JP2003511426A - Assay method - Google Patents

Abstract

  (57) [Summary] Contacting a test compound with a biological system comprising a functional RORα receptor and capable of producing a detectable signal in response to activation of the RORα receptor by a compound having bone growth promoting activity; A method for identifying a compound having bone growth promoting activity, comprising monitoring a system by the occurrence of osteoporosis, and the use of such a compound for the prevention or treatment of diseases and conditions associated with excessive bone and cartilage loss.

Description

Detailed Description of the Invention

The present invention relates to biologically active organic compounds, in particular compounds having activity as promoters of bone growth and development, and the process of identification of such compounds and also to the treatment of such compounds. Regarding the use of.

There are many diseases and conditions associated with excessive bone and cartilage loss, including osteoporosis, gingival diseases such as gingivitis and periodontal disease, Paget's disease, tumor-induced hypercalcemia and bone. Including metabolic diseases. Compounds that have activity as promoters of bone growth and development may be useful in the treatment of such diseases and conditions.

RORα (also known as retinoic acid related orphan receptor alpha, RZR) is a new member of the steroid hormone nuclear receptor superfamily with unknown ligand binding properties or physiological role, Giguere et al.
GENES & DEVELOPMENT 8: 538-553, 1994) and functionally characterized. There are three isotypes of RORα1, RORα2, and RORα3 in RORα. The isotypes of RORα1 and RORα2, which are present in a certain gene sequence, are singly bound to a hormone response component and are present before the half-site core motif PuGGTCA. It is known to be composed of AT-rich sequences. Recently, RORα1 has been reported to be a nuclear receptor for the pineal hormone melatonin (Wiesenberg et al. Nucleic Acids Research, 1995, Vol. 23,
No.3 327-333; Steinhilber et al. J. Biol. Chem., 1995, Vol.270, No.13,
7073-7040).

In accordance with the present invention, we now report that ROR is involved in the process of differentiation of mesenchymal stem cells into osteoblasts.
The expression of α mRNA was found to be differentially upregulated, suggesting that RORα is involved in the development and differentiation of osteogenic cells. Furthermore, the mouse mutant stagger (sg), which has a defect in the RORα gene that prevents translation of the RORα ligand binding domain, exhibits a osteopenic phenotype and is expressed in normal, healthy bone with the expression of fully functional RORα. It was shown to be necessary for the phenotype. Furthermore, it was shown that aging promoted bone defects in a group of animals in which the deletion was heterozygous. These results support the proposal that activation of RORα is a key step in activation of expression of bone-related proteins by RORα and bone growth and development. Therefore, according to the present invention, RORα has been proposed as a novel therapeutic target for the treatment of diseases and conditions associated with excessive bone and cartilage loss such as osteoporosis.

Accordingly, in a first aspect, the present invention provides a method of preventing or treating a disease or condition associated with excessive bone and cartilage loss, which method comprises administering to a patient an effective amount of an activator of RORα. To do. In another embodiment of the first aspect, the invention provides the use of an activator of RORα for the manufacture of a medicament for the treatment of diseases and conditions associated with excessive bone and cartilage loss.

Diseases and conditions associated with excessive bone and cartilage loss that can be treated by the present invention include osteoporosis of various causes (eg, aging, cortico-steroid therapy, lethargy, juvenileness, menopause, menopause). Post-traumatic, post-transplant), bone fracture, osteopathy, skeletal desalination in acute and chronic conditions, osteomalacia, gingival diseases such as gingivitis and periodontal disease, Paget's disease, tumor-induced high Includes all bone conditions associated with increased calcium depletion and increased resorption, or where calcium colonization of the bone is desired, such as calcemia, metabolic bone disease, arthritis and osteoarthritis. In particular, the present invention can be used to treat or prevent osteoporosis due to various causes.

In particular, the present invention relates to the use of activators of RORα for the treatment of diseases associated with excessive bone and cartilage loss. Activators of RORα that may be used in the present invention preferably include novel compounds, rather than the compounds previously known as activators of RORα.

International patent application WO 95/27202 describes receptors of the RZR / ROR receptor family in a test for identifying compounds with anti-autoimmune, anti-arthritic, anti-tumor, melatonin-like and / or melatonin antagonist activity. Or describes the use of functional fragments thereof. The test process described in WO 95/27202 can be used for the identification of compounds with bone growth and development promoting activity. The disclosure of WO 95/27202, the disclosure relating to the use of receptors of the RZR / ROR receptor family or functional fragments thereof in tests for the identification of compounds with RORα, in particular RORα1 activating activity, is hereby incorporated by reference. It is included in the teaching part of.

Therefore, in a further aspect, the invention provides the use of RZR / such as RORα, in particular RORα1, in a test for the identification of compounds with activity promoting bone growth and development.
Use of the ROR receptor family or functional fragments thereof is provided.

In a preferred embodiment of this further aspect, the present invention provides a test compound comprising a functional RO
Generation of a signal by contacting with a biological system that includes a Rα receptor and can generate a detectable signal in response to activation of the RORα receptor by a compound having an activity of promoting bone growth or bone formation Provides a method for identifying a compound having a bone growth and development promoting activity, which comprises monitoring the system.

Thus, for example, the known interaction of the RORα ligand binding domain (RORα-LBD) with its coactivator GRIP may be utilized. This interaction is moderated by the binding of the ligand to RORα-LBD and induces a conformational change that can be converted to a difference in fluorescence that can be monitored using standard techniques.

The methods of the present invention can be used to screen individual compounds and libraries of compounds, including libraries of combinatorial compounds. The method is
It can be used as a first screening assay to identify lead compounds, and to compare or quantify the active amount of RORα activation of compounds, eg, compare compounds produced by medicinal chemistry lead optimization / derivatization programs. Available for.

Accordingly, a preferred embodiment of the present invention is that i) the compound comprises a functional RORα receptor and produces a detectable signal in response to activation of the RORα receptor by a compound having bone growth promoting activity. A compound having a stimulatory activity for bone growth or formation, which comprises contacting a biological system capable of allowing the reaction to be measured, measuring a detectable signal in the presence of a test compound, and comparing the result with a control. Methods of identifying, and ii) an organism that comprises a plurality of compounds that are capable of producing a detectable signal in response to activation of the RORα receptor by a compound that has a functional RORα receptor and has bone growth promoting activity. Contacting the biological system individually, measuring the detectable signal in the presence of each test compound and comparing the resulting signals,
A method for comparing compounds having bone growth and formation promoting activity is provided.

A suitable step in carrying out the identification and comparison methods of the present invention is WO95 / 2720.
Including those described in No. 2. In the present specification, the “bone growth promoting activity” means, for example, an increase in proliferation of osteoprogenitor cells, an increase in differentiation of such cells, which eventually leads to an increase in bone density or maintenance of bone density. It means increase of substrate synthesis by osteoblasts and prolongation of life of osteoblasts and osteocytes. The present invention is further described, for purposes of illustrating the invention, only in the following examples, which relate to particular assays of the invention and refer to the accompanying drawings:

FIG. 1 shows agarose gel electrophoresis patterns of PCR products obtained from mRNA samples collected at different times of human mesenchymal stem cell differentiation. FIG. 2 is a graph showing a quantitative analysis of RORα expression during the differentiation of human mesenchymal stem cells. FIG. 3 is a graph showing the induction of mouse bone sialoprotein promoter activity by RORα. FIG. 4 is a graph showing that inhibition of the osteocalcin promoter by RORα is dominant in vitamin D activity. FIG. 5 shows bone mineral density, area, density and length (d of total tibia of mice with a deletion in the RORα gene, as compared to wild type mice, evaluated by dual energy X-ray absorptiometry (DEXA). ) Is a graph showing. FIG. 6 is a graph showing total bone mineral content, area, and density of a proximal tibia cross section of a mouse having a deletion in the RORα gene, as compared with a wild-type mouse, evaluated by peripheral quantitative computed tomography (pQCT). Is. FIG. 7 is a graph showing cortical thickness and trabecular bone mineral density in the proximal tibia cross section of mice with deletions in the RORα gene, as compared to wild-type mice, assessed by peripheral quantitative computed tomography (pQCT). Is. Figure 8: Proximal tibial cross section of aged mice heterozygous for a deletion in the RORα gene compared to aged and wild type aged mice evaluated by peripheral quantitative computed tomography (pQCT). It is a graph which shows the trabecular bone mineral density of.

Example 1 Differential Expression of RORα / Analysis of RORα Functionality During Mesenchymal Stem Cell Differentiation Experimental process Human mesenchymal stem cell culture and RT-PCR. Human mesenchymal stem cells from four separate donors were cultured according to standard protocols (1 μM dexamethasone; 50 μM ascorbic acid-2-phosphate; 100 μM β-glycerophosphate).
, Differentiated (osteogenic metabolism). The cells were harvested 0, 4, 8 and 15 days after the start of treatment and (RNeasy midi RNA, Quiage
n) was processed according to the manufacturer's protocol. RO 100 ng of total RNA
Suitable primer for Rα (5′-3 ′ forward primer: GTAGAAAC
CGCTGCCAACA, reverse primer: ATCACCTCCCGCTG
CTT) and reaction mix (Superscript one-step RT-PCR system, GibcoB
RL) was added to the PCR reaction. PCR conditions are c at 50 ° C for 30 minutes
DNA synthesis, 94 ° C. 2 minutes, 95 ° C. 1 minute, 56 ° C. 30 seconds, 72 ° C. 1 minute. All experiments were performed twice using RNA preparation from MSCs from separate donors. The PCR fragment was visualized on a 1.5% agarose gel.

Quantitative real-time PCR (Taqman assay). This technique was used to quantitatively monitor mRNA expression. mRNA was extracted from ROS 172.8 cells cultured as described in hMSCs or other sections of the experimental procedure. A pair of oligonucleotide primers for gene-specific PCR and an oligonucleotide probe in which the 5 ′ end was labeled with a reporter fluorescent dye and the 3 ′ end with a quencher dye were designed using primer express 1.0 software. The primers and probes used are as follows: hRORα gene (5 '
-3 ′): Forward primer GTGCGACTTCCATTTTCCTCCAT; Reverse primer GCTTAGGTGATAACATTTACCCATCA; Probe CACTTCAGAATTTTGAGCCAGCAATGCAA. mRNA (10 ng) was added to 50 μl of RT-PCR reaction mix (Perkin El
mer). The conditions of the temperature cycle are 50 ° C. for 30 minutes and 1 cycle, 95 ° C. for 10 minutes and 1 cycle, and 90 ° C. for 15 seconds and 60 ° C. for 1 minute for 40 cycles each.

Preparation of promoter constructs and plasmids. X pBS2.5BSP (donated from J. Aubin, University of Toronto) plasmid containing the promoter region of the target gene
Cleavage with hoI and XbaI gave a 2.5 kb mouse BSP promoter fragment. The fragment was ligated to the XhoI and NheI sites of the pG12-basic vector to move the firefly luciferase gene (BSP-luc). RORα1 expression construct and DR8tk luc are Genev
Obtained from Dr. M Becker-Andre of a, they have been previously described (Giguere et
al., GENES & DEVELOPMENT 8: 538-553, 1994). The promoter construct for osteocalcin is described in Meyer et al. (J Biol Chem., 272, 21090-21095, 1997).

Cell culture, transient transfection and luciferase assay. ROS17 / 2.8 and MG63 cells were buffered with bicarbonate at 37 ° C. in a humidified atmosphere with 5% carbon dioxide in 10% fetal bovine serum, penicillin (100%).
IU / ml) and streptomycin (0.1 mg / ml) added Dulbecco's m
It culture | cultivated by odified Eagle's medium / F12 nutrition mixture. Cells are plated in 6-well culture plates 24 hours before transfection and 50-6.
FuGene6 transfection reagent (Boehringer Ma
nnheim). A typical reaction mixture contained 2 μg reporter plasmid and 1 μg expression plasmid. After exposure to the transfection mix for 4 hours, the medium was replaced and the cells were
If there were signs, vitamin D3 was added and the cells were cultured for 24 hours. The transfected cells were subsequently harvested for luciferase assay by washing with phosphate buffered saline and then scraping into 0.25 ml lysis buffer (Promega, Madison, Wi). The luciferase activity was measured by an automatic fluorometer LB96P (Berthold,
Monitoring was performed according to the Promega Luciferase Assay Kit using Regensburg, Germany). Results are expressed as relative light intensity (RLU) per mg protein.
All experiments were done in triplicate at different times.

Results The basis for the experiments for this study is the reverse transcriptase (RT) -PCR ligation reaction and the use of RNA prepared from hMSCs at different stages of differentiation of bone formation. We directly compared samples of cells in treated (OS) or untreated stages. RO
In the case of Rα, we monitored a distinct differential expression pattern of the RORα messenger signal during the injection of MSCs into the pathway of osteoblastic metabolism. The results obtained are shown in FIG. 1, which shows m recovered at different time points during the differentiation of human MSCs.
1 shows an agarose gel electrophoresis pattern of PCR products obtained from RNA samples. The identity of the PCR products obtained in these experiments was determined by subcloning and sequence analysis. No other members of the ROR subfamily, such as RORβ and RORγ, were detected in human MSCs. RNA prepared from cells of other origin (brain) was used as a positive control (C).

Furthermore, we were able to set up a real-time PCR approach to quantify the expression of RORα at different stages of osteoblast differentiation. Expression of RORα was standardized with GAPDH. The results obtained are shown in FIG. 2, which compares the level of RORα in a sample of treated (OS) or untreated stage (C) cells with its expression level in intact (day 0) cells. 2 is a graph of quantitative analysis of the induction rate of RORα obtained by

Next, the functional importance of RORα was examined in the rat osteosarcoma cell line 17/2.
.8 (ROS 17 / 2.8) was used as host cells and tested in cell transfection assay. Bone sialoprotein (BSP) or osteocalcin (O
Given the background that secretory components of bone tissue matrix such as C) are modulators of mineralization and remodeling, conditionally active transcription factors, such as RORα, thought to be involved in the regulation of bone metabolism, It should control the promoters of these bone-specific genes. BSP is Schrader et al. (JBC, 271, 19731-19736, 1996).
Has identified a hexamerization consensus motif RGGTCA (R = A or G) in the human or rat BSP promoter region, and has already been suggested as a promising target gene for ROR. In the mouse BSP promoter we found a similar consensus sequence (GGGTCA) located between -2007 and -2001 with respect to the transcription initiation site. Therefore, mouse B having a length of 2500 bp
A fragment of the SP promoter was used to drive the firefly luciferase gene. Ros17 / 2.8 cells were transfected with the parental expression vector (Crt) or with the RORα expression vector together with the luciferase reporter gene. The reporter gene was driven by the 2500 promoter fragment of the mouse bone sialoprotein gene. Luciferase activity was assayed in cells from 6-well plates and compared to that of cells transfected with empty expression plasmid. Results were normalized by protein content. Figure 3 shows the mean + SD of 3 experiments each performed in 3 independent triplicate analyses. We are hM
Since α2 and α3 types are not detected by SC RT-PCR (no data disclosed),
Furthermore, among the three subtypes, RORα1 cDNA was used because it is described that RORα1 has the strongest transcriptional activity. RORα
Co-expression enhanced the luciferase activity of the BSP luc construct 7-fold compared to the base level, as shown in FIG.

This enhancement of luciferase activity can be achieved under the same conditions simply by the RORα response element (DR
The same was also true for the results obtained with the reporter construct containing 8) (no data disclosure). In addition, in vivo proof of action of RORα in bone cells was pooled by studying the effect of RORα on the activity of the osteocalcin gene. Figure 4
ROS17 / 2.8 cells with a RORα (2/1 mg) expression vector with a luciferase reporter gene driven by either the human osteocalcin promoter, −334 / + 34 or −890 / + 34, as shown in FIG. Transfection with or without hatching). 10 cells
Incubated with nM vitamin D. Luciferase activity was assayed on cells from 6-well culture plates and compared to that of cells transfected with empty expression plasmid. The results were normalized by protein content. The figure shows the mean + SD of 3 experiments, each performed in 3 independent triplicate analyses. Overexpression of RORα results in OC-8 of −890 / + 34 nucleotides in length.
Neither the basal activity of the 90 promoter nor the basal activity of the -344 / + 34 shorter nucleotide OC-344 promoter was affected. As expected, O
Only the C-800 promoter construct was up to 5 fold regulated by vitamin D3, which shows binding of the VDR / retinoid X receptor (RXR) to the hexamer at a palindromic DNA sequence at the origin of transcription of the human osteocalcin promoter. Upstream bp
This is because it is located between −513 and −493. RORα expression plasmid and OC
Co-transfection of the -890 construct resulted in OC-890 as shown in FIG.
It resulted in partial repression of up to 50% of the vitamin D activation level of the promoter reporter gene.

Summary The results obtained demonstrate the differential expression of RORα during the differentiation of hMSCs into osteoblasts and support the premise that RORα is involved in bone development. Furthermore, ROR
α can regulate at the transcriptional level two major non-collagen proteins, bone sialoprotein and osteocalcin. In the case of bone sialoprotein,
Positive regulation was observed, while in the case of osteocalcin, inhibition of vitamin D-activated osteocalcin transcription levels was observed. This suggests two main things. Ducy et al. (NATUR
E, 1996, 382: 448-452), osteocalcin itself plays a major role in bone metabolism. Furthermore, vitamin D is the major calcium-regulating hormone, and we have demonstrated cross-talk between the vitamin D reporter and RORα. Taken together, these data suggest a physiological role for RORα in osteocyte differentiation and regulation of key bone non-collagen proteins.

Example 2 Screening Assay RORα expression correlates with osteoblast differentiation. From the in vivo and in vitro data it can be concluded that RORα plays a central role in bone metabolism. Therefore, activators of RORα have the potential to be useful in the treatment of osteoporosis. The search for ligands can be done in other ways. A stably integrated RORα expression vector driven by a tk promoter linked to a luciferase reporter gene and a tandem repeat AG
A cell line with a reporter containing a GTCA sequence was used. It has been shown that tandem repeats are the binding site for RORα.

The used plasmid expression vector pCMX RORα1 was obtained from Giguere et al. (Genes & Development,
8: 538-553). The reporter plasmid consists of two repeats of the AGGTCA sequence with an 8 bp space located in front of the tk minimal promoter driving the firefly luciferase reporter gene.

Establishment of a stable cell line The expression vector of RORα1 and the reporter (DR8) tk-luc were transfected into Ros17 / 2.8 cells using Fugene as described in the previous section. In addition, antibiotic resistance gene constructs such as the puromycin resistance gene were co-transfected with these two plasmids. Cells with stable integration of the puromycin resistance gene and the RORα reporter and expression vector create stable cell lines suitable for searching for RORα ligands or activators.

Example 3 Animal Group for Assaying Bone Phenotype of Staggered (sg) Mice The mouse mutant staggered (sg) is a naturally occurring mutation in the pedigree of obese mice in 1995, Located within 160 kb of the RORα position, s
It has been suggested to be the site of the g mutation. A deletion in the RORα gene that prevents translation of the ligand binding domain was found in staggered mice. Stagger homozygotes have staggered gait, light quiver, hypotonia and miniaturization. The superficial surface of the cerebellum is severely underdeveloped, with loss of granule cells and Purkinje cells. RORα knockout mice generated in the mid-1990s exhibit a similar phenotype.

We have found that 16-week-old homozygous (sg / sg), heterozygous (sg / +) and wild-type (+ / +) male mice (n = 10 / group, from various parents) Bone (born littermates) were harvested and it was determined whether the bone phenotype of these mice was altered by a deletion in the RORα gene.

We found that 10 and 18 months of age heterozygotes (sg / +) and wild type (+ /
Bone from (+) male mice was also harvested to determine whether the bones of heterozygous mice exhibit age-related bone loss at rates similar to wild type.

Method The cut left tibia was dehydrated and subsequently immersed in fixative solution at 4 ° C. for 24 hours. Evaluation based on X-rays was carried out in 70% ethanol (DEXA, pQCT). X-rays X-rays (Mammomat, Siemens, Dietikon, Switzerland) were used for bone length measurements.

Dual-Energy X-Ray Absorption Measurement-DEXA Tibia bone content (BMC) and bone mineral density (BMD, mg / cm ² ) were adjusted to a standard Hologic QDR-1000 instrument (Measurement) adapted to small animal measurements. Hologic, Waltham, MA, USA)
It was measured at. 0.9 cm diameter sight and super high resolution mode (line space 0.0
254 cm, resolution: 0.0127 cm) was used. The stability of measurements was controlled daily by scanning the model.

Peripheral Quantitative Computed Tomography-pQCT Cortical and cancellous bone mass and shape 2.5 mm from medial and lateral intercondylar nodules
The metaphysis of the distal proximal tibia was monitored by Stratec-Norland XCT-2000 (Pforzheim, Germany). The following setup was chosen for the measurements: Voxel size: 0.1 mm x 0.1 mm x 0.5 mm (thickness of tissue slices), scan speed:
Scout-view-10 mm / s, CT-2 mm / s, 1 block, contour mode 1, peel mode 2, cortical limit value: 400 mg / cm ³ . The bone was placed in a plastic container filled with 70% ethanol. The stability of measurements was controlled daily by scanning the model.

Statistical analysis results are expressed as mean ± standard error (SEM). BMDP (Version 1
990 for VAX / VMS, BMDP Statistical Software Inc., Cork Ireland). The data were submitted for one-way analysis of variance (ANOVA). The Levene F-test was used to test for agreement of variance, and the differences between groups were Dunnett's test (significance level: p <0.
05). All statistical tests were two-sided. Differences between all groups were tested for statistical significance.

Results DEXA As shown in FIG. 5, the amount of tibial bone mineral was significantly reduced in the homozygous sg / sg mouse compared with the homozygous sg / + mouse and the wild type + / + mouse. (Fig. 5a). This is mainly due to a decrease in density (Fig. 5c) rather than a decrease in bone size (Fig. 5b, d). (FIG. 5: Tibia (according to DEXA), (a) bone mineral content, (b))
Area, (c) density, (d) length; mean ± SEM; ANOVA, Dunnett, p <0.05
, A = sg / sg⇔ + / +, b = sg / sg⇔sg / +;)

(PQCT) The total bone mineral content of the metaphyseal cross section of the proximal tibia was s compared to the sg / + and + / + animal groups.
There was a significant decrease in the g / sg animal group (Fig. 6a). This is due to the reduced cross-sectional area (Fig. 7b) and reduced salt density (Fig. 6), which indicate the fineness of the metaphysis of the proximal tibia in these herds.
It is due to both of c). Cortical bone thickness and trabecular bone density were also reduced (Fig. 7a, b). Homozygotes (sg / +) did not show this bone phenotype at all. Compared to the control wild type (+ / +) group of animals, they showed similar bone shape and density at 4 months of age when the group reached peak bone mass (FIGS. 6 and 7). However, bone loss accelerated with aging in the heterozygous (sg / +) group of animals, as shown by increased loss of reticular bone density compared to the wild type (+ / +) group. (Fig. 8). In addition, we found an exposure of hindlimb stiffening, suggesting rapid joint degeneration in the herd.

(FIG. 6: (a) total bone mineral content, (b) region, (c) density of the proximal tibia cross-section (by pQCT);
Mean ± SEM; ANOVA, Dunnett, p <0.05, a = sg / sg⇔ + / +,
b = sg / sg⇔sg / +;)

(FIG. 7: (a) Cortical thickness of proximal tibial section (by pQCT), (b) Trabecular bone mineral density; mean ± SEM; ANOVA, Dunnett, p <0.05, a = sg / sg ⇔ + / +, b =
sg / sg⇔sg / +, c = sg / + ⇔ + / +;)

FIG. 8: Trabecular bone mineral density in the cross section of the proximal tibia (by pQCT); mean ± SEM; ANO
VA, Dunnett, p <0.05; c = sg / + ⇔ + / +;)

Summary Mouse mutant staggered homozygotes with deletions in the RORα gene have reduced long bone diameters compared to heterozygotes and wild-type. More interestingly, homozygous as shown by bone mineral density measurements (DEXA, pQCT).
The bone of the (sg / sg) group of animals is osteopenic as compared to the wild type (+ / +) group of animals.
Heterozygous zygote (sg / +) mice developed normal bone mass. However, they showed accelerated bone loss during aging compared to wild type (+ / +) littermates.

[Brief description of drawings]

FIG. 1 shows agarose gel electrophoresis patterns of PCR products obtained from mRNA samples collected at different times of differentiation of human mesenchymal stem cells.

FIG. 2 is a graph showing a quantitative analysis of RORα expression during human mesenchymal stem cell differentiation.

FIG. 3 is a graph showing the induction of mouse bone sialoprotein promoter activity by RORα.

FIG. 4 is a graph showing that inhibition of the osteocalcin promoter by RORα is dominant in vitamin D activity.

FIG. 5: Bone mineral content of the entire tibia of mice with a deletion in the RORα gene, compared to wild type mice, assessed by dual energy X-ray absorptiometry (DEXA),
It is a graph which shows area, density, and length (d).

FIG. 6 is a graph showing total bone mineral content, area, and density in the proximal tibia cross-section of mice with a deletion in the RORα gene, as compared to wild-type mice, evaluated by peripheral quantitative computed tomography (pQCT). Is.

FIG. 7 is a graph showing cortical thickness and trabecular bone mineral density of the proximal tibia cross section of mice with a deletion in the RORα gene compared to wild type mice as assessed by peripheral quantitative computed tomography (pQCT). Is.

FIG. 8: Proximal tibial cross section of aged mice heterozygous for a deletion in the RORα gene compared to aged and wild-type aged mice assessed by peripheral quantitative computed tomography (pQCT). It is a graph which shows the trabecular bone mineral density of.

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁷ Identification code FI theme code (reference) A61P 19/10 A61P 19/10 G01N 33/50 G01N 33/50 X Z // G01N 33/15 33/15 Z (81) Designated countries EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, MZ, SD, SL, SZ, TZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AE, AG, AL, AM, AT, AU, AZ, BA, BB, BG BR, BY, BZ, CA, CH, CN, CR, CU, CZ, DE, DK, DM, DZ, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL , IN, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MA, MD, MG, MK, MN, MW, MX, MZ, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, TZ, UA, UG, US, UZ, VN, YU, ZA, ZW F terms (Reference) 2G045 AA29 BB50 CB01 CB13 CB17 GC07 4C084 AA17 DC50 NA14 ZA672 ZA962 ZA972

Claims (8)

[Claims] 1. A method for the prevention or treatment of a condition or disease associated with excessive loss of bone and cartilage comprising administering to a patient an effective amount of an activator of RORα. 2. Use of an activator of RORα in the manufacture of a medicament for the treatment of a condition or disease associated with excessive loss of bone and cartilage. 3. A biological compound that comprises a functional RORα receptor and is capable of producing a detectable signal in response to activation of the RORα receptor by a compound having bone growth promoting activity. A method for identifying a compound having a bone growth promoting activity, which comprises contacting and monitoring the system by generation of the signal. 4. A compound is contacted with a biological system comprising a functional RORα receptor and capable of producing a detectable signal in response to activation of the RORα receptor by a compound having bone growth promoting activity. Measuring the detectable signal in the presence of the test compound and comparing it with the result obtained with the control,
The method for identifying a compound having a bone growth promoting activity according to claim 3. 5. A biological system comprising a plurality of compounds, which comprises a functional RORα receptor and is capable of producing a detectable signal in response to activation of the RORα receptor by a compound having bone growth promoting activity. The method for comparing compounds having a bone growth promoting activity according to claim 3, which comprises contacting each of the test compounds individually with each other, measuring a detectable signal in the presence of each test compound, and comparing the obtained signals. 6. A compound identified by the method of claim 3. 7. Use of a compound according to claim 6 in a method of preventing or treating a disease or condition associated with excessive bone and cartilage loss. 8. Use of a compound according to claim 6 in the manufacture of a medicament for the treatment of diseases or conditions associated with excessive bone and cartilage loss.