequencing methods in the 5'and 3'directions have emerged. Some examples of automated sequencing are MicroGene Clipper ^TM 2 Dye and the
MicroGene Blaster ^TM from the OpenGene ^TM system (Visible Genetics Inc., T
oronto, Ontario, Canada) and the ABI PRISM® system (Perkin
Elmer Inc., PE Biosystems, PE Applied Biosystems, Foster City, Califor
nia, USA). Assay methods that rely on hybridization between nucleic acid and oligonucleotide probes in biological samples include Southern blot, Northern blot or dot blot formats (Saiki et al., 1989), etc.
Unlabeled amplified sample is bound to the membrane and the membrane contains at least one labeled probe and the bound probe is monitored under appropriate hybridization and wash conditions. An alternative is the "reverse" format, where the amplified sequence contains the label. In this format, the selected probe is immobilized at a specific location on the solid support and the amplified polynucleic acid is labeled to allow detection of the purified hybrid. The term "solid support" can be referred to as the substrate to which the oligonucleotide probe is coupled, provided that the background level of hybridization remains low. Usually, the solid support will be a microtiter plate (for example used in the DEIA method), a membrane (for example nylon or nitrocellulose) or microspheres (beads) or chips.
It may be convenient to modify the nucleic acid probe to facilitate immobilization and improve hybridization efficiency prior to application or immobilization to the membrane. Such modifications homopolymer tailing, aliphatic group, NH ₂ group, is intended may encompass a SH group, a carboxyl group, or biotin, may encompass the coupling with the hapten or protein.

Thus, a preferred embodiment of the present invention relates to the above method, further characterized in that it comprises the following steps: (i) possibly extracting nucleic acids present in the biological sample; (ii) Amplifying the nucleic acid; (iii) hybridizing the nucleic acid to one or more probes, preferably under denaturing conditions under suitable conditions, wherein the probes are possibly bound to a solid substrate. (Iv) possibly under appropriate conditions of washing; (v) detecting the hybrids produced.

The reverse hybridization format may be advantageous when multiple probes are used for quick and easy results. In this preferred embodiment, the selected probe is immobilized at a specific location on the solid support and the amplified nucleic acid is labeled to allow detection of the resulting hybrid.

The present invention further relates to a diagnostic kit for use in the above method, comprising the following components: (i) means for releasing, isolating or concentrating nucleic acids present in the sample, where appropriate; (Ii) possibly a primer set or primer mix of the invention; (iii) means for detecting or typing of nucleic acids present in a sample.

The present invention especially relates to the above diagnostic kit, which kit comprises at least one primer and / or at least one probe according to the invention. A special and very user-friendly diagnostic kit is a line probe assay (Stuyver et al., 1996) containing the following components: (i) liberating and isolating nucleic acids present in the sample, where appropriate. Or means for concentrating; (ii) possibly a primer set or primer mix of the invention; (iii) specifically hybridizes to a nucleic acid characteristic of HBV genotype G immobilized on a solid support. At least one probe, or at least one
(Iv) Hybridization buffer, or components necessary for producing the buffer; (v) Wash solution, or components required for producing the solution; (iv) If appropriate, Means for detecting hybrids resulting from hybridization.

In this embodiment, the selected set of probes are linearly immobilized on a piece of membrane. The probes may be immobilized individually in defined locations or as a mixture. The amplified HBV polynucleic acid can be labeled with biotin and the hybrid can then be detected using a non-radioactive chromogenic system with biotin-streptavidin coupling.

The term “hybridization buffer” means a buffer that, under appropriate stringency conditions, allows hybridization between a probe and a polynucleic acid or amplification product present in a sample. The term "wash solution" means a solution that allows washing of the hybrids produced under suitable stringency conditions.

The present invention also relates to a peptide or polypeptide having an amino acid sequence encoded by the polynucleic acid of the present invention. The terms "peptide" and "polypeptide"
Is used herein to refer to a polymer of amino acids (aa) and does not refer to a product of a particular length. Thus, oligopeptides, polypeptides, peptides, proteins and precursors are included in this definition. More specifically, the polypeptide of the present invention is an HBV gene such as preS1, preS2, surface antigen HBsAg, preCore precursor protein, HBeAg, HBcAg, polymerase or X protein of a newly identified HBV strain belonging to genotype G. A type G-specific polypeptide, or any part thereof, or a combination thereof, provided that the polypeptide is from a HBV strain belonging to genotypes A, B, C, D, E or F. It differs from a polypeptide by at least one amino acid. In a very particular embodiment, the invention relates to HBcAg or HBeAg of genotype G, or any portion thereof. 12 additional amino acids RTTLPYGLFGLD (SEQ ID NO: 1
The insert in the core region encoding 55) may be responsible for the novel mechanism of expression of HBcAg and HBeAg, and there may be core and e antigens with unique structural and immunological properties. Therefore, the invention especially relates to peptides derived from HBcAg or HbeAg of HBV genotype G comprising one of the following sequences: RTTLPY (SEQ ID NO 156); TTLPYG (SEQ ID NO 157); TLPYGL (SEQ ID NO 158). ); LPYGLF (SEQ ID NO 159); PYGLFG (SEQ ID NO 160); YGLFGL (SEQ ID NO 161); GLFGLD (SEQ ID NO 162); RTTLPYG (SEQ ID NO 163); TTLPYGL (SEQ ID NO 164); TLPYGLF (SEQ ID NO 165); LPYGLFG (SEQ ID NO 166); PYGLFGL (SEQ ID NO 167); YGLFGLD (SEQ ID NO 168)

The invention further relates to a universal peptide characterized by being included in the peptide sequence of HBV genotypes A, B, C, D, E, F and G. Since the present invention provides amino acid sequence alignments of seven genotypes, the present invention provides HBV
It makes it possible for the first time to describe a universal HBV amino acid sequence characteristic of genotypes A, B, C, D, E, F and G.

Post-translational modifications such as glycosylation, acetylation, phosphorylation and modification with fatty acids are also included in the present invention. For example, a polypeptide comprising one or more amino acid analogs (including unnatural amino acids), a polypeptide with a substituted bond, a mutated version of a polypeptide or a natural sequence variant, containing a disulfide bond between cysteine residues. Polypeptides, biotinylated polypeptides as well as other modifications known in the art are also included in the definition.

By any method known in the art, such as the classical chemical synthesis described by Houbenweyl (1974) and Atherton and Shepard (1989) or the recombinant DNA method described by Sambrook et al. (1989). Can also produce the polypeptide of the present invention.

The present invention therefore also relates to the above-mentioned polypeptides expressed recombinantly. The term "recombinant expression" refers to the fact that the peptide is produced by recombinant expression methods in prokaryotes or lower or higher eukaryotes, as explained below. The invention thus also relates to a method for producing the recombinant polypeptide of the invention comprising the following steps: (i) transformation of a suitable cell host with an expression vector; (ii) the polynucleic acid inserted into the expression vector. Culturing the transformed cell host under conditions that allow expression; then (iii) collecting the polypeptide.

Therefore, also included within the scope of the invention is an expression vector comprising a polynucleic acid or portion thereof operably linked to prokaryotic, eukaryotic or viral transcriptional and translational control elements. The term “expression vector” refers to a vector sequence of the type plasmid, cosmid, phage or viral DNA into which the nucleic acid of the invention has been inserted, which facilitates transcription by the host cell and translation of the polypeptide of the invention. It contains the necessary elements to

The present invention also relates to host cells transformed with the above expression vector. The term “host cell” refers to a cell that is a microbial cell or higher eukaryotic cell line that has been cultured as a unicellular body, and that can or has been used as a recipient of a recombinant vector. Prokaryotic cells used as host cells are Escherichia coli, Lactobac
illus, Lactococcus, Salmonella, Streptococcus, Bacillus or Streptomy
Selected from bacteria such as ces. A preferred lower eukaryotic host cell is yeast, especially Saccharomyces, Schizosaccharomyces, Kluyveromyces, Pichia (eg Pich
ia pastoris), Hansenula (eg Hansenula polymorpha), Yarowia, Schwanni
It is a species contained in omyces, Zygosaccharomyces, etc. Saccharomyces cerevisiae,
Saccharomyces carlsbergensis and K. lactis are the most commonly used yeast hosts. Examples of fungal host cells include Neurospora crassa. Host cells derived from higher eukaryotes include cells derived from higher animals such as mammals, reptiles and insects. Presently, the preferred higher eukaryotic host cells are Chinese hamsters (eg CHO), monkeys (eg COS and Vero cells), infant hamster kidney (BHK), pig kidney (PK15), rabbit kidney 13 cells (RK13).
, Human osteosarcoma cell line 143B, human hepatoma cell lines such as human cell lines HeLa and Hep G2, and insect cell lines (eg, Spodoptera frugiperda.
). Host cells may be provided in the form of suspensions such as flask cultures, tissue cultures, organ cultures and the like.

Any of the purification methods known for recombinant peptides can be used to produce the recombinant peptides of the invention.

The present invention also provides an antibody specific for a previously unidentified HBV genotype G present in a biological sample, preferably a previously unidentified HBV genotype G HBcAg and / or Or in a method of detecting an antibody specific to HBeAg,
It relates to the use of the HBV genotype G-specific polypeptides of the invention.

The present invention also provides an antibody specific for a previously unidentified HBV genotype G present in a biological sample, preferably a previously unidentified HBV genotype G HBcAg and / or Alternatively, a method for detecting an antibody specific to HBeAg, which method comprises the steps of: (i) contacting a biological sample with an HBV genotype G-specific polypeptide of the present invention; The immunological complex formed with the polypeptide is detected.

The present invention also relates to a universal method for detecting genotype A, B, C, D, E, F and G-specific antibodies present in a biological sample, which method comprises the steps of: Including: (i) contacting a biological sample with a universal polypeptide of the invention; (ii) detecting immunological complexes formed between the antibody and the polypeptide.

The present invention also relates to a universal method for HBV genotyping of a biological sample, which method comprises the steps of: (i) a biological sample with at least one polypeptide of the invention. Contacting; (ii) detecting an immunological complex formed between the antibody and the polypeptide.

There are many variants and many formats known in the art for the design of immunoassays. For example, the protocol may use a solid support or may use immunoprecipitation. Most assays involve the use of labeled polypeptides. The label may be, for example, an enzyme, fluorescent, chemiluminescent, radioactive or dye molecule. Assays that amplify the signal from the immune complex include biotin and avidin or streptavidin, and ELIS.
The use of enzyme-labeling and mediated immunoassays such as A.

Immunoassays can be in, but are not limited to, homogeneous or heterogeneous formats and can be of standard or competitive type. In a heterogeneous format, the polypeptide is typically attached to a solid matrix or support to facilitate separation of the sample from the polypeptide after incubation. Examples of solid supports that may be used are nitrocellulose (eg in the form of membranes or microtiter wells), polyvinyl chloride (eg in the form of sheets or microtiter wells),
Polystyrene latex (eg in the form of beads or microtiter plates), polyvinylidene fluoride (known as Immunolon ^™ ), diazotized filter paper,
Nylon membranes, activated beads, as well as protein A beads. For example, Dyna
tech Immunolon ^™ 1 or Immunolon ^™ 2 microtiter plate or 0
． 25 inch polystyrene beads (Precision Plastic Ball) can be used for non-uniform formats. The solid support containing the antigenic peptide is typically washed after separating it from the biological sample and prior to detection of bound antibody. Both standard and competitive formats are known in the art.

In a homogeneous format, the test sample is incubated with the antigen mixture in solution. For example, the conditions may be such that the produced antigen-antibody is precipitated. Both standard and competitive formats for these assays are known in the art.

The invention also relates to a diagnostic kit for use in the above method, which kit comprises at least one polypeptide of the invention, possibly the polypeptide bound to a solid support. . In a preferred embodiment, the kit may include a range of the polypeptide, which is attached to a particular location on a solid support. More preferably, the solid support is a strip of membrane and the polypeptide is coupled to the membrane in the form of parallel lines.

The invention further relates to the polypeptides of the invention for use as active substances in vaccines or medicaments. Alternatively, an anti-idiotype antibody that specifically binds to the antibody of the present invention can be used as an immunogen. The invention further relates to the use of the above-mentioned polypeptide or anti-idiotype antibody for the manufacture of a vaccine for the prevention or treatment of HBV infection.

The present invention also provides a vaccine composition comprising the polypeptide of the present invention or an anti-idiotype antibody as an active substance, which can be inoculated to a human (or a non-human mammal) to counter HBV infection. Vaccine composition or human with HBV (
Or a non-human mammal) therapeutically inoculatable vaccine composition. the term"
A "vaccine" or "vaccine composition" relates to an immunological composition capable of incompletely or completely eliciting protection against HBV. The term "as an active agent" relates to the components of a vaccine composition that induce protection against HBV. The active agent (ie the polypeptide of the invention) can be used as such, in biotinylated form (as described in WO93 / 18054), and / or
Alternatively, Neutral according to the manufacturer's instructions (Molecular Probes Inc., Eugene, OR).
Can be complexed with ite Avidin. “Vaccine” or “vaccine composition” comprises, in addition to the active substance, suitable excipients, diluents, carriers and / or which do not induce the production of antibodies harmful to the individual receiving the composition, nor the protection. It should also be noted that it also includes an adjuvant. Suitable carriers are typically large, slowly metabolized macromolecules such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers and inactive virus particles. Such carriers are well known to those of ordinary skill in the art. Preferred adjuvants which increase the effectiveness of the composition include aluminum hydroxide, aluminum in a mixture with 3-0-deacylated monophosphoryl lipid A as described in WO 93/19780, WO 93 /
Aluminum phosphate as described in 24148, N-acetyl-muramyl-L-threonyl-D-isoglutamine, N-acetyl- as described in U.S. Patent No. 4,606,918.
Normuramyl-L-alanyl-D-isoglutamine, N-acetylmuramyl-L-alanyl-
RIB containing D-isoglutamyl-L-ananine 2 (1'2'dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy) ethylamine and monophosphoryl lipid A
I (ImmunoChem Research Inc., Hamilton, MT), detoxified endotoxin, trehalose-6,6-dimycolate, and cell wall skeleton (MPL + TDM + CWS) in 2% squalene / Tween 80 emulsion, but not limited to Absent. Any of the three components MPL, TDM or CWS may be used alone or in combination by 2 by 2. In addition, Stimulon (Cambridge Bioscience, Worcester,
MA) or SAF-1 (Syntex), RC259 (Coryxa), SBAS2, SBAS3, SBAS4, SBAS5,
Adjuvants such as SBAS6, SBAS7, SBAS8 (Smith Kline Beecham, Rixensart, Belgium) may be used. Furthermore, Complete Freund's Adjuvant (CF
A) and Incomplete Freund's Adjuvant (IFA) may be used for non-human and research purposes. The "vaccine composition" will further include excipients and diluents. The excipients and diluents are non-toxic and non-therapeutic in their own right, for example water,
These include saline, glycerol, ethanol, wetting or emulsifying agents, pH buffer substances, preservatives and the like. Vaccine compositions are typically formulated as injectable liquid solutions or suspensions. Solid forms suitable for solution in, or suspension in, liquid carriers prior to injection may be prepared. The formulation may be emulsified or encapsulated in liposomes to enhance the adjuvant effect. The polypeptide may be included in an immune stimulating complex with a saponin, such as Quil A (ISCOMS). The vaccine composition comprises an immunologically effective amount of the polypeptide of the present invention as well as any of the other components described above. "Immunologically effective amount" means a dose to an individual as part of a single dose or series of doses effective for prevention or treatment. The health and physical condition of the individual to be treated, the taxonomic group of individuals to be treated (eg, non-human primate, primate, etc.), the capacity of the individual's immune system to produce an effective immune response, desired The amount will vary depending on the degree of protection, vaccine formulation, therapist assessment, infected HBV strain, and other important factors. It is believed that the amount is relatively wide and can be determined by routine trials. Usually the amount is 0.01 to 10
It will be 00 μg / dose, more particularly 0.1 to 100 μg / dose. Conventionally, vaccine compositions are administered parenterally, typically by injection, eg subcutaneous or intramuscular injection. Further formulations which are suitable for other modes of administration are oral formulations and suppositories. Administration can be in a single dose schedule or in multiple dose schedules. The vaccine may be administered with other immunomodulators. It should be noted that the vaccine may also be useful in treating an individual, in which case the vaccine is referred to as a "therapeutic vaccine."

The invention also provides an HBV genotype G-specific ligand or at least one of the invention.
Specifically produced by immunization with a HBV genotype G-specific polypeptide of Escherichia coli
Genotype G-specific antibody, wherein the antibody specifically reacts with the polypeptide,
It does not react with peptides characteristic of V genotypes A, B, C, D, E and / or F. In a preferred embodiment, the antibody is HBV genotype G HBV polymerase, X protein, preCore, HBcAg, HBeAg, preS1, preS2.
Alternatively, it specifically recognizes HBsAg.

The present invention also relates to a universal antibody that is specifically produced by immunization with a universal ligand or a universal polypeptide of the invention, the antibody reacting with the universal polypeptide. In a preferred embodiment, H of genotypes A, B, C, D, E, F and G
BV polymerase, X protein, preCore, HBcAg, HBeAg, pre
It specifically recognizes S1, preS2 or HBsAg.

The antibody may be polyclonal or monoclonal. Fab, F (ab) ' ₂ , sc
Fragments derived from these monoclonal antibodies, such as Fv (“single chain variable fragment”) as well as other antibody-like constructs which retain the variable region of the antibody are within the scope of the invention and may be used in the methods of the invention. it can. However, they shall retain their original characteristics. Usually, such fragments are obtained by enzymatic digestion of the antibody with, for example, papain, pepsin, or other pretase. It is well known to those skilled in the art that monoclonal antibodies, or fragments thereof, can be modified for various uses. Also, multivalent antibodies such as mini-antibodies and divalent antibodies, trivalent antibodies, tetravalent antibodies and pentavalent antibodies can be used in the method of the invention.
The manufacture and use of these fragments and multivalent antibodies is described in International Patent Application WO98.
/ 29442. Monoclonal antibodies used in the methods of the invention may be recombinant DN from mouse and / or human genomic DNA sequences encoding the H and L chains or from cDNA clones encoding the H and L chains.
It may be a humanized version of a mouse monoclonal antibody produced by means of method A. Alternatively, the monoclonal antibody used in the method of the invention may be a human monoclonal antibody. The term "humanized antibody" means that a portion of an immunoglobulin framework region is derived from human immunoglobulin sequences. The antibody used in the method of the invention may be labeled with an appropriate label of the enzymatic, fluorescent or radioactive type.

The present invention further provides for the detection of an HBV genotype G-specific polypeptide of the present invention present in a biological sample, preferably a previously unidentified HBV genotype G HbcAg and / or HBeAg. The use of the HBV genotype G-specific antibody or ligand of the present invention in the detection method of

The present invention also provides the detection of an HBV genotype G-specific polypeptide of the present invention present in a biological sample, preferably a previously unidentified HBV genotype G H.
A method for detecting bcAg and / or HBeAg comprising the steps of: (i) subjecting the biological sample to the HBV genotype under conditions suitable for the production of antigen-antibody or antigen-ligand complexes. HB of the invention that recognizes G-specific polypeptides
Contacting with a V genotype G-specific antibody or ligand; and (ii) detecting immunological binding of the antibody or ligand to the polypeptide.

The invention further relates to the use of the universal antibody or ligand of the invention in a method of detecting a universal polypeptide of the invention present in a biological sample.

The present invention also relates to a method of detecting a universal polypeptide of the invention present in a biological sample, the method comprising the steps of: (i) generation of an antigen-antibody or antigen-ligand complex. The biological sample is contacted with a universal antibody or ligand of the invention that recognizes the universal polypeptide under conditions suitable for: (ii) immunology of the antibody or ligand with the polypeptide; To detect dynamic binding.

A method for detecting immunological binding can be performed by combining the polypeptide-antibody complex formed by the polypeptide of the present invention and an antibody that recognizes the polypeptide with the following: Yes: (i) a secondary antibody (or detector antibody) that recognizes a specific epitope of the polypeptide-antibody complex but not only the primary antibody; (ii) to specifically tag the secondary antibody Or a marker that specifically couples to the secondary antibody, wherein the marker is any possible marker known to those of skill in the art; (iii) a secondary antibody and a polypeptide-primary antibody complex And / or a suitable buffer solution for carrying out an immunological reaction between the bound secondary antibody and the marker.

Advantageously, the antibody used in the present invention is immobilized on a suitable support. The secondary antibody may itself carry the marker, or it may carry groups directly or indirectly coupled to the marker. Alternatively, the method of the invention may be practiced by using any of the other immunoassay formats known in the art.

The term “epitope” refers to the part of a polypeptide-antibody complex that is specifically bound by an antibody combining site. Epitopes can be determined by any method known in the art or can be predicted by various computer predictions known in the art. The expressions "recognition", "reaction", "immunological binding" or "formation of a polypeptide-antibody complex" as used herein refer to the polypeptide under the conditions relating to the immunological properties of the antibodies and polypeptides of the invention. It should be understood that binding between the peptide and the antibody occurs. The terms "specifically recognize", "specifically bind", "specifically react" and the like herein with respect to antibodies and ligands refer to the H to which the antibody or ligand has not previously been identified.
Binding to a polypeptide that is unique to BV genotype G (not unique to any of the HBV genotypes A to F), or the antibody or ligand is HBV genotype A, B, It should be construed to bind to a polypeptide that is universal to C, D, E, F and G but not universal to any other polypeptide.

The invention also relates to a diagnostic kit used in the detection of previously unidentified HBV genotype G present in a biological sample, said kit comprising at least one HBV genotype of the invention. Includes G-specific antibodies. In a particular embodiment, the invention relates to a diagnostic kit used for the detection of previously unidentified HBV genotype G present in a biological sample, which kit comprises: (i) ) At least a primary antibody (or capture antibody) that recognizes the HBV genotype G-specific polypeptide of the present invention; (ii) possibly forming an immunological complex with an epitope of the polypeptide-primary antibody complex. A secondary antibody (or detector antibody) that does not form a complex with only the primary antibody; (iii) if possible, the secondary antibody is specifically tagged, or the secondary antibody is specifically capped. (Iv) possibly between the primary antibody of the invention and the polypeptide, between the secondary antibody and the polypeptide-primary antibody complex, and / or between the bound secondary antibody and the marker. Exemption A suitable buffer solution for carrying out the epidemiological reaction; (v) possibly a purified or synthetic peptide which is specifically recognized by the antibody of the kit for standardization purposes.

The present invention also relates to a diagnostic kit for use in the universal detection of HBV present in a biological sample, said kit comprising at least one universal antibody of the invention.

In a particular embodiment, the invention relates to a diagnostic kit used for the universal detection of HBV present in a biological sample, said kit comprising: (i) at least the invention A primary antibody (or capture antibody) that recognizes a universal polypeptide; (ii) possibly forming an immunological complex with an epitope of the polypeptide-primary antibody complex, but only with the primary antibody. A secondary antibody (or detector antibody) that does not form; (iii) possibly a marker that specifically tags the second anti-antibody, or a marker that specifically couples to the second antibody; (iv) possible For carrying out an immunological reaction between a primary antibody of the invention and a polypeptide, a secondary antibody and a polypeptide-primary antibody complex, and / or a bound secondary antibody and a marker. Appropriate Ffa solution; (v) possible is a standardization purposes, it is specifically recognized purified or synthetic peptide with the kit antibody.

The invention further relates to the polypeptides, antibodies or ligands of the invention for use as a medicament. The invention further relates to the use of the polypeptides, antibodies or ligands of the invention for the manufacture of a medicament for preventing HBV infection in humans or treating HBV infections in humans.

The invention also provides a peptide of the invention, which can be used in the treatment of HBV infection,
The present invention relates to a pharmaceutical composition or medicine containing an antibody or a ligand as an active substance.

The term “pharmaceutical” or “composition” (both terms may be mixed) means that saline, Ringer's solution, dextrose solution, Hank's solution, fixed oils,
Includes antibodies of the invention in the presence of suitable excipients known to those of skill in the art, such as ethyl oleate, 5% dextrose in saline, substances that improve isotonicity and chemical stability, buffers and preservatives. Refers to a composition. The "medicament" can be administered by any suitable method within the skill of the art. The preferred route of administration is parenteral. For parenteral administration, the medicament of the present invention is formulated as a single injectable form, for example, a solution, suspension or emulsion mixed with the above pharmaceutically acceptable excipients. However, the dose and mode will depend on the individual. Generally, the medicament is administered so that the antibody is given at a dose of 1 μg / kg to 10 mg / kg, more preferably 10 μg to 5 mg / kg, most preferably 0.1 to 2 mg / kg. Preferably it is given as a bolus dose. Continuous infusion may be used. In that case, the drug may be infused at a dose of 5 to 20 μg / kg / min, more preferably 7 to 15 μg / kg / min. Dosage forms suitable for oral administration include, but are not limited to, tablets, pills, capsules, caplets, granules, powders, elixirs, syrups, solutions and aqueous or oily suspensions. Suitable daily doses of the active compounds administered to humans are generally about 1 mg to about 5000 mg, more usually about 5 mg to about 1000 mg, once a day or one or more times. Administration is divided according to the number of times.

It should be clear that the pharmaceutical compositions of the invention may include variants that are functionally equivalent to the antibodies of the invention. The term refers to a molecule comprising the antibody of the invention, which has been modified in some way and retains all or part of its biological properties. Such modifications include the addition of polysaccharide chains, the addition of specific chemical groups, the addition of lipid moieties, the fusion with other peptides or proteins and the formation of intramolecular crosslinks,
Not limited to these.

The present invention also provides methods for identifying compounds or agents (herein referred to as "test compounds") that may be used in the treatment of diseases characterized by (or associated with) HBV infection. provide. These methods are also referred to herein as "drug screening assays."

In one embodiment, the drug screening assay is capable of interacting (eg, binding) with an HBV genotype G protein or functional equivalent thereof, modulating the interaction of an HBV protein with a target molecule. Screening the test compound for. Typically, the assay is a cell-free assay comprising the following steps: (i) The present invention under conditions that allow the interaction (eg, binding) of the HBV genotype G protein or portion thereof with a test compound. HBV genotype G protein or the immunogenic fragment thereof is mixed with a test compound to form a complex; (ii) formation of the complex is detected.

The ability of a test compound to interact (eg, bind) with the HBV genotype G protein or a portion thereof is indicated by the presence of the test compound in the complex. The formation of complexes between the HBV genotype G protein and the test compound can be quantitated using, for example, standard immunoassays. The HBV genotype G protein or immunogenic fragment thereof used in such a test may be in a free state in a solution, may be immobilized on a solid support, or may be carried on the cell surface. It may well be present in the cell.

In another embodiment, the invention relates to a HBV genotype G protein with: -a molecule with which the HBV genotype G protein normally interacts (target molecule); or-A HBV genotype G protein A screening assay is provided that identifies test compounds that modulate (eg, stimulate or inhibit) the interaction (and possibly the activity of the HBV genotype G protein) with an antibody that specifically recognizes.

The target molecule is a protein in the same signaling pathway as the HBV genotype G protein, eg, a protein (Zn that can function upstream or downstream (including both stimulators and inhibitors of activity) of the HBV protein signaling pathway (Zn. -Finger, protease activity, regulator of cysteine redox status). Typically, the assay is a cell-free assay and comprises the following steps: (i) under conditions that allow the interaction (eg, binding) of the HBV genotype G protein or portion thereof with the target molecule or antibody. , HBV genotype G protein or immunogenic fragment thereof, HBV protein target molecule (eg HBV protein ligand) or specific antibody and test compound are mixed; (ii) HBV genotype G protein and target molecule or antibody The formation of a complex is detected, or the interaction / reaction between the HBV genotype G protein and the target molecule or antibody is detected.

In order to carry out the above-mentioned drug screening assay, it is possible to immobilize either the HBV genotype G protein or its target molecule to facilitate the separation, and to facilitate the automation of the assay. Detection of complex formation may include direct quantification of the complex, eg, by measuring the inducing effect of HBV genotype G protein. Decrease in interaction between HBV genotype G protein and target molecule in the presence of test compound (for example, formation of complex between HBV genotype G protein and target molecule) (detected in the absence of test compound) A statistically significant change (such as in comparison) is a modulation (eg, stimulation or inhibition) of the interaction between the HBV genotype G protein and the target molecule.
Indicates. Modulation of complex formation between the HBV genotype G protein and the target molecule can be quantified using, for example, an immunoassay. It should be clear that modulators of the interaction between the HBV genotype G protein and the target molecule, if identified by any of the methods described herein, are encompassed by the present invention.

One method of drug screening that provides a high throughput screen for compounds with suitable binding affinity for the HBV genotype G protein is described in 198
International patent application WO 84/0356 by Geysen HN, published September 13, 4
4 "Determination of Amino Acid Sequence Antigenicity", which is incorporated herein by reference. In summary, a number of different small peptide test compounds are synthesized on plastic pins or some other surface. The protein test compound is reacted with a fragment of the HBV genotype G protein and washed. The bound HBV genotype G protein is then detected by methods well known in the art.

The present invention also includes the use of a competitive drug screening assay in which a neutralizing antibody capable of binding to an HBV genotype G protein competes with a test compound for binding to an HBV genotype G protein. . In this manner, antibodies can be used to detect the presence of proteins that share one or more antigenic determinants with the HBV genotype G protein.

In yet another embodiment, the invention provides a method of identifying a compound capable of modulating HBV nucleic acid expression and / or HBV protein activity. HBV
Methods of assaying the ability of a test compound to modulate nucleic acid expression or HBV genotype G protein activity are typically cell-based assays. However, animals infected with HBV genotype G are also contemplated herein. Inducing cells infected or transfected with HBV genotype G that signal through a pathway involving HBV genotype G protein to overexpress HBV protein in the presence and absence of a test compound You can These HBV genotype G infected cells also form part of the present invention. The HBV genotype G infected cells and animals are also referred to as HBV genotype G infected clones.

Throughout this specification and the claims below, unless otherwise indicated, "including (
"comprising, comprising, comprising)" means the stated number or steps, or a stated number or group of steps, but does not exclude other numbers or steps or groups of numbers or steps. The disclosures of the various patent applications, patents and / or publications cited in this specification, as well as the documents cited in these publications, are hereby incorporated by reference. However, this does not mean that the contents of all these disclosures are to be found as part of the usual general knowledge.

The present application claims priority to US Patent Application No. 60/169287 filed December 7, 1999 under the provisions of 35 USC 119. Furthermore, the present application
U.S. Patent Application No. 60/16 filed on Dec. 7, 1999 under PCT Article 8
No. 9287 and EP 99870252.6 filed Dec. 3, 1999, claiming priority.

EXAMPLES Example 1 Epidemic of Different HBV Genotypes 1.1 Sample Collection A total of 121 HBV positive plasma samples were collected in France (n = 39) and USA (n = 39).
= 82). Samples were aliquoted and stored at -20 ° C until use. Samples were taken from chronic HBV carriers and randomly selected as they became available.

1.2 HBV DNA extraction and amplification High Pure, essentially as previously described (Stuyver et al., 1999).
HBV DNA was extracted from 100 μl serum samples using the PCR Template Preparation kit (Roche Diagnostics, Brussels, Belgium). Primer HBPr
1 and HBPr135 (outer PCR), followed by a nesting reaction with HBPr2 and HBPr94 to give preS1, preS
2 and a PCR fragment covering the HBsAg region was obtained (FIG. 4; Table 1).
. Viral DNA was amplified by outer PCR for 40 cycles. 94
C. 30 seconds denaturation, 50.degree. C. 30 seconds annealing, and 72.degree. C. 30 seconds extension.
Samples that were negative in the first round of PCR were amplified for another 35 cycles with the same thermal profile using nested PCR primers.

1.3 HBV Genotyping 121 serum samples were further genotyped by using the research version of the HBV genotyping Line Probe Assay (LiPA) (Van Geyt et al., 1998). The results are summarized in Table 2. A very typical but previously unrecognized reactivity pattern was observed for two samples from Europe and eleven samples from the United States. That is, probe 140 (specially designed for genotype A)
, Probe 148 (designed for genotypes A and B), probe 80 (genotype C
(Designed for D and E) and probe 239 (designed for genotypes B and E) (
A hybridization reaction was observed for Van Geyt et al. 1998). This mixed hybridization pattern did not allow unique type recognition and was therefore further characterized by sequence analysis.

Example 2 Characterization of Samples Showing Mixed Hybridization Patterns 2.1 HBV DNA Extraction and Amplification High Pure, essentially as previously described (Stuyver et al., 1999).
HBV DNA was extracted from 100 μl serum samples using the PCR Template Preparation kit (Roche Diagnostics, Brussels, Belgium). Expand High Fidel
The complete genome of HBV was amplified using the ity PCR system (Roche Diagnostics, Brussels, Belgium). For 5 μl of extracted DNA, primer HBPr108
Amplification was carried out using HBPr109 and HBPr109 (Table 1). 5 μl 10 x Expand High
Fidelity PCR system buffer, 2.6 U Expand High Fidelity PCR system enzym
45 μ containing e mix, 200 μM dNTPs, 300 nM of each primer and sterile H ₂ O
1 reaction mixture was obtained. Denaturation at 94 ° C for 40 seconds, shift to 60 ° C for 50 seconds, annealing for 1 minute, shift to 72 ° C for 15 seconds, and extension for 4 minutes, 5
Amplification was performed in increments of seconds / cycle (Gunther et al., 1998). Two short PCR fragments were also obtained: (i) The first amplicon was preS1.
, PreS2, and HBsAg regions, and the primer HB
Pr1 and HBPr135 (outer PCR), followed by HBPr2 and H
Amplified by a nesting reaction with BPr94 (Table 1); and (ii) the second amplicon covers the preCore / Core region and the half-nested set of PCR primers (HBPr86 and HBPr303 followed by HBPr87 and It was amplified using HBPr303). Viral DNA was amplified by outer PCR with 40 cycles of denaturation at 94 ° C for 30 seconds, annealing at 50 ° C for 30 seconds, then extension at 72 ° C for 30 seconds. Negative samples from the first round of PCR were run with the same thermal profile using nested PCR primers.
It was amplified for 5 cycles.

2.2 Sequencing Fluorescence-labeled dideoxynucleotide chain terminator (ABI Prism BigDye Termi
nator Cycle Sequencing Ready Reaction Kit with AmpliTaq DNA polymerase F
S; PE Applied Biosystems) using an automated DNA sequencer ABI 377
(PE Applied Biosystems, Foster City, CA, USA). The primers used to sequence the complete genome are summarized in Table 1. Short pc
The primers used to sequence the R fragment are the same as the amplification primers. One European viral isolate (FR1) was selected for whole genome sequencing (
Figure 1; SEQ ID NO: 1), preCore / Core and p from another 7 samples
The reS / S gene was sequenced (Figures 7 and 8; SEQ ID NOs: 43-56).

2.3 Percentage of Homology with Other Genotypes To compare the genetic association of the FR1 strain with 36 other complete HBV genomes, the percentage of homology was calculated. The sequence of the FR1 strain showed the following homologies:
Genotype A (5 sequences) is 87.1% (minimum 86.2%, maximum 87.7%)
Genotype B (4 sequences) is 86.6% (minimum 86.5%, maximum 86.6%)
); Genotype C (14 sequences) is 86.5% (minimum 86.0%, maximum 87.0).
Genotype D (8 sequences): 86.9% (minimum 86.3%, maximum 87.%).
Genotype E (two sequences) is 88.3% (minimum 88.2%, maximum 88).
． 44.7%; genotype F (3 sequences) is 84.7% (minimum 84.5%, maximum 8)
4.8%).

2.4 Phylogenetic distances to other genotypes To compare the genetic association of the FR1 strain with 36 other complete HBV genomes, phylogenetic distances were calculated. The phylogenetic distances between the 6 recognized HBV genotypes (36 sequences) were compared to each other and to the FR1 strain (FIG. 9). Phylogenetic distance between (i) 1 genotypes (distance range 0.01-0.06) and (
ii) Clear differences appeared between different genotypes (distance range 0.08-0.17). Using the t-test for a distance of 0.08 as the mean and the boundary between genotypes, FR1 was found to be significantly different from genotypes AF (0.11).
~ 0.17 range; P <0.019). Generating a phylogenetic tree, DNADIST, Neighbor and Drawgram software programs o
Analyzed by distance matrix comparison using f PHYLIP version 3.5c (Felsenstein, 1993). MedCalc Version 4.05-Windows 95 (Medcalc Software, Mariake
Statistical analysis (t-test for mean) was performed using rke, Belgium). 0
． P-values less than 05 were considered statistically significant. The complete genomic sequence showing different genotypes was taken from GenBank. The accession numbers are shown in FIG. A phylogenetic tree of the complete genomic sequence (Fig. 10a), as well as individual ORFs [surface regions (pre
For S1, preS2, HBsAg), the phylogenetic tree of FIG. 10b; not shown for the other ORFs] was constructed, showing that FR1 actually exists on a separate branch. Further FIG. 10b shows HB from the US and France.
It shows that the V samples are closely related to each other. Based on the results of these calculations and the phylogenetic tree, FR1 and other virus strains shown to belong to the new HBV genotype are referred to as genotype G.

Example 3 : Characterization of genomic structure and open reading frame in HBV strains belonging to genotype G The complete genomic structure of FR1 was similar to that described for known HBV genotypes, but of 3248 bp. It was found to be the length (Fig. 4). All eight sequenced isolates had codon 2 (CAA in the preCore region.
Instead of TAG) and codon 28 (TAG instead of TGG). Based on the presence of this double stop codon, generally HBeAg
Is not expected. Paradoxically, sample FR2 showed the presence of HBeAg in plasma. The Core region is 585 nucleotides long and contains 195 amino acids of Co.
It encodes the re protein (Fig. 5). In contrast to other genotypes, the Core region is 3
It has a 6 bp nucleotide insert, which is the core translation start point (
It is present 5 nucleotides after position A) A). Therefore, an additional 12
The insert in the core region encoding the single amino acid RTTLPYGLFGLD (SEQ ID NO: 155) may be responsible for the novel mechanism of expression of HBcAg and HBeAg and has unique structural and immunological properties. May exist. Genotype G, and other genotypes except genotype A,
A 6 nucleotide deletion was shown in the carboxy-terminal portion of the HBcAg ORF (Figures 4 and 5). The preS1 region is 354 bp (118 amino acids) and the preS2 region is 165 b.
p (55 amino acids), and the HBsAg region contains 678 bp (226 amino acids) (Figure 6). Similar to genotype E, strain G has a 3 at the amino terminus of preS1.
A nucleotide deletion (1 amino acid at position 11; Figure 6) was indicated. HB
Lysine (K) at position 112, lysine (K) at position 160 and position 12 of sAg.
Based on the presence of 7 proline (P), the serological subtype of this genotype G was estimated to be adw2. The polymerase region of this genotype contains 2526 bp (842 amino acids).
Deletions at the carboxy terminus of HBcAg, as well as at the amino terminus of preS1, affect polymerase protein numbering. Methionine residues, which tend to change during lamivudine treatment, are highly conserved in the YMDD motif (Bart
holomeusz et al., 1998). Figure 6 shows the correct numbering for this methionine residue in other genotypes.

Example 4 : Method for detecting HBV genotype G 4.1 HBV DNA extraction and amplification High Pure PCR Template Preparation Kit (Roche Diagnostics, Brussels, B
HBV DNA was extracted from serum samples using E. g. Nested PCR
Primers were designed to allow amplification of the HBsAg region and a 341 bp fragment was obtained (outer sense primer HBPr134; outer antisense primer HBPr135; nested sense primer HBPr75; nested antisense primer HBPr94; Table 1). All primers were tagged with a biotin group at the 5'end. 40 cycles (95 ° C for 30 seconds; 45 ° C for 30 seconds; 7
The DNA was amplified by outer PCR at 2 ° C. for 30 seconds). First round PC
Negative samples in R were amplified for 35 cycles with the same thermal profile using nested PCR primers.

4.2 Design of LiPA for HBV Genotyping A total of 20 genotype-specific probes were designed. Genotypes A, B, C, D
Probes designed for the identification of E, F and F were those described in Van Geyt et al. (1998). For example, a probe specifically selected for the identification of HBV genotype G nucleic acid sequences recognizes the region labeled Target A or Target B in FIG. Poly d (
T) After enzymatic addition of the tail, selected oligonucleotide probes are applied as horizontal lines on a nitrocellulose membrane. One line of biotinylated DNA is applied side by side as a positive control.

4.3 LiP with Cloned Reference Panel and Typical Clinical Samples
Testing of A The assay was performed essentially as described for the HCV line probe assay (Stuyver et al., 1996). Reactivity of different probes on HBV genotyping LiPA was evaluated using cloned reference panels and clinical samples. Figure 11 shows the results for some typical samples after hybridization of the PCR product to the probe on LiPA. HB
The PCR fragment from V strain FR1 hybridized with the universal probes 140, 148, 80 and 239 and further with the genotype G-specific probe selected to recognize target A or target B shown in FIG. Hybridize.

References Alvarado-Esquivel C, Wyseur A, Herrera-Ortiz F, Ruiz-Maya L, Ruiz-Astorg
a R, Zarate-Aguilar A, Carrillo-Maravilla E, Herrera-Luna R, Moralers-Ma
cedo M, Maertens G and Stuyver L (1998) Hepatitis B and C virus infectio
ns in Mexico: genotypes and geographical distribution in blood donors an
d patients with liver disease. In Therapies for Viral Hepatitis, pp. 35-
41. Eds. RF Schinazi, JP Sommadossi and HC Thomas. International Medica
l Press, London, UK. Asseline U, Delarue M, Lancelot G, Toulme F and Thuong N (1984) Nucleic
acid-binding molecules with high affinity and base sequence specificity:
intercalating agents covalently linked to oligodeoxynucleotides.Proc N
atl Acad Sci USA 81: 3297-3301. Atherton and Shepard (1989) Solid phase peptide synthesis. IRL Press, Ox
ford, UK. Barany F (1991) The ligase chain reaction in a PCR world. PCR Methods Ap
pl 1: 5-16. Bhat RA, Ulrich PP and Girish NV (1990) Molecular characterization of a
new variant of hepatitis B virus in a persistently infected homosexual m
an. Hepatology 11: 271-276. Bowyer SM, van Staden L, Kew MC and Sim JGM (1997) A unique segment of t.
he hepatitis B virus group A genotype identified in isolates from South
Africa. J Gen Virol 78: 1719-1729. Carman WF, Van Deursen FJ, Mimms LT, Hardie D, Coppola R, Decker R and S
anders R (1997) The prevalence of surface antigen variants of hepatitis
B virus in Papua New Guinea, South Africa, and Sardinia. Hepatology 25:
1658-1666. Clay TM, Culpan D, Howell WM, Sage DA, Bradley BA and Bidwell JL (1994)
UHG crossmatching.A comparison with PCR-SSO typing in the selection of
HLA-DPB-compatible bone marrow donors. Transplantation 58: 200-207. Compton J (1991) Nucleic acid sequence-based amplification. Nature 350:
91-92. Duck P (1990) Probe amplifier system based on chimeric cycling oligonucl
eotides. Biotechniques 9: 142-147. Felsenstein J (1993) PHYLIP (Phylogeny Inference Package) version 3.5c.
Distributed by the author. Department of Genetics, University of Washing
ton, Seattle, USA.Guatelli J, Whitfield K, Kwoh D, Barringer K, Richman D and Gengeras T (
1990) Isothermal, in vitro amplification of nucleic acids by a multienzy
me reaction modeled after retroviral replication. Proc Natl Acad Sci USA
87: 1874-1878. Guenther S, Sommer G, Von Breunig F, Iwanska A, Kalinina T, Sterneck M a
nd Will H (1998) Amplification of full-length hepatitis B virus genomes
from samples from patients with low levels of viremia: frequency and fun
ctional consequences of PCR-introduced mutations. J Clin Microbiol 36: 5
31-538. Houbenweyl (1974) Method of organic chemistry. Vol. 15-I et II. Eds. EW
unch, Thieme, Stuttgart, Germany.Kwoh D, Davis G, Whitfield K, Chappelle H, Dimichele L and Gingeras T (1
989) Transcription-based amplification system and detection of amplified
human immunodeficiency virus type 1 with a bead-based sandwich hybridiz
ation format.Proc Natl Acad Sci USA 86: 1173-1177. Landgren U, Kaiser R, Sanders J and Hood L (1988) A ligase-mediated gene
detection technique.Science 241: 1077-1080.Lomeli H, Tyagi S, Pritchard C, Lisardi P and Kramer F (1989) Quantitati
ve assays based on the use of replicatable hybridization probes. Clin Ch
em 35: 1826-1831. Magnius LO and Norder H (1995) Subtypes, genotypes and molecular epidemi
ology of the hepatitis B virus as reflected by sequence variability of t
he S-gene. Intervirology 38: 24-34. Matsukura M, Shinozuka K, Zon G, Mitsuya H, Reitz M, Cohen J and Broder
S (1987) Phosphorothioate analogs of oligodeoxynucleotides: inhibitors o
f replication and cytopathic effects of human immunodeficiency virus. Pr
oc Natl Acad Sci USA 84: 7706-7710. Maxam AM and Gilbert W (1977) A new method for sequencing DNA. Proc Natl
Acad Sci USA 74: 560-564. Maxam AM and Gilbert W (1980) Sequencing end-labeled DNA with base-speci.
fic chemical cleavages. Methods Enzymol. 65: 499-559. Miller P, Yano J, Yano E, Carroll C, Jayaram K and Ts'o P (1979) Nonioni
c nucleic acid analogues. Synthesis and characterization of dideoxyribon
Nucleoside methylphosphonates. Biochemistry 18: 5134-5143. Nielsen P, Egholm M, Berg R and Buchardt O (1991) Sequence-selective rec
ognition of DNA by strand displacement with a thymine-substituted polyam
ide. Science 254: 1497-1500. Nielsen P, Egholm M, Berg R, Buchardt O (1993) Sequence specific inhibit.
ion of DNA restriction enzyme cleavage by PNA. Nucleic Acids Res 21: 197
-200. Norder H, Courouce AM and Magnius LO (1992) Molecular basis of hepatiti
s B virus serotype variations within the four major subtypes. J Gen Viro
l 73: 3141-3145. Norder H, Courouce AM and Magnius LO (1994) Complete genomes, phylogene
tic relatedness, and structural proteins of six strains of the Hepatitis
B virus, four of which represent two new genotypes. Virology 198: 489-5
03. Okamoto H, Tsuda F, Sakugawa H, Sastrosoewinjo RI, Imai M, Miyakawa Y an
d Mayumi M (1988) Typing hepatitis B virus by homology in nucleotide seq
uence: Comparison of surface antigen subtypes. J Gen Virol 69: 2575-2583
.Olerup O and Zetterquist H (1991) HLA-DRB1 * 01 subtyping by allele-specif
ic PCR amplification: a sensitive, specific and rapid technique.Tissue
Antigens 37: 197-204. Saiki RK, Bugawan TL, Horn G, TMullis KB and Erlich HA (1986) Analysis of
Generally amplified beta-globin and HLA-DQ alpha DNA with allele-sp
ecific oligonucleotide probes. Nature 324: 163-166. Saiki RK, Gelfland DH, Stoffel S, Scharf SJ, Higuchi R, Horn GT, Mullis
KB and Erlich HA (1988) Primer-directed theoretical amplification of DNA w
ith a thermostable DNA polymerase. Science 239: 487-491. Saiki RK, Walsh PS, Levenson CH and Erlich HA (1989) Genetic analysis of
amplified DNA with immobilizes sequence-specific oligonucleotide probes
Proc Natl Acad Sci USA 86: 6230-6234. Sambrook J, Fritsch E, Maniatis T (1989) Molecular Cloning: A Laboratory
^{Manual, 2 nd Edition, Cold Spring} Harbour Laboratory Press, Cold Spring
Harbor, NY, USA. Sanchez-Pescador R, Stempien MS, Urdea MS (1988) Rapid chemiluminescent
nucleic acid assays for detection of TEM-1 beta-lactamase-mediated penic
illin resistance in Neisseria gonorrhoeae and other bacteria. J Clin Mic
robiol 26: 1934-1938. Sanger F, Nicklen S and Coulson AR (1977) .DNA sequencing with chain-ter
Terminating inhibitors.Proc Natl Acad Sci USA 74: 5463-5467. Santamaria P, Boyce-Jacino MT, Lindstrom AL, Barbosa JJ, Faras AJ and Ri
ch SS (1992) HLA class II "typing": direct sequencing of DRB, DQB and DQ
A genes. Hum Immunol 33: 69-81. Santamaria P, Lindstrom AL, Boyce JM, Jacino MT, Myster SH, Barbosa JJ,
Faras AJ and Rich SS (1993) HLA class I sequence-based typing. Hum Immun
ol 37: 39-50. Stuyver L, Wyseur A, van Arnhem W, Hernandez F and Maertens G (1996) As
econd generation line probe assay for hepatitis C virus. J Clin Microbio
l 34: 2259-2266.Stuyver L, De Gendt S, Cadranel JF, Van Geyt C, Van Reybrouck G, Dorent
R, Gandjbachkc I, Rosenheim M, Opolon P, Huraux JM and Lunel F (1999) Th
ree cases of severe subfulminant hepatitis in heart transplanted patient
s after nosocomial transmission of a mutant hepatitis B virus. Hepatolog
y 29: 1876-1883.Swenson PD, Riess JT and Krueger LE (1991) Determination of HBsAg subtyp
es in different high risk populations using monoclonal antibodies. J Vir
ol Methods 33: 27-28. Telenta PFS, Poggio GP, Lopez JL, Gonzalez J, Lemberg A and Campos RH (1
997) Increased prevalence of genotype F hepatitis B virus isolates in Bu
enos Aires, Argentina. J Clin Microbiol 35: 1873-1875. Tran A, Kremsdorf D, Capel F, Housset C, Dauguet C, Petit MA and Brecho
t C (1991) Emergence of and takeover by hepatitis B virus (HBV) with rea
rrangements in the pre-S / S and pre-C / C during chronic HBV infection. JV
irol 65: 3566-3574. Urdea MS, Horn T, Fultz TJ, Anderson M, Running JA, Hamren S, Ahle D, Ch
ang CA (1991) Branched DNA amplification multimers for the sensitive, di
rect detection of human hepatitis viruses.Nucleic Acids Symp Ser 24: 197
-200. Van Geyt C, De Gendt S, Rombaut A, Wyseur A, Maertens G, Rossau R and St
uyver L (1998) A line probe assay for hepatitis B virus genotypes. In: T
herapies of viral hepatitis. pp. 139-145. Eds. RF Schinazi, JP Sommadoss
i and H Thomas.International Medical Press, London, UK.Wu D and Wallace B (1989) The ligation amplification reaction (LAR)-am
plification of specific DNA sequences using sequential rounds of templat
e-dependent ligation.Genomics 4: 560-569. Yoshida M, Kimura A, Numano F and Sasazuki T (1992) Polymerase-chain-rea
ction-based analysis of polymorphism in the HLA-B gene.Hum Immunol 34:
257-266.

[Brief description of drawings]

FIG. 1 is the complete nucleotide sequence of FR1 with amino acid translation of the four major ORFs. The target sequence of the HBV genotype G-specific probe and / or primer is indicated by a horizontal line. Nucleotides and nucleotide combinations unique to HBV genotype G are shown in bold and underlined and keyed, respectively.

FIG. 2 is the complete coding sequence of the HBV preC / C gene described by Tran et al. (1991).

FIG. 3 is the complete coding sequence of the HBV preS / S gene described by Tran et al. (1991).

FIG. 4 shows the genomic organization and open reading frame of the HBV genotype G virus compared to other genotypes. For each genotype, only one typical genome is included (genotype A: X70185; B: D00331; C.
: X01587; D: X72702; E: X75664; F: X75663; G
: FR1). Positions in the viral genome where extensive variability is observed are indicated by black zones. The numbering of nucleotides and amino acids is shown. (1): Most of the genotype G isolates have a translation stop codon, which affects the length of the preCore region. xxx: M in conserved YMDD motifs of different genotypes
-Indicates the amino acid numbering for the residues. The positions and directions of the primers shown in Table 1 are indicated by arrows.

FIG. 5 is an amino acid sequence alignment of preCore and Core regions of different HBV genotypes. For each genotype, only one typical genome is included (genotype A: X70185; B: D00331; C: X0158).
7; D: X72702; E: X75664; F: X75663; G: FR1).
The amino acid sequence is derived from the nucleotide sequence. X: Translation stopped.

FIG. 6: PreS1, preS2 and HBsA of different HBV genotypes
Amino acid sequence alignment of the open reading frame of g. For each genotype, only one typical genome is included (genotype A: X70185
B: D00331; C: X01587; D: X72702; E: X75664.
F: X75663; G: FR1). Top: preS1; Middle: preS2; Bottom: H
BsAg. The amino acid sequence is derived from the nucleotide sequence.

FIG. 7: HBV genotype A strain (HBVXCPS) and 7 newly identified genotype G HBV strains (RF1, FR2, US1, US3, US5).
, US6, US7, US10) for the alignment of the preCore / Core sequences. N indicates no nucleotide at this position.

FIG. 8: HBV genotype A strain (HBVXCPS) and 7 newly identified genotype G HBV strains (RF1, FR2, US1, US3, US5).
, US6, US7, US10), showing the alignment of the perS1 / preS2 / HBsAg sequences. N indicates no nucleotide at this position.

FIG. 9 is the phylogenetic distance obtained by the program DNADIST between different HBV genotypes. Thirty-six complete genomes (accession numbers are shown in Figure 10) were compared to the FR1 (genotype G) sequence. The average of each group is shown (A: ■; B:
●; C: ▲; D: X; E: *; F: ◆; G: +), and the standard deviation of the mean is also shown. The standard deviation gives the 95% confidence interval for these distances.

FIG. 10 is a phylogenetic tree of HBV genotypes. Viral isolates are indicated by their GenBank accession number. (A) Complete genome. (B) Surface gene open reading frame (including preS1 / preS2 / HBsAg).

FIG. 11: Some representative samples of genotypes A, B, C, D, E, F and G after hybridization of PCR products to genotyping LiPA designed in Example 4. It is the result obtained about. Piece G: Incubated with PCR fragment of FR1. The right strip shows the location of all applied probes. Probe numbering is described in Van Geyt et al. (1998). Conj. control: conjugate control; Ampl. control: amplification control (probe that reacts with all genotypes, present in conserved regions). The probe lines labeled "Target A" and "Target B" include probes that recognize the Target A and Target B regions shown in FIG. Probes 193 and 77 recognize only genotype A. The probe 78 recognizes only genotype B. Probes 153, 154 and 204 recognize only genotype C. Probes 165 and 208 recognize only genotype D. Probes 172, 177 and 213 recognize genotype E only. Probes 186, 216 and 219 recognize genotype F only. Probe 14
0 recognizes genotypes A and G. Probe 148 has genotypes A, B and G
Recognize. Probe 80 recognizes genotypes C, D, E and G. Probe 239 recognizes genotypes B, E and G.

FIG. 12 is the complete coding sequence of the HBV preC / C gene described by Bhat et al. (1990).

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁷ Identification code FI theme code (reference) A61K 45/00 A61P 31/20 4C084 48/00 C07K 14/02 4C085 A61P 31/20 16/08 4H045 C07K 14 / 02 C12N 1/15 16/08 1/19 C12N 1/15 1/21 1/19 C12P 21/02 C 1/21 C12Q 1/68 A 5/10 Z C12P 21/02 G01N 33/15 Z C12Q 1 / 68 33/50 Z 33/53 D G01N 33/15 M 33/50 33/576 B 33/53 37/00 102 C12N 15/00 ZNAA 33/576 5/00 A 37/00 102 A61K 37/02 ( 81) Designated countries EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE, TR), OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, MZ, SD, SL, SZ, TZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AE, AG, AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, BZ, CA, CH , CN, CR, CU, CZ, DE, DK, DM, DZ, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MA, MD, MG, MK, MN, MW, MX, MZ, NO, NZ, PL, PT, RO, RU , SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, TZ, UA, UG US, UZ, VN, YU, ZA, ZW (72) Inventor Seia de Ghent Belgium, Be-9070 Hesden, Tram Strato 88 Ar No. F term (reference) 2G045 AA25 AA40 BA13 BB03 CA25 CA26 CB01 CB03 CB04 CB09 CB14 CB21 DA12 DA13 DA14 DA36 FB02 FB03 FB04 FB07 4B024 AA01 AA11 BA33 CA04 CA09 DA02 DA05 DA06 DA11 DA12 EA02 EA04 GA11 HA12 4B063 QA13 QA19 QA20 QQ08 QQ4 CA4 CA0 CA4 CA0 CA4 CA04 CA0 CA4 CA04 CA06 CA06 CA06 CA04 CA04 CA06 CA02 AA72X AA90X AA96Y AB01 BA02 CA24 CA44 CA46 4C084 AA02 AA03 AA06 AA07 AA13 BA01 BA02 CA53 NA14 ZA752 ZB332 4C085 AA13 AA14 BB11 CC21 DD62 4H045 AA10 AA11 AA20 AA30 BA10 CA74 DA74 DA75 DA75 DA75 DA86

Claims (38)

[Claims] 1. At least 90%, more preferably 91%, most preferably 92% of the sequence defined in SEQ ID NO: 1; or (a) the sequence defined in SEQ ID NO: 1. A sequence having identity; or (c) a previously unidentified HBV genotype characterized by a sequence as a result of the degeneracy of the genetic code relative to the sequence defined in (a) and (b) And an isolated and / or purified HBV polynucleic acid that is unique to HBV and is phylogenetically distinct from the HBV genotypes A, B, C, D, E and F. 2. The following features: (a) having a length of 3248 base pairs; (b) encoding a translation stop codon at amino acids 2 and 28 of the preCore region; (c) 36 nucleotides at the N-terminal portion of the Core region. (D) having a 6 nucleotide deletion in the C-terminal portion of the HBcAg ORF (e) having a nucleotide deletion in at least one of the 3 nucleotide deletions in the N-terminal portion of the preS1 ORF having a nucleotide sequence of HBV genotype A , B, C, D,
The HBV polynucleic acid of claim 1, further characterized by being different from E or F. 3. The following sequences: SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO. : 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, at least one of claims 1 or 2. The HBV polynucleic acid according to item 1. 4. At least one nucleotide or nucleotides unique to previously unidentified HBV genotype G and different from the nucleotides of known HBV genotypes A, B, C, D, E or F. 4. A combination according to any one of claims 1 to 3, characterized in that it comprises a combination; or-is a universal fragment contained in the nucleic acid sequences of genotypes A, B, C, D, E, F and G. A fragment of the polynucleic acid of claim 1 or its complement, wherein said fragment is not equal to the preC / C sequence of SEQ ID NO: 7 or SEQ ID NO: 169 or the preS / S sequence of SEQ ID NO: 8. 5. A method for detecting the presence of the polynucleic acid according to any one of claims 1 to 4 in a biological sample. 6. The following steps:   (I) possibly extracting nucleic acids present in the biological sample;   (Ii) amplifying the nucleic acid;   (Iii) detecting amplified nucleic acid The method of claim 5, further comprising: 7. The following steps: (i) possibly extracting nucleic acids present in the biological sample; (ii) amplifying the nucleic acids; (iii) possibly suitable under denaturing conditions. Hybridizing the nucleic acid to one or more probes under various conditions, where the probes are possibly bound to a solid substrate; (iv) possibly washing under suitable conditions; 7. The method of any one of claims 5 or 6, further comprising (v) detecting the hybrids produced. 8. The following steps:   (I) possibly extracting nucleic acids present in the biological sample;   (Ii) amplifying the nucleic acid;   (Iii) Performing nucleic acid sequencing 7. The method of any one of claims 5 or 6, further comprising: 9. An oligonucleotide primer comprising the fragment of claim 4, which specifically sequences or specifically amplifies the nucleic acid or portion of the nucleic acid of any one of claims 1 to 3. An oligonucleotide primer that can act as a primer for. 10. An oligonucleotide probe containing the fragment according to claim 4, which is used as a hybridization probe for specifically detecting the nucleic acid or a part of the nucleic acid according to any one of claims 1 to 3. An operable oligonucleotide probe. 11. One of the target sequences from SEQ ID NO: 62 to SEQ ID NO: 154.
The oligonucleotide primer or the oligonucleotide probe according to any one of claims 9 to 10, further recognizing one of them. 12. A method according to claim 5, characterized in that at least one primer according to claim 9 or 11 and / or at least one probe according to claim 10 or 11 is used. HBV genotyping method according to item. 13. Any one of claims 5 to 8 and / or claim comprising at least one primer according to claim 9 or 11 and / or at least one probe according to claim 10 or 11. The diagnostic kit used in the method according to 12. 14. The following components: (i) when appropriate, means for releasing, isolating or concentrating nucleic acids present in the sample; (ii) primer set or primer mix; (iii) solid support. The at least one probe according to any one of claims 10 to 11 which specifically hybridizes with a nucleic acid characteristic of HBV genotype G fixed to the body, or a universal fixed to a solid support. A probe; (iv) a hybridization buffer, or components necessary for producing the buffer; (v) a washing solution, or components necessary for producing the solution; (iv) if appropriate, from the above hybridization A method according to any one of claims 5 to 7 and / or claim 12 comprising means for detecting the resulting hybrid. A diagnostic kit used in the described method. 15. A polypeptide having an amino acid sequence encoded by the polynucleic acid according to any one of claims 1 to 4. 16. SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO:
16. The polypeptide of claim 15, which comprises at least one of 5, SEQ ID NO: 6. 17. The polypeptide of claim 15, comprising at least one of the sequences SEQ ID NO: 155 to SEQ ID NO: 168. 18. The polypeptide according to claim 14, which is expressed by a recombinant method. 19. An expression vector comprising the polynucleic acid according to any one of claims 1 to 4 operably linked to prokaryotic, eukaryotic or viral transcriptional and translational control elements. 20. A host cell transformed with the expression vector of claim 19. 21. The following steps: (i) transforming a suitable cell host with the expression vector of claim 19; (ii) under conditions that allow expression of the polynucleic acid inserted in the expression vector. 19. The method for producing a recombinant polypeptide according to claim 18, which comprises culturing the transformed cell host; and (iii) collecting the polypeptide. 22. The following steps: (i) contacting a biological sample with the polypeptide of any one of claims 15-18; (ii) between the antibody and the polypeptide. A method of detecting an antibody present in a biological sample, comprising detecting the immunological complex formed. 23. The following steps: (i) contacting the biological sample with at least one polypeptide according to any one of claims 15 to 18; (ii) in the biological sample. A method for HBV genotyping a biological sample, which comprises detecting an immunological complex formed between an existing antibody and the polypeptide. 24. A diagnostic kit for use in a method according to any one of claims 22 to 23, comprising at least one polypeptide according to any one of claims 15 to 18, Possible diagnostic kit, wherein said polypeptide is bound to a solid support. 25. A ligand that specifically binds to the polypeptide according to any one of claims 15 to 18. 26. An antibody produced by immunization with at least one polypeptide according to any one of claims 15 to 18, which antibody specifically reacts with any of said polypeptides. 27. A method for detecting the polypeptide according to any one of claims 15 to 18, which comprises the following steps: (i) The ligand according to claim 25 which specifically binds to the polypeptide. Contacting said polypeptide; (ii) detecting the immunological complex formed between said polypeptide and said ligand. 28. A method for detecting the polypeptide according to any one of claims 15 to 18, which comprises the following steps: (i) the antibody according to claim 26 which reacts specifically with the polypeptide. Contacting said polypeptide; (ii) detecting the immunological complex formed between said polypeptide and said antibody. 29. A method for detecting HBcAg or HBeAg specific to the previously unidentified HBV genotype according to claim 1, comprising the following steps: (i) specifically binding to the polypeptide Contacting said polypeptide with a ligand according to claim 25; (ii) detecting the immunological complex formed between said polypeptide and said ligand. 30. A method for detecting HBcAg or HBeAg specific to the previously unidentified HBV genotype according to claim 1, comprising the following steps: (i) reacting specifically with the polypeptide 27. Contacting the antibody of claim 26 with the polypeptide; (ii) detecting an immunological complex formed between the polypeptide and the antibody. 31. A previously unidentified HBV present in a biological sample
A diagnostic kit used for genotype detection, comprising at least one ligand according to claim 25 or at least one antibody according to claim 26. 32. The polypeptide according to any one of claims 15 to 18, a ligand according to claim 25 and / or an antibody according to claim 26, which is used as an active substance in a vaccine or a medicine. 33. A polypeptide according to any one of claims 15 to 18 for producing a vaccine or a medicament for preventing or treating HBV infection.
Use of the ligand according to claim 25 and / or the antibody according to claim 26. 34. A pharmaceutical composition comprising at least one polypeptide according to any one of claims 15 to 18, a ligand according to claim 25 and / or an antibody according to claim 26 and a pharmaceutically acceptable carrier. object. 35. The pharmaceutical composition according to claim 34, which is used in a method for preventing or treating HBV infection. 36. A vaccine for immunizing a mammal against HBV infection comprising at least one polypeptide according to any one of claims 15 to 18 in a pharmaceutically acceptable carrier. 37. A method according to any one of claims 15 to 1 in a drug screening assay.
Use of the polypeptide according to any one of item 8. 38. Use of an HBV genotype G-infected clone in a drug screening assay.