JP2003512857A - Traf family proteins - Google Patents

Abstract

(57) SUMMARY According to the present invention, there is provided a novel TRAF protein binding domain polypeptide (TPBD). The present invention also provides nucleic acid molecules encoding TPBD, vectors containing these nucleic acid molecules, and host cells containing the vectors. The present invention also provides an antibody capable of specifically binding to TPBD. Such TPBD and / or anti-TPBD antibodies are useful for finding drugs that suppress autoimmunity, inflammation, allergy, allograft rejection, sepsis, and other diseases.

Description

Detailed Description of the Invention

BACKGROUND OF THE INVENTION Field of the Invention The present invention relates generally to the field of molecular biology and molecular drugs, and more specifically to the regulation of immunological responses and cell death. Related to the protein.

This invention was made with Government support under Grant No. CA69381 awarded by the National Institutes of Health. The US Government has certain rights in this invention.

Tumor necrosis factor (TNF) family of cytokines is widely used in a wide variety of immunology,
It plays an important role in allergy and inflammatory response. Several members of the TNF family have been identified, including TNFα, lymphotoxin-α, lymphotoxin-β, LIGHT, CD27 ligand (CD27L), CD30L, C.
D40L, Fas-L, Trail, and others. These molecules are generally produced on the surface of cells as type II integral membrane proteins, followed by release into the extracellular environment as a result of proteolytic cleavage. However, many of the TNF family cytokines remain anchored in the plasma membrane, by relying on their interaction with receptor-bearing cells via cell-cell contacts.

The receptors for the TNF family of cytokines are similarly diverse. All members of the family have a conserved cysteine sequence in their extracellular domain. This is one of the criteria for being a member of this family.
The intracellular cytosolic domains of the TNF family of receptors differ in their amino acid sequence but can be broadly classified into two types: (a) those containing a protein interaction module known as the death domain (Death-Domain) ( TNFR1, Fas, DR3, DR4, DR5), and (b) those without it (TNFR2, CD27, CD30, CD40, LTβR, 4B)
1 and others).

The death domain is a subgroup of the TNF receptor (TNFR) family,
It is responsible for interaction with adapter proteins, which in turn bind to intracellular proteases of the caspase family that are involved in inducing apoptosis (programmed cell death). However, the death domain may also mediate binding to other types of adapter molecules that bind kinases or other types of signaling molecules rather than proteases.

Members of these TNFR families, which do not contain a death domain at their cytosolic termini, depend on a family of intracellular adapter proteins for signal transduction. This family of adapter proteins is known as the "TNF receptor associated factor" (TRAF). The TRAF family of proteins are
It contains a protein interaction domain known as the TRAF domain that mediates their binding to the cytosolic domain of the TNF family of receptors. The TRAF domain also allows interactions between members of the TRAF family, giving rise to homo- and hetero-oligomerization opportunities that may have important functional consequences. In humans and mice, six members of the TRAF family have been described, TRAF1, TRAF2, TRAF3, TRAF4,
TRAF5 and TRAF6 are included. The crystal structure of the TRAF domain of TRAF2 has been solved, revealing the assembly of trimers with 3-fold symmetry and demonstrating the presence of surface pockets on each monomer. This accounts for the binding to distinct peptidyl motifs found in the cytosolic domain of many members of the TNF family of receptors.

Several TRAF family proteins physically associate with protein kinases and regulate activation of these kinases. For example, TRAF2,
TRAF5 and TRAF6 have been reported to be able to induce activation of kinases that are involved in the activation of: (a) Jun N-terminal kinase (JNK).
), Some members of the stress kinase family, and (b)
Phosphorylation of IκB, an inhibitor of the transcription factor NF-κB. In contrast, TRAF1
, TRAF3, and TRAF4 do not activate these kinases, and in some situations they may interfere with activation of the kinase by other TRAFs. All kinase activation members of the TRAF family contain additional protein domains (in addition to the TRAF domain). They are important for their function as kinase activators, contain a ring domain, and occasionally z
Contains an inc finger domain.

Gene knockout studies in mice have demonstrated important roles for some of the TRAF family of proteins in the signaling pathways stimulated by the TNF family of receptors. In addition, mutational analysis of the TRAF binding site in the cytosolic domain of the TNF family of receptors also revealed TR
It provided evidence that the interaction of AFs with these receptors is important for many of the biochemical signaling and cellular biological responses induced through the TNF family of receptors.

In addition to their involvement in signaling by the TNF family of receptors, at least one known TRAF may also be involved in signaling mediated by the Toll family of interleukin-1 receptors / receptors. TRAF6 interacts with an adapter protein containing the death domain (MyD88) and a protein kinase containing the death domain (IRAK), which is important for the induction of NF-κB by the IL-1 receptor. Therefore, TRA
F, in some instances, may be involved in signal transduction by other cytokine receptors in addition to those of the TNFR family. In addition, some TR
AF binds to viral proteins, which play a role in the mechanism caused by the virus so that the interaction of such proteins circumvents either immune surveillance or virus-mediated malignant transformation. Suggests to get.

Therefore, there is a need to identify novel TRAF family proteins, or TRAF protein binding domains. The present invention fulfills this need and provides full additional advantages.

SUMMARY OF THE INVENTION In accordance with the present invention, a novel TRAF protein binding domain polypeptide (TP
BD) is provided. The invention also provides nucleic acid molecules encoding TPBD, vectors containing these nucleic acid molecules, and host cells containing the vectors. The present invention also provides an antibody capable of specifically binding to the TPBD of the present invention. Such TPBD and / or anti-TPBD antibodies are useful for autoimmunity, inflammation,
It is useful in finding drugs that suppress allergies, allograft rejection, sepsis, and other diseases.

The present invention also provides screening assays useful for identifying reagents that can efficiently alter the association of the TPBDs of the invention with itself or other proteins. By altering the self-association of TPBD, or by altering their interaction with other proteins, effective reagents may either increase or decrease activation of kinases, or apoptosis, cell proliferation, cell It may regulate cellular pathways that achieve adhesion, cellular stress response, switching of B cell immunoglobulin classes, and the like.

The present invention also provides a method of altering the activity of TPBD in cells. Here, such increased or decreased activity of TPBD can be associated with the level of kinase activity, or apoptosis, cell proliferation, cell adhesion, cell stress response, B
It can regulate cellular pathways that achieve switching of immunoglobulin classes of cells and the like. For example, the activity of TPBD in a cell can be increased by introducing and expressing into the cell a nucleic acid sequence encoding the polypeptide or protein comprising such TPBD. Furthermore, the activity of TPBD or a TPBD-containing protein in a cell can be measured by introducing into a cell an antisense nucleotide sequence that is complementary to a part of the nucleic acid sequence encoding the TPBD or the TPBD-containing protein. , Can be reduced.

The invention also alters apoptosis, cell proliferation, cell adhesion, cell stress response, B cell immunoglobulin class switching due to increased or decreased levels of TPBD in cells. Methods are provided for using a reagent capable of specifically binding to TPBD, or a nucleotide sequence capable of binding to a nucleic acid molecule encoding TPBD, for diagnosing a pathology characterized by levels.

DETAILED DESCRIPTION OF THE INVENTION According to the present invention there is provided a novel TRAF protein binding domain (TPBD) of the newly identified TRAF protein, and fragments thereof. As used herein, TPBD of the present invention refers to a peptide region that binds to one or more TRAF proteins. It has been found herein that the TPBD of the present invention shares sequence homology with the C-TRAF domain of the TRAF protein and has binding properties similar to those of other known TRAF proteins. .. This domain corresponds to a portion of the TRAF domain commonly referred to as the C-TRAF or TRAF-C domain (Arch et al., Supra; and Wajant et al., Cytokine Growth Factor Rev. 10: 15-26.
(1999), each of which is incorporated herein by reference).
. The previously characterized human TRAF domain protein also contains C-TRA.
It has been found to have an N-TRAF domain immediately adjacent to the amino terminus of the F domain.

The TRAF proteins were first identified as a family of proteins that associate with members of the TNF receptor family. TRAF proteins are known to influence a variety of cellular processes such as B cell class switching, apoptosis, cell proliferation, and stress response (Arch et al., Genes Dev. 12: 2821). -2830
(1998)). These effects on cellular action are believed to result from TRAF-mediated regulation of NF-κB and / or cJun N-terminal kinase (JNK) activity. Thus, TRAF proteins represent an important class of intracellular proteins that mediate signal transduction of cell surface receptors, such as members of the TNFR family, that ultimately affect the action of various cells.

In addition to binding to the TNF family of receptors, TRAF domain proteins also interact with other TRAF domain proteins. For example,
TRAF1, TRAF2, and TRAF3 have all been shown to homo-oligomerize. It has been further demonstrated that TRAF2 can hetero-gomerize with TRAF1 and TRAF5. As shown herein, all TRAF domains of the invention have been demonstrated to be capable of interacting with other TRAF domain proteins.

The function of the TRAF domain, including the protein, generally supports the role of the TPBD of the invention and the protein of the TRAF domain of the invention in the intracellular pathway. This is apoptosis, cell proliferation, cell adhesion, cell stress response,
And influence the switching of immunoglobulin classes in B cells.

For example, the TPBDs of this invention have been found to associate with other proteins, including proteins containing the TRAF domain. Exemplary TRAF proteins to which the TPBD of the present invention binds are human TRAF1, TRAF2, TRAF3.
, TRAF4, TRAF5, or TRAF6. As used herein, the terms "bind" or "bindi".
ng) "refers to the relatively specific association of the TPBD of the invention with another protein, which is capable of forming a bound complex. In particular, the binding of TPBD to the TRAF protein is sufficiently specific so that bound complexes can be formed in cells in vivo or under suitable conditions in vitro.

In one embodiment, the HAUSP TPBD (SEQ ID NO: 8 or 23) of the invention binds to TRAF1, TRAF2, TRAF3, TRAF4, TRAF5, and TRAF6, and NF-κB of TRAF2, TRAF5, and TRAF6. It has been found that it can inhibit the activating activity of. In another embodiment, the SPOP TPBD domain of the invention (SEQ ID NO: 10 or 24) is T
It has been found that it can bind to RAF1 and TRAF6 and inhibit the activating activity of TRAF6 on NF-κB. In yet another embodiment, the TRAF-7 TPBD (SEQ ID NO: 12 or 25) of the invention comprises TRAF1, TRAF.
2, can bind to TRAF3, TRAF4, TRAF5, and TRAF6 and inhibit the NF-κB activating activity of TRAF2 and TRAF6, and TR
It has been found that AF5 can increase the NF-κB activating activity. In addition, the TRAF domains of TRAF7 and USP7 may inhibit NF-κB activation induced by TNFα and CD40 overexpression, while the T
The RAF domain has been found to show no inhibitory activity.

In a further embodiment, TRAF7, a TRAF domain of TRAF7,
And the TRAF domain of USP7 (HAUSP) was found to inhibit NIK-induced activation of NFκB. Thus, the present invention provides TPBD that can be used to inhibit NIK-induced activation of NFκB.

In another embodiment, the TPBD of the present invention also binds to proteins of the TNF receptor family. For example, SPOP TPBD of SEQ ID NO: 10 is T
Binds to NF-R2 and TRAF-7 TPBD (SEQ ID NO: 12 or 25)
) Binds TNF-R2, CD40, lymphotoxin-βR, NGFRp75, and DR4. And the TRAF domain of TNRF7 also binds to itself. Furthermore, TRAF proteins are generally known to bind to a wide variety of cell surface receptors, and in particular to cytokine receptors of the TNF receptor family. On the other hand, TRA
Exemplary receptors known to be bound by the F protein are: T
NFR1, TNFR2, CD27, CD30, CD40, 4-1BB, Ox40
, LT-βR, Fas, DR3, DR4, DR5, HVEM, LMP-1, and IL-1R. Furthermore, the TRAF protein has been observed to bind to all members of the TNF receptor family that do not contain a death domain. Therefore, herein, the TPBD of the present invention also includes TNFR1, TNFR2, CD2.
7, CD30, CD40, 4-1BB, Ox40, LT-βR, Fas, DR3
, DR4, DR5, HVEM, LMP-1, and IL-1R, and is intended to bind to one or more receptors selected from members of the TNF receptor family that do not contain a death domain.

In another embodiment of the invention, the TPBD of the invention is found to bind to TRAF-related proteins. For example, TRAF-7 TPBD (SEQ ID NO: 12 or 25) binds to I-TRAF. Furthermore, TRAF proteins are commonly referred to as a number of TRAF-related proteins (eg, TRADD, FA
DD, I-TRAF, TRIP, A20, c-IAP1, c-IAP2, Cas
per, RIP, RIP2, NIK, Peg3, GCK, NIK, ASK1, and IRAK). Therefore, in the present specification, T
PBD also includes TRADD, FADD, I-TRAF, TRIP, A20, c-.
IAP1, c-IAP2, Casper, RIP, RIP2, NIK, Peg3
One or more TRA selected from, GCK, NIK, ASK1, and IRAK
It is intended to bind to F-related proteins.

[0024]   Structurally, the TPBD of the invention is characterized as having the following sequence:
: E (X)_17-21LXW (X)₃VXP (X)_15-16L (X)_24-28K (X)_15-16
W (SEQ ID NO: 19). Here, X is any amino acid. Alternatively, the present invention
The TRAF domain of is characterized as having the following sequence: LXWX (
X ') XVXP (SEQ ID NO: 20). Where X is any amino acid and
And X'is selected from L and I. Preferably, the TRAF domain of the invention is
It has the following sequence: E (X)_10-13S (X)_6-7LXW (X)₃VXP (X)_{Ten- 11} S (X)_FourL (X)_24-28K (X)_9-10F (X)_FiveWG (X)₃F (X)₁₆D (X
)_5-7V (SEQ ID NO: 21). Here, X is any amino acid. More preferred
In particular, the TRAF domain of the invention has the following sequence: E (X)_Four(X_A) (
X)_5-8SX (X_B) (X)_4-5LXWX (X_A) XVXP (X)_10-11S (X_A) (
X)₃L (X)_16-18(X_A) (X)_4-6(X_c) (X)₂K (X)_9-10F (X)_FiveW
G (X_D) (X)₂F (X)_Five(X_A) X (X_c) (X)₇(X_c) DX (X_A) (X) _2-4 (X_C) V (SEQ ID NO: 22). Where X is any amino acid and X_AIs
Selected from V, L, and I; X_BIs selected from P and G; X_CIs D, E,
Selected from N and Q; and X_DIs selected from Y and F. Most preferred
Preferably, the TRAF domain of the invention comprises SEQ ID NOs: 8, 10, 12, 23, 24,
Or 25 sequences.

It is well known in the art that TRAF domain proteins generally modulate the activity of NF-κB and JNK. According to another embodiment of the present invention, TPBD, HAUSP (preferably SEQ ID NO: 8 or 23), SPOP (of the present invention
SEQ ID NO: 10 or 24), and TRAF-7 (SEQ ID NO: 12 or 25) have been found to regulate the activity of NF-κB or cJun N-terminal kinase (JNK).

It has also been found that the TPBD of the present invention regulates various cellular pathways. TRAF domain proteins are generally known in the art as regulating the cellular pathways that achieve apoptosis, cell proliferation, cell adhesion, cell stress response, B cell immunoglobulin class switching, and NF -ΚB and JNK are also well known to regulate these pathways. Therefore, it is within the scope of the present invention that TPBD regulates one or more cellular pathways by which TPBD achieves apoptosis, cell proliferation, cell adhesion, cell stress response, and B cell immunoglobulin class switching. Recognize that you are inside.

In the present invention, the preferred TRAF domain of the present invention is SEQ ID NO: 8, 10,
It comprises substantially the same protein sequence as shown in 12, 23, 24, and 25, as well as an amino acid sequence comprising its biologically active modified form.

In another embodiment, the TPBD of the invention comprises a protein containing a TPBD fragment having the sequence of SEQ ID NO: 19 or SEQ ID NO: 20, wherein the TRAF protein is 213 or less. It is amino acid long. They retain at least one native biological TPBD activity such as: immunogenicity, ability to bind to the TNF family of receptors, TRA.
Ability to bind to F domain protein, ability to bind to TRAF-related protein, ability to regulate NF-κB activity or JNK activity, apoptosis, cell proliferation, cell adhesion, cell stress response, or B cell immunoglobulin class Ability to adjust the switch.

The use of the terms “isolated” and / or “purified” as a modifier of DNA, RNA, polypeptides, or proteins herein and in the claims is thus described. The produced DNA, RNA, polypeptide, or protein has been produced in such form by the human hand and is, therefore, separated from the native in vivo cellular environment and any nucleic acid or protein. It is meant to be substantially free of other species of. The recombinant DNA, RNA, polypeptides, and proteins of the invention as a result of this human intervention are useful in the methods of DNA, RNA, polypeptides, or proteins described herein. is there. Because these do not exist naturally.

As used herein, “eukaryote” refers to various species from which the TPBD of the present invention is derived (eg, yeast, slime, plants, insects, nematodes, mammals, etc.). Say. The preferred TPBD herein is mammalian TRAF.

As used herein, “mammal” is a preferred TPB of the present invention.
The various species from which D is derived (eg, human, rat, mouse, rabbit, monkey, baboon,
Cattle, pigs, sheep, dogs, cats, etc.). More preferred TP herein
BD is human TRAF.

The term “biologically active” or “functional”, as used herein as a modifier of the TPBD (s) or polypeptide fragments thereof of the present invention refers to TPBD. A polypeptide having similar functional characteristics. For example, one biological activity of TPBD is its ability to bind to TRAF proteins, preferably in vivo. Such TRAF binding activity can be assessed, for example, using the methods described in the Examples described herein.

Another biological activity of TRAF is its ability to act as an immunogen for the production of polyclonal and monoclonal antibodies that specifically bind TPBD of the invention. Therefore, the TPBD of the present invention comprises a TPBD having the amino acid sequence of SEQ ID NO: 19 or SEQ ID NO: 20 (preferably including the amino acid shown in SEQ ID NO: 8, 10, 12, 23, 24, or 25). It also encodes a polypeptide that is specifically recognized by an antibody that specifically recognizes it. Such immunological activity can be assessed by any method known to those of skill in the art. For example, a test TPBD polypeptide can be used to raise an antibody, which in turn is SEQ ID NO: 19.
Alternatively, their ability to bind to a TPBD of the invention containing SEQ ID NO: 20 (preferably comprising the sequence set forth in SEQ ID NO: 8, 10, 12, 23, 24, or 25) is evaluated. The antibody is the sequence of SEQ ID NO: 19 or SEQ ID NO: 20 (
Preferably, the test polypeptides and proteins containing the amino acids set forth in SEQ ID NOs: 8, 10, 12, 23, 24, or 25) are also bound with substantially the same affinity. The polypeptide possesses a necessary immunological biological activity.

The protein containing TPBD set forth in SEQ ID NO: 2 was first transformed into PML.
The nuclear domain of the protein, and herpes simplex virus type 1 protein Vmw
Herpes-related ubiquitin-specific protease (HAUSP) associated with 110
(Everett et al., EMBO J. 16: 566-577 (
997). The present application demonstrates the first identification of a portion of this protein that forms the TRAF domain.

The protein containing TPBD set forth in SEQ ID NO: 4 was first identified in serum from patients with scleroderma as having a mottled pattern in the nucleus, and mottled POZ protein or SPOP. (Nagai et al.,
FEBS Lett. 418: 23-26 (1997)). Although the POZ domain of SPOP has an undetermined function, this protein was found to be widely expressed.

The protein containing TPBD set forth in SEQ ID NO: 6 was identified as having a leucine zipper region, a zinc finger region, and a leucine zipper-like K box region (Nagase et al., DNA Res. 5). : 355-
364 (1998)). This protein, originally named KIAA0898, is also referred to herein as TRAF7.

In addition to the TRAF domain, TRAF7 was also found to have a number of previously unrecognized domains (see Figure 3). TRAF7 N
The presence of a ring finger domain (amino acids 15-55) near the termini has long been known. TRAF7 is KIAA0898, which was described in the database as a ring finger protein of unknown function. In addition to this domain, several other new protein domains have been identified in this molecule. The ring finger domain includes the ZF-BBox domain (amino acid 90
˜132), and coiled coil (amino acids 132-177). These three protein domains form a motif called the triple motif.
Triad motifs are found in a very limited list of proteins. This list includes transcription factors, ribonucleoproteins, and oncoproteins. And seems to be involved in protein-protein interactions (Bo
rden, Biochem. Cell Biol. 76: 351-358 (19
98)). After the triple motif, the second coiled coil (amino acids 195-2
31) can be seen. Two putative leucine zipper domains are also found in this region of the protein (amino acids 197-218, and 222-245).
. The TRAF domain (amino acids 277-403) is located after the leucine zipper. The TRAF domain contains another coiled coil (amino acids 427-
446), followed by two regions rich in acidic residues (amino acids 452-5).
77, and 868-964) follows. Therefore, in addition to the TRAF domain comprising the TRAF domain of TRAF7 (SEQ ID NO: 12 or 25), the invention also provides
ZF-BBox domain (amino acids 90 to 132 of SEQ ID NO: 32); coiled coil domain (amino acids 132 to 177, 195 to 231, and 427 to 446 of SEQ ID NO: 32); leucine zipper domain (amino acid 19 of SEQ ID NO: 32)
7-218 and 222-245); and the polyacidic domain (SEQ ID NO: 32).
Of amino acids 452-577 and 868-964) of TRAF7.

According to one embodiment of the invention, the TPBD of the invention (SEQ ID NO: 8 or 23)
Is capable of binding to all known human TRAF proteins (ie TRAF proteins 1 to 6), but the TRAF domain of HAUSP (SEQ ID NO: 8 or 23)
) Has been found to bind somewhat weakly to TRAF3 and very strongly to TRAF6. The HAUSP TPBD of the present invention (SEQ ID NO: 8 or 23) has also been found to inhibit NF-κB activation mediated by either TRAF2, TRAF5, or TRAF6. The TRAF7 TPBD (SEQ ID NO: 12 or 25) was also found to inhibit TRAF2 or TRAF6 mediated activation of NFκB (
See Examples).

In another embodiment of the invention, STP of the invention TPBD (SEQ ID NO: 1)
0 or 24) shows selectivity in the interaction of TRAF proteins and binds to human TRAF1 and TRAF6, while human TRAF proteins 2, 3, 4
, Or 5 is not bound. TPBD of the invention of SPOP (SEQ ID NO: 10
Or 24) has been found to be specific in the TNF-receptor interaction and binds to TNF-receptor 2 but not FAS, CD40,
It does not bind to lymphotoxin-β receptors, NGF receptors, and DR4. The TPBD of the invention of SPOP (SEQ ID NO: 10 or 24) also has T
It has been found to inhibit RAF6-mediated activation of NF-κB.

In a further embodiment of the invention, the inventive TPBD of TRAF7 (SEQ ID NO: 12 or 25) binds to all known human TRAF proteins,
It binds somewhat weakly to TRAF2 and very strongly to TRAF6. The TPBD of the invention of SPOP (SEQ ID NO: 10 or 24) also binds to multiple members of the TNF receptor family including TNF-receptor 2, CD40 (weakly), lymphotoxin-β receptor, NGF receptor, and DR4. However, it does not bind to FAS. TPBD of the present invention in SPOP
(SEQ ID NO: 10 or 24) has also been demonstrated to inhibit activation of NF-κB by either TRAF2 or TRAF6.

Those skilled in the art will appreciate that a number of residues in the above sequences may be replaced by other chemically, conformationally and / or electronically similar residues, the biological activity of the resulting receptor species. Recognize that a substitution can be made without substantial modification. Furthermore, in it SEQ ID NO: 8
Larger polypeptide sequences (eg, splice variants) containing substantially the same sequences as the amino acids shown at 10, 12, 23, 24, and 25 are contemplated.

As used herein, the term “substantially identical amino acid sequence” has at least about 70% identity to a reference amino acid sequence and is defined by the reference amino acid sequence. Amino acid sequence that retains the characteristics of functional and biological activity comparable to that of the protein. Preferably, proteins having "substantially the same amino acid sequence" have at least about 80%, more preferably 90% amino acid identity with the reference amino acid sequence; greater than about 95% amino acid sequence identity. It is particularly preferable to have. However, by virtue of a polypeptide (or nucleic acid as referred to herein above) containing a level of sequence identity less than that described above as a splice variant, or by conservative amino acid substitutions or It will be appreciated that those modified by the substitution of degenerate codons are also included within the scope of the present invention. Identity of any two amino acid sequences can be determined by one of ordinary skill in the art using default parameters, eg, based on BLAST 2.0 computer alignment.

The TPBD of the present invention may be subjected to a variety of methods well known in the art, such as the recombinant expression systems described herein, precipitation, gel filtration, ion exchange, reverse phase, affinity chromatography, and the like. ). Another known method is
Deutscher et al., Guide to Protein Purifica
tion: Methods in Enzymology, Volume 182 (Aca
demonic Press, (1990)). It is incorporated herein by reference. Alternatively, the isolated polypeptides of the present invention can be obtained using well known recombinant methods such as those described in Sambrook et al., Supra, 1989.

Examples of means for preparing the TPBD (s) of the invention are suitable host cells (eg, bacterial cells, yeast cells, amphibian cells (ie oocytes), or mammalian cells). Among them is to express the nucleic acid encoding TPBD using methods well known in the art and to recover the expressed polypeptide again using well known methods. The polypeptides of the present invention can be isolated directly from cells that have been transformed with an expression vector as described herein below. The polypeptides of the present invention, biologically functional fragments thereof, and functional equivalents thereof can also be produced by chemical synthesis. For example, synthetic polypeptides are described in Applied Biosystems, Inc. Model 430A
Alternatively, it can be produced using a 431A automated peptide synthesizer (Foster City, CA) using the chemicals provided by the manufacturer.

By the term TPBD is also included functional fragments or polypeptide analogs thereof. The term "functional fragment" is part of a full-length TPBD so long as that part has the biological activity as defined above, which is characteristic of the corresponding full-length protein. Refers to peptide fragments. For example, a functional fragment of the TPBD of the present invention may be capable of binding to, for example, a TNF family receptor, another TRAF protein, a TRAF-related protein, or NF-. It may have activities such as the ability to regulate κB activity or JNK activity, or the ability to regulate levels of cell proliferation, apoptosis, cell adhesion, cell stress response, class switching and the like. In addition, the characteristics of the functional fragments of TPBD of the present invention that elicit an immune response are useful for obtaining anti-TPBD antibodies. Accordingly, the invention also provides functional fragments of the TPBD of the invention. This can be identified using conventional methods such as binding and bioassays described herein.

The term “polypeptide analog” refers to a TP as described herein, in which one or more residues are conservatively substituted with functionally similar residues.
Includes any polypeptide having a sequence of amino acid residues substantially the same as the sequences set forth herein in detail, showing the ability to functionally mimic BD. Examples of conservative substitutions are the replacement of one non-polar (hydrophobic) residue with another, such as isoleucine, valine, leucine, or methionine, between arginine and lysine, between glutamine and asparagine, Substitution of one polar (hydrophilic) residue with another, such as between glycine and serine, substitution of one basic residue with another, such as lysine, arginine, or histidine, or Mention may be made of the replacement of one acidic residue with another, such as aspartic acid or glutamic acid.

The amino acid length of the functional fragments or polypeptide analogs of the invention can range from about 5 amino acids to one residue less than the full length protein sequence of the TPBD of the invention. In certain embodiments, the amino acid length is
For example, at least about 10 amino acids, at least about 20 amino acids, at least about 30 amino acids, at least about 40 amino acids, at least about 50 amino acids.
Amino acids, at least about 75 amino acids, at least about 100 amino acids, at least about 150 amino acids, at least about 200 amino acids, at least about 213 amino acids, at least about 250 amino acids, at least about 300 amino acids Amino acid length of at least about 350 or more amino acids up to one residue shorter than the protein sequence containing the full length TPBD provided as the sequence of SEQ ID NO: 2, 4 or 6. Can be mentioned.

Preferably the fragment comprises a sequence selected from SEQ ID NO: 19, 21 or 22. Such a fragment also has at least about 10 residues at its amino terminus, carboxy terminus, or both; at least about 20 residues at its amino terminus, carboxy terminus, or both; At least about 30 residues at the amino terminus, carboxy terminus, or both; at least about 40 residues at the amino terminus, carboxy terminus, or both; the amino terminus, carboxy terminus, or those At least about 50 for both
40 residues at its amino terminus, carboxy terminus, or both.

More preferably, the fragment further comprises a sequence selected from SEQ ID NO: 19, 21 or 22 containing one or more domains selected from: N-TRAF, ring finger, Zinc finger, coiled coil, P
OZ, and USP. Most preferably, the fragment has at least one less domain than in the protein from SEQ ID NO: 2, 4, or 6. Here, the domain is selected from N-TRAF, ring finger, zinc finger, coiled coil, POZ, and USP. Such domains are known in the art, as exemplified in Arch et al., Supra; and Wajant et al., Supra. Identification of domains in proteins derived from SEQ ID NOs: 2, 4, and 6 is done by reference to publications reporting such proteins (ie HAUSP (SEQ ID NO: 2), SPOP).
For (SEQ ID NO: 4) and TRAF7 (SEQ ID NO: 6), Eve respectively
rett et al., supra, Nagai et al., supra, and Nagase et al., supra).

As used herein, the phrase “conservative substitution” also refers to chemically substituted for a non-derivatized residue so long as the polypeptide exhibits the required binding activity. Includes the use of derivatized residues. The phrase "chemical derivative" refers to a test polypeptide in which one or more residues have been chemically derivatized by reaction of a functional side group. As such a derivatized molecule, for example, a free amino group may form an amine hydrochloride, a p-toluenesulfonyl group, a carbobenzoyl group, a t-butyloxycarbonyl group, a chloroacetyl group, or a formyl group. The molecules that have been derivatized are listed. Free carboxyl groups can be derivatized to form salts, methyl and ethyl esters, or other types of esters, or hydrazides. Free hydroxyl groups can be derivatized to form O-acetyl or O-alkyl derivatives. The imidazole nitrogen of histidine can be derivatized to form N-im-benzylhistidine. Chemical derivatives also include peptides of the 20 standard amino acids, including one or more naturally occurring amino acid derivatives. For example: 4-hydroxyproline can be replaced by proline; 5-hydroxylysine can be replaced by lysine;
3-Methylhistidine can be replaced with histidine; homoserine can be replaced with serine; and ornithine can be replaced with lysine. The polypeptides of the present invention may also include one or more residues compared to the sequence of a polypeptide set forth herein, so long as the required activity is maintained. It includes any polypeptide having additions and / or deletions.

According to another embodiment, there is provided a novel TPBD-containing TRAF protein. The TRAF protein containing the TPBD of the present invention is a protein containing the TPBD of the present invention containing SEQ ID NO: 19 or containing SEQ ID NO: 20, or a TRAF protein containing TPBD having the sequence Recombinant containing its naturally occurring allelic variant encoded by the mRNA produced by alternative splicing of the main transcript unless the sequence is numbered 2, 4 or 6. TRAF protein containing the TPBD of the present invention produced by Preferably, T containing TPBD
The RAF protein comprises a TPBD of the invention having a sequence substantially the same as SEQ ID NO: 8, 10, 12, 23, 24, or 25. More preferably TPBD
TRAF proteins containing SEQ ID NOs: 8, 10, 12, 23, 24,
Or TPBD of the invention having 25 sequences.

TRAFs containing TPBD containing the TPBD domain of the invention
The protein further binds to one or more members of the TNF family of receptors, or to one or more TRAF domain proteins, or to one or more TRAF-related proteins; or NF-
as regulating κB activity, or as regulating cJun N-terminal kinase (JNK) activity; or as regulating apoptosis, cell proliferation, cell adhesion, cell stress response, or B cell immunoglobulin class switching; or Characterized by any combination thereof.

In another embodiment of the invention, it comprises a TPBD of the invention or a fragment thereof, having the sequence of SEQ ID NO: 19 or SEQ ID NO: 20, and further derived from a heterologous protein. Chimeric proteins containing TPBD are provided that contain one or more sequences. The chimeric protein containing the TPBD of the present invention includes, for example, a polypeptide having the sequence of SEQ ID NO: 8, 10, 12, 23, 24, or 25. Sequences derived from a heterologous protein to which TPBD or a functional fragment thereof is fused include, for example, glutathione-S-transferase, antibodies, or other proteins or functional fragments thereof that facilitate the recovery of chimeras. Can be mentioned. Additional proteins to which TPBD or a functional fragment thereof is fused include, for example, luciferase, green fluorescent protein, antibodies, or other proteins or functional fragments thereof that facilitate the identification of chimeras. As a further protein to which TPBD or a functional fragment thereof is fused, eg a LexA DNA binding domain,
These include lysine, α-salicin, antibodies, or other proteins having therapeutic properties or other biological activity.

The amino acid sequence of the resulting chimeric protein is typically a non-naturally occurring sequence, since such a chimeric protein contains sequences derived from two different proteins. Therefore, according to this embodiment of the invention, a chimeric protein containing a TPBD of the invention, having the sequence of SEQ ID NO: 19 or SEQ ID NO: 20, unless the sequence of the chimeric protein is naturally occurring. Or a fragment thereof is provided.

Additional chimeric proteins of the invention contemplated herein are TPs of the invention.
BD is a chimeric protein in which one or more domains selected from heterologous protein-derived ring finger domains, zinc finger domains, and N-TRAF domains are combined. For example, SEQ ID NOs: 8, 10, 12, 23,
Twenty-four or twenty-five TPBDs can be fused to the ring finger domain of a TRAF protein such as human TRAF2, 3, 4, 5 or 6. Another example of such a chimera is a TRAF in which the TPBD of SEQ ID NO: 8, 10, 12, 23, 24, or 25 is human TRAF1, 2, 3, 4, 5, or 6, etc.
It is a protein fused to an N-TRAF domain derived from the protein.

Another embodiment of the invention is fused to a moiety to form a conjugate,
Provide TPBD or a functional fragment thereof. As used herein, a "moiety" can be a physical, chemical, or biological moiety that contributes functionality to TPBD or a functional fragment thereof. Functionality contributed by the moiety includes therapeutic or other biological activity, or the ability to facilitate identification or recovery of TPBD. Thus, the moieties include molecules known in the art to be useful in detecting conjugates, such as by fluorescence, magnetic imaging, detection of radioactive radiation, and the like. The moiety may also be useful for recovery of the conjugate, eg, a His tag or other known tag used for protein isolation / purification, or a physical material such as a bead. . The moiety can be a therapeutic compound, eg, a cytotoxic drug that can be effective to effect a biological change in the cell in which the conjugate localizes.

According to another embodiment of the present invention, the TPBD of the present invention and fragments thereof,
Oligomers containing the TPBD-containing proteins, TPBD-containing chimeric proteins, or combinations thereof of the present invention are provided. TP
It has been found that a BD, such as the TRAF7 TPBD (SEQ ID NO: 12 or 25), may bind at least one other comparable TPBD in forming homo-oligomers. Thus, in one embodiment, the invention comprises homooligomers of the TPBDs of the invention and fragments thereof, the TPBD-containing proteins of the invention, chimeric proteins containing TPBDs, or combinations thereof. .

In another embodiment of the invention, a TPBD of the invention and a fragment thereof, a protein containing a TPBD of the invention, a chimeric protein containing a TPBD, or a combination thereof is contained. Hetero-oligomers are provided. HAUSP-TPBD (SEQ ID NO: 8 or 23) of the present invention, SPOP-TP
BD (SEQ ID NO: 10 or 24), and TRAF7-TPBD (SEQ ID NO: 12)
Or 25) were all found to bind, for example, multiple TRAF proteins. Thus, the hetero-oligomer contains a TPBD of the present invention and fragments thereof, a protein containing a TPBD of the present invention, a chimeric protein containing a TPBD, or a combination thereof, and further human T
It contains a TRAF protein such as RAF1, TRAF2, TRAF3, TRAF4, TRAF5, TRAF6, or a combination thereof. For example, HA
USP-TPBD (SEQ ID NO: 8 or 23) is human TRAF1, TRAF2
, TRAF3, TRAF4, TRAF5, TRAF6 or combinations thereof can form hetero-oligomers. In another example, SPOP-TPBD (SEQ ID NO: 10 or 24) can form a hetero-oligomer with human TRAF1, TRAF6, or a combination thereof. In a further example, TRAF7-T
PBD (SEQ ID NO: 12 or 25) is human TRAF1, TRAF2, TRA
Hetero-oligomers with F3, TRAF4, TRAF5, TRAF6 or combinations thereof can be formed.

According to another embodiment of the present invention, the novel TPBD and its fragments, T
An isolated nucleic acid encoding a TRAF protein containing a PBD and a chimeric protein containing a TPBD is provided. The TPBD-encoding nucleic acid is preferably in vivo to one or more members of the tumor necrosis factor receptor family (TNFR family), or to one or more TRAF family members, or to one or more TRAFs. For related proteins,
Or having the ability to bind to any combination thereof, or NF
It encodes a protein having the ability to regulate κB activity, JNK activity, apoptosis, cell proliferation, cell adhesion, cell stress response, or B cell immunoglobulin class switching. Nucleic acids of the invention encode TPBD with the following _{sequence: E (X) 17-21 L (} X) 2 W (X) 3 VXP (X) 15- 16 L (X) 24-28 K (X ) _15-16 W (SEQ ID NO: 19). Here, X is any amino acid. Alternatively, the nucleic acid of the invention encodes a TPBD having the following sequence: LXWX (X ') XVXP (SEQ ID NO: 20). Here, X is any amino acid and X ′ is selected from L and I. Preferably, the nucleic acid of the invention encodes a TPBD having the sequence: E (X) _10-13 S (X) _6-7 LX.
W (X) ₃ VXP (X) _10-11 S (X) ₄ L (X) _24-28 K (X) _9-10 F (X) ₅ W
G (X) ₃ F (X) ₁₆ D (X) _5-7 V (SEQ ID NO: 21). Here, X is any amino acid. More preferably, the nucleic acid of the present invention has the following sequence: TPBD
Code: E (X) ₄ (X _A ) (X) _5-8 SX (X _B ) (X) _4-5 LXWX (X _A ) XVXP (X) _10-11 S (X _A ) (X) ₃ L (X) _16-18 (X _A ) (X) _4-6 (X _c
) (X) ₂ K (X) _9-10 F (X) ₅ WG (X _A ) (X) ₂ F (X) ₅ (X _A ) X (X _c
) (X) ₇ (X _c ) DX (X _A ) (X) _2-4 (X _C ) V (SEQ ID NO: 22). Where X is any amino acid, X _A is selected from V, L, and I; X _B is selected from P and G; X _C is selected from D, E, N, and Q; and X _D is Y
And F. Most preferably, the nucleic acid of the invention is SEQ ID NO: 8,10.
, TPBD containing the sequence 12, 23, 24, or 25.

The nucleic acid molecules described herein are useful for producing the proteins of the invention when such nucleic acids are incorporated into various protein expression systems known to those of skill in the art. is there. Further, such nucleic acid molecule or fragment thereof may be
The TP of the present invention can be labeled with readily detectable substituents and in a given sample.
It can be used as a hybridization probe to assay the presence and / or amount of BD gene or mRNA transcripts. The nucleic acid molecules and fragments thereof described herein are used as primers and / or templates in the polymerase chain reaction (PCR) to amplify genes encoding the proteins of the invention described herein. Is also useful.

The term “nucleic acid” (also called polynucleotide) includes ribonucleic acid (RNA) or deoxyribonucleic acid (DNA), probes, oligonucleotides, and primers. The DNA can be either complementary DNA (cDNA) or genomic DNA (eg, the gene encoding TPBD). One means of isolating TPBD-encoding nucleic acids is to probe a mammalian genomic library with natural or artificially designed DNA probes using methods well known in the art. Is. DNA probes derived from the TPBD gene are particularly useful for this purpose. DNA molecules and cDNA molecules encoding TPBD are eukaryotic (eg, human, primate, mammal, plant, nematode, insect, yeast, etc.).
Or a genomic DNA, cDNA, or R complementary to a mammalian source
To obtain NA or by the method described in more detail below.
It can be used to isolate related cDNA or genomic clones by screening A or genomic libraries.
Examples of nucleic acids are RNA, cDNA, or isolated genomic DNA encoding TPBD, unless the nucleic acid comprises the nucleotide sequence shown in SEQ ID NO: 1, 3, or 5. Such nucleic acids include, but are not limited to, nucleic acids containing nucleotide sequences that are substantially the same as those shown in SEQ ID NOs: 7, 9 and 11.

In one embodiment of the invention, the TPBD of the invention disclosed herein.
The cDNA coding for contains a nucleotide sequence substantially the same as the sequence shown in SEQ ID NO: 19 or 20, unless these include the sequences shown in SEQ ID NO: 1, 3 or 5. Preferably, the cDNA encoding the TPBD of the invention disclosed herein comprises a nucleotide sequence substantially the same as any of the sequences set forth in SEQ ID NOs: 7, 9 and 11, provided that these sequences are It does not include the sequences shown in No. 1, 3, or 5. A preferred cDNA molecule encoding a protein of the invention comprises the same nucleotide sequence as that shown in SEQ ID NOs: 7, 9 and 11.

In another embodiment of the invention, the cDNA encoding the TPBD of the invention disclosed herein has a nucleotide substantially the same as the sequence set forth in SEQ ID NO: 19 or 20, which is Sequences, provided that these are no longer than 639 bases long. Preferably, the cDNA encoding the TPBD of the invention disclosed herein comprises a nucleotide sequence substantially the same as any of the sequences set forth in SEQ ID NOs: 7, 9, and 11, provided that these It is no longer than 639 bases. Preferred cDNA molecules encoding the proteins of the invention are SEQ ID NOs: 7, 9,
And containing the same nucleotide sequence as shown in 11.

CDNA molecules encoding the TRAF domain of the present invention (SEQ ID NOS: 7, 9, and 11) are nucleotides 1-639 set forth in SEQ ID NO: 1; nucleotides 1-540 set forth in SEQ ID NO: 3; A nucleotide sequence identical to nucleotides 847 to 1305 shown in No. 5 is shown.

As used herein, “substantially the same nucleotide sequence” refers to DNA that has sufficient identity to a reference polynucleotide, such that this nucleotide sequence has a moderate Hybridizes to the reference nucleotide under stringent hybridization conditions. In one embodiment, DNA having a nucleotide sequence substantially the same as the reference nucleotide sequence is SEQ ID NO: 8, 1 unless the DNA encodes the sequence shown in SEQ ID NO: 2,4, or 6.
It encodes an amino acid sequence substantially the same as any of the sequences set forth in 0, 12, 23, 24, and 25. In another embodiment, the DNA having "substantially the same nucleotide sequence" as the reference nucleotide sequence has at least 60% identity with the reference nucleotide sequence. At least 7 relative to the reference nucleotide sequence
0%, more preferably at least 90%, even more preferably at least 95%
DNA having the same identity is preferred. Identity of any two nucleic acid sequences can be determined by one of skill in the art using default parameters, eg, based on BLAST 2.0 computer alignment. The BLAST 2.0 search is based on Tatiana et al., FEMS Microbiol Lett. 174: 2
47-250 (1999), http: // www. ncb
i. nlm. nih. gov / gorf / bl2. html. Is available at.

The present invention also includes nucleic acids that differ from the nucleic acids set forth in SEQ ID NOs: 7, 9, and 11 but have the same phenotype. Nucleic acids that are phenotypically similar are also referred to as "functionally equivalent nucleic acids." As used herein, the phrase “functionally equivalent nucleic acid” refers in substantially the same manner to produce the same protein product (s) as the nucleic acids disclosed herein. It includes nucleic acids that are characterized by subtle and insignificant sequence variations that are functional. In particular, a functionally equivalent nucleic acid encodes a polypeptide that is the same as that encoded by the nucleic acids disclosed herein or that has conservative amino acid mutations. For example, conservative mutations include the replacement of a non-polar residue with another non-polar residue, or a similarly charged residue with a charged residue. These mutations include those recognized by those of skill in the art as those that do not substantially alter the tertiary structure of the protein.

Further, the degeneracy of the genetic code provides for nucleic acids encoding TPBD that do not necessarily hybridize to the nucleic acids of the invention under specific hybridization conditions. Preferred nucleic acids encoding the TPBD of the invention are SEQ ID NOs: 8, 10
, And 12 consisting of nucleotides that encode substantially the same amino acid sequence as those shown in SEQ ID NOs.

Accordingly, exemplary nucleic acids encoding the TPBD of the present invention may be selected from: (a) DNA encoding the amino acid sequence set forth in SEQ ID NO: 19 or 20 (b) Moderately stringent. DNA that hybridizes to the DNA of (a) under conditions, wherein the DNA encodes a biologically active TPBD or is degenerate with (c) (b). Thus, the above DNA now encodes a biologically active TPBD (wherein the nucleic acid sequence does not encode an amino acid sequence longer than 213 residues).

Another exemplary nucleic acid encoding a TPBD of the present invention may be selected from: (a) DNA encoding the amino acid sequence set forth in SEQ ID NOs: 8, 10, 12, 23, 24, and 25, (B) a DNA which hybridizes to the DNA of (a) under moderately stringent conditions, wherein said DNA encodes a biologically active TPBD, or (c) (b) Wherein said DNA encodes a biologically active TPBD, wherein the nucleic acid sequence encodes the amino acid sequence set forth in SEQ ID NO: 2, 4, or 6. do not do.

Hybridization refers to the mutual binding of complementary strands of nucleic acids through hydrogen bonding (ie, sense strand: antisense strand or probe: target DNA), as well as naturally occurring binding in chromosomal DNA. Target DN with a given probe
The level of stringency used to hybridize with A can be readily modified by one of ordinary skill in the art.

The phrase “stringent hybridization” as used herein refers to conditions under which a polynucleic acid hybrid is stable. As known to those of skill in the art, the stability of a hybrid is reflected in the melting point ( _Tm ) of the hybrid. In general, hybrid stability is a function of sodium ion concentration and temperature. Typically, the hybridization reaction is performed under conditions of low stringency, followed by washes that alter the stringency wp (but not higher). With regard to hybridization, stringency refers to such wash conditions.

As used herein, the phrase “moderate stringency hybridization” refers to about 60% identity to the target DNA, preferably about 75%.
Nucleic acid and target DNA having about 85% identity, more preferably about 85% identity
Refers to the conditions that allow the binding of the; Preferably, moderately stringent conditions are hybridization in 50% formamide, 5x Denhardt's solution, 5xSSPE, 0.2% SDS at 42 ° C, followed by 0.2xSSPE. ,
The conditions are equivalent to a wash at 42 ° C in 0.2% SDS.

The phrase “high stringency hybridization” forms hybrids that are stable in 0.018 M NaCl at 65 ° C. (ie, if the hybrid is not stable at 0.018 M NaCl, 65 ° C.). , Which refers to conditions that allow hybridization of only nucleic acid sequences (which are not stable under conditions of high stringency, as intended herein). High stringency conditions are eg hybridization in 50% formamide, 5 × Denhardt's solution, 5 × SSPE, 0.2% SDS at 42 ° C.,
Subsequently, it can be provided by washing at 65 ° C. in 0.1 × SSPE and 0.1% SDS.

The phrase “low stringency hybridization” refers to hybridization at 42 ° C. in 10% formamide, 5 × Denhardt's solution, 6 × SSPE, 0.2% SDS, followed by 1 × SSPE. , 50% in 0.2% SDS
It means the same condition as washing at ℃. Denhardt's solution and SSPE (eg Sa
Mbrook et al., Molecular Cloning, A Laborato.
ry Manual, Cold Spring Harbor Laborat
ory Press, 1989) are well known to those skilled in the art as other suitable hybridization buffers.

As used herein, the term "degenerate" differs from a reference nucleic acid (eg, SEQ ID NOs: 7, 9, and 11) by at least one nucleotide, but encodes the same amino acid as the reference nucleic acid. The codon to do. For example, the triplet "UCU
, "UCC", "UCA", and "UCG" are degenerate with respect to each other. Because all of these four codons code for the amino acid serine.

Preferred nucleic acids encoding the polypeptide (s) of the present invention are moderately stringent (preferably, as long as they do not include the sequence set forth in SEQ ID NOs: 1, 3 or 5). Under high stringency conditions, substantially the entire sequence, or a substantial portion (ie, typically 15 to 30 nucleotides) of the nucleic acid sequences set forth in SEQ ID NOs: 7, 9, and 11. Hybridize to.

Nucleic acids of the invention can be prepared using methods well known in the art, such as those described herein, using PCR amplification using oligonucleotide primers derived from various regions such as SEQ ID NOs: 7, 9, and 11. Can be produced by the methods described therein.

According to a further embodiment of the present invention, an optionally labeled cDNA encoding TRAF or a fragment thereof is provided in a library (s) for additional nucleic acid sequences encoding a novel eukaryotic TPBD ( For example, cd
NA, genome, etc.). Appropriate eukaryotic cDNA
Library construction is well known in the art. Screening of such a cDNA library is first performed under conditions of low stringency.
The conditions include temperatures below about 42 ° C., formamide concentrations below about 50%, and moderate to low salt concentrations.

The preferred probe-based screening conditions described include temperature of about 37 ° C., formamide concentration of about 20%, and salt concentration of about 5 × standard citrate solution (S.
SC (pH 7.0); 20 × SSC contains 3M sodium chloride, 0.3M sodium citrate). Such conditions do not require perfect homology, but allow the identification of sequences that have a substantial degree of similarity to the probe sequences. The phrase "substantial similarity" refers to sequences that share at least 50% homology.
Preferably, hybridization conditions are selected which allow the identification of sequences having at least 70% homology with the probe, but which distinguish sequences having a low degree of homology with the probe. As a result, a nucleic acid having substantially the same nucleotide sequence as SEQ ID NOs: 1, 3, and 5 is obtained.

As used herein, a nucleic acid “probe” is the same (or complementary) to at least 14 contiguous bases shown in SEQ ID NOs: 7, 9, and 11. A single-stranded D having a sequence of nucleotides comprising at least 20, at least 50, at least 100, at least 200, at least 300, at least 400, or at least 500 contiguous bases,
NA or RNA or analogs thereof. Preferred regions for constructing the probe include the 5'and / or 3'coding regions of SEQ ID NOs: 7, 9, and 11. Furthermore, a cDNA encoding the region of TRAF of the present invention
The whole or the entire sequence corresponding to SEQ ID NO: 7, 9 and 11 can be used as a probe. The probe can be labeled by methods well known in the art, as described herein below, and used in various diagnostic kits.

As used herein, the terms “label” and “indicator means” in their various grammatical forms, either directly or indirectly, in producing a detectable signal. Refers to the single atoms and molecules involved. Any label or indicator means can be linked to the nucleic acid probe, expressed protein, polypeptide fragment, or antibody molecule of the present invention. These atoms or molecules can be used alone or in combination with additional reagents. Such labels are themselves well known in clinical diagnostic chemistry.

The labeling means can be a fluorescent labeling reagent that forms a useful immunofluorescent tracer, a fluorescent dye (dye) that chemically binds to antibodies or antigens without denaturation. For a description of immunofluorescence analysis techniques, see DeLuca, “Immunofluorescence.
Analysis ", Antibody As a Tool, Marcha
ed. by Lonis et al., John Wiley & Sons, Ltd, 189-23.
See page 1 (1982), which is incorporated herein by reference.

In one embodiment, the indicator group is horseradish peroxidase (HRP).
, Enzymes such as glucose oxidase. In another embodiment, radioactive elements are used to label the reagents. Binding of label to substrate (ie labeling of nucleic acid probes, antibodies, polypeptides, and proteins)
Are well known in the art. For example, the antibodies of the invention can be labeled by the metabolic uptake of radiolabeled amino acids provided in the culture medium. For example, G
alfre et al., Meth. Enzymol. , 73: 3-46 (1981). The conventional means of attachment or coupling by activated functional groups of proteins are particularly applicable. See, eg, Aurameas et al., Scand.
J. Immunol. Volume 8, Supplement, 7: 7-23 (1978), Rodwel
l et al., Biotech. , 3: 889-894 (1984), and U.S. Pat. No. 4,493,795.

In another embodiment of the invention, having the sequence of SEQ ID NO: 19 or SEQ ID NO: 20, and further containing one or more sequences from a heterologous protein,
Nucleic acids encoding chimeric proteins containing the TPBDs or fragments thereof of the present invention are provided. Functional fragments of TPBD include, for example, the polypeptides having the sequences of SEQ ID NOs: 8, 10, 12, 23, 24, or 25. The nucleic acid encoding the protein to which the TPBD or functional fragment thereof is fused may also encode, for example, glutathione-S-transferase, an antibody, or another protein or functional fragment thereof that facilitates recovery of the chimera. . The nucleic acids of the present invention also include proteins to which TPBD or a functional fragment thereof is fused (eg, luciferase, green fluorescent protein,
Antibodies, or other proteins or functional fragments thereof that facilitate the identification of chimeras). Still further nucleic acids of the invention are proteins to which TPBD or a functional fragment thereof is fused, including a LexA DNA binding domain, lysine, α-salicin, antibody, or other protein having therapeutic properties or other biological activity. Code

The present invention also provides compositions containing an acceptable carrier and any protein containing isolated and purified TPBD or a functional polypeptide fragment thereof, alone or in combination with each other. provide. These polypeptides or proteins can be recombinantly derived, chemically synthesized, or purified from natural sources. As used herein,
The term "acceptable carrier" refers to any standard pharmaceutical carrier (eg, phosphate buffered saline, water, and emulsions (eg, oil / water or water / oil emulsions)). Various types of wetting agents).

The TPBD compositions described herein can be used, for example, in a method for modulating the activity of a member of the TNFR family. Binding to the TNF family of receptors is well known in the art as mediating the signaling activity of the receptor, and it is demonstrated herein that the TPBD of the invention can bind to the TNF receptor. Thus, it is found that a protein containing the sequence of SEQ ID NO: 19 or 20, or a nucleic acid encoding a protein containing the sequence of SEQ ID NO: 19 or 20, regulates the activity of one or more TNF family receptors. Within the range of.

In one embodiment, the regulation of members of the TNFR family is TNF.
Contacting a member of the R family with a protein containing the sequence of SEQ ID NO: 19 or 20. Preferably, the method is SEQ ID NO: 8, 1.
Contacting the cell with a protein containing the sequence 0, 12, 23, 24, or 25.

In another embodiment, the regulation of members of the TNFR family is TNFR.
Contacting a member of the family with a nucleic acid encoding a protein containing the sequence of SEQ ID NO: 19 or 20. Preferably, the method comprises
Contacting the cell with a nucleic acid encoding a protein containing the sequence of SEQ ID NOs: 8, 10, 12, 23, 24, or 25.

In another embodiment, a TPBD described herein, eg, in a method for modulating the activity of a protein containing a TRAF domain.
The composition may be used. Therefore, the protein containing the sequence of SEQ ID NO: 19 or 20, or the nucleic acid encoding the protein containing the sequence of SEQ ID NO: 19 or 20, is the activity of a protein containing one or more TRAF domains. It is within the scope of the invention to adjust

In one embodiment, regulation of a protein containing a TRAF domain is performed by changing the protein containing a TRAF domain to SEQ ID NO: 19 or 20.
Contacting with a protein containing the sequence of Preferably, the method comprises contacting the cell with a protein containing the sequence of SEQ ID NO: 8, 10, 12, 23, 24, or 25.

In another embodiment, regulation of a protein containing a TRAF domain comprises adding a protein containing a TRAF domain to a nucleic acid encoding a protein containing the sequence of SEQ ID NO: 19 or 20. The step of contacting is included.
Preferably, the method comprises contacting the cell with a nucleic acid encoding a protein containing the sequence of SEQ ID NO: 8, 10, 12, 23, 24, or 25.

In another embodiment, a T containing the sequence of SEQ ID NO: 19 or 20.
A nucleic acid encoding PBD, or a protein containing the sequence of SEQ ID NO: 19 or 20, regulates the activity of one or more TRAF-related proteins. Some TRAF-related proteins are known to regulate NF-κB activity, others are known to regulate cJun N-terminal kinase (JNK) activity, and yet others , Are known to regulate the activity of other proteins. For example, c-IAP1 and c-IAP2 regulate caspase activity,
And thus affect apoptosis. Thus, the TRAF domain proteins of the present invention may regulate the activity of TRAF-related proteins, which are any protein known to interact with them.
It is within the scope of the present invention.

In one embodiment, modulating a TRAF-related protein comprises contacting the TRAF-related protein with a protein containing the sequence of SEQ ID NO: 19 or 20. Preferably, the method is SEQ ID NO: 8, 10, 12, 2.
Contacting the cell with a protein containing 3, 24, or 25 sequences.

In another embodiment, modulating a TRAF-related protein comprises contacting the TRAF-related protein with a nucleic acid encoding a protein containing the sequence of SEQ ID NO: 19 or 20. Preferably, the method is SEQ ID NO: 8,
Contacting the cell with a nucleic acid encoding a protein containing the 10, 12, 23, 24, or 25 sequence.

TPBD compositions can also be used in methods for modulating the activity of, for example, NF-κB and cJun N-terminal kinase (JNK). TP of the present invention
Protein homologues for BD, such as the human TRAF domain protein, are well known in the art as modulating the activity of NF-κB and JNK, and are further referred to herein as SEQ ID NOs: 8, 10, 12, It has been shown that 23, 24, and 25 can regulate NF-κB activity. Therefore, according to another embodiment of the present invention, the protein containing the sequence of SEQ ID NO: 19 or 20, or the nucleic acid encoding the protein containing the sequence of SEQ ID NO: 19 or 20, is NF-κB or Modulates the activity of JNK.

In one embodiment, the modulation of NF-κB or JNK activity is NF-κ.
contacting a cell containing κB or JNK activity with a protein containing the sequence of SEQ ID NO: 19 or 20. Preferably, the method comprises contacting the cell with a protein containing the sequence of SEQ ID NO: 8, 10, 12, 23, 24, or 25.

In another embodiment, the modulation of NF-κB or JNK activity is NF-κ.
Contacting a cell containing B or JNK activity with a nucleic acid encoding a protein containing the sequence of SEQ ID NO: 19 or 20. Preferably, the method comprises contacting the cell with a nucleic acid encoding a protein containing the sequence of SEQ ID NO: 8, 10, 12, 23, 24, or 25.

The function of the TPBD of the present invention plays a role of TRAFs in regulating the cellular pathways that achieve apoptosis, cell proliferation, cell adhesion, cell stress response, or B cell immunoglobulin class switching. to support. Therefore,
According to another embodiment of the invention, the protein containing the sequence SEQ ID NO: 19 or 20, or the nucleic acid encoding the protein containing the sequence SEQ ID NO: 19 or 20, is used for apoptosis, cell proliferation, cell It regulates adhesion, cellular stress response, or B-cell immunoglobulin class switching.

In one embodiment, the modulation of apoptosis, cell proliferation, cell adhesion, cell stress response, or B cell immunoglobulin class switching is performed in a cell containing a sequence of SEQ ID NO: 19 or 20. In contact with a protein that is present, which regulates apoptosis, cell proliferation, cell adhesion, cell stress response, or B cell immunoglobulin class switching. Preferably, the method comprises contacting the cell with a protein containing the sequence of SEQ ID NOs: 8, 10, 12, 23, 24, or 25.

In another embodiment, the modulation of apoptosis, cell proliferation, cell adhesion, cell stress response, or B cell immunoglobulin class switching comprises the cell containing a sequence of SEQ ID NO: 19 or 20. Contacting a nucleic acid encoding a protein that is present, which results in apoptosis, cell proliferation, cell adhesion,
The cellular stress response or the switching of B cell immunoglobulin classes is regulated. Preferably, the method comprises treating the cells with SEQ ID NOs: 8, 10, 12, 23.
Contacting with a nucleic acid encoding a protein containing the sequence 24, 24, or 25.

Also provided are antisense nucleic acids that have the ability to specifically bind to full length mRNA or any portion of mRNA encoding a TPBD polypeptide, such that it has a sequence that prevents transcription of the mRNA. The antisense nucleic acid can have a sequence capable of specifically binding to any portion of the sequence of the cDNA encoding the TPBD polypeptide. As used herein, the phrase "binds specifically" recognizes complementary nucleic acid sequences, and double helix segments with them through the formation of hydrogen bonds between complementary base pairs. The ability of the nucleic acid sequence to form. Examples of antisense nucleic acids are antisense nucleic acids containing chemical analogs of nucleotides.

Contains a certain amount of the antisense nucleic acid described above, is effective for reducing the expression of TPBD polypeptide by crossing the cell membrane,
Also provided herein are compositions that specifically bind to mRNA encoding a TPBD polypeptide so as to prevent translation, and compositions containing an acceptable hydrophobic carrier capable of crossing cell membranes. To be done. Suitable hydrophobic carriers are, for example, US Pat. Nos. 5,334,761; 4,889,953;
897,355 and the like. Acceptable hydrophobic carriers that are capable of crossing the cell membrane also include structures that bind to receptors specific for the selected cell type and are thereby taken up by cells of the selected cell type. This structure may be part of a protein known to bind to cell type specific receptors.

Antisense nucleic acid compositions are useful for inhibiting translation of mRNA encoding a polypeptide of the invention. Synthetic oligonucleotides or other antisense chemical structures bind to the TPBD polypeptide-encoding mRNA,
It is then designed to inhibit the translation of mRNA and is useful as a composition for inhibiting the expression of TPBD-related genes in tissue samples or subjects.

According to another embodiment of the invention, a kit for detecting mutations, duplications, deletions, rearrangements, and aneuploidies in the TPBD gene comprises at least one probe or antisense nucleotide of the invention. Contains.

The present invention provides a means for modulating the level of expression of TPBD polypeptides by using synthetic antisense nucleic acid compositions (hereinafter SANC). This inhibits translation of the mRNA encoding these polypeptides. The chemical structure of synthetic oligonucleotides or other antisense nucleic acids designed to recognize and selectively bind mRNA is set forth in SEQ ID NOs: 7, 9,
It is constructed to be complementary to the entire length or a part of the coding strand of TPBD, which comprises the nucleotide sequences shown in 11 and 11. SANCs are designed to be stable in the bloodstream for administration to a subject by injection or stable under cell culture conditions in the laboratory. SANC is designed, for example, by designing the chemical structure of a small, hydrophobic SANC to enter the cytoplasm of cells through the physical and chemical properties of SNAC that causes it to cross the cell membrane. Alternatively, it is designed to be able to cross the cell membrane by means of a specific transport system in the cell that recognizes SANC and transports SANC into the cell. Moreover, SANCs bind to a selected population of cells and S only within that population.
By targeting SANC that is recognized by a specific cellular uptake mechanism that takes up ANC, it can be designed for administration only to a particular selected population of cells. In a particular embodiment, the SANC is an antisense oligonucleotide.

For example, SANCs can be designed to bind to receptors found only in particular cell types, as discussed above. SANCs are also designed to recognize and selectively bind target mRNA sequences. this is,
It may correspond to the sequences contained in the sequences shown in SEQ ID NOs: 7, 9 and 11. S
Does ANC bind to it and induce mRNA degradation (eg, RNase
I digestion), or inhibiting the translation of the target sequence of mRNA by binding and interfering with transcriptional regulators or ribosomes, or other chemical structures (eg, ribozyme sequences or reactive chemical groups (targets). target mRN, either by degrading the mRNA or chemically modifying)))
Designed to inactivate the A sequence. SANCs have been shown to be capable of such properties when directed against mRNA targets (Cohen et al., TIPS, 10: 435 (1989) and Weintraub, Sci. A).
Merican, January (1990), page 40; both are hereby incorporated by reference).

According to yet another embodiment of the present invention there is provided a method for recombinant production of the TPBD of the present invention by expressing the above nucleic acid sequence in a suitable host cell. Recombinant DN suitable for producing the TPBD described herein
The A expression system is well known in the art. For example, the above nucleotide sequence can be incorporated into a vector for further manipulation. Vector (or plasmid), as used herein, refers to discrete elements used to introduce heterologous DNA into a cell, either for its expression or replication.

Suitable expression vectors are well known in the art, and vectors capable of expressing DNA operably linked to regulatory sequences such as promoter regions that can regulate the expression of such DNA. Can be mentioned. Thus, expression vector refers to recombinant DNA or RNA constructs (eg, plasmids, phages, recombinant viruses or other vectors) which have been engineered for, when introduced into a suitable host, inserted D.
Result in the expression of NA. Suitable expression vectors are well known to those of skill in the art and are replicable in eukaryotic cells and / or prokaryotic cells and remain episomal or integrated into the genome of the host cell. .

As used herein, a promoter region refers to a segment of DNA that controls transcription of operably linked DNA. As a promoter region,
Specific sequences are included that are sufficient for RNA polymerase recognition, binding, and transcription initiation. In addition, the promoter region contains sequences that regulate this recognition, binding, and transcription initiation activity of RNA polymerase. These sequences can be cis-acting or can respond to trans-acting factors. The promoter can be constitutive or regulated, depending on the nature of the regulation. As an exemplary promoter intended for use in the practice of the present invention, SV40
The early promoter, cytomegalovirus (CMV) promoter, mouse mammary tumor virus (MMTV) steroid-inducible promoter, Moloney murine leukemia virus (MMLV) promoter and the like can be mentioned.

As used herein, the term "operably linked" refers to regulatory and effector nucleotide sequences (eg, promoters, enhancers, transcriptional and translational stop sites, and other signal sequences). And the functional relationship of DNA with. For example, operably linked DNA to a promoter refers to the physical and functional relationship between the DNA and the promoter, such that transcription of such DNA specifically recognizes DNA and It is initiated from a promoter by an RNA polymerase that binds and transcribes it.

As used herein, expression refers to the process by which a polynucleic acid is transcribed into mRNA and translated into a peptide, polypeptide, or protein.
If the polynucleic acid is derived from genomic DNA, expression will include splicing of the mRNA if an appropriate eukaryotic host cell or organism is selected.

Prokaryotic transformation vectors are well known in the art, and pBluesk
ript and phage Lambda ZAP vector (Stratagene
, La Jolla, CA) and the like. Other suitable vectors and promoters are disclosed in detail in US Pat. No. 4,798,885 issued Jan. 17, 1989. This disclosure is incorporated herein by reference in its entirety.

E. Another suitable vector for transformation of E. coli cells is the pET expression vector (see Novagen, US Pat. No. 4,952,496) (
For example, pET11a, which contains the T7 promoter, T7 terminator, inducible E. coli lac operator, and lac repressor gene; and pET 12a-c, which contains the T7 promoter, T7 terminator, and E. coli. including the ompT secretion signal)). Another suitable vector is pIN-IIIompA2 (Duffaud et al., M.
eth. in Enzymology, 153: 492-507, 1987). It contains the lpp promoter, the lacUV5 promoter operator, the ompA secretion signal, and the lac repressor gene.

Exemplary eukaryotic transformation vectors include cloned bovine papillomavirus genomes, murine retrovirus cloned genomes, and eukaryotic cassettes (eg, pSV-2 gpt system (
Mulligan and Berg, Nature, 277: 108-114 (1.
979)), the Okayama-Berg cloning system (Mol. Cell. Biol. 2: 161-170 (1982)), and G.
The expression cloning vector described by the Enetics Institute (Wong et al., Science 228: 810-815 (1985).
) Are available and they provide substantial confirmation of at least some expression of the protein of interest in transformed eukaryotic cell lines.

A particularly preferred basic vector containing regulatory sequences that can be ligated to the DNA encoding the TPBD of the invention for transfection of mammalian cells is:
Vectors based on the cytomegalovirus (CMV) promoter (eg pc
DNA1 (Invitrogen, San Diego, CA), a vector based on the MMTV promoter (for example pMAMNeo (Clontech, P).
alo Alto, CA) and pMSG (Pharmacia, Piscat)
Away, NJ)) as well as vectors based on the SV40 promoter (eg pSVβ (Clontech, Palo Alto, CA)).

According to another embodiment of the invention, there is provided a "recombinant cell" containing a nucleic acid molecule of the invention (ie, DNA or mRNA). Applicable for transforming suitable host cells (preferably bacterial cells, and more preferably E. coli cells), as well as culturing the above cells containing a gene encoding a heterologous protein. Methods are generally known in the art. For example, S
ambrook et al., Molecular Cloning: A Laborat
ory Manual (2nd edition) Cold Spring Harbor La
laboratory Press, Cold Spring Harbor, Ne
See York, USA (1989).

Exemplary methods of transformation include, for example, transformation with plasmids, viruses, or bacteriophage vectors, transfection, electroporation, lipofection and the like. The heterologous DNA may optionally include a sequence capable of its extrachromosomal maintenance, or may be a heterologous DN as described above.
A may cause integration into the host's genome (as an alternative means to ensure stable maintenance in the host).

Host organisms contemplated for use in the practice of the present invention include those organisms in which recombinant production of heterologous proteins has occurred. Examples of such host organisms include bacteria (eg E. coli), yeast (eg Sacch).
aromyces cerevisiae, Candida tropical
is, Hansenula polymorpha, and P. pasotri
s; see, for example, US Pat. Nos. 4,882,279, 4,837,148, 4,929,555, and 4,855,231), mammalian cells. (Eg, HEK293, CHO, and Ltk ⁻ cells), insect cells, and the like. The preferred host organism in the present invention is a bacterium. The most preferred bacteria are E. E. coli.

In one embodiment, TPBD-encoding nucleic acids of the invention can be delivered into mammalian cells either in vivo or in vitro using appropriate viral vectors well known in the art. . Suitable retroviral vectors specially designed for "gene therapy" methods are described, for example, in WIPO Publication No. WO9.
205266 and WO9214829. This provides a description of methods for efficiently introducing nucleic acids into human cells. Furthermore, the introduction of the antisense strand of the nucleic acids of the invention is intended when it is desired to limit or reduce the in vivo expression of the TRAFs of the invention.

Virus-based systems offer the advantage of being able to introduce relatively high levels of heterologous nucleic acid into a variety of cells. Suitable viral vectors for introducing the nucleic acids of the invention encoding TPBD into mammalian cells (eg vascular tissue segments) are well known in the art. These viral vectors include, for example, herpes simplex virus vectors (eg, Geller et al., Sci.
ence, 241: 1667-1669 (1988)), a vaccinia virus vector (for example, Piccini et al., Meth. in Enzymology,
153: 545-563 (1987); cytomegalovirus vector (Moc
arski et al., Viral Vectors, Y. Gluzman and S.M. H
． Hughes edition, Cold Spring Harbor Laborato
ry, Cold Spring Harbor, N .; Y. , 1988, 78-8
4), Moloney murine leukemia virus vector (Danos et al., PNAS, U).
SA, 85: 6469 (1980)), adenovirus vectors (eg Lo.
gan et al., PNAS, USA, 81: 3655-3659 (1984); Jon.
es et al., Cell, 17: 683-689 (1979); Berkner, Bi.
otechniques, 6: 616-626 (1988); Cotten et al.,
PNAS, USA, 89: 6094-6098 (1992); Graham et al.,
Meth. Mol. Biol. 7: 109-127 (1991)), adeno-associated virus vector, retrovirus vector (for example, US Pat. No. 4,405).
, 712 and 4,650, 764) and the like. Particularly preferred viral vectors are adenovirus and retrovirus vectors.

For example, in one embodiment of the invention, the adenovirus-transferrin / polylysine-DNA (TfAdp1-DNA) vector complex (Wagne).
er et al., PNAS, USA, 89: 6099-6103 (1992); Curi.
el et al., Hum. Gene Ther. , 3: 147-154 (1992); G.
ao et al., Hum. Gene Ther. , 4: 14-24 (1993)) is used to transduce mammalian cells with a heterologous TPBD nucleic acid. Any of the plasmid expression vectors described herein may contain TfAdp1-D.
It can be used in NA complexes.

As used herein, a “retroviral vector” is a well known transgenic plasmid that has an expression cassette that encodes a heterologous gene located between two retroviral LTRs. Say. Retroviral vectors typically allow RNA transcribed using a retroviral vector, or a retroviral vector as a template, to be packaged into viral virions in a suitable packaging cell line. , With appropriate packaging signals (see, eg, US Pat. No. 4,650,764).

Retroviral vectors suitable for use herein are described, for example, in US Pat. No. 5,252,479, and WIP, which are incorporated herein by reference.
O Publication number WO92 / 07573, WO90 / 06997, WO
89/05345, WO92 / 05266, and WO92 / 14
No. 829. These provide a description of methods for efficiently introducing nucleic acids into human cells using such retroviral vectors. Other retroviral vectors include, for example, mouse mammary tumor virus vectors (eg, Shackleford et al., PNAS, USA, 85: 9655.
-9659 (1988)) and the like.

According to yet another embodiment of the present invention there is provided an anti-TPBD antibody having specific reactivity with one or more TPBD polypeptides of the present invention. Active fragments of antibodies are included in the definition of "antibody". The antibody of the present invention can be produced by a method known in the art using the polypeptide, protein, or a part thereof of the present invention as an antigen. For example, polyclonal and monoclonal antibodies are described, for example, in Harlow and Lane, Antibodies: A Labo.
rally Manual (Cold Spring Harbor Lab)
can be produced by methods well known in the art, as described in Oratory (1988)). It is incorporated herein by reference. The polypeptides of the present invention can be used as immunogens in making such antibodies. Alternatively, synthetic peptides can be prepared (using commercially available synthesizers) and used as the immunogen. Amino acid sequences can be analyzed by methods well known in the art to determine whether they encode the hydrophobic or hydrophilic domains of the corresponding polypeptides. Chimeric antibody, humanized antibody, CDR grafted antibody, or bifunctional
1) Modified antibodies such as antibodies can also be produced by methods well known in the art. Such antibodies may also be produced by hybridoma, chemical synthesis, or recombinant methods, for example, as described in Sambrook et al., Supra, and Harlow and Lane, supra. Both anti-peptide and anti-fusion protein antibodies can be used. (For example, Bahouth et al., Trends
Pharmacol. Sci. 12: 338 (1991); Ausubel et al.,
Current Protocols in Molecular Biolo
gy (See John Wiley and Sons, NY (1989), which is incorporated herein by reference).

The antibodies so produced are particularly diagnostic methods for detecting the level of TPBD present in a mammalian (preferably human) body sample (eg tissue or vascular fluid) and Can be used in the system. Such antibodies also
It can be used for the purification of the TRAFs of the invention by immunoaffinity chromatography or affinity chromatography. Further contemplated herein are methods for detecting the presence of TPBD of the invention, either intracellularly or on the surface of cells. This method involves contacting a cell with an antibody that specifically binds to a TPBD polypeptide under conditions that allow the binding of the antibody to the TPBD polypeptide, and detecting the presence of the antibody bound to the TPBD polypeptide. And thereby detecting the presence of the polypeptide of the invention on the surface of the cell. For detection of such polypeptides, the antibodies can be used for in vitro diagnostics or in vivo imaging methods.

Immunological procedures useful for the in vitro detection of target TPBD polypeptides in a sample include immunoassays using detectable antibodies.
Such immunoassays include, for example, ELISA, Pandex microfluorimetric assay, agglutination assay, flow cytometry, serum diagnostic assay, and immunohistochemical staining procedures, which are well known in the art.
Antibodies can be made detectable by various means well known in the art. For example, a detectable marker can be attached directly or indirectly to the antibody. Useful markers include, for example, radionucleotides, enzymes, fluorophores, chromogens, and chemiluminescent labels.

The anti-TPBD antibodies of the invention are herein used to modulate the activity of a TPBD polypeptide in living animals, humans, or biological tissues or fluids isolated therefrom. Intended for use. The term "modulate" increases (eg, through an agonist), decreases (eg, through an antagonist), or otherwise modifies (eg, through) the biological activity of a TPBD protein of the invention as follows: First TPBD while decreasing second TPBD activity
(Increasing activity) the ability of a compound to refer to: TNFR family binding, TRAF
Protein binding activity, TRAF-related protein binding activity, NF-κB regulatory activity, JNK regulatory activity, apoptosis regulatory activity, cell proliferation regulatory activity, cell adhesion, cellular stress response regulatory activity, or B cell immunoglobulin Class switch regulatory activity, etc. Thus, an amount of an antibody having specificity for a TPBD polypeptide that is effective to block naturally occurring ligands or other TPBD-related proteins from binding to the TPBD polypeptides of the invention, and Compositions comprising a carrier are contemplated herein. For example, a monoclonal antibody directed against an epitope of the TPBD polypeptide of the invention containing the amino acid sequences set forth in SEQ ID NOs: 8, 10, 12, 23, 24, and 25 is for this purpose. Can be useful for.

The invention further provides a transgenic non-human mammal capable of expressing an exogenous nucleic acid encoding TPBD. As used herein, the phrase "exogenous nucleic acid" is not native to the host or is present in the host in a environment other than its native environment (eg, a genetically engineered DNA construct). (As part of) a nucleic acid sequence. In addition to naturally occurring levels of TPBD-containing proteins, the TPBDs of the invention are overexpressed or underexpressed in transgenic mammals (eg, as in known knockout transgenics). Could be either.

Mutated such that normal activity is not possible (ie native TP
Transgenic non-human mammals capable of expressing a nucleic acid encoding a TPBD polypeptide (which does not express BD) are also provided. The present invention also provides mRNA
TPB, which hybridizes to and thereby reduces its translation
Antisense mRNs complementary to mRNA encoding D polypeptide
Provided is a transgenic non-human mammal having a genome containing an antisense nucleic acid complementary to a nucleic acid encoding a TPBD polypeptide, arranged to be transcribed into A. . The nucleic acid further contains inducible promoters and / or tissue-specific regulatory elements such that expression can be induced or restricted to specific cell types. An example of a nucleic acid is SEQ ID NO: 1.
A DNA or cDNA having a coding sequence substantially the same as the coding sequences shown in 3, and 5. Examples of non-human transgenic mammals are:
It is a transgenic mouse. Examples of tissue specificity determining elements are the metallothionein promoter and the L7 promoter.

Physiological role and behavior of TPBD polypeptides
An animal model system describing the role is also provided, which is produced by creating transgenic animals in which the expression of the TPBD polypeptide is altered using various techniques. Examples of such techniques are suitable for producing transgenic animals, normal or mutated versions of nucleic acids encoding TRAF polypeptides, by microinjection, retroviral infection, or other means known to those of skill in the art. Examples include insertion into a fertilized embryo. (For example, Ho
gan et al., Manipulating the Mouse Embryo: A
Laboratory Manual (Cold Spring Harbo)
r Laboratory, (1986)).

As used herein, in order to alter the regulation of TPBD polypeptide expression or structure, a homologous recombination technique of a mutant or normal version of the TPBD gene with a native locus in a transgenic animal is used. Also intended for use (
Capecchi et al., Science 244: 1288 (1989); Zim.
See mer et al., Nature 338: 150 (1989); these are incorporated herein by reference). Homologous recombination is well known in the art. Homologous recombination does not express the native (endogenous) protein, but to produce an animal capable of expressing a mutated protein that results in, for example, altered expression of the TPBD polypeptide, to produce a native (endogenous) protein. Replace the gene with the recombinant or mutated gene.

In contrast to homologous recombination, microinjection adds a gene to the host genome without removing the host gene. Microinjection can give rise to transgenic animals that can express both endogenous and exogenous TPBD. An inducible promoter can be linked to the coding region of the nucleic acid to provide a means for controlling the expression of the transgene. Tissue-specific regulatory elements can be linked to the coding region to allow tissue-specific expression of the transgene. The transgenic animal model system is useful for in vivo screening of compounds for the identification of specific ligands (ie, agonists and antagonists) that activate or inhibit the protein response.

The nucleic acids of the invention, oligonucleotides (including antisense), vectors containing them, transformed host cells, polypeptides, and combinations thereof, and antibodies of the invention are compounds It can be used to screen compounds in vitro to determine if they function as effective agonists or antagonists of the TPBD of the invention. These in vitro screening assays provide information regarding the function and activity of the TPBD of the present invention. This can lead to the identification and design of compounds that can specifically interact with one or more types of polypeptides, peptides, or proteins.

[0134]   As used herein, the TPBD of the invention comprises the following sequences:
E (X)_17-21L (X)₂W (X)₃VXP (X)_15-16L (X)_24-28K (X)_{15- 16} W (SEQ ID NO: 19). Here, X is any amino acid. Alternatively,
Ming TPBD is characterized as having the following sequence: LXWX (X ').
XVXP (SEQ ID NO: 20). Where X is any amino acid and X '
Is selected from L and I. Preferably, the TPBD of the present invention has the following sequence:
Yes: E (X)_10-13S (X)_6-7LXW (X)₃VXP (X)_10-11S (X)_FourL
(X)_24-28K (X)_9-10F (X)_FiveWG (X)₃F (X)₁₆D (X)_5-7V (array
No. 21). Here, X is any amino acid. More preferably, the invention
TPBD has the following sequence: E (X)_Four(X_A) (X)_5-8SX (X_B) (X
)_4-5LXWX (X_A) XVXP (X)_10-11S (X_A) (X)₃L (X)_16-18(X _A ) (X)_4-6(X_c) (X)₂K (X)_9-10F (X)_FiveWG (X_A) (X)₂F (X
)_Five(X_A) X (X_c) (X)₇(X_c) DX (X_A) (X)_2-4(X_C) V (SEQ ID NO:
22). Where X is any amino acid and X_AIs selected from V, L, and I
Selected; X_BIs selected from P and G; X_CIs selected from D, E, N, and Q
And X_DIs selected from Y and F. Most preferably, the TPB of the present invention
D comprises the sequence of SEQ ID NO: 8, 10, 12, 23, 24, or 25.

Due to the known homology of the TPBD of the present invention to known TRAF domains,
It is within the present invention that the TPBD of the present invention also has a role in the cellular pathways that achieve apoptosis, cell proliferation, cell adhesion, cell stress response, B cell immunoglobulin class switching. Thus, the TPBD of the present invention is also for a wide variety of pathologies including autoimmunity, inflammation, allergies, allograft rejection, and sepsis, as well as a wide variety of cancer pathologies (eg, glioma, It provides drug discovery targets for carcinomas, sarcomas, melanomas, hamartomas, etc.). In a particular aspect of the invention, the TRAF protein of the invention, or an agonist or antagonist thereto, comprises autoimmunity, inflammation, allergy, allograft rejection, sepsis, keratinocyte hyperplasia, neoplasm, keloid, benign prostate gland. It is used to treat hypertrophy, inflammatory hyperplasia, fibrosis, smooth muscle cell proliferation (restenosis) in arteries after balloon angioplasty. Exemplary cancer pathologies contemplated herein for treatment include glioma, carcinoma, adenocarcinoma, sarcoma, melanoma, hamartoma, leukemia, lymphoma, and the like.

Also provided herein are methods for treating a pathology. The above methods include the step of administering an effective amount of the therapeutic composition of the present invention. Such compositions are typically administered in physiologically compatible compositions.

Methods for treating aberrant cell proliferation pathologies include methods of modulating the activity of one or more oncogene proteins. Here, the oncogene protein is T
It interacts specifically with PBD. A method of modulating the activity of such an oncogene protein comprises contacting the oncogene protein with substantially pure TPBD or an active fragment thereof (ie, an oncogenic protein binding fragment). This contact regulates the activity of the oncogene protein, thereby providing a method for treating the pathologies caused by the oncogene protein. A further method of modulating the activity of the oncogene protein comprises contacting the oncogene protein with a factor that modulates the interaction between TPBD and the oncogene protein.

Immune-based pathologies (eg autoimmunity, inflammation, allergies, allograft rejection,
And sepsis) include modulating the activity of one or more proteins that modulate the immune response. Here, proteins that regulate the immune response interact specifically with TPBD. Methods of modulating the activity of such proteins that modulate the immune response include contacting substantially pure TPBD or an active fragment thereof (ie, a protein binding fragment) with a protein that modulates the immune response. To be This contact regulates the activity of proteins that regulate the immune response, thereby providing a method for treating pathologies caused by proteins that regulate the immune response. A further method of modulating the activity of a protein that regulates an immune response includes contacting a factor that regulates the interaction between TPBD and a protein that regulates an immune response with a protein that regulates an immune response.

Also herein, the pharmaceutical of the present invention for the treatment of pathological disorders in which there are too few cell divisions (eg myelodysplasia, immunodeficiency due to reduced lymphocyte count, etc.). Methods of treatment using the topical compositions are contemplated. Also provided herein are methods of treating various inflammatory disorders (eg, treating sepsis, fibrosis (eg, scarring), arthritis, graft-versus-host disease, etc.) with the therapeutic compositions of the invention. Intended in the book.

The present invention also provides therapeutic compositions that are useful for practicing the therapeutic methods described herein. Therapeutic compositions (eg, pharmaceutical compositions) of the invention
Is a TPBD (or functional fragment thereof) of the invention, a TPBD modulating reagent (eg, a compound (agonist or antagonist) identified by the methods described herein), or described herein. And an anti-TPBD antibody, which is dissolved or dispersed therein as the active ingredient, together with a physiologically compatible carrier. In a preferred embodiment, the therapeutic composition is not immunogenic when administered to a mammalian or human patient for therapeutic purposes.

As used herein, the terms “pharmaceutically acceptable,” “physiologically compatible,” and grammatical variations thereof refer to the composition, carrier, diluent. , And reagent are used interchangeably and that the material can be administered to a mammal without causing undesired physiological effects (eg, nausea, dizziness, gastric upset, etc.). Show.

The preparation of pharmaceutical compositions containing the active ingredient dissolved or dispersed therein is well known in the art. Typically, such a composition comprises
Prepared as injectables, either as liquid solutions or suspensions;
However, solid forms suitable for solution or suspension in liquid prior to use can also be prepared. The preparation can also be emulsified.

The active ingredient may be admixed with an excipient in which it is pharmaceutically acceptable and compatible with the active ingredient, in an amount suitable for use in the therapeutic methods described herein. . Suitable excipients are, for example, water, saline, dextrose, glycerol, ethanol and the like, as well as any combination of two or more thereof. In addition, if desired, the composition can contain minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents and the like. These enhance the effectiveness of the active ingredients.

The therapeutic compositions of the present invention may include pharmaceutically acceptable salts of the components therein.
Pharmaceutically acceptable non-toxic salts include acid addition salts (formed with the free amino group of a polypeptide). This includes, for example, hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, phosphoric acid, acetic acid, propionic acid, glycolic acid, lactic acid, pyruvic acid, oxalic acid, malonic acid, succinic acid, maleic acid. , Fumaric acid, anthranilic acid, cinnamic acid, naphthalene sulfonic acid, sulfanilic acid, and the like.

Salts formed with free carboxyl groups may also be inorganic bases such as, for example, sodium hydroxide, ammonium hydroxide, potassium hydroxide and the like; and mono-
, Di- and tri-alkyl and aryl amines (eg triethylamine, diisopropylamine, methylamine, dimethylamine etc.) and optionally substituted ethanolamines (eg ethanolamine, diethanolamine etc.) It can be derived from a base.

Physiologically tolerable carriers are well known in the art. Exemplary liquid carriers contain no other ingredients in addition to the active ingredient and water, or sodium phosphate at physiological pH, physiological saline, or both (eg, phosphorus). Sterile aqueous solution containing a buffer solution such as acid buffered saline. Still further, aqueous carriers can include one or more buffer salts, as well as salts such as sodium and potassium chloride, dextrose, polyethylene glycol, and other solutes.

Liquid compositions may also include a liquid phase in addition to exclusion of water. Exemplary additional liquid phases include glycerin, vegetable oils (eg cottonseed oil) and water-oil emulsions.

As described herein, an “effective amount” is a predetermined amount calculated to achieve a desired therapeutic effect (eg, modulate the activity of the TPBD of the invention). Is the amount. The required dosage will vary with the particular treatment, and with the duration of treatment desired; however, about 10 μg / kg body weight per day.
It is expected that doses of up to about 1 mg will be used for therapeutic treatment. It may be particularly advantageous to administer such compounds in a depot form or a long-lasting form, as discussed later herein. A therapeutically effective amount is typically about 0.1 μg / mg when administered in the form of a physiologically acceptable composition.
ml to about 100 μg / ml, preferably about 1.0 μg / ml to about 50 μg
/ Ml, more preferably at least about 2 μg / ml, and usually 5 to 1
An amount of a TPBD modulating agent or compound identified herein that is sufficient to achieve a plasma concentration of 0 μg / ml. Anti-TP of the invention for treatment
The BD antibody may be administered in proportionately appropriate amounts according to practices known in the art.

According to yet another embodiment of the invention, there is provided a method for identifying a compound that binds to a TPBD polypeptide. The proteins of the invention can be used in competitive binding assays. Such assays can be adapted for rapid screening of large numbers of compounds to determine which compounds can bind TPBD. Subsequently, a more detailed assay, using compounds found to bind, to further determine whether such compounds act as modulators, agonists or antagonists of the TPBD of the invention. Can be done. Compounds that bind to and / or modulate the TPBD of the invention are TPBDs of the invention.
It can be used to treat a variety of pathologies mediated by.

In another embodiment of the invention, bioassays are provided for identifying compounds that modulate the activity of the TPBD polypeptides of the invention. The TPBD polypeptide of the present invention is known to affect, for example, the activity of NF-κB. In addition, homologous TRAF polypeptides include, for example, NF-κB and cJun N.
It is known to affect the activity of terminal kinases (JNKs). Therefore, NF
Reporter gene constructs for assaying for κB or JNK activity can be used to test TPBD activity of the invention (see Examples).
. According to this method, the TPBD polypeptide of the invention is contacted with an "unknown" or test substance and the activity of the TPBD polypeptide of the invention is monitored following contact with the "unknown" or test substance. , And, for example, a substance that achieves modulation of the consequences of NF-κB activity or JNK activity is identified as a functional ligand for the TPBD polypeptide.

Alternative bioassays for identifying compounds that modulate the activity of the TPBD polypeptides of the invention, which are routinely used to test protein: protein interactions, can be used. Such bioassays include yeast two-hybrid assays, glutathione-S-transferase fusion protein binding assays, co-immunoprecipitation assays and the like. Such assays are well known in the art and are described, for example, in Sambrook et al., Supra, and Curren.
t Protocols in Molecular Biology, supra, can be found in standard references.

According to another embodiment of the invention, the transformed host cell recombinantly expressing a polypeptide of the invention may be contacted with a test compound and its modulatory effect (s) is , Then T in the presence and absence of the test compound
By comparing the response mediated by PBD (eg, through expression of a reporter gene) or by comparing the response of a test cell to a control cell (ie, a cell that does not express a TPBD polypeptide) for the presence of a compound. , Can be evaluated.

As used herein, a compound or signal that “modulates” the activity of a TPBD polypeptide of the invention is defined as one in which the activity of the polypeptide of the invention is in the absence of the compound or signal. Is different in the presence of the compound or signal,
A compound or signal that alters the activity of a TRAF polypeptide. In particular, such compounds or signals include agonists and antagonists. Agonists include compounds or signals that activate expression of the TPBD protein. Alternatively, the antagonist comprises a compound or signal that interferes with the expression of TPBD. Typically, the effect of antagonists is observed as a block of agonist-induced protein activation. Antagonists include competitive and non-competitive antagonists. Competitive antagonists (or competitive blockers) interact at or near sites specific for agonist binding. Non-competitive antagonists or blockers inactivate the function of the polypeptide by interacting at a site other than the site at which the agonist interacts.

As will be appreciated by those in the art, assay methods for identifying compounds that modulate TPBD activity generally require comparison to controls. One type of "control" is substantially the same as the test cell or test culture exposed to the compound, with the distinction that the "control" cell or culture is not exposed to the compound. Cells or cultures so treated. For example, in a method that uses a voltage clamp electrophysical procedure, the same cells can be tested in the presence or absence of a compound by simply exchanging the external solution that bathes the cells. Another type of "control" cell or culture can be the same cell or culture as the transfected cells, except that the "control" cell or culture does not express the native protein. Thus, the response of transfected cells to a compound is compared to (or lacking) the response of a "control" cell or culture to the same compound under the same reaction conditions.

In yet another embodiment of the invention, activation of the TPBD polypeptide may be modulated by contacting the polypeptide with an effective amount of at least one compound identified by the above bioassay.

According to another embodiment of the present invention there is provided a method for diagnosing cancer comprising the steps of: SEQ ID NOS: 7, 9 and 11 in the above subject. The step of detecting a defective sequence or variant.

According to another embodiment of the invention there is provided a diagnostic system (preferably in the form of a kit) containing at least one nucleic acid of the invention in a suitable packaging material. Diagnostic nucleic acids include, for example, the TPBs described herein.
Derived from the nucleic acid encoding D. In one embodiment, the diagnostic nucleic acid is
Derived from any of SEQ ID NOs: 7, 9 and 11. The diagnostic system of the present invention is
Genomic DNA, or transcribed nucleic acid encoding TRAF (eg, mRNA
, Or cDNA) for the presence or absence of the nucleic acid encoding TPBD.

Suitable diagnostic systems include at least one nucleic acid of the invention (preferably two or more nucleic acids of the invention) as a separately packaged chemical reagent (s) for at least one assay. Included in sufficient quantity. Instructions for use of the packaged reagents will also typically be included. One of ordinary skill in the art can readily prepare nucleic acid probes and / or primers of the invention in the form of a kit in which the nucleic acid probes and / or primers of the invention are combined with appropriate buffers and solutions for practicing the methods of the invention as described herein. Can be incorporated into.

As used herein, the phrase "packaging material" refers to one or more used to house the contents of a kit, such as a nucleic acid probe or primer of the invention. Refers to the physical structure of. The packaging material is preferably provided in a known manner, preferably to provide a sterile contaminant-free environment,
Be built. The packaging material detects a particular sequence that encodes a TPBD in which the nucleic acid of the invention contains the nucleotide sequences set forth in SEQ ID NOs: 7, 9, and 11, or mutations or deletions therein, Can be used to diagnose the presence of cancer or its susceptibility. In addition, the packaging material comprises instructions indicating how the materials in the kit will be used both to detect particular sequences and to diagnose the presence or susceptibility of a cancer.

The packaging materials used herein with respect to diagnostic systems are those customarily utilized in nucleic acid-based diagnostic systems. As used herein, the term "package" refers to an isolated nucleic acid, oligonucleotide, or restricted restriction immobilized with a primer of the invention, such as glass, plastic, paper, foil, and the like. Refers to a solid matrix or material that can be maintained therein. Thus, for example, the package may be a glass vial used to contain milligram quantities of the intended nucleic acid, oligonucleotide, or primer, or
Alternatively, this may be a well of a microtiter plate to which a milligram amount of the intended nucleic acid probe is operably immobilized.

“Instruction for use” typically refers to the concentration of reagents, or at least one assay method parameter (eg, the relative amounts of reagent and sample administered, the reagent / sample mixture). It includes a tangible notation that describes the maintenance time, temperature, buffer conditions, etc.

All US patents and all publications mentioned herein are incorporated by reference in their entirety. The present invention is described herein in further detail with reference to the following non-limiting examples.

Examples I. Isolation of TPBD of TRAF7, HAUSP, and SPOP Nucleic acid encoding TRAF protein binding domain fragment (TPBD) of TRAF7 (residues 282-435 of SEQ ID NO: 6), HAUSP 2 μg of a nucleic acid encoding the TRAF protein binding domain (residues 1-213 of SEQ ID NO: 2) and a nucleic acid encoding the TRAF protein binding domain of SPOP (residues 1-180 of SEQ ID NO: 4) from Jurkat cells Was isolated by polymerase chain reaction (PCR). RNA extraction and cDNA
The method for the synthesis of was provided by the manufacturer (Pharmingen). PCR was performed for 1 cycle at 94 ° C for 2 minutes, followed by 94 ° C for 15 seconds, 60 ° C for 20 seconds, and 72 ° C for 100 seconds for 35 cycles, followed by a final cycle of 72 ° C for 5 minutes. It was performed using the following primers: HAUSP:
5'GCGAATTCCAGGCCGCG 3 '(SEQ ID NO: 13) and 5'
TTCCTCGAGCCGACTTAGCCTGTGTGC 3 '(SEQ ID NO: 14); SPOP: 5' CTTCGAATTCGCGATGTCAAGGGGT
TCC 3 '(SEQ ID NO: 15) and 5'CCATGCTCGAGGGTATT
CTAGCCAGAAATG 3 '(SEQ ID NO: 16); TRAF7: 5' CC
AGAATTCACCAGTGAATTTAGTGCC 3 '(SEQ ID NO: 17) and 5'CCACTCGAGTAATGTTACCAATGCTAGTCC3
'(SEQ ID NO: 18). The amplified fragment was purified, EcoR1 and Xh
digested with o1 restriction enzyme and into pCDNA-3-myc tag, and pGE
Subcloned into X4T (Pharmacia).

II. Expression of TPBC of TRAF7, USP7, and SPOP To determine the expression of mRNA of genes encoding various TRAF domain proteins, Northern blot analysis of mRNA levels of TRAF7, USP7, and SPOP was performed. , In human tissue. To filter-fix the ³² P-labeled cDNA fragment of TRAF7, USP7, or SPOP, which corresponds to the TRAF domain, to poly-A ⁺ RNA derived from various tissues in the order of TRAF7, USP7, and SPOP. And subsequently hybridized (1 μg /
Lane) (Clontech; Palo Alto CA). The tissues tested are
Brain, heart, skeletal muscle, colon, thymus, spleen, kidney, liver, small intestine, placenta, lung, and peripheral blood leukocytes (PBL). The hybridized fragments were visualized by autoradiography. The same RNA blot was finally hybridized with a human β-actin cDNA probe for control of RNA loading (bottom panel).

As shown in FIG. 4, the TRAF7 probe hybridized to an mRNA of about 5 kb. TRAF7 mRNA was most highly expressed in brain, heart, skeletal muscle, kidney, liver, and placenta. TRAF7 was expressed at low levels in thymus, small intestine, lung, spleen, PBL, and colon.

USP7, also known as HAUSP, was shown as a doublet of approximately 7 kb and 5.5 kb. USP7 is most highly expressed in heart, skeletal muscle, and kidney, low in brain, thymus, liver, placenta, and PBL, and lowest in colon, spleen, small intestine, and lung, barely detected. It was possible.

SPOP was expressed as an approximately 2.6 kb mRNA. SPOP was most highly expressed in heart and skeletal muscle, low in kidney and liver, and even lower in brain, skeletal muscle, colon, thymus, small intestine, placenta, lung, and PBL.

[0168]   (III. Binding to TNF receptor family)   For the production of the GST fusion protein, pGEX plasmid was constructed in
Transformed into XL-1 blue bacterial cells and grown in LB medium,
A with 1 mM isopropyl-1-thio-β-D-galactopyranoside ₆₀₀ = 1.0 and induction at 25 ° C. for 4 hours. The cells are then harvested and 1m
M dithiothreitol, 1 mM phenyl-methyl-sulfonyl-fluorine
Resuspended in PBS containing 100 μg / ml lysozyme,
And it was made to dissolve by ultrasonic treatment. GST-TRAF2 (263-501)
, GST-HAUSP (SEQ ID NO: 8), GST-SPOP (SEQ ID NO: 10),
And GST-TARF7 (SEQ ID NO: 12) protein to glutathione-sepha
Using loin (Amersham Pharmacia Biotech)
Purified from bacterial lysates by affinity chromatography. Then
, Resin in PBS containing 1 mM dithiothreitol, OD_{260 nm}
Washed until <0.01.

Plasmids pGEX-TRAF2 (263-501), pGEX-CD40 (
ct), pGEX-Fas (ct), pGEX-LTβR (ct), pGEX-
DR4 (ct), and pGEX-NGFR (ct) have been previously described (Leo et al., 1999, JBC 274, 22414; Sato et al., 1995,
FEBS lett. 358: 113; Crowe et al. Exp. Med. ，
1995, 181, 1205; McFarlane et al. Biol. Chem
． , 1997, 272, 25417; Rabizadeh et al., Proc. Nat
l. Acad. Sci. U. S. A. , 1994, 91, 10703). The plasmid pGEX-TNF-R2 (ct) was cloned into C.I. Dr. Lare (La Jolla
, Institute for Energy and Immunology
) By courtesy.

The in vitro GST-protein binding assay was performed as previously described (Hanada, M., Aime-Sempe, C., Sato, T.
． And Reed, JC. , 1995, JBC 270, 11962-1196.
8; Sato, T .; , Irie, S .; , Kitada, S .; And Reed, J
C. 1995, Science, 268, 411-415; Takayama,
S. , Sato, T .; , Krajewski, S .; , Kochel, C .; , Ir
ie, S.I. Millan, J .; And Reed, JC, 1995, Cell
80, 279-284, Leo et al., 1999, JBC, 274, 22414).
Briefly, ( ³⁵ S) -methionine labeled GST-fused TNF family receptor FAS (ct), TNF-R2 (ct), CD40 (ct), LTβR (c
t), NGFRp75 (ct), and DR4 (ct) using the TnT-coupled hairy red cell system, manufacturer's instructions (Promega).
Inc. ), And produced by in vitro translation. The amount of each labeled protein (2-6 μl lysate) was then added to 250 μl binding buffer (142 mM KCl, 5 mM MgCl 2, 10 mM Hepes, pH 7).
． 4, 0.2% Nonidet-P40, 0.5 mM dithiothreitol,
Mixture of 1 mM EGTA, 0.5 mM phenyl-methyl-sulfonyl-fluoride and other protease inhibitors (Boehringer 169.
7498)) and incubated with GST-protein resin (0.25 μg protein) for 2 hours at 4 ° C. The resin was then washed extensively with binding buffer and the GST-protein bound complex was washed with 50 mM Tris-.
Elution was performed with a buffer containing HCl, pH 8, 1 mM dithiothreitol, and 100 mM glutathione, and analyzed by SDS-PAGE and fluorography.

The results of the binding assay are shown in FIG. The protein binding assay in vitro, as described above, by translating the TRAF2 or TRAF domain TRAF7 in vitro in the presence of ³⁵ S-L-methionine in the lysates of hairy erythrocytes, followed TRA by transfection of 293T cells
This was done by in vivo overexpression of the TRAF2 or TRAF domain of F7. An equal volume of the in vitro translation mixture (10 μl) was immobilized on glutathione sepharose and various members of the TNF-R family (FAS, TN).
F-R2, CD40, LTβR, NGFRp75, and DR4) were incubated with a GST-fusion protein containing the cytosolic domain (1 μg). 293 for expression of TRAF domain proteins in vivo.
T lysate (50 μl) was added to TNF-R family members, DR4, H
VEM, TNF-R2, LTβR, NGFRp75, CD40, and TRAF
Incubated with GST-fusion protein (1 μg) containing 7 cytosolic domains, then immobilized on glutathione sepharose. Control GST and other GST control proteins were included in all assays. After washing, bound proteins were analyzed by SDS-PAGE followed by fluorography for binding assays using the in vitro translated protein. For the transfected 293 cells, the samples were treated with anti-T to detect TD binding of TRAF2 or TRAF7, respectively.
Immunoblotted using RAF2 or anti-Myc antibody. Bound protein was then detected by standard chemiluminescence assay (ECL; Amer
sham; Piscataway NJ).

As shown in FIG. 5, three TNF family receptors were identified as TRAF2: T.
It interacted with the GST-fused TRAF domain of NF-R2, CD40, and LTβR. However, FAS, NGFRp75, and DR4
Did not appreciably interact within the TRAF domain of E. coli. In contrast,
The GST-SPOP fusion protein contains only one of these six receptors (T
NF-R2), and GST-HAUSP did not significantly interact with any of the six receptors. In contrast, GST-TR
AF7 binds to TNF-R2, CD40 (weakly), LTβR, NRFRp75, and DR4. This result shows that TPBD of the present invention (SEQ ID NO: 1
0) and HAUSP's TPBD of the present invention (SEQ ID NO: 8) is TRAF2 TR.
It is shown that the AF domain and TRAF7 may show higher selectivity in receptor binding than the TPBD of the present invention (SEQ ID NO: 12).

29 transfected with the TRAF domain of TRAF2 or TRAF7
Binding to several TNF-R family members was observed in cell lysates of 3 cells. TRAF2 is HVEM, TNF-R2, LTβR, CD
40, and low binding activity that interacted with TRAF7 was also observed with NGFRp75. The TRAF domain of TRAF7 interacted with DR4, LTβR, and NGFRp75, and strong binding to TRAF7 was observed. A faint binding of TRAF7 to interact with TNF-R2 under these conditions was also observed, but no binding of TRAF to CD40 or HVEM was detected. Therefore, TRAF7 has a strong binding activity with itself.

(IV. Binding to TRAF Family Protein) The above GST-HAUSP, GST-SPOP, and GST-TRA.
F7 was produced and purified using the procedure described above.

HTRAF1 (pSG5-TRAF1), hTRAF2 (pcDNA3-HA
-TRAF2), hTRAF3 (pbluescriptKS-TRAF3b)
, HTRAF4 (pcDNA3-HA-TRAF4), hTRAF5 (pcDN
A3-Flag-TRAF5), and hTARF6 (pcDNA3-myc-).
A plasmid containing a cDNA containing the complete open reading frame of TRAF6) has been previously described (Sato et al., 1995, FEBS).
lett. 358, 113; Nakano et al., 1996, JBC, 271, 14.
461; Mosialos et al., 1995, Cell 80, 389; Kraje.
wska et al., 1998, Am. J. Pathol. 152, 1549; Leo et al., 1999, JBC 274, 22414; Song and Donner.
1995, Biochem. J. 309,825; Rothe et al., 1995, C.
ell 78, 281).

In vitro translated TRAF1, TRAF2, TRAF3, TRAF4,
TRAF5, TRAF6, full length I-TRAF (Rothe et al., Proc. Na
tl. Acad. Sci. USA 93: 8241-8246 (1996)),
HAUSP (1-213, SEQ ID NO: 8), SPOP (1-180, SEQ ID NO: 10)
), And TRAF7 (282-435, SEQ ID NO: 12) were incubated with GST-protein resin using the method previously described.

The image obtained is the TPBD of TRAF7 fused with GST (SEQ ID NO: 12).
Interacted with all previously identified TRAF proteins, TRAFS1-6, and I-TRAF (see FIG. 6). further,
The TRAF7 TPBD showed the ability to self-associate with the HAUSP GST-fused TPBD (SEQ ID NO: 8), although it was also able to interact with all previously known TRAF proteins. Somewhat weakly interacted weakly with I-TRAF. However, HAUSP did not show the ability to self-associate. In contrast, TPBD fused to SPOP GST (SEQ ID NO: 1
0) showed high selectivity, had significant interaction with TRAF1 and TRAF6 only, and was not capable of self-association. Interestingly, the TPB of the present invention
Heterogeneous interactions between D (ie HAUSP: SPOP, HAUSP: TRA
F7, and SPOP; TRAF7) were not observed.

V. Reporter Gene Assay 293T cells were obtained from ATCC (Rockville, MA) and high in Dulbecco's modified Eagle supplemented with 10% FCS (Hyclone, UT), 1 mM glutamine, and antibiotics. Glucose medium (Life tech
noology, Inc. ). Reporter gene plasmid pUC13-4 × NFκB-luc containing promoter (4 tandem HI
Contains V-NFκB response element and minimal fos promoter)
And pCMV-β-galactosidase have been previously described (Miyas.
hita and Reed, 1995, Cell 80, 293; Lin and Stavnezer, 1996, MCB 16, 4591).

For NF-κB reporter gene assay, 293T cells were added at 3.5 μg
PcDNA3-myc-hTRAF2, pcDNA3-myc-hTRAF5
, Or pcDNA3-myc-hTRAF6, either 3.5 μg or 7 μg of control plasmid pcDNA3-myc-HAUS
P (1-213, SEQ ID NO: 8), pcDNA3-myc-SPOP (1-180)
, SEQ ID NO: 10), or pcDNA3-myc-TRAF7 (282-435)
, 12 μg of the DNA contained in combination with SEQ.
Except for 5, at 60% confluency in 6-well plates in duplicate,
Calcium phosphate was transfected. For TRAF5, 7 μg pcD
Only NA3-myc-HAUSP or pcDNA-myc-TRAF7 were transfected. In the case of SPOP, 3.5 μg of either pcDNA-
myc-hTRAF6 was used. 0.5 μg of pUC13-4 × NFκB-1
All of the uc plasmid and 1 μg of pCMV-β-galactosidase plasmid were also transfected. After 36 hours, the cells were placed in 0.5 ml of Prom.
Lysis was performed using ega lysis buffer. Luciferase activity from 10 μl of each cell lysate was determined using the luciferase assay system by Promega according to the manufacturer's protocol and read using a luminometer (EG & G Berthold). Luciferase activity was calibrated by comparison with β-galactosidase activity (Miyashita and Reed, 1995, Cell 80, 293).

Immunoblotting was performed as described (Krajewski).
Et al., 1996, Anal. Biochem. 236, 221). Briefly, 5 μl of each cell lysate was analyzed by immunoblotting using anti-TRAF6 antibody or anti-myc antibody and standard chemiluminescence method for detection (Amersham).

The results show that TPBD of HAUSP (SEQ ID NO: 8) and TPBD of SPOP (SEQ ID NO: 10) and TPBD of TRAF7 (SEQ ID NO: 12) can inhibit TRAF6-induced activation of NF-κB. (See FIG. 7). In particular, HAUSP TPBD is a TRAF in NF-κB activation.
It can cancel almost all of the increase induced by 6. Furthermore, HAUSP
TPBD is also NF-κB induced by TRAF2 and TRAF5.
Strongly inhibits the activation of. TRAF7 TPBD also shows the ability to inhibit TRAF2-mediated activation of NF-κB, but in fact TRAF5
Increase NF-κB activation mediated by

The activity of various domains of the TRAF proteins USP7 and TRAF7 was further characterized with respect to modulating the activity of NFκB. The effect of TRAF7 and USP7 in modulating NFκB activity induced by TRAF2 and TRAF6 in mammalian cell lines was tested. Briefly, 293
About 10 μg of pcDNA3 control plasmid, 3.5 μg of p
Transfection in 6-well plates with either cDNA3-myc-hTRAF6 or pcDNA3-hTRAF2, and 7 μg of any of several TRAF7 or any of the USP7 plasmid constructs containing various domains. (See FIG. 8, bottom). Transfections were also performed with 0.5 μg of pUC13-4 × NFκB-luc plasmid and 1 μg.
g of pCMV-β-galactosidase plasmid was included. Relative NFκB activity was determined by 1 of each of the cell lysates prepared 36 hours after transfection.
0 μl was used to evaluate by luciferase assay and calibrated for β-galactosidase activity. At least 3 to 8 separate experiments were performed. Results are shown as fold activity and one representative experiment is shown (FIG. 8).

As shown in FIG. 8, U lacking full-length USP7 and TRAF domains
The SP7 construct had a slight inhibitory effect on TRAF2 or TRAF6 induced NFKB activity. USP7 TRAF domain alone, N
It strongly inhibited the increase induced by TRAF2 and TRAF6 in the activation of FκB. In contrast to USP7, full-length TRAF7 and TRAF
The TRAF domain of 7 alone, TRAF2 and T in the activation of NFκB
It had inhibitory activity on the increase induced by RAF6. Mutant constructs of TRAF7 lacking the TRAF domain had no effect on inhibiting TRAF2 or TRAF6 mediated activation of NFκB.

The effect of the TRAF domains of TRAF7, USP7, and SPOP in modulating the activity of NFκB induced by overexpression of TNFα or CD40 was also examined. 293T cells were treated with approximately 10 μg pcDNA3 control plasmid, 7 μg TRAF7 TD, USP7 TD, or SPOP.
0.5 μg of pUC13-4 × NFκB-luc plasmid with either TD plasmid and no plasmid (TNFα in FIG. 9) or 3.5 μg pcDNA3-myc-CD40 (CD40 in FIG. 9). And 1μ
g of pCMV-β-galactosidase plasmid was used to transfect in 6-well plates. Treatment with TNFα was performed by adding 100 ng / ml of TNFα to the cells 12 hours prior to harvest. Relative NFκ
B activity was assessed by luciferase assay using 10 μl of each of the cell lysates prepared 36 hours post transfection and calibrated for β-galactosidase activity. At least 3 separate experiments were performed. Results of representative experiments are shown as fold activity.

As shown in FIG. 9, the TRAF domain of TRAF7 contains TNFα and CD4.
It had some inhibitory activity on the activation of NFκB induced by both 0 overexpression. The TRAF domain of USP7 had even stronger inhibitory activity than the TRAF domain of TRAF7. In contrast, the TRAF domain of SPOP is essentially NF upon overexpression of either TNAFα or CD40.
It showed no inhibitory activity on the activation of κB.

TRA of NFκB activation induced by TRAF-related protein NIK
Modulation by F7 and USP7 was also tested. About 10 μg of 293T cells
PcDNA3 control plasmid, 7 μg empty pcDNA3, or T
PcDNA3-myc containing RAF7, TRAF7 TD, USP7
Either TD or SPOP TD plasmid and 3.5 μg pc
Using DNA3-Flag-NIK, 0.5 μg of pUC13-4 × NFκB
-Luc plasmid and 1 μg of pCMV-β-galactosidase plasmid were transfected in 6-well plates. Relative NFκB activity was determined by 10% of each of the cell lysates prepared 36 hours after transfection.
Evaluated by luciferase assay using μl. Calibrated for β-galactosidase activity. At least 3 separate experiments were performed. Results of representative experiments are shown as fold activity (Figure 10).

As shown in FIG. 10, NIK-induced activation of NFκB was associated with TRA
It may be partially regulated by F7 and USP7. TRAF7 and TRAF
Both 7 TRAF domains partially blocked NIK-induced activation of NFκB. The TRAF domain of USP7 also partially inhibited NIK-induced activation of NFκB, whereas full-length USP7 did not inhibit NIK-induced activation of NFκB.

VI. TPBD Domain Subcellular Localization To test the function of species domains in subcellular localization, TRAF
7 and USP7 deletion mutants were constructed. For deletion mutants of TRAF7, Cos7 cells were transfected with Lipofectamine plus (Life Technology).
es; Rockville MD) and 3 μg of plasmid. A deletion mutant of TRAF7 (shown in Figure 11) was constructed as a Myc fusion protein. Twenty-four hours after transfection, cells were plated on polylysinated cover slips and fully treated for an additional 24 hours. Cells were fixed with methanol-acetone (50% each). After blocking
Cells were treated with anti-myc mAb (Santa Cruz Biotechnology).
Santa Cruz CA) and secondary FITC labeled rabbit anti-mouse I;
The cells were stained with g (Dako; Carpinteria CA). Bio-
It was performed using a Rad confocal microscope (BioRad; Hercule.
s CA).

FIG. 11 shows the subcellular localization of TRAF7 and various deletion mutants of the molecule. A schematic representation of the various TRAF7 variants analyzed is also shown. TRAF7 is localized in cytosolic particles, which can appear as discrete dots (panel A) or as large aggregates (A, small panel). TRAF7 deletion mutant lacking the ring finger domain (B), mutant containing only a tripartite domain (C), mutant lacking the polyacidic region (D) , Or T
The mutant lacking the RAF domain (E) has a subcellular localization similar to full-length TRAF7. In contrast, the TRAF domain alone (F) or the TRAF domain also containing the leucine zipper (G) does not show this particular subcellular localization, and is a diffuse cytosolic localization. Had. The C-terminal region (H) of the molecule containing the TRAF domain and the polyacidic region (H) or only the polyacidic region (I) has a similar diffuse cytosolic localization, but in this case they Appears to be localized in the nucleus as well. These results indicate that the region of TRAF7, which is a determinant for its subcellular localization, can be mapped to the Zb box and the first coiled coil.

To characterize the localization of deletion mutants of USP7, Cos7 cells were transfected with Lipofectamine plus (Life Technologies) and 3 μg of all of the plasmids. USP7 full-length, and deletion mutants,
It was constructed as a Myc fusion protein. The tested USP7 deletion mutants are TR
The mutant lacking the AF domain and the mutant containing the TRAF domain of USP7. Twenty-four hours after transfection, cells were plated on polylysinated cover slips and fully treated for an additional 24 hours. Cells were fixed with methanol-acetone (50% each). After blocking, cells were stained with anti-myc mAb (Santa Cruz Biotech) and secondary FITC-labeled rabbit anti-mouse Ig (Dako). Analysis
Performed using a Bio-Rad confocal microscope. 2 of each construct
Two representative examples are shown.

FIG. 12 shows full-length USP7 (A and B), deletion mutants of USP7 lacking the TRAF domain (C and D), and TRAF domain of USP7 (
E and F) show subcellular localization. USP7 is predominantly localized in the nucleus, although some cytosolic staining can also be observed in some cells. T
A deletion mutant lacking the RAF domain is completely eliminated from the nucleus, even if it still contains a nuclear localization signal. Finally, the TRAF domain of USP7 appears to have diffuse localization, with large concentrations in specific areas. These results indicate that the TRAF domain of USP7 is essential, but this molecule is not sufficient to target the nucleus.

Although the present invention has been described with reference to the above examples, it should be understood that various modifications can be made without departing from the spirit of the invention. Accordingly, the invention is limited only by the following claims.

[Sequence list]

[Brief description of drawings]

FIG. 1 shows HAUSP (SEQ ID NO: 8) (also known as USP7), S
Figure 3 shows a schematic diagram of the structure of POP (SEQ ID NO: 10), and TRAF7 (SEQ ID NO: 12), and additionally, the newly identified TRAF proteins designated as TARF1 and TRAF2. Shaded boxes indicate the relative positions of the protein domains shown below: TRAF domain, protease domain, ring finger, Zb box, zinc finger, polyacidic domain, coiled coil, and nuclear translocation signal.

FIG. 2 shows TRAF7 (SEQ ID NO: 25) (also known as KIAA),
HAUSP (SEQ ID NO: 23) (also known as USP7), and SP
The amino acid sequence of the TRAF domain of OP (SEQ ID NO: 24) is represented by 6 other known human TRAF proteins (hT1td to hT6td, SEQ ID NOs: 26 to 31).
Shown aligned with the TRAF domain. Gray squares indicate identical residues among family members. White squares indicate structurally related residues.

FIG. 3 shows the deduced amino acid sequence of TRAF7 (corresponding to amino acids 16-979 of SEQ ID NO: 32, SEQ ID NO: 6). Various protein domains and regions of this protein are shown: ring finger domain (amino acid 15
~ 55); ZF-B box domain (amino acids 90 to 132); coiled coil (amino acids 132 to 177); coiled coil (amino acids 195 to 231);
Two leucine zipper domains (amino acids 197-218, and 222-2
45); TRAF domain (amino acids 277-403); coiled coil (42
7 to 466); and two polyacidic regions (amino acids) (amino acids 868-9).
64).

FIG. 4. TRAF7, USP7, and SPOP mRN in human tissues.
A shows Northern blot analysis of A level. Northern blot analysis of human 12
Northern blot of multiple tissues in lane (MTN; Clontech; Palo
Alto CA) and performed as recommended by the manufacturer. The TRAF domains of TRAF7, USP7, and SPOP, and actin as a control were labeled with ³² P-cytidine using the nick translation assay kit.

FIG. 5 shows the T of the present invention for various members of the TNF receptor family.
3 shows an analysis of RAF protein binding domain (TPBD) binding. Results of in vitro binding assays of cytosolic domains of selected members of the TNF-R family are shown. GST-F immobilized on glutathione sepharose
as (ct), GST-TNF-R2 (ct), GST-CD40 (ct), G
ST-LTβR (ct), GST-NGFR (ct), and GST-DR4 (
in vitro translated ( ³⁵ ) S-TRAF2, -SPOP, -HAU.
Incubated with SP, and -TRAF7 TRAF domain. Alternatively, the TRAF domain of TRAF7 or TRAF2 was expressed in 293 cells. Bound TRAF protein was detected by SDS-PAGE and fluorometric analysis.

FIG. 6 shows human TRAF proteins 1-6 and I-TRAF (Rothe et al., Proc. Natl. Acad. Sci. USA 93: 8241-8246).
(1996)) shows an analysis of binding to TRAF-7, HAUSP, and SPOP. GST-TRAF7 (2 immobilized on glutathione sepharose
82-435), GST-HAUSP (1-213), and SPOP (1-1)
80) Proteins were incubated with in vitro translated ³⁵ S-TRAF protein and I-TRAF as indicated. Bound TRAF protein was detected by SDS-PAGE and fluorometric analysis.

FIG. 7 shows that TPBD of HAUSP, SPOP, and TRAF7 can specifically inhibit NF-κB activity induced by TRAF-containing proteins. In the upper panel, the relative NF-κB activity affected by the various TRAF domains is shown. The cells were treated with the control plasmid pc
DNA3-myc-hTRAF6 alone or 7 μg pcDNA3-myc
-HAUSP (1-213) or pcDNA3-myc-SPOP (1-1
80), with 0.5 μg of pUC13-4xNFκB-luc plasmid and 1 μg of pCMV-β-galactosidase plasmid,
Transfected as indicated. Normalized for β-galactosidase activity, relative NF-κB activity was assessed by luciferase assay. Results are shown as fold activity compared to controls.

FIG. 8 shows the effect of TRAF7 and USP7 in modulating TRAF2 and TRAF6 induced NFκB activity in mammalian cell lines.

FIG. 9 shows the effect of TRAF domains of TRAF7, USP7, and SPOP in the regulation of NFκB activity induced by overexpression of TNFα or CD40.

FIG. 10 shows the regulation of NIK-induced activation of NFκB by TRAF7 and USP7.

FIG. 11   FIG. 11 shows the subcellular localization of various TRAF7 deletion mutants.

[Fig. 12]   Figure 12 shows subcellular localization of various domains of USP7.

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁷ Identification code FI theme code (reference) A61P 29/00 A61P 35/00 4C085 35/00 37/00 4H045 37/00 37/06 37/06 37 / 08 37/08 43/00 105 43/00 105 C07K 14/47 C07K 14/47 16/18 16/18 19/00 19/00 C12N 1/15 C12N 1/15 1/19 1/19 1/21 1 / 21 C12Q 1/02 5/10 1/48 Z C12Q 1/02 1/68 A 1/48 G01N 33/53 D 1/68 M G01N 33/53 Y 33/566 C12P 21/08 33/566 C12N 15 / 00 ZNAA // C12P 21/08 5/00 BA (81) Designated countries EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE, TR), OA (BF, BJ, CF, CG, CI, CM, GA , GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, MZ, SD, SL, SZ, TZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AE, AG, AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, BZ, CA, CH, CN, CR, CU, CZ, DE, DK, DM, DZ, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, KE, KG, KP , KR, KZ, LC, LK, LR, LS, LT, LU, LV, MA, MD, MG, MK, MN, MW, MX, MZ, NO, NZ, PL, PT, R O, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, TZ, UA, UG, US, U , VN, YU, ZA, ZW (72) inventor lead, John Sea. United States California 92067, Rancho Santa Fe, P. Oh. Box 137, El Camino Real 17044 F-Term (reference) 4B024 AA01 AA11 BA80 CA04 DA02 DA05 DA06 DA11 DA12 EA02 EA04 GA11 HA12 HA15 4B063 QA19 QA20 QQ08 QQ27 QQ43 QR08 QR42 QR56 QS02 QS25 QS34 QX0224001 CA20B4 CA01 CA20A4B20 CA0A4B20 CA0A2 AA57X AA72X AA90X AB01 BA02 CA24 CA44 CA46 4C084 AA16 ZA36 ZB07 ZB08 ZB11 ZB13 ZB21 ZB26 4C085 AA13 AA14 CC21 EE05 4H045 AA10 AA11 AA30 BA10 CA40 DA75 EA20 EA50 FA72 FA74

Claims (73)

[Claims] 1. A TRAF protein binding domain (T
PBD) polypeptide, wherein said polypeptide is 213 amino acids or less, TPBD polypeptide. 2. The TPBD polypeptide of claim 1, further comprising SEQ ID NO: 20. 3. The TPBD polypeptide of claim 1, further comprising SEQ ID NO: 21. 4. The TPBD of claim 1, wherein the protein amino acid sequence comprises a sequence substantially identical to any of SEQ ID NOs: 8, 10, 12, 23, 24 or 25. TPBD. 5. The TPBD of claim 1, comprising an amino acid sequence identical to the amino acid sequence of any of SEQ ID NOs: 8, 10, 12, 23, 24 or 25.
. 6. The TPBD of claim 4, wherein the polypeptide is encoded by a nucleotide sequence comprising a sequence substantially identical to the nucleotide sequence set forth in SEQ ID NO: 7, 9 or 11. , TPBD. 7. The TPBD of claim 1, wherein the polypeptide is encoded by a nucleotide sequence comprising a sequence identical to the nucleotide sequence set forth in SEQ ID NO: 7, 9 or 11. 8. An isolated anti-TPBD antibody having specific reactivity with the TPBD of claim 1. 9. The antibody according to claim 8, which is a monoclonal antibody. 10. A cell line producing the monoclonal antibody according to claim 9. 11. The antibody according to claim 8, which is a polyclonal antibody. 12. An isolated nucleic acid encoding a TRAF protein binding domain (TPBD) or a functional fragment thereof, which nucleic acid comprises: (a) SEQ ID NO: 8, 10 or 12, 23, 24 or A DNA encoding the amino acid sequence described in 25 or (b) a DNA which hybridizes to the DNA of (a) under moderately stringent conditions, wherein the DNA is a biologically active TPBD. Code D
A nucleic acid selected from NA, or DNA degenerate with (c) and (b), wherein the DNA encodes a biologically active TPBD. 13. SEQ ID NOS: 7, 9 and 1 under highly stringent conditions.
13. The nucleic acid of claim 12, which hybridizes to any one of the TPBD coding portions of 1. 14. The nucleic acid of claim 12, wherein the nucleotide sequence of the nucleic acid is substantially identical to the nucleotide sequence of any of SEQ ID NOs: 7, 9 and 11. 15. The nucleic acid according to claim 12, wherein the nucleotide sequence of the nucleic acid is the same as the nucleotide sequence according to any one of SEQ ID NOs: 7, 9 and 11. 16. The nucleic acid according to claim 12, which is cDNA. 17. A vector comprising the nucleic acid of claim 12. 18. A recombinant cell comprising the nucleic acid of claim 12. 19. An oligonucleotide comprising at least 15 nucleotides capable of specifically hybridizing with the nucleotide sequence set forth in any of SEQ ID NOs: 7, 9 and 11. 20. The oligonucleotide according to claim 19, which is labeled with a detectable marker. 21. An antisense nucleic acid capable of specifically binding to mRNA encoded by the nucleic acid according to claim 12. 22. A kit for detecting the presence of a TRAF cDNA sequence, the kit comprising at least one oligonucleotide according to claim 20. 23. A method according to claim 2 in an amount effective to inhibit expression of human TPBD.
A composition comprising the antisense nucleic acid of claim 1 and an acceptable hydrophobic carrier capable of crossing a cell membrane. 24. A method for the expression of TPBD, said method comprising culturing the cells of claim 18 under conditions suitable for expression of said TPBD. 25. A method for identifying a nucleic acid encoding a mammalian TPBD, said method comprising contacting a sample containing the nucleic acid with the oligonucleotide of claim 19, wherein The method comprising the step of contacting performed under high stringency hybridization conditions, and identifying a compound that hybridizes to the oligonucleotide. 26. A method for detecting the presence of human TPBD in a sample, the method comprising contacting a test sample with the antibody of claim 8, detecting the presence of an antibody: TPBD complex. And detecting the presence of human TPBD in the test sample. 27. A single-stranded DNA primer for amplification of TPBD nucleic acid, wherein the primer comprises a nucleic acid sequence derived from the nucleic acid sequences set forth in SEQ ID NOs: 7, 9 and 11. 28. A method of modulating a TNF family receptor, the method comprising contacting a cell with an agent that modulates the activity of a TPBD-containing protein, wherein the TNF family receptor is TNFR1, TNFR2
, CD27, CD30, CD40, 4-1BB, Ox40, LT-βR, Fas
, DR3, DR4, DR5, HVEM, LMP-1, IL-1R, and members of the TNF receptor family that do not contain a death domain. 29. The TNF family receptor is TNF-R2, CD
29. The method of claim 28, selected from 40, LT- [beta] R, NGFRp75 and DR4. 30. A method of modulating a TRAF protein, the method comprising:
A method comprising contacting a cell with an agent that modulates the activity of a TPBD-containing protein. 31. The method of claim 30, wherein the TRAF protein is human TRAF1, human TRAF2, human TRAF3, human TRAF.
A method selected from 4, human TRAF5, and human TRAF6. 32. A method of modulating a TRAF-related protein comprising contacting a cell with an agent that modulates the activity of a TPBD-containing protein, wherein the TRAF-related protein is TRADD, FADD, I-TR
AF, TRIP, A20, c-IAP1, c-IAP2, Casper, RIP
, RIP2, NIK, Peg3, GCK, NIK, ASK1, and IRAK. 33. A method of modulating the activity of NF-κB or cJun N-terminal kinase comprising contacting a cell with an agent that modulates the activity of a TPBD-containing protein. 34. The method of claim 33, wherein the NF-κB activity is regulated. 35. A method of modulating the action of cells, the method comprising:
A method comprising contacting with a factor that modulates the activity of a TPBD-containing protein, wherein the action of the cell is selected from apoptosis, cell proliferation, cell adhesion, cell stress response and B cell immunoglobulin class switch. 36. A method for modulating the activity of a tumorigenic protein, the method comprising contacting the tumorigenic protein with substantially pure TPBD, or a tumorigenic protein binding fragment thereof. how to. 37. A method of identifying an effective factor that regulates the association of TPBD with a TRAF protein, the method comprising the steps of: a) allowing the TPBD and TRAF proteins to associate with the TPBD and TRAF proteins. Contacting the TPBD and TRAF proteins under conditions that allow them to associate with a suspected regulatable factor, and b) detecting the regulated association of the TPBD and TRAF proteins. And wherein the regulated association identifies an effective factor. 38. The method of claim 37, wherein the altered association is detected by measuring the activity of NF-κB. 39. The method of claim 37, wherein the altered association is determined by measuring the activity of c-Jun N-terminal kinase. 40. The method of claim 37, wherein the effective agent is a drug. 41. The method of claim 37, wherein the effective agent is a protein. 42. A method for modulating TPBD-mediated activity, said method comprising contacting said TPBD with a modulating effective amount of an agent identified by the method of claim 37. A method of including. 43. The method of claim 42, wherein the regulated activity is: TPBD binding to TNRF; TPBD binding to TRAF protein, TPBD binding to TRAF-related protein; NF. -ΚB activity, c-Jun
A method selected from the group consisting of N-terminal kinase activity, apoptotic activity, cell proliferative activity, cell adhesion, cell stress response activity and B cell immunoglobulin class switch activity. 44. A method of modulating the level of apoptosis in a cell, the method comprising the steps of: a) introducing a nucleic acid molecule encoding TPBD into the cell; and b) in the cell. Expressing the TPBD, wherein expression of the TPBD regulates apoptosis in the cell. 45. A method of modulating class switching in a B cell, the method comprising introducing an antisense nucleotide sequence into the cell, wherein the antisense nucleotide sequence encodes TPBD. A method of specifically hybridizing to a nucleic acid molecule, wherein said hybridization reduces or inhibits expression of said TPBD in said cell. 46. A treatment comprising TPBD, or a functional fragment thereof, a TPBD modulator identified according to the method of claim 37, or a compound selected from anti-TPBD antibodies; and a pharmaceutically acceptable carrier. Composition. 47. A method of treating a pathology characterized by aberrant cell proliferation or aberrant immunoglobulin class switching, the method comprising administering an effective amount of the composition of claim 46. A method of including. 48. Increased or decreased levels of T in a subject.
A method of diagnosing a pathology characterized by PBD, comprising the following steps: a) obtaining a test sample from the subject; b) the test sample with an agent capable of binding the TPBD; Contacting under suitable conditions that allow specific binding of the factor to the TPBD; and c) the amount of specific binding in the test sample is compared to the amount of specific binding in the control sample. The step of comparing, wherein the increased or decreased amount of the specific binding in the test sample when compared to the control sample is
A method comprising the step of diagnosing a pathological condition. 49. The method of claim 48, wherein the factor is an anti-TPBD antibody, TNF family receptor, TRAF protein, or TRAF-related protein. 50. A method of modulating the level of apoptosis in a cell, the method comprising: treating the cell with TPBD with a TRAF-related protein in the cell.
Or the step of contacting the factor with a factor that effectively alters the association of NF-κB or JNK in the cell. 51. A chimeric protein comprising the TPBD of claim 1. 52. A chimeric TPBD-containing protein comprising the sequence of SEQ ID NO: 19, provided that the chimeric TPBD-containing protein does not occur in nature. 53. A chimeric TPBD-containing protein, which comprises the following: (a) the sequence of SEQ ID NO: 19; and (b) the sequence derived from a heterologous protein. 54. The chimeric T of claim 53, further comprising SEQ ID NO: 20.
PBD-containing protein. 55. The chimeric T of claim 53, further comprising SEQ ID NO: 21.
PBD-containing protein. 56. The chimeric protein of claim 53, further comprising a ring finger domain. 57. An isolated TPBD-containing TR comprising the sequence of SEQ ID NO: 19.
A TRAF domain containing protein which is an AF protein or a fragment thereof, but which does not consist of the sequence of SEQ ID NO: 2, 4, or 6. 58. The T of claim 57, further comprising the sequence of SEQ ID NO: 20.
TRBD protein containing PBD. 59. The T of claim 57, further comprising the sequence of SEQ ID NO: 21.
TRBD protein containing PBD. 60. A TPBD-containing polypeptide comprising the sequence of SEQ ID NO: 20, wherein the polypeptide is 213 or less amino acids in length. 61. The method of claim 37, wherein the factor is T
A method of modulating TPBD association with a RAF protein, or TPBD with a TNF family receptor, or TPBD with a TRAF-related protein. 62. A method of modulating a TPBD: TRAF protein interaction comprising contacting TPBD with the agent of claim 61. 63. The method of claim 37, wherein the factor modulates JNK activity. 64. The method of claim 37, wherein the factor modulates NF-κB activity. 65. A method of regulating class switching, the method comprising:
The following: a compound selected from the group consisting of TPBD or a functional fragment thereof, an agent identified according to the method of claim 28, and an anti-TPBD antibody,
A method comprising the step of contacting cells. 66. A method of diagnosing cancer or monitoring cancer therapy, comprising the step of contacting a test sample from a patient with the antibody of claim 8. 67. A method of assessing the prognosis of a patient with cancer, comprising the step of contacting a test sample from the patient with the antibody of claim 8. 68. An effective factor which binds to the TRAF protein binding site of TPBD. 69. A TNF family receptor or TRAF protein,
Effective factors that regulate the association of TPBD with TRAF proteins or TRAF-related proteins. 70. The TNF family receptor is TNF-R2,
70. The factor of claim 69, wherein the TRAF protein is human TRAF6 and the TRAF-related protein is I-TRAF. 71. The factor of claim 69, wherein the TNF family receptor is CD40, the TRAF protein is human TRAF2, and the TRAF-related protein is I-TRAF. 72. The factor according to claim 69, wherein the effective factor inhibits the association of the TPBD with the TNF family receptor or TRAF protein, TRAF protein or TRAF-related protein. 73. The factor of claim 69, wherein the effective factor increases the association of the TPBD with the TNF family receptor or TRAF protein, TRAF protein or TRAF-related protein.