JP2003514513A - Polymorphism in the closo gene - Google Patents

Abstract

  (57) [Summary] Methods and means are described for diagnosing a disease or a predisposition to a disease by genotyping an individual-derived closo gene and identifying the presence of one or more risk polymorphisms. These risk polymorphisms, either directly or indirectly, are associated with a predisposition to various chronic diseases, including osteoporosis, skin disorders, aging-related diseases, lung dysfunction, and metabolic syndrome. Therapeutic methods, kits for diagnostic purposes, and isolated closogenes containing all or a portion of a range of polymorphisms are also described, as well as methods for isolating molecules that regulate closogenes.

Description

Detailed Description of the Invention

FIELD OF THE INVENTION The present invention relates to methods for determining polymorphisms in genes, as well as means for using such methods in therapy. Specifically, the present invention provides for screening for the presence of polymorphisms in a gene,
A method for diagnosing a disease or a predisposition to a disease.

More particularly, the present invention relates to the diagnosis of a predisposition to all or a combination of diseases or disease states including metabolic syndrome, obesity, skin diseases, aging-related disease states such as osteoporosis and pulmonary dysfunction. . Furthermore, the present invention relates to treatments for the above disease states. Furthermore, the present invention relates to a kit for diagnosing susceptibility or predisposition to some diseases including aging-related diseases and components for inclusion in the kit.

Background of the Invention Due to the occurrence of chronic diseases, resource consumption becomes serious in both developing and developed countries. For example, pulmonary diseases such as asthma and emphysema and cardiovascular diseases such as arteriosclerosis are particularly relevant to public health. Also, chronic aging-related diseases are found in many metabolic disorders such as obesity and hypertension. As a result, the costs of national and international public health programs seeking to address the consequences of these diseases have been substantial. Therefore,
It would be desirable to provide screening tools for identifying those who are predisposed to the disease, and in particular for identifying which chronic diseases they are susceptible to.

Currently, treatment of chronic diseases is effective in slowing the progression of the disease, but only after the disease has been diagnosed. However, once onset, such treatments rarely reverse the effects of the disease. Prophylactic treatment of the entire population is expensive, and a significant drawback is that such treatment does not address the needs of the individual, and can even be superfluous or even counterproductive. Prolonged exposure to inadequate preventive measures may cause adverse side effects.

For example, prophylactic treatments such as hormone replacement therapy (HRT) are established therapies for diseases such as osteoporosis. These treatments have been shown to be effective in not further reducing bone mineral density (BMD), a feature found in women suffering from the disease. However, HRT is generally not able to reverse osteoporosis. That is, it cannot induce an increase in BMD in the patient.

Therefore, it would be particularly advantageous to be able to more accurately identify individuals who have a predisposition to a disease such as osteoporosis, ie are very susceptible to the disease. Appropriate therapy can then be administered before the onset of a disease such as osteoporosis.

A relatively new gene called "Kuroso" has been shown to be involved in the suppression of several aging phenotypes (Kuro-o et al., Nature, 390 , 45-51 ( 1997))
. These investigators revealed that mice deficient in closo gene expression show many conditions that can be associated with aging. This defect was thought to be due to a severe hypomorphic mutation in the 5'upstream region. As a result, this defect results in only a slight transcription of the closo gene, resulting in only a slight repression of the aging phenotype. Therefore, this type of defect, which can cause only a slight transcription of the klosso gene, is of limited relevance to the clinician.

The human croso gene has also been isolated (Matsumura et al., Biochem. Biophys.
Res. Comm., 242 , 626-630 (1998)). The isolated human croso cDNA encodes a protein consisting of 1,012 amino acids and shows about 86% homology to the mouse closoprotein (Kuro-o et al., Ibid.). An association between CA-microsatellite repeat units located downstream of the final exon of the human closo gene (ie, in the noncoding 3'region) and bone loss in postmenopausal women has also been reported (Ogata et al., Abs.
tract T302 ASBMR-IBMS Second Joint Meeting (1988)). These results suggest that the closo gene is involved in the development of senile osteoporosis in postmenopausal women.

However, it is more desirable to provide a means for diagnosing a person who is predisposed to a chronic disease such as osteoporosis, at a young age long before the effects of the disease become clear. Therefore, it would be advantageous to further provide a means for diagnosing a predisposition to reduced BMD, osteopenia and osteoporosis, so that these conditions can be diagnosed in young as well as old people.

The present invention aims to provide additional means for the diagnosis of diseases and / or predisposition to diseases. It is also an object of the present invention to provide a diagnostic and / or therapeutic method for diseases, which obviates or at least ameliorate the drawbacks of the prior art.

SUMMARY The present invention relates to methods for specifically identifying and / or diagnosing the presence or absence of one or more risk polymorphisms within a closo gene sequence. In particular, these methods relate to screens to determine the presence or absence of risk polymorphisms such as single nucleotide polymorphisms (SNPs). Also,
The method of the invention can also be used to determine the relative position of multiple risk polymorphisms within a closo gene sequence, providing a set of closo gene risk polymorphisms or haplotypes in an individual. The identified risk polymorphisms can be used to diagnose a disease and / or a predisposition to a disease by correlating the identified polymorphisms with congenital genetic factors and / or phenotypic traits. Polymorphisms identified in the Chroso gene are targets for discovery of agents (eg, modulators) that can be effectively used to prevent or delay or treat diseases or predispositions to diseases associated with these genetic mutations. Can also be used as

(Detailed Aspect of the Present Invention) In the first aspect of the present invention, there is provided a method for diagnosing a disease associated with a risk polymorphism in a closo gene or a predisposition to the disease, wherein the risk polymorphism is SNP Is provided, and (ii) genotyping the closo gene, and (ii) determining whether the genotype comprises a risk genotype.

In this embodiment, generally, the croso gene is in a sample taken from or taken from an individual.

In a second aspect of the present invention, a method for diagnosing a disease or a predisposition to a disease associated with a risk polymorphism in a closo gene derived from an individual, wherein the risk polymorphism is the 5'region of the closo gene, Is present in the region of the croso gene selected from the group consisting of exons of the closo gene and introns of the closo gene, and (i) genotyping the closo gene, and (ii) the genotype is a risk gene A method is provided that includes determining whether to include a type.

In this embodiment, generally the individual is a human. In this embodiment, preferably the risk polymorphism is in the 5'region of the Chroso gene.

[0016] In the third aspect of the present invention, there is provided a method for preventing and / or treating a disease or a predisposition to a disease associated with a risk polymorphism in a closo gene, wherein the risk polymorphism is an SNP risk polymorphism. And (i) genotyping the Kuroso gene, (
ii) determining the presence of a risk genotype, and (iii) preventing, delaying or predisposing the disease or a predisposition to the disease if the closo gene comprises a risk genotype,
Methods are provided that include administering treatments to alleviate or cure.

In a fourth aspect of the invention, a method of preventing and / or treating a disease or predisposition to a disease associated with a risk polymorphism in a closo gene from an individual comprising:
The risk polymorphism is present in the region of the croso gene selected from the group consisting of the 5'region, the exon of the closo gene and the intron of the closo gene, and (i)
Genotyping the closo gene, (ii) determining the presence of the risk genotype, and (iii) preventing, delaying, alleviating or treating the disease if the closo gene comprises the risk genotype. For that purpose, a method is provided that comprises applying a treatment.

In a fifth aspect of the present invention, there is provided a method of identifying a SNP risk polymorphism associated with a risk SNP risk polymorphism in a closo gene, comprising: (i) relating to a risk SNP risk polymorphism in a closo gene. Genotyping for SNP risk polymorphisms, and (i
i) A method is provided that comprises determining whether the genotype is linked to or in linkage disequilibrium (LD) with the risk genotype.

[0019] In a sixth aspect of the present invention, there is provided a method of identifying a risk polymorphism in a closo gene which is associated with a risk polymorphism in a closo gene from an individual, wherein the risk polymorphism is 5 'SNP polymorphism that is present in the region of the closo gene selected from the group consisting of the region, the exon of the closo gene and the intron of the closo gene, and (i) is associated with the risk SNP risk polymorphism in the closo gene. And (ii) determining whether the genotype is linked to or in linkage disequilibrium (LD) with the risk genotype. It

In the seventh aspect of the present invention, the cytosine at the 1122nd nucleotide in the closo gene, the deleted adenine at the 1337th nucleotide, the guanine at the 1686th nucleotide, the guanine at the 2406th nucleotide, the 12707th nucleotide At least one SNP risk polymorphism present at a position selected from the group consisting of cytosine, adenine at nucleotide 12753, cytosine at nucleotide 19489, thymine at nucleotide 961996, and thymine at nucleotide 20445. An isolated Kuroso gene is provided that comprises.

In an eighth aspect of the invention, comprising (i) means for genotyping the closo gene, and (ii) reference means for determining whether the genotype comprises a risk genotype , A kit for diagnosing a disease or a predisposition to the disease is provided.

Other aspects of the invention are set forth in the accompanying claims and the following description and drawings. These aspects are shown with separate chapter headings. However, the teaching of each chapter
You are not necessarily limited to that particular chapter heading.

Preferred Aspects In some embodiments, preferably the risk polymorphism is present in exons of the klosso gene. In some embodiments, preferably the risk polymorphism is present in an intron of the klosso gene. Preferably, the treatment is hormone replacement therapy (HRT) or a treatment comprising it. Preferably the treatment is a gene therapy or a treatment comprising it.

In a preferred embodiment of the invention the risk polymorphism is the SNP risk polymorphism. In a preferred embodiment of the invention, the SNP risk polymorphism is 5 of the human croso gene.
'Exists in the realm. In a preferred embodiment of the invention, the SNP risk polymorphism is in an exon of the human closo gene. In a preferred embodiment of the invention, the SNP risk polymorphism is present in the intron of the human croso gene. Preferably the polymorphism has one risk polymorphism correlation. In some applications, preferably the polymorphism has two risk polymorphism correlations.

[0025] Preferably, the risk polymorphism is nucleotide 1122 (5 'region), nucleotide 1337 (5' region), nucleotide 1686 (5 'region), nucleotide in the closo gene.
2406, nucleotide 12707 (exon 2), nucleotide 12753, nucleotide 194
It is selected from the SNPs of the invention present at positions 89 (exon 4), nucleotide 19969 (exon 4) and nucleotide 20445.

Preferably, the SNP risk polymorphism is cytosine at nucleotide 1122, deleted adenine at nucleotide 1337, guanine at nucleotide 1686, guanine at nucleotide 2406, cytosine at nucleotide 12707, 12753. It is present in a region selected from the group consisting of adenine at nucleotide number 19, cytosine at nucleotide position 19489, thymine at nucleotide position 19969, and thymine at nucleotide position 20445.

[0027] Preferably, the PCR technique is used for genotyping a nucleic acid containing an individual-derived closo gene or a part thereof. Preferably, screening is performed using PCR primers. Preferably, genotyping (which may be a screening method) is performed using allele-specific primers. Preferably, the results of genotyping of Kuroso polymorphisms can also be used to identify patients who are most likely to suffer the side effects of certain therapies. Preferably, the invention provides a diagnosis of predisposition to reduced BMD and osteoporosis.

(Advantages) The present invention has the following advantages in facilitating genotyping of closo gene polymorphisms. (i) A more accurate diagnosis of the predisposition to the disease state is provided. Thus, genotyping a single gene, such as the Kuroso gene, can also identify whether an individual is predisposed to some or all of many chronic diseases, such as age-related diseases. . (ii) It makes it possible to identify individuals who are predisposed to various chronic diseases or are at high risk for developing such diseases. Appropriate therapy can then be administered to prevent or treat these diseases or delay their onset.
(iii) Helps identify patients who are most likely to respond positively to certain therapies or treatment with particular therapies. (iv) It is possible to select the optimal clinical trial patient sample and thereby reduce the clinical trial size and / or shorten the clinical trial period.

[0029]   Other advantages are discussed and apparent in the discussion below.

Chloso Gene Wherever appropriate, the term “closo gene” refers to the closo gene (also referred to as a nucleotide sequence of interest (NOI)), and / or any biologically active fragment thereof and / or its expression product. It can be used interchangeably with the gene encoding (otherwise referred to as EP and / or any biologically active fragment thereof).

The term “NOI” includes DNA, RNA and single and double stranded sequences. It also includes sequences prepared by synthetic means. In some applications, the NOI has been isolated and / or purified.

The mouse and human croso genes have already been isolated (Kuro-o
Et al., Ibid.). A severe hypomorphic mutation believed to be in the 5'upstream region has been identified in the mouse croso gene and has been shown to be associated with an aging phenotype. Furthermore, a microsatellite repeat unit associated with senile osteoporosis has been identified downstream of the last exon in the human closo gene (Ogata et al., Ibid.). No polymorphisms are present in regions such as the 5'region, exon or intron regions of the human croso gene. Furthermore, single nucleotide polymorphisms (SNPs) have never been identified in either the mouse or human croso genes.

The present invention is based on the surprising finding that a risk polymorphism exists in this gene. Accordingly, the present invention provides methods for identifying and / or diagnosing polymorphisms in the closo gene that are associated with phenotypic traits present in certain age-related disease states. The polymorphisms can also be used to identify agents that can regulate the development of diseases associated with the phenotypic traits of such genetic variations.

The closo gene of the present invention differs from the wild type sequence. Here, the term "wild type" refers to the human croso gene, i.e., Matsumura et al., Biochem. Biophys. Res.
It means the published wild-type nucleotide sequence of the human croso gene published by Comm., 242 , 626-630 (1998). This sequence is in GenBank accession, accession number AB009
666 and AB009667.

Accordingly, some embodiments of the invention are based on methods of identifying a closo gene other than the wild-type closo gene. Genes to be identified include polymorphisms with risk polymorphisms, mutants or alleloso genes. It should be understood that these mutant closo genes can be identified by reference to either the wild type croso gene or another standard / control sequence.

Isolated Kuroso Gene The isolated Kuroso gene of the invention can be introduced into a vector and expressed in vitro, and / or in vivo, and / or ex vivo conditions. In this way, the expression products can be used for applications including, but not limited to, gene therapy, identification of potential drug targets in high throughput screening (HTS) assays and forensic analysis.

Preferably, the isolated closo gene of the present invention comprises cytosine at nucleotide 1122, deleted adenine at nucleotide 1337, guanine at nucleotide 1686, guanine at nucleotide 2406, and guanine at nucleotide 12707. It comprises at least one SNP selected from the group consisting of nucleotide cytosine, 12753 nucleotide adenine, 19489 nucleotide cytosine, 19969 nucleotide thymine, and 20445 nucleotide thymine.

[0038] Preferably, the isolated closo gene of the present invention is introduced into a vector and expressed under in vitro, and / or in vivo, and / or ex vivo conditions.

Polymorphism The term “polymorphism” is used herein to mean the coexistence of sequences of multiple shapes. The term "plurality" means two or more genetically determined distinct sequences or alleles in a population. The term "allele" means a variant of a gene that occurs at the same locus or a different sequence variant found in a given marker. The term "marker" means a specific site in a gene that shows sequence variation between individuals.

The term “sequence variation” includes, but is not limited to, single or multiple base changes including insertions, deletions or substitutions or a variable number of sequence repeat units. Here, the terms “sequence variation” and “allele” can be used interchangeably with the term “polymorphism”. The risk polymorphism of the present invention can be present in the klosso gene region. Such regions are called polymorphic regions. As used herein, the term "polymorphic region" is the locus or position at which diversity occurs.

Types of polymorphisms Several different polymorphisms have been reported. Polymorphic markers include restriction fragment length polymorphism (RFLP), tandem repeat repeat number (VNTR), single nucleotide polymorphism (SNP), hypervariable region, minisatellite, dinucleotide repeat, trinucleotide repeat, tetranucleotide. Includes repeats, simple repeats and inserts such as Alu. Polymorphic loci can be as small as one base pair. Single base pair changes can occur in codons.

As used herein, the term “codon” means a sequence of three contiguous nucleotides (trinucleotide sequence) that specifies the start / stop sites for amino acids or translation.

RFLP restriction fragment length polymorphism (RFLP) is described by Botstein et al., Am. J. Hum. Genet., 32 , 31.
It means a mutation in the DNA sequence that changes the length of the restriction enzyme fragment as described in 4-331 (1980). RFLPs create or eliminate restriction sites, thereby altering the length of restriction enzyme fragments. RFLPs have been widely used in human and animal genetic analysis (WO90 / 13668, WO90 / 11369, Donis-Keller, Cell 51 , 319-337 (19
87), Lander et al., Genetics, 121 , 85-99 (1989)). R with specific hereditary traits
The presence of this RFLP in an individual when associated with FLP can be used to predict the likelihood that this individual will exhibit this property as well.

Tandem Repeat Polymorphisms Other polymorphisms take the form of short tandem repeats (STR) containing tandem di-, tri- and tetranucleotide repeat motifs. These tandem repeats are also referred to as tandem repeat repeat number (VNTR) polymorphisms. VNTRs, in personal identification and paternity analysis (U.S. Pat. 5,075,217, Armor et al., FEBS Lett., 3 07, 113-115 (1992), Horn et al., WO91 / 14003, Jeffreys, EP 370,719) and a large number of genetic mapping studies Has been used.

Single nucleotide polymorphisms (SNPs) Other polymorphisms take the form of single nucleotide variations between individuals of the same species. Such single nucleotide mutations result from the substitution of one nucleotide for another at the polymorphic site or the deletion of nucleotides or the insertion of nucleotides relative to the standard allele. These single nucleotide variations are referred to herein as single nucleotide polymorphisms (SNPs). Such SNPs are much more common than RFLP, STR and VNTR. Some SNPs may also occur in protein-coding sequences, in which case one of the polymorphic forms may cause the expression of defective or other mutant proteins, which may lead to inherited disease. There is also. Other SNPs occur in noncoding regions. Some of these polymorphisms also express defective proteins (eg:
As a result of splicing defects). Other SNPs may have no phenotypic effect.

SNPs can be used similarly to RFLPs and VNTRs, but offer some advantages. SNPs occur more frequently and are more uniformly distributed throughout the genome than other polymorphisms. The higher frequency and homogeneity of SNPs means that this polymorphism is more likely to be found closer to the locus of interest than is the case with other polymorphisms. Also, the characterized different SNPs are identified more easily (eg, by using an assay with allele-specific hybridization probes or primers) than with other polymorphisms.

Risk Correlation As used herein, the term “one risk polymorphism correlation” means that an individual having a risk polymorphism associated with one disease state is suggested to be in the risk category for that disease state. To do. As an example, if a risk polymorphism in the closo gene associated with lung dysfunction is identified, it is suggested that the individual is at risk for lung disease (one risk polymorphism correlation).

As used herein, the term “two risk polymorphism associations” refers to a risk polymorphism that correlates to a first disease state (such as decreased BMD) and a second disease state (lower BMD and pulmonary dysfunction). It means that individuals with BMD are at a very high risk category for BMD, and thus have a high risk of osteoporosis (two risk polymorphism correlation).

In another embodiment of the invention, identifying at least two risk polymorphisms in the closo gene provides a means for diagnosing a disease or a predisposition to a disease. In this embodiment of the invention, the combination of data from at least two identified polymorphisms allows an accurate diagnosis of which disease state an individual is predisposed to.

In one embodiment, the invention provides a method of diagnosing a disease or disease predisposition by determining the genotype of the closo gene. Determining the genotype of the Kuroso gene allows either a direct diagnosis of a disease or a predisposition to a disease state.

Risk Polymorphism The term “risk polymorphism” is used herein to mean a polymorphism associated with a disease or predisposition to a disease or susceptibility to a disease.

Genotype The term “genotype” is used herein to mean a croso gene screened for the presence of at least one risk polymorphism at a particular locus. Unless otherwise stated, the screened closo genes can also be referred to as "genotyping closo genes."

Risk Genotype The term “risk genotype” is used herein to mean a croso gene containing at least one risk polymorphism associated with at least one disease phenotype or phenotypic trait.

Phenotype The term "phenotype" is used herein to mean any detectable property that is the result of one or more genes. Polymorphisms can contribute differently to the phenotype of an individual. Some polymorphisms occur within protein-coding (exon-like) sequences and contribute to the phenotype by affecting the protein structure. Other polymorphisms appear in non-coding regions (such as promoter regions or introns), but can exert phenotypic effects indirectly through effects on replication, transcription and translation. A single polymorphism can affect more than one phenotypic trait. Similarly, one phenotypic trait may be affected by polymorphisms in different genes. In addition, some polymorphisms predispose individuals to significant mutations that are causally associated with a phenotype or phenotypic trait.

Phenotypic traits The polymorphisms of the invention can contribute to a variety of individual phenotypes. Some polymorphisms are
It appears within a protein-encoding sequence (such as an exon) and contributes to the phenotype by affecting the protein structure. Other polymorphisms appear in non-coding regions (such as promoter regions or introns), but can exert phenotypic effects indirectly through effects on replication, transcription and translation. A single polymorphism can affect more than one phenotypic trait. Similarly, one phenotypic trait may be affected by polymorphisms in different genes. In addition, some polymorphisms predispose individuals to significant mutations that are causally associated with a phenotype or phenotypic trait.

Correlation of Polymorphisms with Phenotypic Traits As an example of the use of the invention (described in more detail below), common SNP risk polymorphisms in the human Closo gene were identified in a cohort of 1,435 twins, We assessed their association with multiple risk characteristics. In another example of the invention, the genotypes of the four SNP risk polymorphisms in the human croso gene were used individually or as a combination of haplotypes to diagnose several age-related disease states.

As used herein, the term “haplotype” means a collection or set of polymorphic sites that are inherited as a group (ie, in linkage disequilibrium (LD)) within a particular gene sequence, such as a closo gene sequence. Use it as what you do. The identification of disease-related haplotypes (such as the set of risk polymorphisms in LD) can help determine which of the risk polymorphisms are responsible for the disease, rather than merely linked to the disease-causing alleles. Facilitate. This information is then used to formulate appropriate treatment modalities. Furthermore, the determination of disease-related alleles in LD allows diagnostic tests for more than one risk polymorphism and helps eliminate the possibility of false positives.

By way of example, according to the present invention (described in further detail below), the genotypes of up to 3 SNP risk polymorphisms in the human closogene are used individually or as a combination of haplotype shapes to predispose to osteoporosis. A diagnostic method is provided.

Further by way of example, according to the present invention (described in more detail below), a predisposition to lung dysfunction using the genotypes of the three SNP risk polymorphisms in the human closo gene individually or as a combination of haplotype shapes. Diagnostic methods are provided.

As a further example, according to the present invention (described in more detail below), the genotypes of two SNP risk polymorphisms in the human closo gene are used individually or as a combination of haplotypes to predispose to aging-related skin diseases. A diagnostic method is provided.

As an example of the use of the invention described in more detail below, in the human Closso gene
Methods of diagnosing a predisposition to metabolic syndrome are provided that use the genotypes of the three SNP risk polymorphisms individually or as a combination of haplotypes.

Other Risk Factors An assessment of an individual's risk factors is calculated, with similar reference to other known genetic, physical, nutritional or other indications as appropriate. In this way, the invention can provide further information and on the basis of this information the individual risk of the disease or predisposition can be determined.

Genotyping The term “genotyping” is used herein to mean determining whether a closo gene contains at least one risk polymorphism. The term "genotyping" is synonymous with "genetic test", "genetic screening", "determining or identifying alleles or polymorphisms", "molecular diagnostics" or any other similar term.

Any method can be used as long as it can identify nucleotide differences in the appropriate sample DNA sequence. Indeed, many of the various known methods are suitable for use in genotyping (ie, genotyping) the closo genes of the present invention.
These methods include direct sequencing, PCR-RFLP, ARMS-PCR, Taqman ^™ Molecular b.
Examples include, but are not limited to, eacons, hybridization to oligonucleotides on a DNA chip or array, single nucleotide primer extension and oligoligation assays.

Genotype Screening In one embodiment of the present invention, a method for screening a gene polymorphism for a nucleic acid containing an individual-derived closo gene is provided. The method for screening a gene polymorphism for a nucleic acid containing an individual-derived closo gene requires amplification of the nucleic acid from a target sample derived from the individual.

Target Sample The target sample of the present invention may be any target nucleic acid containing a closo gene from the individual to be analyzed. Virtually any biological sample (other than pure red blood cells) is suitable for assaying such nucleic acids. For example, convenient target samples include:
Examples include, but are not limited to, whole blood, white blood cells, semen, saliva, tears, urine, feces, sweat, cheeks, skin and hair. For cDNA or mRNA assays, target samples are generally obtained from cells or organs that express the target gene.

Genotyping SNPs Many of the various methods are suitable for use in genotyping SNPs.
These methods include direct sequencing, PCR-RFLP, ARMS-PCR, Taqman ^™ , molecular beacons,
Hybridization to oligonucleotides on a DNA chip or array,
Examples include, but are not limited to, single nucleotide primer extension and oligoligation assays. Any method capable of identifying single nucleotide differences in the appropriate DNA sequence can be used as well.

Amplification The term “amplification” is used herein to mean nucleic acid replication with template specificity. Template specificity specifically relates to "target sample" or "target sequence" specificity. Target sequences are "targets" in the sense that they are sought to be sorted out from other nucleic acids. As a result, amplification technology
It has been designed primarily to screen this. Examples of amplification methods include polymerase chain reaction (PCR), specific allele polymerase chain reaction (PASA), ligase chain reaction (LCR), transcription amplification, self-sustaining sequence replication and nucleic acid-based sequence amplification (N
ASBA), but is not limited thereto.

Suitable means for TAQMAN ^™ genotyping may be based on Taqman ^™ technology. This Taqm
An ^TM technology is disclosed in U.S. Patents 4,683,202, 4,683,195 and 4,965,188. The use of uracil N-glycosylase included in the Taqman ^™ allele identification assay is disclosed in US Pat. No. 5,035,996.

PCR PCR technology is well known in the art (eg EP-A-0200362, EP-A-
0201184 and U.S. Pat. Nos. 4,683,195 and 4,683,202). The step of amplifying the target sequence includes a large excess of two oligonucleotide primers containing the desired target sequence.
It consists of introducing into a DNA mixture, followed by precise and sequential thermal cycling in the presence of DNA polymerase. By PCR, a single copy of a specific target sequence is obtained, for example, in genomic DNA by several different methodologies (hybridization with labeled probes, incorporation of biotinylated primers followed by avidin enzyme-linked detection,
And incorporation of ³² P-labeled deoxynucleotide triphosphates such as dCTP or dATP into the amplified sequence) to a detectable level. Apart from this, it is possible to amplify different polymorphic sites (markers) with differently labeled and thus respectively detectable primers. One approach for the analysis of multiple markers involves labeling each marker with a different fluorescent probe. The PCR product is then analyzed on a fluorescence-based automatic sequencer. In addition to genomic DNA, any oligonucleotide sequence can be amplified with the appropriate set of primer molecules. In particular, the amplified segment produced by the PCR process itself is itself an efficient template for subsequent PCR amplification. As an example, PCR can also be used to identify primers for amplifying the appropriate section in humans or in human-derived closo genes.

Primers The present invention also provides a series of useful primers. As used herein, the term “primer” refers to a suitable buffer under suitable conditions (ie, in the presence of four different nucleoside triphosphates and a substance for polymerization such as DNA or RNA polymerase or reverse transcriptase). Used as meaning a single-stranded oligonucleotide that acts in solution at a suitable temperature as an initiator of DNA synthesis along a template. The appropriate length of a primer depends on the intended use of the primer, but generally ranges from 15 to 30 nucleotides. In general, shorter primer molecules will require lower temperatures in order to form sufficiently stable hybrid complexes with this template. The primer need not reflect the exact sequence of this template, but must be sufficiently complementary to hybridize to the template.

The term “primer site” means the region of target DNA to which a primer hybridizes. The term "primer pair" refers to a primer set comprising a 5'upstream primer that hybridizes to the 5'end of a DNA sequence to be amplified and a 3'downstream primer that hybridizes to the complementary strand at the 3'end of the sequence to be amplified. Means The primer of the present invention may be DNA or RNA, and may be single-stranded or double-stranded. Alternatively, the primer may be of natural or synthetic origin, but will generally be prepared by synthetic means.

Primer Hybridization Conditions As used herein, the term “hybridization” means the pairing of complementary nucleic acids. Hybridization and hybridization strength (ie, strength of binding between nucleic acids) depends on the degree of complementarity between nucleic acids, the stringency of the conditions at that time, the melting temperature (Tm) of the forming hybrid and the G: C ratio within the nucleic acid. It is greatly affected by such factors. The term "stringency" is used herein with reference to the temperature at which nucleic acid hybridization is performed, ionic strength and the presence of other compounds such as organic solvents. Hybridizations are generally carried out under stringent conditions, for example at salt concentrations below 1M and at temperatures of at least 25 ° C. For example, 5 x SSPE (7
50 mM NaCl, 50 mM Na phosphate, 5 mM EDTA, pH 7.4) and a temperature of 25-30 ° C are suitable for allele-specific primer hybridization.

Allele-Specific Primer An allele-specific primer hybridizes to a site on the target DNA that overlaps the polymorphism and initiates amplification of only the allele to which the primer is perfectly complementary (Gibbs, Nucleic Acid Res., 17 , 2427-2448 (1989)). This primer can be used with a second primer that hybridizes to the distal site. If amplification proceeds from these two primers and it becomes possible to detect byproducts, it means that the specific allele is present. Controls were performed with the second pair of primers, one showing a single base mismatch at the polymorphic site and the other showing perfect complementarity to the distal site. This single base mismatch prevents amplification and no detectable product is formed. This method works best when the mismatch is contained at the most 3'position of the oligonucleotide with which the polymorphism is matched, because it provides maximum destabilization to extension by the primer (eg, , WO93 / 22456). Hybridization probes that can detect single base mismatches by specific hybridization are known in the art and Maniatas et al., Molecular Cloning: A Laboratory Manual, 2nd Edition,
It can also be prepared by the method described in Cold Spring Harbor (1989).

(I) PCR allele-specific primers Preferably, the screen is a PCR allele-specific primer designed to amplify a portion of the human croso gene containing either nucleotide 1686, nucleotide 12707, nucleotide 19489 or nucleotide 19969. Is carried out using a specific primer.

[0076]   An example of such a PCR primer has the following nucleotide sequence:

[0077] For amplification of a DNA sequence containing nucleotide 1686:     5 'AAATCTACTTTGTCTTCCTCG 3'     5 'AAAGGCACCTGTTTCTCCC 3'

[0078] For amplification of a DNA sequence containing nucleotide 12707:     5 'TGAATCTGAGAAAAAGTTCATC 3'     5'CATTTATGTTAGATAATCTTAGAG 3 '

[0079] For amplification of DNA sequences containing nucleotides 19489:     5 'AGTGGAATATTGTCTTCCTC 3'     5 'CCATAGGCTGCCACAGGG 3'

[0080] For amplification of a DNA sequence containing nucleotides 19969:     5 'CACCATCCTGCAGTACTATC 3'     5 'TTTGGTTCAGCCAGTCCCTC 3'

In one embodiment, preferably the PCR primer is nucleotide 1686.
Made to amplify a portion of the human croso gene containing In one embodiment, preferably the PCR primer is nucleotide 12707.
Made to amplify a portion of the human croso gene containing In one embodiment, preferably the PCR primer is nucleotide 19489.
Made to amplify a portion of the human croso gene containing In one embodiment, preferably the PCR primers are nucleotides 19969.
Made to amplify a portion of the human croso gene containing Other primers are shown in Table 4.

Detection of Polymorphisms in Amplified Target Sequences Amplified base sequences are used for allele-specific probes, tiling arrays, direct sequencing, denaturing gradient gel electrophoresis and single-stranded conformation polymorphisms (SCCP).
It can be detected using analysis, but is not limited to these.

Allele-Specific Probes Allele-specific probes can be made that hybridize to a target DNA segment from one individual, but not to a corresponding segment from another individual, for the reason , Due to the presence of different polymorphisms in each segment from the two individuals.

As used herein, the term “probe” refers to an oligonucleotide (ie, a sequence of nucleotides) that is naturally derived, such as in a purified restriction enzyme digest, or synthetically produced, which is It can hybridize to one target oligonucleotide sequence. The probes are useful in detecting, identifying and isolating specific gene sequences. The hybridization probe of the present invention is generally an oligonucleotide capable of binding to a complementary strand of a nucleic acid in a base-specific manner.

The probes of the invention can be labeled with any “reporter molecule” and can be detected with any detection system including enzymes (eg ELISA and enzyme-based histochemical assays), fluorescence, radioactivity and chemiluminescence systems. It is possible, but not limited to these. The target sequence of interest (ie, the sequence to be detected) can also be labeled with a reporter molecule. The present invention is not limited to any particular detection system or label.

The hybridization conditions selected for the probes of the present invention are sufficiently stringent that there is a significant difference in hybridization intensity between alleles, preferably a dual response in principle, whereby , The probe hybridizes to only one of the alleles. General hybridization conditions are stringent conditions that can determine a single base pair mismatch as described above for the allele-specific primers of the invention.

Tiling Array Polymorphisms of the invention can also be identified by hybridization of nucleic acid arrays, some examples of which are described in WO95 / 11995. The term "tiling"
Refers generally to the synthesis of a defined set of oligonucleotide probes composed of a sequence complementary to the sequence to be analyzed (target sequence) as well as a preselected variant of that sequence. This variant usually contains substitutions by one or more nucleotides at one or more base positions.

Direct Sequencing Direct analysis of polymorphic sequences of the present invention may be performed by the dideoxy chain termination method or Maxam-
Gilbert method (Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd edition,
CSHP, New York (1989)) or, for example, ABI Prism 37
Using Big Dye Terminator cycle sequencing reaction analyzed by 7 sequencer A
This can be achieved using BI's standard sequencing method.

Denaturing Gradient Gel Electrophoresis The amplification products of the invention are produced using PCR and can also be analyzed using denaturing gradient gel electrophoresis. Different alleles have different sequence-dependent melting properties and electrophoretic mobility of DNA in solution, edited by Ehrlich, PCR Technology, Principl.
es and Applications for DNA Amplification, Chapter 7 (WH Freeman and C
o, New York (1992)).

Single Strand Conformation Polymorphism (SCCP) Analysis Alleles of the target sequence of the present invention also contain single-strand conformation polymorphisms (SC).
CP) analysis can be used to reveal differences, where Orita et al., Proc. Nat. Acad. Sc
i., 86 , 2766-2770 (1989), base differences are identified by alterations in electrophoretic mobility of single-stranded PCR products. The amplified PCR product is as described above,
It can be produced and heated or otherwise denatured to form a single-stranded amplification product.
Single-stranded nucleic acids reform or form secondary structures that are partly sequence dependent. The different electrophoretic mobilities of single-stranded amplification products can be related to differences in base sequence between alleles of the target sequence.

Identification of Differences between Test and Control Sequences These detection procedures for amplified nucleic acid sequences are used to identify mutations at one or more positions between the standard and test base sequences, or Compare different polymorphisms in genes.

Standard Base Sequence As used herein, the term “standard base sequence” refers to a control, such as a control DNA sequence, which represents one or more individuals homozygous for each of the alleles tested in the assay. Used to mean a base sequence. As an example, the control DNA sequence is (i)
Genomic DNA from homozygous individuals, (ii) P containing related SNPs amplified from homozygous individuals
CR products, or (iii) including, but not limited to, DNA sequences containing related SNPs cloned into a plasmid or other suitable vector. The control sample is also an allele ladder containing multiple alleles from a known set of alleles.
It can also be a (ladder). There can also be multiple control samples, each containing a different allele or set of alleles. Other standard / control samples generally include diagram representations, written representations, templates or any other means suitable for identifying the presence of polymorphisms in PCR products or other nucleic acid fragments. The terms "standard base sequence", standard sample and control sample are used interchangeably throughout the text.

In one embodiment, cytosine at nucleotide 1122, deleted adenine at nucleotide 1337, guanine at nucleotide 1686, guanine at nucleotide 2406, cytosine at nucleotide 12707, nucleotide 12753. Adenine, 19489 nucleotide cytosine, 19969 nucleotide thymine, and 20445 nucleotide thymine selected from the group consisting of at least one SNP selected from the group consisting of, for example, a kit of the present invention. It can also be used as the standard fragment used. The canonical sequence may be a wild type croso gene sequence. Alternatively, the standard sequence may be a consensus wild type croso gene sequence.

The term “consensus” is used herein to mean an idealized sequence of nucleotides or their constituent bases, which refers to the nucleotide most likely to occur at each position in the sequence. .

5 ′ Region The term “5 ′ region” is used herein to mean a region that is 5 ′ to the first exon of a structural gene such as the closo gene. The term "5 'region" includes, but is not limited to, 5'non-coding regions and regions containing putative promoter regions or promoter elements.

Promoter The term “promoter” is used herein to mean a DNA segment containing the initiation signal for RNA polymerase and thus promoting transcription at the start of the structural gene. It also contains binding sites for transcription factors that regulate gene expression. The promoter DNA segment is generally located in the 5'region relative to the structural gene. That is, the promoter DNA segment is generally located in the 5'region.

Exons The term “exon” is used herein to mean any segment of the disrupted gene shown in the mature RNA product. For example, exons are internal regions of a gene that encode a polypeptide chain or domain. In general, the mature protein is composed of several domains encoded by different exons within a single gene.

Intron The term “intron” is used herein to mean any segment of the split gene that does not appear in the mature RNA product. The intron, which is part of the primary nuclear transcript, is excised from the mRNA during mRNA production and then transported to the cytoplasm.

Linked As used herein, the term "linked" refers to the tendency of genes, alleles, loci or genetic markers to be inherited together as a result of their location on the same chromosome (ie, alleles are related to each other. Co-inherited or co-isolated). Linkage between genes, alleles, loci or genetic markers can also be measured by the percent recombination between two genes, alleles, loci or genetic markers. In a further embodiment, the present invention provides that a plurality of risk polymorphisms that are either themselves linked to a disease state or are in risk disequilibrium (LD) with other risk polymorphisms. By combining the information of
Alternatively, diagnosing the predisposition to the disease is provided.

Linkage Disequilibrium (LD) As used herein, the term “linkage disequilibrium” refers to the co-inheritance of two alleles at a higher frequency than predicted from the respective frequencies of occurrence of each allele in a given control population. Used to mean that That is, LD means the tendency that a specific allele co-occurs at a higher frequency than that predicted by chance. The cause of imbalance is often unknown. It may be due to some allelic combination or to a new mix of genetically heterogeneous populations. In addition, for markers that are very closely linked to the disease gene, if the disease mutation appears in the not too distant past and sufficient time has passed that recombination is achieved by recombination in a small region of the chromosome. If not, an association of this disease gene with the allele (or allele group) is predicted.

Linkage Equilibrium (LE) Alleles at a given locus are linked (if they occur at the expected frequency)
LE). The frequency of occurrence of two independently inherited alleles is the second allele frequency × the first allele frequency. That is, alleles are in linkage equilibrium if the frequency of a particular set of alleles is the product of their respective population frequencies.

Vector As is well known in the art, a vector is a biological means that allows or facilitates the transfer of one entity from one environment to another. Examples of vectors used in the recombinant DNA method include, but are not limited to, plasmids, chromosomes, artificial chromosomes or viruses.

The term “vector” includes expression and / or transformation vectors. The term "expression vector" means a construct capable of expression in vivo or in vitro / ex vivo. The term "transformation vector" means a construct that can be delivered from one species to another.

Vector Delivery Vectors containing the nucleotide sequences (NOIs) of the present invention may be prepared using various techniques known in the art, such as transfection, transformation, electroporation and gene gun transformation. It can be introduced into a suitable host cell.

The term “transfection” is used herein to mean the process of delivering a gene to a target mammalian cell using a non-viral vector. Common transfection methods include electroporation, gene gun,
Lipid-mediated transfection, Compressed DNA-mediated transfection, Liposomes, Immunoliposomes, Lipofection, Cationic substance mediated, Cationic surface amphiphiles (CFAs) (Nature Biotechnology, 14 , 556 (1996)), spermine, cationic lipids Or polyvalent cations such as polylysine, 1,2-bis (oleoyloxy) -3- (trimethylammonio) propane (DOTAP) -cholesterol complex (Wolff and Trubetskoy, Nature Biotechnology, 16 , 421 (1998)) And combinations thereof.

Host Cells A wide variety of host cells, both prokaryotic and eukaryotic, can be used for expression of the NOI of the invention. Suitable host cells include bacteria such as E. coli, yeast, fungi, insect cells, generally immortalized mammalian cells such as mouse, CHO, human and monkey cell lines and derivatives thereof. Preferred host cells can modify the NOI expression product (EP) to produce the appropriate mature polypeptide.
Modifications include, but are not limited to, glycosylation, ubiquitination, disulfide bond formation and general post-translational modifications.

Expression Vectors Preferably, the base sequence of interest (NOI) inserted into the vector is operably linked to control sequences which allow expression of the coding sequence by the host cell.
That is, this vector is an expression vector. The expression product (EP) produced by a host recombinant cell may be secreted or may be internal to the cell, depending on the sequence and / or the vector used. As will be appreciated by those in the art, NOI-containing expression vectors can be designed to have a signal sequence that directs secretion of the NOI coding sequence through a particular prokaryotic or eukaryotic cell membrane.

In Vitro / In Vivo / Ex Vivo Expression Regulation The present invention also encompasses gene therapy to control NOI in vitro / in vivo / ex vivo. For example, regulated expression can be achieved by administering a compound that binds to the NOI or a regulatory region that is transposed to the NOI or its corresponding RNA transcript and modulating the transcription or translation rate.

Control Sequences Control sequences which can be operably linked to the NOI coding sequence include promoters / enhancers and other expression control signals. These control sequences can be selected as appropriate for the host cell and / or target cell prepared for using the expression vector. By modifying the regulatory sequences, eg by adding further transcriptional regulatory elements, the level of transcription directed by the regulatory sequences can be made more reactive towards transcriptional regulators.

[0110] The term "operably linked" means that the described components are in a relationship that causes them to function as intended. A control sequence “operably linked” to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under conditions suitable for the control sequences.

The NOI of the invention can be expressed in an expression vector in which the mutant gene is operably linked to the native promoter or other promoters. Usually the promoter is a eukaryotic promoter for expression in mammalian cells. Transcriptional control sequences generally include heterologous promoters, and enhancers that are recognized by the host, as appropriate. Appropriate promoters such as trp, lac, phage promoters, glycolytic enzyme promoters and tRNA promoters are selected depending on the host selected. Commercially available expression vectors can be used as well. Vectors also include, but are not limited to, host recognition replication systems, amplifiable genes, selectable markers, host sequences useful for insertion into the host genome.

EP Isolation The expression product (EP) is described in Jacoby, Methods in Enzymology, Vol. 104, Academic Pr.
ess, New York (1984), Scopes, Protein Purification, Principles and Pract
ice, 2nd edition, Springer-Verlag, New York (1987) and Deutscher, Guide to
Protein Purification, Methods in Enzymology, Vol. 182 (1990), isolated by conventional protein biochemistry and purification procedures and free of cellular constituent contaminants up to 80, 95 or 99% parenchyma. A pure product can be obtained. If EP is secreted, it can be isolated from the supernatant in which the host is growing. If not secreted, EP can be isolated from host cell lysates.

Transgenic Animals In addition, the present invention provides transgenic non-human animals capable of expressing the NOIs of the invention and / or inactivating and / or removing one or more NOIs. Expression of the NOI is usually achieved by microinjecting the construct into the zygote, which is operably linked to the promoter, and optionally an enhancer. Hogan et al., Manipulating the Mouse Embryo, A Labora
See tory Manual, Cold Spring Harbor Laboratory. The NOI can be inactivated by inserting a positive selection marker into the cloned NOI to produce an inactivated transgene. See Capecchi, Science, 244 , 1288-1292 (1989). This transgene is then introduced into embryonic stem cells, where homologous recombination with the endogenous mutant gene occurs. Preferred animals include mice and other rodents. Such animals provide a useful drug screening system.

Biologically Active Fragments Substantially full-length EP (eg, polypeptide) expressed by a NOI of the invention.
In addition, the EP of the present invention also includes biologically active fragments or analogs thereof that include organic molecules that mimic the interaction of the peptides. EP for biologically active fragments
To any portion of the full-length polypeptide which confers on it a biological function such as ligand binding and antibody binding. Ligand binding includes binding with nucleic acids, proteins or polypeptides, biologically active small molecules or large cell structures.

Antibodies Polyclonal and / or monoclonal antibodies that specifically bind to the NOIs of the invention but not to the corresponding wild-type gene product are provided. Antibodies can be made by injecting NOI EP or synthetic peptide fragments thereof into mice or other animals. Monoclonal antibodies are, for example, Harlow & Lane, A
ntibodies, A Laboratory Manual, Cold Spring Harbor Press, New York (1988
), Goding, Monoclonal antibodies, Principles and Practice, 2nd edition, Academ
Screening can be performed as described in ic Press, New York (1986). Monoclonal antibodies can test for specific immunoreactivity to NOI EP and its lack of immunoreactivity to the corresponding wild-type gene product. These antibodies are useful in diagnostic assays for the detection of mutations or as active ingredients in pharmaceutical compositions.

Screening The NOIs of the invention and / or cell lines expressing the NOIs of the invention can be used to screen for agents that can affect the expression of the sequences and / or the biological activity of the EPs. .

As used herein, the term “drug” refers to compounds, mixtures of compounds, peptides, organic or inorganic molecules, biopolymers, and biological materials such as bacteria, fungi or animal (especially mammalian) cells or tissues. Included extracts, but are not limited thereto.

In one embodiment, the screens of the invention can identify agonists and / or antagonists of the expression products of the invention. In another embodiment, the NOIs of the invention can be used in various drug screening techniques. By way of example, the NOI or its EP used in such a test can be free in solution, immobilized on a solid support, retained on the cell surface or present intracellularly. The binding specificity / loss of biological activity or the formation of a binding complex between the NOI and / or its EP and the test substance can be measured.

As another screening technique, there is provided a high throughput screening (HTS) of substances having an appropriate binding affinity for NOI of the present invention based on the method described in detail in WO84 / 03564. It The assay method of the present invention is expected to be suitable for small and large scale screening of test compounds and quantitative assays.

Further, the present invention provides methods for identifying compounds for the prevention and / or delay and / or alleviation and / or treatment of diseases and / or predispositions to diseases. This method involves administering (a) a compound to animal tissue, and (
b) A method comprising determining whether the compound modulates the NOI of the invention.

In the use cases of the invention, various compounds are administered to animal cells (in vitro) in tissue culture. In this way, thousands of potential small molecule modulators of closo gene expression and function can be screened. Modulation of this closo gene can be determined by either assessing whether the candidate compound affects the expression level of the closo gene or whether the function of the closo gene product (EP) is affected. Also according to the present invention, candidate compounds capable of modulating the closo gene are administered to animal tissues in vivo, i.e. the compounds are administered to living animals and their effects are determined by conventional methods such as histopathological analysis of tissues. Evaluating is provided.

Diagnosis of Diseases Methods of diagnosing predisposition to disease states include determining whether an individual has a published wild-type sequence or a polymorphism at one or more polymorphic sites. In this regard, an individual's genotype is compared to this individual's phenotype. As used previously in this text, the term "phenotype" means any detectable characteristic of an individual that is the result of one or more genes.

Predisposition to Disease As used herein, the term “predisposition to disease” means that certain risk polymorphisms are clearly associated with certain disease states. Therefore, they are over-represented in individuals with the disease as compared to healthy individuals, and those individuals may be at increased risk of developing the disease, or may develop more severe symptoms or particular types of disease. It suggests that you may not.

Disease States Disease states that may be associated with risk polymorphisms in the closo gene include metabolic syndrome,
Obesity, skin disorders, skin atrophy, decreased bone mineral density (BMD), osteopenia, osteoporosis, aging-related disorders, cancer, cardiovascular disorders, blood pressure disorders, emphysema and pulmonary dysfunction and / or their major constituents Diseases of.

In one embodiment of the invention, an individual's predisposition to osteoporosis can be assessed by determining whether the individual carries a risk polymorphism in the closo gene.

Treatment Accordingly, the therapeutic strategies of the present invention are tailored to the needs of the individual being treated and minimize exposure to adverse side effects. Thus, the present invention can be used to identify which individuals are most likely to benefit from, for example, gene therapy. Gene therapy techniques include, but are not limited to, techniques that replace defective genes such as the closo gene, and / or suppress the expression of this gene and / or the function of gene products.

In another embodiment, a method of treating an aging-related disease in an individual according to the invention, comprising: (a) determining the genotype of the closo gene, And (c) if the genotype is a risk genotype, then treating the human to prevent premature onset of the aging-related disease. .

Combination Therapy The diagnostic methods of the present invention are suitable for use in combination with various treatments on humans suffering from or predisposed to disease states such as osteoporosis. These treatments include hormone replacement therapy and / or administration of bisphosphonates.

Bisphosphonate Treatment Another suitable treatment (for osteoporosis) is the use of bisphosphonates. There are two specific treatments with xanthine oxidase inhibitors or substituted benzodiacepines, described in U.S. Pat.No. 5,436,258 and U.S. Pat.
The contents are referred to and quoted in the text. Further treatments are known to those of skill in the art.
Strong treatment methods include, for example, JP-A-9-30977, WO97 / 06254, JP-A-9-25293 and WO97 / 0.
4799, WO97 / 03060, and JP-A-9-12592. Currently approved treatments for osteoporosis include the use of estrogen with or without progesterone, the use of selective estrogen receptor modulators, the use of anabolic steroids such as nandrolone, bisphosphonate alendronate and etidronate. The use of disodium, the use of salcatonin and the administration of calcium nutrients are mentioned.

Hormone replacement therapy Hormone replacement therapy (HRT) can be used to contain the onset of a disease (such as osteoporosis), and to delay or even prevent the disease, revealing symptoms. It is an example of preventive therapy that can be carried out before. However, HRT use has its own increased risk of breast cancer complications. The present invention provides the advantage that the increased breast cancer risk associated with HRT is acceptable only to women who are known to have a potential predisposition to osteoporosis.

Osteoporosis and BMD Reduction Osteoporosis is a common condition characterized by low bone mass, deterioration of bone tissue ultrastructure and increased risk of fracture. Osteoporotic fracture risk is associated with bone mineral density (BMD) and is under genetic control.

In one embodiment, the invention provides: (a) genotyping the closo gene in said human; (b) determining whether said genotype comprises a risk genotype; and (c) If the genotype comprises a risk genotype, prevention of the disease,
There is provided a method of treating a disease in a human comprising the step of applying treatment to the human to delay or alleviate.

Administration of therapeutic agents for osteoporosis All routes of administration are suitable for drug treatment of osteoporosis, including oral administration, intravenous, intraperitoneal, intramuscular and subcutaneous injection, intranasal and topical administration. Common dosage regimens and treatment durations are described in the British National Formula, cited in the text for reference.
As described in clinical reference books such as ry. None of the osteoporosis drugs currently approved by the US Food and Drug Administration (FDA) for postmenopausal women are approved for men. Testosterone replacement therapy can be prescribed to men with low testosterone levels. Calcitonin slows bone loss,
Or, it is a drug that stops it, which can relieve fracture pain in some patients. Calcitonin is FDA approved for the treatment of osteoporosis in postmenopausal women. Although its effect in men has not been studied, the finding is that
It suggests that it can act in men as well as in women. Calcitonin is available as an injection and as a nasal spray. Its use is described in US Pat. No. 5,440,012.

Bisphosphonates are drugs that have been shown to help retain and increase bone mineral density by slowing or arresting bone loss. The FDA has approved a bisphosphonate known as alendronate for the treatment of postmenopausal osteoporosis in women. There are other bisphosphonates in development,
In fact, etidronate was licensed, but only outside the United States. Sodium fluoride has recently been recommended for approval by the FDA Commission. The parathyroid hormone calcitriol and others are also drugs under consideration. It will take some time before the research findings on these prescriptions are available. Bone mineral density reduction can also be slowed by intake of calcium nutrients, with 1000 mg of calcium per day for women undergoing estrogen replacement therapy and 1500 mg of calcium per day for women not receiving estrogen therapy.

Modulators Examples of modulators of the closo gene of the present invention include, but are not limited to, compounds and agents that affect gene expression and activity and / or amount of the expressed gene product. General modulators suitable for use in the present invention include closo agonists and / or antagonists of either closo genes or closo gene products, high and low molecular weight inhibitors of closo gene expression or function, closo genes or transcripts. Antisense sequences including antisense oligonucleotides, antibodies, closo gene product binding proteins including dominant negative forms of closo gene products involved in oligomerization, and closo gene product kinases, or fragments, variants and derivatives thereof Be done.

Examples of modulators according to the present invention are antisense oligonucleotides which bind to closo mRNA and prevent or reduce its transcription. This modulator can be used to reduce the activity and / or amount of the closogene EP.

The term “antisense” is used herein to mean a nucleic acid strand that is complementary to the “sense” strand. The designation (-) is sometimes used to mean the antisense strand, and the designation (+) is sometimes used to mean the sense (or positive) strand.
The antisense nucleic acid against closo-NOI of the present invention can be prepared by any method, including synthesizing closo-NOI in the opposite direction to the promoter capable of synthesizing the coding strand. This transcribed strand is mixed with, for example, native mRNA produced by the cell to form a duplex. These duplexes can then block either further transcription of the mRNA and / or its translation.

Another suitable modulator is EP itself, which can be administered by injection and is used to increase the activity and / or amount of Chroso EP. In a further embodiment of the invention, there is provided a method of preventing and / or treating a disease comprising administering a modulator of closo NOI.

Administration of Modulators The closogene modulators of the present invention are also suitable for many disease states. Such modulators are suitable for either prophylactic administration or after the disease has been diagnosed. The route of administration is appropriately selected according to the disease or condition to be treated, but general routes of administration of the modulator of the present invention include oral, rectal, intravenous, parenteral, intramuscular and subcutaneous routes, It is not limited to these. The present invention also provides closomodulators that are administered as either DNA or RNA, ie, in the form of gene therapy or as proteins. The modulator can be delivered directly into cells by means including, but not limited to, liposomes, viral vectors and coated particles (gene gun).

The modulators of the invention are suitable for treating a variety of diseases and conditions.
In some individuals, a combination of diseases is present or expected, in others only one disease is diagnosed. Diseases and conditions for which closomodulators can be used appropriately include metabolic symptoms, diabetes, obesity, skin diseases, skin atrophy, decreased bone mineral density, osteopenia, osteoporosis, aging-related diseases, cancer, cardiovascular disease, blood pressure disorders. , Diseases such as emphysema and lung dysfunction are commonly included. Aging-related diseases and syndromes such as metabolic syndrome have been clinically found to manifest as a wide range of physical conditions, and thus include other conditions, some of which are described in more detail in the Examples and below. It is described in the figure.

The present invention also provides a kit for diagnosing a disease or a predisposition to a disease, which kit generally comprises (a) means for determining the genotype of a closo gene in humans, and (b) a risk. Reference means for identifying the presence of the polymorphism are included.

Kits Generally, kits of the invention will include all of the components necessary to determine the presence / absence of a polymorphism of the invention in an individual. These components include PCR primers, PCR enzymes, restriction enzymes, means for DNA purification, means for sampling DNA, and other useful for determining polymorphic differences between the wild-type closo gene and the allelic closo mutant of the invention. Including, but not limited to, any ingredient. By way of example, the kit comprises at least one allele-specific oligonucleotide primer and / or allele-specific oligonucleotide probe. Apart from this, this kit is
It contains one or more pairs of allele-specific oligonucleotides that can be hybridized to different polymorphic forms. In the kit, this allele-specific oligonucleotide may be immobilized on a substrate. By way of example, the substrate can include an allele-specific oligonucleotide probe for at least detecting SNP risk polymorphisms such as those mentioned above. Optional additional components of the kit include, for example, the means used to label (eg, where the label is biotin,
Avidin enzyme conjugate and enzyme substrate and chromophore), and a suitable buffer for reverse transcription, PCR, or hybridization reactions. The control / standard sample can include the wild-type klotho gene or can contain alleles known to be associated with age-related diseases. Alternatively, this standard / control sample may contain the actual PCR product produced by amplification of the relevant disease-related allele, or may be from an individual with a known particular disease-related allele pair. It can contain genomic or cloned DNA. Also, the kit will typically include a manual for performing the method. The kit can also be used for detecting and measuring risk polymorphisms such as SNPs in biological fluids and tissues, and for measuring the location of SNPs in tissues. In addition, this kit is
It can also be used simultaneously or sequentially with the modulator.

Summary In summary, methods and means for diagnosing a disease or a predisposition to a disease by genotyping a closo gene from an individual and identifying the presence of one or more risk polymorphisms. Is disclosed. These risk polymorphisms, either directly or indirectly, are associated with a predisposition to various chronic diseases including osteoporosis, skin disorders, age-related diseases, pulmonary dysfunction and metabolic syndrome. Also disclosed are methods of treatment, kits for diagnostic purposes and methods of isolating isolated crosogenes, including all or part of various polymorphisms, and molecules that regulate closogenes.

The invention, in some aspects, is a method of diagnosing a disease or predisposition to a disease associated with a risk polymorphism in a closo gene, wherein the risk polymorphism is a SNP risk polymorphism, and (i) determining the genotype of the Kuroso gene, and (ii
) A method comprising determining whether the genotype comprises a risk genotype.

The present invention also provides a method for diagnosing a disease or a predisposition to a disease associated with a risk polymorphism in a closo gene derived from an individual, wherein the risk polymorphism is a closo gene
A 5'region, an exon of a closo gene and an intron of the closo gene, which is present in a region of the closo gene selected from the group consisting of: (i) genotyping the closo gene; and (ii) the genotype A method comprising determining whether to include a risk genotype.

The present invention also provides a method of preventing and / or treating a disease or a predisposition to a disease associated with a risk polymorphism in a closo gene, wherein the risk polymorphism is an SNP risk polymorphism, i) genotyping the closo gene, (ii) determining whether the genotype comprises a risk genotype, and (iii) if the closo gene comprises a risk genotype, the disease or Prevent predisposition to the disease,
It relates to a method comprising administering treatment to delay, alleviate or cure.

The present invention also provides a method for preventing and / or treating a disease or a predisposition to a disease associated with a risk polymorphism in a closo gene derived from an individual, wherein the risk polymorphism is 5 ′ of the closo gene. Region, a region of the closo gene selected from the group consisting of exons of the closo gene and introns of the closo gene, (i) genotyping the closo gene, and (ii) the genotype is a risk genotype. And (iii) if the closo gene comprises a risk genotype, then administering treatment to prevent, delay, alleviate or treat the disease or a predisposition to the disease. Regarding the method.

The present invention also provides SNPs associated with known risk SNP risk polymorphisms in the closo gene.
A method for identifying a risk polymorphism, comprising: (i) determining a genotype for an SNP risk polymorphism associated with a risk SNP risk polymorphism in a closo gene, and (ii) said genotype A method comprising determining whether to be linked to, or in linkage disequilibrium (LD) with, a risk genotype.

The present invention also provides a method for identifying a risk polymorphism in a closo gene that is related to a known risk polymorphism in a closo gene derived from an individual, wherein the risk polymorphism is 5 ′ of the closo gene. Region, an exon of the closo gene and an intron of the closo gene, which are present in the region of the closo gene selected from the group consisting of (i)
Genotyping SNP risk polymorphisms associated with SNP risk polymorphisms,
And (ii) a method comprising determining whether the genotype is linked to or in linkage disequilibrium (LD) with the risk genotype.

The present invention also provides a cytosine at the 1122nd nucleotide, a deleted adenine at the 1337th nucleotide, a guanine at the 1686th nucleotide, a guanine at the 2406th nucleotide, a cytosine at the 12707th nucleotide, and a 12753th nucleotide. Adenine, a cytosine at nucleotide 19489, a thymine at nucleotide 19969, and a thymine at nucleotide 20445 at a position selected from the group consisting of at least one SNP risk polymorphism within the closo gene. Regarding the isolated Chroso gene.

The present invention also provides (i) means for genotyping the closo gene, and (ii)
) A kit for the diagnosis of a disease or a predisposition to a disease, comprising a reference means for determining whether said genotype comprises a risk genotype.

[0152] Other aspects of the invention are described by the numbered paragraphs below.

1. A method of diagnosing a disease or a predisposition to a disease involving genotyping of the Kuroso gene.

2. The method of paragraph 1, wherein the method comprises determining whether the closo gene comprises at least one risk polymorphism, and the presence of the risk polymorphism diagnoses the disease or predisposition to the disease.

3. The method of paragraph 2, wherein the method comprises determining whether the klosso gene comprises at least two risk polymorphisms.

4. 4. The method according to paragraph 2 or 3, wherein the risk polymorphism is present in a region of the closo gene selected from the group consisting of 5'non-coding regions, promoter elements, exons and introns.

5. The method according to any of paragraphs 2 to 4, wherein the risk polymorphism comprises a single nucleotide polymorphism (SNP).

6. The risk polymorphisms are nucleotide 1122, nucleotide 1337, nucleotide 168.
6, nucleotide 2406, nucleotide 12707, nucleotide 12753, nucleotide 1
A method according to paragraph 5, comprising an SNP present in the closo gene at a position selected from the group consisting of 9489, nucleotides 19969 and nucleotides 20445.

7. The polymorphism is the cytosine at the 1122nd nucleotide, the deleted adenine at the 1337th nucleotide, the guanine at the 1686th nucleotide, the guanine at the 2406th nucleotide, the cytosine at the 12707th nucleotide, the adenine at the 12753th nucleotide, 19489. The method of paragraph 6 comprising at least one SNP selected from the group consisting of cytosine at nucleotide n th, thymine at nucleotide 91996 and thymine at nucleotide 20445.

8. The disease consists of metabolic syndrome, obesity, skin disease, skin atrophy, bone mineral density (BMD) reduction, osteopenia, osteoporosis, aging-related disease, cancer, cardiovascular disease, blood pressure disease, emphysema and pulmonary dysfunction. The method according to any of the preceding paragraphs comprising at least one condition selected from the group.

9. (a) determining the genotype of the closo gene, (b) determining whether the genotype comprises a risk genotype, and (c) a disease or disorder if the closo gene comprises a risk genotype. A method of treating a disease comprising taking preventive measures to prevent, delay or alleviate a predisposition to.

10. 10. The method according to paragraph 9, wherein the risk polymorphism is present in a region of the closo gene selected from the group consisting of 5'non-coding regions, promoter elements, exons and introns.

[0163]   11. 11. The method of paragraph 9 or 10 wherein the risk polymorphism comprises SNP.

12. The risk polymorphisms are nucleotide 1122, nucleotide 1337, nucleotide 16
86, nucleotide 2406, nucleotide 12707, nucleotide 12753, nucleotide
The method of paragraph 11 comprising at least one SNP present at a position selected from the group consisting of 19489, nucleotides 19969 and nucleotides 20445.

13. The risk polymorphism, 1122 nucleotide cytosine, 1337 nucleotide deletion adenine, 1686 nucleotide guanine, 2406 nucleotide guanine, 12707 nucleotide cytosine, 12753 nucleotide adenine, 13. The method of paragraph 12, comprising at least one SNP selected from the group consisting of cytosine at nucleotide 19489, thymine at nucleotide 961996, and thymine at nucleotide 20445.

14. The disease is metabolic syndrome, obesity, skin disease, skin atrophy, bone mineral density (BMD)
The method according to any one of paragraphs 9 to 13 including at least one condition selected from the group consisting of depression, osteopenia, osteoporosis, aging-related diseases, cancer, cardiovascular disease, blood pressure disease, emphysema and pulmonary dysfunction. .

15. 15. The method of any of paragraphs 9-14, wherein the prophylactic treatment comprises hormone replacement therapy (HRT).

16. 16. The method according to any of paragraphs 9 to 15, wherein the prophylactic treatment comprises gene therapy.

17. (a) genotyping the closo gene in a human, (b) determining whether the genotype is a risk genotype, and (c) if the closo gene is a risk genotype, A method of treating an aging-related disease in a human, comprising taking prophylactic treatment for the aging-related disease in a human.

18. A kit for diagnosing a disease or a predisposition to a disease, comprising (a) means for determining the genotype of a closo gene, and (b) reference means for identifying the presence of a risk genotype.

[0171]   19. Array:     5 'AAATCTACTTTGTCTTCCTCG 3' An oligonucleotide primer containing

[0172]   20. Array:     5 'AAAGGCACCTGTTTCTCCC 3' An oligonucleotide primer containing

[0173]   twenty one. Array:     5 'TGAATCTGAGAAAAAGTTCATC 3' An oligonucleotide primer containing

[0174]   twenty two. Array:     5'CATTTATGTTAGATAATCTTAGAG 3 ' An oligonucleotide primer containing

[0175]   twenty three. Array:     5 'AGTGGAATATTGTCTTCCTC 3' An oligonucleotide primer containing

[0176]   twenty four. Array:     5 'CCATAGGCTGCCACAGGG 3' An oligonucleotide primer containing

[0177]   twenty five. Array:     5 'CACCATCCTGCAGTACTATC 3' An oligonucleotide primer containing

[0178]   26. Array:     5 'TTTGGTTCAGCCAGTCCCTC 3' An oligonucleotide primer containing

27.1122 cytosines at nucleotide 2, 1337 deletion adenine, 1686 guanine, 2406 guanine, 12707 cytosine, 12753 adenine, 19489 cytosine, 19969 thymine, and An isolated croso gene comprising at least one SNP selected from the group consisting of the 20445th thymine.

28. A method for identifying a polymorphism that correlates with a known polymorphism in a klotho gene, comprising: (a) determining the position of the polymorphism and correlating it with the known polymorphism in the closo gene; A method comprising determining whether a type is associated with a disease or its major components.

29. The novel polymorphisms are metabolic syndrome, obesity, skin diseases, skin atrophy, bone mineral density (BM
D) Paragraph 28, including determining whether it is associated with a condition selected from the group consisting of depression, osteopenia, osteoporosis, aging-related diseases, cancer, cardiovascular disease, blood pressure disease, emphysema and pulmonary dysfunction. The method described.

30. A method of treating a disease comprising administering a modulator of a closo gene.

31. The disease is metabolic syndrome, obesity, skin disease, skin atrophy, bone mineral density (BMD)
31. The method of paragraph 30, comprising at least one condition selected from the group consisting of depression, osteopenia, osteoporosis, aging-related diseases, cancer, cardiovascular disease, blood pressure disease, emphysema and pulmonary dysfunction.

32. The modulator is a closo agonist and / or antagonist,
High- and low-molecular weight inhibitors of closo gene expression or function, antisense sequences including antisense oligonucleotides to closo genes or transcripts,
32. A method according to paragraph 30 or 31, comprising a molecule selected from the group consisting of an antibody, a closo gene product binding protein and a closo gene product kinase, or fragments, variants and derivatives thereof.

33. A method of identifying a compound for the treatment of a disease, comprising: (a) administering the compound to animal tissue, and (b) determining whether the compound modulates the closo gene.

34. 34. The method of paragraph 33, wherein the animal tissue comprises animal cells in tissue culture.

[0187]     (Example)   The invention will now be further described only by way of example, in which reference is made to the drawings.

FIG. 1 is a diagrammatic representation of the human croso gene with SNP risk polymorphisms of the present invention and the disease states shown below and their correlations. Colored bars indicate the detected association between SNPs and phenotypes at a significance level of 0.05 or less. FIG. 2 is a diagrammatic representation of the human croso gene having an SNP risk polymorphism of the present invention and the disease states shown below and their correlations. Gray bars indicate the detected association between SNP and phenotype between significance levels 0.050 and 0.095.

Example 1 The DNA sequence of the human croso gene was obtained from Matsumura et al., Biochem. Biophys. Res. Comm.
, 242 , 626-630 (1998). Deposit numbers AB009666 and AB00
This sequence, included in the GenBank entry at 9667, is referred to as the wild-type sequence. PCR primers were generated to amplify the 2 Kb sequence 5'to exon 1 to exon 1 of the human croso gene and exon 1 containing the putative promoter region of the gene. these
PCR products were screened to identify common polymorphisms. SNP detection is based on ABI Prism
It was performed using ABI's standard sequencing method with a cycle sequencing reaction using a Big Dye Terminator analyzed with a 377 sequencer. For each PCR fragment, sequences from 16 unrelated Caucasians were compared to the consensus "wild type" sequence,
Any sequence differences were identified. For each fragment, both the forward and reverse strands were sequenced and confirmed only if the SNP was present on both strands.

The 9 SNPs identified in the human croso gene are shown in Table 1 below. Allele frequency estimates in the Caucasian population were obtained from a sample of 192 unrelated individuals. The frequencies of rare alleles are shown in Table 2 below. Allele frequencies of all SNPs were in Hardy-Weinberg equilibrium.

Pair-scale linkage disequilibrium (LD) values have been estimated (as shown in Table 3) for SNPs with rare allele frequencies above 0.1. The LD estimates suggest that there is a strong background LD in the gene. The presence of a strong background LD indicates, overall, that the association of predisposition to disease with a particular genotype or genotype combination is the genetic origin of the closo gene. The association with SNPs or combinations of SNPs is a direct consequence of SNP effects screened for closogene function. Alternatively, SNPs may be in LD with an etiologic polymorphism.

The examples below describe the use of 4 of the 9 SNPs identified for the diagnosis of disease and / or disease predisposition. However, because of the strong background LD in the gene, the other five SNPs listed in the text were either alone or as described above.
It is suitable for use as well, for the diagnosis of a predisposition to the disease, either in combination with. The four major SNPs mentioned in the examples below are:

[Table 1]

This analysis is based on a total of 2870 female twin subjects, including 1025 dizygotic (DZ) pairs and 410 monozygotic (MZ) pairs. 1086 women (37.8%) were pre-menopausal,
1135 women (39.5%) were already menopausal. Each polymorphism was tested for association with a disease-related phenotype using the mean effects model. The association of the four SNPs in the human croso gene with the phenotypes associated with the disease states discussed below is summarized in Figures 1 and 2.

Example 2 Genotype of SNPs in the Human Closso Gene A known technique suitable for genotyping the above-mentioned SNPs is Taqman ^™ . In this case, two allele-specific probes were included in the PCR reaction along with PCR primers. Allele identification is accomplished by hybridization of the appropriate probe to the polymorphic site, followed by Taq polymerase integration of the probe during PCR extension of the primer.
Achieved by cleavage by 5'nucleose activity. The primers and probes thus obtained have nucleotides 1686 and 1270.
Suitable for screening 7, nucleotide 19489 and nucleotide 19969. Table 4 (see below) contains examples of suitable primers and probes for use in genotyping SNP risk polymorphisms in the closo gene using Taqman ^™ technology.

Example 3 Diagnosis of Osteoporosis Predisposition Based on Genotyping of Human Croso Gene Published wild-type sequence or nucleotide 12707 (GenBank Deposit No. AB0096)
67), nucleotide 19489 (GenBank Deposit No. AB009667) and nucleotide 1996.
Individuals were screened to determine if they had one or more polymorphisms in 9 (GenBank Accession No. AB009667). The screening was performed using the Taq described in Example 2.
Performed using the man ^™ assay.

A homozygous T / T genotype at nucleotide 19489 (GenBank Accession No. AB009667) was found to be associated with forearm and spinal cord BMD in menopausal women. Similarly, a homozygous T / T genotype at nucleotide 19489 (GenBank deposit number AB009667) and a homozygous at nucleotide 12707 (GenBank deposit number AB009667).
T / T genotype was associated with decreased VOS in postmenopausal women. Furthermore, in premenopausal women, the C / C homozygous genotype at nucleotide 19969 (GenBank Accession No. AB009667) was associated with a low BMD of the spinal cord and nucleotide 12707 (GenBank Deposit No. AB00966).
It was associated with the heterozygous G / C genotype in 7).

Example 4 Diagnosis of Predisposition to Lung Dysfunction Based on Genotyping of the Human Croso Gene Published wild-type sequence or nucleotide 12707 (GenBank Deposit No. AB0096).
67), nucleotide 19489 (GenBank Deposit No. AB009667) and nucleotide 1996.
9 (GenBank Deposit No. AB009667) to determine whether to have a polymorphism,
Screened individuals. Screening was performed using the Taqman ^™ assay described in Example 2.

The heterozygous G / C genotype at nucleotide 12707 (GenBank Accession No. AB009666) is associated with low forced expiratory volume (FEV) and forced expiratory volume / forced vital capacity (FEV / FVC) in menopausal women. Was there. Similarly, nucleotide 19489 (GenBank
The homozygous C / C genotype in deposit number AB009667) was associated with low FEV in premenopausal women. In postmenopausal women, nucleotide 19969 (GenBank Deposit No. AB009667
C / C homozygous genotype in) was associated with low FVC.

Example 5 Diagnosis of Predisposition to Aging-related Skin Disorders Based on Genotyping of Human Croso Gene Published wild-type sequence or nucleotide 12707 (GenBank Deposit No. AB0096).
67), nucleotide 19489 (GenBank Deposit No. AB009667) and nucleotide 1996.
9 (GenBank Deposit No. AB009667) to determine whether to have a polymorphism,
Screened individuals. Screening was performed using the Taqman ^™ assay described in Example 2.

In premenopausal women, high moles are associated with nucleotides 19969 (GenBank Accession No. AB
[009667) was associated with the homozygous C / C genotype. In postmenopausal women,
C / T heterozygous genotype at nucleotide 19969 (GenBank deposit number AB009667) and homozygous C / C at nucleotide 12707 (GenBank deposit number AB009667)
Genotype was associated with an increase in moles.

Example 6 Diagnosis of Predisposition to Metabolic Syndrome Based on Genotyping of the Human Closo Gene Published wild-type sequence or nucleotide 1686 (GenBank Deposit No. AB00966).
6), nucleotide 12707 (GenBank Deposit No. AB009667) and nucleotide 19489.
To determine whether to have a polymorphism in (GenBank Deposit No. AB009667),
Screened individuals. Screening was performed using the Taqman ^™ assay described in Example 2.

The homozygous A / A genotype at nucleotide 1686 (GenBank Accession No. AB009666) was associated with low serum triglyceride levels in premenopausal women. Similarly,
The homozygous C / C genotype at nucleotide 12707 (GenBank Accession No. AB009667) was also associated with low serum triglyceride levels in premenopausal women. Furthermore, the C / T heterozygous genotype at nucleotide 19489 (GenBank Accession No. AB009667) was associated with total fat mass gain and weight gain. Thus provided are methods and means of diagnosis and treatment of several diseases.

[0203]

[Table 2]

[0204]

[Table 3]

[0205]

[Table 4]

[0206]

[Table 5]

All publications mentioned in the above specification are herein incorporated by reference.
Various modifications and variations of the methods and systems described in this invention will be apparent to those skilled in the art without departing from the scope and spirit of this invention. Although the present invention has been described in connection with specific preferred embodiments, the invention set forth in the claims is
It should not be unduly limited to such a specific embodiment. Indeed, modifications of the described modes for carrying out the invention will be apparent to those skilled in molecular biology or related fields, and these are intended to be covered by the present invention.

[Brief description of drawings]

Figure 1a   Show the diagram.

Figure 1b   Show the diagram.

[Fig. 1c]   Show the diagram.

Figure 2a   Show the diagram.

Figure 2b   Show the diagram.

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁷ Identification code FI theme code (reference) A61P 9/00 A61P 17/00 11/00 19/08 17/00 19/10 19/08 35/00 19 / 10 43/00 35/00 C07K 14/47 43/00 C12N 1/15 C07K 14/47 1/19 C12N 1/15 1/21 1/19 C12P 21/02 C 1/21 C12N 15/00 ZNAA 5 / 10 5/00 A C12P 21/02 A61K 37/24 (81) Designated countries EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, GM, KE) , LS, MW, MZ, SD, SL, SZ, TZ, UG, ZW) , EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AE, AG, AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, BZ, CA , CH, CN, CR, CU, CZ, DE, DK, DM, DZ, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, K E, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MA, MD, MG, MK, MN, MW, MX, MZ, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, TZ, UA, UG, US, UZ, VN, YU, ZA, ZW (72) Inventor Morroy, Helen United Kingdom CB 49 XN Cambridge, Impington, Millley 10 (72) Inventor Ciano, Matthias England 85 Sue Hartfordshire, Royston, Barnes Road 139 F term (reference) 4B024 AA01 AA11 BA80 CA04 GA11 HA14 4B064 AG01 CA19 CC24 DA01 DA13 4B065 AA93Y AB01 AC14 CA24 CA44 CA46 4C084 4 AA17 BA44 DB01 NA14 ZA36 ZA59 ZA70 ZA89 ZA96 ZA97 ZB26 ZC03 ZC21 ZC52 4H045 AA10 AA20 AA30 CA40 EA20 EA27 EA50 FA74

Claims (36)

[Claims] 1. A method of diagnosing a disease or a predisposition to a disease associated with a risk polymorphism in a closo gene, wherein the risk polymorphism is an SNP risk polymorphism, and (i) genotyping the closo gene. And (ii) determining whether the genotype comprises a risk genotype. 2. A method for diagnosing a disease or a predisposition to a disease associated with a risk polymorphism in an individual or in a closo gene derived from an individual, wherein the risk polymorphism is the 5 ′ region of the closo gene, an exon of the closo gene. And (i) genotyping the closo gene, and (ii) determining whether the genotype includes a risk genotype. Determining. 3. A method for preventing and / or treating a disease or a predisposition to a disease associated with a risk polymorphism in a closo gene, wherein the risk polymorphism is an SNP risk polymorphism, and (i) the closo gene is Genotyping, (ii) determining the presence of a risk genotype in the closo gene, and (iii) preventing, delaying, or alleviating a disease or predisposition to the disease if the closo gene comprises a risk genotype. Or administering treatment to treat. 4. A method for preventing and / or treating a disease or a predisposition to a disease associated with a risk polymorphism in a closo gene derived from an individual, wherein the risk polymorphism comprises a 5 ′ region, an exon of the closo gene and Is present in the region of the Kuroso gene selected from the group consisting of introns of the Kuroso gene, (i) genotyping the Kuroso gene, (ii) determining the presence of a risk genotype in the Kuroso gene, And (iii) if the closo gene comprises a risk genotype, administering treatment to prevent, delay, alleviate or treat the disease or predisposition to the disease. 5. The method of claim 3 or 4, wherein the treatment is for an aging-related disease. 6. The method of any one of claims 3-5, wherein the treatment is hormone replacement therapy (HRT) or a treatment comprising it. 7. A method for identifying an SNP risk polymorphism associated with a risk SNP risk polymorphism in a closo gene, comprising: (i) regarding an SNP risk polymorphism associated with a risk SNP risk polymorphism in a closo gene. Determining the genotype, and (ii) determining whether the genotype is linked to the risk genotype or is in linkage disequilibrium (LD) with the risk genotype. 8. A method for identifying a risk polymorphism in a closo gene related to a known risk polymorphism in a closo gene derived from an individual, wherein the risk polymorphism is the 5'region of the closo gene, the closo gene. Exist in the region of the closo gene selected from the group consisting of exons and introns of the closo gene, and (i) for the SNP risk polymorphism related to the risk SNP risk polymorphism in the closo gene, the croso gene is genotyped. Determining, and (ii) determining whether the genotype is linked to or in linkage disequilibrium (LD) with the risk genotype. 9. The method of any one of the preceding claims, wherein the risk polymorphism comprises at least two risk polymorphisms. 10. The method of any one of the preceding claims, wherein the risk polymorphism comprises a haplotype. 11. The risk polymorphism is nucleotide 1122, nucleotide 1337, nucleotide 1686, nucleotide 2406, nucleotide 12707 in the closo gene,
A method according to any one of the preceding claims comprising at least one SNP risk polymorphism present at a position selected from the group consisting of nucleotide 12753, nucleotide 19489, nucleotide 19969 and nucleotide 20445. 12. The polymorphism comprises cytosine at nucleotide 1122, deleted adenine at nucleotide 1337, guanine at nucleotide 1686, guanine at nucleotide 2406, and cytosine at nucleotide 12707 in the closo gene. , At least one SNP risk polymorphism present at a position selected from the group consisting of adenine at nucleotide 12753, cytosine at nucleotide 19489, thymine at nucleotide 961996, and thymine at nucleotide 20445. Method according to any one of the preceding claims. 13. The disease is an aging-related disease, and / or metabolic syndrome, obesity, skin disease, skin atrophy, bone mineral density (BMD) reduction, osteopenia, osteoporosis, cancer,
13. The method of any one of the preceding claims, including cardiovascular disease, blood pressure disease, emphysema, lung dysfunction and diseases associated with one or more of the major components of these diseases. 14. A cytosine at nucleotide 1122 within the closo gene,
Deletion adenine at nucleotide 1337, guanine at nucleotide 1686,
Guanine at nucleotide 2406, Cytosine at nucleotide 12707, 127
Adenine at nucleotide 53, Cytosine at nucleotide 19489, 19969
An isolated closo gene comprising at least one SNP risk polymorphism present at a position selected from the group consisting of thymine at nucleotide nucleotide 20 and thymine at nucleotide position 20445. 15. A construct comprising the closo gene of claim 14. 16. A vector containing the closo gene according to claim 14. 17. A plasmid containing the closo gene according to claim 14. 18. A host cell containing the closo gene of claim 14. 19. A method for preparing an isolated crosoprotein, the method comprising:
19. A method comprising expressing the nucleotide sequence according to claim 14 in the state of being present in the product of any one of 1 to 18, and optionally isolating and purifying the crosoprotein. 20. A closoprotein prepared by the method of claim 19. 21. An assay method for identifying an agent capable of regulating a closo gene or an expression product thereof, comprising: (i) said agent being any one of claims 1 to 12 or 14 to 19; A method of assaying, comprising: contacting a closo gene or an expression product thereof as defined in any one of (1) to (ii) and determining whether the agent regulates the closo gene or an expression product thereof. 22. The assay method according to claim 21, wherein the assay is to screen an agent useful for the prevention and / or treatment of aging-related diseases. 23. (i) performing the assay of claim 21 or 22; (ii) identifying one or more agents capable of modulating the closo gene or its expression product; and (iii) identified Preparing a large amount of one or more drugs. 24. (i) performing the assay of claim 21 or 22; (ii) identifying one or more agents capable of modulating the closo gene or its expression product; and (iii) identified A method comprising preparing a pharmaceutical composition comprising one or more agents. 25. (i) performing the assay according to claim 21 or 22, (ii) identifying one or more agents capable of regulating the closo gene or its expression product, (iii) the identified one Modifying one or more agents, and (iv) preparing a pharmaceutical composition comprising one or more modified agents. 26. An agent identified or modified by the method of any one of claims 23-25. 27. The drug according to claim 26, and a pharmaceutically acceptable carrier,
A pharmaceutical composition comprising a diluent, excipient or adjuvant or any combination thereof. 28. A method for preventing and / or treating a closogene-related disease, which comprises administering the agent according to claim 26 or the medicament according to claim 27, wherein the agent or the medicament is croso. A method characterized in that a gene or its expression product is regulatable, resulting in a beneficial therapeutic effect. 29. The method of claim 28, wherein said disease is a disease as defined in claim 13. 30. Use of the medicament according to claim 26 for the preparation of a pharmaceutical composition for the treatment of age related diseases related to the Crosogene. 31. (i) means for genotyping a closo gene, and (ii) reference means for determining whether the genotype comprises a risk genotype,
A kit for diagnosing a disease or a predisposition to the disease, comprising: 32. The kit according to claim 31, which comprises the agent according to claim 26 or the medicine according to claim 27, wherein the agent or the medicine regulates an aging-related disease, and / or A kit characterized by being preventable and / or treatable. 33.     5 'AAATCTACTTTGTCTTCCTCG 3',     5 'AAAGGCACCTGTTTCTCCC 3',     5 'TGAATCTGAGAAAAAGTTCATC 3',     5'CATTTATGTTAGATAATCTTAGAG 3 ',     5'AGTGGAATATTGTCTTCCTC 3 ',     5 'CCATAGGCTGCCACAGGG 3',     5 'CACCATCCTGCAGTACTATC 3'and     5 'TTTGGTTCAGCCAGTCCCTC 3' A base sequence containing one of the following. 34. Using at least one of the nucleotide sequences according to claim 33,
14. The method according to any one of claims 1 to 13, comprising amplifying the risk polymorphism in the Kuroso gene. 35. The method of claim 34, wherein the risk polymorphism is a SNP risk polymorphism. 36. A risk polymorphism used for diagnosing a disease or a predisposition to the disease, wherein the risk polymorphism is an SNP risk polymorphism, and the SNP risk polymorphism is a nucleotide at the 1122nd nucleotide in the closo gene. Cytosine, deleted adenine at nucleotide 1337, guanine at nucleotide 1686, guanine at nucleotide 2406, cytosine at nucleotide 12707, 1
Adenine at nucleotide 2753, Cytosine at nucleotide 19489, 199
A risk polymorphism comprising at least one SNP present at a position selected from the group consisting of thymine at nucleotide 69, and thymine at nucleotide 20445.