JP2003508033A - TRF-β receptor polynucleotides, polypeptides, and antibodies - Google Patents

Abstract

  (57) [Summary] The present invention relates to novel human TGF-β receptor polypeptides and isolated nucleic acids comprising the coding region of a gene encoding such a polypeptide. Also provided are vectors, host cells, antibodies and recombinant methods for producing human TGF-β receptor polypeptide. The invention further relates to diagnostic and therapeutic methods useful for diagnosing and treating disorders relating to these novel human TGF-β receptor polypeptides. The invention provides a method of diagnosing a pathological condition, or susceptibility to a pathological condition, in a subject.

Description

Detailed Description of the Invention

FIELD OF THE INVENTION The present invention relates to a novel transforming growth factor β (TGF-β) for proteins.
It relates to a member of the receptor family. More specifically, isolated nucleic acid molecules encoding novel TGF-β receptor polypeptides are provided. New T
GF-β receptor polypeptides and antibodies that bind to these polypeptides are provided. Vectors, host cells, and recombinant and synthetic methods for producing human TGF-β receptor polynucleotides and / or polypeptides are also provided. The present invention further relates to diagnostic and therapeutic methods useful for diagnosing, treating, preventing and / or prognosing disorders associated with these novel TGF-β receptor polypeptides. The invention further relates to screening methods for identifying agonists and antagonists of the polynucleotides and polypeptides of the invention. The invention further relates to methods and / or compositions for inhibiting the production and function of the polypeptides of the invention.

BACKGROUND OF THE INVENTION Members of the superfamily of secreted proteins known as the transforming growth factor beta (TGF-β) family of proteins are cytokines and proteins that affect a wide range of biological functions. Activin and d
Includes pp / Vg related subfamilies (Kim, D., et al., J. Biomed.
Sci. , 3: 143-58 (1996)). TGF-β is believed to inhibit proliferation of multiple epithelial cell lines, and antisense inhibition of TGF-β is
As a result, the tumorigenicity of weak tumorigenic cell lines is increased (Markowitz).
, S. Et al., Science, 268: 1336-8 (1995)). Additional activities associated with members of the TGF-β superfamily of proteins include:
It includes developmental regulation in vertebrates, hematopoiesis, immune responses, inflammatory responses, and induction of extracellular matrix products.

The TGF-β protein is a specialized cell that constitutes two related transmembrane serine / threonine kinases, designated TGF-β type I and type II receptors (TβR-I and TβR-II), respectively. Eliminate biological responses via binding to surface receptors (Luo, K. et al., EMBO J., 15: 4).
485-96 (1996); Huse, M .; Et al., Cell, 96: 425-36.
(1999)). Both TβR-I and TβR-II receptors consist of the same domain (ie, a cysteine-rich N-terminal extracellular domain involved in ligand binding, a transmembrane domain, and a C-terminal cytoplasmic kinase domain) (C
hen, F.H. Et al., Proc. Natl. Acad. Sci. , 92: 1565-
9 (1995)). TGF-β that binds to the TβR-II receptor is TβR-
TβR-obtained from phosphorylation of serine and threonine in the GS region of I
Induced the formation of a heteromeric complex between I and TβR-II (Wrana
J. Et al., Nature, 370: 341-6 (1994)). Tβ of TβRI
Phosphorylation by RII activates the receptor kinase of TβRI, which
Phosphorylates and activates transforming factors (eg TAK-1), Smad proteins, or additional members of the MADR family of signal transducing molecules ((Wrana, JL, Miner Elect. Metab., 24: 1.
20-30 (1998)).

[0004] Markowitz et al. Demonstrated that colon cancer cell lines carrying mutations in the gene encoding TβR-II result in inactivation of the TβR-II receptor. Furthermore, it was determined that a subset of colon cancer cells were encoded for inactive TβR-II receptors and that these cells could avoid TGF-β-mediated growth inhibition (Markowitz, S. et al., Science,
268: 1336-8 (1995); Kim, D. et al. , Et al. Biomed. S
ci. , 3: 143-58 (1996)).

Similarly, Kadin et al. Found that loss of response to TGF-β by T-cell lymphoma cells correlates with a decrease in TβR-II receptor expression (Kadin et al., Proc. Natl. Acad. Sci. USA, 91:
6002-06 (1994)). Kim et al. Determined that the loss of susceptibility to TGF-β by the prostate cancer cell line LNCaP was due to a genetic alteration in the TβR-I receptor gene in these cells (Kim, I. et al., Cancer).
r Res. 56: 44-8 (1996)).

Based on these and other studies, loss of expression of TβR-II and / or TβR-I, or of inactive forms of TβR-II and / or TβR-I is associated with malignant lymphoma and other cancers. It may be due to the unregulated proliferation of lymphocytes in the cells. Impaired expression of TβR-I and / or TβRII can serve as a prognostic marker for the progression of some cancers.

Therefore, there is a clear need to identify and develop new members of the TGF-β receptor family of proteins. Although structurally related, such proteins may have diverse and pleiotropic functions in different cells and cell types. Receptor-type molecules should prove useful in targets based on the screening of small molecules and other such pharmacological agents.
The TGF-β receptors of the present invention are also useful in gene therapy-based therapeutic applications, restoring the activity of a wide variety of TGF-β receptors on cells expressing inactive TGF-β receptors. Furthermore, TβR-I and / or T
Assays designed to monitor βR-II expression may be useful as diagnostic tools for monitoring the presence or progression of certain types of cancer.

SUMMARY OF THE INVENTION The present invention is disclosed in the Sequence Listing and / or described in Table 1 and Ameri.
It comprises a polynucleotide sequence contained in a human cDNA plasmid deposited at the can Type Culture Collection (ATCC), or, alternatively, an isolated nucleic acid molecule consisting of that sequence. Fragments, variants and derivatives of these nucleic acid molecules are also included in the invention. The invention also includes isolated nucleic acid molecules that include, or alternatively consist of, polynucleotides that encode TGF-β receptor polypeptides. The invention further includes TGF-β receptor polypeptides encoded by these polynucleotides. An amino acid sequence comprising 7TM polypeptides as disclosed in the Sequence Listing and / or described in Table 1 and encoded by the human cDNA plasmid deposited with the ATCC, or alternatively consisting of those polypeptides, Further provided. Antibodies that bind to these polypeptides are also included in the invention. Fragments, variants, and derivatives of polypeptides of these amino acid sequences are also included in the invention, as are polynucleotides encoding these polypeptides and antibodies that bind these polypeptides.

Detailed Description Table 1 Table 1 summarizes ATCC deposits, deposit dates, and ATCC deposit numbers made by the ATCC in connection with the present application. Table 1 shows each “gene number” described below, including the cDNA clone identification, the type of vector included in the cDNA clone identification, the nucleotide sequence identification number, the nucleotides contained in the disclosed sequence, and the disclosed sequence. Further information is summarized regarding the position of the 5'nucleotide of the start codon, the amino acid sequence identification number, and the last amino acid of the ORF encoded by the disclosed sequence.

Table 2 shows known ESTs, and at least 1, 2, 3, 4, 5, 10 or more of any one or more of these known ESTs are optionally identified according to the invention. Are excluded from the embodiments of.

Table 3 summarizes the expression profile of the polynucleotides corresponding to the clones disclosed in Table 1. This first column provides a unique clone identification "Clone SEQ ID NO: Z" for the cDNA clones associated with each coating sequence disclosed in Table 1. The "library code" in the second column indicates the expression profile of the tissue expressing the polynucleotide of the invention and / or the cell line library. Each library code in the second column represents a tissue / cell source identification code corresponding to the library code and library instructions provided in Table 5. Expression of these polynucleotides was not observed in other tissue and / or cell libraries tested. Those of skill in the art routinely use this information to identify tissues that exhibit a predominant expression pattern of the corresponding polynucleotides of the invention, or to identify polynucleotides that exhibit predominant and / or specific tissue expression. Can be used.

Column 1 of Table 4 provides the nucleotide sequence identifier “SEQ ID NO: X” which corresponds to the nucleotide (SEQ ID NO: X) listed in column 5 of Table 1. The second column of Table 4 provides the chromosomal arrangement "cytological band or chromosome" of the polypeptide corresponding to SEQ ID NO: X. The chromosome arrangement is NCBI (National Center for
Biotechnology Information) was determined by finding an exact match with the EST and cDNA sequences contained in the UniGene database. In the case of putative chromosomal arrangements, the association of disease loci is determined by Onlin Me
ndelian Inheritance in Man (Online Me
delian Inheritance in Man, OMIM ^™ . McKu
dick-Nathans Institute for Genetic M
edicine, Johns Hopkins University (Ba
ltimere, MD) and National Center for Bi
technology Technology, National Lib
rarry of Medicine, (Bethesda, MD) 2000. W
old Wide Web URL: http: // www. ncbi. nl
m. nih. It was determined by comparison with Morbid Map, which was derived from gov / omim /). The putative chromosomal locus of Query is Morbid Ma
The OMIM reference identification number of this Morid Map entry, if it overlaps with the chromosomal locus of the p entry, is provided in the third column of Table 4, “OMIM I
Labeled "D". The keys for the OMIM reference identification numbers are provided in Table 6.

Table 5 provides the library code disclosed in the third column of Table 3. The second column provides a description of the tissue or cell source from which the corresponding library was derived.

Table 6 provides the keys for the OMIM reference identification numbers disclosed in the third column of Table 4. The OMIM reference identification number (first column) is the Online Mendelian
Inheritance in Man (Online Medielian I
health in Man, OMIM. McKusick-Nath
an's Institute for Genetic Medicine, J
hons Hopkins University (Baltimore, M
D) and National Center for Biotechnolo
gy Information, National Library of M
edicine, (Bethesda, MD) 2000. World Wide
Web URL: http: // www. ncbi. nlm. nih. gov
/ Omim /). The second column is Morbid Map datab
Provide the diseases associated with the cytological bands disclosed in the second column of Table 4 as determined from ase.

Definitions The following definitions are provided to facilitate understanding of certain terms used throughout this specification.

In the present invention, “isolated” refers to a substance taken from its original environment (eg, the natural environment if it is naturally occurring), and thus It has been altered "by the hand of man" from its natural state. For example, an isolated polynucleotide can be part of a vector or composition, or can be contained within a cell and still be in an "isolated" state. This is because the vector, composition, or particular cell is not the natural environment of the polynucleotide. The term "isolated" includes genomic or cDNA libraries, whole cell total RNA or mRNA preparations, genomic DNA preparations, including those that have been electrophoretically separated and transferred to blots. Neither sheared whole cell genomic DNA preparations nor other compositions shown in the art to have the polynucleotide / sequence discriminating features of the invention.

As used herein, a “polynucleotide” has the nucleic acid sequence contained in SEQ ID NO: X (as set forth in column 5 of Table 1) (SEQ ID NO: X). Molecule, or cDNA plasmid Z (listed in column 3 of Table 1 and contained within the pool of plasmids deposited with the ATCC). For example, the polynucleotide includes 5'and 3'untranslated sequences, coding regions with or without native or artificial signal sequences, protein coding regions, and fragments, epitopes, domains, and variants of this nucleic acid sequence. Including, full-length cDNA
The nucleotide sequence of the sequence may be included. Furthermore, as used herein, a "polypeptide" refers to a polynucleotide of the invention that is broadly defined (both the polyphenylalanine peptide sequence and the polylysine peptide sequence resulting from the translation of the poly A tail of the sequence corresponding to the cDNA. (Excluding explicitly) refers to a molecule having an amino acid sequence encoded by

In the present invention, a representative plasmid containing the sequence of SEQ ID NO: X is American
Deposited at Type Culture Collection (“ATCC”) and listed in Table 1. As shown in Table 1, each plasmid had cDNA
A clone ID (identification number) and ATCC deposit number (ATCC deposit number Z). Plasmids pooled and deposited as a single deposit have the same T
It has an ACC deposit number. ATCC is 10801 University B
ulevard, Manassas, Virginia 20110-220.
Located in 9, USA. The ATCC deposit was made in accordance with the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the purposes of Patent Procedure.

The “polynucleotide” of the present invention also includes, under stringent hybridization conditions, a sequence contained in SEQ ID NO: X, or a complement thereof (eg, a polynucleotide fragment described herein. Any one, two, three, four or more complements thereof, and / or a sequence contained in the relevant cDNA plasmid Z in the library deposited with the ATCC (eg, as described herein). Any one, two, three, four of the polynucleotide fragments
One or more complements). “Stringent hybridization conditions” means 50% formamide, 5 × SS
C (750 mM NaCl, 75 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5 × Denhardt's solution, 10% dextran sulfate, and at 42 ° C. in a solution containing 20 μg / ml denatured sheared salmon sperm DNA. Overnight incubation, followed by washing the filters in 0.1 × SSC at about 65 ° C.

The “polynucleotide” of the present invention also includes nucleic acid molecules that hybridize to the polynucleotide of the present invention under lower stringency hybridization conditions. Alteration of hybridization stringency and signal detection is primarily accomplished through manipulation of formamide concentration (lower percentages of formamide produce reduced stringency); salt conditions, or temperature. For example, lower stringency conditions include 6 × SSPE (20
× SSPE = 3M NaCl; 0.2M NaH ₂ PO ₄ ; 0.02M EDTA
, PH 7.4), 0.5% SDS, 30% formamide, 100 μg / ml salmon sperm blocking DNA in a solution at 37 ° C. overnight incubation;
It then includes a wash at 50 ° C. with 1 × SSPE, 0.1% SDS. Furthermore, in order to achieve even lower stringency, washes performed after stringent hybridization should be performed at higher salt concentrations (eg 5 × SS).
C).

Note that variations on the above conditions can be achieved by the inclusion and / or substitution of alternative blocking reagents used to suppress background in hybridization experiments. Typical blocking reagents include Denhardt's reagent, BLOTTO, heparin, denatured salmon sperm D.
NA, and commercially available patented formulations. The inclusion of specific blocking reagents may require modification of the above hybridization conditions due to compatibility issues.

Of course, a poly A + sequence (eg, any 3'terminal poly A + region of the cDNA shown in the sequence listing) or a poly hybridizing only to a complementary stretch of T (or U) residues. Nucleotides are not included in the definition of "polynucleotide." Because such a polynucleotide hybridizes to any nucleic acid molecule containing a poly (A) stretch or its complement (eg, virtually any double-stranded cDNA clone generated using oligo dT as a primer). Because it soybeans.

The polynucleotide of the present invention may be composed of any polyribonucleotide or polydeoxyribonucleotide, which may be unmodified RNA or unmodified DN.
It may be A or modified RNA or modified DNA. For example, a polynucleotide is a single-stranded or double-stranded DNA, a mixture of single-stranded and double-stranded regions D
NA, single-stranded and double-stranded RNA, and RNA that is a mixture of single-stranded and double-stranded regions, single-stranded, or more typically double-stranded or single-stranded regions and double It may be composed of hybrid molecules including DNA and RNA, which may be a mixture with the strand regions. In addition, the polynucleotide may be composed of triple-stranded regions, including RNA or DNA or both RNA and DNA. Polynucleotides may also include one or more modified bases or DNA or RNA backbones that have been modified for stability or for other reasons. "Modified" bases include, for example, tritylated bases and unusual bases such as inosine. Various modifications can be made to DNA and RNA;
Thus, "polynucleotide" includes chemically, enzymatically, or metabolically modified forms.

In certain embodiments, the polynucleotide of the invention is at least 15, at least 30, at least 50, at least 100, at least 125, at least 500 or at least 1000 contiguous nucleotides, but 300 kb, 200 kb in length. , 100 kb, 50 kb, 15 kb, 10 kb, 7.5
kb, 5 kb, 2.5 kb, 2.0 kb or 1 kb or less. In a further embodiment, the polynucleotide of the invention comprises part of the coding sequence as disclosed herein, but not all or part of any intron.
In another embodiment, the polynucleotide containing the coding sequence does not include the coding sequence of a genomic flanking gene (ie, 5 ′ or 3 ′ in the genome relative to the gene of interest). In another embodiment, the polynucleotide of the invention has 100
0, 500, 250, 100, 50, 25, 20, 15, 10, 5, 4, 3, 2
, Or more than one genomic flanking gene coding sequence is not included.

“SEQ ID NO: X (SEQ ID NO: X)” refers to the polynucleotide sequence listed in column 5 of table 1, while “SEQ ID NO: Y” refers to column 10 of table 1. Refers to the polypeptide sequences described in. SEQ ID NO: X is identified by the integer specified in column 6 of Table 1. SEQ ID NO: Y of the polypeptide sequence is the translated open reading frame (ORF) encoded by polynucleotide SEQ ID NO: X. The polynucleotide sequences are shown in the sequence listing, immediately followed by all polypeptide sequences. Therefore, the polypeptide sequence corresponding to SEQ ID NO: 2 of the polynucleotide sequence is the first polypeptide sequence shown in the sequence listing. Hereinafter, the second polypeptide sequence corresponds to the polynucleotide sequence as shown in SEQ ID NO: 3, and so on.

The polypeptides of the invention may be composed of amino acids linked to each other by peptide bonds or modified peptide bonds, ie, peptide isosteres, and amino acids other than the 20 gene-encoded amino acids. May be included. The polypeptide is either by a natural process, such as post-translational processing, or by chemical modification techniques well known in the art.
It can be modified. Such modifications are well documented in basic texts, and more detailed research articles, and in many research literature. Modifications can occur anywhere in a polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini. It will be appreciated that the same type of modification may be present in the same or varying degrees at several sites in a given polypeptide. Also, a given polypeptide may contain many types of modifications. Polypeptides can be branched, eg, as a result of ubiquitination, and polypeptides can be cyclic, with or without branching. Cyclic, branched and branched cyclic polypeptides can result from natural post-translational processes or can be made by synthetic methods. Modifications include acetylation, acylation, ADP-ribosylation, amidation, flavin covalent bond, heme moiety covalent bond, nucleotide or nucleotide derivative covalent bond, lipid or lipid derivative covalent bond, phosphatidylinositol (phosphotide).
covalent bond, cross-linking, cyclization, disulfide bond formation, demethylation, covalent cross-link formation, cysteine formation, pyroglutamate formation, formylation, γ-carboxylation, glycosylation, GPI anchor formation, water Oxidation, iodination, methylation, myristoylation, oxidation, pegylation,
Transfer R of amino acids to proteins such as proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, arginylation
NA-mediated addition, and ubiquitination. (For example, PROTEINS
-Structure AND MOLECULAR PROPERIES,
Second Edition, T.S. E. Creighton, W.C. H. Freeman and Co
company, New York (1993); POST TRANSLATION
AL COVALENT MODIFICATION OF PROTEINS
, B. C. Edited by Johnson, Academic Press, New Yor
k, pp. 1-12 (1983); Seifter et al., Meth Enzymol.
182: 626-646 (1990); Rattan et al., Ann NY Aca.
d Sci 663: 48-62 (1992)).

The polypeptides of the present invention can be prepared in any suitable manner. Such polypeptides include naturally occurring isolated polypeptides, recombinantly produced polypeptides, synthetically produced polypeptides, or polypeptides produced by a combination of these methods. Is included. Means for preparing such polypeptides are well understood in the art.

The polypeptide may be in the form of a secreted protein, including the mature form,
Or a larger protein (eg, fusion protein (see below))
Can be a part of. It is often advantageous to include additional amino acid sequences.
The amino acid sequence may include a secretory or leader sequence, a pro sequence, a sequence that aids purification (eg, multiple histidine residues), or additional sequences for stability during recombinant production.

The polypeptides of the invention are preferably provided in isolated form and are preferably substantially purified. Recombinantly produced versions of the polypeptide, including secreted polypeptides, can be prepared using techniques described herein or otherwise known in the art (eg, Smith and Johnson, G
ene 67: 31-40 (1988) by a one-step method). The polypeptides of the present invention may also be described herein or otherwise raised against the polypeptides of the present invention by techniques known in the art (eg, methods well known in the art). The antibodies of the invention) can be used to purify from natural, synthetic, or recombinant sources.

By a polypeptide exhibiting "functional activity" is meant a polypeptide capable of exhibiting one or more known functional activities associated with the full-length (complete) protein of the invention.
Such functional activities include biological activity, antigenicity [ability to bind (or compete with the polypeptide for binding) anti-polypeptide antibody], immunogenicity (binds to a particular polypeptide of the invention). Ability to generate antibodies), the ability to form multimers with the polypeptides of the invention, and the ability to bind to receptors or ligands for the polypeptides, including but not limited to.

A “polypeptide having functional activity” is similar to the activity of a polypeptide of the invention, with or without dose dependence, as measured in a particular assay (eg, biological assay). A polypeptide (including a mature form) that is active, but shows an activity that is not necessarily the same as that activity. If a dose dependence is present, the dose dependence need not be the same as that of the polypeptide, but rather is substantially that of a given activity when compared to a polypeptide of the invention. Similar (ie, the candidate polypeptide has a higher activity, or about 1/25 or more, preferably 1/10 or more, and most preferably about 1/3 or more activity as compared to the polypeptide of the invention. Indicates).

The functional activity of the polypeptide, and fragments, variants, derivatives and analogs thereof, can be assayed by a variety of methods.

For example, in one embodiment in which the ability to bind or compete with a full-length polypeptide of the invention for binding of an antibody to the full-length polypeptide is assayed,
A variety of immunoassays known in the art may be used, including radioimmunoassays, ELISAs (enzyme-linked immunosorbent assays), "sandwich" immunoassays, immunoradiometric assays, gel diffusion precipitation reactions, immunodiffusion assays. , In situ immunoassays (eg using colloidal gold, enzyme labels or radioisotope labels), western blots, precipitation reactions, agglutination assays (eg gel agglutination assays, hemagglutination assays), complement fixation assays, immunofluorescence assays Competitive and non-competitive assay systems using techniques such as, protein A assays, and immunoelectrophoresis assays, and the like. In one embodiment, antibody binding is detected by detecting the label on the primary antibody. In another embodiment, the primary antibody is detected by detecting binding of a secondary antibody or reagent to the primary antibody. In a further embodiment, the secondary antibody is labeled. Many means for detecting binding in immunoassays are known in the art and are within the scope of the present invention.

In another embodiment, when a ligand is identified, or when the ability of a polypeptide fragment, variant, or derivative of the invention to multimerize is assessed, the binding is eg reduced and non-reduced. It can be assayed by means well known in the art such as gel chromatography, protein affinity chromatography, as well as affinity blotting. Generally, Phizicky
, E. Et al., Microbiol. Rev. 59: 94-123 (1995). In another embodiment, the physiological correlation (signal transduction) of the polynucleotide of the invention to its substrate may be assayed.

In addition, the assays described herein (see, eg, the Examples) and other assays known in the art include polypeptides of the invention and their fragments, variants, derivatives, and Analogs can be routinely applied to measure the ability of an analog to elicit a biological activity (either in vitro or in vivo) associated with a polypeptide.

(Polynucleotides and Polypeptides of the Present Invention) (Characteristics of Protein Encoded by Gene No. 1) The translation product corresponding to this gene is human protein kinase (HPK) (see International Application WO9811234) and Mouse Nedl Serine / Threonine and Tyrosine Specific Protein Kinase (Genbank Registration AAB23
529) share sequence homology. It is believed to be important in controlling cell signaling and cell differentiation and / or proliferation.

The gene encoding the translation product of the present invention is a member of the TGF-β receptor family of proteins. Proteins belonging to this family contain a cytoplasmic serine / threonine kinase domain. The following consensus patterns have been developed to identify these kinase domains (Swiss Ins).
Title of Bioinformatics): [LIVMFYC] -x- [HY] -x-D- [LIVMFY] -Kx (2).
-N- [LIVMFYCT] (3). A preferred polypeptide of the invention comprises or consists of the following amino acid sequence: VMHRDIKPANVFI.
(SEQ ID NO: 26). Fragments and / or variants of these polypeptides (eg, the fragments and / or variants described herein) are included in the invention. Polynucleotides encoding these polypeptides, including fragments and / or variants, are also included in the invention, as are antibodies that bind these polypeptides. A polypeptide comprising the serine / threonine kinase domain of SEQ ID NO: 26, and at least 5 of SEQ ID NO: 14,
More preferred are 10, 15, 20, 25, 30, 50, or 75 additional contiguous amino acid residues. The additional contiguous amine acid residue may be N-terminal or C-terminal to the serine / threonine kinase domain. Alternatively, the additional contiguous amino acid residues can be both N-terminal and C-terminal to the serine / threonine kinase domain. Here, the total N-terminal and C-terminal contiguous amino acid residues equal a certain number.

A preferred polypeptide of the invention comprises as residues residues 1, 2, 3, 4, 5, 6, 7, 8, 9, or all 9 of the immunogenic epitopes shown in SEQ ID NO: 14. Or consisting of them: Met-1 to Gly-9, Pro-14 to Leu-
22, Glu-37 to Arg-42, Phe-126 to Pro-134, His
-209 to Asp-218, Pro-235 to Met-241, Lys-249.
-Asp-254, Pro-257-Leu-267, and Pro-277-
Asp-284. Fragments and / or variants of these polypeptides (
(For example, the fragments and / or variants described herein) are encompassed by the present invention. Polynucleotides encoding these polypeptides (including fragments and / or variants) are also encompassed by the invention, as are antibodies that bind these polypeptides.

This gene is expressed mainly in liver cancer tissues, as well as musculoskeletal and smooth muscle tissues.

Accordingly, the polynucleotides and polypeptides of the invention, including antibodies, are useful for the differential identification of tissues or cell types present in a biological sample, and for the following diseases and conditions, including but not limited to: Useful as reagents for diagnosis: liver cancer, and disorders and / or disorders of the musculoskeletal system, and cancer. Similarly,
The polypeptides and antibodies to these polypeptides are useful for providing immunological probes for differential identification of tissue or cell types. Normal gene expression levels (ie, expression levels of healthy tissue or body fluids from non-disordered individuals) for many disorders of the tissues or cells, particularly liver cancer and the musculoskeletal system.
Expression of this gene at levels that are significantly higher or lower than that of specific tissues or cell types taken from individuals with such disorders, such as liver tissue, musculoskeletal, cancerous tissue and wound tissue. ) Or body fluid (eg lymph, serum, plasma, urine, synovial fluid, or spinal fluid) or another tissue or sample.

The tissue distribution in liver cancer tissue and musculoskeletal tissue, and the homology of HPK and Nekl proteins indicate that the polynucleotides and polypeptides corresponding to this gene are used for the diagnosis, detection and / or treatment of liver cancer and general cancer, And useful for musculoskeletal diseases and / or disorders.

The tissue distribution of liver cancer tissue is useful as a marker that polynucleotides, translation products and antibodies corresponding to this gene may be useful in controlling the growth of liver cancer, and to indicate the presence or growth of liver cancer. Indicates that it is possible. Thus, this gene is a good target for agonists, especially antibodies that promote receptor activity such as, for example, signal transduction and / or inhibition of cell proliferation. Therefore, an antibody that specifically binds to the protein of the translation product of this gene is preferable. Kits for detecting liver cancer are also provided. In one embodiment, such a kit comprises
It includes an antibody specific for the translation product of the gene that binds to the solid support. A method of detecting solid liver cancer is also preferred, which comprises contacting an antibody specific for the translation product of this gene with a body fluid (preferably serum) from the solid, and the antibody being found in the body fluid. Included in the antigen. Preferably the antibody is bound to a solid support and the body fluid is serum. The above embodiments and other treatments and diagnostic tests (kits and methods) are described in more detail elsewhere herein.

Alternatively, the tissue distribution in smooth muscle tissue may be such that the protein product of this gene indicates that cardiovascular conditions and pathologies (eg, heart disease, restenosis, atherosclerosis, stroke, angina, thrombosis, and wounds). It is useful for diagnosis and treatment of (healing). The protein and antibodies related to this protein may prove useful as tumor markers and / or immunotherapeutic targets for the tissues listed above.

(Characteristics of Protein Encoded by Gene No. 2) The translation product corresponding to this gene has multiple protein kinases (eg, Ge).
Share sequence homology with the nbank entry CAA88531). It is thought to be involved in cell signaling.

The gene encoding the translation product of the present invention is a member of the TGF-β receptor family of proteins. Proteins belonging to this family contain a cytoplasmic serine / threonine kinase domain. The following consensus patterns have been developed to identify these domains: [LIVMFYC] -x- [HY] -x-D- [LIVMFY] -Kx (2).
-N- [LIVMFYCT] (3). A preferred polypeptide of the invention comprises or consists of the following amino acid sequence: VHIRDLKSRNVVI.
(SEQ ID NO: 27). Fragments and / or variants of these polypeptides (eg, the fragments and / or variants described herein) are included in the invention. Polynucleotides encoding these polypeptides, including fragments and / or variants, are also included in the invention, as are antibodies that bind these polypeptides. A polypeptide comprising the serine / threonine kinase domain of SEQ ID NO: 27, and at least 5 of SEQ ID NO: 15,
More preferred are 10, 15, 20, 25, 30, 50, or 75 additional contiguous amino acid residues. The additional contiguous amine acid residue may be N-terminal or C-terminal to the serine / threonine kinase domain. Alternatively, the additional contiguous amino acid residues can be both N-terminal and C-terminal to the serine / threonine kinase domain. Here, the total N-terminal and C-terminal contiguous amino acid residues equal a certain number.

Preferred polypeptides of the invention are 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, or 12 of the immunogenic epitopes shown in SEQ ID NO: 15 as residues. Includes or consists of all: Asn-95 to Glu-101, A
sp-246-Phe-253, Met-263-Ser-275, Arg-2.
93-Arg-299, Phe-303-Arg-314, Glu-319-A
sn-327, Val-352 to Ser-358, Ser-424 to Lys-4.
34, Pro-448 to Lys-456, Try-516 to Lys-527, S
er-535-Glu-542, Thr-555-Asp-570, Thr-5
86-Ser-593, Phe-605-Ser-610, Asn-631-G
In640, Asn-653 to Gly-684, Ser-690 to Lys-71.
3, Asn-723 to Asn-741, His-749 to Val-763, and Glu-772 to Try-797. Fragments and / or variants of these polypeptides (eg, fragments and / or variants described herein) are encompassed by the present invention. Polynucleotides encoding these polypeptides (including fragments and / or variants) are also encompassed by the invention, as are antibodies that bind these polypeptides.

This gene is expressed in bone marrow and osteoblasts, as well as primarily dendritic cells.

Accordingly, the polynucleotides and polypeptides of the present invention, including antibodies, are useful for the differential identification of tissues or cell types present in a biological sample, and for the following diseases and conditions, including but not limited to: Useful as diagnostic reagents: diseases and / or disorders of the skeletal and immune systems and cancer. Similarly, polypeptides and antibodies related to these polypeptides are useful for providing immunological probes for differential identification of tissue or cell types. Significantly higher or lower than standard gene expression levels (ie, expression levels of body fluids from healthy tissues or individuals without disorders) for many disorders of the tissues or cells, particularly the skeletal and immune systems The expression of this gene at a level is dependent on the specific tissue or cell type (e.g., skeletal tissue, bone marrow tissue, osteoblast tissue, immune tissue, primary dendritic cell tissue, collected from an individual with such a disorder, Cancerous and wound tissues) or body fluids (eg lymph, serum, plasma, urine, synovial fluid, or spinal fluid) or other tissues or samples.

The tissue distribution of bone marrow cells, primary dendritic cells, and osteoblasts, as well as the homology of multiple kinase proteins, indicates that the polynucleotides and polypeptides corresponding to this gene are diagnostic of the immune and skeletal systems, Shown to be useful for detection and / or treatment. Polynucleotides and translation products corresponding to this gene may be associated with inhibition of cell growth and, therefore, may be useful in the prevention and / or elimination of cell proliferative disorders, such as cancer.

Expression of the gene product in bone marrow cells and primary dendritic cells includes blood stem cells,
It suggests that it helps control the proliferation of primary pancreatic hematopoietic cell lines; survival; differentiation; and / or activity. This gene product may be associated with cytokine products, control of antigen presentation, or other processes that may also be suggested to be useful in the treatment of cancer (eg, by a boosting immune response). This gene is expressed in cells of lymphoid origin, gene or protein, so that antibodies directed against the protein may show utility as tumor markers and / or immunotherapeutic targets for the tissues listed above. . Therefore, it may be useful as a reagent for immune disorders, including arthritis, asthma, immunodeficiency disorders (eg, AIDS, leukemia, rheumatoid arthritis, immune bowel disease, sepsis, and psoriasis). Furthermore, this gene product can be used commercially for expansion of defined precursors of stem cells and various blood lineages, as well as for differentiation and / or proliferation of various cell types.

Alternatively, it is suggested that expression of the gene product in osteoblasts may help osteoblast survival, proliferation, and / or growth. Therefore, it may be useful in affecting bone mass, such as conditions such as osteoporosis. Furthermore, translation products corresponding to this gene, as well as antibodies related to these translation products, may be shown to be useful as tumor markers and / or immunotherapeutic targets for the tissues listed above.

(Characteristics of Protein Encoded by Gene No. 3) The translation product of this gene is derived from multiple kinase proteins (eg, human STE2).
Shares sequence homology with 0-like stress activated serine / threonine kinases (see International Application No. WO9915635). It is thought to be involved in cellular processes such as signal transduction. Based on this homology, these proteins are believed to share at least some biological activity.

Preferred polypeptides of the invention are 1,2,3,4,5,6,7,8,9,10,11,12 of the immunogenic epitopes shown in SEQ ID NO: 16 as residues.
Or comprises all 12 or consists of: Ile-42 to Gln-47
, Glu-58 to Glu-63, Cys-77 to Val-82, Ser-137.
~ Ile-145, Thr-172 to Thr-178, Ser-194 to Asp
-201, Ala-213 to His-223, Leu-255 to Ala-265.
, Asn-277 to Thy-283, Arg-290 to Trp-324, Thr.
-328 to Val-338, and Leu-364 to Gly-376. Fragments and / or variants of these polypeptides (eg, fragments and / or variants described herein) are encompassed by the present invention. Polynucleotides encoding these polypeptides (including fragments and / or variants) can also be labeled as well as antibodies that bind these polypeptides,
Included by the present invention.

This gene is expressed primarily in placental tissue, T cells and T cell lymphomas.

Accordingly, the polynucleotides and polypeptides of the present invention, including antibodies, are useful for the differential identification of tissues or cell types present in a biological sample, and for the following diseases and conditions, including but not limited to: Useful as diagnostic reagents: diseases and / or disorders of the placenta, developmental system, and immune system (mainly T-cell lymphoma). Similarly, polypeptides and antibodies to these polypeptides include
Useful to provide immunological probes for differential identification of tissue or cell type. Significantly higher than normal gene expression levels (ie, expression levels of healthy tissue or fluid from unaffected individuals) for many disorders of the tissues or cells, particularly placenta and immune and developmental systems Or low levels of expression of this gene in particular tissues or cell types taken from individuals with such disorders (eg, immune, developmental, placental, cancerous and wounded tissues).
Or it can be detected in bodily fluids such as lymph, serum, plasma, urine, synovial fluid, or spinal fluid or another tissue or sample.

Placental tissue, T-cell lymphoma and T-cell tissue distribution, and the homology of several kinase proteins that are thought to be involved in signal transduction and activation of proteins, indicate that the polynucleotides, translation products and It is shown that the antibodies are useful for the diagnosis, detection and / or treatment of the placenta, developmental system and immune system. Polynucleotides and translation products corresponding to this gene may be associated with inhibition of cell growth and, therefore, may be useful in the prevention and / or elimination of cell proliferative disorders, such as cancer.

This tissue distribution suggests that the protein product of this clone is useful in the diagnosis and / or treatment of disorders of this placenta. The specific expression in this placenta is
It is suggested that this gene product may be useful for proper construction and maintenance of placental function. Alternatively, this gene may be produced by the placenta and then transported to the embryo, which may play an important role in the development and / or survival of the developing embryo or fetus. Expression of the gene product in vascular rich tissues (eg placenta) also suggests that the gene product may be produced more generally in endothelial cells or circulation. In such cases, it may play a more general role in vascular function (eg, angiogenesis). It can also be produced in blood vessels and affects other cells within this circulation (eg, hematopoietic cells). This may help promote proliferation, survival, activation, and / or differentiation of hematopoietic cells and other cells throughout the body.

Similarly, expression of this gene product in T cells, including blood stem cells, potentially
It suggests a role in the control of proliferation, survival, differentiation, and / or activation of all hematopoietic cell lineages. This gene product may be associated with cytokine products, antigen presentation, or other processes that may also be suggested to be useful in the treatment of cancer (eg, by a boosting immune response). This gene is expressed in lymphoid origins, genes or proteins, so that antibodies directed against the protein may show utility as tumor markers and / or immunotherapeutic targets for the tissues listed above. Therefore, it may be useful as a reagent for immune disorders, including arthritis, asthma, immunodeficiency disorders (eg, AIDS, leukemia, rheumatoid arthritis, immune bowel disease, sepsis, and psoriasis). In addition, this gene product has been used commercially for the expansion of defined precursors of stem cells and various blood lineages, as well as the differentiation and / or proliferation of various cell types. The protein and antibodies related to this protein may prove useful as tumor markers and / or immunotherapeutic targets for the tissues listed above. CHARACTERISTICS OF PROTEIN ENCODED BY GENE NO: 4 The translation products of this gene have numerous kinase and serine / threonine kinase proteins (Genbank accession numbers CAA66229 and CAB06295).
, Or International Publication No. WO9801756)).

The gene encoding the translation product of the present invention is a member of the TGF-β receptor family of proteins. Proteins belonging to this family contain a cytoplasmic serine / threonine kinase domain. To identify these kinase domains, the following consensus pattern was developed: [LIVMFYC] -x- [HY] -x-D- [LIVMFY] -Kx (2).
-N- [LIVMFYCT] (3). A preferred polypeptide of the invention comprises or consists of the following amino acid sequence: VVHRDLKLENILL (SEQ ID NO: 28). Fragments and / or variants of these polypeptides (eg, the fragments and / or variants described herein are included in the invention. These polypeptides (including fragments and / or variants))
Also included in the invention are polynucleotides that encode, such as antibodies that bind to these polypeptides. A serine / threonine kinase domain of SEQ ID NO: 28, and at least 5, 10, 15, 20, of the amino acid sequence of SEQ ID NO: 17,
Further preferred are polypeptides comprising 25, 30, 50 or 75 additional consecutive amino acid residues. The additional contiguous amino acid residue may be N-terminal or C-terminal to the serine / threonine kinase domain. Alternatively, the additional contiguous amino acid residues can be both N-terminal and C-terminal to the serine / threonine kinase domain, where the total number of contiguous amino acid residues at the N- and C-termini is a certain number. be equivalent to.

A preferred polypeptide of the invention is the residue in SEQ ID NO: 17: Ala-38.
-Leu-43, Ser-48-Glu-57, Asn-128-Ser-13
9, Ser-169 to Asp-181, Pro-194 to Thr-199, Gl
n-220 to Gly-226, Pro-229 to Ala-234, Arg-24.
3 to Leu-249, Pro-272 to Gln-277, Leu-280 to As.
p-288, Asp-296 to Lys-311, Val-328 to Glu-33.
4, Lys-356 to Ser-374, Asp-388 to Gln-396, Gl
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 of immunogenic epitopes designated as u-467 to Leu-474, and Glu-487 to Gly-507.
, 12, 13, 14, 15, or 16 all or consist of.
Fragments and / or variants of these polypeptides (eg, fragments and / or variants described herein) are included in the invention. Polynucleotides encoding these polypeptides (including fragments and / or variants) are also included by the invention, as are antibodies to which these polypeptides bind.

[0061]   This gene is expressed primarily in neutrophil and ovarian cancer tissues.

Thus, the polynucleotides and polypeptides of the present invention include for differential identification of tissues or cell types present in a biological sample, as well as diseases and / or disorders of the immune system, and ovarian cancer. It is useful as a reagent for diagnosis of diseases and conditions that are not limited thereto. Similarly, polypeptides and antibodies to these polypeptides are useful in providing immunological probes for the differential identification of tissues or cell types. Significantly higher than standard gene expression levels (ie, expression levels in normal tissues or fluids from individuals without the disorder) for disorders of the tissues or cells, particularly the immune and reproductive systems, or Lower levels of expression of this gene may be associated with specific tissues or cell types (eg, immune, reproductive, cancerous and wound tissues) or body fluids (eg, lymph, Serum, plasma, urine, synovial fluid and spinal fluid), or another tissue or cell sample.

This tissue distribution in neutrophil and ovarian cancer tissues indicates that the polynucleotides, translation products, and antibodies corresponding to this gene affect the immune system, and ovarian cancer disease and / or
Or indicate utility in the diagnosis, detection, and / or treatment of a disorder. Polynucleotides and translation products corresponding to this gene may be involved in the inhibition of cell proliferation and thus be useful in the prevention and / or elimination of cell proliferation disorders.

Expression of this gene product in neutrophils suggests a role in regulating the proliferation; survival; differentiation; and / or activation of potentially all hematopoietic cell lineages (including blood stem cells). This gene product may be involved in the regulation of cytokine production, antigen presentation, or other processes, which may also suggest utility in treating cancer (eg, by boosting the immune response). Since this gene is expressed in cells of hematopoietic origin, the gene or gene product, and antibodies to this protein may show utility as tumor markers and / or immune targets for the tissues listed above. Polynucleotides, translation products and antibodies corresponding to this gene are also immunological including arthritis, asthma, immunodeficiency diseases (eg, AIDS), leukemia, rheumatoid arthritis, inflammatory bowel disease, sepsis, acne, and psoriasis. It can be used as a drug for disorders. Furthermore, this gene product may have commercial utility in the expansion of stem and committed progenitor cells of various blood lineages, and in the differentiation and / or proliferation of various cell types. Expression of this gene in neutrophils also strongly suggests a role for this protein in immune function and immune surveillance.

Alternatively, this tissue distribution in ovarian cancer tissue indicates that this gene is a good target for agonists or antagonists (particularly antibodies) that block the binding of the receptor by its cognate ligand. Therefore, antibodies and / or small molecules that specifically bind to part of the translation product of this gene are preferred. Also,
A kit for detecting ovarian cancer is provided. In one embodiment, such a kit comprises an antibody specific for the translation product of this gene bound to a solid support. Also provided is a method of detecting these ovarian cancers in an individual, the method comprising:
An antibody specific to the translation product of this gene is used as a body fluid (preferably serum) derived from an individual.
And contacting the antibody and determining whether the antibody binds to an antigen found in body fluids. Preferably the antibody is bound to a solid support and the body fluid is serum. The above embodiments and other therapeutic and diagnostic tests (kits and methods) are described in more detail elsewhere herein. In addition, translation products corresponding to this gene, and antibodies to these translation products, may show utility as tumor markers and / or immunotherapeutic targets for the tissues listed above.

(Characteristics of Protein Encoded by Gene No. 5) The translation product corresponding to this gene shares sequence homology with the mouse NEK6 protein (see International Publication No. WO9966051). This mouse NEK
The 6 protein is a protein thought to have serine / threonine kinase activity. Based on this homology, these proteins are expected to share at least some biological activity.

A preferred polypeptide of the invention is the residue of SEQ ID NO: 18: Leu-2 ...
Asp-11, Asn-31 to Ser-36, Ala-73 to Ser-82, G
lu-107 to Ala-116, Gly-130 to Gln-138, Leu-1
45-Trp-150, Gln-158-Gln-189, Ala-210-L
eu-217, Val-226 to Pro-237, Gln-257 to Phe-2.
74, Ser-295-Asn-300, Thr-313-Gly-326, and one of the immunogenic epitopes designated as Pro-329-Glu-340,
Includes or consists of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 all. Fragments and / or variants of these polypeptides (eg, fragments and / or variants described herein)
Are included in the present invention. Polynucleotides encoding these polypeptides (including fragments and / or variants) are also included by the invention, as are antibodies to which these polypeptides bind.

This gene is expressed primarily in fetal brain, cerebellum, colon, and colon cancer tissues.

Accordingly, the polynucleotides and polypeptides of the present invention are useful for the differential identification of tissues or cell types present in biological samples, as well as for diseases and / or disorders of the nervous and gastrointestinal systems, and cancer. It is useful as a reagent for the diagnosis of diseases and conditions including, but not limited to. Similarly, polypeptides and antibodies to these polypeptides are useful in providing immunological probes for the differential identification of tissues or cell types. Significantly higher than standard gene expression levels (ie expression levels in normal tissues or fluids from individuals without the disorder) for disorders of the tissues or cells, particularly nervous and gastrointestinal systems, or Lower levels of expression of this gene may be associated with specific tissue or cell types (eg brain tissue, nervous tissue, colon tissue, gastrointestinal tissue, cancerous tissue and wound tissue) taken from an individual having such a disorder or Body fluids (eg lymph, serum, plasma,
Urine, synovial fluid and spinal fluid), or in another tissue or cell sample.

Tissue distribution in nerve tissue, colon cancer tissue, and gastrointestinal tissue, and mouse NE
Homology to the K6 protein means that the polynucleotides, translation products and antibodies corresponding to this gene are used in the diagnosis, detection and / or treatment of the nervous and gastrointestinal systems,
And useful for the diagnosis, detection and / or treatment of colon cancer. Polynucleotides and translation products corresponding to this gene may be involved in the inhibition of cell proliferation and thus be useful in the prevention and / or elimination of cell proliferation disorders (eg cancer).

The tissue distribution in colon tissue indicates that the protein product of this clone is useful in the diagnosis and / or treatment of disorders involving the gastrointestinal system. This may include diseases related to digestion and food absorption, as well as hematopoietic disorders involving Peyer's patches of the small intestine or other hematopoietic cells and tissues in the body. Moreover, there is a potential role for this gene as a diagnostic marker or causative agent in the development of colon cancer, and cancer in general. Thus, the translation product corresponding to this gene shows to be a good target for agonists or antagonists (particularly antibodies) that block the binding of the receptor by its cognate ligand. Therefore, antibodies and / or small molecules that specifically bind to part of the translation product of this gene are preferred. Also provided is a kit for detecting testicular cancer. In one embodiment, such a kit comprises an antibody specific for the translation product of this gene bound to a solid support. Also provided is a method of detecting colon cancer in an individual, which method comprises contacting an antibody specific for the translation product of this gene with a body fluid (preferably serum) from the individual, and the antibody is in the body fluid. The step of confirming whether or not it binds to the antigen found in 1.
Preferably the antibody is bound to a solid support and the body fluid is serum. The above embodiments and other therapeutic and diagnostic tests (kits and methods) are described in more detail elsewhere herein.

Alternatively, the tissue distribution in neural tissue is such that polynucleotides, translation products and antibodies corresponding to this gene are associated with Alzheimer's disease, Parkinson's disease, Huntington's disease, Tourette's syndrome, schizophrenia, mania, dementia, paranoia, obsessive-compulsive disorder. And / or detection of neurodegenerative disease states and behavioral disorders such as sexual disorders, panic disorders, learning disorders, ALS, psychosis, autism, and behavioral changes (including impairment of nutritional support, sleep patterns, balance, and perception) Or suggests that it is useful for treatment. Moreover, genes or gene products may also play a role in the treatment and / or detection of developing embryos or developmental disorders associated with sexually-mediated disorders. In addition, translation products corresponding to this gene, and antibodies to these translation products, may show utility as tumor markers and / or immunotherapeutic targets for the tissues listed above. Characterization of Protein Encoded by Gene No: 6 The translation product of this gene shares sequence homology with numerous kinase proteins (see Genbank Accession No. CAB76471, or International Publication No. WO9418328).

The gene encoding the translation product of the present invention is a member of the TGF-β receptor family of proteins. Proteins belonging to this family contain a cytoplasmic serine / threonine kinase domain. To identify these kinase domains, the following consensus pattern was developed: [LIVMFYC] -x- [HY] -x-D- [LIVMFY] -Kx (2).
-N- [LIVMFYCT] (3). A preferred polypeptide of the invention comprises or consists of the following amino acid sequence: IIHRDVKPDNILL (SEQ ID NO: 29). Fragments and / or variants of these polypeptides (eg, the fragments and / or variants described herein are included in the invention. These polypeptides (including fragments and / or variants))
Also included in the invention are polynucleotides that encode, such as antibodies that bind to these polypeptides. A serine / threonine kinase domain of SEQ ID NO: 29, and at least 5, 10, 15, 20, of the amino acid sequence of SEQ ID NO: 19,
Further preferred are polypeptides comprising 25, 30, 50 or 75 additional consecutive amino acid residues. The additional contiguous amino acid residue may be N-terminal or C-terminal to the serine / threonine kinase domain. Alternatively, the additional contiguous amino acid residues can be both N-terminal and C-terminal to the serine / threonine kinase domain, where the total number of contiguous amino acid residues at the N- and C-termini is a certain number. be equivalent to.

A preferred polypeptide of the invention is the residue in SEQ ID NO: 19: Arg-91.
~ Asp-97, Asn-137 to Ser-143, Asn-174 to Cys-
180, Arg-194 to Leu-223, Arg-239 to Pro-252,
Trp-265-Asn-270, Gly-304 to Gly-315, Thr-
320-Gly-331, Thr-344-Cys-349, Gly-360
Trp-372, Pro-374 to Gly-380, and Arg-400 to A.
1,2,3,4,5,6,7 of the immunogenic epitopes designated as la-410
, 8, 9, 10, 11, 12, or all 12, or consist of. Fragments and / or variants of these polypeptides (eg, fragments and / or variants described herein) are included in the invention.
Polynucleotides encoding these polypeptides (including fragments and / or variants) are also included by the invention, as are antibodies to which these polypeptides bind.

This gene is expressed primarily in neural tissue (eg, adult and fetal brain tissue, and hypothalamic tissue), as well as monocytes.

Accordingly, the polynucleotides and polypeptides of the present invention are for differential identification of tissues or cell types present in a biological sample, as well as for diseases and / or disorders of the nervous and immune systems, and cancer. It is useful as a reagent for the diagnosis of diseases and conditions including, but not limited to. Similarly, polypeptides and antibodies to these polypeptides are useful in providing immunological probes for the differential identification of tissues or cell types. Significantly higher than standard gene expression levels (ie, expression levels in normal tissues or fluids from individuals without the disorder) for disorders of the tissues or cells, particularly nervous and immune systems, or Lower levels of expression of this gene may be associated with specific tissues or cell types (eg, nervous tissue, immune tissue, cancerous tissue and wound tissue) or body fluids (eg, lymph, Serum, plasma, urine, synovial fluid and spinal fluid), or another tissue or cell sample.

This tissue distribution in neural tissue is derived from the polynucleotide corresponding to this gene,
The translation products and antibodies are shown to be useful in diagnosing, detecting, and / or treating diseases and / or disorders of the nervous and immune systems. Polynucleotides and translation products corresponding to this gene may be involved in the inhibition of cell proliferation and thus be useful in the prevention and / or elimination of cell proliferation disorders (eg cancer).

This tissue distribution shows that the protein product of this clone shows that Alzheimer's disease, Parkinson's disease, Huntington's disease, Tourette's syndrome, schizophrenia, dementia, paranoia, obsessive-compulsive disorder, panic disorder, learning disorder, ALS, psychosis. , Autism, and suggest usefulness in the detection / treatment of neurodegenerative disease states and behavioral disorders such as behavioral changes, including impaired nutrition, sleep patterns, balance, and perception. Moreover, genes or gene products may also play a role in the treatment and / or detection of developing embryos or developmental disorders associated with sexually-mediated disorders.

Alternatively, the tissue distribution in monocytes is such that this gene product produces cytokines,
It may be involved in the regulation of antigen presentation, or other processes, which also treats cancer (
For example, by boosting the immune response). Since this gene is expressed in cells of hematopoietic origin, it may generally play a role in hematopoietic cell survival, proliferation, and / or differentiation, and is useful in the expansion of large numbers of stem cells and committed progenitor cells. Can be. further,
Translation products corresponding to this gene, and antibodies to these translation products, may show utility as tumor markers and / or immunotherapeutic targets for the tissues listed above. (Characteristics of Protein Encoded by Gene No. 7) The translation product of this gene is the human warts protein (International Publication No. WO99
15558)) and share sequence homology. This human warts protein is homologous to the Drosophila warts gene expression product and is believed to be involved in regulating epithelial cell proliferation and / or differentiation, and in suppressing tumorigenesis. Furthermore, the translation product of this gene shares sequence homology with the mouse m-lats2 protein (see International Publication No. WO9630402).
The mouse m-lats2 protein is a putative protein-serine / threonine-kinase (PSTK) that is thought to inhibit cell proliferation and play an important role throughout development.

The gene encoding the translation product of the present invention is a member of the TGF-β receptor family of proteins. Proteins belonging to this family contain a cytoplasmic serine / threonine kinase domain. To identify these kinase domains, the following consensus pattern was developed: [LIVMFYC] -x- [HY] -x-D- [LIVMFY] -Kx (2).
-N- [LIVMFYCT] (3). A preferred polypeptide of the invention comprises or consists of the following amino acid sequence: FIHRDIKPDNILI (SEQ ID NO: 30). Fragments and / or variants of these polypeptides (eg, the fragments and / or variants described herein are included in the invention. These polypeptides (including fragments and / or variants))
Also included in the invention are polynucleotides that encode, such as antibodies that bind to these polypeptides. A serine / threonine kinase domain of SEQ ID NO: 30, and at least 5, 10, 15, 20, of the amino acid sequence of SEQ ID NO: 20,
Further preferred are polypeptides comprising 25, 30, 50 or 75 additional consecutive amino acid residues. The additional contiguous amino acid residue may be N-terminal or C-terminal to the serine / threonine kinase domain. Alternatively, the additional contiguous amino acid residues can be both N-terminal and C-terminal to the serine / threonine kinase domain, where the total number of contiguous amino acid residues at the N- and C-termini is a certain number. be equivalent to.

A preferred polypeptide of the invention is the residue in SEQ ID NO: 20: His-76.
~ Gln-122, Ala-211 to Gly-219, Ser-236 to Ala
-243, Asp-259 to Ser-274, Leu-281 to Glu-290.
, Arg-300 to Gly-316, and 1,2,3,4,5,6,7,8,9,10 of immunogenic epitopes designated as Ser-320 to Ser-329.
, 11, 12, or all 12 or all. Fragments and / or variants of these polypeptides (eg, fragments and / or variants described herein) are included in the invention. Polynucleotides encoding these polypeptides (including fragments and / or variants) are also included by the invention, as are antibodies to which these polypeptides bind.

This gene is expressed primarily in 9-week old embryonic tissue and to a lesser extent in smooth muscle tissue.

Accordingly, the polynucleotides and polypeptides of the present invention are for differential identification of tissues or cell types present in a biological sample, as well as diseases and / or disorders of musculoskeletal and developmental tissues, and It is useful as a reagent for the diagnosis of diseases and conditions including, but not limited to cancer. Similarly, polypeptides and antibodies to these polypeptides are useful in providing immunological probes for the differential identification of tissues or cell types. Significantly higher or lower levels relative to standard gene expression levels (ie, expression levels in normal tissues or fluids from individuals without the disorder) with respect to the disorders of the tissues or cells, particularly the developmental system. Expression of this gene in specific tissues or cell types taken from individuals with such disorders (eg, developing tissue, cancerous tissue and wound tissue)
Or it can be routinely detected in body fluids such as lymph, serum, plasma, urine, synovial fluid and spinal fluid, or another tissue or cell sample.

The distribution of this tissue in smooth muscle and embryonic tissues, and the homology to the warts and m-lats proteins, indicates that the polynucleotides, translation products, and antibodies corresponding to this gene are associated with muscle and embryonic disorders, as well as cancer. Is useful for the diagnosis, detection and / or treatment of. The tissue distribution suggests that the protein product of this clone is useful in the diagnosis and treatment of cancer and other proliferative disorders.

Expression in embryonic tissues and other cell sources that are labeled by proliferating cells may cause this protein to play a role in the regulation of cell division, or to specific cell types (eg muscle tissue). Suggesting that it may play a role in the inhibition of the growth of the. This tissue distribution in smooth muscle tissue indicates that the protein product of this gene is associated with the condition and pathology of the cardiovascular system (eg, heart disease, restenosis, atherosclerosis, stroke, angina, thrombosis, and wound healing). , Show utility in diagnosis and treatment. In addition, the polynucleotide, translation product,
And antibodies may play a role in the proliferation, differentiation, and / or survival of hematopoietic cell lines. In such an event, this gene may be useful in the treatment of lymphoproliferative and in the maintenance and differentiation of various hematopoietic lineages derived from early hematopoietic stem cells and directed progenitor cells. Similarly, embryonic development also involves decisions regarding cell differentiation and / or apoptosis in patterning. Therefore,
This protein may be involved in apoptosis or tissue differentiation and is also useful in cancer therapy. In addition, translation products corresponding to this gene, and antibodies to these translation products, may show utility as tumor markers and / or immunotherapeutic targets for the tissues listed above.

(Characteristics of Protein Encoded by Gene No. 8) A preferred polypeptide of the present invention has the residues shown in sequence 21: Lys-15 to
Leu-21, Asp-27 to Met-40, Arg-43 to Asn-52, P
ro-55-Asp-89, Leu-105-Asp-124, Glu-138
-Asp-150, Thr-157-Asn-166, Arg-198-Gly
-208, Lys-216 to Glu-225, Ser-250 to Glu-258.
, Thr-266 to Gly-291, Lys-294 to Glu-299, Ile.
-329 to Cys-339, Asn-367 to Phe-373, Ser-410.
~ Val-416, Ile-420 to Leu-432, Thr-474 to Leu
-485, Thr-488 to Arg-493, Ser-506 to Lys-515.
, Ser-521 to Met-526, Ile-530 to Ala-535, Glu.
-553 to Leu-566, Leu-581 to Leu-586, Asp-647.
~ Lys-652, and 1,2,3,4,5,6,7,8,9,10,11,12 of the immunogenic epitopes designated as Glu-657 to Gly-665.
, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24
, 25 or all 25 or composed of such immunogenic epitopes. Fragments and / or variants of these polypeptides, such as the fragments and / or variants described herein, are included in the invention. Polynucleotides encoding these polypeptides (including fragments and / or variants) are also encompassed by the present invention, as are antibodies that bind these polypeptides.

This gene is expressed primarily in the infant brain, as well as in fetal and embryonic tissues.

Accordingly, the polynucleotides and polypeptides (including antibodies) of the present invention are used for the differential identification of tissues or cell types present in a biological sample, and as follows: diseases of the nervous system and developmental system. It is useful as a reagent for the diagnosis of diseases and conditions including but not limited to disorders and / or disorders. Similarly, the polypeptides and antibodies directed against these polypeptides are useful in providing immunological probes for differential identification of tissue or cell types. Significantly higher or lower than standard gene expression levels (ie, expression levels in normal tissues or body fluids from unaffected individuals) for many disorders of the tissues or cells, particularly nervous and developmental systems Levels of this gene are expressed in a specific tissue or cell type (eg, neural tissue, developmental tissue, cancerous tissue and wound tissue) or body fluid (eg, lymph, serum, etc.) taken from an individual having such a disorder. Plasma, urine, synovial fluid, and spinal fluid)
, Or in another tissue or sample from an individual without such a disorder, can be routinely detected.

Tissue distribution in infant brain tissue, as well as in fetal and embryonic tissues, indicates that polynucleotides, translation products and antibodies corresponding to this gene diagnose, detect and / or detect diseases and / or disorders of the nervous and developmental system. Shows utility in treatment. Polynucleotides and translation products corresponding to this gene may be involved in the inhibition of cell proliferation and thus be useful in the prevention and / or elimination of cell proliferative disorders (eg cancer).

Tissue distribution in the infant brain is characterized by the presence of polynucleotides, translation products and antibodies corresponding to this gene in neurodegenerative disease states and behavioral disorders (eg Alzheimer's disease, Parkinson's disease, Huntington's disease, Tourette's syndrome, schizophrenia). ,mania,
Useful for detection / treatment of dementia, paranoia, obsessive-compulsive disorder, panic disorder, learning disability, ALS, psychosis, autism, and behavioral changes (including impaired nutrition, sleep patterns, balance, and perception) Suggest that. Furthermore, the gene or gene product may also play a role in the treatment and / or detection of developmental or sex-related disorders associated with the developing embryo.

Alternatively, the tissue distribution in embryonic tissues suggests that this protein may play a role in the regulation of cell division. Embryonic development is involved in decisions involving cell differentiation and / or apoptosis in pattern formation. Thus the protein may also be involved in apoptosis or tissue differentiation and may also be useful in cancer therapy. The protein, as well as antibodies to this protein, may show utility as tumor markers and / or immunotherapeutic targets for the tissues listed above.

(Characteristics of Protein Encoded by Gene No. 9) The translation product corresponding to this gene is CDC2-related protein kinase 7 (Ge
nbank Accession AAF36401)). Based on this homology, these proteins are believed to share at least some biological activity.

A preferred polypeptide of the invention has the residues shown in sequence 22: Met-1 to G.
lu-13, Pro-34 to Thr-39, Ser-73 to Ser-82, Pr
o-89 to Lys-122, Ser-171 to Gln-178, Ala-192.
-Pro-204, Leu-256-Glu-280, Pro-290-Pro
-307, Pro-337 to Gly-343, Met-355 to Thr-375.
, Asp-381 to Gly-388, Glu-414 to Gly-422, Thr.
-464 to Glu-471, Gly-490 to Tyr-497, and Lys-.
1,2,3 of the immunogenic epitopes designated as 499-Val-517,
4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or all 15, or composed of such immunogenic epitopes. Fragments and / or variants of these polypeptides, such as the fragments and / or variants described herein, are included in the invention. Polynucleotides encoding these polypeptides (including fragments and / or variants) are also encompassed by the present invention, as are antibodies that bind these polypeptides.

This gene is expressed in testis tissue, neutrophils, T cells and smooth muscle tissue.

Accordingly, the polynucleotides and polypeptides (including antibodies) of the present invention are used for the differential identification of tissues or cell types present in a biological sample and as follows: reproductive system, immune system and heart. It is useful as a reagent for the diagnosis of diseases and conditions including, but not limited to, vascular diseases and / or disorders. Similarly, polynucleotides and antibodies to these polypeptides are useful in providing immunological probes for differential identification of tissue or cell types. Significantly higher than standard gene expression levels (ie, expression levels in normal tissues or fluids from unaffected individuals) with respect to many disorders of the tissues or cells, particularly the reproductive and cardiovascular systems, or Low levels of expression of this gene may result in specific tissue or cell types (eg, reproductive tissue, immune tissue, cardiovascular tissue, cancerous tissue and wound tissue) or body fluid (eg, reproductive tissue, immune tissue, cardiovascular tissue and wound tissue) taken from an individual having such a disorder. , Lymph, serum, plasma, urine, synovial fluid, and spinal fluid), or another tissue or sample from an individual without such disorders.

Tissue distribution in testis, smooth muscle, and immune system indicates that the polynucleotides, translation products and antibodies corresponding to this gene are used to diagnose, detect and / or diagnose reproductive, immune and cardiovascular diseases and / or disorders. Alternatively, it is indicated to be useful for treatment. Polynucleotides and translation products corresponding to this gene may be involved in the inhibition of cell proliferation and thus be useful in the prevention and / or elimination of cell proliferative disorders (eg cancer). Similarly, antibodies to translation products corresponding to this gene can inhibit cell growth.

Tissue distribution indicates that polynucleotides, translation products and antibodies corresponding to this gene are useful for the treatment and diagnosis of conditions related to proper testicular function (eg endocrine function, sperm maturation) and cancer. Thus, polynucleotides, translation products and antibodies corresponding to this gene are useful in treating male infertility and / or impotence. Polynucleotides, translation products and antibodies corresponding to this gene are also useful in assays designed to identify binding agents, as such agents (antagonists) are useful as male contraceptives. Similarly,
Polynucleotides, translation products and antibodies corresponding to this gene are considered useful in the treatment and / or diagnosis of testicular cancer. Testis is also the active site of gene expression for transcripts expressed at particularly low levels in other tissues of the body. Thus, this gene product is expressed in other specific tissues or organs, where it is expressed by other processes, such as hematopoiesis, to name a few potential targets.
Inflammation, bone formation, and renal function).

The tissue distribution in smooth muscle tissue is determined by the fact that the protein product of this gene is associated with cardiovascular conditions and pathological conditions (eg heart disease, restenosis, atherosclerosis, stroke, angina (angina), It is useful for diagnosis and treatment of thrombosis and wound healing). Expression of this gene product in T cells and neutrophils also strongly suggests a role for this protein in immune function and immune surveillance. further,
Translation products corresponding to this gene and antibodies to these translation products may show utility as tumor markers for the tissues listed above and / or as targets for immunotherapy.

(Characteristics of Protein Encoded by Gene No. 10) The gene encoding the translation product of the present invention is a member of the TGF-β receptor family of proteins. Proteins belonging to this family contain a cytoplasmic serine / threonine kinase domain. To identify these kinase domains, the following consensus pattern was developed: [LIVMFYC] -x- [HY] -x-D- [LIVMFY] -Kx (2).
-N- [LIVMFYCT] (3). A preferred polypeptide of the invention comprises or consists of the following amino acid sequence: LVHRDIKLNKNVLL (SEQ ID NO: 31). Fragments and / or variants of these polypeptides, such as fragments and / or variants as described herein, are also encompassed by the invention. Polynucleotides encoding these polypeptides (including fragments and / or variants) are also encompassed by the present invention, as are antibodies that bind these polypeptides. The serine / threonine kinase domain of SEQ ID NO: 31 and at least 5,10,15,20,25,30,50, or 75 of SEQ ID NO: 23
Further preferred are polypeptides comprising additional contiguous amino acid residues of The additional contiguous amino acid residue may be N-terminal or C-terminal to the serine / threonine kinase domain. Alternatively, the additional contiguous amino acid residues can be both N-terminal and C-terminal to the serine / threonine kinase domain, where the total number of N-terminal and C-terminal contiguous amino acid residues is equal to a certain number.

A preferred polypeptide of the invention has the residues shown in sequence 23: Gly-20 to
Includes 1, 2, 3, 4 or all 4 of the immunogenic epitopes designated as Ser-25, Val-62 to Arg-70, Trp-86 to Lys-92, and Leu-110 to Thr-126. Alternatively, it is composed of such immunogenic epitopes. Fragments and / or variants of these polypeptides, such as the fragments and / or variants described herein include:
Included in the present invention. Polynucleotides encoding these polypeptides (including fragments and / or variants) are also encompassed by the present invention, as are antibodies that bind these polypeptides.

This gene is expressed primarily in melanocytes and microvascular endothelial cells.

Accordingly, the polynucleotides and polypeptides (including antibodies) of the invention are used for the differential identification of tissues or cell types present in a biological sample and as follows: skin and skeletal muscle diseases and It is useful as a reagent for the diagnosis of diseases and conditions including but not limited to disorders. Similarly, the polypeptides and antibodies directed against these polypeptides are useful in providing immunological probes for differential identification of tissue or cell types. Significantly higher than standard gene expression levels (ie expression levels in normal tissues or body fluids from non-disordered individuals) for many disorders of the tissues or cells, particularly the cutaneous and musculoskeletal systems, or Low levels of expression of this gene may result in specific tissues or cell types (eg skin tissue, skeletal muscle tissue, cancerous tissue and wound tissue) or body fluids (eg lymph, (Serum, plasma, urine, synovial fluid, and spinal fluid), or another tissue or sample from an individual without such disorders, and can be routinely detected.

Tissue distribution in melanocytes and microvascular endothelial cells indicates that polynucleotides, translation products and antibodies corresponding to this gene are useful in the diagnosis, detection and / or treatment of skin and musculoskeletal diseases and / or disorders. Demonstrate usefulness.
Polynucleotides and translation products corresponding to this gene may be involved in the inhibition of cell proliferation and thus be useful in the prevention and / or elimination of cell proliferative disorders (eg cancer).

The tissue distribution in melanocytes was determined by the fact that the protein products of this clone were congenital disorders (ie nevus, pigmented nevus, freckles, Mongolian spots, hemangiomas, wine-like syndrome), integumental tumors (ie , Keratoses, Bowen's disease, basal cell carcinoma, squamous cell carcinoma, malignant melanoma, Paget's disease, mycosis fungoides, and Kaposi's sarcoma), skin damage and inflammation (ie wounds, rashes, erythema erythematosus disorders, psoriasis) , Dermatitis), atherosclerosis, urticaria, eczema, photophobia, autoimmune disorders (ie lupus erythematosus, vitiligo, dermatomyositis, localized scleroderma, scleroderma, pemphigoid,
And pemphigus), keloids, striatum, erythema, petechiae, purpura, and blepharoptosis, and is useful in the treatment, diagnosis and / or prevention of various skin disorders. In addition, such disorders include viral and bacterial infections of the skin (ie, herpes simplex, warts, chickenpox, molluscum contagiosum, herpes zoster, swelling, cellulitis,
It may predispose to increased susceptibility to erysipelas, impetigo, tinea, worms, and ringworm.

Alternatively, the tissue distribution in microvascular endothelial cells suggests that the protein product of this clone is useful in the diagnosis and / or treatment of disorders involving the vasculature. Elevated expression of this gene product by endothelial cells suggests that this gene product may play an important role in regulating endothelial cell function; secretion; proliferation; or angiogenesis. Alternatively, this may indicate that the gene product is expressed by endothelial cells and transported to distant sites of action on various target organs. In addition, translation products corresponding to this gene, and antibodies to these translation products, may show utility as tumor markers for the tissues listed above and _Hlk77335 and / or immunotherapeutic targets. _Hlk77335 (Characteristics of protein encoded by gene number 11) The translation product of this gene is a human transforming growth factor β-activating kinase T that is considered to be important in MAPK kinase activation by phosphorylation.
Shares sequence homology with AK-1 (Japanese Patent No. J09163990). The translation product of this gene also shares sequence homology with numerous protein kinases (
See Genbank accession number AAA32779).

A preferred polypeptide of the invention has the residues shown in sequence 24: Gln-27-
Gly-32, Asp-47 to Pro-54, Glu-77 to Ile-85, A
sp-100 to Leu-105, Gln-135 to Arg-145, Arg-1
53-Ile-158, Lys-170-Leu-180, Glu-191-G
ly-203, Thr-246 to Thr-253, Leu-294 to Asp-3
00, Thr-363-Ser-373, Gly-414-Ile-420, and 1,2,3,4,5,6,7,8 of the immunogenic epitopes designated as Lys-427-Leu-441. , 9, 10, 11, 12, 13, or all 13 or composed of such immunogenic epitopes. Fragments and / or variants of these polypeptides, such as the fragments and / or variants described herein, are included in the invention. Polynucleotides encoding these polypeptides (including fragments and / or variants) are also encompassed by the present invention, as are antibodies that bind these polypeptides.

This gene is expressed primarily in smooth muscle and microvascular endothelial cells, as well as in colon cancer tissues and T cell lymphomas.

Accordingly, the polynucleotides and polypeptides (including antibodies) of the invention are used for the differential identification of tissues or cell types present in a biological sample and as follows: gastrointestinal and cardiovascular It is useful as a reagent for the diagnosis of diseases and / or disorders, as well as diseases and conditions including but not limited to cancer. Similarly,
Polynucleotides and antibodies to these polypeptides are useful in providing immunological probes for differential identification of tissue or cell types. Significantly higher than standard gene expression levels (ie, expression levels in normal tissues or body fluids from unaffected individuals) for many disorders of the tissues or cells, particularly the gastrointestinal and cardiovascular systems, or Low levels of expression of this gene may result in specific tissue or cell types (eg colon tissue, musculoskeletal tissue, cancerous tissue and wound tissue) or body fluids (eg lymph, tissue, etc.) taken from an individual having such a disorder. (Serum, plasma, urine, synovial fluid, and spinal fluid), or another tissue or sample from an individual without such disorders, and can be routinely detected.

Tissue distribution in smooth muscle, microvascular endothelial cells, T-cell lymphoma, and colon cancer tissues, in combination with homology to TGF-β activated kinase and other kinase proteins, corresponds to this gene. Show that the polynucleotides, translation products and antibodies are useful in the diagnosis, detection and / or treatment of gastrointestinal and cardiovascular diseases and / or disorders, and cancerous tissues such as colon cancer and T-cell lymphoma. . Polynucleotides and translation products corresponding to this gene may be involved in the inhibition of cell proliferation and thus be useful in the prevention and / or elimination of cell proliferative disorders (eg cancer).

The tissue distribution in microvascular endothelial cells suggests that the protein product of this clone is useful in the diagnosis and / or treatment of disorders involving the vasculature. Expression of this gene product by endothelial cells suggests that it may play an important role in the regulation of endothelial cell function; secretion; proliferation; or angiogenesis. This tissue distribution in smooth muscle tissue indicates that the protein product of this gene is useful for diagnosing and / or treating cardiovascular conditions and pathologies (eg, heart disease, restenosis, stroke, angina, thrombus, and wound healing). Is shown.

Furthermore, the tissue distribution in colon cancer tissues and T-cell lymphomas shows that the polynucleotides, translation products and antibodies corresponding to this gene are associated with cancers of colon cancer and T-cell lymphomas and other tissues where expression is observed. Suggests that it is useful for detection and / or treatment. The tissue distribution in colon cancer tissues also indicates that this gene is a good target for agonists or antagonists, especially antibodies, which block the binding of the receptor by its cognate ligand. Therefore, antibodies and / or small molecules that specifically bind to part of the translation product of this gene are preferred. Also provided is a kit for detecting colon cancer and / or T cell lymphoma. Such a kit, in one embodiment, comprises an antibody specific for the translation product of this gene bound to a solid support. Also provided are methods of detecting colon cancer or T cell lymphoma in an individual. This method involves contacting an antibody specific for the translation product of this gene with a body fluid (preferably serum) derived from this individual, and confirming whether the antibody binds to the antigen found in this body fluid. Including the step of Preferably the antibody is bound to a solid support and the body fluid is serum. The above embodiment,
And other treatments and diagnostic tests (kits and methods) are described in more detail elsewhere herein. Furthermore, translation products corresponding to this gene and antibodies to these translation products may show utility as tumor markers for the tissues listed above and / or targets for immunotherapy.

CHARACTERISTICS OF PROTEIN ENCODED BY GENE NO: 12 Preferred polypeptides of the present invention include the residues shown in sequence 25: Ile-6 to
It comprises, or consists of, one, two or both of the immunogenic epitopes designated as Ser-28 and Phe-69 to Phe-77. Fragments and / or variants of these polypeptides (
For example, fragments and / or variants described herein) are encompassed by the present invention. Polynucleotides encoding these polypeptides (including fragments and / or variants) are also encompassed by the present invention, as are antibodies that bind these polypeptides.

[0113]   This gene is expressed in liver cancer tissue.

Accordingly, the polynucleotides and polypeptides (including antibodies) of the present invention are for differential identification of tissues or cell types present in a biological sample and as follows: including liver cancer and cancer. It is useful as a reagent for diagnosis of diseases and conditions that are not limited thereto. Similarly, the polypeptides and antibodies directed against these polypeptides are useful in providing immunological probes for differential identification of tissue or cell types. Significantly higher or lower levels of this gene relative to standard gene expression levels (ie expression levels in normal tissues or body fluids from unaffected individuals) for many disorders of the tissues or cells, especially the liver. Expression of a specific tissue or cell type (eg, liver tissue, cancerous tissue and wound tissue) or body fluid (eg, lymph, serum, plasma, urine, synovial fluid, etc.) collected from an individual having such disorders. And cerebrospinal fluid), or in another tissue or sample from an individual without such a disorder.

Tissue distribution in liver cancer tissue indicates that the polynucleotides, translation products and antibodies corresponding to this gene are useful for diagnosing, detecting and / or treating cancer of liver cancer tissue and other tissues where expression is observed. Is shown. Polynucleotides and translation products corresponding to this gene may be involved in the inhibition of cell proliferation and thus be useful in the prevention and / or elimination of cell proliferative disorders (eg cancer).

Tissue distribution in liver cancer tissue indicates that this gene blocks the binding of receptors by agonists or antagonists, especially antibodies (its cognate ligands).
Is a good target for. Therefore, antibodies and / or small molecules that specifically bind to part of the translation product of this gene are preferred. Also provided is a kit for detecting liver cancer. Such a kit, in one embodiment, comprises an antibody specific for the translation product of this gene bound to a solid support. Also provided is a method of detecting liver cancer in an individual. This method involves contacting an antibody specific for the translation product of this gene with a body fluid (preferably serum) derived from this individual, and determining whether the antibody binds to an antigen found in this body fluid. Including the step of confirming. Preferably the antibody is bound to a solid support and the body fluid is serum. The above embodiments, as well as other treatments and diagnostic tests (kits and methods) are described in more detail elsewhere herein.

[0117]

[Table 1] Table 1 summarizes the information corresponding to each "gene number" above. The nucleotide sequence identified as "nucleotide SEQ ID NO: X" is obtained from the "cDNA clone ID" identified in Table 1 and, in some cases, from additional related DNA clones. "Overlapping") sequences. Overlapping sequences are assembled into a single highly contiguous contiguous sequence (usually 3-5 overlapping sequences at each nucleotide site) and SEQ ID NO:
(SEQ ID NO): The final sequence identified as X was obtained.

The cDNA clone ID was deposited on that date and is labeled "ATCC Deposit No. Z.
And the corresponding accession numbers listed under "Dates". Some of the deposits contain multiple different clones corresponding to the same gene. "Vector" refers to the type of vector contained in the cDNA clone ID.

“Total nucleotide sequence” refers to the total number of nucleotides in the contig identified by the “gene number”. The deposited plasmid contains all of these sequences, which are reflected by the nucleotide positions shown as "5 'nucleotides of the clone sequence" and "3' nucleotides of the clone sequence" in SEQ ID NO: X. . S of the putative methionine start codon (if present)
The nucleotide position of EQ ID NO: X is identified as the "5 'nucleotide of the start codon". Similarly, the SEQ of the putative signal sequence (if present)
The nucleotide position of ID NO: X is identified as the "5 'nucleotide of the first amino acid of the signal peptide".

The translated amino acid sequence begins at the first translation codon of the polynucleotide sequence and is identified as "amino acid SEQ ID NO: Y", although other reading frames have also been identified using known molecular biology techniques. Can be easily translated using. The polypeptides produced by these alternative open reading frames are specifically contemplated by the present invention.

SEQ ID NO: X (where X can be any of the polynucleotide sequences disclosed in the Sequence Listing) and translated SEQ ID NO: Y (where Y is the polynucleotide disclosed in the Sequence Listing). (Which can be any of the peptide sequences) is sufficiently accurate and otherwise suitable for a variety of uses well known in the art and described further below. For example, SEQ ID NO: X has uses including, but not limited to, in designing nucleic acid hybridization probes that detect the nucleic acid sequence contained in SEQ ID NO: X or the cDNA contained in the deposited plasmid. These probes also hybridize to nucleic acid molecules in biological samples, thereby enabling the various forensic and diagnostic methods of the invention. Similarly, the polypeptide identified from SEQ ID NO: Y includes uses including but not limited to producing antibodies that specifically bind to secreted proteins encoded by the cDNA clones identified in Table 1. Have.

Nevertheless, the DNA sequences produced by the sequencing reaction may contain sequencing errors. Errors are present as misidentified nucleotides or as insertions or deletions of nucleotides in the resulting DNA sequence. Incorrectly inserted or deleted nucleotides cause a frameshift in the reading frame of the deduced amino acid sequence. Although in these cases the resulting DNA sequence may be more than 99.9% identical (eg, a single base insertion or deletion in an open reading frame of more than 1000 bases) to the actual DNA sequence. , The deduced amino acid sequence differs from the actual amino acid sequence.

Therefore, for those applications requiring accuracy in the nucleotide or amino acid sequence, the present invention provides a generated nucleotide sequence identified as SEQ ID NO: X and a putative nucleotide sequence identified as SEQ ID NO: Y. Also provided is a sample of plasmid DNA containing the human cDNA of the invention deposited at the ATCC, as described in Table 1, as well as the translated amino acid sequence of The nucleotide sequence of each deposited plasmid can be readily determined by sequencing the deposited plasmid according to known methods.

The deduced amino acid sequence can then be verified from such deposit. further,
The amino acid sequence of the protein encoded by the particular plasmid may also be expressed by peptide sequencing or in a suitable host cell containing the deposited human cDNA, the protein may be harvested and sequenced. By that, it can be determined directly.

The name of the vector containing the cDNA plasmid is also provided in Table 1. Each vector is conventionally used in the art. The following additional information is provided for your convenience.

Vectors Lambda Zap (US Pat. Nos. 5,128,256 and 5,286,636), Uni-Zap XR (US Pat. No. 5,128,25).
6 and 5,286,636) and Zap Express (US Pat. Nos. 5,128,256 and 5,286,636) pBluescript.
t (pBS) (Short, JM, et al., Nucleic Acids Res).
． 16: 7583-7600 (1988); Alting-Mees, M .; A
． And Short, J. et al. M. , Nucleic Acids Res. 17
: 9494 (1989)) and pBK (Alting-Mees, MA).
Et al., Strategies 5: 58-61 (1992)) by Stratag.
ene Cloning Systems, Inc. , 11011 N.I. Tor
commercially available from rey Pines Road, La Jolla, CA, 92037. pBS contains the ampicillin resistance gene and pBK contains the neomycin resistance gene. Phagemid pBS is based on λZap vector and Un
can be excised from the i-Zap XR vector, and the phagemid pBK
It can be excised from the ap expression vector. Both phagemids were transformed into E. coli strain XL-1 Blue (also available from Stratagene)
Can be transformed into.

Vectors pSport1, pCMVSport 1.0, pCMVSport
2.0 and pCMVSport3.0 are based on Life Technology
es, Inc. , P .; O. Box 6009, Gaithersburg, MD
Obtained from 20897. All Sport vectors contain the ampicillin resistance gene, and E. coli. E. coli strain DH10B (again, Life Tech
(available from Nologies). For example, Grub
er, C.I. E. See Focus 15:59 (1993). Vector lafmid BA (Bento Soares, Columbia Uni
Versity, New York, NY) contains the ampicillin resistance gene, and E. E. coli strain XL-1 Blue. Vector pC
R (R) 2.1 (this is Invitrogen, 1600 Farada)
y Avenue, Carlsbad, CA 92008).
Contains the ampicillin resistance gene, and E. E. coli strain DH10B (Lif
e Technologies) (available from e-Technologies). For example, Clark, J .; M. , Nuc. Acids Res. 16: 9677-9
686 (1988) and Mead, D .; Et al, Bio / Technology
9: (1991).

The invention also relates to the gene corresponding to SEQ ID NO: X, SEQ ID NO: Y, and / or the deposited plasmid (cDNA plasmid: Z). This corresponding gene can be isolated according to known methods using the sequence information disclosed herein. Such methods include, but are not limited to, preparing probes or primers from the disclosed sequences, and identifying or amplifying the corresponding gene from a suitable source of genomic material.

Also provided in the present invention are allelic variants, orthologs (or
and / or species homologues. Procedures known in the art correspond to SEQ ID NO: X, SEQ ID NO: Y, and / or cDNA plasmid: Z using the sequences disclosed herein or information from the ATCC deposited clones. It can be used to obtain full length genes, allelic variants, splice variants, full length coding portions, orthologs, and / or species homologs of a gene. For example, allelic variants and / or species homologs make suitable probes or primers from the sequences provided herein, and a suitable nucleic acid supply for the allelic variant and / or the desired homologue. It can be isolated and identified by screening the source.

The invention provides a polynucleotide comprising, or alternatively consisting of, the nucleic acid sequence of SEQ ID NO: X and / or the cDNA plasmid: Z. The invention also includes a polypeptide sequence of SEQ ID NO: Y, a polypeptide encoded by SEQ ID NO: X, and / or a polypeptide encoded by the cDNA in cDNA plasmid Z, or alternatively consisting of them. Provide a peptide. A polypeptide sequence comprising the polypeptide sequence of SEQ ID NO: Y, the polypeptide encoded by SEQ ID NO: X, and / or the polypeptide encoded by the cDNA in cDNA plasmid Z, or alternatively consisting of them. Nucleotides are also encompassed by the present invention. The invention further includes polynucleotides that include, or alternatively consist of, the complement of the nucleic acid sequence of SEQ ID NO: X, and / or the complement of the coding strand of the cDNA in cDNA plasmid Z.

Many polynucleotide sequences (eg, EST sequences) are publicly available and accessible through sequence databases, and may have been publicly available prior to the concept of the invention. Preferably, such related polynucleotides are specifically excluded from the scope of the invention. Listing all relevant sequences is too cumbersome for the disclosure of this application. Accordingly, preferably SEQ ID NO: X is a nucleotide sequence described by the general formula ab, where a is any integer between 1 of SEQ ID NO: X and the final nucleotide-15 of SEQ ID NO: X. , B is 15
Is an integer of the last nucleotide of SEQ ID NO: X, where both a and b correspond to the position of the nucleotide residue shown in SEQ ID NO: X, and where b is a + 14.
One or more polynucleotides including) are excluded.

RACE Protocol for Recovery of Full Length Genes Partial cDNA clones are described in Frohman, M .; A et al., Proc. Nat '
l. Acad. Sci. USA, 85: 8998-9002 (1988), and the full length can be generated by utilizing the rapid amplification of cDNA ends (RACE) procedure. CDNA clones with deletions at either the 5'or 3'end can be reconstructed to contain deleted base pairs extending to the start or stop codon of translation, respectively. In some cases, the cDNA is therefore deleted at the start of translation. Below is a brief description of modifications of this original 5'RACE procedure. Polyscript A or total RNA was labeled with Superscript II (Gibc
o / BRL) and cDNA sequences and reverse transcribed with antisense or complementary primers. The primer was applied to Microcon Co
Remove from reaction using ncentrator (Amicon). The first strand cDNA is then ligated using dATP and terminal deoxynucleotide transferase (Gibco / BRL). Thus, an anchor sequence is produced, which is necessary for PCR amplification. The second strand is a PC containing dA-tail.
R buffer, Taq DNA polymerase (Perkin-Elmer Cetus
) Synthesized from oligo dT primers containing three flanking restriction sites (XhoI, SalI and ClaI) at the 5 ′ end and primers containing these restriction sites appropriately. This double-stranded cDNA is used as the same primer and nested cDNA
PCR-amplify for 40 cycles with specific antisense primers. This P
The CR product is size separated on an ethidium bromide agarose gel and the region of the gel containing the cDNA product of the estimated size of the missing protein-encoding DNA is removed. The cDNA was transferred to the Magic PCR Prep kit (Prom
aga), purified from an agarose gel, restriction digested with XhoI or SalI, and plasmid (eg pBluescript SKII (
Stratagene)) at the XhoI and EcoRV sites. The DNA was transformed into bacteria and the plasmid clone was sequenced,
Identify the correct protein-encoding insert. The correct 5'end is confirmed by comparing this sequence with the putatively identified homolog with the overlap with the partial cDNA clone. Amplify and recover the 3'end using similar methods and / or commercially available kits known in the art.

Several quality control kits are commercially available for purchase. Reagents and methods similar to those described above are supplied in kit form from Gibco / BRL for both 5'RACE and 3'RACE for recovery of full length genes. The second kit is available from Clontech. This kit is D
umas et al., Nucleic Acids Res. , 19: 5227-32 (
1991), a modification of related technology (SLIC (single-stranded ligation to single-stranded cDNA)). The main difference in the procedure is that the RNA is alkaline hydrolyzed after reverse transcription and RNA ligase is used to ligate an anchor primer containing a restriction site to the first strand cDNA. This eliminates the need for dA tailing reactions that result in poly T elongation that has been difficult to sequence in the past.

An alternative to producing 5'cDNA or 3'cDNA from RNA is to use a cDNA library double-stranded DNA. Asymmetric PCR amplified antisense cDNA strands are synthesized using antisense cDNA specific primers and plasmid anchor primers. Remove these primers and
CR reactions are performed with nested cDNA-specific antisense primers and plasmid anchor primers.

(RN for producing a 5'-terminal sequence or a 3'-terminal sequence and obtaining a full-length gene
A Ligase Protocol) Once the gene of interest has been identified, several methods are available for the identification of the 5'or 3'parts of the gene which may not be present in the original cDNA plasmid. Become. These methods include, but are not limited to, filter probe probing, clonal enrichment using specific probes, and 5 '.
Similar and identical protocol to RACE and 3'RACE. The full-length gene is
While it may be present in the library and identified by searching, a useful method for producing the 5'or 3'end is to generate missing information from the original cDNA. The use of existing sequence information. 5'RA
A method similar to CE is available to generate the missing 5'end of the desired full-length gene (this method is described in Frommont-Racine et al., Nucle.
ic Acids Res. , 21 (7): 1683-1684 (1993)). Briefly, a particular RNA oligonucleotide is ligated to the 5'end of a population of RNAs that probably contains full-length gene RNA transcripts, and primers specific for the ligated RNA oligonucleotide and the known sequence of the gene of interest. A 5'portion of the desired full-length gene is PCR amplified using a primer set containing primers specific for. The amplified product can then be sequenced,
This can then be used to generate a full length gene. The method starts with total RNA isolated from the desired source and poly-A RNA can be used, although this is not a requirement of the procedure. The RNA preparation is then treated with phosphatase, if necessary, to remove 5 of degraded or damaged RNA that can interfere with subsequent RNA ligase steps.
'The phosphate group can be eliminated. The phosphatase, if used, is then treated with tobacco acid pyrophosphatase to inactivate the phosphatase and to remove the cap structure present at the 5'end of the messenger RNA. This reaction is
A 5'phosphate group is then left at the 5'end of the capped RNA that can then be ligated to the RNA oligonucleotide using T4 RNA ligase. Then, this modified R
The NA preparation can be used as a template for first-strand cDNA synthesis using gene-specific oligonucleotides. The first strand synthesis reaction is then treated with primers specific for the ligated RNA oligonucleotide and the desired TGF-β.
It can be used as a template for PCR amplification of the desired 5'end using primers specific for the known sequence of the receptor gene. The resulting product is then sequenced and analyzed to confirm that the 5'terminal sequence belongs to the relevant TGF-β receptor gene.

Polynucleotide and Polypeptide Fragments The present invention also relates to polynucleotide fragments of the polynucleotides (nucleic acids) of the present invention. In the present invention, the "polynucleotide fragment" means
A polynucleotide having the following nucleic acid sequence: part of the cDNA contained in cDNA plasmid Z, or the cDNA contained in cDNA plasmid Z
A portion of a cDNA encoding a polypeptide encoded by: a portion of the polynucleotide sequence in SEQ ID NO: X or its complement; a polynucleotide sequence encoding a portion of the polypeptide of SEQ ID NO: Y; A polynucleotide sequence that encodes a portion of an encoded polypeptide. The nucleotide fragments of the present invention are preferably at least about 15 nt, and more preferably at least about 20 nt, even more preferably at least about 30 nt, and even more preferably at least about 40 nt, at least about 50 nt, at least about 75 nt, at least about 100 nt. , At least about 125 nt, or at least about 150 nt in length. For example, a fragment of “at least about 20 nt in length” is intended to include, for example, 20 or more contiguous bases derived from the sequence contained in the cDNA of cDNA plasmid Z or the nucleotide sequence shown in SEQ ID NO: X or its complementary strand. It In this context “about” includes the specifically stated value or values that are greater or lesser by a few (5, 4, 3, 2, or 1) nucleotides. These nucleotide fragments have uses, including but not limited to, use as diagnostic probes and primers, as discussed herein. Of course, larger fragments (eg at least 150, 175, 200, 250, 500, 600
, 1000 or 2000 nucleotides in length) are also included in the invention.

Furthermore, typical examples of the polynucleotide fragment of the present invention include, for example,
Fragments containing or consisting of the following SEQ ID NO: X, or a sequence of approximately the number of nucleotides of its complementary strand, or consisting of: 1-50, 51-100
101-150, 151-200, 201-250, 251-300, 301
~ 350, 351-400, 401-450, 451-500, 501-550
, 551-600, 651-700, 701-750, 751-800, 800
~ 850, 851-900, 901-950, 951-1000, 1001-1
050, 1051 to 1100, 1101 to 1150, 1151 to 1200, 12
01-1250, 1251-1300, 1301-1350, 1351-140
0, 1401 to 1450, 1451 to 1500, 1501 to 1550, 1551
~ 1600, 1601-1650, 1651-1700, 1701-1750,
1751 to 1800, 1801 to 1850, 1851 to 1900, 1901-1
950, 1951-2000, 2001-2050, 2051-2100, 21
01-2150, 2151-2200, 2201-2250, 2251-230
0, 2301-2350, 2351-2400, 2401-2450, 2451
~ 2500, 2501 to 2550, 2551 to 2600, 2601 to 2650,
2651 to 2700, 2701 to 2750, 2751 to 2800, 2801 to 2
850, 2851-2900, 2901-2950, 2951-3000, 30
01-3050, 3051-3100, 3101-3150, 3151-320
0, 3201 to 3250, 3251 to 3300, 3301 to 3350, 3351
~ 3400, 3401 to 3450, 3451 to 3500, 3501 to 3550,
3551-3600, 3601-3650, 3651-3700, 3701-3
750, 3751 to 3800, 3801 to 3850, 3851 to 3900, 39
01-3950, 3951-4000, 4001-4050 and / or 40
51-4087. In this context, "approximately" shall mean a few (5,
It includes a range that is larger or smaller by 3, 2, or 1) nucleotides.
Preferably, these fragments encode a polypeptide having the functional activity (eg, biological activity) of the polypeptide encoded by the polynucleotide of which the sequence is a part. More preferably, these fragments can be used as probes or primers as discussed herein. Also included in the invention are polynucleotides that hybridize to one or more of these fragments under stringent hybridization conditions or under lower stringency conditions, as well as the polypeptides or fragments encoded by these polynucleotides. include.

Furthermore, as typical examples of the polynucleotide fragment of the present invention, for example,
The cDNA nucleotide sequence contained in the cDNA plasmid Z, or a sequence containing the following approximate number of nucleotides of its complementary strand, or a fragment consisting of the following is mentioned: 1-50, 51-100, 101-150, 151- Two
00, 201-250, 251-300, 301-350, 351-400, 4
01-450, 451-500, 501-550, 551-600, 651-7
00, 701-750, 751-800, 800-850, 851-900, 9
01-950, 951-1000, 1001-1050, 1051-1100,
1101-1150, 1151-1200, 1201-1250, 1251-1
300, 1301-1350, 1351-1400, 1401-1450, 14
51 to 1500, 1501 to 1550, 1551 to 1600, 1601 to 165
0, 1651 to 1700, 1701 to 1750, 1751 to 1800, 1801
~ 1850, 1851 to 1900, 1901 to 1950, 1951 to 2000,
2001-2050, 2051-2100, 2101-2150, 2151-2
200, 2201-2250, 2251-2300, 2301-2350, 23
51-2400, 2401-2450, 2451-2500, 2501-255
0, 2551-2600, 2601-2650, 2651-2700, 2701
~ 2750, 2752 to 2800, 2801 to 2850, 2851 to 2900,
2901-2950, 2951-3000, 3001-3050, 3051-3
100, 3101 to 3150, 3151 to 3200, 3201 to 3250, 32
51-3300, 3301-3350, 3351-3400, 3401-345
0, 3451 to 3500, 3501 to 3550, 3551 to 3600, 3601
~ 3650, 3651 to 3700, 3701 to 3750, 3751 to 3800,
3801-3850, 3851-3900, 3901-3950, 3951-4
000, 4001-4050 and / or 4051-4087. In this context, "approximately" is a few (5, 4, 3, 2, or 1) nucleotides greater than this, particularly in the stated range, or at either or both termini. , Or including a small range. Preferably, these fragments encode a polypeptide having the functional activity (eg, biological activity) of the polypeptide encoded by the cDNA nucleotide sequence contained in cDNA plasmid Z. More preferably, these fragments can be used as probes or primers, as discussed herein. Also included in the invention are polynucleotides that hybridize to one or more of these fragments under stringent hybridization conditions or under lower stringency conditions, and the polypeptides encoded by these polynucleotides or fragments are also included. ,included.

In the present invention, the “polypeptide fragment” means a part of the amino acid sequence contained in SEQ ID NO: Y, a part of the amino acid sequence encoded by the polynucleotide sequence of SEQ ID NO: X, and / or the cDNA plasmid Z. Refers to an amino acid sequence which is a part of the amino acid sequence encoded by the cDNA contained therein. A protein (polypeptide) fragment may be "free-standing," or a larger polypeptide, which fragment forms a portion or region, most preferably as a single continuous region. )). As a typical example of the polypeptide fragment of the present invention, for example, a fragment containing the amino acid sequence of the following approximate amino acid numbers in the coding region of SEQ ID NO: Y below or consisting of the amino acid sequence of the following approximate amino acid numbers Examples include: 1-20, 21-40, 41-60, 61-80, 81-100.
, 102-120, 121-140, 141-160, 161-180, 181
~ 200, 201-220, 221-240, 241-260, 261-280
, 281-300, 301-320, 321-340, 341-360, 361
~ 380, 381-400, 401-420, 421-440, 441-460
, 461-480, 481-500, 501-520, 521-540, 541
~ 560, 561 to 580, 581 to 600, 601 to 620, 621 to 640
, 641 to 660, 661 to 680, 681 to 700, 701 to 720, 721
-740, 741-760, 761-780, and / or 781-800.
Further, the polypeptide fragments of the present invention are at least about 10,15,20.
, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80
, 85, 90, 100, 110, 120, 130, 140, or 150 amino acids in length. In this context, "about" means the range or value specifically recited, or a few (5, 4, 3, 2, or 1) more amino acids at either or both termini. Contains a range or value that is only greater or less than. Polynucleotides encoding these polypeptide fragments are also included in the invention.

Although deletion of one or more amino acids from the N-terminus of a protein results in modification of the loss of one or more biological functions of the protein, it may have other functional activities (eg, biological activity). , The ability to multimerize, the ability to bind ligand) can still be retained. For example, the ability of a truncated mutein to induce and / or bind to an antibody that recognizes the intact or mature form of the polypeptide is less than that of the intact polypeptide or the majority of the mature polypeptide. If the group is removed from the N-terminus, it will generally be retained. Whether a particular polypeptide lacking the N-terminal residue of the complete polypeptide retains such immunological activity is determined by conventional methods described herein, and known in the art. Can be easily determined by another method. Muteins with multiple deleted N-terminal amino acid residues are:
It seems possible to retain some biological or immunogenic activity. actually,
Peptides consisting of as few as 6 amino acid residues can often elicit an immune response.

Thus, polypeptide fragments of the present invention include secreted proteins as well as mature forms. Further preferred polypeptide fragments include
Included are secreted proteins that have a contiguous series of deleted residues from the amino or carboxy terminus, or both, or mature forms. For example, any number of amino acids (range 1-60) can be deleted from the amino terminus of either the secreted polypeptide or the mature form. Similarly, any number of amino acids (1-30
Can be deleted from the carboxy terminus of the secreted protein or mature form. Furthermore, any combination of the above amino-terminal and carboxy-terminal deletions is preferred. Similarly, polynucleotides encoding these polypeptide fragments are also preferred.

The present invention provides a polypeptide disclosed herein (eg, a polypeptide of SEQ ID NO: Y, a polypeptide encoded by a polynucleotide sequence contained in SEQ ID NO: X, and / or a cDNA plasmid Z). Further provided is a polypeptide having one or more residues deleted from the amino terminus of the amino acid sequence of the polypeptide encoded by the included cDNA). In particular, the deletion at the N-terminus is represented by the general formula mq
Can be described by q is a polypeptide of the invention (eg, SEQ ID NO: Y
Is a whole integer representing the total number of amino acid residues in the polypeptide disclosed in
Then, m is defined as an arbitrary integer in the range of 2 to q-6. Polynucleotides encoding these polypeptides, including fragments and / or variants, are also included in the invention.

Furthermore, as mentioned above, even if the deletion of one or more amino acids from the C-terminus of the protein results in modification of the loss of one or more biological functions of the protein,
Other functional activities (eg, biological activity, ability to multimerize, ability to bind ligand) may still be retained. For example, the ability of a truncated mutein to induce and / or bind to an antibody that recognizes the intact or mature form of a polypeptide is less than that of the intact polypeptide or the majority of the mature polypeptide. Is generally retained when removed from the C-terminus. Whether a particular polypeptide lacking the C-terminal residue of the complete polypeptide retains such immunogenic activity is determined by conventional methods described herein and otherwise. It can be readily determined by other methods known in the art. Muteins with multiple deleted C-terminal amino acid residues are likely to retain some biological or immunogenic activity. In fact, peptides consisting of as few as 6 amino acid residues can often elicit an immune response.

Accordingly, the invention provides a polypeptide disclosed herein (eg, a polypeptide of SEQ ID NO: Y, a polypeptide encoded by a polynucleotide sequence contained in SEQ ID NO: X, and / or a cDNA plasmid). Further provided is a polypeptide having one or more residues deleted from the carboxy terminus of the amino acid sequence of the polypeptide encoded by the cDNA contained in Z). In particular, a C-terminal deletion can be described by the general formula 1-n, where n is any whole integer in the range 6 to q-1, and n is a polypeptide of the invention. Corresponds to the position of the amino acid residue in. Polynucleotides encoding these polypeptides are also
Included by the present invention.

In addition, any of the N-terminal or C-terminal deletions described above may be combined to produce N-terminal and C-terminal deleted polypeptides. The invention also provides polypeptides having one or more deleted amino acids from both the amino and carboxy termini. The polypeptide is generally SEQ ID NO: X (including, but not limited to, preferably the polypeptide disclosed as SEQ ID NO: Y) and / or the cDNA in a cDNA plasmid Z, and / or their The polypeptide encoded by the complementary strand may be described as having residues m-n, where n and m are integers as described above. Polynucleotides encoding these polypeptides are also included in the invention.

[0146] Any polypeptide sequence contained in the polypeptide of SEQ ID NO: Y, any polypeptide sequence encoded by the polynucleotide sequence set forth as SEQ ID NO: X, or encoded by the cDNA in cDNA plasmid Z. Any polypeptide sequence can be analyzed to determine particular preferred regions of that polypeptide. For example, the cDNA in SEQ ID NO: X or cDNA plasmid Z
The amino acid sequence of the polypeptide encoded by the polynucleotide sequence of
DNASTAR Computer Algorithm (DNASTAR, Inc., 122
8 S. Park St. , Madison, WI 53715 USA; ht
tp: // www. dnastar. com /) default parameters.

Regions of the polypeptide that may be routinely obtained using the DNASTAR computer algorithm include, but are not limited to: Ga
α-region, β-region, turn region and coil region of rnier-Robson, α-region, β-region and turn region of Chou-Fasman, Kyt
Hydrophilic and hydrophobic regions of e-Doolittle, α-amphipathic and β-amphipathic regions of Eisenberg, flexible regions of Karplus-Schulz, surface-forming regions of Emini and Jameson with high antigenicity index.
-Wolf area. In this regard, some of the highly preferred polynucleotides of the invention include some structural features (eg, some of the features described above (eg, 1, 2, 3).
Alternatively, there is a polynucleotide encoding a polypeptide containing the region combined with 4)).

Furthermore, Kyte-Doolittle hydrophilic and hydrophobic regions, Emi
ni surface formation region, and Jameson-Wolf region (
That is, containing 4 or more consecutive amino acids with an antigenicity index greater than or equal to 1.5, as identified using the default parameters of the Jameson-Wolf program) It is routinely used to determine regions of a polypeptide that exhibit a high degree of potential for sex. Areas of high antigenicity are determined by DNASTAR analysis by selecting values that represent areas of the polypeptide that appear to be exposed on the surface of the polypeptide in the environment where antigen recognition may occur during the initiation process of the immune response. Determined from the data.

Preferred polypeptide fragments of the invention are those fragments which comprise or alternatively consist of an amino acid sequence which exhibits a functional activity (eg biological activity) of a polypeptide sequence whose amino acid sequence is a fragment. Is. "
A polypeptide exhibiting "functional activity" refers to one or more known functional activities associated with a full-length protein (eg, biological activity, antigenicity, immunogenicity, and / or multimer as described above). ), Etc.).

Other preferred polypeptide fragments are biologically active fragments. Biologically active fragments are fragments that show similar, but not identical, activity to a polypeptide of the invention. The biological activity of this fragment may include an improved desired activity, or a decreased undesirable activity.

In a preferred embodiment, the polypeptide of the invention comprises, or alternatively consists of, 1, 2, 3, 4, 5 or more antigenic fragments of the polypeptide of SEQ ID NO: Y, or portions thereof. . Polynucleotides encoding these polypeptides are also included in the invention.

The invention comprises a polypeptide which comprises, or alternatively consists of, the following polypeptides: an epitope of the polypeptide sequence set forth in SEQ ID NO: Y, or c
An epitope of the polypeptide sequence encoded by the cDNA in DNA plasmid Z, or the epitope coding sequence of SEQ ID NO: X under stringent or lower stringency hybridization conditions, as defined above. Alternatively, an epitope of a polypeptide sequence encoded by a polynucleotide that hybridizes to a complementary strand of the epitope coding sequence contained in cDNA plasmid Z. The present invention further provides a polynucleotide sequence that encodes an epitope of the polypeptide sequence of the present invention (eg, the sequence disclosed in SEQ ID NO: X), a polynucleotide sequence of the complementary strand of a polynucleotide sequence that encodes the epitope of the present invention. , And, as defined above, a polynucleotide sequence that hybridizes to its complementary strand under stringent hybridization conditions or under lower stringency hybridization conditions.

The term “epitope”, as used herein, refers to that portion of a polypeptide that has antigenic or immunogenic activity in an animal, preferably a mammal, and most preferably a human. Say. In a preferred embodiment,
The invention includes polypeptides that include an epitope, and polynucleotides that encode the polypeptides. An "immunogenic epitope", as used herein, is as determined by any method known in the art (eg, by the methods for producing the antibodies described below). , As part of a protein that elicits an antibody response in animals (eg, Geysen et al., Proc).
． Natl. Acad. Sci. USA 81: 3998-4002 (1983).
)checking). The term “antigenic epitope” as used herein refers to an antibody as determined by any method known in the art (eg, by the immunoassays described herein). Is defined as the part of the protein that is capable of immunospecifically binding to its antigen. Immunospecific binding excludes non-specific binding, but need not exclude cross-reactivity with other antigens. Antigenic epitopes need not be immunogenic.

Fragments that function as epitopes can be produced by any conventional method. (For example, Houghten, RA, Proc. Natl. Aca.
d. Sci. USA 82: 5131-5135 (1985). This is further described in U.S. Pat. No. 4,631,211).

In the present invention, an antigenic epitope preferably comprises at least 4, at least 5, at least 6, at least 7 amino acid sequences, more preferably at least 8, at least 9, at least 10, at least 11, at least 12 at least.
, At least 13, at least 14, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50 amino acid sequences, and most preferably between about 15 and about 30 amino acids. Preferred polypeptides containing immunogenic or antigenic epitopes are at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55.
, 60, 65, 70, 75, 80, 85, 90, 95 or 100 amino acid residues in length. Additional non-exclusively preferred antigenic epitopes include the antigenic epitopes disclosed herein and portions thereof. Antigenic epitopes are useful (eg, to raise antibodies (including monoclonal antibodies) that specifically bind to the epitope). Preferred antigenic epitopes include the antigenic epitopes disclosed herein and any combination of 2, 3, 4, 5 or more of these antigenic epitopes. Antigenic epitopes can be used as target molecules in immunoassays. (For example, Wilson et al., Cell 37: 767-7.
78 (1984); Sutcliffe et al., Science 219: 660-.
666 (1983)).

Similarly, immunogenic epitopes can be used to induce antibodies, eg, according to methods well known in the art. (For example, Sutcliffe et al., Supra; Wilson et al., Supra; Chow et al., Proc. Natl. Acad. Sci. USA 82:
910-914; and Bittle et al., J. Am. Gen. Virol. 66:23
47-2354 (1985)). Preferred immunogenic epitopes are
Includes immunogenicity and any combination of 2, 3, 4, 5 or more of these immunogenic epitopes disclosed herein. Polypeptides that include one or more immunogenic epitopes can be labeled with an animal system (eg, albumin) along with a carrier protein (eg, albumin).
The antibody may be presented to elicit an antibody response against rabbits or mice) or, if the polypeptide is sufficiently long (at least about 25 amino acids), the polypeptide may be presented without a carrier. However, immunogenic epitopes containing as few as 8-10 amino acids have been shown to be sufficient to elicit at least antibodies capable of binding to linear epitopes in denatured polypeptides ( For example, in Western blotting).

The epitope-bearing polypeptides of the present invention can be used to induce antibodies according to methods well known in the art. These well-known methods include in vivo immunization,
In vitro immunization, and phage display methods are included, but are not limited to. See, for example, Sutcliffe et al., Supra; Wilson et al., Supra, and Bittle et al., J. Chem. Gen. Virol. , 66: 2347-2354 (1
985). When using in vivo immunization, animals can be immunized with free peptide; however, anti-peptide antibody titers will bind the peptide to macromolecular carriers such as keyhole limpet hemocyanin (KLH) or tetanus toxoid. Can be boosted by For example, a peptide containing a cysteine residue is a maleimidobenzoyl-N-hydroxysuccinimide ester (M
It can be attached to the carrier using a linker such as BS). On the other hand, other peptides can be bound to the carrier using more common binding agents such as glutaraldehyde. Animals such as rabbits, rats, and mice are known to stimulate, for example, about 100 μg of peptide or carrier protein and Freund's adjuvant or immune response with either free peptide or carrier-bound peptide. Immunization is carried out by intraperitoneal and / or intradermal injection of an emulsion containing the adjuvant. Several booster injections may be needed to provide a useful titer of anti-peptide antibody, for example, at intervals of about 2 weeks. This titer can be detected, for example, by an ELISA assay using free peptide adsorbed on the solid surface. The titer of anti-peptide antibody in the serum from the immunized animal depends on the choice of anti-peptide antibody (eg by adsorption to the peptide on a solid support and elution of the selected antibody according to methods well known in the art). Can rise.

As will be appreciated by those of skill in the art, and as discussed above, the polypeptides of the invention and immunogenic and / or antigenic epitope fragments thereof are fused to other polypeptide sequences. obtain. For example, the polypeptides of the present invention may be fused to immunoglobulin (IgA, IgE, IgG, IgM) constant domains or portions thereof (CH1, CH2, CH3, or any combination thereof, and portions thereof). , Which results in a chimeric polypeptide. Such fusion proteins can facilitate purification and increase half-life in vivo. This has been shown for a chimeric protein consisting of the first two domains of human CD4 polypeptide and various domains of the constant region of the heavy or light chain of mammalian immunoglobulins. For example, EP 394,82
7; Traunecker et al., Nature, 331: 84-86 (1988).
checking ... Enhanced delivery of antigens across the epithelial barrier to the immune system is
cRn binding partners (eg IgG or Fc fragments (
For example, antigens (eg, insulin) conjugated to PCT publications WO 96/2024 and WO 99/04813) have been demonstrated. An IgG fusion protein having a disulfide bridged dimer structure also has its Ig
It has been found to be more effective in binding and neutralizing other molecules than the monomeric polypeptides or their fragments alone, due to the G moiety disulfide bond. For example, Fountoulakis et al. Biochem. 270
: 3958-3964 (1995).

Similarly, EP-A-O 464 533 (Canadian counterpart 2045869)
Discloses a fusion protein comprising various portions of the constant region of an immunoglobulin molecule along with another human protein or part thereof. In many cases, the Fc part in the fusion protein may be advantageous in therapy and diagnosis and thus give rise to eg improved pharmacokinetic properties (EP-A 0232 262). Alternatively, it is desirable that the Fc portion can be deleted after the fusion protein has been expressed, detected, and purified. For example, when the fusion protein is used as an immunizing antigen,
The Fc portion may interfere with therapy and diagnosis. In drug discovery, for example hIL
Human proteins such as -5 have been fused to the Fc portion for the purpose of high throughput screening assays to identify antagonists of hIL-5.
(D. Bennett et al., J. Molecular Recognition.
8: 52-58 (1995); Johnson et al. Biol. Che
m. 270: 9459-9471 (1995). 3.) Furthermore, the polypeptides of the invention may be fused to a marker sequence, such as a peptide that facilitates purification of the fused polypeptide. In a preferred embodiment, the marker amino acid sequence is, inter alia, the pQE vector (QIAGEN, I
nc. , 9259 Eton Avenue, Chatsworth, CA, 9
1311) hexa-histidine peptides such as the tags provided in 1311), many of which are commercially available. For example, Gentz et al., Proc. Natl
． Acad. Sci. Hexa-histidine provides convenient purification of the fusion protein, as described in USA 86: 821-824 (1989). Another peptide tag useful for purification, the "HA" tag, corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson et al., Cell 37: 7.
67 (1984)).

Accordingly, any of these above fusions can be engineered with a polynucleotide or polypeptide of the invention.

Nucleic acid encoding the above epitopes may also be expressed as an epitope tag (eg, a hemagglutinin (“HA”) tag or a flag tag) of the expressed polypeptide with the gene of interest. It can aid in detection and purification.
For example, the system described by Janknecht et al. Allows for rapid purification of native fusion proteins expressed in human cell lines (Janknecht).
Et al., Proc. Natl. Acad. Sci. USA 88: 8972-897.
(1991)). In this system, the gene of interest has a reading frame of 6
It is subcloned into a vaccinia recombinant plasmid so that it is translationally fused to an amino-terminal tag consisting of three histidine residues. This tag serves as the substrate binding domain for the fusion protein. Extracts from cells infected with recombinant vaccinia virus were loaded onto Ni2 + nitrilotriacetic acid agarose columns,
The histidine-tagged protein can then be selectively eluted with an imidazole-containing buffer.

Further fusion proteins of the invention can be produced through the techniques of gene shuffling, motif shuffling, exon shuffling, and / or codon shuffling (collectively referred to as "DNA shuffling"). D
NA shuffling can be used to modulate the activity of the polypeptides of the invention, and such methods can be used to produce polypeptides with altered activity, as well as agonists and antagonists of the polypeptides. Generally, US Pat. Nos. 5,605,793; 5,811,238; 5,830,721; 5,834,252; and 5,837,458, And Pa
Tten et al., Curr. Opinion Biotechnol. 8: 724-
33 (1997); Harayama, Trends Biotechnol.
16 (2): 76-82 (1998); Hansson et al., J. Am. Mol. Bio
l. 287: 265-76 (1999); and Lorenzo and Bla.
sco, Biotechniques 24 (2): 308-13 (1998).
(Each of these patents and publications are hereby incorporated by reference in their entirety). In one embodiment, modification of the polynucleotides corresponding to SEQ ID NO: X and the polypeptides encoded by these polynucleotides can be accomplished by DNA shuffling. DNA shuffling involves assembling two or more DNA segments by homologous or site-specific recombination to produce changes in a polynucleotide sequence.
In another embodiment, the polynucleotides or encoded polypeptides of the invention may be modified by subjecting them to random mutagenesis by error-prone PCR, random nucleotide insertion or other methods prior to recombination. In another embodiment, one or more components, motifs, sections, portions, domains, fragments, etc., of a polynucleotide encoding a polypeptide of the invention are one or more components of one or more heterologous molecules. , Motifs, sections, parts, domains, fragments and the like.

Polynucleotide and Polypeptide Variants The present invention also includes TGF-β receptor variants. The present invention relates to variants of the polynucleotide sequences disclosed in SEQ ID NO: X or variants of their complementary strands, and / or variants of the cDNA sequences contained in cDNA plasmid Z.

The invention also provides variants of the polypeptide sequence disclosed in SEQ ID NO: Y, variants of the polypeptide sequence encoded by the polynucleotide of SEQ ID NO: X and / or
Or a variant of the polypeptide sequence encoded by the cDNA in cDNA plasmid Z.

“Variant” refers to a polynucleotide or polypeptide that differs from a polynucleotide or polypeptide of the invention, but retains their properties. In general, the variants are very similar overall and, in many areas,
It is the same as the polynucleotide or polypeptide of the present invention.

Accordingly, one aspect of the invention is an isolated nucleic acid molecule comprising a polynucleotide having a nucleotide sequence selected from the group consisting of: or alternatively a nucleotide selected from the group consisting of: Provided is an isolated nucleic acid molecule consisting of a polynucleotide having a sequence: (a) encoding a TGF-β receptor polypeptide having an amino acid sequence as shown in the Sequence Listing, and SEQ ID NO: X.
Or a nucleotide sequence as described in the cDNA of cDNA plasmid Z;
(B) The cDNA of SEQ ID NO: X or the cDNA of cDNA plasmid Z as shown in the sequence listing
A nucleotide sequence encoding a mature TGF-β receptor polypeptide having an amino acid sequence as described in (c) an amino acid sequence as set forth in SEQ ID NO: X or in the cDNA of cDNA plasmid Z. Have T
A nucleotide sequence encoding a biologically active fragment of a GF-β receptor polypeptide; (d) a TGF-β receptor having the amino acid sequence set forth in the Sequence Listing and set forth in the cDNA of SEQ ID NO: X or cDNA plasmid Z A nucleotide sequence encoding an antigenic fragment of the polypeptide; (e) a nucleotide encoding a TGF-β receptor polypeptide comprising the complete amino acid sequence encoded by the human cDNA plasmid contained in the cDNA of SEQ ID NO: X or cDNA plasmid Z. A sequence; (f) a nucleotide sequence encoding a mature TGF-β receptor polypeptide having an amino acid sequence encoded by the human cDNA plasmid contained in the cDNA of SEQ ID NO: X or cDNA plasmid Z; (g) sequence Having the amino acid sequence encoded by the human cDNA plasmid contained cDNA in No. X or cDNA plasmid Z TGF-
a nucleotide sequence encoding a biologically active fragment of a β-receptor polypeptide; (h) a TGF having an amino acid sequence encoded by a human cDNA plasmid contained in the cDNA of SEQ ID NO: X or cDNA plasmid Z
A nucleotide sequence encoding an antigenic fragment of the β receptor polypeptide; (i) (a), (b), (c), (d), (e), (f), (g) or (h) above. A) a nucleotide sequence complementary to any of the nucleotide sequences in.

The present invention also includes, for example, (a), (b), (c), (d), (e) and (f
), (G), (h) or (i) at least 80
%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100%
It relates to nucleic acid molecules which comprise or consist of identical nucleotide sequences. Polypeptides encoded by these nucleic acid molecules are also included by the invention. In another embodiment, the present invention provides the above (a), (b), (c
), (D), (e), (f), (g), (h) or (i) the polynucleotide which hybridizes under stringent hybridization conditions or under low stringency conditions. Nucleic acid molecules comprising or consisting of Polynucleotides that hybridize to the complements of these nucleic acid molecules under stringent hybridization conditions or under low stringency conditions may also be included by the invention, as are the polypeptides encoded by these polynucleotides. .

Another aspect of the present invention provides an isolated nucleic acid molecule comprising or consisting of a polynucleotide having a nucleotide sequence selected from the group consisting of: (a) shown in the Sequence Listing. And TGF- having the amino acid sequence shown in Table 1.
a nucleotide sequence encoding a β receptor polypeptide; (b) a nucleotide sequence encoding a mature TGF-β receptor polypeptide having the amino acid sequence shown in the Sequence Listing and set forth in Table 1; (c) in the Sequence Listing A nucleotide sequence, which encodes a biologically active fragment of a TGF-β receptor polypeptide having the amino acid sequence shown and having the amino acid sequence shown in Table 1; (d) the amino acid shown in the Sequence Listing and shown in Table 1. A nucleotide sequence encoding an antigenic fragment of a TGF-β receptor polypeptide having a sequence; (e) a complete amino acid sequence encoded by the human cDNA in the cDNA plasmid contained in the ATCC deposit and as set forth in Table 1. A nucleotide sequence encoding a TGF-β receptor polypeptide comprising; (F) a nucleotide sequence encoded by the human cDNA in the cDNA plasmid contained in the ATCC deposit and encoding a mature TGF-β receptor polypeptide having the amino acid sequence set forth in Table 1; (g)
A nucleotide sequence encoding a biologically active fragment of a TGF-β receptor polypeptide encoded by a human cDNA in a cDNA plasmid contained in the ATCC deposit and having the amino acid sequence set forth in Table 1; (h) A
A nucleotide sequence encoded by a human cDNA in a cDNA plasmid contained in a TCC deposit and encoding an antigenic fragment of a TGF-β receptor polypeptide having the amino acid sequence set forth in Table 1; (i) above (a). , (
A nucleotide sequence complementary to any of the nucleotide sequences in b), (c), (d), (e), (f), (g) or (h).

The present invention also includes, for example, the above (a), (b), (c), (d), (e), (f
), (G), (h) or (i) at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical. A nucleic acid molecule comprising or consisting of a nucleotide sequence. Polypeptides encoded by these nucleic acid molecules are also encompassed by the present invention. In another embodiment, the present invention provides the above (a), (b), (c
), (D), (e), (f), (g), (h) or (i) the polynucleotide which hybridizes under stringent hybridization conditions or under lower stringency conditions. Nucleic acid molecules comprising or consisting of: Polynucleotides that hybridize to the complements of these nucleic acid molecules under stringent hybridization conditions or under lower stringency conditions are also encompassed by the invention, as well as the polynucleotides encoded by these polynucleotides. Peptides are also encompassed by the present invention.

The invention also includes, for example, the polypeptide sequence shown in SEQ ID NO: Y, the polypeptide sequence encoded by the nucleotide sequence in SEQ ID NO: X, the polypeptide encoded by the cDNA in cDNA plasmid Z. At least 80%, 85%, 90%, 95%, 96%, 97, relative to the sequence, and / or polypeptide fragment of any of these polypeptides (eg, the fragments described herein). %, 98%, 99% or 10
It relates to a polypeptide which comprises or consists of an amino acid sequence which is 0% identical. Polynucleotides that hybridize to the complement of nucleic acid molecules encoding these polypeptides under stringent or lower stringency hybridization conditions are also encompassed by the invention, as well as these Polypeptides encoded by the polynucleotides are also encompassed by the invention.

By a nucleic acid having a nucleotide sequence that is at least 95% “identical” to a reference nucleotide sequence of the present invention, the nucleotide sequence of that nucleic acid is the reference nucleotide sequence of which each nucleotide sequence encodes a polypeptide 100
It is intended to be identical to a reference sequence, except that it can contain up to 5 point mutations per nucleotide. In other words, up to 5% of the nucleotides of the reference sequence may be deleted or replaced by another nucleotide in order to obtain a nucleic acid having a nucleotide sequence which is at least 95% identical to the reference nucleotide sequence. Alternatively, up to 5% of the total nucleotides in the reference sequence can be inserted in the reference sequence. The query sequence can be the entire sequence shown in Table 1, the ORF (open reading frame), or any fragment identified as described herein.

As a practical matter, any particular nucleic acid molecule or polypeptide will be at least 80%, 85%, 90%, 95%, 96%, 9% of the nucleotide sequences of the invention.
Whether 7%, 98%, or 99% identical can be conventionally determined using known computer programs. A preferred method for determining the best overall compatibility (also called global sequence alignment) between a query sequence (the sequence of the invention) and a subject sequence is described by Brutlag et al. (Comp. App. Bio).
sci. 6: 237-245 (1990) based FASTD
It can be determined using the B computer program. In a sequence alignment, both the query and subject sequences are DNA sequences. The RNA sequence is U
To T can be compared. The result of this overall sequence alignment is
Shown in percent identity (%). DNA to calculate percent identity
Preferred parameters used in the FASTDB alignment of sequences are: Matr
ix = Unitary, k-tuple = 4, Mismatch Penalt
y = 1, Joining Penalty = 30, Randomization
Group Length = 0, Cutoff Score = 1, Gap P
energy = 5, Gap Size Penalty 0.05, Windows
w Size = 500 or the length of the nucleotide sequence of interest (whichever is shorter).

If the sequence of interest is shorter than the query sequence due to the 5'or 3'deletions (as opposed to due to internal deletions), a manual correction must be made to the results. This is because the FASTDB program does not consider 5'and 3'truncations of the subject sequence when calculating percent identity. For a subject sequence that is truncated at the 5'or 3'end, the percent identity to the query sequence is 5% of the subject sequence that is not matched / aligned as a percentage of the total bases of the query sequence.
Corrected by calculating the number of bases in the query sequence that are'and 3 '. Whether the nucleotides are matched / aligned is determined by the results of the FASTDB sequence alignment. This percentage is then subtracted from the percent identity calculated by the FASTDB program above using the specified parameters to arrive at the final percent identity score. This corrected score is
It is used for the purpose of the present invention. Only bases outside the 5'and 3'bases of the subject sequence that are not matched / aligned with the query sequence, as indicated by the FASTDB alignment, are calculated for the purpose of manually adjusting the percent identity score.

For example, a 90 base subject sequence is aligned with a 100 base query sequence to determine percent identity. Deletions occur at the 5'end of the subject sequence, so the FASTDB alignment shows no match / alignment at the first 10 bases at the 5'end. 1
Zero unpaired bases represent 10% of the sequence (number of unmatched 5'and 3'terminal bases / total number of bases in the query sequence), so 10% are FASTD
Subtracted from the percent identity score calculated by the B program.
If the remaining 90 bases were an exact match, the final percent identity would be 90%. In another example, a 90 base subject sequence is compared to a 100 base query sequence. In this case, the deletion is an internal deletion such that there are no bases in the 5'or 3'of the subject sequence that are not matched / aligned with the query. In this case, FASTD
The percent identity calculated by B is not manually corrected. Again, only the 5'or 3'bases of the subject sequence that do not match / align with the query sequence are manually corrected. No other manual correction is made for the purposes of the present invention.

By virtue of a polypeptide having an amino acid sequence which is at least 95% “identical” to a query amino acid sequence of the invention, the amino acid sequence of the subject polypeptide is such that the subject polypeptide sequence is each of the query amino acid sequences. It is intended to be identical to the query sequence, except that changes of up to 5 amino acids per 100 amino acids may be included. In other words, up to 5% of the amino acid residues in the sequence of interest are subject to insertions, deletions, (indels) in order to obtain a polypeptide having an amino acid sequence that is at least 95% identical to the query amino acid sequence.
) Or another amino acid. These modifications of the reference sequence can occur at the amino-terminal or carboxy-terminal positions of the reference amino acid sequence, or anywhere between those terminal positions, either individually between the residues in the reference sequence or the reference sequence. One or more of the following groups are scattered in any of the states.

As a practical matter, any particular polypeptide may be used, for example, as an amino acid sequence shown in Table 1 or a fragment thereof, an amino acid sequence encoded by the nucleotide sequence in SEQ ID NO: X or a fragment thereof, or a cDNA.
At least 80%, 85%, 90%, 95%, 96% for the amino acid sequence encoded by the cDNA in NA plasmid Z or a fragment thereof.
Whether 97%, 98%, or 99% identical can be determined conventionally using known computer programs. Query sequence (sequence of the present invention)
A preferred method for determining the best overall match (also referred to as global sequence alignment) between the subject and the subject sequence is Brutlag et al. (Comp. App. Bios).
ci. 6: 237-245 (1990)) based FASTDB
It can be determined using a computer program. In a sequence alignment, the query and subject sequences are either both nucleotide sequences or both amino acid sequences. The results of the above global sequence alignments are given in percent identity. Preferred parameters used for FASTDB amino acid alignment are: Matrix = PAM 0, k-tuple = 2, Mismatc.
h Penalty = 1, Joining Penalty = 20, Rando
migration Group Length = 0, Cutoff Score
= 1, Window Size = length of array, Gap Penalty = 5, G
ap Size Penalty = 0.05, Window Size = 500
Alternatively, it is the length of the target amino acid sequence (whichever is shorter).

If the subject sequence is shorter than the query sequence due to N-terminal or C-terminal deletions (and not due to internal deletions), manual corrections must be made to the results. This is because the FASTDB program does not consider N-terminal and C-terminal truncations of the subject sequence when calculating overall percent identity. Regarding the target sequence shortened at the N-terminus and C-terminus, with respect to the query sequence,
Percent identity is corrected by calculating the number of residues in the query sequence that are N- and C-terminal to the subject sequence that are not matched / aligned with the corresponding subject residues as a percentage of the total bases of the query sequence. . Whether the residues are matched / aligned is determined by the results of the FASTDB sequence alignment. This percentage is then subtracted from the percent identity calculated by the FASTDB program above using the specified parameters to arrive at the final percent identity score. This final percent identity score is what is used for the purposes of the present invention. Only residues N- and C-terminal to the subject sequence that are not matched / aligned with the query sequence are considered for the purpose of manually adjusting the percent identity score. That is, only query residue positions outside the furthest N- and C-terminal residues of the subject sequence.

For example, a 90 amino acid residue subject sequence is aligned with a 100 residue query sequence to determine percent identity. Deletions occur at the N-terminus of the subject sequence, and therefore the FASTDB alignment does not show a match / alignment of the first 10 residues at the N-terminus. The 10 unpaired residues represent 10% of the sequence (number of non-matching N- and C-terminal residues / total number of residues in the query sequence), resulting in FAS.
10% is subtracted from the percent identity score calculated by the TDB program. If the remaining 90 residues were perfectly matched, the final percent identity would be 90%. In another example, a 90 residue subject sequence is compared to a 100 residue query sequence. In this case, the deletion is an internal deletion, so there are no residues at the N-terminus or C-terminus of the subject sequence that are not matched / aligned with the query sequence.
In this case, the percent identity calculated by FASTDB is not manually corrected. Again, only residue positions outside the N- and C-termini of the subject sequence that do not match / align with the query sequence, as shown in the FASTDB alignment, are manually corrected. No other manual correction is made for the purposes of the present invention.

Variants may include changes in the coding regions, non-coding regions, or both. Particularly preferred are polynucleotide variants that contain changes that produce silent substitutions, additions, or deletions, but do not alter the properties or activity of the encoded polypeptide. Nucleotide variants produced by silent substitutions due to the degeneracy of the genetic code are preferred. Furthermore, less than 50 amino acids, 40
Less than 30 amino acids, less than 30 amino acids, less than 20 amino acids, less than 10 amino acids, or 5 to 50 amino acids, 5 to 25 amino acids, 5 to 10 amino acids, 1 to 5 amino acids, or 1 to 2 amino acids substituted or deleted in any combination. Variants that have been lost or added are also preferred. Polynucleotide variants optimize codon expression for a variety of reasons (eg, codon expression for a particular host (codons in human mRNA are
E. change to a preferred codon by a bacterial host such as E. coli)).

Naturally occurring variants are referred to as “allelic variants” and refer to one of several alternative forms of a gene that occupy a given locus on the chromosome of an organism. (Genes II, Lewin, B., edited by John Wiley &
Sons, New York (1985)). These allelic variants are
It can vary at either the polynucleotide level and / or the polypeptide level and is included in the present invention. Alternatively, non-naturally occurring variants may be produced by mutagenesis techniques or by direct synthesis.

Using known methods of protein engineering and recombinant DNA technology, variants are
It can be made to improve or change the properties of the polypeptides of the invention. For example, as discussed herein, one or more amino acids can be deleted from the N-terminus or C-terminus of a polypeptide of the invention without substantial loss of biological function. . Ron et al. Biol. Chem. 268: 2984-2988 (1
993) reported modified KGF proteins that have heparin binding activity even after deletion of 3, 8, or 27 amino terminal amino acid residues. Similarly, interferon γ is 8 to 8 from the carboxy terminus of this protein.
After deletion of 10 amino acid residues, it showed up to 10 times higher activity (D
obeli et al. Biotechnology 7: 199-216 (198).
8)).

Furthermore, a wealth of evidence demonstrates that variants often retain activities similar to those of naturally occurring proteins. For example, Gayle and co-workers (J. Biol. Chem 268: 22105-22111 (1
993)) performed an extensive mutational analysis of the human cytokine IL-1a. They used random mutagenesis to generate over 3,500 individual IL-1a variants that averaged 2.5 amino acid changes per variant over the entire length of the molecule. Multiple mutations were tested at every possible amino acid position. The investigators found that "the majority of molecules can be altered with little effect on either [binding activity or biological activity]." (See summary). In fact, of the over 3,500 nucleotide sequences tested, only 23 unique amino acid sequences produced proteins that differed significantly in activity from the wild type.

Further, as discussed herein, deletion of one or more amino acids from the N-terminus or C-terminus of a polypeptide results in modification or deletion of one or more biological functions. , But other biological activities may still be retained. For example, the ability of a deletion variant to induce and / or bind an antibody that recognizes a secreted form may be retained if less than the majority of the secreted forms are removed from the N- or C-termini. Is. Whether a particular polypeptide lacking the N-terminal or C-terminal residues of a protein retains such immunogenic activity is determined by conventional methods described herein, and Otherwise it can be readily determined by conventional methods known in the art.

Accordingly, the present invention further includes polypeptide variants that exhibit a functional activity (eg, biological activity) of a polypeptide of the invention, the polypeptide variant being a modification of the polypeptide of the invention. It is the body. Such variants include deletions, insertions, inversions, repeats, and substitutions selected according to general rules known in the art such that they have little effect on activity.

The present application contemplates at least 80%, 85%, 90% of the nucleic acid sequences disclosed herein (eg, encoding a polypeptide having an amino acid sequence with an N-terminal deletion and / or a C-terminal deletion). %, 95%, 96%, 97%, 98%, 99% or 10
For nucleic acid molecules that are 0% identical, regardless of whether the nucleic acid encodes a polypeptide having functional activity. Those skilled in the art will still know how to use the nucleic acid, eg as a hybridization probe or polymerase chain reaction (PCR) primer, even if the particular nucleic acid molecule does not encode a polypeptide having a functional activity. Because there is. The use of the nucleic acid molecule of the present invention that does not encode a polypeptide having functional activity includes, inter alia: (1
) Isolating the gene or its allelic or splice variants in a cDNA library; (2) Verma et al., Human Chrom.
osomes: A Manual of Basic Techniques,
Detect in situ hybridization (eg, FISH) to metaphase chromosome spreads to provide precise chromosomal location of a gene, as described in Pergamon Press, New York (1988); as well as detecting mRNA expression in specific tissues Northern blot analysis for.

However, preferred is at least 80% of the nucleic acid sequences disclosed herein that actually encode a polypeptide having the functional activity of a polypeptide of the invention.
, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical.

Naturally, due to the degeneracy of the genetic code, for example, the cDNA in cDNA plasmid Z
NA at least 80%, 85%, 90%, 95%, 96%, 9 with the nucleic acid sequence shown in Table 1 (SEQ ID NO: X) or fragments thereof.
One of ordinary skill in the art will readily recognize that the majority of nucleic acid molecules that have 7%, 98%, 99%, or 100% sequence identity encode polypeptides that have "functional activity." Indeed, since degenerate variants of any of these nucleotide sequences all encode the same polypeptide, in many cases this will be apparent to one of skill in the art, even without performing the comparative assay described above. . It is further recognized in the art that for nucleic acid molecules that are not degenerate variants, a reasonable number also encodes a polypeptide having functional activity. This results in amino acid substitutions that are either unlikely or significantly less likely to affect protein function (eg, one aliphatic amino acid for a second amino acid, as discussed further below). (Substitution with an aliphatic amino acid) is completely known to those skilled in the art.

For example, for guidance on how to make phenotypically silent amino acid substitutions, see Bowie et al., “Deciphering the Message in P”.
protein sequences: Tolerance to Amino
Acid Substitutions, Science 247: 1306-
1310 (1990), the authors show that there are two main strategies for studying the permissiveness of amino acid sequences for changes.

The first strategy takes advantage of the permissiveness of amino acid substitutions by natural selection during the course of evolution. Conservative amino acids can be identified by comparing amino acid sequences in different species. These conserved amino acids appear to be important for protein function. In contrast, the amino acid positions at which substitutions were allowed by natural selection indicate that these positions are not important for protein function. Thus, the positions that allow amino acid substitutions can be modified while still maintaining the biological activity of the protein.

The second strategy uses genetic engineering to introduce amino acid changes at specific positions in the cloned gene to identify regions important for protein function. For example, site-directed mutagenesis or alanine scanning mutagenesis (
The introduction of one alanine mutation at every residue in the molecule) can be used. (Cun
Ningham and Wells, Science 244: 1081-108.
5 (1989)). The resulting mutant molecule can then be tested for biological activity.

As the authors state, these two strategies revealed that the protein was surprisingly tolerant of amino acid substitutions. The authors further indicate which amino acid changes are likely to be tolerated at particular amino acid positions in the protein. For example, the most buried amino acid residues (within the tertiary structure of proteins) require non-polar side chains, but surface side chain characteristics are generally poorly conserved. In addition, tolerated conservative amino acid substitutions are conserved for the aliphatic or hydrophobic amino acids Al
Substitution of a, Val, Leu, and Ile; hydroxyl residues Ser and T
Substitution of hr; Substitution of Asp and Glu of acidic residues; Substitution of Asn and Gln of amide residues, substitution of Lys, Arg, and His of basic residues; substitution of Phe, Tyr, and Trp of aromatic residues Substitutions and small amino acids A
Includes substitutions of la, Ser, Thr, Met, and Gly. In addition to conservative amino acid substitutions, variants of the invention include (i) substitutions with one or more non-conservative amino acid residues, wherein the amino acid residue replaced is an amino acid encoded by the genetic code. May or may not be a residue, or (ii) substitution with one or more amino acid residues having a substituent, or (iii) another compound (eg, stability of the polypeptide Compounds for increasing sex and / or solubility (
Fusion of the mature polypeptide with, for example polyethylene glycol)), or (i
v) Including fusion of the polypeptide with additional amino acids (eg, IgG Fc fusion region peptide, or leader or secretory sequences, or sequences that facilitate purification). Such variant polypeptides are considered to be within the skill of those in the art given the teachings herein.

Polypeptide variants that include amino acid substitutions of charged amino acids, for example, with other charged or neutral amino acids, are proteins with improved characteristics (eg, less aggregation). Can be generated. Aggregation of the pharmaceutical formulation reduces activity and increases clearance due to the immunogenic activity of the aggregate. (
Pinkard et al., Clin. Exp. Immunol. 2: 331-340
(1967); Robbins et al., Diabetes 36: 838-845 (
1987); Cleland et al., Crit. Rev. Therapeutic
Drug Carrier Systems 10: 307-377 (1993).
)).

A further embodiment of the invention comprises at least one amino acid substitution, but 50
Amino acids of a polypeptide having an amino acid sequence of no more than amino acid substitutions, even more preferably no more than 40 amino acid substitutions, even more preferably no more than 30 amino acid substitutions, and even more preferably no more than 20 amino acid substitutions. A polypeptide comprising a sequence. Of course, the polypeptide comprises, in increasing order of preference, an amino acid sequence comprising the amino acid sequence of the polypeptide of SEQ ID NO: Y, the amino acid sequence encoded by SEQ ID NO: X, and / or at least one amino acid substitution. It is highly preferred to have the amino acid sequence encoded by the cDNA in cDNA plasmid Z that contains no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 amino acid substitutions. In certain embodiments, the amino acid sequence of SEQ ID NO: Y or a fragment thereof (eg, the mature forms and / or other fragments described herein), the amino acid sequence encoded by SEQ ID NO: X or a fragment thereof, and / or The number of additions, substitutions and / or deletions in the amino acid sequence encoded by the cDNA plasmid XZ or a fragment thereof is 1-5, 5-10, 5-25, 5-50,
10 to 50, or 50 to 150, and a conservative amino acid substitution is preferred. As discussed herein, any polypeptide of the invention can be used to produce a fusion protein. For example, the polypeptides of the present invention can be used as an antigenic tag when fused to a second protein. Antibodies raised against the polypeptides of the invention can be used to indirectly detect a second protein by binding to the polypeptide. Furthermore, since secreted proteins target cell locations based on transport signals, the polypeptides of the invention shown to be secreted can serve as targeting molecules once fused to other proteins. Can be used.

Examples of domains that can be fused with the polypeptides of the invention include not only heterologous signal sequences, but also other heterologous functional regions. The fusion does not necessarily have to be direct, but can occur via a linker sequence.

In certain preferred embodiments, the protein of the invention comprises a polypeptide of N
Included fusion polypeptides that are truncation variants and / or C-terminal truncation variants. In a preferred embodiment, the present application provides at least 80%, 85%, 90% of the nucleic acid sequence encoding the polypeptide having the amino acid sequences of the specific N-terminal deletion variant and C-terminal deletion variant, 95%, 96%, 97%, 98% or 99% identical nucleic acid molecules. Polynucleotides (including fragments and / or variants) encoding these polypeptides are also included according to the invention.

In addition, fusion proteins can also be engineered to improve the characteristics of the polypeptides of the invention. For example, additional amino acids, especially regions of charged amino acids, can be added to the N-terminus of the polypeptide to improve stability and persistence during purification from host cells or subsequent handling and storage. Also, peptide moieties may be added to the polypeptide to facilitate purification. Such regions may be removed prior to final preparation of the polypeptide. Addition of peptide moieties to facilitate handling of polypeptides is well known and routine in the art.

As will be appreciated by those in the art, the polypeptides of the present invention and the epitope-bearing fragments described above may be combined with heterologous polypeptide sequences. For example, the polypeptides of the present invention can be fused to heterologous polypeptide sequences. For example, a polypeptide of the invention may comprise an immunoglobulin (IgA, IgE, IgG, IgM) constant domain or portions thereof (including the entire domain or both portions thereof, CH1,
CH2, CH3, and any combination thereof, resulting in a chimeric polypeptide. These fusion proteins facilitate purification and exhibit increased half-life in vivo. One reported example describes a chimeric protein consisting of the first two domains of the human CD4-polypeptide and various domains of the constant regions of the heavy or light chains of mammalian immunoglobulins (EP 394, EP 394).
827; Traunecker et al., Nature, 331: 84-86 (198).
8)). Fusion proteins with disulfide-bonded dimer structures due to IgG may also be more effective in binding and neutralizing other molecules than monomeric polypeptides or their protein fragments alone (Fountoul).
akis et al. Biochem. , 270: 3958-3964 (1995).
).

Vectors, Host Cells, and Protein Production The present invention also relates to vectors containing the polynucleotides of the present invention, host cells, and the production of polypeptides by recombinant techniques. For example, the vector can be a phage vector, a plasmid vector, a viral vector, or a retroviral vector. Retroviral vectors can be replication competent or replication defective. In the latter case, viral propagation generally will complement the host cell (co
It occurs only during the implementation.

The polynucleotide of the present invention may be ligated to a vector containing a selectable marker for propagation in a host. Generally, the plasmid vector is introduced in a precipitate, such as a calcium phosphate precipitate, or in complex with a charged lipid. If the vector is a virus, the viral vector can be packaged in vitro using a suitable packaging cell line and then transduced into host cells.

[0200] The polynucleotide insert may include any suitable promoter (eg, phage λPL promoter, E. coli lac promoter, trp promoter, phoA promoter and tac promoter, SV40 early promoter and SV40 late promoter, and retrovirus, to name a few). Should be operably linked to the LTR promoter). Other suitable promoters are known to those of skill in the art. The expression construct further comprises sites for transcription initiation, transcription termination,
And in the transcribed region, it contains a ribosome binding site for translation. The coding portion of the transcript expressed by the construct preferably has a translation initiation codon initially and a termination codon (UAA, U) appropriately located at the end of the translated polypeptide.
GA or UAG).

As indicated, the expression vector preferably contains at least one selectable marker. Such markers include dihydrofolate reductase, G418, or neomycin resistance for eukaryotic cell culture, as well as E. coli. It contains a tetracycline, kanamycin or ampicillin resistance gene for cultivation in E. coli and other bacteria. Representative examples of suitable hosts include bacterial cells such as E. coli.
, Streptomyces and Salmonella typhimuri
um cells); fungal cells such as yeast cells (eg, Saccharomyces
cerevisiae or Pichia pastoris (ATCC Registration No. 201178)); Drosophila S2 and Spodopter
a Insect cells such as Sf9 cells; animal cells such as CHO cells, COS cells, 293 cells, and Bowes melanoma cells; and plant cells, but are not limited thereto. Appropriate culture media and conditions for the above-described host cells are known in the art.

Among the preferred vectors for use in bacteria are pQE70, pQE6.
0 and pQE-9 (available from QIAGEN, Inc.); pBluesc
ript vector, Phagescript vector, pNH8A, pNH16
a, pNH18A, pNH46A (Stratagene Cloning S
systems, Inc. ); And ptrc99a, pKK22
3-3, pKK233-3, pDR540, pRIT5 (Pharmacia)
Biotech, Inc. Available from). Among the preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXT1 and pSG (
(Available from Stratagene); and pSVK3, pBPV, pMS
G and pSVL (available from Pharmacia). Preferred vectors for use in yeast systems are pYES2, pYD1, pTEF1 / Zeo.
, PYES2 / GS, pPICZ, pGAPZ, pGAPZalph, pPIC
9, pPIC3.5, pHIL-D2, pHIL-S1, pPIC3.5K, p
PIC9K, and PAO815 (all Invitrogen, Carlbad
, CA, etc.), but are not limited to these. Other suitable vectors will be readily apparent to those of skill in the art.

Introduction of the construct into the host cell is carried out by calcium phosphate transfection, DE
It can be provided by AE-dextran mediated transfection, cationic lipid mediated transfection, electroporation, transduction, infection, or other methods. Such methods are described by Davis et al., Basic Metho.
It is described in many standard laboratory manuals such as ds In Molecular Biology (1986). It is specifically contemplated that the polypeptides of the present invention may in fact be expressed by host cells lacking the recombinant vector.

Polypeptides of the invention may be ammonium sulfate precipitated or ethanol precipitated, acid extracted, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectins. It can be recovered from recombinant cell culture and purified by well-known methods, including chromatography. Most preferably high performance liquid chromatography (“HPLC”)
Is used for purification.

Polypeptides of the invention may also be recovered from: products purified from natural sources, including body fluids, tissues and cells, whether directly isolated or cultured; chemical; Products of synthetic procedures; and products produced by recombinant techniques from prokaryotic or eukaryotic hosts, including, for example, bacterial cells, yeast cells, higher plant cells, insect cells, and mammalian cells. Depending on the host used in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or non-glycosylated. In addition, the polypeptides of the present invention may also, in some cases, include an initial modified methionine residue as a result of host-mediated processes. Therefore, it is well known in the art that, in general, the N-terminal methionine encoded by the translation initiation codon is removed with high efficiency from any post-translational protein in all eukaryotic cells. The N-terminal methionine in most proteins is also efficiently removed in most prokaryotes, but for some proteins this prokaryotic removal process depends on the nature of the amino acids to which the N-terminal methionine is covalently attached. Is inefficient.

In one embodiment, the yeast Pichia pastoris is used to express a polypeptide of the invention in a eukaryotic cell line. Pichi
a pastoris is a methyltrophic yeast that can metabolize with methanol as its sole carbon source. The major step in the methanol metabolism pathway is the oxidation of methanol to formaldehyde using O ₂ . This reaction is catalyzed by the enzyme alcohol oxidase. In order to metabolize methanol as its sole carbon source, Pichia pas
toris produces high levels of alcohol oxidase, due in part to the relatively low affinity of alcohol oxidase for O ₂ . Consequently, the promoter region of one of the two alcohol oxidase genes (AOX1) is highly active in growth media that relies on methanol as the major carbon source. In the presence of methanol, the alcohol oxidase produced from the AOX1 gene comprises up to approximately 30% of total soluble protein in Pichia pastoris. Ellis, S .; B. Et al., Mol. Cell.
Biol. 5: 1111-21 (1985); Koutz, P .; J. Et al, Yea
st 5: 167-77 (1989); Tschopp, J .; F. Nucl
． Acids Res. 15: 3859-76 (1987). Therefore, AOX1
Heterologous coding sequences under transcriptional regulation of all or part of the regulatory sequences, such as the polynucleotides of the invention, are expressed at exponentially high levels in Pichia yeast grown in the presence of methanol.

In one example, the plasmid vector pPIC9K was transformed into "Pichia P
rotocols: Methods in Molecular Biolog
y ", D.I. R. Higgins and J.M. Edited by Cregg (The Humana
Press, Totowa, NJ, 1998), and is used to express DNA encoding a polypeptide of the invention as shown herein in the Pichea yeast system, essentially as described. This expression vector is a Pichia pastoris located upstream of the multiple cloning site.
The strong AOX1 promoter linked to the alkaline phosphatase (PHO) secretion signal peptide (ie leader) allows expression and secretion of the proteins of the invention.

Many other yeast vectors (eg pYES2, pYD1, pTEF1 / Ze
o, pYES2 / GS, pPICZ, pGAPZ, pGAPZalpha, pP
IC9, pPIC3.5, pHIL-D2, pHIL-S1, pPIC3.5K
, And PAO815) are arranged appropriately such that transcription, translation, secretion (if desired), etc., including an in-frame AUG when the proposed expression construct is required, as will be readily appreciated by those of skill in the art. Can be used in place of pPIC9K as long as it provides a good signal.

In another embodiment, high levels of expression of a heterologous coding sequence (eg, a polynucleotide of the invention, etc.) is obtained by cloning a heterologous polynucleotide of the invention into an expression vector (eg, pGAPZ or pGAPZalpha). , And can be achieved by growing the yeast culture in the absence of methanol.

[0210] In addition to including host cells containing the vector constructs discussed herein, the present invention also includes primars of vertebrate origin, particularly mammalian origin.
y) Includes host cells, secondary host cells, and immortalized host cells. These host cells have been engineered to delete or replace endogenous genetic material (eg, coding sequences) and / or genetic material operably linked to a polynucleotide of the invention (eg, A heterologous polynucleotide sequence) and activates, alters, and / or modifies an endogenous polynucleotide.
Or it amplifies. For example, techniques known in the art can be used to operably link heterologous control regions (eg, promoters and / or enhancers) and endogenous polynucleotide sequences via homologous recombination (eg, 19
U.S. Patent No. 5,641,670 issued June 24, 1997; September 1996
International Publication No. WO 96/29411, published on May 26; August 4, 1994
Published International Publication No. WO 94/12650; Koller et al., Pro.
c. Natl. Acad. Sci. USA 86: 8932-8935 (198).
9); and Zijlstra et al., Nature 342: 435-438 (1).
989). Each of these disclosures is incorporated by reference in their entirety).

In addition, the polypeptides of the present invention can be chemically synthesized using techniques known in the art (eg Creighton, 1983, Proteins: Stru).
cultures and Molecular Principles, W.C. H.
Freeman & Co. , N .; Y. And Hunkapiller et al., Na
Tur., 310: 105-111 (1984)). For example, a polypeptide corresponding to a fragment of the polypeptide sequence of the present invention can be synthesized by using a peptide synthesizer. Furthermore, if desired, nonclassical amino acids or chemical amino acid analogs can be introduced as a substitution or addition into the polypeptide sequence. Non-classical amino acids include, but are not limited to, the common amino acid D isomers, 2,4-diaminobutyric acid, a-aminoisobutyric acid, 4
-Aminobutyric acid, Abu, 2-aminobutyric acid, g-Abu, e-Ahx, 6-aminohexanoic acid, Aib, 2-aminoisobutyric acid, 3-aminopropionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline , Homocitrulline, cysteic acid, t-butylglycine, t-butylalanine,
Phenylglycine, cyclohexylalanine, b-alanine, fluoroamino acids, designer amino acids (eg, b-methyl amino acids), Ca-methyl amino acids, Na-methyl amino acids, and common amino acid analogs. In addition, the amino acids can be D (dextrorotatory) or L (levorotatory).

The present invention may be used during or after translation, for example, glycosylation, acetylation, phosphorylation, amidation, derivatization with known protecting / blocking groups, proteolytic cleavage, antibody molecules or other cellular agents. It includes polypeptides of the invention that are differentially modified, such as by binding to a ligand. Any of numerous chemical modifications, including the following may be carried out by known, but not limited to techniques: cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease, specific chemical cleavage by NaBH _4; acetylation, Formylation, oxidation, reduction; metabolic synthesis in the presence of tunicamycin;

Further post-translational modifications included according to the invention include, for example: N-linked or O-linked carbohydrate chains (N-terminal or C-terminal processing), chemical moieties to the amino acid backbone. Attachment, chemical modification of N-linked or O-linked carbohydrate chains, and addition or deletion of N-terminal methionine residues as a result of prokaryotic host cell expression. The polypeptide may also be modified with a detectable label such as an enzymatic label, a fluorescent label, an isotope label or an affinity label to allow detection and isolation of the protein.

The present invention also provides chemically modified derivatives of the polypeptides of the present invention that may provide additional advantages such as increased solubility, stability and circulation time of the polypeptide, or decreased immunogenicity. (See US Pat. No. 4,179,337). The chemical moieties for derivatization can be selected from water soluble polymers such as polyethylene glycol, ethylene glycol / propylene glycol copolymers, carboxymethyl cellulose, dextran, polyvinyl alcohol, and the like. The polypeptide may be modified at random positions within the molecule or at predetermined positions within the molecule and may contain one, two, three or more attached chemical moieties.

The polymer can be of any molecular weight and can be branched or unbranched. For polyethylene glycol, a preferred molecular weight is between about 1 kDa and about 100 kDa for ease of handling and manufacturing (the term "about" refers to some molecules in the preparation of polyethylene glycol Heavy, and some indicate lighter than the indicated molecular weight). The desired therapeutic profile (eg, desired duration of sustained release, effect on biological activity in some cases, ease of handling, degree of antigenicity or lack of antigenicity, and therapeutic protein or analog). Other sizes may be used, depending on other known effects of polyethylene glycol).

The polyethylene glycol molecule (or other chemical moiety) should be attached to the protein in view of its effect on the functional or antigenic domains of this protein. There are numerous coupling methods available to those of skill in the art (eg, EP 0 401 384 (G-CSF to P, incorporated herein by reference).
EG)), Malik et al., Exp. Hematol. 20: 1028-
1035 (1992) (pegylation of GM-CSF with tresyl chloride).
See also report)))). For example, polyethylene glycol can be covalently attached via a amino acid residue by a reactive group such as a free amino or carboxyl group. Reactive groups are groups to which activated polyethylene glycol molecules can be attached. The amino acid residue having a free amino group may include a lysine residue and an N-terminal amino acid residue; the amino acid residue having a free carboxyl group may include an aspartic acid residue, a glutamic acid residue and a C-terminal amino acid residue. Residues may be mentioned. Sulfhydryl residues can also be used as a reactive group to attach the polyethylene glycol molecule. Preferred for therapeutic purposes is a bond at the amino group, eg at the N-terminus or at the lysine group.

Proteins that are chemically modified at the N-terminus may be specifically desired. Using polyethylene glycol as an illustration of the composition of the invention, from various polyethylene glycol molecules (by molecular weight, branching, etc.), the ratio of polyethylene glycol molecules to protein (polypeptide) molecules in the reaction mixture, the pegs to be performed. The type of oxidization reaction and the method of obtaining the selected N-terminal pegylated protein can be selected. The method of obtaining the N-terminal PEGylated preparation (ie, separating this moiety from other mono-PEGylated moieties, if necessary) is performed by purification of the N-terminal PEGylated material from a population of PEGylated protein molecules. obtain. The selective protein chemically modified by N-terminal modification is
It can be achieved by reductive alkylation, which takes advantage of the differential reactivity of different types of primary amino groups (lysine vs. N-terminus) available for derivatization in a particular protein. Under appropriate reaction conditions, substantially selective derivatization of proteins at the N-terminus with a carbonyl group-containing polymer is achieved.

Polypeptides of the invention include monomers or multimers (ie, dimers,
Trimers, tetramers and higher multimers). Accordingly, the present invention relates to monomeric and multimeric polypeptides of the invention, their preparation and compositions (preferably pharmaceutical compositions) containing them. In certain embodiments, the polypeptides of the invention are monomers, dimers, trimers or tetramers. In a further embodiment, the multimers of the invention are at least dimers,
It is at least a trimer, or at least a tetramer.

Multimers encompassed by the present invention can be homomers or heteromers. As used herein, the term homomer refers to the amino acid sequence of dentition number Y (including fragments, variants, and fusion proteins of the polypeptides described herein) or SEQ ID NO: X or A multimer containing only a polypeptide corresponding to the amino acid sequence encoded by the complement of SEQ ID NO: X and / or the amino acid sequence encoded by cDNA plasmid: Z. These homomers may include polypeptides having the same or different amino acid sequences. In certain embodiments, homomers of the invention are multimers that only include polypeptides that have the same amino acid sequence. In another particular embodiment, the homomers of the invention are multimers that include polypeptides with different amino acid sequences. In certain embodiments, the multimers of the invention are homodimers (eg, containing polypeptides having the same or different amino acid sequences) or homotrimers (eg.
For example, including polypeptides having the same or different amino acid sequences).
In a further embodiment, the homomeric multimers of the invention are at least homodimers, at least homotrimers or at least homotetramers.

As used herein, the term heteromer refers to a multimer that comprises one or more heterologous polypeptides (ie, polypeptides of different proteins) in addition to the polypeptide of the invention. In a particular embodiment, the multimers of the invention are heterodimers, heterotrimers or heterotetramers. In a further embodiment, the heteromeric multimers of the invention are at least heterodimers, at least heterotrimers or at least heterotetramers.

The multimers of the invention may be the result of hydrophobic, hydrophilic, ionic and / or covalent attachment and / or may be indirectly linked by, for example, liposome formation. Thus, in one embodiment, multimers of the invention (eg, homodimers or homotrimers) are formed when the polypeptides of the invention contact each other in solution. In another embodiment, the heteromultimer of the invention (
Heterotrimers or heterotetramers, for example) are formed when a protein of the invention is contacted in solution with an antibody against a polypeptide of the invention, including an antibody against a heterologous polypeptide sequence in a fusion protein of the invention. It
In other embodiments, the multimers of the invention are formed by covalent attachment to and / or between polypeptides of the invention. Such a covalent bond is contained in a polypeptide sequence (eg, the sequence set forth in SEQ ID NO: Y or encoded by SEQ ID NO: X and / or contained in a cDNA plasmid: Z). It may include the above amino acid residues. In one example, the covalent bond is a bridge between cysteine residues that are present within the polypeptide sequence that interact in the native (ie, naturally occurring) polypeptide. In another example, this covalent bond is the result of chemical or recombinant manipulation.
Alternatively, such a covalent bond may comprise one or more amino acid residues contained in the heterologous polypeptide sequence in the fusion protein. In one example, the covalent bond is between the heterologous sequences contained in the fusion protein of the invention (eg, US Pat. No. 5,47).
See No. 8,925). In a particular example, this covalent bond is between the heterologous sequences contained in the Fc fusion protein of the invention (as described herein).
In another particular example, the covalent attachment of a fusion protein of the invention is carried out by another protein capable of forming covalently linked multimers (eg, osteoprotegerin).
(see, eg, International Publication No. WO 98/49305, the contents of which are hereby incorporated by reference in its entirety). In another embodiment, two or more polypeptides of the invention are linked through a peptide linker. Examples include the peptide linkers described in US Pat. No. 5,073,627, which is incorporated herein by reference. Proteins comprising multiple polypeptides of the invention separated by a peptide linker can be produced using conventional recombinant DNA techniques.

Another method for preparing the multimeric polypeptides of the invention involves the use of the polypeptides of the invention fused to a leucine zipper polypeptide sequence or an isoleucine zipper polypeptide sequence. Leucine zipper domains and isoleucine zipper domains are polypeptides that promote multimerization of the proteins in which they are found. The leucine zipper originally had some DN
Identified in A-binding proteins (Landschulz et al., Science)
240: 1759, (1988)), and since then in a variety of different proteins. Particularly known leucine zippers are naturally occurring peptides and their derivatives that form dimers or trimers. Examples of leucine zipper domains suitable for producing the soluble multimeric proteins of the present invention include PCT application WO 94/10, incorporated herein by reference.
The leucine zipper domain described at 308. Recombinant fusion proteins comprising a polypeptide of the invention fused to a dimer- or trimer-forming polypeptide sequence in solution are expressed in a suitable host cell, and the resulting soluble multimeric fusion proteins are Are recovered from the culture supernatant using techniques known in.

The trimer polypeptides of the invention may provide the advantage of enhanced biological activity. Preferred leucine zipper and isoleucine moieties are those that preferentially form trimers. One example is Hopp, which is incorporated herein by reference.
Leucine zipper derived from pulmonary surfactant protein D (SPD) as described in e. et al. (FEBS Letters 344: 191, (1994)) and US patent application Ser. No. 08 / 446,922. Other peptides derived from naturally occurring trimer proteins can be used in the preparation of the trimer polypeptides of the invention.

In another example, a protein of the invention is linked by an interaction between Flag® polypeptide sequences contained in a fusion protein of the invention that includes a Flag® polypeptide sequence. In a further embodiment, the protein of the invention binds by interaction between the heterologous polypeptide sequence contained in the Flag® fusion protein of the invention and the anti-Flag® antibody.

The multimers of the present invention can be produced using chemical techniques known in the art.
For example, the polypeptides desired to be included in the multimers of the present invention can be chemically crosslinked using linker molecules and linker molecule length optimization techniques known in the art (eg, US Pat. , 478,925, which is incorporated herein by reference.) Further, the multimers of the invention are produced using techniques known in the art and included in the multimers. One or more intermolecular bridges may be formed between cysteine residues located within the sequence of the polypeptide desired to be processed (eg, US Pat. No. 5,478,925, which is incorporated herein by reference). Incorporated in its entirety as a reference)). Furthermore, the proteins of the invention may be routinely modified by the addition of cysteine or biotin to the C-terminus or N-terminus of this polypeptide, and techniques known in the art have been modified with one or more of these modifications. Can be applied to generate multimers containing polypeptides (
See, eg, US Pat. No. 5,478,925, which is incorporated herein by reference in its entirety). In addition, techniques known in the art can be applied to generate liposomes containing polypeptide components that are desired to be included in the multimers of the invention (eg, US Pat. No. 5,478,925, which is incorporated herein by reference). The disclosure of which is hereby incorporated by reference in its entirety)).

Alternatively, the multimers of the invention can be produced using genetic engineering techniques known in the art. In one embodiment, the polypeptides included in the multimers of the invention are recombinantly produced using fusion protein technology described herein or otherwise known in the art (eg, herein). See US Pat. No. 5,478,925, which is incorporated by reference in its entirety). In certain embodiments, a polynucleotide encoding a homodimer of the invention comprises a polynucleotide sequence encoding a polypeptide of the invention linked to a sequence encoding a linker polypeptide, and then further from the original C-terminus to the N-terminus. Produced by ligating to a synthetic polynucleotide (lacking a leader sequence) that encodes the translation product of the polypeptide in the opposite direction to that of (eg, US Pat. See Japanese Patent No. 5,478,925). In another embodiment, recombinant techniques described herein or otherwise known in the art are applied to include a transmembrane domain (or hydrophobic or signal peptide), and membrane reconstitution techniques. To produce a recombinant polypeptide of the invention that can be incorporated into liposomes (see, eg, US Pat. No. 5,478,925, which is incorporated herein by reference in its entirety).

Antibodies Further, a polypeptide of the invention is a polypeptide of SEQ ID NO: Y of the invention (as determined by immunoassays well known in the art for assaying specific antibody-antigen binding). , Polypeptide fragments, or variants, and / or
Alternatively, an antibody that immunospecifically binds to an epitope and a T cell antigen receptor (T
CR). The antibody of the present invention is a polyclonal antibody, a monoclonal antibody,
Multispecific antibodies, human antibodies, humanized or chimeric antibodies, single chain antibodies, Fab fragments, F (ab ') fragments, fragments produced by Fab expression libraries, anti-idiotype (anti-Id) antibodies (eg, (Including anti-Id antibodies against antibodies of the invention), and epitope binding fragments of any of the above, but not limited thereto. As used herein, the term "antibody" refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, ie, molecules that contain an antigen binding site that immunospecifically binds an antigen. Say. The immunoglobulin molecules of the invention can be of any type of immunoglobulin molecule (eg, IgG, IgE,
IgM, IgD, IgA, and IgY), any class (eg, IgG1,
IgG2, IgG3, IgG4, IgA1 and IgA2) or any subclass.

Most preferably, the antibody is a human antigen-binding antibody fragment of the invention, which comprises Fab, Fab 'and F (ab') 2, Fd, single chain Fvs (sc).
Fv), single chain antibodies, disulfide-bonded Fvs (sdFv) and VL or V
Examples include, but are not limited to, fragments that include any of the H domains. Antigen-binding antibody fragments, including single chain antibodies, may include variable regions alone or in combination with all or part of the following: hinge region, CH1 domain, C
H2 domain and CH3 domain. Also included in the invention are antigen binding fragments that also include any combination of variable and hinge regions, CH1 domains, CH2 domains and CH3 domains. Antibodies of the invention may be derived from any animal origin including birds and mammals. Preferably, the antibody is human, murine (eg, mouse and rabbit), donkey, ship rabbit (
ship rabbit), goat, guinea pig, camel, horse, or chicken. As used herein, "human" antibody includes antibodies having the amino acid sequence of human immunoglobulin and is transgenic for a human immunoglobulin library or one or more human immunoglobulins and Antibodies isolated from animals that do not express sex immunoglobulin (as described below and, eg, by Kucherlapati et al., US Pat. No. 5,939,598.
As described in No.).

Antibodies of the invention may be monospecific, bispecific, trispecific or of greater multispecificity. A multispecific antibody may be specific for different epitopes of a polypeptide of the invention, or both a polypeptide of the invention and a heterologous epitope (eg, a heterologous polypeptide or a solid support material). Can be specific to. For example, PCT Publication WO 93/17715; WO 9
2/08802; WO 91/00360; WO 92/05793; Tu
tt et al. Immunol. 147: 60-69 (1991); U.S. Pat. No. 4
, 474,893, 4,714,681, 4,925,648,
No. 5,573,920, No. 5,601,819; Kostelny et al.
J. Immunol. 148: 1547-1553 (1992).

The antibodies of the invention may be described or specified with respect to the epitopes or portions of the polypeptides of the invention to which they recognize or specifically bind. Portions of this epitope or polypeptide can be specified, for example, by N-terminal and C-terminal positions, as described herein by size in contiguous amino acid residues. Antibodies that specifically bind any epitope or polypeptide of the invention can also be excluded. Accordingly, the present invention includes antibodies that specifically bind the polypeptides of the present invention and allow for the exclusion of the polypeptides of the present invention.

The antibodies of the invention may also be described or specified for their cross-reactivity. Antibodies that do not bind any other analog, ortholog or homolog of a polypeptide of the invention are included. At least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 65%, at least 60%, at least 55% and at least 50% identity to the polypeptides of the present invention. An antibody that binds a polypeptide having (when calculated using methods known in the art and described herein) is also
Included in the present invention. In certain embodiments, the antibodies of the invention cross-react with human, mouse, rat and / or rabbit homologs of human proteins and their corresponding epitopes. 95 for polypeptides of the invention
%, Less than 90%, less than 85%, less than 80%, less than 75%, less than 70%, 65
Antibodies that do not bind polypeptides with less than 60%, less than 60%, less than 55% and less than 50% identity (as calculated using methods known in the art and methods described herein). Are also included in the present invention. In certain embodiments, the above cross-reactivity is any monospecific antigenic or immunogenic polypeptide disclosed herein, or 2, 3, 4, 5 or more specific. It relates to a combination of antigenic and / or immunogenic polypeptides. Further included in the invention is an antibody that binds the polypeptide encoded by the polynucleotide that hybridizes to the polynucleotide of the invention under hybridization conditions (as described herein). Antibodies of the invention may also be described or specified for their binding affinity for the polypeptides of the invention. Preferred binding affinity is less than 5 × 10 ⁻² M, less than 10 ⁻² M, less than 5 × 10 ⁻³ M, 10 ⁻³ M
Less than 5 × 10 ⁻⁴ M, less than 10 ⁻⁴ M, less than 5 × 10 ⁻⁵ M, less than 10 ⁻⁵ M, 5
Less than × 10 ^-6 M, less than 10 ^-6 M, less than 5 × 10 ^-7 M, less than 10 ^-7 M, less than 5 × 10 ^-8 M, less than 10 ^-8 M, less than 5 × 10 ^-9 M, 10 Less than ^-9 M, less than 5 × 10 ^-10 M, less than 10 ^-10 M, less than 5 × 10 ^-11 M, less than 10 ^-11 M, less than 5 × 10 ^-12 M, 1
0 less than ^-12 M, less than 5 × 10 ^-13 M, less than 10 ^-13 M, less than ^{5 × 10 -14 M, 10 -1} 4 below M, 5 × 10 ^-15 M or less than less than 10 ^-15 M dissociation Affinities with a constant or Kd are mentioned.

The present invention also includes antibodies to epitopes of the invention, as determined by any method known in the art for determining competitive binding (eg, immunoassays described herein). Antibodies that competitively inhibit the binding of In a preferred embodiment, the antibody is at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 60%, or at least 50% competitively bound to an epitope. Inhibit.

The antibodies of the invention can act as agonists or antagonists of the polypeptides of the invention. For example, the invention includes antibodies that disrupt the receptor / ligand interaction with a polypeptide of the invention either partially or completely. Preferably, the antibodies of the invention bind the antigenic epitopes disclosed herein, or portions thereof. The present invention features both receptor-specific and ligand-specific antibodies. The invention also features receptor-specific antibodies that do not interfere with ligand binding but interfere with receptor activation. Receptor activation (ie signal transduction) can be determined by the techniques described herein, or otherwise known in the art. For example, receptor activation can be determined by phosphorylating the receptor (eg, tyrosine or serine / threonine), or detecting its substrate by immunoprecipitation followed by Western blot analysis (eg, as described above). In certain embodiments, in the absence of the antibody, the ligand or receptor activity is at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 60% of its activity. %, Or at least 50% inhibition is provided.

The present invention also recognizes receptor-specific antibodies that interfere with both ligand binding and receptor activation, as well as receptor-ligand complexes, and, preferably, binds unbound receptor or unbound ligand. It has the characteristics of an antibody that does not recognize. Similarly, the present invention binds ligands and neutralizing antibodies that prevent the binding of ligands to receptors, and ligands, thereby preventing receptor activation, but not ligand binding to receptors. Contains antibodies. Further, the invention includes antibodies that activate the receptor. These antibodies may act as receptor agonists, ie enhance or activate either all or a subset of the biological activation of ligand-mediated receptor activation by, for example, inducing receptor dimerization. obtain. The antibody may be specified as an agonist, antagonist or inverse agonist for a biological activity, including the specific biological activity of the peptides of the invention disclosed herein. The antibody agonist can be produced using a method known in the art. For example, PCT Publication WO 96/40281; US Pat. No. 5,811,09
7; Deng et al., Blood 92 (6): 1981-1988 (1998).
Chen et al., Cancer Res. 58 (16): 3668-3678 (1
998); Harrop et al. Immunol. 161 (4): 1786-1
794 (1998); Zhu et al., Cancer Res: 58 (15): 320.
9-3214 (1998); Yoon et al., J. Am. Immunol. 160 (7):
3170-3179 (1998); Prat et al. Cell. Sci. 111
(Pt2): 237-247 (1998); Pitard et al. Immuno
l. Methods 205 (2): 177-190 (1997); Liaut
Ard et al., Cytokine 9 (4): 233-241 (1997); Car.
lson et al. Biol. Chem. 272 (17): 11295-1130.
1 (1997); Taryman et al., Neuron 14 (4): 755-76.
2 (1995); Muller et al., Structure 6 (9): 1153-.
1167 (1998); Bartunek et al., Cytokine 8 (1): 1.
4-20 (1996), all of which are incorporated herein by reference in their entirety.

Antibodies of the invention can be used, for example, but not limited to, to purify, detect, and target the polypeptides of the invention. These include both in vitro and in vivo diagnostic and therapeutic methods. For example, the antibody has use in immunoassays for qualitatively and quantitatively measuring the levels of polypeptides of the invention in biological samples. For example, Harl
ow et al., Antibodies: A Laboratory Manual, (
Cold Spring Harbor Laboratory Press,
2nd edition, 1988), which is hereby incorporated by reference in its entirety.

As discussed in further detail below, the antibodies of the invention can be used either alone or in combination with other compounds. The antibody can further be recombinantly fused to the heterologous polypeptide at the N-terminus or C-terminus to the polypeptide or other compound, or can be chemically linked (including covalent and non-covalent). For example, the antibodies of the present invention can be recombinantly fused or conjugated to effector molecules such as molecules and heterologous polypeptides, agents, radionuclides, or toxins that are useful as labels in detection assays. For example, PCT publication WO92 / 0849
5; WO91 / 14438; WO89 / 12624; US Pat. No. 5,314,9
95; and EP 396,387.

The antibodies of the invention are modified (ie, covalently attached).
attachment), by covalent attachment of any type of molecule to the antibody such that the antibody does not prevent it from producing an anti-idiotypic response. For example, without limitation, antibody derivatives include, for example, glycosylations, acetylations, pegylations, phosphorylations.
n), amidation, known blocking / blocking groups
Antibodies modified by derivatization with, proteolytic cleavage, ligation to cellular ligands or other proteins, and the like. Any of a number of chemical modifications can be performed by known techniques including, but not limited to, specific chemical cleavage, acetylation, formylation, metabolic synthesis of tunicamycin, and the like. In addition, the derivative may contain one or more non-classical amino acids.

The antibodies of the invention may be produced by any suitable method known in the art.
Polyclonal antibodies to the antigen of interest can be produced by various procedures well known in the art. For example, the polypeptides of the invention can be administered to a variety of host animals, including but not limited to rabbits, mice, rats, etc., to induce the production of serum containing polyclonal antibodies specific for the antigen. Various adjuvants can be used to increase the immunological response, depending on the host species, and Freund's (complete and incomplete), mineral gels such as aluminum hydroxide (mi
general gel), surface-active substances such as lysolecithin, pluronic (p
luuronic) polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, dinitrophenol, and BCG (calumet-
Bacillus gellan) and strongly useful human adjuvants such as corynebacterium parvum. Such adjuvants are also well known in the art.

Monoclonal antibodies can be prepared using a wide variety of techniques known in the art including the use of hybridoma, recombinant, and phage display techniques, or a combination thereof. For example, monoclonal antibodies can be produced using the hybridoma technology known in the art, including: Har
Low et al., Antibodies: A Laboratory Manual,
(Cold Spring Harbor Laboratory Press
, 2nd edition, 1988); Hammerling et al., Monoclonal An.
tibodies and T-Cell Hybridomas 563-6
81 (Elsevier, NY, 1981), which is incorporated by reference in its entirety. As used herein, the term "
The term "monoclonal antibody" is not limited to antibodies produced through hybridoma technology. The term "monoclonal antibody" refers to an antibody that is derived from a single clone, including any eukaryotic, prokaryotic, or phage clone, and not the method by which the monoclonal antibody is produced.

Methods for producing and screening for particular antibodies using hybridoma technology are routine and well known in the art and discussed in detail in the Examples. In a non-limiting example, mice can be immunized with the polypeptides of the invention or cells expressing such peptides. Once an immune response is detected (eg, an antibody specific for the antigen is detected in mouse serum)
The mouse spleen is harvested and splenocytes are isolated. The splenocytes are then fused by well known techniques to any suitable myeloma cells, such as cells from cell line SP20 available from the ATCC. Hybridomas are selected and cloned by limiting dilution. The hybridoma clones are then assayed for cells secreting antibodies capable of binding the polypeptides of the invention by methods known in the art. Ascites fluid, which generally contains high levels of antibodies, can be produced by immunizing mice with positive hybridoma clones.

Accordingly, the present invention provides a method for producing a monoclonal antibody, and an antibody produced by a method comprising culturing hybridoma cells secreting the antibody of the present invention, wherein, preferably, this antibody is The hybridoma is a hybridoma clone that secretes an antibody capable of binding the peptide of the present invention by fusing splenocytes isolated from a mouse immunized with the antigen of the present invention having myeloma cells, and then, Produced by screening the hybridomas that result from the fusion.

Antibody fragments that recognize particular epitopes can be produced by known techniques. For example, Fab and F (ab ') 2 fragments of the invention may be papain (to produce Fab fragments) or pepsin (F (ab').
Enzymes) to produce 2 fragments) and can be produced by proteolytic cleavage of immunoglobulin molecules. F (ab ′) 2 fragments contain the variable region, the light chain constant region and the CH1 domain of the heavy chain.

For example, the antibodies of the present invention can also be produced using various phage display methods known in the art. In phage display methods, functional antibody domains are displayed on the surface of phage particles which carry the polynucleotide sequences encoding them. In certain embodiments, such phage may be cloned into a repertoire antibody library or a combinatorial antibody library (eg,
It can be used to display an antigen binding domain expressed from human or mouse). Phage expressing an antigen binding domain that binds an antigen of interest may be selected or identified with the antigen (eg, using labeled antigen or antigen bound or captured on a solid surface or solid beads). . Phage used in these methods are typically phage having the antibody domain of Fab, Fv or disulfide stabilized Fv recombinantly fused to either the phage gene III protein or the phage gene VIII protein. Is a filamentous phage containing the fd and M13 binding domains expressed from E. coli. Examples of phage display methods that can be used to generate the antibodies of the invention include those disclosed below: Brinkman et al.
Immunol. Methods 182: 41-50 (1995); Ames
Et al., J. Immunol. Methods 184: 177-186 (1995)
); Kettleborough et al., Eur. J. Immunol. 24:95
2-958 (1994); Persic et al., Gene 187 9-18 (19).
97); Burton et al., Advances in Immunology 5
7: 191-280 (1994); PCT published PCT / GB91 / 01134
PCT publication WO90 / 02809; WO91 / 10737; WO92 / 01
047; WO92 / 18619; WO93 / 11236; WO95 / 15982.
WO95 / 20401; and US Pat. No. 5,698,426;
No. 223,409; No. 5,403,484; No. 5,580,717; No. 5,427,908; No. 5,750,753; No. 5,821,047.
No. 5,571,698; No. 5,427,908; No. 5,516.
No. 637; No. 5,780,225; No. 5,658,727; No. 5,7.
33,743 and 5,969,108, each of which is incorporated by reference in its entirety.

As described in the above references, after phage selection, the region encoding the phage-derived antibody is used to generate whole antibodies, including human antibodies, or any other desired antigen-binding fragment. And can be expressed in any desired host, including, for example, mammalian cells, insect cells, plant cells, yeast and bacteria, as described in detail below. For example, techniques for recombinantly producing Fab, Fab 'and F (ab') 2 fragments can also be used using methods known in the art. This method is, for example, the method disclosed below: PCT Publication WO 92/22324; Mullinax et al., Bio.
Techniques 12 (6): 864-869 (1992); and Sa.
wai et al., AJRI 34: 26-34 (1995); and Better et al.
Science 240: 1041-1043 (1998) (the above references are incorporated by reference in their entirety).

Examples of techniques that can be used to produce single chain Fvs and antibodies include US Pat. Nos. 4,946,778 and 5,258,498; Huston.
Et al., Methods in Enzymology 203: 46-88 (19.
91); Shu et al., PNAS 90: 7995-7999 (1993); and Skerra et al., Science 240: 1038-1040 (1988). For some applications, including in vivo use of antibodies in humans and in vitro detection assays, the use of chimeric, humanized or human antibodies may be preferred. A chimeric antibody is a molecule in which different portions of this antibody are derived from different animal species (eg, an antibody having variable regions derived from mouse monoclonal antibodies and human immunoglobulin constant regions). Methods for producing chimeric antibodies are known in the art. For example, Morrison, S
science 229: 1202 (1985); Oi et al., BioTechniq.
ues 4: 214 (1986); Gillies et al., (1989) J. Am. Imm
unol. Methods 125: 191-202; and US Pat. No. 5,8.
07,715; 4,816,567; and 4,816,397, which are hereby incorporated by reference in their entireties. Humanized antibodies are antibody molecules from non-human species antibodies that bind a desired antigen having one or more complementarity determining regions (CDRs) from non-human species and framework regions from human immunoglobulin molecules. Often, framework residues in the human framework regions will be substituted with the corresponding residue from the CDR donor antibody to alter (preferably improve) antigen binding. These framework substitutions have been identified by methods well known in the art, for example modeling interactions between CDRs and framework residues to identify framework residues important for antigen binding, as well as specific positions. By sequence comparison to identify unusual framework residues in. (For example, Queen et al., US Pat. No. 5,585,089; Riechm.
See Ann, et al., Nature 332: 323 (1988), which are incorporated herein by reference in their entirety). Antibodies can be humanized using various techniques known in the art including, for example: CDR-grafting (European Patent 239,400; PCT Publication WO 91).
/ 09967; U.S. Pat. Nos. 5,225,539; 5,530,101 and 5,585,089), veneering or resurfacing (European patent 592). 106; European Patent 519,596; Padlan, Molecular Immu.
28 (4/5): 489-498 (1991); Stdni
Cka et al., Protein Engineering 7 (6): 805-81.
4 (1994); Roguska et al., PNAS 91: 969-973 (199.
4)), and chain shuffling (
U.S. Pat. No. 5,565,332).

Fully human antibodies are particularly desirable for therapeutic treatment of human patients. Human antibodies can be made by a variety of methods known in the art, including the phage display methods described above using antibody libraries derived from human immunoglobulin sequences. U.S. Pat. Nos. 4,444,887 and 4,716
, 111; and PCT publications WO98 / 46645, WO98 / 50433.
, WO98 / 24893, WO98 / 16654, WO96 / 34096, WO
See also 96/33735, and WO 91/10741, each of which is incorporated herein by reference in its entirety.

Human antibodies can also be produced using transgenic mice that are incapable of expressing functional endogenous immunoglobulins but are capable of expressing human immunoglobulin genes. For example, a complex of human heavy and light chain immunoglobulin genes can be introduced randomly or by homologous recombination into mouse embryonic stem cells. Alternatively, human variable regions, constant regions and diversity regions (diversity)
region) can be introduced into mouse embryonic stem cells in addition to the human heavy chain gene and human light chain gene. The mouse heavy and light chain immunoglobulin genes can be rendered non-functional separately or simultaneously with the introduction of human immunoglobulin loci by homologous recombination. In particular, homozygous deletions in the JH region interfere with endogenous antibody production. The modified embryonic stem cells are expanded and microinjected into blastocysts to produce chimeric mice. The chimeric mouse is then bred to produce homozygous offspring that express human antibodies. Transgenic mice are immunized in the normal fashion with a selected antigen (eg, all or part of a polypeptide of the invention). Monoclonal antibodies against the antigen can be obtained from immunized, transgenic mice using conventional hybridoma technology. Human immunoglobulin transgenes are harbored by rearrangement of transgenic mice during B cell differentiation and then undergo class switching and somatic mutations. Thus, the use of such techniques allows for the production of therapeutically useful IgG, IgA, IgM and IgE antibodies. For an overview of this technology for producing human antibodies, see Lo
nberg and Huszar, Int. Rev. Immunol. 13:65
-93 (1995). For a detailed discussion of this technique for producing human antibodies and human monoclonal antibodies, as well as protocols for producing such antibodies, see, eg, PCT Publication WO98 / 24893; WO92.
/ 01047; WO96 / 34096; WO96 / 33735; European Patent No. 0.
598 877; U.S. Pat. Nos. 5,413,923; 5,625,126; 5,633,425; 5,569,825; 5,661,0.
No. 16; No. 5,545,806; No. 5,814,318; No. 5,88.
5,793,5,916,771; and 5,939,598, which are incorporated herein by reference in their entireties. In addition, Abgenix, Inc. (Freemont, CA) and Genpha
Companies such as rm (San Jose, CA) may be engaged in providing human antibodies to selected antigens using techniques similar to those described above.

Human antibodies that fully recognize the selected epitope were "guided (gui).
ed) selection ”. In this approach,
Selected non-human monoclonal antibodies (eg, murine antibodies) are used to guide the selection of human antibodies that fully recognize the same epitope (Jespers et al., Bio / technology 12: 899-903 (1988)).

Furthermore, antibodies against the polypeptides of the present invention can in turn be utilized to generate anti-idiotypic antibodies that "mimic" the polypeptides of the present invention, using techniques well known to those of skill in the art. (Eg Greenspan and Bona, FASE
BJ. 7 (5): 437-444 (1989); and Nissinoff.
J. Immunol. 147 (8): 2429-2438 (1991)). For example, binding and multimerization of polypeptides.
antibody and / or an antibody that competitively inhibits the binding of the polypeptide of the invention to a ligand is used to "mimic" the multimerization and / or binding domain of the polypeptide and, as a result, the polypeptide and / or
Alternatively, it may generate an anti-idiotype that binds to and neutralizes its ligand.
Such neutralizing anti-idiotypes or Fab fragments of such anti-idiotypes can be used in therapeutic regimens to neutralize polypeptide ligands. For example, such an anti-idiotype antibody may be used to bind a polypeptide of the invention and / or to bind its ligand / receptor,
Thereby, its biological activity may be blocked.

Polynucleotide Encoding Antibodies The present invention further provides polynucleotides comprising nucleotide sequences encoding the antibodies of the present invention and fragments thereof. The invention also provides that under stringent conditions or lower stringency hybridization conditions (
(For example, as described above), a polynucleotide encoding an antibody (preferably an antibody that specifically binds to the polypeptide of the present invention), preferably an antibody that binds to a polynucleotide having the amino acid sequence of SEQ ID NO: Y. A polynucleotide that encodes the polynucleotide.

These polynucleotides can be obtained and the nucleotide sequence of these polynucleotides determined by any method known in the art. For example, if the nucleotide sequence of the antibody is known, the polynucleotide encoding the antibody can be assembled from chemically synthesized oligonucleotides (eg, Kutmeier et al., BioTechniques 17: 242 (199).
4)), which, in brief, is the synthesis of overlapping nucleotides containing portions of the antibody-encoding sequence, the annealing and ligation of those oligonucleotides, and then this ligation by PCR. Including amplification of the oligonucleotide.

Alternatively, the polynucleotide encoding the antibody can be made from nucleic acid from an appropriate source. No clone containing a nucleic acid encoding a particular antibody is available, but if the sequence of the antibody molecule is known, the nucleic acid encoding the immunoglobulin is
It can be chemically synthesized or from a suitable source (eg, an antibody cDNA library, or any tissue or cell expressing the antibody (eg, a hybridoma cell selected for expression of an antibody of the invention)). The generated cDNA library, or a nucleic acid isolated from it (preferably poly A + RNA), can be used, for example, to identify a cDNA clone from a cDNA library encoding an antibody at the 3'end and 5 It can be obtained by PCR amplification using synthetic primers hybridizable to the'end or by cloning using an oligonucleotide probe specific for that particular gene sequence. PC
The amplified nucleic acid produced by R can then be cloned into a replicable cloning vector using any method known in the art.

Once the antibody nucleotide sequence and corresponding amino acid sequence are determined,
Nucleotide sequences of antibodies can be prepared by methods well known in the art for manipulation of nucleotide sequences (eg, recombinant DNA technology, site-directed mutagenesis, PCR, etc. (eg,
Sambrook et al., 1990, Molecular Cloning, AL.
Laboratory Manual, 2nd Edition, Cold Spring Har
bor Laboratory, Cold Spring Harbor, NY
And Ausubel et al., 1998, Current Protocols.
in Molecular Biology, John Wiley & Sons
, NY. Both are incorporated herein by reference in their entirety. )) Can be engineered with to produce antibodies with different amino acid sequences to generate, for example, amino acid substitutions, deletions, and / or insertions.

In certain embodiments, the amino acid sequences of the variable domains of the heavy and / or light chains are used to identify the sequence of complementarity determining regions (CDRs) by methods well known in the art, eg, other methods. By comparing the known amino acid sequences of the variable regions of the heavy and light chains to determine the sequence hypervariable regions. Conventional recombinant DNA
Using techniques, one or more CDRs can be inserted within a framework region, eg, within a human framework region to humanize a non-human antibody, as described above. This framework region may be a naturally occurring or common framework region, and preferably a human framework region (for a list of human framework regions see, eg, Chothia et al., J. Mol. Bi.
ol. 278: 457-479 (1998)). Preferably, the polynucleotide produced by the combination of the framework regions and the CDRs is
Encodes an antibody that specifically binds to a polypeptide of the invention. Preferably, one or more amino acid substitutions occur within the framework regions, as discussed above, and preferably the amino acid substitutions improve binding of the antibody to its antigen. In addition, such methods provide antibodies that lack one or more intrachain disulfide bonds, either for amino acid substitutions or by deleting one or more variable region cysteine residues that participate in intrachain disulfide bonds. It can be used to generate molecules. Other modifications to the polypeptide are accomplished by the present invention and techniques in the art.

Furthermore, by splicing a gene from a mouse antibody molecule of suitable antigen specificity with a gene from a human antibody molecule of suitable biological activity, "
Chimeric antibody "(Morrison et al., Proc. Natl. Acad. Sci.
81: 851-855 (1984); Neuberger et al., Nature 3
12: 604-608 (1984); Takeda et al., Nature 314:
Techniques developed for the production of 452-454 (1985)) can be used. As mentioned above, a chimeric antibody is a molecule in which different parts are derived from different animal species (
For example, a molecule having a variable region derived from a mouse mAb and a human immunoglobulin constant region), for example, a humanized antibody.

Alternatively, techniques described for the production of single chain antibodies (US Pat. No. 4,946)
, 778; Bird, Science 242: 423-42 (1998);
Huston et al., Proc. Natl. Acad. Sci. USA 85:58
79-5883 (1998); and Ward et al., Nature 334: 54.
4-54 (1989)) can be adapted to produce single chain antibodies. Single chain antibodies are formed by linking the heavy and light chain fragments of the Fv region via amino acid bridges to produce a single chain polypeptide. E. Techniques for the assembly of functional Fv fragments in E. coli can also be used (Sk
erra et al., Science 242: 1038-1041 (1998)).

Methods of Antibody Production The antibodies of the invention may be produced by methods known in the art for antibody synthesis, in particular by chemical synthesis, or preferably by recombinant expression techniques.

Antibodies of the invention, or fragments, derivatives or analogs thereof (eg,
Recombinant expression of the heavy or light chain of an antibody of the invention, or a single chain antibody of the invention) requires the construction of an expression vector containing a polynucleotide encoding the antibody.
Once the polynucleotide encoding the antibody molecule or the heavy or light chain of the antibody, or a portion thereof (preferably comprising the variable domain of the heavy or light chain) of the invention is obtained, for the production of the antibody molecule. Vectors can be produced by recombinant DNA technology using techniques well known in the art. Thus, methods for preparing a protein by expression of a polynucleotide containing an antibody encoding a nucleotide sequence are described herein. Methods well known to those of skill in the art can be used to construct expression vectors containing antibody coding sequences and appropriate transcriptional and translational control signals. These methods include, for example, in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Accordingly, the invention provides a replicable vector comprising a nucleotide sequence encoding an antibody molecule of the invention, or a heavy or light chain thereof, or a heavy or light chain variable domain operably linked to a promoter. provide. Such a vector comprises a nucleotide sequence encoding the constant region of an antibody molecule (see, eg, PCT International Publication No. WO 86/058).
07; PCT International Publication No. WO 89/01036; and US Pat. No. 5,12.
See 2,464. ), And the variable region of the antibody can then be cloned into such a vector for full expression of the heavy or light chain.

The expression vector is transferred into a host cell by conventional techniques and the transfected cells are then cultured by conventional techniques to produce the antibody of the invention.
Accordingly, the invention includes a host cell containing a single chain antibody of the invention operably linked to a polynucleotide encoding an antibody of the invention, or its heavy or light chain, or a heterologous promoter. In a preferred embodiment for expression of double-chain antibodies, vectors encoding both heavy and light chains may be co-expressed in a host cell for expression of whole immunoglobulin molecules, as detailed below. .

A variety of host expression vector systems may be utilized to express the antibody molecule of the present invention. Such host expression systems represent vehicles in which the coding sequence of interest may be produced and subsequently purified, but also in situ when transformed or transfected with sequences encoding the appropriate nucleotides. 2 represents a cell capable of expressing an antibody molecule of the invention. These include, but are not limited to: Bacteria transformed with recombinant bacteriophage DNA expression vectors, plasmid DNA expression vectors or cosmid DNA expression vectors containing antibody-encoding sequences (eg, Microorganisms such as E. coli, B. subtilis); yeast transformed with a recombinant yeast expression vector containing antibody-encoding sequences (eg, Saccharomyces, Pichia); recombinant viral expression containing antibody-encoding sequences Insect cell lines infected with vectors (eg baculovirus); Plant cell lines infected with recombinant viral expression vectors (eg cauliflower mosaic virus, CaMV; Tobacco mosaic virus, TMV) or recombinants containing sequences encoding antibodies. Plastic Bromide expression vector (for example,
A plant cell line transformed with a Ti plasmid), or a promoter derived from the genome of a mammalian cell (eg, metallothionein promoter) or a promoter derived from a mammalian virus (eg, adenovirus late promoter; vaccinia virus 7.5K). A mammalian cell line carrying a recombinant expression construct comprising a promoter (eg COS, CHO, BHK, 293, 3T3 cells). Preferably bacterial cells such as Escherichia coli, and more preferably eukaryotic cells, especially for the expression of whole recombinant antibody molecules, are used for the expression of the recombinant antibody molecules. For example, mammalian cells such as Chinese hamster ovary cells (CHO) in combination with vectors such as the major immediate early gene promoter element from human cytomegalovirus are effective expression systems for antibodies. (Föcking et al., Gene 45:10.
1 (1986); Cockett et al., Bio / Technology 8: 2 (
1990)).

In bacterial systems, many expression vectors may be advantageously selected depending upon the use intended for the expression of the antibody molecule. For example, if large quantities of such proteins are produced, vectors that direct high levels of expression of fusion protein products that are easily purified may be desired for the production of pharmaceutical compositions of antibody molecules. Such vectors include, but are not limited to: the antibody coding sequence in frame with the lacZ coding region in the vector.
Can be individually ligated together, resulting in the production of a fusion protein in E. coli. coli expression vector pUR278 (Ruther et al., EMBO J. 2: 1791 (198).
3)); pIN vector (Inouye & Inouye, Nucleic Ac)
ids Res. 13: 3101-3109 (1985); Van Heeke.
& Schuster, J .; Biol. Chem. 24: 5503-5509 (1
989)) and so on. The pGEX vector can also be used to express foreign polypeptides as a fusion protein with glutathione S-transferase (GST). In general, such fusion proteins are soluble and can be easily purified from lysed cells by adsorption and binding to matrix glutathione-agarose beads followed by elution in the presence of free glutathione. The pGEX vector was designed to contain a thrombin or Factor Xa protease cleavage site so that the cloned target gene product is G
It can be released from the ST moiety.

In an insect system, Autographa californica nuclear polyhedrosis virus (AcNPV) is used as a vector to express heterologous genes. This virus grows in Spodoptera frugiperda cells. The antibody coding sequences can be individually cloned into non-essential regions of the virus (eg the polyhedrin gene) and placed under control of the AcNPV promoter (eg the polyhedrin promoter).

In mammalian host cells, a number of virus-based expression systems are available. When an adenovirus is used as an expression vector, the sequence encoding the antibody of interest may be linked to the adenovirus transcription / translation control complex, such as the late promoter and a three-part leader sequence. Then
This chimeric gene can be inserted into the adenovirus genome by in vitro or in vivo recombination. Insertions in nonessential regions of the viral genome (eg, E1 or E3 regions) result in recombinant viruses that are viable and capable of expressing antibody molecules in infected hosts (eg, Logan & Shenk).
, Proc. Natl. Acad. Sci. USA 81: 355-359 (1
984)). Specific initiation signals may also be required for efficient translation of inserted antibody coding sequences. These signals are ATG
It includes a start codon and adjacent sequences. In addition, this initiation codon ensures that translation of the entire insert is ensured by the reading frame of the desired coding sequence (
must be in phase with the reading frame). These exogenous translational control signals and initiation codons can be of various origins, both natural and synthetic. The efficiency of expression can be enhanced by the inclusion of appropriate transcription enhancer elements, transcription terminators, etc. (Bittner et al. Methods i).
n Enzymol. 153: 51-544 (1987)).

In addition, a host cell line may be chosen which modulates the expression of the inserted sequences or modifies and processes the gene product in the specific fashion desired.
Such modifications (eg glycosylation) and processing of protein products (
Cleavage, for example) can be important for the function of the protein. Different host cells have characteristic and specific mechanisms for post-translational processing and modification of proteins and gene products. Appropriate cell lines or host systems can be chosen to ensure the correct modification and processing of the foreign protein expressed. To this end, eukaryotic host cells can be used that have the cellular machinery for the precise processing of primary transcription, glycosylation, and phosphorylation of the gene product. Such mammalian host cells include CHO, VERY, BHK, Hela,
COS, MDCK, 293, 3T3, WI38, and especially, for example, BT48
3, breast cancer cell lines such as Hs578T, HTB2, BT20 and T47D, and normal breast cell lines such as, for example, CRL7030 and Hs578Bst.

Long-term, high-yield production of recombinant proteins, stable expression is preferred. For example, cell lines that stably express the antibody molecule can be engineered. Rather than using an expression vector that includes a viral origin of replication, the host cell may employ suitable expression control elements (e.g., promoters, enhancers, sequences, transcription terminators, polyadenylation sites,
Etc.), and DNA controlled by the selectable marker. Following the introduction of exogenous DNA, the engineered cells can be grown in enriched medium for 1-2 days and then switched to selective medium. The selectable marker in the recombinant plasmid confers resistance to selection, and the cell stably integrates the plasmid into its chromosome and proliferates to form cell foci, which in turn can be cloned into a cell line. To be able to be expanded to. This method can be advantageously used to engineer cell lines that express antibody molecules. Such engineered cell lines may be particularly useful in screening and evaluation of compounds that interact directly or indirectly with the antibody molecule.

A number of selection systems may be used, including herpes simplex virus thymidine kinase (Wigler et al., Cell 11: 223 (1977)), hypoxanthine-guanine phosphoribosyl transferase (Szybalska & Sz.
ybalski, Proc. Natl. Acad. Sci. USA 48:20
2 (1992)), and adenine phosphoribosyl transferase (Low
y et al., Cell 22: 817 (1980)), but without limitation, these genes may be used in tk-, hgprt- or aprt- cells, respectively. Antimetabolite resistance can also be used as a basis for selection of the following genes: dhfr, which confers resistance to methotrexate (Wig.
ler et al., Natl. Acad. Sci. USA 77: 357 (1980);
O'Hare et al., Proc. Natl. Acad. Sci. USA 78:15.
27 (1981)); gpt, which confers resistance to mycophenolic acid (
Mulligan & Berg, Proc. Natl. Acad. Sci. USA
78: 2072 (1981)); neo, which is the aminoglycoside G-418.
(Clinical Pharmacy 12: 488-
505; Wu and Wu, Biotherapy 3: 87-95 (199).
1); Tolstoshev, Ann. Rev. Pharmacol. Toxi
col. 32: 573-596 (1993); Mulligan, Science.
Ce 260: 926-932 (1993); and Morgan and A.
nderson, Ann. Rev. Biochem. 62: 191-217 (1
993); May, 1993, TIB TECH 11 (5): 155-21.
5); and hygro, which confers resistance to hygromycin (S
anterre et al., Gene 30: 147 (1984)). Methods well known in the field of recombinant DNA technology can be routinely applied to select the desired recombinant clones, and such methods are described below: eg Ausub.
el et al. (ed.), Current Protocols in Molecular
r Biology, John Wiley & Sons, NY (1993); K
riegler, Gene Transfer and Expression
, A Laboratory Manual, Stockton Press,
NY (1990); and Chapters 12 and 13, Dracopoli et al. (Eds.).
, Current Protocols in Human Genetics
, John Wiley & Sons, NY (1994); Colberre-G.
arapin et al. Mol. Biol. 150: 1 (1981), which are incorporated herein by reference in their entirety.

Expression levels of antibody molecules can be increased by vector amplification (for review,
Bebington and Hentschel, The use of ve
ctors based on gene amplification fo
r the expression of cloned genes in
mammalian cells in DNA cloning, Vol. Three
． (See Academic Press, New York, 1987). When the marker in the vector system expressing the antibody is amplifiable, an increase in the level of inhibitor present in the culture of the host cell will increase the number of copies of the marker gene. Since the amplified region is linked to the antibody gene, antibody production is also increased (Crouse et al., Mol. Cell. Biol. 3: 257.
(1983)).

A host cell may be co-transfected with two expression vectors of the invention, a first vector encoding a polypeptide from the heavy chain and a second vector encoding a polypeptide from the light chain. . The two vectors may contain identical selectable markers which enable equal expression of heavy and light chain polypeptides. Alternatively, a single vector may be used, which encodes and expresses both heavy and light chain polypeptides. In such situations, the light chain should be placed before the heavy chain to avoid excess toxic free heavy chain (Pr
audfoot, Nature 322: 52 (1986); Kohler, P.
roc. Natl. Acad. Sci. USA 77: 2197 (1980)).
. The coding sequences for the heavy and light chains may include cDNA or genomic DNA.

Once the antibody molecule of the present invention is produced by an animal, chemically synthesized, or recombinantly expressed, any of the art-known methods for the purification of immunoglobulin molecules. Methods such as chromatography (eg, ion exchange,
It can be purified by affinity (particularly by affinity for protein A followed by specific antigen), and size column chromatography), centrifugation, differential solubility, or any other standard technique for protein purification.
Furthermore, the antibodies of the present invention or fragments thereof can be fused to heterologous polypeptide sequences described herein or otherwise known in the art to facilitate purification.

The present invention provides a polypeptide of the invention (or a portion thereof, preferably at least 10, 20, 30, 40, 50, 60, 70, 80, 90 of this polypeptide,
Or 100 amino acids), recombinantly fused or chemically linked (including both covalent and non-covalent bonds) to produce a fusion protein. The fusion need not be direct, but can occur via a linker sequence. The antibody is a polypeptide of the invention (or a portion thereof, preferably at least 10, 20, 30, 40, 50, 60, 70,
(80, 90, or 100 amino acids). For example, targeting a polypeptide of the invention to a particular cell type, either in vitro or in vivo, by fusing or conjugating the polypeptide of the invention to an antibody specific for a particular cell surface receptor. Antibodies can be used to Antibodies fused or conjugated to the polypeptides of the invention can also be used in in vitro immunoassays and purification methods using methods known in the art. See, eg, Harbor et al., Supra, and PCT Publication WO 93/21.
232; EP 439,095; Naramura et al., Immunol. Lett
． 39: 91-99 (1994); U.S. Patent No. 5,474,981; Gill.
ies et al., PNAS 89: 1428-1432 (1992); Fell et al., J.
． Immunol. 146: 2446-2452 (1991). These are incorporated by reference in their entirety.

The invention further includes compositions comprising a polypeptide of the invention fused or linked to a domain other than the variable region of an antibody. For example, the polypeptides of the invention can be fused or conjugated to the Fc region of an antibody, or a portion thereof. The part of this antibody fused to the polypeptide of the invention comprises the constant region, hinge region, CH1 domain, C
It may include the H2 domain, and the CH3 domain, or any combination of whole domains or portions thereof. These polypeptides can also be fused or conjugated to portions of the above antibodies to form multimers. For example, an Fc portion fused to a polypeptide of the invention can form a dimer through a disulfide bond between the Fc portions. Higher multimeric forms can be made by fusing the polypeptide to portions of IgA and IgM. Methods for fusing or conjugating the polypeptides of the invention to antibody moieties are known in the art. For example, US Pat. Nos. 5,336,603; 5,622,929; 5,359,04.
No. 6, No. 5,349,053; No. 5,447,851; No. 5,112.
, 946; EP 307,434; EP 367,166; PCT publication WO9.
6/04388; WO91 / 06570; Ashkenazi et al., Proc. N
atl. Acad. Sci. USA 88: 10535-10539 (1991).
); Zheng et al. Immunol. 154: 5590-5600 (199
5); and Vil et al., Proc. Natl. Acad. Sci. USA 89
: 11337-11341 (1992) (the above references are incorporated by reference in their entireties).

As discussed above, the polypeptide corresponding to the polypeptide, polypeptide fragment, or variant of SEQ ID NO :, is to increase the in vivo half-life of the polypeptide, or It can be fused or conjugated to the above antibody moieties for use in immunological assays using methods known in the art.
In addition, the polypeptide corresponding to SEQ ID NO: Y can be fused or conjugated to the antibody portion described above to facilitate purification. One reported example describes a chimeric protein consisting of the first two domains of the human CD4 polypeptide and various domains of the constant region of the heavy or light chain of mammalian immunoglobulins (E
P 394,827; Traunecker et al., Nature 331: 84-.
86 (1988)). Polypeptides of the invention fused or conjugated to an antibody having a disulfide-linked dimer structure (due to IgG) also bind to other molecules than monomeric secreted proteins or protein fragments alone. And may be more efficient at neutralizing (Funtoulakis et al., J. Bio.
chem. 270: 3958-3964 (1995)). In many cases, the Fc portion of fusion proteins may be beneficial in therapy and diagnosis, thus resulting, for example, in improved pharmacokinetic properties (EP A 232,262). Alternatively, it may be desirable to delete the Fc portion after the fusion protein has been expressed, detected and purified. For example, if the fusion protein is used as an antigen for immunization, the Fc portion may interfere with therapy and diagnosis. For example, in drug discovery, human proteins such as hIL-5 have been used for the purpose of high throughput screening assays to identify antagonists of hIL-5.
has been fused to the c moiety (Bennett et al., J. Molecular Rec.
ignition 8: 52-58 (1995); Johnson et al., J. Am. B
iol. Chem. 270: 9459-9471 (1995)).

Further, the antibodies of the invention or fragments thereof may be fused to a marker sequence, such as a peptide that facilitates purification. In a preferred embodiment, the marker amino acid sequence is inter alia a hexa-histidine peptide (eg pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chats.
The tag, provided by W. Worth, CA, 91311), and many of these marker amino acid sequences are commercially available. For example, Gentz et al., Proc
． Natl. Acad. Sci. Hexa-histidine provides convenient purification of fusion proteins, as described in USA 86: 821-824 (1989). Another peptide tag useful for purification is the "HA" tag (Wilson et al., Ce, which corresponds to an epitope derived from the influenza hemagglutinin protein.
ll 37: 767 (1984)), and "flag" tags.

The present invention further includes an antibody or fragment thereof conjugated to a diagnostic or therapeutic agent. Antibodies can be used diagnostically, for example, to monitor tumor development or progression as part of a clinical testing procedure (eg, to determine the efficacy of a given treatment regimen). Detection can be facilitated by coupling the antibody to a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent substances, luminescent substances, bioluminescent substances, radioactive substances,
Positron emitting metals using various positron emission tomography, and non-radioactive paramagnetic metal ions. The detectable substance is either directly or indirectly directed to the antibody (or fragment thereof) by a mediator using techniques known in the art, such as linkers known in the art. Can be linked or conjugated via. See, eg, US Pat. No. 4,741,900 for metal ions that can be conjugated to antibodies for use as diagnostics according to the present invention. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin / biotin and avidin / biotin; Examples of suitable fluorescent substances include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; examples of luminescent substances include luminol; bioluminescent substances Examples of luciferase include luciferase, luciferin and aequorin; and examples of suitable radioactive substances include ¹²⁵ I, ¹³¹ I, ¹¹¹ In or ⁹⁹ Tc.
Is mentioned.

Further, the antibody or fragment thereof may be used in therapeutic moieties (eg cytotoxins (eg cytostatic or cytotoxic agents)), therapeutic agents or radioactive metal ions (eg α-emitters (eg 213Bi)). Etc.). Cytotoxic or cytotoxic agents include any agent that is harmful to cells. Examples include paclitaxel, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, teniposide (t
Enoposide), vincristine, vinblastine, colchicine (col)
chicin), doxorubicin, daunorubicin, dihydroxyanthracin dione, mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone,
Glucocorticoids, procaine, tetracaine, lidocaine, propranolol, and puromycin, and analogs or homologues thereof. The therapeutic agent may be an antimetabolite (eg, methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracildecarbazine (5
-fluorouracil decarbazine), alkylating agents (e.g., mechlorethamine, thioepa (thioepa) chlorambucil, melphalan, carmustine (BSNU) and lomustine (CCNU), cyclophosphamide (cyclothosphamide), busulfan, dibromomannitol, streptozotocin, mitomycin C, And cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines (eg daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (eg dactinomycin (formerly actinomycin), bleomycin, mithramycin, And anthramycin (AMC),
And anti-mitotic agents such as vincristine and vinblastine, but are not limited thereto.

The conjugates of the invention can be used to modify a given biological response and the therapeutic agent or drug moiety is not construed as limited to classical chemotherapeutic agents. For example, the drug moiety can be a protein or polypeptide that has the desired biological activity. Such proteins include, for example, toxins (eg, abrin, ricin A, pseudomonas exotoxin, or diphtheria toxin); proteins (eg,
Tumor necrosis factor, a-interferon, β-interferon, nerve growth factor,
Platelet-derived growth factor, tissue plasminogen activator, apoptotic drug (eg TNF-α, TNF-β, AIM I (International Publication No. WO97 / 338).
99), AIM II (see WO 97/34911), Fas ligand (Takahashi et al., Int. Immunol).
． 6: 1567-1574 (1994)), VEGI (International Publication No. WO99 / 2).
3105)), thrombotic or anti-angiogenic agents (eg, angiostatin or endostatin); or biological response modifiers (eg, lymphokines, interleukin-1 (“IL-1”)). , Interleukin-2 ("
IL-2 "), interleukin-6 (" IL-6 "), granulocyte macrophage colony stimulating factor (" GM-CSF "), granulocyte colony stimulating factor (" G-CS ").
F "), or other growth factors).

The antibody can also be attached to a solid support, which is particularly useful for immunoassay or purification of the target antigen. Such solid supports include, but are not limited to, glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride or polypropylene.

Techniques for conjugating such therapeutic moieties to antibodies are well known, eg Arn.
on et al., “Monoclonal Antibodies For Immun.
targeting Of Drugs In Cancer Therap
y ”Monoclonal Antibodies And Cancer T
cure, Reisfeld et al. (eds.), pp. 243-56 (Alan RL
iss, Inc. 1985); Hellstrom et al., "Antibodies.
For Drug Delivery "Controlled Drug D
release (2nd edition), Robinson et al. (eds.), pp. 623-53 (Ma.
rcel Dekker, Inc. 1987); Thorpe, "Antibo
dy Carriers Of Cytotoxic Agents In C
cancer Therapy: A Review "Monoclonal An
tibodies'84: Biological And Clinical
Applications, Pinchera et al. (Eds.), Pp. 475-506 (1
985); "Analysis, Results, And Future Pr.
Descendant Of The Therapeutic Use Of
Radiolabeled Antibody In Cancer Ther
apy ”Monoclonal Antibodies For Cancer
Detection And Therapy, Baldwin et al. (Ed.), 3
03-16 (Academic Press 1985), and Thorp
e, et al., "The Preparation And Cytotoxic Pr.
operations of Antibody-Toxin Conjugate
s ", Immunol. Rev. 62: 119-58 (1982).

Alternatively, the antibody is conjugated to a second antibody and the antibody is US Pat. No. 4,676,980 (
This may form an antibody heteroconjugate as described by Segal in (incorporated herein in its entirety).

Antibodies, with or without a therapeutic moiety that binds to the antibody, administered alone or in combination with cytotoxic factors and / or cytokines, can be used as therapeutic agents.

Immunophenotyping The antibodies of the invention can be utilized for immunophenotyping cell lines and biological samples. The translation products of the genes of the present invention are useful as cell-specific markers, or more particularly as cell markers that are differentially expressed at various stages of differentiation and / or maturation of particular cell types. obtain. Monoclonal antibodies directed against specific epitopes, or combinations of epitopes, allow screening of cell populations expressing markers. Various techniques can be utilized with monoclonal antibodies to screen for cell populations that express markers, and include magnetic separation using antibody-coated magnetic beads, solid matrices (ie, "Panning" using antibodies attached to plates, as well as flow cytometry (eg US Pat. No. 5,985,6).
60; and Morrison et al., Cell, 96: 737-49 (1999.
) Refer to)).

These techniques apply to hematological malignancies (ie, minimal residual disease (MRD) in patients with acute leukemia).
And allows screening of specific populations of cells as may be found with "non-self" cells in transplantation to prevent graft versus host disease (GVHD). Alternatively, these techniques allow for the screening of hematopoietic stem cells and progenitor cells that may undergo proliferation and / or differentiation as may be found in human cord blood.

Assays for Antibody Binding The antibodies of the invention can be assayed for immunospecific binding by any method known in the art. Immunoassays that can be used include Western blots, radioimmunoassays, to name just a few.
ELISA (enzyme linked immunosorbent assay), "sandwich" immunoassay, immunoprecipitation assay, precipitation reaction, gel diffusion precipitation reaction, immunodiffusion assay, agglutination assay, complement fixation assay, immunoradiometric assay, fluorescent immunoassay, protein A Included, but not limited to, competitive and non-competitive assay systems that use techniques such as immunoassays. Such assays are routine and well known in the art (eg, Ausubel et al. Eds., 1994, Current Protocol), which is incorporated by reference herein in its entirety.
ls in Molecular Biology, Volume 1, John Wil
ey & Sons, Inc. , New York). Exemplary immunoassays are briefly described below (although these are not intended to be limiting).

Immunoprecipitation protocols generally involve RIPA buffer (1% NP-40 or Triton X-100, 1, 1% NP-40, supplemented with protein phosphatase inhibitors and / or protease inhibitors (eg, EDTA, PMSF, aprotinin, sodium vanadate). % Sodium deoxycholate, 0.1%
SDS, 0.15M NaCl, 0.01M sodium phosphate (pH 7.2)
) Lysing a population of cells in a lysis buffer such as 1% Transylol), adding the antibody of interest to the cell lysate, and incubating at 4 ° C. for a period of time (eg 1-4 hours) Adding protein A sepharose beads and / or protein G sepharose beads to the cell lysate, incubating at 4 ° C. for about 1 hour or more, washing the beads in lysis buffer, and SDS / sample buffer Resuspending the beads in. The ability of the antibody of interest to immunoprecipitate a particular antigen can be assayed, for example, by Western blot analysis. One of skill in the art will be able to discern parameters that can be modified to increase binding of antibody to antigen and to reduce background (eg, preclearing cell lysates with Sepharose beads). . For further discussion on immunoprecipitation protocols, see, eg, Ausub.
el et al., 1994, Current Protocols in Molec.
ural Biology, Volume 1, John Wiley & Sons, Inc.
． , New York, 10.16.1.

Western blot analysis generally involves the steps of preparing a protein sample, polyacrylamide gel (eg 8% -20% SDS-depending on the molecular weight of the antigen).
Electrophoresis of the protein sample in PAGE), transferring the protein sample from the polyacrylamide gel to a membrane such as nitrocellulose, PVDF or nylon, blocking solution (eg 3% BSA or PBS with nonfat dry milk). Blocking the membrane in a washing buffer (eg PB
Washing the membrane in S-Tween 20), blocking the membrane with a primary antibody (antibody of interest) diluted in blocking buffer, washing the membrane in washing buffer , A secondary antibody (recognizing the primary antibody, eg, an anti-human antibody) bound to an enzyme substrate (eg, horseradish peroxidase or alkaline phosphatase) or a radioactive molecule (eg, 32P or 125I) diluted in blocking buffer With the step of blocking the membrane, washing the membrane in wash buffer, and detecting the presence of the antigen. One of ordinary skill in the art will be aware of parameters that can be modified to increase the signal detected and to reduce background noise. For further discussion on Western blot protocols, see, eg, Ausu.
Bel et al., 1994, Current Protocols in Mole.
polar Biology, Volume 1, John Wiley & Sons, In
c. , New York, 10.8.1.

ELISA is for the purpose of preparing an antigen, coating the wells of a 96-well microtiter plate with the antigen, binding to a detectable compound such as an enzyme substrate (eg horseradish peroxidase or alkaline phosphatase). Antibody to the wells and incubating for a period of time, and detecting the presence of the antigen. In the ELISA, the antibody of interest need not be bound to the detectable compound; instead, a second antibody (which recognizes the antibody of interest) bound to the detectable compound can be added to the wells. . Further, instead of coating the well with the antigen, the antibody can be coated to the well. In this case, a second antibody conjugated to a detectable compound can be added subsequent to the addition of the antigen of interest to the coated wells. One of ordinary skill in the art will be aware of parameters that can be modified to increase the signal detected, and other variations of the ELISA known in the art. EL
For further discussion on ISA, see, eg, Ausubel et al., Eds., 199.
4, Current Protocols in Molecular Bio
LOGY, Volume 1, John Wiley & Sons, Inc. , New Yo
See rk, 11.2.1.

[0287] The binding affinity of the antibody for the antigen and the off-rate of the antibody-antigen interaction (of
f-rate) can be determined by competitive binding assay. One example of a competitive binding assay is a radioimmunoassay, which involves labeling with a labeled antigen (eg, 3H or 125I), incubation with the antibody of interest in the presence of increasing amounts of unlabeled antigen, and labeling. Includes detection of antibody bound to antigen. The affinity of the antibody of interest for a particular antigen, and the binding off-rate can be determined from the data by Scatchard plot analysis. Competition with the second antibody can also be determined using a radioimmunoassay. In this case, the antigen is incubated with the antibody of interest bound to a labeled compound (eg, 3H or 125I) in the presence of increasing amounts of unlabeled second antibody.

Therapeutic Uses The present invention further relates to antibody-based therapies for treating one or more of the disclosed diseases, disorders, or conditions in animals, preferably mammals, and most Preferably, the step of administering the antibody of the present invention to a human patient is included. Therapeutic compounds of the invention include antibodies of the invention (including fragments, analogs and derivatives thereof, as described herein) and nucleic acids encoding the antibodies of the invention (described herein). (Including, but not limited to, fragments, analogs and derivatives thereof and anti-idiotypic antibodies). Antibodies of the invention include diseases, disorders or conditions associated with aberrant expression and / or activity of the polypeptides of the invention (including any one or more of the diseases, disorders, or conditions described herein). Can be used to treat, inhibit or prevent). Aberrant expression of the polypeptide of the invention and /
Alternatively, treating and / or preventing a disease, disorder or condition associated with activity includes, but is not limited to, ameliorating the symptoms associated with the disease, disorder or condition. The antibodies of the present invention are known in the art or can be provided in a pharmaceutically acceptable composition as described herein.

A summary of how the antibodies of the invention may be used therapeutically is locally or systemically in the body, or mediated (eg, by complement (CDC), or by effector cells (ADCC)). By direct binding of the polynucleotide or polypeptide of the invention by the direct cytotoxicity of the antibody. Some of these approaches are described in more detail below. Given the teachings provided herein, one of ordinary skill in the art would be able to determine, without undue experimentation, how to use the antibodies of the invention for diagnostic, monitoring or therapeutic purposes. Recognize.

Antibodies of the invention may be other monoclonal or chimeric antibodies, or lymphokines or hematopoietic growth factors (eg, IL-2, IL-2, IL-2, IL-2, IL-2, IL-3 and IL
(Such as −7).

The antibodies of the invention can be administered alone or in combination with other types of treatments such as radiation therapy, chemotherapy, hormone therapy, immunotherapy and anti-tumor agents.
Generally, it is preferred to administer a species-sourced or species-reactive product that is the same species as the patient's species (in the case of antibodies). Thus, in a preferred embodiment, human antibodies,
The fragment derivative, analog, or nucleic acid is administered to a human patient for treatment or prevention.

A high affinity and / or affinity for a polypeptide or polynucleotide of the invention, both for immunoassays for the polynucleotides or polypeptides of the invention (including fragments thereof) and for the treatment of disorders associated therewith. Or potent in vivo inhibitory and / or neutralizing antibodies, fragments thereof,
Alternatively, it is preferable to use those areas. Such antibodies, fragments or regions are preferably polynucleotides or polypeptides of the invention (
(Including its fragments). The preferred binding affinity is 5 × 10 ⁻² M, 10 ⁻² M, 5 × 10 ⁻³ M, 10 ⁻³ M, 5 × 10 ⁻⁴ M, 10 ⁻⁴ M, 5 × 10 ⁻⁵ M, 10 ⁻⁵ M, 5 × 10 ⁻⁶ M, 10 ⁻⁶ M, 5 × 10 ⁻⁷ M, 10 ⁻⁷ M, 5 × 10 ⁻⁸ M, 10 ⁻⁸ M, 5 × 10 ⁻⁹ M, 10 ^{− 9 M, 5 × 10 -10 M} , 10 - 10 M, 5 × 10 -11 M, 10 -11 M, 5 × 10 -12 M, 10 -12 M, 5 × 10 -13 M
Included are binding affinities with dissociation constants or Kd less than 10 ⁻¹³ M, 5 × 10 ⁻¹⁴ M, 10 ⁻¹⁴ M, 5 × 10 ⁻¹⁵ M, and 10 ⁻¹⁵ M.

Gene Therapy In certain embodiments, a nucleic acid comprising a sequence encoding an antibody or functional derivative thereof treats a disease or disorder associated with aberrant expression and / or activity of a polypeptide of the invention, Administered for the purpose of gene therapy to inhibit or prevent. Gene therapy refers to a therapy that is performed by administering an expressed or expressible nucleic acid to a subject. In this embodiment of the invention, the nucleic acids produce their encoded protein, which mediates a therapeutic effect.

[0294] Any method available in the art for gene therapy can be used in accordance with the present invention. An exemplary method is described below.

For a general review of methods of gene therapy, see Goldspiel et al., Cli.
Nal Pharmacy 12: 488-505 (1993); Wu and Wu, Biotherapy 3: 87-95 (1991); Tolstos.
hev, Ann. Rev. Pharmacol. Toxicol. 32: 573
-596 (1993); Mulligan, Science 260: 926-.
932 (1993); and Morgan and Anderson, Ann.
Rev. Biochem. 62: 191-217 (1993); May, TIB.
See TECH 11 (5): 155-215 (1993). Methods generally known in the recombinant DNA art that can be used are described in Ausubel.
Et al., Current Protocols in Molecular
Biology, John Wiley & Sons, NY (1993); and Kriegler, Gene Transfer and Express.
n, A Laboratory Manual, Stockton Press
, NY (1990).

In a preferred aspect, the compound comprises a nucleic acid sequence encoding an antibody, said nucleic acid sequence being an expression vector expressing the antibody, or fragment or chimeric protein thereof, or heavy or light chain thereof, in a suitable host. Is part of. In particular, such nucleic acid sequences have a promoter operably linked to the antibody coding region, said promoter being inducible or constitutive, and optionally tissue-specific. In another particular embodiment, nucleic acid molecules are used that flank the region encoding the antibody and any other desired sequences that facilitate homologous recombination at the desired site in the genome, thus rendering the antibody Provides intrachromosomal expression of the encoding nucleic acid (Koller and Smithies, Proc. N.
atl. Acad. Sci. USA 86: 8932-8935 (1989);
Zijlstra et al., Nature 342: 435-438 (1989)).
In a particular embodiment, the expressed antibody molecule is a single chain antibody; or the nucleic acid sequence comprises sequences encoding both the heavy and light chains of the antibody or fragments thereof.

Delivery of the nucleic acid to the patient can be direct (where the patient is directly exposed to the nucleic acid or nucleic acid-bearing vector) or indirect (where the cell is first transfected with the nucleic acid in vitro). Converted and then transplanted to the patient). These two approaches are known as in vivo gene therapy or as ex vivo gene therapy, respectively.

In a specific embodiment, the nucleic acid sequences are directly administered in vivo, where they are expressed to produce the encoded product. This is accomplished by a number of methods known in the art, such as constructing them as part of a suitable nucleic acid expression vector and constructing them (eg, defective or attenuated retrovirus or other viral vectors (US Pat. 4,980,286) (by infection with cells) or by direct injection of naked DNA, or by microparticle bombardment (eg gene gun; Biol).
istic, Dupont), or by coating with lipids or cell surface receptors, or by transfecting agents, or by encapsulating them in liposomes, microparticles, or microcapsules, or By administering to a peptide that is known to enter, by administering to a ligand that undergoes receptor-mediated endocytosis (eg, Wu and Wu, J. Biol. Chem.
． 262: 4429-4432 (1987)), which can be used to target cell types that specifically express the receptor. In another embodiment, nucleic acid-ligand complexes can be formed where the ligand disrupts endosomes fusogen.
ic) contains a viral peptide, allowing this nucleic acid to avoid lysosomal degradation. In yet another embodiment, the nucleic acids can be targeted in vivo for cell-specific uptake and expression by targeting specific receptors (eg, PCT Publication No. WO92 / 06180; WO92 / 226).
No. 35; No. WO92 / 20316; No. WO93 / 14188, No. WO
93/20221). Alternatively, the nucleic acid can be introduced inside the cell and incorporated into the host cell DNA for expression by homologous recombination (
Koller and Smithies, Proc. Natl. Acad. Sci
． USA 86: 8932-8935 (1989); Zijlstra et al., Na.
true 342: 435-438 (1989)).

In a specific embodiment, viral vectors that contain nucleic acid sequences that encode the antibodies of the invention are used. For example, a retroviral vector can be used (Mi
ller et al., Meth. Enzymol. 217: 581-599 (1993).
checking). These retroviral vectors contain the necessary components for correct packaging of the viral genome and correct integration into host cell DNA. The nucleic acid sequence encoding the antibody used in gene therapy is cloned into one or more vectors, which facilitates delivery of the gene into patients. For more details on retroviral vectors, see Boesen et al., Bi.
others, 6: 291-302 (1994), which describes the use of retroviral vectors to deliver the mdr1 gene to hematopoietic stem cells in order to make the stem cells more resistant to chemotherapy. Can be issued. Other references describing the use of retroviral vectors in gene therapy are: Clowes et al., J. Am. Clin. Invest. 93: 644-651 (19
94); Kiem et al., Blood 83: 1467-1473 (1994); S.
almons and Gunzberg, Human Gene Therapy
4: 129-141 (1993); and Grossman and Wils.
on, Curr. Opin. in Genetics and Devel. Three
: 110-114 (1993).

Adenovirus is another viral vector that can be used in gene therapy. Adenoviruses are particularly attractive vehicles for delivering genes to respiratory epithelia. Adenovirus naturally infects respiratory epithelia where it causes mild disease. Other targets of adenovirus-based delivery systems are the liver, central nervous system, endothelial cells, and muscle. Adenovirus has the advantage that it can infect non-dividing cells. Kozarsky and Wilson, Curr
ent Opinion in Genetics and Developopm
ent 3: 499-503 (1993) provides an overview of adenovirus-based gene therapy. Bout et al., Human Gene Therapy 5: 3.
-10 (1994) demonstrated the use of adenoviral vectors to transfer genes to the rhesus monkey respiratory epithelium. Other examples of the use of adenovirus in gene therapy are described by Rosenfeld et al., Science 252: 431-434 (19).
91); Rosenfeld et al., Cell 68: 143-155 (1992).
Mastrangeli et al., J .; Clin. Invest. 91: 225-2
34 (1993); PCT Publication No. WO 94/12649; and Wang et al.,
Gene Therapy 2: 775-783 (1995).
In a preferred embodiment, adenovirus vectors are used.

Adeno-associated virus (AAV) has also been proposed for use in gene therapy (Walsh et al., Proc. Soc. Exp. Biol. Med. 204:
289-300 (1993); US Pat. No. 5,436,146).

Another approach to gene therapy involves transferring a gene to cells in tissue culture by such methods as electroporation, lipofection, calcium phosphate mediated transfection, or viral infection. Usually, the method of transfer involves transfer of the selectable marker to the cells. The cells are then subjected to selection to isolate those cells that take up and express the transferred gene.
The cells are then delivered to the patient.

In this embodiment, the nucleic acid is introduced into the cell prior to in vivo administration of the resulting recombinant cell. Such introduction can be performed by any method known in the art, including but not limited to: transfection, electroporation, microinjection, viruses including nucleic acid sequences. Infection with vector or bacteriophage vector, cell fusion, chromosome-mediated gene transfer, microcell-mediated gene transfer, spheroplast fusion, etc. Many techniques are known in the art for introducing foreign genes into cells (eg, Loeffler and Behr, Met.
h. Enzymol. 217: 599-618 (1993); Cohen et al., M.
eth. Enzymol. 217: 618-644 (1993); Cline,
Pharmac. Ther. 29: 69-92m (1985)),
And if the necessary developmental and physiological functions of the recipient cells are not disrupted, they can be used according to the invention. This technique should provide for stable transfer of the nucleic acid to the cell so that the nucleic acid is expressible by the cell, preferably heritable and expressible by the progeny of the cell.

The resulting recombinant cells can be delivered to a patient by various methods known in the art. Recombinant blood cells (eg, hematopoietic stem cells or hematopoietic progenitor cells) are preferably administered intravenously. The amount of cells contemplated for use depends on the desired effect, patient condition, etc. and can be determined by one of skill in the art.

Cells into which nucleic acids can be introduced for purposes of gene therapy include any desired available cell type, including but not limited to: epithelial cells, endothelial cells,
Keratinocytes, fibroblasts, muscle cells, hepatocytes; T lymphocytes, B lymphocytes, monocytes, macrophages, neutrophils, eosinophils, megakaryocytes, blood cells such as granulocytes; various stem cells or progenitor cells, In particular, hematopoietic stem cells or hematopoietic progenitor cells (eg cells such as those obtained from bone marrow, cord blood, peripheral blood, fetal liver, etc.).

In a preferred embodiment, the cells used for gene therapy are autologous to the patient.

In embodiments in which recombinant cells are used in gene therapy, the nucleic acid sequences encoding the antibody are introduced into the cells such that the nucleic acid sequences are expressible by the cells or their progeny, and then the recombinant cells are , Administered in vivo for therapeutic effects. In a specific embodiment, stem cells or progenitor cells are used. Any stem and / or progenitor cells that can be isolated in vitro and maintained in vitro can potentially be used according to this embodiment of the invention (
For example, PCT Publication No. WO 94/08598: Temple and Ande.
rson, Cell 71: 973-985 (1992); Rheinwald.
, Meth. Cell Bio. 21A: 229 (1980); and Pit
telkow and Scott, Mayo Clinic Proc. 61: 7
71 (1986)).

In a particular embodiment, the nucleic acid to be introduced for the purpose of gene therapy contains an inducible promoter operably linked to the coding region so that expression of the nucleic acid is controlled by the appropriate transcription inducer. Can be controlled by controlling the presence or absence of.

The compounds or pharmaceutical compositions of the invention are preferably tested for their desired therapeutic or prophylactic activity in vitro, prior to use in humans, and then in vivo. For example, in vitro assays to demonstrate therapeutic or prophylactic utility of a compound or pharmaceutical composition include the effect of the compound on cell lines or patient tissue samples. The effect of a compound or composition on cell lines and / or tissue samples can be determined utilizing techniques known to those of skill in the art, including but not limited to rosette formation assays and cytolytic assays. In vitro assays that can be used in accordance with the present invention to determine if administration of a particular compound is indicated include in vitro cell culture assays, in which a patient tissue sample is grown in culture, The compound is then exposed or otherwise administered and the effect of such compound on the tissue sample is observed.

Therapeutic / Prophylactic Administration and Compositions The present invention provides for treatment, inhibition by administration to a subject of an effective amount of a compound or pharmaceutical composition of the invention, preferably a peptide or antibody of the invention. And provide methods of prevention. In a preferred aspect, the compound is substantially purified (eg, substantially free of substances that limit its effect or produce undesired side effects). The subject is preferably an animal, including but not limited to animals such as cows, pigs, horses, chickens, cats, dogs, and preferably mammals, and most preferably humans.

Formulations and methods of administration that can be used when the compound comprises nucleic acids or immunoglobulins are described above; additional suitable formulations and routes of administration are selected from among those described herein below. Can be done.

Various delivery systems are known and can be used to administer the compounds of the invention (eg, liposomes, microparticles, microcapsules, encapsulation in recombinant cells capable of expressing the compound). , Receptor-mediated endocytosis (
For example, Wu and Wu, J .; Biol. Chem. 262: 4429-443
2 (1987)), the construction of nucleic acids as part of retroviruses or other vectors). Methods of introduction include, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes. The compound or composition may be administered by any convenient route, such as by infusion or bolus injection, by absorption through the epithelial or mucosal lining, such as the oral, rectal and intestinal mucosa, and other It can be administered with a biologically active agent. Administration can be systemic or local. Further, the pharmaceutical compounds or compositions of the invention may be administered by any suitable route, including intraventricular and intrathecal injections; intraventricular injection may be for example, intraventricular injection attached to a reservoir, such as the Ommaya reservoir. Introduction to the central nervous system by means of a catheter). Pulmonary administration may also be employed, eg, by use of an inhaler or nebulizer, and formulation with an aerosolizing agent.

In certain embodiments, it may be desirable to administer the pharmaceutical compounds or compositions of the invention locally to the area in need of treatment; this is for example, but not limited to, surgery. By local infusion, topical application (eg, in combination with post-surgical wound dressing), by injection, by catheter, by suppository, or by an implant (the implant being a membrane such as a sialastic membrane or Porous, non-porous, or glue-like materials, including fibers). Preferably, in administering a protein of the invention, including antibodies, care must be taken to use materials that do not absorb the protein.

In another embodiment, the compound or composition can be delivered into vesicles, particularly liposomes (Langer, Science 249: 1527-1533 (
1990); Treat et al., Liposomes in the Therap.
y of Infectious Disease and Cancer, L
opez-Berestein and Fidler (ed.), Liss, New
York, pp. 353-365 (1989); Lopez-Berestein,
Ibid, pages 317-327; see ibid.).

In yet another embodiment, the compound or composition can be delivered in a controlled release system. In one embodiment, a pump may be used (Lang.
er, (supra); Sefton, CRC Crit. Ref. Biomed. E
ng. 14: 201 (1987); Buchwald et al., Surgery 88.
: 507 (1980); Saudek et al., N .; Engl. J. Med. 321
574 (1989)). In another embodiment, polymeric materials may be used (Medical Applications of Control).
led Release, Langer and Wise (ed.), CRC Pre
s. , Boca Raton, Florida (1974); Control
ed Drug Bioavailability, Drug Product
Design and Performance, Smolen and Bal
1 (eds.), Wiley, New York (1984); Ranger and P.
eppas, J .; Macromol. Sci. Rev. Macromol. Ch
em. 23:61 (1983); Levy et al., Science 2
28: 190 (1985); During et al., Ann. Neurol. 25: 3
51 (1989); Howard et al., J. Am. Neurosurg. 71: 105 (
1989) also). In yet another embodiment, the controlled release system can be placed near the therapeutic target, ie, the brain, thus requiring only a portion of the systemic dose (eg, Goodson, Medical Applicat).
ions of Controlled Release, (supra), Volume 2,
115-138 (1984)).

Other controlled release systems are discussed in the review by Langer (Science 249: 1527-1533 (1990)).

In a specific embodiment, wherein the compound of the invention is a nucleic acid encoding a protein, the nucleic acid constitutes it as part of a suitable nucleic acid expression vector and is such that it is intracellular. By administration (eg, by use of retroviral vectors (see US Pat. No. 4,980,286), or by direct injection, or microparticle bombardment (eg, gene gun; Biolis).
Tic, Dupont) or by coating with a lipid or cell surface receptor or transfecting agent, or in combination with a homeobox-like peptide known to enter the nucleus (eg,
Joliot et al., Proc. Natl. Acad. Sci. USA 88:18
64-1868 (see 1991)) and the like, so as to enhance the expression of the encoded protein in vivo. Alternatively, the nucleic acid can be introduced intracellularly and incorporated into host cell DNA for homologous recombination for expression.

The present invention also provides pharmaceutical compositions. Such compositions comprise a therapeutically effective amount of the compound and a pharmaceutically acceptable carrier. In a specific embodiment, the term "pharmaceutically acceptable" has been approved by the Federal Regulatory Authority or the U.S. Government for use in animals, and more particularly in humans, or in the United States Pharmacopeia or other Means that it is listed in the generally accepted pharmacopoeia.
The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered. Such pharmaceutical carriers include sterile liquids such as water and oils, including oils of petroleum, animal, vegetable or synthetic origin (eg, peanut oil, soybean oil, mineral oil, sesame oil, etc.). Can be. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions, and aqueous dextrose and glycerol solutions can also be used as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, skim milk powder, glycerol, propylene. , Glycol, water, ethanol and the like. The composition can, if desired, also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. These compositions may take the form of solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained release formulations and the like. The composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides. Oral formulations can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate and the like. Examples of suitable pharmaceutical carriers are E.I. W. "Reming" by Martin
ton's Pharmaceutical Sciences ". Such a composition comprises a therapeutically effective amount of the compound, preferably in purified form,
It is included with a suitable amount of carrier to provide the form for proper administration to the patient. The formulation should suit the mode of administration.

In a preferred embodiment, the composition is formulated in accordance with routine procedures as a pharmaceutical composition adapted for intravenous administration to human beings. Typically, compositions for intravenous administration are solutions in sterile isotonic aqueous buffer. If desired, the composition can also include a solubilizer and a local anesthesia such as lignocaine to relieve pain at the site of injection. Generally, the components are either separately or mixed together in a single dosage form, eg, in ampoules or sachets (s) showing a fixed amount of active agent.
supplied as a lyophilized powder or water-free concentrate in a sealed container such as an achette). Where the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline. Where the composition is administered by injection, the ingredients may be mixed prior to administration,
Ampoules of sterile water for injection or saline can be provided.

The compounds of the present invention may be formulated as neutral or salt forms. Pharmaceutically acceptable salts include salts formed with anions such as those derived from hydrochloric acid, phosphoric acid, acetic acid, oxalic acid, tartaric acid and the like, and sodium, potassium, ammonium, calcium, ferric hydroxide, Isopropylamine, triethylamine,
Mention may be made of salts formed with cations such as those derived from 2-ethylaminoethanol, histidine, procaine and the like.

The amount of a compound of the invention that is effective in this treatment (suppression and prevention of diseases or disorders associated with aberrant expression and / or activity of the polypeptides of the invention) will be determined by standard clinical techniques. Can be done. In addition, in vitro assays may optionally be used to help identify optimal dosage ranges. Precise dosages to be used in the formulation will also depend on the route of administration, and the severity of the disease or disorder, and should be decided according to the judgment of the practitioner and each patient's circumstances. Effective doses may be extrapolated from dose-response curves derived from in vitro or animal model test systems.

For antibodies, the dosage administered to a patient is typically 0.1 mg to 100 mg per kg patient body weight. Preferably, the dosage administered to a patient is between 0.1 mg and 20 mg / kg of the patient's body weight, more preferably 1 mg to 10 mg / kg of the patient's body weight. In general, human antibodies have a longer half-life within the human body than antibodies from other species due to the immune response to the foreign polypeptides. Thus, low dosages and infrequent administrations of human antibodies are often possible. Further, the dosage and frequency of administration of the antibodies of the invention may be altered (eg,
It can be reduced by enhancing antibody uptake by lipidation and the like and tissue penetration (eg into the brain).

The invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more ingredients of the pharmaceutical compositions of the invention. Notifications in the form prescribed by governmental agencies regulating the manufacture, use or sale of pharmaceutical or biological products may optionally be accompanied by such containers. This notice
It reflects the agency's approval of manufacture, use or sale for human administration.

Diagnostic and Imaging Labeled antibodies that specifically bind to the polypeptide of interest, as well as derivatives and analogs thereof, have been used for diagnostic purposes to aberrate expression and abnormal expression of the polypeptides of the invention. Diseases and / or disorders associated with activity can be detected, diagnosed or monitored. The present invention provides for the detection of aberrant expression of a polypeptide of interest, which comprises (a) using one or more antibodies specific for the polypeptide of interest to target in a cell or body fluid of an individual. Assaying the expression of the polypeptide of
And (b) comparing the level of gene expression to the level of standard gene expression, whereby increasing or decreasing the level of assayed polypeptide gene expression compared to the standard level of expression. Shows abnormal expression.

The present invention provides a diagnostic assay for diagnosing a disorder, which assay comprises (
a) assaying the expression of the polypeptide of interest in cells or fluids of an individual using one or more antibodies specific for the polypeptide of interest, and (b) this gene expression level and standard Comparing the level of gene expression, whereby an increase or decrease in the assayed polypeptide gene expression level compared to its standard expression level is indicative of a particular disorder. With respect to cancer, the presence of relatively high amounts of transcripts in biopsied tissue from an individual may indicate a predisposition for the development of the disease or may provide a means for detecting the disease prior to the onset of actual clinical symptoms. Can be provided. A more definitive diagnosis of this type may allow health professionals to use preventative measures or early aggressive treatment, thereby preventing the development or further progression of cancer.

The antibodies of the invention can be used to assay protein levels in biological samples using classical immunohistological methods known to those of skill in the art (eg, Jalk).
anen et al. Cell. Biol. 101: 976-985 (1985);
Jalkanen et al. Cell. Biol. 105: 3087-3096 (
1987)). Other antibody-based methods useful for detecting protein gene expression include immunoassays such as enzyme-linked immunosorbent assay (ELISA) and radioimmunoassay (RIA). Suitable antibody assay labels are known in the art and are enzymatic labels (eg glucose oxidase); radioisotopes (eg iodine (125I, 1, 1
21I), carbon (14C), sulfur (35S), tritium (3H), indium (112In), and technetium (99Tc)); luminescent labels (eg luminol); and fluorescent labels (eg fluorescein and rhodamine), and Examples include biotin.

One aspect of the present invention is the detection and diagnosis of diseases or disorders associated with aberrant expression of the polypeptide of interest in animals, preferably mammals, and most preferably humans. In one embodiment, diagnosis is a) administering to a subject (eg, parenterally, subcutaneously, or intraperitoneally) an effective amount of a labeled molecule that specifically binds to a polypeptide of interest. B) to allow the labeled molecule to preferentially concentrate at the site in the subject where the polypeptide is expressed (and to remove unbound labeled molecule to background levels) A) waiting for a time interval after administration; c) determining the background level; and d) detecting the labeled molecule in the subject, so that the label is above this background level. Detection of the activating molecule indicates that the subject has a particular disease or disorder associated with aberrant expression of the polypeptide of interest. Background level can be determined by a variety of methods, including comparing the amount of labeled molecule detected to standard values previously determined for a particular system.

It is understood in the art that the size of the subject and the imaging system used will determine the amount of imaging moiety needed to produce diagnostic images. In the case of a radioisotope moiety, for a human subject, the quantity of radioactivity injected will normally be 99mTc, in the range of about 5-20m Curie. The labeled antibody or labeled antibody fragment will then preferentially accumulate at the location of cells which contain the particular protein. In vivo tumor imaging is described by S. et al. W. Burchiel et al.
Immunopharmacokinetics of Radiolabel
ed Antibodies and Their Fragments "(T
Umor Imaging, Chapter 13: The Radiochemical
Detection of Cancer, S.M. W. Burchiel and B
． A. Rhodes, Masson Publishing Inc. (19
82).

Depending on a number of variations, including the type of label used and the mode of administration, the labeled molecule allows for preferential enrichment of sites in the subject and is bound. The time interval after administration for removal of unlabeled molecules to background levels is 6-48 hours or 6-24 hours or 6-12 hours. In another embodiment, the time interval after administration is 5-20 days or 5-10 days.

In one embodiment, monitoring diseases and disorders is performed by repeating the method for diagnosing a disease or disorder (eg, one month after initial diagnosis, first 6 months after diagnosis, 1 year after initial diagnosis, etc.).

The presence of labeled molecule can be detected in a patient using methods known in the art for in vivo scanning. These methods depend on the type of label used. One of ordinary skill in the art can determine the appropriate method for determining a particular label. Methods and devices that may be used in the diagnostic methods of the present invention include computer tomography (CT), whole body scans (eg, protons).
n) emission tomography (PET)), magnetic resonance imaging (MRI), and ultrasound diagnostics, but not limited to these.

In a particular embodiment, the molecule is labeled with a radioisotope and is subjected to a radiation responsive surgical instrument.
(Thurston et al., US Pat. No. 5,441,050)
To detect in patients using. In another embodiment, the molecule is labeled with a fluorescent compound and detected in a patient using a fluorescence response scanning instrument. In another embodiment, the molecule is labeled with a positron emitting metal and detected in the patient using positron emission tomography. In yet another embodiment, the molecule is labeled with a paramagnetic label and detected in the patient using magnetic resonance imaging (MRI). (Kit) The present invention provides a kit that can be used in the above method. In one embodiment, the kit comprises an antibody of the invention, preferably a purified antibody, in one or more containers. In a particular embodiment, the kit of the invention comprises a substantially isolated polypeptide comprising an epitope. This epitope specifically immunoreacts with the antibody contained in the kit. Preferably, the kit of the present invention further comprises a control antibody that does not react with the polypeptide of interest. In another specific embodiment, the kit of the invention comprises means for detecting binding of the antibody to a polypeptide of interest (eg, the antibody is a detectable substrate (eg, a fluorescent compound, an enzyme substrate). , Radioactive compounds or luminescent compounds), or a secondary antibody that recognizes the primary antibody can be conjugated with a detectable substrate).

In another particular embodiment of the invention, the kit is a diagnostic kit for use in screening sera containing antibodies specific for proliferative and / or cancerous polynucleotides and polypeptides. is there. Such a kit may include a control antibody that does not react with the polypeptide of interest. Such a kit may comprise a substantially isolated polypeptide antigen containing the epitope. This epitope specifically immunoreacts with at least one anti-polypeptide antigen antibody. Further, such a kit comprises means for detecting the binding of the above antibody to an antigen (eg, the antibody is a fluorescent compound (eg, fluorescein or rhodamine that can be detected by flow cytometry) and a conjugate). Can be). In certain embodiments, the kit may comprise a recombinantly produced polypeptide antigen or a chemically synthesized polypeptide antigen. The polypeptide antigens of the kit can also be attached to a solid support.

[0334] In a more particular embodiment, the detection means of the kit comprises a solid support to which the polypeptide antigen is attached. Such a kit may also include a non-attached reporter labeled anti-human antibody. In this embodiment, binding of the antibody to the polypeptide antigen can be detected by binding of the reporter-labeled antibody described above.

In a further embodiment, the invention comprises a diagnostic kit for use in screening serum containing antigens of the polypeptides of the invention. The diagnostic kit comprises a substantially isolated antibody that specifically immunoreacts with a polypeptide or polynucleotide antigen, and a means for detecting the binding of the polynucleotide or polypeptide antigen to the antibody. Prepare In one embodiment, the antibody is attached to a solid support. In a particular embodiment, the antibody may be a monoclonal antibody. This detection means of the kit may include a secondary labeled monoclonal antibody. Alternatively, or additionally, the detection means can include a labeled competing antigen.

In one diagnostic configuration, test serum is reacted with a solid phase reagent having a surface bound antigen obtained by the method of the invention. After binding of the specific antigen antibody to this reagent and removal of unbound serum components by washing, this reagent is reacted with a reporter-labeled anti-human antibody to bind the bound anti-human antibody to the solid support. A reporter is bound to this reagent in proportion to the amount of antigen antibody. The reagent is washed again to remove unbound labeled antibody and the amount of reporter associated with the reagent is determined. Typically, the reporter is an enzyme, which is detected by incubating the solid phase in the presence of a suitable fluorescent, luminescent or colorimetric substrate (Sigma, St. Louis, MO). To be done.

The solid surface reagents in the above assay are used to convert protein material to solid support material (
For example, prepared by known techniques for attachment to polymeric beads, dipsticks, 96-well plates or filtration material). These methods of attachment generally include non-specific adsorption of proteins to the support or chemically active groups (eg, activated carboxyl groups, hydroxyl groups, or aldehyde groups) on the solid support. Covalent attachment of proteins (typically via free amine groups). Alternatively, streptavidin-coated plates can be used with biotinylated antigen.

The invention thus provides an assay system or kit for carrying out this diagnostic method. The kit generally comprises a support having surface-bound recombinant antigens, and a reporter-labeled anti-human antibody for detecting surface-bound anti-antigen antibody.

Uses of Polynucleotides Each of the polynucleotides identified herein can be used as reagents in a number of ways. The following description should be considered exemplary and utilizes known techniques.

The polynucleotides of the present invention are useful for chromosome identification. Chromosome marking reagents based on actual sequence data (repeated polymorphisms) are currently scarcely available, so there remains a need to identify new chromosomal markers. Each sequence can be specifically targeted to and hybridized to a particular location on an individual human chromosome. Thus, each polynucleotide of the present invention may be conveniently used as a chromosomal marker using techniques known in the art.

Briefly, the sequence is derived from the sequence set forth in SEQ ID NO: X or a complement thereto to a PCR primer (preferably at least 15 bp (eg 15-25 bp.
bp)) can be mapped to the chromosome. The primer is
Primers can be optionally selected using computer analysis so that they do not span more than one predicted exon in the genomic DNA. These primers are then used to PCR somatic cell hybrids containing individual human chromosomes.
Used for screening. Only the hybrid containing the human gene corresponding to SEQ ID NO: X produces an amplified fragment.

[0342] Similarly, somatic cell hybrids include polynucleotides that bind the polynucleotide to specific chromosomes.
It provides a rapid method for CR mapping. Three or more clones can be assigned per day using a single thermal cycler. Moreover, sublocalization of the polynucleotide can be accomplished using a panel of specific chromosomal fragments. Other gene mapping strategies that may be used are in situ hybridization, labeled flow sorted.
pre-screening on the flow sorted) chromosome, chromosome-specific cd
Preselection by hybridization to construct an NA library, and computer mapping techniques (eg, Shuller, Trends Biotechnol 16:45, which is incorporated herein by reference in its entirety).
6-459 (1998)).

The exact chromosomal location of the polynucleotide is also determined by the metaphase chromosomal spread (spr
ead) fluorescence in situ hybridization (FISH). This technique uses polynucleotides as short as 500 or 600 bases; however, 2,000-4,000 bp polynucleotides are preferred. For a review of this technology, see Verma et al., “Human Chromoso.
mes: a Manual of Basic Technologies ", Pe
See rgamon Press, New York (1988).

For chromosome mapping, polynucleotides may be used individually (to mark a single chromosome or a single site on that chromosome) or in panels (to mark multiple sites and / or multiple chromosomes). Can be done.

Accordingly, the invention also provides a method for chromosomal localization, which method comprises (a) preparing a PCR primer from the polynucleotide sequence in Table 1 and SEQ ID NO: X, and (b A) screening somatic cell hybrids containing individual chromosomes.

The polynucleotides of the present invention can also be used for radiation hybrid mapping, HA.
Useful for PPY mapping and long range limited mapping. For an overview of these and other techniques known in the art, see, eg, Dear “Genom.
e Mapping: A Practical Approach "IRL P
pressure at Oxford University Press, London
on (1997); Aydin, J .; Mol. Med. 77: 691-694 (
1999); Hacia et al., Mol. Psychiatry 3: 483-49
2 (1998); Herrick et al., Chromosome Res. 7:40
9-423 (1999); Hamilton et al., Methods Cell B.
iol. 62: 265-280 (2000); and / or Ott, J. et al. He
red. 90: 68-70 (1999), each of which is incorporated herein by reference in its entirety.

Once the polynucleotide has been mapped to a precise chromosomal location, the physical location of the polynucleotide can be used in linkage analysis. Linkage analysis establishes coinheritance between the chromosomal location and the presentation of a particular disease. (Disease mapping data is described in, for example, V. McKusick, Mendel.
ian Inheritance in Man (Johns Hopkins
(Available online through the University Welch Medical Library)). Given 1 megabase mapping resolution and 1 gene per 20 kb, the cDNA precisely localized to the chromosomal region associated with disease could be one of 50-500 potential causative genes.

Thus, once co-inheritance is established, differences in the polynucleotides of the invention and corresponding genes between affected and unaffected individuals can be tested. First, visible structural changes in the chromosome (eg, deletions or translocations) are examined in chromosome spreads or by PCR. In the absence of structural changes, the presence of point mutations is confirmed. Mutations observed in some or all affected individuals but not in normal individuals indicate that this mutation may cause the disease. However, complete sequencing of polypeptides and the corresponding genes from some normal individuals is required to distinguish mutations from polymorphisms. If a new polymorphism is identified, this polymorphic polypeptide can be used for further linkage analysis.

In addition, increased or decreased expression of genes in affected individuals compared to unaffected individuals can be assessed using the polynucleotides of the invention. Any of these changes (
Altered expression, chromosomal rearrangements, or mutations) can be used as a diagnostic or prognostic marker.

Accordingly, the present invention also provides a diagnostic method useful during the diagnosis of disorders, which method comprises the step of measuring the expression level of a polynucleotide of the present invention in cells or body fluids from an individual, and Comprising a step of comparing the measured gene expression level to a standard polynucleotide expression level, whereby an increase or decrease in gene expression level relative to the standard is indicative of a disorder.

In yet another embodiment, the invention comprises a kit for analyzing a sample for the presence of proliferative and / or cancerous polynucleotides from a test subject. In a general embodiment, the kit comprises at least one polynucleotide probe containing a nucleotide sequence that specifically hybridizes to a polynucleotide of the invention, and a suitable container. In this particular embodiment, the kit comprises two polynucleotide probes defining an internal region of a polynucleotide of the invention, wherein each probe comprises a 31 'mer end internal to this region. Has one chain. In a further embodiment, this probe may be useful as a primer for polymerase chain reaction amplification.

The present invention is useful as a prognostic indicator when the diagnosis of related disorders, including, for example, the diagnosis of tumors, has already been carried out by conventional methods, whereby the polynucleotide of the present invention which is enhanced or suppressed thereby. Patients exhibiting expression experience poor clinical outcomes compared to patients expressing this gene at levels closer to normal levels.

By “measuring the expression level of the polynucleotide of the present invention”, the level of the polypeptide of the present invention or the mRNA encoding the polypeptide of the present invention
Is directly (eg, by determining or assessing absolute protein or mRNA levels) or relative (eg, polypeptide levels in the second biological sample) in the first biological sample. Qualitatively or quantitatively) or by comparison to mRNA levels). Preferably, the polypeptide or mRNA level in the first biological sample is measured or evaluated and compared to a standard polypeptide or mRNA level, the standard being an individual without an associated disorder. Determined from a second biological sample obtained from or by averaging the levels from a population of individuals without associated disorders. As will be appreciated in the art, once standard polypeptide or mRNA levels are known, this can be used repeatedly as a standard for comparison.

By “biological sample” is meant a polypeptide of the invention or the corresponding mRN.
Any biological sample obtained from an individual, body fluid, cell line, tissue culture or other source, including A, is contemplated. As shown, the biological sample is found to express the polypeptide of the invention in a body fluid (eg, semen, lymph, serum, plasma, urine, synovial fluid and spinal fluid) containing the polypeptide of the invention. Includes tissue sources issued. Methods for obtaining tissue biopsies and body fluids from mammals are well known in the art. If the biological sample contains mRNA, tissue biopsy is a preferred source.

The methods provided above may preferably be applied to diagnostic methods and / or kits in which the polynucleotides and / or polypeptides of the invention are bound to a solid support. In one exemplary method, the support is made according to US Pat. No. 5,837,
It may be a "gene chip" or a "biological chip" as described in 832, 5,874,219 and 5,856,174. Further, such gene chips to which the polynucleotides of the invention are attached can be used to identify polymorphisms between the polynucleotide sequences of the invention and polynucleotides isolated from test subjects. Knowledge of such polymorphisms (ie, the location of the polymorphism, and the presence of the polymorphism) can lead to many disorders (eg, neuropathy, immune system disorders, muscle disorders,
Reproductive disorders, gastrointestinal disorders, pulmonary disorders, cardiovascular disorders, renal disorders, proliferative disorders, and / or cancerous diseases and conditions are useful in identifying disease loci. Such methods are described in US Pat. Nos. 5,858,659 and 5,856.
, 104. The United States patents referenced above are incorporated herein by reference in their entireties.

The present invention includes polynucleotides of the present invention that are chemically synthesized (ie, reproduced as a peptide nucleic acid (PNA)) or synthesized according to other methods known in the art. The use of PNA serves as the preferred form when the polynucleotide of the invention is incorporated into a solid support, ie a gene chip. For the purposes of the present invention, peptide nucleic acid (PNA) is a DNA analog of the polyamide type, and monomer units for adenine, guanine, thymine and cytosine are commercially available (Perceptice Biosystems).
. Certain components of DNA (eg phosphorus, phosphorus oxide or deoxyribose derivatives) are not present in PNA. P. E. Nielsen, M .; Egholm, R
． H. Berg and O.M. Buchardt, Science 254, 149
7 (1997); and M.S. Egholm, O.I. Buchardt, L .; Ch
ristensen, C.I. Behrens, S .; M. Freier, D.F. A. D
river, R.R. H. Berg, S .; K. Kim, B.H. Norden and P.M.
E. PNAs bind specifically and tightly to complementary DNA strands, as disclosed by Nielsen, Nature 365, 666 (1993),
And it is not decomposed by nucleases. In fact, PNA binds more strongly to DNA than does DNA itself. This is probably due to the absence of electrostatic repulsion between the two chains and also the more flexible polyamide backbone. This allows PNA / DNA duplexes to bind under a wider range of stringency conditions than DNA / DNA duplexes, making it easier to perform multiplex hybridization. Due to the strong binding, smaller probes can be used than with DNA. Furthermore, perhaps single base mismatches can be determined using PNA / DNA hybridizations. Because the single mismatch in the 15-mer PNA / DNA was 4 ° C for the 15-mer DNA / DNA duplex.
This is because the melting point (T.sub.m) is lowered by 8 to 20 ° C. while the temperature is up to 16 ° C. Also, the absence of charged groups in the PNA means that hybridization can be done at low ionic strength and reduce possible interference by salts during the analysis.

The present invention has applications including, but not limited to, detection of cancer in mammals. In particular, the invention is useful during the diagnosis of pathological cell proliferative neoplasia, including but not limited to: acute myeloid leukemia (acute monocytic leukemia, acute myeloblastic leukemia, acute Including promyelocytic leukemia, acute myelomonocytic leukemia, acute erythroleukemia, acute megakaryocytic leukemia, and acute undifferentiated leukemia); and chronic myelogenous leukemia (chronic myelomonocytic leukemia, chronic granulocytic leukemia) Including leukemia). Preferred mammals include monkeys, apes, cats, dogs, cows, pigs, horses, rabbits and humans. Especially preferred is human.

Pathological cell proliferative disorders are often associated with inappropriate activation of proto-oncogenes (
Gelmann, E .; P. Et al., “The Etiology of Accuet”
Leukemia: Molecular Genetics and Vir
al Oncology ”, Neoplastic Diseases of
the Blood, Volume 1, Wiernik, P .; H. Et al., 161-182
(1985)). Neoplasia is now from qualitative alterations of the normal cellular gene product, by the insertion of viral sequences into the chromosome, chromosomal translocations of genes into more actively transcribed regions, or by some other mechanism, or of gene expression. It is believed to result from quantitative modification (Gelmann et al., Supra). Mutated or altered expression of certain genes appears to be involved in the pathogenesis of some leukemias, among other tissues and other cell types (Gelmann et al., Supra). In fact, human counterparts of some animal neoplastic oncogenes have been amplified or translocated in some cases of human leukemia and cancer (Gelmann et al., Supra).

[0359] For example, c-myc expression is highly amplified in the non-lymphocytic leukemia cell line HL-60. The levels of c-myc are found to be down-regulated when HL-60 cells are chemically induced to stop amplification (International Publication No. WO 91/15580). However, 5'of c-myc or c-myb
Exposure of HL-60 cells to a DNA construct that is complementary to the ends down-regulates expression of the c-myc or c-myb protein by the corresponding m.
It has been shown to block translation of RNA and cause cell growth and arrest of differentiation of treated cells (International Publication No. WO 91/15580; Wickst).
rom et al., Proc. Natl. Acad. Sci. 85: 1028 (1988)
); Anfossi et al., Proc. Natl. Acad. Sci. 86: 337
9 (1989)). However, one of ordinary skill in the art will find the utility of the present invention in the treatment of proliferative disorders of hematopoietic cells and tissues, given the large number of cells and cell types of various origins known to exhibit a proliferative phenotype. Recognize that you are not limited.

In addition to the above, the polynucleotides of the present invention can be used to control gene expression through triple helix formation or through antisense DNA or RNA. Antisense technology is described in, for example, Okano, J. et al. Neurochem
． 56: 560 (1991), "Oligodeoxynucleotides.
as Antisense Inhibitors of Gene Exp
", CRC Press, Boca Raton, FL (198).
8). Triple helix formation is described, for example, in Lee et al., Nucleic.
Acids Research 6: 3073 (1979); Cooney et al., Science 241: 456 (1988); and Dervan et al., Sc.
ience 251: 1360 (1991). Both methods rely on the binding of the polynucleotide to complementary DNA or RNA. For these techniques, the preferred polynucleotides are usually oligonucleotides 20-40 bases in length, and the gene regions involved in transcription (triple helix-Le.
e et al., Nucl. Acids Res. 6: 3073 (1979); Cone
y et al., Science 241: 456 (1988); and Dervan et al.,
Science 251: 1360 (1991)) or mRNA.
As such (Antisense-Okano, J. Neurochem. 56: 560 (1
991); Oligodeoxy-nucleotides as Antis.
sense Inhibitors of Gene Expression, C
RC Press, Boca Raton, FL (1988)). Triple helix formation optimally results in the blockage of RNA transcription from DNA, whereas antisense RNA hybridisation results in mRN to polypeptide.
Block the translation of the A molecule. The above oligonucleotides are also antisense RN
A or DNA can be delivered to cells so that it can be expressed in vivo and inhibit polypeptide production of the antigens of the invention. Both techniques are effective in model systems, and the information disclosed herein provides antisense in an attempt to treat disease, particularly for the treatment of proliferative diseases and / or conditions. Or it can be used to design triple helix polynucleotides.

The polynucleotides of the present invention are also useful in gene therapy. One goal of gene therapy is to insert a normal gene into an organism that has a defective gene in an attempt to correct the genetic defect. The polynucleotide disclosed in the present invention is
It provides a means to target such genetic defects in a highly accurate manner. Another goal is to insert new genes that were not present in the host genome, thereby creating new traits in the host cell.

Polynucleotides are also useful for identifying an individual from a small biological sample. For example, the United States military is considering the use of restriction fragment length polymorphisms (RFLPs) to identify its personnel. In this technique, an individual's genomic DNA is digested with one or more restriction enzymes and probed for Southern blots to generate unique bands to identify staff. This method does not suffer from the current limitations of the "Dog tag," which can be difficult to positively identify by being lost, exchanged, or stolen. The polynucleotide of the present invention can be used as an additional DNA marker for RFLP.

The polynucleotides of the present invention may also be used as an alternative to RFLP by determining the actual base-by-base DNA sequence of selected portions of the genome of an individual. These sequences can be used to prepare PCR primers to amplify and isolate such selected DNA, which can then be sequenced. Individuals can be identified using this technique because each individual has a unique set of DNA sequences. Once a unique ID database is established for an individual, whether that individual is alive or dead, positive identification of that individual can be made from a very small tissue sample.

Forensic biology will also benefit using DNA-based identification techniques as disclosed herein. Tissue (eg hair or skin) or body fluid (eg blood, saliva, semen, synovial fluid, amniotic fluid, milk, lymph, lung sp (pulmonary sp)
DNA) obtained from a very small biological sample, such as urium) or surfactant, urine, fecal material, etc.) can be amplified using PCR.
In one prior art, gene sequences amplified from polymorphic loci such as the DQa class II HLA gene are used in forensic biology to identify individuals. (Errich, H., PCR Technology, Freem.
an and Co. (1992)). Once these specific polymorphic loci are amplified, they are digested with one or more restriction enzymes. This results in an identified set of bands for Southern blots probed with DNA corresponding to the DQa class II HLA gene. Similarly, the polynucleotides of the present invention can be used as polymorphic markers for forensic purposes.

There is also a need for reagents that can identify the source of a particular tissue. Such a need arises in forensic medicine, for example, if tissue of unknown origin is provided. Suitable reagents may include, for example, DNA probes or primers specific for prostate or prostate cancer polynucleotides prepared from the sequences of the invention. Such a panel of reagents may identify tissues by species and / or organ type. In a similar fashion, these reagents can be used to screen tissue cultures for contaminants.

The polynucleotides of the present invention are also useful as hybridization probes for the differential identification of tissues or cell types present in a biological sample. Similarly, the polypeptides and antibodies relating to the polypeptides of the invention provide immunological probes for the differential identification of tissues (eg, immunohistochemistry assays) or cell types (eg, immunocytology assays). Useful for. Furthermore, the polynucleotide / polypeptides of the invention against many disorders of the above-mentioned tissues or cells, as compared to “standard” gene expression levels (ie, expression levels of healthy tissues from individuals without disorders). Significantly higher or lower levels of gene expression of
For example, a specific tissue (eg, a tissue expressing a polypeptide and / or polynucleotide of the present invention, and / or cancerous tissue and / or wound tissue) or body fluid (eg, serum, obtained from an individual with a disorder). Plasma, urine, synovial fluid or spinal fluid).

Accordingly, the present invention provides a method of diagnosing a disorder comprising the steps of: (a) assaying the gene expression level in cells or body fluids of an individual; (b) with a standard gene expression level. Comparing this gene expression level, whereby an increase or decrease in the assayed gene expression level relative to a standard expression level is indicative of a disorder.

At a minimum, the polynucleotides of the present invention were "subtracted (s
(utract-out) "to raise anti-DNA antibodies using DNA immunization techniques to select and make oligomers for attachment to" gene chips "or other supports as probes to known sequences, And can be used as an antigen to elicit an immune response.

Uses of Polypeptides Each of the polypeptides identified herein can be used in many ways. The following description should be considered exemplary and utilizes known techniques.

Polypeptides and antibodies directed against the polypeptides of the present invention may be used in tissue (eg, immunohistochemical assays such as ABC immunoperoxidase (Hsu et al., J. Am.
Histochem. cytochem. 29: 577-580 (1981)).
Alternatively, it is useful to provide immunological probes for the differential identification of cell types (eg, immunocytochemical assays).

Antibodies may be used to assay levels of a polypeptide encoded by a polynucleotide of the invention in a biological sample using classical immunohistological methods known to those of skill in the art. . (For example, Jalkanen et al., J. Cell. Bi
ol. 101: 976-985 (1985); Jalkanen et al. Cel
l. Biol. 105: 3087-3096 (1987)). Other antibody-based methods useful for detecting gene expression of proteins include immunoassays, such as enzyme-linked immunosorbent assay (ELISA) and radioimmunoassay (RIA). Suitable antibody assay labels are known in the art and are enzymatic labels (eg glucose oxidase); radioisotopes (eg iodine ( ¹³¹ I, ¹²⁵ I, ¹²³ I, ¹²¹ I), carbon ( ¹⁴ C). ),
Sulfur ( ³⁵ S), tritium ( ³ H), indium ( ^{115 m} In, ^{113 m} In, ¹¹² In
, ¹¹¹ In), and technetium ( ⁹⁹ Tc, ^99m Tc), thallium ( ²⁰¹ Tl)
, Gallium ( ⁶⁸ Ga, ⁶⁷ Ga), palladium ( ¹⁰³ Pd), molybdenum ( ⁹⁹ Mo)
), Xenon ( ¹³³ Xe), fluorine ( ¹⁸ F), ¹⁵³ Sm, ¹⁷⁷ Lu, ¹⁵⁹ Gd, ¹⁴⁹
Pm, ¹⁴⁰ La, ¹⁷⁵ Yb, ¹⁶⁶ Ho, ⁹⁰ Y, ⁴⁷ Sc, ¹⁸⁶ Re, ¹⁸⁸ Re, ¹⁴² Pr
, ¹⁰⁵ Rh, ⁹⁷ Ru; luminescent labels (eg luminol); and fluorescent labels (eg fluorescein and rhodamine) and biotin.

In addition to assaying the levels of the polypeptides of the invention in a biological sample, proteins can also be detected in vivo by imaging. Antibody labels or markers for in vivo imaging of proteins include those detectable by radiography, NMR, or ESR. Labels suitable for radiography include radioisotopes such as barium or cesium, which emit detectable radiation, but are clearly not harmful to the subject. Suitable markers for NMR and ESR include markers with a detectable characteristic spin (eg deuterium), which are incorporated into the antibody by labeling the nutrients for the relevant hybridoma. obtain.

[0373]   Radioisotopes (eg,¹³¹I,¹¹²In,^99mTc, (¹³¹I,¹²⁵I,^{one two Three}I, ¹²¹ I), carbon (¹⁴C), sulfur (³⁵S), tritium (³H), indium (^115m In,^113mIn,¹¹²In,¹¹¹In), and technetium (⁹⁹Tc,^99mTc
),thallium(²⁰¹Tl), gallium (⁶⁸Ga,⁶⁷Ga), palladium (¹⁰³Pd
),molybdenum(⁹⁹Mo), xenon (¹³³Xe), fluorine (¹⁸F),¹⁵³Sm, ¹⁷⁷ Lu,¹⁵⁹Gd,¹⁴⁹Pm,¹⁴⁰La,¹⁷⁵Yb,¹⁶⁶Ho,⁹⁰Y,⁴⁷Sc,¹⁸⁶
Re,¹⁸⁸Re,¹⁴²Pr,¹⁰⁵Rh,⁹⁷Ru), radiopaque material, or nucleus
Labeled with a suitable detectable imaging moiety, such as a material detectable by magnetic resonance
In addition, protein-specific antibodies or antibody fragments have been tested for disorders of the immune system.
Introduced into the mammal to be investigated (eg parenterally, subcutaneously, or intraperitoneally)
It The size of the subject and the imaging system used will produce diagnostic images.
It is understood in the art to determine the amount of imaging moiety needed to achieve this. Radioactive isotope
In the case of body parts, for human subjects, the amount of radioactivity injected will typically be^99m
It is in the range of about 5 to 20 millicuries of Tc. Then, the labeled antibody or anti-antibody
The body fragment is a polypeptide encoded by the polynucleotide of the present invention.
Accumulates preferentially at the location of cells expressing. In vivo tumor imaging is described by S. W.
Burchiel et al., “Immunopharmacokinetics of
  Radiolabeled Antibodies and Their F
ragments "(Tumor Imaging: The Radioche
Chapter 13 of the Medical Detection of Cancer, S.M. W. B
urchiel and B. A. Edited by Rhodes, Masson Public
ing Inc. (1982)).

In one embodiment, the invention is by administering a polypeptide of the invention (eg, a polypeptide and / or antibody encoded by a polynucleotide of the invention) that associates with a heterologous polypeptide or nucleic acid. , For the specific delivery of the compositions of the invention to cells. In one example, the invention provides a method for delivering therapeutic proteins into targeted cells. In another example, the invention provides a single-stranded nucleic acid (eg, an antisense or ribozyme) or a double-stranded nucleic acid (eg, a DNA that can integrate into the genome of a cell or replicate episomally and be transcribed). ) To targeted cells.

In another embodiment, the invention provides for specific destruction of cells (eg, by administering a polypeptide of the invention related to a toxin or cytotoxic prodrug, eg,
Tumor cell destruction).

“Toxin” refers to the endogenous cytotoxic effector system, radioisotope, holotoxin (
holotoxin), modified toxins, catalytic subunits of toxins, or one or more compounds that bind and activate any molecule or enzyme normally absent in or on the surface of a cell that causes cell death under defined conditions. means. Toxins that may be used in accordance with the methods of the present invention include, but are not limited to, radioisotopes known in the art, compounds that bind to an intrinsic or induced endogenous cytotoxic effector system. (For example, antibody (or complement fixing-containing portion)), thymidine kinase, endonuclease, RNAse, α-toxin, ricin, abrin, Pseudomonas exotoxin A, diphtheria toxin, saporin,
Momordin, gelonin, pokeweed antiviral protein, alpha sarcin and cholera toxin. "toxin"
Are also cytostatic or cytocidal agents, therapeutic agents or radioactive metal ions (eg α-emitters (eg ²¹³ Bi)) or other radioisotopes (eg ¹⁰³ Pd, ¹³³ Xe, ¹³¹ I). , ⁶⁸ Ge, ⁵⁷ Co, ⁶⁵ Zn, ⁸⁵ Sr, ³² P, ³⁵ S
, ⁹⁰ Y, ¹⁵³ Sm, ¹⁵³ Gd, ¹⁶⁹ Yb, ⁵¹ Cr, ⁵⁴ Mn, ⁷⁵ Se, ¹¹³ Sn, ⁹⁰ yttrium, ¹¹⁷ tin, ¹⁸⁶ rhenium, ¹⁶⁶ holmium, and ¹⁸⁸ rhenium); luminescent labels (eg, luminol); And fluorescent labels (eg, fluorescein and rhodamine), and biotin.

Techniques known in the art can be applied to label the polypeptides (including antibodies) of the invention. One such technique is the use of bifunctional binders (
For example, US Pat. Nos. 5,756,065; 5,714,631; 5
, 696, 239; 5,652, 361; 5,505, 931;
No. 5,489,425; No. 5,435,990; No. 5,428,13.
No. 9; No. 5,342, 604; No. 5,274, 119; No. 4,994.
, 560; and 5,808,003; the content of each of which is incorporated herein by reference in its entirety), but is not limited thereto.

The invention thus provides a method of diagnosing a disorder, which comprises: (a) assaying the expression level of a polypeptide of the invention in cells or body fluids of an individual; and (b) an assay. Comparing the expression level of the expressed polypeptide with the expression level of the standard polypeptide, whereby an increase or decrease in the expression level of the assayed polypeptide relative to the standard expression level is indicative of an impairment. For cancer, the presence of relatively high amounts of transcripts in biopsied tissue from an individual may indicate a predisposition to the development of the disease, or the actual clinical manifestation of the disease before it becomes apparent. May be provided for detecting. A more definitive type of diagnosis may allow health professionals to use preventative measures or aggressive treatment earlier, thereby preventing the onset or further progression of cancer.

Furthermore, using the polypeptides of the present invention, diseases or conditions (eg neuropathy,
Immune system disorder, muscle disorder, reproductive disorder, gastrointestinal disorder, lung disorder, cardiovascular disorder, renal disorder,
Proliferative disorders and / or cancerous diseases and conditions, etc.) can be treated or prevented.
For example, the patient reverses the absence or reduced levels of the polypeptide (eg, insulin), supplements the absence or reduced levels of the different polypeptides (eg, hemoglobin S vs. hemoglobin S, SOD, catalase). ,
DNA repair proteins), inhibiting the activity of polypeptides (eg oncogenes or tumor suppressors), activating the activity of polypeptides (eg by binding to receptors), membrane bound receptors for free ligands Reducing the activity of membrane-bound receptors by competing with (eg, soluble TNF receptors used in reducing inflammation) or producing a desired response (eg, inhibition of blood vessel growth, proliferating cells or tissues). Of the present invention) can be administered a polypeptide of the present invention.

Similarly, antibodies directed against the polypeptides of the present invention may also be used to treat diseases (as described above and elsewhere herein). For example, administration of an antibody directed against a polypeptide of the invention may bind the polypeptide and / or neutralize the polypeptide and / or reduce overproduction of the polypeptide. Similarly, administration of the antibody can activate the polypeptide, for example, by binding to a membrane-bound polypeptide (receptor).

At a minimum, the polypeptides of the present invention are SDS-using methods well known to those of skill in the art.
It can be used as a molecular weight marker for PAGE gels or molecular sieve gel filtration columns. As a method of assessing transformation of host cells, polypeptides can also be used to raise antibodies, which are then used to measure protein expression from recombinant cells. In addition, the polypeptides of the present invention can be used to test the following biological activities.

(Gene Therapy Method) Another aspect of the present invention is a gene therapy method for treating or preventing disorders, diseases and conditions. This gene therapy method relates to the introduction of nucleic acid (DNA, RNA and antisense DNA or RNA) sequences into an animal in order to achieve the expression of the polypeptide of the present invention. This method requires a polynucleotide encoding a polypeptide of the invention operably linked to a promoter and any other genetic elements required for expression of this polypeptide by the target tissue. Such gene therapy and delivery techniques are known in the art (see, eg, WO 90/11092, incorporated herein by reference).

Thus, for example, a cell derived from a patient may have a polynucleotide (DNA or RN) that comprises a promoter operably linked to a polynucleotide of the invention ex vivo.
A) can be engineered with and the engineered cells are then provided to a patient to be treated with a polypeptide of the invention. Such methods are well known in the art. For example, Belldegrun, A .; Et al., J. Natl. Cancer
Inst. 85: 107-216 (1993); Ferrantini, M .;
Et al., Cancer Research 53: 1107-1112 (1993).
Ferrantini, M .; Et al., J. Immunology 153: 460
4-4615 (1994); Kaido, T .; Int. J. Cancer
60: 221-229 (1995); Ogura, H .; Et al, Cancer Re
search 50: 5102-5106 (1990); Santodonat
o, L. Et al., Human Gene Therapy 7: 1-10 (1996).
); Santodonato, L .; Et al, Gene Therapy 4: 124.
6-1255 (1997); and Zhang, J. et al. -F. Et Cancer
See Gene Therapy 3: 31-38 (1996). These are incorporated herein by reference. In one embodiment, the engineered cells are arterial cells. The arterial cells can be reintroduced into the patient via direct injection into the artery, the tissue surrounding the artery, or via catheter infusion.

As discussed in more detail below, the polynucleotide construct can be used to deliver injectable substances to cells of an animal by any method (eg, tissue (heart, muscle, skin, lung, liver, etc.). Injection into the interstitial space). The polynucleotide construct can be delivered in a pharmaceutically acceptable liquid or aqueous carrier.

In one embodiment, the polynucleotides of the invention are delivered as naked polynucleotides. The term “naked” polynucleotide, DNA or RNA refers to any delivery vehicle (viral sequence, viral particle, liposomal formulation, lipofectin or precipitate) that acts to assist, facilitate or facilitate entry into cells. (Including agents) is not included. However, the polynucleotides of the invention may also be delivered, such as in liposomal formulations and lipofectin formulations that may be prepared by methods well known to those of skill in the art. Such a method is, for example,
US Pat. Nos. 5,593,972, 5,589,466 and 5,5
80,859, which are incorporated herein by reference.

Polynucleotide vector constructs used in gene therapy methods are preferably those that do not integrate into the host genome or contain sequences that allow replication. Suitable vectors include pWLNEO, pSV2CAT, pOG44, pXT1 and pSG available from Stratagene; Pha
pSVK3, pBPV, pMSG and pSVL available from Rmcia;
And pEF1 / V5, pcDNA3., Available from Invitrogen.
1 and pRc / CMV2. Other suitable vectors will be readily apparent to those of skill in the art.

Any strong promoter known to those of skill in the art can be used to drive the expression of the polynucleotide sequence. Suitable promoters include adenovirus promoters (eg adenovirus major late promoter); or heterologous promoters (eg cytomegalovirus (CMV) promoter); RS virus (RSV) promoter; inducible promoters (eg MMT promoter, Metallothionein promoter); heat shock promoter; albumin promoter; ApoAI promoter; human globin promoter; viral thymidine kinase promoter (eg, herpes simplex thymidine kinase promoter); retroviral LTR; b-actin promoter; and human growth hormone promoter. The promoter can also be the native promoter for the polynucleotides of the invention.

Unlike other gene therapy techniques, one major advantage of introducing a naked nucleic acid sequence into a target cell is the transient nature of polynucleotide synthesis in that cell. Studies have shown that non-replicating DNA sequences can be introduced into cells to provide for production of the desired polypeptide for a period of up to 6 months.

Polynucleotide constructs are used in tissues in animals (muscle, skin, brain, lung, liver, spleen, bone marrow, thymus, heart, lymph, blood, bone, cartilage, pancreas, kidney, gallbladder, stomach, intestine, testis. , Ovary, uterus, rectum, nervous system, eye, gland, and connective tissue). The interstitial spaces of this tissue are the intercellular liquid mucopolysaccharide matrix between the reticulated fibers of the organ tissue, elastic fibers in the walls of blood vessels or chambers, collagen fibers of fibrous tissue, or connective tissue sheath muscle cells (connective muscle cells). tissu
The same matrix within an eensheating muscle cell or in a bony tear. This is likewise the space occupied by circulating plasma and lymphatic fluid of the lymphatic channels. Delivery of muscle tissue into the interstitial space is preferred for the reasons discussed below. The polynucleotide constructs of the present invention may be conveniently delivered by injection into tissues containing these cells. The polynucleotide constructs of the present invention are preferably delivered to and expressed in differentiated, persistent, non-dividing cells, which delivery and expression may be in undifferentiated cells or cells that are not fully differentiated ( (Eg, blood stem cells or dermal fibroblasts). Muscle cells in vivo are particularly qualified for their ability to take up and express polynucleotides.

For naked nucleic acid sequence injection, the effective dosage of DNA or RNA is about 0.05.
It ranges from mg / kg body weight to about 50 mg / kg body weight. Preferably, this dosage is about 0.005 mg / kg to about 20 mg / kg, and more preferably about 0.05 mg / kg to about 5 mg / kg. Of course, as the skilled artisan will appreciate, this dosage will vary depending on the tissue site of injection. Suitable and effective dosages of nucleic acid sequences can be readily determined by those of ordinary skill in the art and may depend on the condition being treated and the route of administration.

The preferred route of administration is by the parenteral route of injection into the interstitial space of tissues. However, other parenteral routes may also be used, including, for example, inhalation of aerosol formulations, especially for delivery to lung or bronchial tissues, throat or mucous membranes of the nose, among others. In addition, naked DNA constructs can be delivered to arteries during angioplasty by the catheter used in this procedure.

Naked polynucleotides can be any method known in the art including, but not limited to, direct needle injection at the site of delivery, intravenous injection, topical administration, catheter injection, and so-called “gene gun”. Delivered by. These methods of delivery are known in the art.

The constructs can also be delivered using delivery vehicles such as viral sequences, viral particles, liposomal formulations, lipofectins, precipitants and the like. Such delivery methods are known in the art.

In a particular embodiment, the polynucleotide construct is complexed in a liposome preparation. Liposomal preparations for use in the present invention include cationic (positively charged), anionic (negatively charged) and neutral preparations. However, cationic liposomes are particularly preferred because they can form a robust charge complex between the cationic liposomes and the polyanionic nucleic acid. Cationic liposomes, in functional form, include plasmid DNA (Felgner et al., Proc. Natl. Acad. Sci. U, incorporated herein by reference).
SA (1987) 84: 7413-7416); mRNA (Malone et al., Proc. Natl. Acad. Sci. U., incorporated herein by reference).
SA (1989) 86: 6077-6081); and purified transcription factors (Debs et al., J. Biol. Chem. (1) incorporated herein by reference).
990) 265: 10189-10192) has been shown to mediate intracellular delivery.

Cationic liposomes are readily available. For example, N [1-2,3-dioleyloxy) propyl] -N, N, N-triethylammonium (DOTM
A) Liposomes are particularly useful, and G under the trademark Lipofectin
IBCO BRL, Grand Island, N .; Y. (Felgner et al., Proc. Natl. Acad. Sci.
USA (1987) 84: 7413-7416). Other commercially available liposomes include transfectase (trans).
surface) (DDAB / DOPE) and DOTAP / DOPE (Bo
ehringer).

Other cationic liposomes can be prepared from readily available materials using techniques well known in the art. DOTAP (1,2-bis (oleoyloxy)-
For a description of the synthesis of 3- (trimethylammonio) propane) liposomes, see, eg, PCT Publication No. WO 90/11092, which is incorporated herein by reference. The preparation of DOTMA liposomes is described in the literature and is described, for example, in P. et al. Felgner et al., Proc.
Natl. Acad. Sci. USA, 84: 7413-7417. Similar methods can be used to prepare liposomes from other cationic lipid substances.

Similarly, anionic and neutral liposomes are described, for example, in Avant.
It is readily available from i Polar Lipids (Birmingham, Ala.) or can be easily prepared using readily available materials.
Such substances include, among others, phosphatidylcholine, cholesterol, phosphatidylethanolamine, dioleoylphosphatidylcholine (DOPC).
), Dioleoylphosphatidylglycerol (DOPG), and dioleoylphosphatidylethanolamine (DOPE). These substances also
It can be mixed with DOTMA starting material and DOTAP starting material in suitable proportions. Methods of using these materials to form liposomes are well known in the art.

For example, commercially, dioleoylphosphatidylcholine (DOPC), dioleoylphosphatidylglycerol (DOPG), and dioleoylphosphatidylethanolamine (DOPE) were used in various combinations, with the addition of cholesterol. Even without, conventional liposomes can be produced. Therefore,
For example, DOPG / DOPC vesicles can be prepared by drying each 50 mg of DOPG and DOPC under a stream of nitrogen gas into a sonicated vial. The sample is placed under vacuum pump overnight and hydrated the next day with deionized water. The sample was then placed in a capped vial using a Heat Systems Model 350 sonicator equipped with an inverted cup (bath type) probe at maximum setting, circulating the bath at 15 EC. Sonicate for 2 hours. Alternatively, negatively charged vesicles can be prepared without sonication to generate multilamellar vesicles or extruded through nucleopore membranes to separate unilamellar vesicles of different sizes. Can be generated. Other methods are known and available to those of skill in the art.

This liposome includes multilamellar vesicles (MLV), small unilamellar vesicles (SUV).
Alternatively, large unilamellar vesicles (LUVs) may be mentioned, SUVs being preferred. Various liposome-nucleic acid complexes are prepared using methods well known in the art. For example,
Straubinger et al., Method, incorporated herein by reference.
Sof Immunology, 101: 512-527 (1983). For example, MLVs containing nucleic acids can be prepared by depositing a thin film of phospholipids on the walls of glass tubes and then hydrating with a solution of the substance to be encapsulated. SUVs are prepared by long-term sonication of MLVs, producing a homogeneous population of unilamellar vesicles. Pre-formed M to be encapsulated
Add to suspension of LV, then sonicate. When using liposomes containing cationic lipids, dry lipid membranes should be treated with sterile water or 10 mM Tris / N.
Resuspend in a suitable solution, such as an isotonic buffered solution such as aCl, sonicate, then mix the preformed liposomes directly with the DNA. Due to the binding of the positively charged liposomes to the cationic DNA, the liposomes and DNA form a very stable complex. SUVs find use with small nucleic acid fragments. LUVs are prepared by many methods well known in the art. A commonly used method is Ca ²⁺ -EDTA chelation (Papahadjopou).
los et al., Biochim. Biophys. Acta (1975) 394: 4.
83; Wilson et al., Cell (1979)) 17:77; ether injection (D.
eamer, D.E. And Bangham, A .; , Biochim. Biophy
s. Acta (1976) 443: 629; Ostro et al., Biochem. B
iophys. Res. Commum. (1977) 76: 836; Fulle.
y et al., Proc. Natl. Acad. Sci. USA (1979) 76:33.
48); detergent dialysis (Enoch, H. and Strittmatter,
P. , Proc. Natl. Acad. Sci. USA (1979) 76:14.
5); and reverse phase evaporation (REV) (Fraley et al., J. Biol.
． Chem. (1980) 255: 10431; Szoka, F .; And Pap
ahadjopuulos, D.A. , Proc. Natl. Acad. Sci. U
SA (1978) 75: 145; Schaefer-Ridder et al., Scie.
No. (1982) 215: 166), which are incorporated herein by reference.

Generally, the ratio of DNA to liposomes is from about 10: 1 to about 1:10. Preferably, the ratio is about 5: 1 to about 1: 5. More preferably, the ratio is from about 3: 1 to about 1: 3. Even more preferably, the ratio is about 1: 1.

US Pat. No. 5,676,954 (incorporated herein by reference) reports the injection of genetic material complexed with cationic liposome carriers into mice. U.S. Pat. Nos. 4,897,355, 4,946,787, 5,049,386, 5,459,127, 5,589,466.
No. 5,693,622, No. 5,580,859, No. 5,703.
055 and WO 94/9469, which are incorporated herein by reference, provide cationic lipids for use in transfecting DNA into cells and mammals. U.S. Pat. No. 5,589,466,
No. 5,693,622, No. 5,580,859, No. 5,703,05
No. 5 and WO 94/9469, which are incorporated herein by reference, provide methods of delivering DNA-cationic lipid complexes to mammals.

In a particular embodiment, an RN comprising a sequence encoding a polypeptide of the invention.
The retroviral particles containing A are used to engineer cells ex vivo or in vivo. Examples of the retrovirus capable of inducing a retrovirus plasmid vector include Moloney murine leukemia virus, splenic necrosis virus, Rous sarcoma virus,
Harvey sarcoma virus, chicken leukemia virus, gibbon leukemia virus,
Human immunodeficiency virus, myeloproliferative sarcoma virus, and breast cancer virus are included, but are not limited to.

This retroviral plasmid vector is used to transduce a packaging cell line to form a producer cell line. Examples of packaging cell lines that can be transfected include Miller, Human Gene Therapy, 1: 5-14 (199), which is incorporated herein by reference in its entirety.
0) PE501, PA317, R-2, R-AM, PA1 as described in
2, T19-14X, VT-19-17-H2, RCRE, RCRIP, GP +
Examples include, but are not limited to, E-86, GP + envAm12 and DAN cell lines. The vector may transduce the packaging cells by any means known in the art. Such means, electroporation, the use of liposomes, and CaPO ₄ precipitation include, but are not limited to. In one alternative, the retroviral plasmid vector can be encapsulated in liposomes or attached to lipids and then administered to a host.

This producer cell line produces infectious retroviral vector particles which contain a polynucleotide encoding a polypeptide of the invention. Such retroviral vector particles can then be used to transduce eukaryotic cells either in vitro or in vivo. The transduced eukaryotic cell expresses a polypeptide of the invention.

In certain other embodiments, the polynucleotides contained in the adenovirus vectors are used to engineer cells ex vivo or in vivo. Adenovirus can be engineered so that it encodes and expresses the polypeptide of the invention, while at the same time being inactivated with respect to its ability to replicate in the normal lytic viral life cycle. Adenovirus expression is achieved without integration of the viral DNA into the host cell chromosome, resulting in less worry about insertional mutagenesis. In addition, adenovirus has been used for many years as a live vaccine for the intestine with excellent safety aspects (Schwartzet, AR et al., (197).
4) Am. Rev. Respir. Dis. , 109: 233-238). Finally, adenovirus-mediated gene transfer has been demonstrated in a number of cases, including the transfer of α-1-antitrypsin and CFTR into the lungs of cotton rats (R
osenfeld, M .; A. Et al., (1991) Science, 252: 431.
~ 434; Rosenfeld et al., (1992) Cell 68: 143-15.
5). Furthermore, extensive research seeking to establish adenovirus as the causative agent in human cancers was uniformly negative (Green, M. et al. (1979) Pr.
oc. Natl. Acad. Sci. USA, 76: 6606).

Suitable adenovirus vectors useful in the present invention are, for example, Koz.
arsky and Wilson, Curr. Opin. Genet. Devel
． 3: 499-503 (1993); Rosenfeld et al., Cell, 68.
: 143-155 (1992); Engelhardt et al., Human Gen.
et. Ther. 4: 759-769 (1993); Yang et al., Nature.
e Genet, 7: 362-369 (1994); Wilson et al., Natu.
re 365: 691-692 (1993); and US Pat. No. 5,652,2.
24, which are hereby incorporated by reference. For example, the adenovirus vector Ad2 is useful and can be propagated in human 293 cells. These cells contain the adenovirus E1 region and constitutively express Ela and Elb, which complement the defective adenovirus by providing the product of the gene deleted from this vector. . In addition to Ad2, a variety of other adenoviruses (eg, Ad3, Ad5, and Ad7) are also useful in the present invention.

Preferably, the adenovirus used in the present invention is replication defective. Replication-defective adenoviruses require the help of helper viruses and / or packaging cell lines to form infectious particles. The resulting virus is capable of infecting cells and can express the polynucleotide of interest operably linked to a promoter, but is unable to replicate in most cells. A replication-defective adenovirus can be deleted at one or more of the following genes: E1a, E1b, E3, E4, E2a or all or part of L1 to L5.

In certain other embodiments, adeno-associated virus (AAV) is used to engineer the cells ex vivo or in vivo. AAV is a naturally occurring defective virus that requires a helper virus to produce infectious particles (
Muzyczka, N .; Curr. Topics in Microbiol
． Immunol. , 158: 97 (1992)). AAV is also one of the few viruses that can integrate its DNA into cells that are not dividing.
Vectors containing AAV as small as 300 base pairs can be packaged and can integrate, but space for exogenous DNA is limited to about 4.5 kb. Methods of generating and using such AAV are known in the art. For example, US Pat. Nos. 5,139,941, 5,173,414 and 5,354,67.
No. 8, No. 5,436, 146, No. 5,474, 935, No. 5, 478.
, 745 and 5,589,377.

For example, an AAV vector suitable for use in the present invention contains all the sequences necessary for DNA replication, encapsidation, and host cell integration. Sam
Brook et al., Molecular Cloning: A Laborator.
y Manual, Cold Spring Harbor Press (19
The polynucleotide construct is inserted into this AAV vector using standard cloning methods, such as those found in 89). The recombinant AAV vector is then transfected into packaging cells infected with helper virus using any standard technique, including lipofection, electroporation, calcium phosphate precipitation and the like. Suitable helper viruses include adenovirus, cytomegalovirus, vaccinia virus,
Or herpes virus. Once the packaging cells are transfected and infected, they contain infectious AAV containing polynucleotide constructs.
Generates virus particles. These viral particles are then used to transduce eukaryotic cells, either ex vivo or in vivo. The transduced cell contains the polynucleotide construct integrated into its genome and expresses a polypeptide of the invention.

Another method of gene therapy is homologous recombination (see, eg, US Pat. No. 5,641,6).
70, published June 24, 1997; International Publication No. WO 96/29411, 19
Published September 26, 1996; International Publication No. WO94 / 12650, August 4, 1994
Published: Koller et al., Proc. Natl. Acad. Sci. USA, 8
6: 8932-8935 (1989); and Zijlstra et al., Nature.
e, 342: 435-438 (1989)) operably linking a heterologous regulatory region and an endogenous polynucleotide sequence (eg, a sequence encoding a polypeptide of the invention). including. The method involves activation of a gene that is present in the target cell but is normally not expressed in that cell or is expressed at a lower level than desired.

Polynucleotide constructs are made using standard techniques known in the art. This construct contains a promoter with targeting sequences flanking the promoter. Suitable promoters are described herein. The targeting sequence is sufficiently complementary to the endogenous sequence to allow homologous recombination between the promoter-targeting sequence and the endogenous sequence. The targeting sequence is located sufficiently close to the 5'end of the desired endogenous polynucleotide sequence so that upon homologous recombination the promoter is operably linked to the endogenous sequence.

The promoter and targeting sequence can be amplified using PCR. Preferably, the amplified promoter contains additional restriction enzyme sites at the 5'and 3'ends. Preferably, the 3'end of the first targeting sequence contains the same restriction enzyme sites as the 5'end of the amplified promoter, and the 5'end of the second targeting sequence contains the 3'end of the amplified promoter. Includes the same restriction sites as the termini. The amplified promoter and targeting sequences are digested and ligated together.

Liposomes, viral sequences, viral particles, whole viruses, lipofections, either as naked polynucleotides or as described in more detail above.
The promoter-targeting sequence construct is delivered to cells, either with a transfection facilitating agent such as a precipitating agent. Direct needle injection, intravenous injection,
The P promoter-targeting sequence may be delivered by any method, including local administration, catheter infusion, particle accelerators and the like. This method is described in more detail below.

The promoter-targeting sequence construct is taken up by cells. Homologous recombination occurs between this construct and the endogenous sequence, so that the endogenous sequence is placed under the control of this promoter. This promoter then drives the expression of the endogenous sequence.

[0415] Preferably, the polynucleotide encoding the polypeptide of the present invention comprises a secretory signal sequence that facilitates secretion of the protein. Typically, the signal sequence is located in the coding region of the polynucleotide, expressed towards or at the 5'end of the coding region of the polynucleotide. The signal sequence may be homologous or heterologous to the polynucleotide of interest and homologous or heterologous to the transfected cells. In addition, the signal sequence can be chemically synthesized using methods known in the art.

Any dosage form of any of the above polynucleotide constructs may be used, so long as the dosage form expresses one or more molecules in an amount sufficient to provide a therapeutic effect. . This includes direct needle injections, systemic injections, catheter injections, biolistic injectors, particle accelerators (ie "gene guns"), gel foam sponge depots, and other commercial depots.
pot) substances, osmotic pumps (eg Alza minipumps), solid (tablets or pills) pharmaceutical formulations for oral or suppository, and intra-operative decanting or topical application. For example, direct injection of calcium phosphate-precipitated naked plasmid into rat liver and rat spleen or direct injection of protein-coated plasmid into the portal vein resulted in gene expression of foreign genes in rat liver (Ka
neda et al., Science, 243: 375 (1989)).

The preferred method of local administration is by direct injection. Preferably, the recombinant molecule of the present invention complexed with the delivery vehicle is administered by direct injection within the arterial region or locally within the arterial region. Topical administration of the composition within the arterial region refers to injection of the composition into the artery several centimeters, preferably several millimeters.

Another method of topical administration is to contact the polynucleotide constructs of the invention within or around a surgical wound. For example, a patient can undergo surgery and the polynucleotide construct can be coated on the tissue surface inside the wound or the construct can be injected into the tissue area inside the wound.

Therapeutic compositions useful for systemic administration include a recombinant molecule of the present invention complexed with a targeted delivery vehicle of the present invention. Suitable delivery vehicles for use in systemic administration include liposomes containing ligands that target the vehicle to a particular site.

Preferred methods of systemic administration include intravenous injection, aerosol, oral and transdermal (topical) delivery. Intravenous injections may be performed using methods standard in the art. Aerosol delivery may also be performed using methods standard in the art (eg, Stribling, incorporated herein by reference).
Et al., Proc. Natl. Acad. Sci. USA, 189: 11277-1.
1281, 1992). Oral delivery can be accomplished by complexing the polynucleotide constructs of the present invention to a carrier capable of withstanding degradation by digestive enzymes in the intestine of the animal. Examples of such carriers include plastic capsules or tablets, such as those known in the art. Topical delivery may be accomplished by mixing a lipophilic reagent (eg DMSO) that is capable of passing into the skin with a polynucleotide construct of the present invention.

Determining the effective amount of a substance to be delivered can be determined, for example, by the chemical structure and biological activity of the substance, the age and weight of the animal, the exact condition requiring treatment and its severity, and administration. It may depend on a number of factors, including the pathway. The frequency of treatment is
It depends on many factors such as the amount of polynucleotide construct administered per dose and the health and medical history of the subject. The exact amount, frequency of dosing and timing of dosing will be determined by the attending physician or veterinarian.

The therapeutic compositions of the present invention may be administered to any animal, preferably mammals and birds. Preferred mammals include humans, dogs, cats, mice, rats,
Rabbits, sheep, cows, horses and pigs are mentioned, with humans being particularly preferred.

Biological Activity The polynucleotides or polypeptides of the invention, or agonists or antagonists, can be used in assays to test for one or more biological activities. If these polynucleotides or polypeptides of the invention, or agonists or antagonists, are active in a particular assay, then it is likely that these molecules may be involved in the disease associated with their biological activity. Thus, the polynucleotides and polypeptides, as well as agonists or antagonists, can be used to treat related diseases.

Members of the TGF-β receptor family of proteins are believed to be involved in extracellular matrix production, inflammatory responses, hematopoietic and immune system responses, developmental regulation, and biological activities associated with neoplastic disorders. Accordingly, the compositions of the present invention, including the polynucleotides, polypeptides and antibodies of the present invention, and fragments and variants thereof, are useful for treating diseases and / or disorders associated with aberrant TGF-β and TGF-β receptor activity. Can be used for the diagnosis, detection and / or treatment of. In a preferred embodiment, the compositions of the present invention, including the polynucleotides, polypeptides and antibodies of the present invention, and fragments and variants thereof, are useful for treating neoplastic disorders (eg, cancer, and / or “hyperproliferation” below). Sexual disorders "and" diseases at the cellular level "), extracellular matrix production, immune system responses (eg, inflammatory responses, and / or described below under" Immune Activity "),
And can be used in the diagnosis, detection and / or treatment of diseases and / or disorders associated with developmental regulation. Thus, the polynucleotides, translation products and antibodies of the present invention are useful for extracellular matrix production, inflammatory responses, hematopoietic and immune system responses, developmental regulation,
And are useful in the diagnosis, detection and / or treatment of diseases and / or disorders associated with activity including, but not limited to, neoplastic disorders.

More generally, polynucleotides, translation products and antibodies corresponding to this gene may be useful in diagnosing, detecting and / or treating diseases and / or disorders involving the following systems.

(Immune Activity) The polynucleotide or polypeptide, or agonist or antagonist of the present invention activates or inhibits the proliferation, differentiation, or mobilization (chemotactic) of immune cells, thereby causing a defect in the immune system or It may be useful in treating disorders. Immune cells develop through a process called hematopoiesis, producing myeloid cells (platelets, erythrocytes, neutrophils and macrophages) and lymphoid cells (B and T lymphocytes) from pluripotent stem cells. The etiology of these immune deficiencies or disorders can be genetic, somatic (eg, cancer or some autoimmune disorder), acquired (eg, due to chemotherapy or toxins) or infectious. Furthermore, the polynucleotides or polypeptides of the invention, or agonists or antagonists, can be used as markers or detectors of diseases or disorders of the particular immune system.

The polynucleotides or polypeptides of the invention, or agonists or antagonists, may be useful in treating or detecting hematopoietic cell defects or disorders. The polynucleotides or polypeptides of the invention, or agonists or antagonists, are used to differentiate and proliferate hematopoietic cells, including pluripotent stem cells, in an attempt to treat disorders associated with the reduction of certain (or many) types of hematopoietic cells. Can be used to increase Examples of immunodeficiency syndromes include disorders of blood proteins (eg, agammaglobulinemia, hypogammaglobulinemia), ataxia-telangiectasia, unclassified immunodeficiency, Di George syndrome, HIV infection, HTLV. -BLV infection, leukocyte adhesion deficiency syndrome, lymphopenia, phagocytic bactericidal dysfunction, severe combined immunodeficiency (SCID), Viscott-Aldrich disorder, anemia, thrombocytopenia, or hemoglobinuria. It is not limited to them.

In addition, the polynucleotides or polypeptides of the invention, or agonists or antagonists, may also be used to modulate hemostatic activity (stop bleeding) or thrombolytic activity (clot formation). For example, by increasing hemostatic activity or thrombolytic activity, a polynucleotide or polypeptide of the invention,
Or using an agonist or antagonist to impair blood coagulation (eg,
Fibrinogenemia, factor deficiency), disorders of blood platelets (eg thrombocytopenia),
Alternatively, wounds resulting from trauma, surgery or other causes may be treated. Alternatively, a polynucleotide or polypeptide of the invention, or an agonist or antagonist that can reduce hemostatic or thrombolytic activity, can be used to inhibit or lyse blood clots. These molecules may be important in the treatment of heart attack (infarction), stroke or scarring.

Polynucleotides or polypeptides of the invention, or agonists or antagonists, may also be useful in treating or detecting autoimmune disorders. Many autoimmune disorders result from inappropriate recognition of self as foreign substances by immune cells. This improper recognition triggers an immune response that results in the destruction of host tissue. Thus, administration of a polynucleotide or polypeptide of the invention, or an agonist or antagonist that is capable of inhibiting the immune response, particularly T cell proliferation, differentiation or chemotaxis, may be an effective treatment in the prevention of autoimmune disorders. .

Examples of autoimmune disorders that may be treated or detected include Addison's disease, hemolytic anemia, antiphospholipid syndrome, rheumatoid arthritis, dermatitis, allergic encephalomyelitis, glomerulonephritis, Goodpasture's syndrome, Graves. Disease, multiple sclerosis, myasthenia gravis, neuritis, ophthalmitis, bullous pemphigoid, pemphigoid, multiple endocrine diseases, purpura, Reiter's disease, Stiffman syndrome, autoimmune thyroiditis, Systemic lupus erythematosus, autoimmune lung inflammation, Guyan-Barre syndrome, insulin-dependent diabetes mellitus,
And autoimmune inflammatory eye diseases, but are not limited thereto.

Similarly, asthma (especially allergic asthma) or other respiratory problems,
Allergic reactions and conditions can also be treated with the polynucleotides or polypeptides of the invention, or agonists or antagonists. In addition, these molecules can be used to treat anaphylaxis, hypersensitivity or blood group incompatibility to antigenic molecules.

The polynucleotides or polypeptides of the invention, or agonists or antagonists, may also be used to treat and / or prevent organ rejection or graft versus host disease (GVHD). Organ rejection occurs by the destruction of transplanted tissue by host immune cells via the immune response. Similarly, the immune response is also involved in GVHD, where foreign transplanted immune cells destroy host tissue. Administration of a polynucleotide or polypeptide of the invention, or an agonist or antagonist that inhibits an immune response, particularly T cell proliferation, differentiation or chemotaxis, may be an effective treatment in preventing organ rejection or GVHD.

Similarly, the polynucleotides or polypeptides of the present invention, or agonists or antagonists, may also be used to modulate inflammation. For example, the polynucleotide or polypeptide, or agonist or antagonist, may inhibit proliferation and differentiation of cells involved in the inflammatory response. Using these molecules, chronic prostatitis, granulomatous prostatitis and malacoplakia, inflammation associated with infection (eg, septic shock, sepsis, or systemic inflammatory response syndrome (S
IRS)), inflammation associated with ischemia-reperfusion injury, inflammation associated with endotoxin lethality, inflammation associated with arthritis, inflammation associated with complement-mediated hyperacute rejection, inflammation associated with nephritis, cytokines or chemokines. Inflammation associated with induced lung injury, inflammation associated with inflammatory bowel disease, inflammation associated with Crohn's disease or cytokines (eg, T
Both chronic and acute inflammatory conditions can be treated, including inflammation resulting from overproduction of NF or IL-1).

Hyperproliferative Disorders Polynucleotides or polypeptides of the invention, or agonists or antagonists, can be used to treat or detect hyperproliferative disorders, including neoplasms.
The polynucleotides or polypeptides of the invention, or agonists or antagonists, may inhibit the growth of this disorder via direct or indirect interactions. Alternatively, the polynucleotides or polypeptides of the invention, or agonists or antagonists, can proliferate other cells that can inhibit hyperproliferative disorders.

Hyperproliferative disorders may be treated, for example, by increasing the immune response, particularly by increasing the antigenic quality of the hyperproliferative disorder, or by proliferating, differentiating or recruiting T cells. This immune response can be augmented by either enhancing an existing immune response or initiating a new immune response. Alternatively, reducing the immune response may also be a method of treating hyperproliferative disorders, such as chemotherapeutic agents.

Examples of hyperproliferative disorders that may be treated or detected by the polynucleotides or polypeptides of the present invention, or agonists or antagonists, include colon, abdomen, bone, breast, digestive system, liver, pancreas, peritoneum, endocrine glands. (Adrenal gland, parathyroid gland, pituitary gland, testis, ovary, thymus, thyroid), eye, head and neck, nerves (central and peripheral), lymphatic system, pelvis, skin, soft tissue, spleen, chest, and genitourinary organs. Located in, but is not limited to.

Similarly, other hyperproliferative disorders can also be treated or detected with the polynucleotides or polypeptides of the invention, or agonists or antagonists. Examples of such hyperproliferative disorders include, but are not limited to, hypergammaglobulinemia, lymphoproliferative disorders, paraproteinemia, purpura, sarcoidosis, Sézary syndrome, Waldenström. Macroglobulinemia, Gaucher disease, histiocytosis, and any other hyperproliferative disease, as well as neoplasms found in the organ systems listed above.

One preferred embodiment of utilizing the polynucleotides of the invention is to inhibit aberrant cell division by gene therapy using the invention and / or fusion proteins or fragments thereof.

Accordingly, the invention provides a method for treating a cell proliferative disorder by inserting a polynucleotide of the invention into an aberrantly proliferating cell, wherein the polynucleotide is the expression thereof. Indicates.

Another embodiment of the invention provides a method of treating a cell proliferative disorder in an individual, wherein the method comprises one cell that is abnormally proliferating one or more active gene copies of the invention or Administering to multiple cells. In a preferred embodiment, the polynucleotide of the invention is a DNA construct containing a recombinant expression vector effective in expressing the DNA sequence encoding the polynucleotide. In another preferred embodiment of the invention D encoding a polynucleotide of the invention
The NA construct is inserted into the cells to be treated using a retroviral vector, or more preferably an adenoviral vector (GJ. Nabel et al., PNAS 1999 96: 324-326, which is referred to herein). Incorporated as a reference in))). In the most preferred embodiment, the viral vector is defective and transforms only proliferating cells rather than non-proliferating cells.
Furthermore, in a preferred embodiment, the polynucleotides of the invention inserted into proliferating cells, either alone or in combination or fusion with other polynucleotides, are then subjected to external stimulation (ie, magnetic, specific Small molecule, chemical, or drug administration, etc., which acts on a promoter upstream of this polynucleotide to induce expression of the encoded protein product. Thus, the beneficial therapeutic effects of the present invention can be positively modulated (ie, increase, decrease, or inhibit expression of the present invention) based on this external stimulus.

Polynucleotides encoding the polypeptides of the present invention may be administered with other polynucleotides encoding other angiogenic proteins. Angiogenic proteins include acidic and basic fibroblast growth factor, VEGF-1, VEG
F-2, VEGF-3, epidermal growth factor α and β, platelet-derived endothelial cell growth factor, platelet-derived growth factor, tumor necrosis factor α, hepatocyte growth factor, insulin-like growth factor, colony stimulating factor, macrophage colony stimulation Factors, granulocyte / macrophage colony stimulating factor, and nitric oxide synthase, but are not limited thereto.

The polynucleotides of the present invention may be useful in suppressing the expression of oncogenes or antigens. By "suppression of expression of oncogene", suppression of gene transcription, degradation of gene transcript (pre-message RNA), inhibition of splicing, messenger RNA destruction, prevention of post-translational modification of protein, protein Disruption of the protein or inhibition of the normal function of the protein.

For topical administration to aberrantly proliferating cells, the polynucleotides of the invention may be administered by any method known to those of skill in the art, including transfection, electroporation, Without limitation, microinjection of cells, or in a vehicle (eg, liposome, lipofectin), or as a naked polynucleotide, or any other method described throughout this specification. The polynucleotide of the present invention can be used in a known gene delivery system (for example, a retroviral vector (Gilboa, J. Virology 44: 845 (
1982); Hocke, Nature 320: 275 (1986); Wil.
Son et al., Proc. Natl. Acad. Sci. U. S. A. 85: 301
4), vaccinia virus system (Chakrabarty et al., Mol. Cell.
Biol. 5: 3403 (1985)) or other effective DNA known to those skilled in the art.
Delivery systems (including but not limited to Yates et al. Nature 313: 812 (1985)). These references are for illustration only and are incorporated herein by reference. In order to specifically deliver or transfect aberrantly proliferating cells and to avoid the use of non-dividing cells, retroviruses known to those skilled in the art, or adenoviruses (either in the art and herein) It is preferred to use delivery systems (as described). This is because host DNA replication requires retroviral DNA for integration, and the retrovirus cannot self-replicate because it lacks the retroviral genes required for its life cycle. By using such a retroviral delivery system for the polynucleotides of the invention, the genes and constructs target abnormally proliferating cells and do not use non-dividing normal cells.

The polynucleotides of the present invention can be used to direct cell-proliferative disorders / internal organ tracts, body cavities, etc. by the use of imaging devices that are used to direct the injection needle directly into the disease site.
It can be delivered directly to the disease site. The polynucleotides of the invention may also be administered to the disease site during surgical procedures.

By “cell proliferative disorder” is meant any human or animal disease or disorder that affects any one or any combination of organs, cavities, or body parts, which is benign. It is characterized by a single or multiple local overgrowth of cells, groups of cells, or tissues, whether malignant or malignant.

Any amount of the polynucleotide of the present invention can be administered, so long as the polynucleotide of the present invention has a biologically inhibitory effect on the growth of the treated cells. Furthermore, it is possible to administer more than one of the polynucleotides of the invention simultaneously to the same site. By "biologically inhibiting" is meant partial or total growth inhibition of cells and proliferation or growth of cells (g
A decrease in the rate of (rowth) is implied. The biologically inhibitory dose can be determined by assessing the effect of the polynucleotide of the invention on targeted malignant or overgrowth cell growth in tissue culture, tumor growth in animals and cell culture, or by any method known to those of skill in the art. Can be determined by other methods.

The present invention further relates to antibody-based therapies, which comprise anti-polypeptide and anti-polynucleotide antibodies to treat mammalian (preferably human) patients in order to treat one or more of the described disorders. And the step of administering to. Methods for producing polyclonal and monoclonal antibodies of anti-polypeptide and anti-polynucleotide antibodies are described in detail elsewhere herein. Such antibodies may be provided in pharmaceutically acceptable compositions known in the art or as described herein.

A summary of the ways in which the antibodies of the invention can be used therapeutically is that polynucleotides or polypeptides of the invention can be administered locally or systemically in the body, or by direct cytotoxicity of the antibody ( For example, the step of binding (as mediated by complementing cells (CDC) or effector cells (ADCC)) is included. Some of these approaches are described in more detail below. Given the teachings provided herein, those of skill in the art will understand, without undue experimentation, how to use the antibodies of the invention for diagnostic, monitoring or therapeutic purposes.

In particular, the antibodies, fragments and derivatives of the present invention treat a subject having or developing a cell proliferative disorder and / or a cell differentiation disorder as described herein. Useful for. Such treatment involves the administration of single or multiple doses of the antibody or fragment, derivative or conjugate thereof.

The antibodies of the invention may be used advantageously, for example, in combination with other monoclonal or chimeric antibodies, or in combination with lymphokines or hematopoietic growth factors, which determines the number of effector cells that interact with the antibody or Helps to increase activity.

[0451]   High affinity for the polypeptide or polynucleotide of the invention and / or
Is a potent in vivo inhibitory and / or neutralizing antibody, fragment thereof or
Regions are defined as polynucleotides or polypeptides of the invention (fragments thereof).
Immunoassays for) and the treatment of disorders associated therewith.
It is preferable to use Such antibodies, fragments or regions are preferred.
More preferably, the polynucleotide or polypeptide (including fragments thereof)
) Has an affinity for. The preferred binding affinity is 5 x 10^-6M, 10 ^-6 M, 5 x 10^-7M, 10^-7M, 5 x 10^-8M, 10^-8M, 5 x 10^-9M, 10 ^-9 M, 5 x 10^-TenM, 10^-TenM, 5 x 10^-11M, 10^-11M, 5 x 10^-12M
10,^-12M, 5 x 10^-13M, 10^-13M, 5 x 10^-14M, 10^-14M, 5 x 1
0^-15M and 10^-15Binding affinities with dissociation constants less than M, or Kd
Be done.

Furthermore, as described elsewhere herein, the polypeptides of the invention, either alone, as a fusion protein, or in combination with other polypeptides, are either direct or indirect. And are useful in inhibiting angiogenesis of proliferating cells or tissues. In the most preferred embodiment, this anti-angiogenic effect is
It can be achieved indirectly, for example through the inhibition of hematopoietic cells, tumor-specific cells (eg tumor-associated macrophages) (Joseph IB et al., J Natl Ca.
ncer Inst, 90 (21): 1648-53 (1998), which is incorporated herein by reference). Antibodies directed against the polypeptides or polynucleotides of the invention may also directly or indirectly result in inhibition of angiogenesis (Wite L et al. Cancer Metastatis Re.
v. 17 (2): 155-61 (1998), which is incorporated herein by reference).

The polypeptides of the invention (including fusion proteins) or fragments thereof are
It may be useful in inhibiting proliferative cells or tissues through the induction of apoptosis. This polypeptide can be used as a death domain receptor (eg, tumor necrosis factor (T
In the activation of NF) receptor 1, CD95 (Fas / APO-1), TNF receptor-related apoptosis mediator protein (TRAMP) and TNF-related apoptosis inducing ligand (TRAIL) receptor 1 and receptor 2),
It can act either directly or indirectly to induce apoptosis in proliferative cells and tissues (Schulze-Osthoff K et al., Eur J.
Biochem 254 (3): 439-59 (1998), which is incorporated herein by reference). Furthermore, in another preferred embodiment of the invention, the polypeptide is administered through other mechanisms (eg, in activating other proteins that activate apoptosis), or alone or in small molecule drugs or adjuvants (eg, Either in combination with apoptonin, galectin, thioredoxin, anti-inflammatory protein),
Through stimulation of expression of this protein, apoptosis can be induced (eg M
utat Res 400 (1-2): 447-55 (1998), Med H.
yptheses. 50 (5): 423-33 (1998), Chem Bi.
ol Interact. Apr 24; 111-112: 23-34 (199.
8), J Mol Med. 76 (6): 402-12 (1998), Int.
J Tissue React; 20 (1): 3-15 (1998), all of which are incorporated herein by reference).

The polypeptides of the present invention, including fusion proteins or fragments thereof, are useful in inhibiting metastasis of proliferating cells or tissues. Inhibition can be as a direct result of administration of the polypeptide, or an antibody directed against the polypeptide as described elsewhere herein, or indirectly (eg, known to inhibit metastasis. Activation of expression of a protein (eg, α4 integrin) that has been generated (eg, Curr Top Microbiol Imm)
unol 1998; 231: 125-41, which is incorporated herein by reference). Such therapeutic effects of the present invention can be achieved either alone or in combination with small molecule drugs or adjuvants.

In another embodiment, the invention comprises a composition comprising a polypeptide of the invention (eg, a polypeptide or polypeptide antibody associated with a heterologous polypeptide, a heterologous nucleic acid, a toxin, or a prodrug. To a target cell expressing the polypeptide of the present invention. A polypeptide or polypeptide antibody of the invention may associate with a heterologous polypeptide, heterologous nucleic acid, toxin, or prodrug via hydrophobic, hydrophilic, ionic and / or covalent interactions.

The polypeptides of the invention, their fusion proteins or fragments thereof may be “directly” vaccinated with an immune response, eg, because the polypeptides of the invention respond to proliferative antigens and immunogens. "As is the case" or indirectly (eg, as in the activation of expression of proteins (eg, chemokines) known to enhance the immune response to this antigen and immunogen). , Are useful in enhancing the immunogenicity and / or antigenicity of proliferating cells or tissues.

Cardiovascular Disorders Polynucleotides or polypeptides of the invention, or agonists or antagonists, can be used to treat cardiovascular disorders, including peripheral arterial disease such as limb ischemia.

Cardiovascular disorders include arterio-arterial fistulas.
stula), arteriovenous fistula, cerebral arteriovenous birth defects, congenital heart defects (congeni)
cardiovascular abnormalities such as tal heart defects, pulmonary valve atresia, and Scimitar syndrome. Congenital heart defects include aortic coarctation, tricentric heart, coronary vessel anomalies
, Cross heart, right thoracic heart, patent ductus arteri
oss), Ebstein's anomaly, Eisenmenger complex, left ventricular underdevelopment syndrome, left thoracic heart, tetralogy of Fallot, transposition of the great arteries, bilateral right ventricle origin, tricuspid valve closure, residual arterial canal , And heart septal deficiency
ts) (e.g., aortopulmonary separation)
eptal defect, endocardial bed deficiency, Luthambache syndrome, trilogy of Fallot, ventricular heart septal defect (ventricular heart sep
tal defects)).

Cardiovascular disorders also include arrhythmias, carcinoid heart disease, high cardiac output (hi
gh cardiac output, low cardiac output (low cardiac)
output), cardiac tamponade, endocarditis (including bacterial), cardiac aneurysm,
Cardiac arrest, congestive heart failure, congestive cardiomyopathy, paroxysmal dyspnea, edema, cardiac hypertrophy, congestive cardiomyopathy, left ventricular hypertrophy, right ventricular hypertrophy, post-infarction (post-inf)
arcion heart rupture), ventricular septal rupture, heart valve disease,
Myocardial disease, myocardial ischemia, endocardial effusion, epicarditis (including infarct and tuberculosis),
Pneumopericardial disease, postpericardiotomy syndrome, right heart disease, rheumatic heart disease, ventricular dysfunction, hyperemia, cardiovascular pregnancy complications
and heart diseases such as scimitar syndrome, cardiovascular syphilis, and cardiovascular tuberculosis.

Arrhythmias include sinus arrhythmia, atrial fibrillation, atrial flutter, bradycardia, premature contraction, Adams-Stokes syndrome, leg block, sinoatrial block, long QT syndrome (long).
QT syndrome), collateral contraction, Lone-Ganning-Levine syndrome, Maheme-type pre-excita
tion syndrome), Wolff-Parkinson-White syndrome, sinus dysfunction syndrome, tachycardia, and ventricular fibrillation. As tachycardia, paroxysmal tachycardia,
Supraventricular tachycardia, ventricular intrinsic rhythm promotion, atrioventricular nodal reentry tachycardia (atrioventri
circular nodal reentry tachycardia), ectopic atrial tachycardia, ectopic junction tachycardia, sinoatrial nodal reentry tachycardia
dal reentry tachycardia), sinus tachycardia, torsade
De pointe, and ventricular tachycardia.

Heart valve diseases include aortic insufficiency, aortic stenosis, and murmur (hea).
r murmurs), aortic valve prolapse, mitral valve prolapse, tricuspid valve prolapse, mitral valve dysfunction, mitral valve stenosis, pulmonary valve atresia, pulmonary valve dysfunction, pulmonary valve stenosis, tricuspid Includes atresia, tricuspid dysfunction, and tricuspid stenosis.

Cardiomyopathy includes alcoholic cardiomyopathy, congestive cardiomyopathy, hypertrophic cardiomyopathy, subvalvular aortic stenosis, subvalvular pulmonary stenosis, restricted cardiomyopathy, Chagas cardiomyopathy, intracardiac Membrane fibroelasticity, endocardial myocardial fibrosis, Keens syndrome, myocardial reperfusion injury, and myocarditis.

Myocardial ischemia includes angina, coronary aneurysm, coronary atherosclerosis, coronary thrombosis, coronary vasospasm, myocardial infarction, and myocardial stunnin.
g) such as coronary artery disease.

Cardiovascular diseases also include aneurysms, angiogenesis, hemangiomatosis, bacterial hemangiopathies, Hippel-Lindau Disease.
), Klipel-Tornone-Weber syndrome, Sturgi-Weber syndrome,
Vasomotor edema, aortic disease, Takayasu arteritis, aortitis, Leuriche syndrome,
Arterial occlusive disease, arteritis, arteritis, polyarteritis nodosa, cerebrovascular disease, diabetic vasculopathy, diabetic retinopathy, embolism, thrombosis, erythromelalgia, hemorrhoids, liver Venous obstruction disorder, hypertension, hypotension, ischemia, peripheral vascular disorder, phlebitis, pulmonary vein occlusion disease, hypertension, hypotension, ischemia, peripheral vascular disease, phlebitis, pulmonary vein occlusion disease, Raynaud's disease, CREST syndrome, Retinal vein occlusion, Scimitar syndrome, superior vena cava syndrome, telangiectasia, ataxia tela
vascular diseases such as hereditary hemorrhagic telangiectasia, varicocele, varicose veins, varicose ulcers, vasculitis, and venous insufficiency.

Aneurysms include dissecting aneurysms, pseudoaneurysms, infected aneurysms, ruptured aneurysms, aortic aneurysms, cerebral aneurysms, coronary aneurysms, cardiac aneurysms, and iliac aneurysms. Is mentioned.

Arterial occlusive disease includes arteriosclerosis, intermittent claudication, carotid stenosis, fibromuscular dysplasia, mesenteric vascular occlusion, Moyamoya disease, renal artery occlusion, retinal artery occlusion, and occlusive thrombosis. Sexual vasculitis.

Cerebrovascular disorders include carotid artery disease, cerebral amyloid angiopathy, cerebral aneurysm, cerebral anoxia, cerebral arteriosclerosis, cerebral arteriovenous congenital abnormality, cerebral artery disease, cerebral embolism and thrombosis, Carotid artery thrombosis, sinus thrombosis, Wallenberg syndrome, cerebral hemorrhage, epidural hematoma, subdural hematoma, subarachnoid hemorrhage
Morrage), cerebral infarction, cerebral ischemia (including transient), subclavian stealing syndrome, periventricular leukomalac
ia), vascular headache, cluster headache, migraine, and vertebro.
basallar) dysfunction.

Embolisms include air embolisms, amniotic fluid embolisms, cholesterol embolisms, toe cyanosis syndrome, fat embolisms, pulmonary embolisms, and thromboembolisms. As thrombosis, coronary artery thrombosis, hepatic vein thrombosis, retinal vein occlusion, carotid artery thrombosis,
Includes sinus thrombosis, Wallenberg syndrome, and thrombophlebitis.

As ischemia, there are cerebral ischemia, ischemic colitis, and partition syndrome (compartme).
nt syndrome, anterior compar
ment syndrome), myocardial ischemia, reperfusion injury, and peripheral limb ischemia. Vasculitis includes aortitis, arteritis, Behcet.
t) Syndrome, Churg-Strauss Syndrome, Mucocutaneous Lymph Node Syndrome, Obstructive Thrombotic Vasculitis, Hypersensitivity Vasculitis, Schoenline-Henoho Purpura (Schoenl)
ein-Henoch purpura), allergic cutaneous vasculitis and Wegener's granulomatosis.

The polynucleotides or polypeptides, or agonists or antagonists of the invention are particularly effective for the treatment of dangerous limb ischemia and coronary artery disease.

The polypeptide may be administered using any method known in the art, including direct needle injection at the site of delivery, intravenous injection, topical administration,
Catheter injection, biolistic injection, particle accelerators, gel foam sponge depots, other commercial depot materials, osmotic pumps, solid pharmaceutical formulations for oral or suppository, intraoperative decanting or topical application, aerosol delivery. But is not limited to these. Such methods are known in the art.
Polypeptides are described in more detail below in Therapeutic Agents (Therapeuti).
It can be administered as part of c). Methods of delivering polynucleotides are described in more detail herein.

Anti-Angiogenic Activity The naturally occurring equilibrium between endogenous stimulators and inhibitors of angiogenesis is the equilibrium in which the inhibitory effects predominate. Rastinejad et al., Cell 5
6: 345-355 (1989). In rare cases where neovascularization occurs under normal physiological conditions (eg, wound healing, organ regeneration, embryogenesis, and female reproductive processes), angiogenesis is tightly regulated and spatial and temporal. It is specified. Conditions for pathological angiogenesis (eg, characterizing solid tumor growth)
Below, there is no control over these adjustments. Unregulated angiogenesis becomes pathological and maintains the progression of many neoplastic and non-neoplastic diseases. Many serious diseases are dominated by abnormal neovascularization, including the growth and metastasis of solid tumors, arthritis, some types of ocular disorders and psoriasis. For example, Mo
ses et al., Biotech. 9: 630-634 (1991); Folkman.
N. et al. Engl. J. Med. 333: 1757-1763 (1995);
Auerbach et al. Microvasc. Res. 29: 401-411
(1985); Folkman, Advances in Cancer Re.
search, Klein and Weinhouse, Academic P
less, New York, pp. 175-203 (1985); Patz, Am.
． J. Opthalmol. 94: 715-743 (1982); and Fol.
See review by Kman et al., Science 221: 719-725 (1983). In many pathological conditions, the process of angiogenesis contributes to the disease state. For example, significant data has been accumulated that suggests that solid tumor growth depends on angiogenesis. Folkman and Klagsbrun, S
science 235: 442-447 (1987).

The present invention provides treatment of diseases or disorders associated with neovascularization by the administration of the polynucleotides and / or polypeptides of the present invention and the agonists or antagonists of the present invention. Malignant and metastatic conditions that can be treated with the polynucleotides and polypeptides of the invention, or agonists or antagonists, include malignant diseases, solid tumors, and cancers described herein, as well as others known in the art. (For a review of such disorders, see Fishman
Et al., Medicine, 2nd Edition, J. Am. B. Lippincott Co. , Ph
iladelphia (1985)), but is not limited thereto. Accordingly, the present invention provides a method of treatment of angiogenesis-related diseases and / or disorders, which method comprises administering a therapeutically effective amount of a polynucleotide, polypeptide, antagonist and / or agonist of the present invention Administering to an individual in need of treatment. For example, the polynucleotides, polypeptides, antagonists and / or agonists can be utilized in a variety of additional ways to therapeutically treat cancer or tumors. Cancers that can be treated with polynucleotides, polypeptides, antagonists and / or agonists include prostate cancer, lung cancer, breast cancer, ovarian cancer, gastric cancer, pancreatic cancer, laryngeal cancer, esophageal cancer, testicular cancer, liver cancer, parotid cancer. Solid tumors, including cholangiocarcinoma, colon cancer, rectal cancer, cervical cancer, uterine cancer, endometrial cancer, renal cancer, bladder cancer, thyroid cancer; primary tumors and metastases; melanoma; glioblastoma; Kaposi's sarcoma Leiomyosarcoma; non-small cell lung cancer; colorectal cancer; advanced malignancies; and tumors arising from blood (eg, leukemia). For example, the polynucleotides, polypeptides, antagonists and / or agonists can be delivered locally to treat cancers such as skin cancer, head and neck tumors, breast tumors and Kaposi's sarcoma.

In yet another aspect, the polynucleotides, polypeptides, antagonists and / or agonists can be utilized to treat superficial forms of bladder cancer, eg, by intravesical administration. Polynucleotides, polypeptides, antagonists and / or agonists can be delivered directly to the tumor or near the tumor site via injection or catheter. Of course, as the skilled artisan will appreciate, the appropriate mode of administration will vary with the cancer to be treated. Other modes of delivery are discussed herein.

Polynucleotides, polypeptides, antagonists and / or agonists may be useful in treating other disorders in addition to cancer, including angiogenesis. These disorders include, but are not limited to, benign tumors (eg, hemangiomas, acoustic neuromas, neurofibromas, trachoma, and pyogenic granulomas); atherosclerotic plaques; ocular angiogenesis. Diseases (eg, diabetic retinopathy, immature retinopathy, macular degeneration, corneal transplant rejection, neovascular glaucoma, post lens fibroplasia, rubeosis, retinoblastoma, uveitis and pterygium of the eye (Pter).
ygia) (abnormal blood vessel growth)); rheumatoid arthritis; psoriasis; delayed wound healing;
Endometriosis; Angiogenesis; Granulation; Hyperplastic scar (keloid); Pseudoarthritis fracture; Scleroderma; Trachoma; Vascular adhesion; Myocardial angiogenesis; Coronary coronary
cerebral collaterals; arteriovenous malformations; ischemic extremity angiogenesis; Osler-Webber syndrome; plaque neovascularization; telangiectasia; hemophilic joints; angiofibromas; Fibromuscular dysplasia; wound granulation; Crohn's disease; and atherosclerosis.

For example, in one aspect of the present invention, treating hyperplastic scars and keloids comprising administering to the hyperplastic scars or keloids the polynucleotides, polypeptides, antagonists and / or agonists of the present invention. A method for doing so is provided.

In one embodiment of the invention, polynucleotides, polypeptides, antagonists and / or agonists are directly injected into hyperplastic scars or keloids to prevent the progression of these lesions. This treatment is of particular value in the prophylactic treatment of conditions known to result in the development of hypertrophic scars and keloids (eg burns), and preferably at the time the proliferative phase progresses (of the initial injury). About 14 days later) but before the onset of hyperplastic scars or keloids. As mentioned above, the present invention also provides neovascularization disorders of the eye (eg,
Methods are provided for treating corneal neovascularization, neovascular glaucoma, proliferative diabetic retinopathy, post lens fibroplasia and macular degeneration.

Furthermore, the polynucleotides and polypeptides of the invention (agonists and / or
Ocular disorders associated with neovascularization that can be treated with (including or antagonists) include, but are not limited to, neovascular glaucoma, diabetic retinopathy, retinoblastoma, posterior lens fibrosis. Hyperplasia, uveitis, immature retinopathy, macular degeneration, corneal transplant neovascularization, as well as other inflammatory diseases of the eye, eye tumors,
And diseases associated with choroidal or iris neovascularization. For example, Waltma
n et al., Am. J. Ophthal. 85: 704-710 (1978) and G.
artner et al., Surv. Ophthal. 22: 291 to 312 (1978)
) See the review article.

Accordingly, in one aspect of the invention, corneal neovascularization (comprising the step of administering to the patient a therapeutically effective amount of a compound (described above) to the cornea such that blood vessel formation is inhibited. Methods are provided for treating neovascularization disorders of the eye, including corneal transplant neovascularization). Briefly, the cornea is a tissue that normally lacks blood vessels. However, in certain pathological conditions, capillaries may extend from the limbal pericorneal plexus to the cornea. When the cornea becomes vascularized, it also becomes clouded, resulting in diminished vision of the patient. The cornea becomes completely opaque (opa
vision loss can be complete. A wide variety of disorders can result in corneal neovascularization, including, for example: corneal infections (eg trachoma,
Herpes simplex keratitis, leishmaniasis and onchocerciasis), immunological processes (eg, graft rejection and Stevens-Johnson syndrome), alkaline burns, trauma, inflammation (of any cause), toxic and nutritional deficiencies, and As a complication of wearing contact lenses.

In a particularly preferred embodiment, the invention may be prepared for topical administration in saline, in combination with any preservative and antibacterial agent commonly used in ophthalmic formulations, and It can be administered in the form of eye drops. Solutions or suspensions may be prepared in pure form and administered several times daily. Alternatively, the anti-angiogenic composition prepared as described above can also be administered directly to the cornea. In a preferred embodiment, the anti-angiogenic composition is prepared with a mucoadhesive polymer that binds to the cornea. In a further embodiment, the anti-angiogenic factor or anti-angiogenic composition can be utilized as an adjunct to conventional steroid therapy. Topical treatment may also be prophylactically useful in corneal lesions that are known to have a high potential to induce an angiogenic response (eg, chemical burns). In these cases, treatment (possibly combined with steroids) may be started immediately to help prevent subsequent complications.

In another embodiment, the above compounds may be injected directly into the corneal stroma by an ophthalmologist under the guidance of a microscope. Although the preferred site of injection may vary in the form of individual lesions, the goal of administration is to place the composition on the advancing surface of the vasculature (ie, dispersed between blood vessels and normal corneas). It is). In most cases this is a peril to "protect" the cornea from advancing vessels.
imbic) Cornea injection is included. This method can also be utilized immediately after corneal injury to prevent corneal neovascularization prophylactically. In this situation, the substance may be injected between the corneal lesion and its undesired potential blood supply limbus and injected into the perilimbal cornea. Such methods can also be utilized in a similar fashion to prevent capillary infiltration of the transplanted cornea. In the sustained release form, the infusion is 2 to 1 year.
It may only be needed three times. Steroids may also be added to the infusion solution to reduce inflammation resulting from the injection itself.

In another aspect of the invention, angiogenesis comprising the step of administering to a patient a therapeutically effective amount of a polynucleotide, polypeptide, antagonist and / or agonist to the eye so as to inhibit the formation of blood vessels. Methods for treating glaucoma are provided. In one embodiment, the compound may be administered topically to the eye to treat the early forms of neovascular glaucoma. In other embodiments, the compound may be implanted by injection into the area of the anterior chamber angle. In other embodiments, the compound can also be placed in any location such that the compound is continuously released into the aqueous humor. In another aspect of the invention, the step of administering to the patient a therapeutically effective amount of a polynucleotide, polypeptide, antagonist and / or agonist to the eye such that blood vessel formation is inhibited,
Methods are provided for treating proliferative diabetic retinopathy.

[0483] In a particularly preferred embodiment of the invention, proliferative diabetic retinopathy affects the aqueous humor or the vitreous to increase local concentrations of polynucleotides, polypeptides, antagonists and / or agonists in the retina. It can be treated by injection. Preferably, this treatment should be initiated prior to the acquisition of the severe disease requiring photocoagulation.

In another aspect of the invention, the lens comprising administering to the patient a therapeutically effective amount of a polynucleotide, polypeptide, antagonist and / or agonist to the patient such that blood vessel formation is inhibited. Methods are provided for treating post-fibroproliferative disorders. The compounds may be administered locally via intravitreal injection and / or via intraocular implantation.

Further, disorders that can be treated with the polynucleotides, polypeptides, agonists and / or agonists include, but are not limited to: hemangiomas, arthritis, psoriasis, angiofibromas, atherosclerotic plaques. , Delayed wound healing, granulation, hemophilic joints, hyperplastic scars, pseudo-articular fractures, Osler-Weber syndrome, pyogenic granulomas, scleroderma, trachoma,
And vascular adhesion.

Further, disorders and / or conditions that may be treated with the polynucleotides, polypeptides, agonists and / or agonists include, but are not limited to: solid tumors, blood borne. Tumors (eg leukemia), tumor metastases, Kaposi's sarcoma, benign tumors (eg hemangiomas, acoustic neuromas, neurofibromas, trachoma and purulent granulomas), rheumatoid arthritis,
Psoriasis, ocular angiogenic disorders (eg, diabetic retinopathy, immature retinopathy, macular degeneration, corneal transplant rejection, neovascular glaucoma, post lens fibroplasia, rubeosis, retinoblastoma, and uveitis), Delayed wound healing, endometriosis, angiogenesis, granulation, hyperplastic scar (keloid), pseudoarticular fracture, scleroderma, trachoma, vascular adhesion, myocardial angiogenesis, coronary collateral ( coronary collaterals, cerebral collaterals, arteriovenous malformations, ischemic extremity angiogenesis, Ausler-Weber syndrome,
Plaque neovascularization, telangiectasia, hemophilic joint, angiofibromas, fibromuscular dysplasia, wound granulation, Crohn's disease, atherosclerosis, birth control drug (
By controlling the angiogenesis necessary for embryo implantation that controls menstruation, pathogenic consequences (eg, cat scratch disease (Rochele minalia qu).
diseases with angiogenesis, such as intosa), ulcers (Helicobacter pylori), Bartonellosis and bacterial hemangiomas).

In one aspect of the birth control method, an amount of the compound sufficient to block embryo implantation is administered before or after sexual intercourse and fertilization occur, thus providing an effective method of birth control, perhaps “post-treatment.” (Morning after) method. Polynucleotides, polypeptides, agonists and / or agonists can also be used in controlling menstruation or can be administered either as peritoneal lavage fluid in the treatment of endometriosis or for peritoneal transplantation.

The polynucleotides, polypeptides, agonists and / or agonists of the invention can be incorporated into surgical sutures to prevent stitch granulomas.

The polynucleotide, polypeptide, agonist and / or agonist is
It can be utilized in a wide variety of surgical procedures. For example, in one aspect of the invention, the composition (eg, in the form of a spray or film) is used to separate normal surrounding tissue from malignant tissue and / or prevent the spread of disease to surrounding tissue. In order to do so, it can be utilized to coat or spray the area prior to tumor removal. In another aspect of the invention, the composition (eg, in the form of a spray) is delivered via an endoscopic procedure to coat a tumor or to inhibit angiogenesis at a desired location. obtain. In yet another aspect of the invention, a surgical mesh coated with an anti-angiogenic composition of the invention can be utilized in any procedure in which a surgical mesh can be utilized. For example, in one embodiment of the invention, a surgical mesh laden with an anti-angiogenic composition.
en) may be utilized during abdominal cancer resection surgery (eg, after colectomy) to provide support for the structure and to release certain amounts of anti-angiogenic factors.

In a further aspect of the invention, polynucleotides, polypeptides, agonists and / or agonists are added to the tumor margin after resection so that local recurrence of cancer and formation of new blood vessels at the site are inhibited. Methods for treating a tumor excision site are provided that include administering. In one embodiment of the invention, the anti-angiogenic compound is administered directly to the site of tumor resection (eg, smearing, brushing, or otherwise ablated the tumor with the anti-angiogenic compound). Applied by coating). Alternatively, the anti-angiogenic compound is
It can be incorporated into known surgical pastes prior to administration. In a particularly preferred embodiment of the invention, the anti-angiogenic compound is applied after hepatectomy and neurosurgery for malignancy.

In one aspect of the invention, the polynucleotides, polypeptides, agonists and / or agonists are administered at the resection margin of a wide variety of tumors, including breast tumors, colon tumors, brain tumors and liver tumors. Can be done. For example, in one embodiment of the invention, the anti-angiogenic compound is present at the site of the neurological tumor after resection.
It can be administered so that the formation of new blood vessels at the site is inhibited.

The polynucleotides, polypeptides, agonists and / or agonists of the invention can also be administered with other anti-angiogenic factors. Representative examples of other anti-angiogenic factors include: anti-invasive factors, retinoic acid and its derivatives, paclitaxel, suramin, tissue inhibitors of metalloproteinase-1, tissue inhibitors of metalloproteinase-2, Plasminogen activator inhibitor-1, plasminogen activator inhibitor-2 and the lighter "group d" transition metals of various forms.

Lighter "group d" transition metals include, for example, vanadium, molybdenum, tungsten, titanium, niobium and tantalum species. Such transition metal species are
A transition metal complex can be formed. Suitable complexes of the above transition metal species include oxo transition metal complexes.

[0494] Representative examples of vanadium complexes include oxovanadium complexes such as vanadate and vanadyl complexes. Suitable vanadate complexes include, for example, metavanadate complexes and orthovanadate complexes such as ammonium metavanadate, sodium metavanadate and sodium orthovanadate. Suitable vanadyl complexes include, for example, vanadyl acetylacetonate and vanadyl sulfate, including vanadyl sulfate hydrates such as vanadyl sulfate monohydrate and vanadyl sulfate trihydrate.

Representative examples of tungsten and molybdenum complexes also include oxo complexes. Suitable oxotungsten complexes include tungstate complexes and tungsten oxide complexes. Suitable tungstate complexes include ammonium tungstate, calcium tungstate, sodium tungstate dihydrate and tungstic acid. Suitable tungsten oxides include tungsten (IV) oxide and tungsten (VI).
An oxide is mentioned. Suitable oxomolybdenum complexes include molybdate,
Included are molybdenum oxide and molybdenyl complexes. Suitable molybdate complexes include ammonium molybdate and its hydrates, sodium molybdate and its hydrates, and potassium molybdate and its hydrates. Suitable molybdenum oxides include molybdenum (VI) oxide,
Included are molybdenum (VI) oxide and molybdic acid. Suitable molybdenyl complexes include, for example, molybdenyl acetylacetonate. Other suitable tungsten and molybdenum complexes include, for example, glycerol, tartaric acid and sugar derived hydroxo derivatives.

A wide variety of other anti-angiogenic factors may also be utilized in the context of the present invention. Representative examples include: Platelet Factor 4; Protamine Sulfate; Sulfated Chitin Derivatives (prepared from queen crab shells) (Murata et al. Cancer Res. 51: 22-26, 1991)
Sulphated polysaccharide peptidoglycan complex (SP-PG) (the function of this compound can be enhanced by the presence of steroids (eg, estrogen) and tamoxifen citrate); staurosporine; regulators of substrate metabolism (eg, (Including proline analogs, cishydroxyproline, d, L-3,4-dehydroproline, thiaproline, α, α-dipyridyl, aminopropionitrile fumarate)
4-propyl-5- (4-pyridinyl) -2 (3H) -oxazolone; methotrexate; mitoxantrone; heparin; interferon; 2 macroglobulin-serum; ChIMP-3 (Pavloff et al., J. Bio. Chem. 267).
: 17321-17326, 1992); chymostatin (Tomkinson et al., Biochem J. 286: 475-480, 1992); cyclodextrin tetradeca sulfate; eponomycin; camptothecin; fumagillin (
Ingber et al., Nature 348: 555-557, 1990); Sodium gold thiomalate ("GST"; Matsubara and Ziff, J.C.
lin. Invest. 79: 1440-1446, 1987); anti-collagenase-serum; α2-antiplasmin (Holmes et al., J. Biol. Chem.
． 262 (4): 1659-1664, 1987); Bisantoren (Natio).
nal Cancer Institute); lobenzarit disodium (
N- (2) -carboxyphenyl-4-chloroanthronylic acid (chloroa)
nthoronic acid) disodium, or "CCA"; Tak
euchi et al., Agents Actions 36: 312-316, 199.
2); thalidomide; Angostatic steroids; AGM-1470; carboxynaminolmidazole.
); And metalloproteinase inhibitors (eg, BB94).

Diseases at the Cellular Level Diseases associated with increased cell survival or inhibition of apoptosis that can be treated or detected by the polynucleotides or polypeptides of the invention and antagonists or agonists include cancer (eg, follicular). Lymphomas, carcinomas with p53 mutations, and hormone-dependent tumors, which are: colon cancer, heart tumor,
Pancreatic cancer, melanoma, retinoblastoma, glioblastoma, lung cancer, intestinal cancer, testicular cancer, gastric cancer,
Including neuroblastoma, myxoma, myoma, lymphoma, endothelioma, osteoblastoma, giant cell tumor of bone, osteosarcoma, chondrosarcoma, adenoma, breast cancer, prostate cancer, Kaposi's sarcoma and ovarian cancer,
Autoimmune disorders (eg, multiple sclerosis, Sjogren's syndrome, Hashimoto thyroiditis, biliary cirrhosis, Behcet's d).
disease), Crohn's disease, polymyositis, systemic lupus erythematosus and immune-related glomerulonephritis and rheumatoid arthritis) and viral infections (eg, herpesvirus, poxvirus and adenovirus), inflammation, graft-versus-host disease, acute Graft rejection as well as chronic graft rejection are mentioned. In a preferred embodiment, the polynucleotides, polypeptides, and / or antagonists of the invention include cancer growth, progression, and / or metastasis (especially listed above).
It is used to inhibit the metabolism.

Additional diseases or conditions associated with increased cell survival that can be treated or detected by the polynucleotides or polypeptides of the present invention, or agonists or antagonists, include malignant disease progression and / or metastasis and associations such as: Disorders including, but not limited to: leukemia (acute leukemia (eg, acute lymphocytic leukemia, acute myelogenous leukemia (myeloblastic, promyelocytic, myelomonocytic, monocytic and erythroleukemia). Including)) and chronic leukemia (eg, chronic myelogenous (granulocytic) leukemia and chronic lymphocytic leukemia), polycythemia vera, lymphoma (eg, Hodgkin's and non-Hodgkin's disease), multiple bone marrow Tumors, Waldenstrom macroglobulinemia, heavy chain disease, and solid tumors (
Sarcomas and carcinomas (eg fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphatic sarcoma, lymphatic endothelium, periostealoma, mesothelioma) , Ewing tumor, leiomyosarcoma,
Rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous adenocarcinoma, papillary carcinoma, papillary adenocarcinoma, cystadenocarcinoma, pith Cancer, bronchial carcinoma, renal cell carcinoma, hepatocellular carcinoma, cholangiocarcinoma, choriocarcinoma, seminoma, embryonal carcinoma,
Wilms tumor, cervical cancer, testicular tumor, lung cancer, small cell lung cancer, bladder cancer, epithelial cancer, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pineal Somatoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma
, Melanoma, neuroblastoma, and retinoblastoma)).

Diseases associated with increased apoptosis that can be treated or detected by the polynucleotides or polypeptides of the invention and agonists or antagonists include: AIDS; neurodegenerative disorders (eg Alzheimer's disease, Parkinson's disease). , Amyotrophic lateral sclerosis, retinitis pigmentosa, cerebellar degeneration and brain tumors or previously related disorders; autoimmune disorders (eg, multiple sclerosis,
Sjogren's syndrome, Hashimoto thyroiditis, biliary cirrhosis, Behcet's disease (Behc
et's disease), Crohn's disease, polymyositis, systemic lupus erythematosus and immune-related glomerulonephritis and rheumatoid arthritis), myelodysplastic syndrome (eg, aplastic anemia), graft-versus-host disease, ischemic Injury (such as that caused by myocardial infarction, stroke and reperfusion injury), liver injury (eg hepatitis-related liver injury, ischemia / reperfusion injury, cholestosis (bile duct injury) and liver cancer); toxicants Induced liver disease (such as that caused by alcohol), septic shock, cachexia and anorexia.

Wound Healing and Epithelial Cell Proliferation In accordance with yet a further aspect of the present invention, a polynucleotide or polypeptide of the present invention, as well as an agonist or antagonist, is administered to epithelial cells for therapeutic purposes, eg, for wound healing purposes. Processes are provided for utilization to stimulate proliferation and basal keratinocytes, as well as to stimulate hair follicle production and skin wound healing. The polynucleotides or polypeptides of the invention, as well as agonists or antagonists, may be clinically useful in stimulating wound healing, including: surgical wounds, excisional wounds, deep wounds (damage to the dermis and epidermis). ), Ocular tissue wounds, tooth tissue wounds, oral wounds, diabetic ulcers, skin ulcers, elbow ulcers, arterial ulcers, venous stasis ulcers, heat exposure or chemical burns, And other abnormal wound healing conditions such as uremia, malnutrition, vitamin deficiency, and complications associated with steroids, radiotherapy and systemic treatment with antitumor drugs and antimetabolites. Nucleotides or polypeptides, as well as agonists or antagonists, are used to promote skin recovery after skin loss. Get.

Polynucleotides or polypeptides of the invention, as well as agonists or antagonists, are used to increase the adherence of skin grafts to the wound bed and to stimulate re-epithelialization from the wound bed. Can be done. The following are types of implants in which the polynucleotides or polypeptides, agonists or antagonists of the invention can be used to increase adhesion to the wound bed:
Autograft, artificial skin, allograft, autograft, autoepdermographic graft, avascular (avacu)
lar) graft, Blair-Brown graft, bone graft, embryonic tissue graft, dermal graft, delayed graft, skin graft, epidermal graft, fascia graft, full-thickness skin graft, xenograft. (Heterologous graft), xenograft (xenog)
Raft), homograft graft, proliferative graft, lamellar graft, reticular graft, mucosal graft, Olie-Tielsch graft, omental graft, patch implantation. Pieces, stalk-like grafts, penetrating grafts, split-thickness skin grafts, split-thickness skin grafts. The polynucleotides or polypeptides of the present invention, as well as agonists or antagonists, can be used to promote skin strength and improve the appearance of aged skin.

Polynucleotides or polypeptides of the invention, as well as agonists or antagonists, may also induce hepatocyte proliferation and lung, breast, pancreas, stomach, small intestine (sm).
all intesting) and changes in epithelial cell proliferation in the large intestine. Polynucleotides or polypeptides of the invention, as well as agonists or antagonists, can be used to bind epithelial cells (eg, sebocytes (se
follicles, hair follicles, liver parenchymal cells, alveolar epithelial cells type II p
neuocytes, mucin-producing goblet cells, and other epithelial cells, and their progenitors contained in the skin, lungs, liver, and gastrointestinal tract). The polynucleotides or polypeptides, agonists or antagonists of the invention can promote the proliferation of endothelial cells, keratinocytes, and basal keratinocytes.

The polynucleotides or polypeptides of the present invention, as well as agonists or antagonists, can also be used to reduce the toxic side effects of gut toxicity resulting from radiation, chemotherapeutic treatment or viral infections. The polynucleotides or polypeptides of the invention, as well as agonists or antagonists, may have a cytoprotective effect on the small intestinal mucosa. The polynucleotides or polypeptides of the invention, as well as agonists or antagonists, may also stimulate healing of mucositis (oral mucosa) resulting from chemotherapy and viral infections.

Polynucleotides or polypeptides of the invention, as well as agonists or antagonists, provide sufficient regeneration of skin (ie, hair follicles, sweat glands, and sebaceous glands) in full and partial thickness skin defects, including burns. Regrowth), and may be further used in the treatment of other skin defects such as psoriasis. Polynucleotides or polypeptides of the present invention, as well as agonists or antagonists, can affect epidermal bullosa, an epidermal epidermis to the intrinsic dermis that results in frequent open and painful blisters by promoting re-epithelialization of these lesions. It can be used to treat defects in adhesion. The polynucleotides or polypeptides of the invention, as well as agonists or antagonists, also treat gastric and duodenal ulcers and aid in scarring of the lining of the mucosa and faster regeneration by regeneration of the lining of the glandular and duodenal mucosa. Can be used for. Inflammatory bowel disease (eg, Coulomb's disease and ulcerative colitis) are diseases that result in the disruption of the mucosal surface of the small or large intestine, respectively. Thus, the polynucleotides or polypeptides of the present invention, as well as agonists or antagonists, may be used to resurface mucosal surfaces.
ng) can be used to promote faster healing and prevent the progression of inflammatory bowel disease. Treatment with the polynucleotides or polypeptides of the invention, as well as agonists or antagonists, is expected to have a significant effect on mucosal production of the entire gastrointestinal tract, and the intestinal mucosa is ingested or after surgery. Can be used to protect against harmful substances. The polynucleotides or polypeptides of the invention, as well as agonists or antagonists, can be used to treat diseases associated with the expression of the polynucleotides of the invention.

In addition, the polynucleotides or polypeptides of the present invention, as well as agonists or antagonists, can be used to prevent and cure damage to the lung due to various pathological conditions. Polynucleotides or polypeptides of the invention, as well as agonists or antagonists, can stimulate proliferation and differentiation to prevent or treat acute or chronic lung injury, and alveoli and bronchi (br).
ochiolar) can promote epithelial repair. For example, bronchial epithelium and alveoli (
aveoli) necrosis resulting in progressive loss of alveoli
And inhalation injuries (ie resulting from smoke inhalation and burns) can be effectively treated using the polynucleotides or polypeptides of the invention, as well as agonists or antagonists. Also, the polynucleotides or polypeptides of the invention, as well as agonists or antagonists, can be used to stimulate the proliferation and differentiation of alveolar epithelial cell type II, which is associated with hyaline membrane disease in premature infants (eg, infants). It may help treat or prevent diseases such as respiratory distress syndrome and bronchopulmonary dysplasia.

Polynucleotides or polypeptides of the invention, as well as agonists or antagonists, can stimulate proliferation and differentiation of liver parenchymal cells and, thus, liver diseases and conditions (eg, fulminant liver failure caused by cirrhosis, hepatitis virus). And toxic substances (ie, acetaminophen, carbon tetrachloride).
It can be used to alleviate or treat liver damage) caused by raholide), and other liver toxins known in the art).

Furthermore, the polynucleotides or polypeptides of the invention, as well as agonists or antagonists, can be used to treat or prevent the onset of diabetes mellitus. In patients newly diagnosed with type I and type II diabetes, if some islet cell function remains, the polynucleotide or polypeptide of the invention, as well as the agonist or antagonist, will exert a persistent expression of the disease. Can be used to maintain its islet function so as to mitigate, delay or prevent.
Also, the polynucleotides or polypeptides of the invention, as well as agonists or antagonists, can be used as an adjunct in islet cell transplantation to improve or promote islet cell function.

Neurological Disorders In accordance with yet a further aspect of the invention, the polynucleotides or polypeptides of the invention, and agonists, for therapeutic purposes, eg, to stimulate neurological cell proliferation and / or differentiation. Alternatively, a process is provided for utilizing the antagonist. Thus, the polynucleotides, polypeptides, agonists and / or antagonists of the invention can be used to treat and / or detect neurological disorders. Furthermore, the polynucleotides or polypeptides of the invention, or agonists or antagonists, can be used as markers or detectors of certain nervous system diseases or disorders.

Examples of neurological disorders that may be treated or detected with the polynucleotides, polypeptides, agonists and / or antagonists of the present invention include: Brain disorders (eg of maternal phenylketonuria). Metabolic brain diseases including phenylketonuria), pyruvate carboxylase deficiency, pyruvate dehydrogenase complex deficiency, Wernicke encephalopathy, cerebral edema, infratent (infr
cerebellar neoplasms such as cerebellar neoplasms including neoplasms, ventricular neoplasms such as choroid plexus neoplasms, hypothalamic neoplasms, tentative neoplasms, Canavan's disease, ataxia-telangiectasia Cerebellar diseases such as cerebellar ataxia including spinocerebellar ataxia, cerebellar dyskinesia, Friedreich's ataxia, Machado-Joseph disease, olive pontine cerebellar atrophy, cerebellar neoplasms such as subtentorial neoplasms , Diffuse periaxial encephalitis, bulbous cell leukodystrophy, diffuse cerebral sclerosis such as metachromatic leukodystrophy and subacute sclerosing panencephalitis, cerebrovascular disease (eg carotid thrombosis, carotid stenosis) And carotid artery disease including Moyamoya disease), brain amyloid angiopathy, cerebral aneurysm,
Cerebral arteriosclerosis, cerebral arteriovenous malformation, cerebral artery disease, carotid thrombosis, sinus thrombosis and thrombosis such as Wallenberg syndrome, epidural hematoma, subdural hematoma and subarachnoid hemorrhage Bleeding, cerebral fissure fracture, transient cerebral ischemia, subclavian artery stealing syndrome and vertebrobasilar insuf
such as cerebral ischemia such as ficiacy, vascular dementia such as multiple cerebral infarction dementia, periventricular leukomalacia, vascular headache such as cluster headache, migraine, AIDS dementia complex Senile dementia such as dementia, Alzheimer's disease and Creutzfeldt-Jakob disease, senile dementia such as Alzheimer's disease and progressive supranuclear palsy, vascular dementia such as multiple cerebral infarction, diffuse periaxial Encephalitis such as encephalitis, pandemic encephalitis, Japanese encephalitis, St. Louis encephalitis, tick-borne encephalitis and viral encephalitis such as West Nile fever,
Acute disseminated encephalomyelitis, uveal meningitis syndrome, meningoencephalomyelitis such as post-encephalitis Parkinson's disease and subbulbar sclerosing panencephalitis, encephalomalacia such as periventricular leukoplakia, occipital spasm Epilepsy such as whole body epilepsy, including Absence epilepsy
epilepsy), myoclonic epilepsy including MERRF syndrome, ankylosis /
Clonic epilepsy, complex partial epilepsy, partial epilepsy such as frontal lobe epilepsy and temporal lobe epilepsy, post-traumatic epilepsy, status epilepticus such as persistent partial epilepsy, Hallerfolden-Spatz syndrome, Dandy-Walker syndrome and Hydrocephalus such as normal pressure hydrocephalus, hypothalamic diseases such as hypothalamic neoplasms,
Cerebral malaria, narcolepsy including cataplexy, medullary polio (bulbar p
cerebral pseudotumor, Ret syndrome, Reye's syndrome, thalamic disease, cerebral toxoplasmosis, intracranial tuberculosis and Zerweger syndrome, central nervous system infections such as AIDS dementia, brain abscess, subdural empyema, Includes encephalomyelitis such as equine encephalomyelitis, Venezuelan equine encephalomyelitis, necrotizing hemorrhagic encephalomyelitis, visna, cerebral malaria, meningitis such as arachnoiditis, lymphocytic choriomeningitis Aseptic meningitis such as viral meningitis, bacterial meningitis including Haemophilus meningitis, Listeria meningitis, meningococcal meningitis such as Waterhouse-Friedericsen syndrome , Pneumococcal meningitis and meningococcal disease, fungal meningitis such as cryptocox meningitis, subdural exudation, meningoencephalitis such as uveal meningoencephalitis syndrome, transverse myelitis (trans) erse myelitis) myelitis such as, neurosyphilis such as spinal wax, polio comprising bulbar poliomyelitis and the post polio syndrome, prion diseases (e.g., Creutzfeldt - Jakob disease, bovine spongiform encephalopathy, Gerusutokon -
Cerebral toxoplasmosis, central nervous system neoplasms such as brain neoplasms, including cerebellar neoplasms such as subtentorial neoplasms, choroid plexus neoplasms, hypothalamic neoplasms and supratentorial. Ventricular neoplasms such as neoplasms, meningeal neoplasms, spinal neoplasms including epidural neoplasms, demyelinating diseases such as Canavan's disease, diffuse cerebral sclerosis including adrenoleukodystrophy.
bral cells, diffuse periaxial encephalitis, spheroid leukodystrophy,
Metachromatic leukodystrophy diffuse cerebral sclerosis, allergic encephalomyelitis, necrotizing hemorrhagic encephalomyelitis, progressive multifocal leukoencephalopathy, multiple sclerosis, central bridge myelinolysis, transverse myelitis , Neuromyelitis optica, scrapie, lordosis, chronic fatigue syndrome, visna, high pressure nervous syndrome (High Pressure Nerve Synth)
drome), meningopathy, spinal cord diseases such as congenital myotonia, amyotrophic lateral sclerosis, spinal muscle atrophy such as Verdnig-Hoffmann disease, spinal cord compression, epidural neoplasia Spinal neoplasm, syringomyelia, spinal fistula, Stiffman syndrome, maternal origin 1
5 q-13 Minor deficiency such as micro deficiency, squealing cat syndrome, de Lange syndrome,
Down's syndrome, gangliosidosis such as gangliosidosis G (M1), Zandhoff's disease, Tay-Sachs disease, Hartnup's disease, homocystinuria, Lawrence-Moon-Beedle's syndrome, Lesch-Nyhan's syndrome, maple syrup's disease, fucose Mucolipidosis such as storage disease, neuronal ceroid lipofuscinosis, ocular-brain renal syndrome, phenylketonuria such as maternal phenylketonuria, Prader-Villi syndrome, Rett syndrome, Rubinstein-Tevi syndrome, tuberous sclerosis Disorders, WAGR syndrome, nervous system abnormalities such as panencephalus, water incompetence (hydran)
neural insufficiency such as incapacity, arnold-chiari malformations, cerebral hernia, meningocele, meningocele, spinal cord fusion defects such as cystic spina bifida and occult spina bifida, Charcot-Marie disease Hereditary sensory and autonomic disorders such as motor and sensory neuron disorders, including visual atrophy, Refsum disease, hereditary spastic paraplegia, Verdnig-Hoffmann disease, congenital analgesia and familial autonomic neuropathy Neuropathy, neurological manifestations (eg, agnosia including Gerstmann syndrome), amnesia such as retrograde amnesia, apraxia, neurogenic bladder, weakness, deafness, partial hearing loss and loud voice ( Includes impairment of communication, such as hearing loss, including recruitment and tinnitus, aphasia, Broca aphasia and Wernicke aphasia Speech disorders such as speech disorders, dyslexia such as acute dyslexia, language development disorders, name aphasia, speech disorders such as aphasia including Broca aphasia and Wernicke aphasia, accumulation disorders, syntactic disorders, echo language, muteness And communication disorders such as speech disorders including stuttering, dysphonia such as aphonia and hoarseness, decerebral rigidity, delirium, fasciculations, hallucinations, meningopathy, 15q-13 microdefects of maternal origin ,
Ataxia, athetosis, chorea, ataxia, hypokinesia, hypotonia, movement disorders such as myoclonus, tics, torticollis and tremors, muscle hypertonia such as muscle stiffness such as Stiffman syndrome, muscles Spasticity, nerve palsy such as facial nerve palsy including otic zoster, gastroparesis, hemiplegia, ophthalmoplegia such as diplopia, chronic progressive external ophthalmoplegia such as dueane syndrome, horner syndrome, keens syndrome Illness,
Paraplegia, tropical spastic paraparesis, Brown-Sekar syndrome, paraplegia such as tetraplegia, respiratory and vocal cord paralysis, paresis, taste disorders such as phantom limbs, anorexia and dysgeusia, amblyopia, blindness. , Visual disorders such as color blindness, diplopia, semi-blindness, scotoma and subnormal vision, sleep disorders such as Kleine-Levin syndrome, hypersomnia including insomnia and sleepwalking disorders, trismus. Spasticity, coma, persistent vegetative state and loss of consciousness such as syncope and dizziness, neuromuscular diseases such as congenital myotonia, amyotrophic lateral sclerosis, Lambert-Eaton myasthenic syndrome, Motor aneurysms, spinal muscular atrophy, muscular atrophy such as Charcot-Marie disease and Verdnig-Hoffmann disease, post-polio syndrome, muscular dystrophy,
Myasthenia gravis, atrophic myotonia, congenital myotonia, nemarin myopathy, familial quadriplegia, multiple paramyloclonus (Multiplex Paramy)
loclonus), tropical spasmodic paraplegia and Stiffman syndrome, peripheral nervous system diseases such as acrolimb pain, renal amyloidosis, Ardy syndrome,
Such as Barre-Lieou syndrome, familial autonomic neuropathy, Horner syndrome, autonomic nervous system diseases such as reflex sympathetic dystrophy and Shy-Drager syndrome, inner ear nerve diseases such as acoustic neuroma including neurofibromatosis 2. Cranial nerve diseases, facial nerve diseases such as facial neuralgia, Merkerson-Rosenthal syndrome, ocular motility disorders including amblyopia, nystagmus, oculomotor paralysis, ophthalmoplegia such as Duane syndrome, Horner syndrome, Keens syndrome Including chronic progressive external ophthalmoplegia, strabismus such as strabismus and exotropia, oculomotor nerve palsy, optic nerve diseases such as ocular atrophy including hereditary ocular atrophy, optic disc drus, optic myelitis Demyelinating diseases like optic neuritis, papilledema, trigeminal neuralgia, vocal cord paralysis, neuromyelitis optica and lordosis, sugars like diabetic feet Disease neuropathy, nerve crush syndromes such as carpal tunnel syndrome, tarsal tunnel syndrome, thoracic outlet syndrome such as cervical rib syndrome, ulnar nerve compression syndrome,
Causalgia, neuralgia such as brachial neuralgia, facial neuralgia and trigeminal neuralgia, experimental allergic neuritis, optic neuritis, polyneuritis, polyradiculoneuritis and radiculitis (eg polyradiculitis, Hereditary motor and sensory neuropathy (eg Charcot-Marie disease, hereditary eye atrophy, Lefsum's disease, hereditary spastic paraplegia and Verdnig-Hoffmann disease, hereditary sensory and autonomic neuropathy (congenital analgesia and. (Including familial autonomic neuropathy), POEMS syndrome, sciatica, taste sweating syndrome and tetany)) and neuritis.

Infectious Diseases Polynucleotides or polypeptides of the invention, as well as agonists or antagonists, can be used to treat or detect infectious agents. For example,
Infectious diseases can be treated by increasing the immune response, especially by increasing the proliferation and differentiation of B and / or T cells. The immune response is
It can be elevated either by raising an existing immune response or by initiating a new immune response. Alternatively, the polynucleotides or polypeptides of the invention, as well as agonists or antagonists, may also directly inhibit the infectious agent without necessarily eliciting an immune response.

Viruses are an example of infectious agents that can cause diseases or conditions that can be treated or detected by the polynucleotides or polypeptides of the invention and / or agonists or antagonists. Examples of viruses include the following D
Viruses and viruses of NA and RNA include, but are not limited to: Arbovirus, Adenovirus, Arenaviridae, Arterivirus, Birnaviridae, Bunyaviridae, Calciviridae, Circoviridae. , Coronavirus family, Dengue fever, EBV, HI
V, Flaviviridae, Hepadnaviridae (hepatitis), Herpesviridae (eg, cytomegalovirus, herpes simplex, herpes zoster), Mononegavirus (eg, paramyxoviridae, measles virus, rhabd) Viridae), Orthomyxoviridae (eg, influenza A, influenza B, and parainfluenza), papillomavirus, papovaviridae, parvoviridae, picornaviridae, poxviridae (eg, pox or vaccinia), reovirus. Family (for example, rotavirus), retroviridae (HTLV-I, HTLV-II, lentivirus),
And Togaviridae (eg, Rubivirus). Viruses that fall within these families can cause a variety of diseases or conditions, including but not limited to: arthritis, bronchiolitis, respiratory syncytial virus, encephalitis, ocular infections (eg, conjunctivitis). , Keratitis), chronic fatigue syndrome,
Hepatitis (A, B, C, E, chronic activity, Delta), Japanese encephalitis B, Argentine hemorrhagic fever, Chinnia, Rift Valley fever, yellow fever, meningitis, opportunistic infections (
For example, AIDS), pneumonia, Burkitt lymphoma, chickenpox, hemorrhagic fever, measles, mumps, parainfluenza, rabies, common cold, polio, leukemia, rubella, sexually transmitted diseases, skin diseases (eg Kaposi, warts). ), And viremia. Any of these conditions or diseases can be treated or detected using the polynucleotides or polypeptides of the invention, or agonists or antagonists. In certain embodiments, the polynucleotides, polypeptides, or agonists or antagonists of the invention are used for the treatment of: meningitis, dengue fever, EBV.
, And / or hepatitis (eg, hepatitis B). In a further specific embodiment, the polynucleotides, polypeptides, or agonists or antagonists of the invention are used to treat patients who are non-responsive to one or more other commercially available hepatitis vaccines. In a more specific embodiment, the polynucleotides, polypeptides, or agonists or antagonists of the invention are used to treat AIDS.

Similarly, bacterial or fungal agents which can cause a disease or condition and which can be treated or detected by the polynucleotides or polypeptides of the invention and / or agonists or antagonists are the following Gram-negative and Gram-negative: Positive bacteria and bacteria families and fungi, including but not limited to:
Actinomycetales (eg, Corynebacterium,
Mycobacterium, Norcardia), Cryptococcu
s neoformans, Aspergillosis, Bacilrace
ae (eg, Anthrax, Clostridium), Bacteroi
daceae, Blastomycosis, Bordetella, Borr
elia (eg, Borrelia burgdorferi), Bruce
Illosis, Candidiasis, Campylobacter, Coc
cidioidomycosis, Cryptococcosis, Derma
toys, E. coli (for example, Enterotoxigenic
E. E. coli and Enterohemorrhagic E. coli. coli),
Enterobacteriaceae (Klebsiella, Salmon
ella (eg, Salmonella typhi, and Salmone
lla paratyphi), Serratia, Yersinia), Er
ysipelothrix, Helicobacter, Legionello
sis, Leptospirosis, Listeria, Mycoplasm
atales, Mycobacterium leprae, Vibrio c
hallae, Neisseriaceae (for example, Acinetobac
ter, Gonorrhea, Menigococcal), Meisseri
a meningitidis, Pasteurellacea infections (eg Actinobacillus, Hemophilus (eg Hea
mophilus influenza B), Pasteurella), Pseu
domonas, Rickettsiaceae, Chlamydiaceae
, Syphilis, Shigella spp. , Staphylococc
al, Meningiococcal, Pneumococcal and St
reptococcal (eg, Streptococcus pneumo
niae and Group B Streptococcus). These bacterial or fungal families can cause diseases or conditions including, but not limited to: bacteremia, endocarditis, eye infections (conjunctivitis, tuberculosis, uveitis), gingivitis, opportunism. Infections (eg, AIDS related infections), periungual inflammation, prosthesis related infections,
Reiter's disease, respiratory tract infections (eg, whooping cough or empyema), sepsis, Lyme disease,
Cat scratch disease, dysentery, paratyphoid fever, food poisoning, typhoid fever, pneumonia, gonorrhea, meningitis (eg meningitis A and B), chlamydia, syphilis, diphtheria, leprosy,
Paratuberculosis, tuberculosis, lupus, botulism, gangrene, tetanus, impetigo, rheumatic fever,
Scarlet fever, sexually transmitted diseases, skin diseases (eg cellulitis, dermatomycosis)
,), toxemia, urinary tract infection, wound infection. The polypeptides or polynucleotides, agonists or antagonists of the invention may be used to treat or detect any of these conditions or diseases. In a specific embodiment, the polynucleotides, polypeptides, agonists or antagonists of the invention are used to treat: tetanus, diphtheria, botulinum, and / or meningitis type B.

Further, diseases or conditions caused by a parasitic factor that can be treated or detected by the polynucleotides or polypeptides of the present invention, and / or agonists or antagonists include, but are not limited to, the following families or classes: Not to be done: amebiasis, babesiosis, coccidiosis, cryptosporidiosis, dinuclear amebiasis (Dientamoebiasis), quarantine, ectoparasite, giardia flagellosis, helminthosis, leishmaniasis, theileriosis, toxoplasmosis, trypanosomes And Trichomonas (Tric
homonas), as well as sporozoan disease (Sporozoan) (eg Pl
asmodium virax, Plasmodium falcipariu
m, Plasmodium malariae and Plasmodium o
vale). These parasites can cause a variety of diseases or conditions including, but not limited to: scabies, scrub typhus, ocular infections, intestinal diseases (eg, dysentery, giardia giardiasis), liver diseases, lungs. Diseases, opportunistic infections (eg, AIDS-related), malaria, pregnancy complications, and toxoplasmosis. The polynucleotides or polypeptides of the invention, or agonists or antagonists, can be used to treat or detect any of these conditions or diseases. In certain embodiments, the polynucleotides, polypeptides, or agonists or antagonists of the invention are used to treat malaria.

A polynucleotide or polypeptide of the invention, as well as an agonist or antagonist, administers to the patient an effective amount of the polypeptide, or removes cells from the patient and supplies the polynucleotides of the invention to the cells, Then the engineered cells can either be returned to the patient (ex vivo treatment). Moreover, the polypeptides or polynucleotides of the invention can be used as antigens in vaccines to elicit an immune response against infectious diseases.

Regeneration Polynucleotides or polypeptides of the invention, as well as agonists or antagonists, can be used to differentiate, proliferate, and attract cells to guide tissue regeneration (Science 276: 59-87 ( 1997)). Tissue regeneration can be used with birth defects, trauma (wounds, burns, incisions, or ulcers), aging, diseases (eg, osteoporosis, osteoarthritis).
tis), periodontal disease, liver failure), surgery including cosmetic surgery, fibrosis, reperfusion injury, or tissue damaged by systemic cytokine damage may be repaired, replaced, or protected.

Tissues that can be regenerated using the present invention include the following: Organs (eg,
Pancreas, liver, intestine, kidney, skin, endothelium), muscle (smooth muscle, skeletal muscle, or myocardium),
Tissues of the vascular system (including blood vessels and lymph vessels), nerves, hematopoiesis, and skeleton (bones, cartilage, tendons, and ligaments). Preferably, regeneration occurs without or with reduced scarring. Regeneration can also include angiogenesis.

Furthermore, the polynucleotides or polypeptides of the invention, as well as agonists or antagonists, may increase the regeneration of tissues that are difficult to heal.
For example, increasing tendon / ligament regeneration speeds recovery time after injury. The polynucleotides or polypeptides of the invention, as well as agonists or antagonists, can also be used prophylactically in an attempt to avoid injury.
Specific diseases that can be treated include tendinitis, carpal tunnel syndrome, and other tendon or ligament defects. Further examples of tissue regeneration of non-healing wounds include ulcers associated with decubitus ulcers, vascular insufficiency, surgical wounds, and traumatic wounds.

Similarly, nerve and brain tissue can also be regenerated by using the polynucleotides or polypeptides of the invention and agonists or antagonists to proliferate and differentiate nerve cells. Diseases that can be treated using the present methods include central and peripheral nervous system diseases, neuropathy, or mechanical and traumatic disorders (eg, myelopathy, head trauma, cerebrovascular disease, and stroke (s).
like)). In particular, diseases associated with peripheral nerve injury, peripheral neuropathy (eg resulting from chemotherapy or other medical therapies), localized neuropathy, and central nervous system diseases (eg Alzheimer's disease, Parkinson's disease, Huntington). Disease, amyotrophic lateral sclerosis, and Shy-Drager syndrome) can all be treated with the polynucleotides or polypeptides of the invention and agonists or antagonists.

Chemotaxis The polynucleotides or polypeptides and agonists or antagonists of the invention may have chemotactic activity. Chemotactic molecules allow cells (eg, monocytes, fibroblasts, neutrophils, T cells, mast cells, eosinophils, epithelial cells and / or endothelial cells) to move to specific sites in the body (eg, Site of inflammation, infection, or hyperproliferation). The recruited cells may then repel and / or heal the particular trauma or abnormality.

The polynucleotides or polypeptides and agonists or antagonists of the present invention may increase the chemotactic activity of certain cells. These chemotactic molecules are then used to treat inflammation, infection, hyperproliferative disorders, or any immune system disorder by increasing the number of cells targeted to specific locations in the body. obtain. For example, chemotactic molecules can be used to treat wounds and other trauma to tissues by attracting immune cells to the injured location. The chemotactic molecules of the invention can also attract fibroblasts, which can be used to treat wounds.

It is also contemplated that the polynucleotides or polypeptides of the invention and agonists or antagonists may inhibit chemotactic activity. These molecules can also be used to treat disorders. Thus, the polynucleotides or polypeptides of the invention and agonists or antagonists can be used as chemotactic inhibitors.

Binding Activity The polypeptides of the invention can be used to screen for molecules that bind to this polypeptide, or molecules to which this polypeptide binds. The binding of the polypeptide to the molecule can activate (agonist), increase, inhibit (antagonist), or decrease the activity of the bound polypeptide or molecule.
Examples of such molecules include antibodies, oligonucleotides, proteins (eg receptors), or small molecules.

Preferably, the molecule is closely related to the natural ligand (eg, fragment of the ligand) of the polypeptide or natural substrate, ligand, structural mimetic, or functional mimic (Coligan et al. , Current Prot
ocols in Immunology 1 (2): Chapter 5 (1991)). Similarly, the molecule may be intimately associated with the natural receptor to which the polypeptide binds, or at least a fragment of the receptor (eg, the active site) that may be bound by the polypeptide. In any case, the molecule can be rationally designed using known techniques.

Preferably, screening for these molecules involves producing suitable cells that express the polypeptide. Preferred cells include mammals,
Yeast, Drosophila, or E. cells derived from E. coli. The cells expressing the polypeptide (or cell membranes containing the expressed polypeptide) are then preferably observed for binding, stimulating, or inhibiting activity of either the polypeptide or the molecule. Are contacted with a test compound potentially containing the molecule of

The assay can simply test binding of a candidate compound to the polypeptide, where binding is detected by the label or in an assay for competition with a labeled competitor. In addition, the assay can test whether a candidate compound produces a signal generated by binding to this polypeptide.

Alternatively, the assay can be performed with cell-free preparations, polypeptides / molecules attached to a solid support, chemical libraries, or a mixture of natural products. The assay also simplifies the steps of mixing the candidate compound with a solution containing the polypeptide, measuring the activity or binding of the polypeptide / molecule, and comparing the activity or binding of the polypeptide / molecule to a standard. May be included.

[0527] Preferably, an ELISA assay may measure the level or activity of a polypeptide in a sample (eg, a biological sample) using monoclonal or polyclonal antibodies. Antibodies may be bound to the polypeptide either directly or indirectly, or by competition with the polypeptide for a substrate,
The level or activity of the polypeptide can be measured.

Furthermore, the receptors to which the polypeptides of the invention bind can be obtained by a number of methods known to those skilled in the art, such as ligand panning and FACS sorting (Coliga).
n et al., Current Protocols in Immun. , 1 (2),
Chapter 5 (1991)). For example, expression cloning is used when polyadenylated RNA is prepared from cells responsive to this polypeptide, eg, NIH3T3 cells, which are known to contain multiple receptors for FGF family proteins, And SC-3 cells, and a cDNA library made from this RNA are pooled and used to transfect COS cells or other cells that are not responsive to the polypeptide. Transfected cells growing on glass slides are exposed to the polypeptides of the invention after labeling them. The polypeptide may be labeled by various means, including iodination or encapsulation of recognition sites for site-specific protein kinases.

After immobilization and incubation, slides are subjected to autoradiographic analysis. Positive pools are identified and subpools are prepared and retransfected using an iterative subpooling and rescreening process to ultimately yield a single clone encoding the putative receptor.

As an alternative approach for receptor identification, labeled polypeptides can be photoaffinity-linked or extracted with a preparation expressing the receptor molecule, photoaffinity. The crosslinked material is separated by PAGE analysis and exposed to X-ray film. A labeled complex containing the receptor for the polypeptide can be excised,
It can be separated into peptide fragments and subjected to protein microsequencing. The amino acid sequence obtained from microsequencing is used to design a set of degenerate oligonucleotide probes to screen a cDNA library to identify the gene encoding the putative receptor.

In addition, gene shuffling, motif shuffling, exon shuffling, and / or codon shuffling techniques (collectively referred to as “DNA shuffling”) can be utilized to modulate the activity of the polypeptides of the invention. Effectively produces agonists and antagonists of the polypeptides of the invention. Generally, US Pat. Nos. 5,605,793, 5,811,238, 5,830,721, 5,834,252, and 5,83.
7,458, and Patten, P .; A. Curr. Opinion
Biotechnol. 8: 724-33 (1997); Harayama,
S. Trends Biotechnol. 16 (2): 76-82 (1998)
); Hansson, L .; O. Et al., J. Mol. Biol. 287: 265-7
6 (1999); and Lorenzo, M .; M. And Blasco, R .;
See Biotechniques 24 (2): 308-13 (1998), each of which patents and publications are incorporated herein by reference. In one embodiment, alteration of the polynucleotides of the invention and corresponding polypeptides can be accomplished by DNA shuffling. DNA shuffling is the process of homologous recombination or site-specific recombination of two or more DNA fragments.
Includes assembly of segments into desired molecules. In another embodiment, the polynucleotides of the invention and the corresponding polypeptides are subjected to random mutagenesis by error-prone PCR, random nucleotide insertion or other methods prior to recombination. Can be changed. In another embodiment, one or more components, motifs, fragments, portions, domains, fragments, etc. of the polypeptides of the invention are one or more components, motifs, fragments, portions, domains of one or more heterologous molecules. , Fragments, etc. In a preferred embodiment, the heterologous molecule is a member of the family. In a further preferred embodiment, the heterologous molecule is, for example, platelet derived growth factor (PDGF),
Insulin-like growth factor (IGF-I), transforming growth factor (TGF)
-Α, epidermal growth factor (EGF), fibroblast growth factor (FGF), TGF-β,
Bone morphogenetic protein (BMP) -2, BMP-4, BMP-5, BMP-6, BM
P-7, activin A and activin B, decapentapresic (decap
entangled (dpp), 60A, OP-2, dosalin (dors)
alin), growth differentiation factor (GDF), nodule, MIS, inhibin-α, TGF-β1, TGF-β2, TGF-β3, TGF-β5, and glial-derived neurotrophic factor (GDNF). It is a growth factor.

Other preferred fragments are biologically active fragments of the polypeptides of the invention. A biologically active fragment is a fragment that exhibits an activity similar to, but not necessarily identical to, that of the polypeptide of the invention. The biological activity of this fragment may include an improved desired activity, or a decreased undesired activity.

The invention further provides methods of screening compounds to identify those that modulate the action of the polypeptides of the invention. An example of such an assay involves combining mammalian fibroblasts, a polypeptide of the invention, a compound to be screened and ³ [H] thymidine under cell culture conditions in which the fibroblasts normally grow. . The control assay can be carried out in the absence of the compound to be screened and, in each case compared to the amount of proliferation of fibroblasts in the presence of this compound, of incorporation of ³ [H] thymidine. The determination can determine whether the compound stimulates proliferation. The amount of fibroblast proliferation is measured by liquid scintillation chromatography, which measures ³ [H] thymidine incorporation. Both agonist and antagonist compounds can be identified by this procedure.

In another method, a mammalian cell or membrane preparation expressing a receptor for a polypeptide of the invention is incubated with a labeled polypeptide of the invention in the presence of the compound. The ability of the compound to enhance or block this interaction can then be measured. Alternatively, the response and receptor of a known second messenger system according to the interaction of the compound to be screened is measured and the ability of the compound to bind to the receptor and elicit a second messenger response is measured to Determine if it is a potential agonist or antagonist. Such second messenger systems include, but are not limited to, cAMP guanylate cyclase, ion channels or phosphoinositide hydrolysis.

All of these above assays can be used as diagnostic or prognostic markers. Molecules discovered using these assays can be used to treat or treat diseases by activating or inhibiting polypeptides / molecules, or to produce specific results in a patient, such as blood vessel growth. . In addition, the assay can discover factors that can inhibit or enhance production of the polypeptides of the invention from appropriately engineered cells or tissues.

Accordingly, the invention includes a method of identifying a compound that binds to a polypeptide of the invention comprising the steps of: (a) incubating a candidate binding compound with a polypeptide of the invention; and ( b) determining whether a bond has occurred. Further, the invention includes a method of identifying an agonist / antagonist comprising the steps of: (a) incubating a candidate compound with a polypeptide of the invention, (b) assaying biological activity, And (b) determining whether the biological activity of the polypeptide has been modified.

Targeted Delivery In another embodiment, the invention provides a composition comprising a targeted cell expressing a receptor for a polypeptide of the invention, or a cell-bound form of a polypeptide of the invention. Methods of delivering to expressing cells are provided.

As discussed herein, a polypeptide or antibody of the invention is a hydrophobic, hydrophilic, ionic and / or covalent bond with a heterologous polypeptide, heterologous nucleic acid, toxin or prodrug. May be associated through interaction. In one embodiment, the invention provides a polypeptide of the invention ((a) associated with a heterologous polypeptide or nucleic acid (
A method for specific delivery of a composition of the invention to cells by administering (including an antibody) is provided. In one example, the invention provides a method for delivering therapeutic proteins into targeted cells. In another example, the invention can be a single-stranded nucleic acid (eg, an antisense or ribozyme) or a double-stranded nucleic acid (eg, integrated into the genome of a cell, or can be episomally replicating, and transcribed). , DNA) for delivery to targeted cells.

In another embodiment, the invention provides for cell specificity by administering a polypeptide of the invention (eg, a polypeptide of the invention or an antibody of the invention) associated with a toxin or a cytotoxic prodrug. Methods for selective destruction (eg, destruction of tumor cells).

A “toxin” is an endogenous cytotoxic effector system, radioisotope, holotoxin, modified toxin, catalytic subunit of a toxin, or a cell that causes cell death under defined conditions. Alternatively, it means a compound that binds and activates any molecule or enzyme not normally present on the cell surface. Toxins that may be used in accordance with the methods of the present invention include, but are not limited to, radioisotopes known in the art, compounds that bind an intrinsic or induced endogenous cytotoxic effector system. (For example, antibody (or complement fixation including a part thereof), thymidine kinase, endonuclease, RNAse, α-toxin, ricin,
Abrin, Pseudomonas endotoxin A, diphtheria toxin, saporin, momordin, gelonin, pokeweed antiviral protein, alpha-sarcin and cholera toxin. "
By "cytotoxic prodrug" is meant a non-toxic compound that is converted into a cytotoxic compound by the enzymes normally present in cells. Cytotoxic prodrugs that may be used in accordance with the methods of the present invention include glutamyl derivatives of benzoic acid mustard alkylating agents, phosphate derivatives of etoposide or mitomycin C, cytosine arabinoside, daunorubicin, and phenoxyacetamide derivatives of doxorubicin. However, the present invention is not limited to these.

Drug Screening Further contemplated is the use of the polypeptides of the invention, or the polynucleotides encoding these polypeptides, to screen for molecules that modify the activity of the polypeptides of the invention. Such methods include the steps of contacting the polypeptides of the invention with selected compounds suspected of having antagonistic or agonistic activity, and assaying the activity of these polypeptides following binding. To do.

The present invention is particularly useful for screening therapeutic compounds by using the polypeptides of the present invention, or binding fragments thereof, in any of a variety of drug screening techniques. The polypeptide or fragment used in such a test can be immobilized on a solid support, expressed on the cell surface, free in solution, or localized intracellularly. One method of drug screening utilizes eukaryotic or prokaryotic host cells which are stably transformed with recombinant nucleic acids expressing the polypeptide or fragment. Drugs are screened against such transformed cells in competitive binding assays. For example, the formation of a complex between the agent being tested and the polypeptide of the invention can be measured.

Accordingly, the invention provides methods of screening for drugs or any other agents that affect the activity mediated by the polypeptides of the invention. These methods involve contacting such agents with a polypeptide of the invention or fragment thereof by methods well known in the art, and the presence of a complex between the agent and the polypeptide or fragment thereof. The step of assaying is included. In such competitive binding assays, the drug to be screened is typically labeled. After incubation, free drug is separated from drug present in bound form, and the amount of free or uncomplexed label is a measure of the ability of a particular drug to bind a polypeptide of the invention. .

Another technique for drug screening provides a high throughput screen for compounds having the appropriate binding affinity for a polypeptide of the invention,
And European patent application 84/03564 (published on September 13, 1984) (this is
Incorporated herein by reference) in greater detail. Briefly, large numbers of different small peptide test compounds are synthesized on a solid substrate (eg, plastic pins or some other surface). The peptide test compound is reacted with the polypeptide of the invention and washed. Bound polypeptide is then detected by methods well known in the art. The purified polypeptide is coded directly on the plate for use in the drug screening techniques described above. In addition, non-neutralizing antibodies can be used to capture the peptide and immobilize it on a solid support.

The invention also contemplates the use of competitive drug screening assays in which a neutralizing antibody capable of binding a polypeptide of the invention specifically competes with a test compound for binding to the polypeptide or fragment thereof. To do. In this style,
Antibodies are used to detect the presence of any peptide that shares one or more antigenic epitopes with a polypeptide of the invention.

Antisense and Ribozymes (Antagonists) In certain embodiments, an antagonist according to the invention is a nucleic acid corresponding to the sequence contained in SEQ ID NO: X, or the complement thereof, and / or the associations identified in Table 1. Is a nucleic acid corresponding to the nucleotide sequence contained in the cDNA plasmid Z. In one embodiment, the antisense sequence is produced internally by the organism, and in another embodiment the antisense sequence is administered separately (eg, O'Connor, J., Neurochem. 56: 560 ( 1991)). Oligodeoxynucleotides as Anti
sense Inhibitors of Gene Expression,
CRC Press, Boca Raton, FL (1988). Antisense technology can be used to control gene expression through antisense DNA or RNA or through the formation of triple helices. Antisense technology is, for example, O
kano, Neurochem. 56: 560 (1991); Oligodeo.
xynucleotides as Antisense Inhibitor
s of Gene Expression, CRC Press, Boca
Raton, FL (1988). Triple helix formation is described, for example, in Le
e et al., Nucleic Acids Research 6: 3073 (197).
9); Cooney et al., Science 241: 456 (1988); and Dervan et al., Science, 251: 1300 (1991). These methods are based on the binding of polynucleotides to complementary DNA or RNA.

For example, the use of c-myc and c-myb antisense RNA constructs to inhibit the growth of the non-lymphocytic leukemia cell line HL-60 and other cell lines has been previously described (Wickstrom et al. 1988); Anfossi et al.
9)). These experiments were performed in vitro by incubating cells with oligoribonucleotides. A similar procedure for in vivo use is
It is described in WO 91/15580. Briefly, a pair of oligonucleotides for a given antisense RNA is generated as follows: a sequence complementary to the first 15 bases of the open reading frame, an EcoRI site at the 5'end and a HindIII at the 3'end. Adjacent to the site. The oligonucleotide pairs are then heated at 90 ° C. for 1 min, then 2 × ligation buffer (20 mM TR
Annealed in IS HCl pH 7.5, 10 mM MgCl2, 10MM dithiothreitol (DTT) and 0.2 mM ATP) and then ligated into the EcoR1 / HindIII sites of the retroviral vector PMV7 (WO91 / 15580).

For example, the 5'coding portion of a polynucleotide encoding a polypeptide of the invention can be used to design an antisense RNA oligonucleotide of about 10-40 base pairs in length. DNA oligonucleotides are designed to be complementary to regions of the gene involved in transcription, thereby inhibiting transcription and production of receptors. The antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into a receptor polypeptide.

In one embodiment, the antisense nucleic acids of the invention are produced intracellularly by transcription from a foreign sequence. For example, the vector or a portion thereof is transcribed to produce the antisense nucleic acid (RNA) of the invention. Such vectors include sequences encoding antisense nucleic acids. Such a vector can remain episomal or can be chromosomally integrated, as long as it can be transcribed to produce the desired antisense RNA. Such vectors can be constructed by recombinant DNA technology methods standard in the art. The vector can be a plasmid, virus, etc. known in the art used for replication and expression in vertebrate cells. Expression of sequences encoding the polypeptides of the present invention or fragments thereof may be obtained by any promoter known in the art to act in vertebrate, preferably human cells. Such promoters can be inducible or constitutive. Such promoters include the SV40 early promoter region (Bernist and Chambon, Nature, 29: 304-.
310 (1981)), the promoter contained in the 3'long terminal repeat of Rous sarcoma virus (Yamamoto et al., Cell, 22: 787-797 (1980)).
Herpes thymidine promoter (Wagner et al., Proc. Natl. Ac.
ad. Sci. U. S. A. 78: 1441-1445 (1981)), regulatory sequences of the metallothionein gene (Brinster et al., Nature, 296: 3).
9-42 (1982)) and the like, but are not limited thereto.

The antisense nucleic acid of the present invention contains a sequence complementary to at least a part of RNA transcript of the gene of the present invention. However, complete complementarity, although preferred, is not necessary. A sequence "complementary to at least a portion of RNA" as referred to herein means a sequence that has sufficient complementarity to hybridize with RNA and forms a stable duplex; Therefore, in the case of a double-stranded antisense nucleic acid,
Single strands of double-stranded DNA can be tested or triplex formation can be assayed. The ability to hybridize depends on both the degree of complementarity and the length of the antisense nucleic acid. In general, longer hybridizing nucleic acids may contain more base mismatches with RNA, which may include stable duplexes (or triplexes) and still form. obtain. One of skill in the art can ascertain the degree of mismatch tolerance by using standard procedures to determine the melting temperature of the hybridizing complex.

Oligonucleotides that are complementary to the 5'end of the message (eg, 5'untranslated sequences up to and including the AUG start codon) should work most efficiently in inhibiting translation. is there. However, sequences complementary to the 3'untranslated sequences of mRNAs have likewise been shown to be effective in inhibiting translation of mRNAs. Generally, Wagner, R .; , 1994, Nature 372: 333-33.
See 5. Therefore, 5'of the polynucleotide sequences described herein.
Oligonucleotides complementary to either -or 3'-untranslated noncoding regions can be used in antisense approaches to inhibit translation of endogenous mRNAs.
Oligonucleotides complementary to the 5'untranslated region of the mRNA should include the complement of the AUG start codon. Antisense oligonucleotides complementary to the mRNA coding region, although less efficient inhibitors of translation, can be used in accordance with the present invention. Whether designed to hybridize to the 5'region, 3'region or coding region of the mRNA of the invention, the antisense nucleic acid should be at least 6 nucleotides in length, and preferably 6 ~ About 50
An oligonucleotide that spans the length of a nucleotide. In particular aspects, the oligonucleotide is at least 10 nucleotides, at least 17 nucleotides, at least 25 nucleotides or at least 50 nucleotides.

The polynucleotides of the present invention may be DNA, or RNA, or chimeric mixtures, or derivative or modified versions thereof, single-stranded, or double-stranded. The oligonucleotide may be modified at the base moiety, sugar moiety, or phosphate backbone to improve, for example, molecular stability, hybridization, and the like. This oligonucleotide can be attached to other additional groups such as peptides (eg, to target host cell receptors in vivo), or to factors that facilitate transport across cell membranes (eg, Letsinger et al., 1989, Proc. Natl. ．
Acad. Sci. U. S. A. 86: 6553-6556; Lemaitre.
Et al., 1987, Proc. Natl. Acad. Sci. 84: 648-652
PCT Publication No. WO 88/09810 (published December 15, 1988), or the blood-brain barrier (eg, PCT Publication No. WO 89/10134 (see
(Published April 25, 1988)), and hybridization-triggered cleaving agent (hybridization-triggered cleavage agent).
gent) (eg Kroll et al., 1988, BioTechniques, 6).
: 958-976), or an intercalating agent (eg, Zon.
, 1988, Pharm. Res. 5: 539-549). For this purpose, oligonucleotides are different molecules (eg peptides,
Hybridization-inducing cross-linking agents, transport agents, hybridization-inducing cleavage agents, etc.).

The antisense oligonucleotide may comprise at least one modified base moiety, which base moiety is selected from the group including, but not limited to: 5-fluorouracil, 5-bromouracil, 5 -Chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5- (carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2
-Thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, β-D-galactosylcueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, β-D- Mannosyl cuocosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2
-Methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v
), Wybutoxosine, pseudouracil, queocin, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxy. Acetic acid (v), 5-methyl-2-thiouracil,
3- (3-amino-3-N-2-carboxypropyl) uracil, (acp3)
w, and 2,6-diaminopurine.

Antisense oligonucleotides can also include at least one modified sugar moiety selected from the group including, but not limited to: arabinose, 2-fluoroarabinose, xylulose, and hexose.

In yet another embodiment, the antisense oligonucleotide comprises at least one modified phosphate backbone selected from the group including, but not limited to: phosphorothioate, phosphorodithioate, phosphoro. Amidothioates, phosphoramidates, phosphorodiamidates, methylphosphonates, alkyl phosphotriesters, and formacetals or analogs thereof.

In yet another embodiment, the antisense oligonucleotide is an a-anomeric oligonucleotide. The a-anomeric oligonucleotides form specific double-stranded hybrids with complementary RNA, the strands of which are parallel to each other as opposed to the normal b-unit (Gautier et al., 1987, Nucl. Ac.
ids Res. , 15: 6625-6641). This oligonucleotide is
Is it a 2'-O-methyl ribonucleotide (Inoue et al., 1987, Nuc.
l. Acids Res. , 15: 6131-6148), or chimeric RNA.
-A DNA analog (Inoue et al., 1987, FEBS Lett. 21).
5: 327-330).

Polynucleotides of the invention may be prepared using standard methods known in the art (eg automated D
By NA synthesizer (such equipment is Biosearch, Applied B
(commercially available from iosystems, etc.)). For example, phosphorothioate oligonucleotides are described by Stein et al.
8, Nucl. Acids Res. 16: 3209) and methyl phosphonate oligonucleotides have a controlled pore glass (control).
red pore glass) polymer support (Sarin et al., 1988, P.
roc. Natl. Acad. Sci. U. S. A. 85: 7448-7451
) And the like.

On the other hand, antisense nucleotides complementary to the coding region sequences may be used,
Most preferred are antisense nucleotides complementary to the transcribed untranslated region.

Potential antagonists according to the present invention also include catalytic RNA, ie ribozymes (eg PCT International Publication WO 90/11364, October 4, 1990).
Published: Sarver et al., Science, 247: 1222-1225 (19).
90)). On the other hand, a ribozyme that cleaves an mRNA with a site-specific recognition sequence can be used to destroy the mRNA, but it is preferable to use a hammerhead ribozyme. Hammerhead ribozymes cleave mRNAs at positions determined by flanking regions that form complementary base pairs with the target mRNA. The only requirement is that the target mRNA has the following two base sequence: 5 '.
-UG-3 '. Construction and production of hammerhead ribozymes is well known in the art, and Haseroff and Gerlach, Nature, 334.
: 585-591 (1988). There are many potential hammerhead ribozyme cleavage sites within the nucleotide sequence of SEQ ID NO: X. Preferably, the ribozyme is engineered so that the cleavage recognition site is located near the 5'end of the mRNA; ie, to increase efficiency and minimize intracellular accumulation of non-functional mRNA transcripts. It

In the case of the antisense approach, the ribozymes of the invention may be composed of modified oligonucleotides (improved for stability, targeting, etc.) and delivered to cells expressing in vivo. Is. The DNA construct encoding the ribozyme can be introduced into the cell in the same manner as described above for the introduction of antisense encoding DNA. Preferred methods of delivery include strong constitutive promoters (such as the pol III or pl II promoters).
The use of a DNA construct that "encodes" a ribozyme under the control of, so that the transfected cells produce a sufficient amount of ribozyme to disrupt the endogenous message and inhibit translation. Ribozymes, unlike antisense molecules, are catalytic, so lower intracellular concentrations are required for efficiency.

Antagonist / agonist compounds are utilized to grow and proliferate the polypeptides of the invention on neoplastic cells and tissues.
eration) effect may be hindered. That is, by stimulating tumor agonists, thereby causing abnormal cell growth and proliferation (eg, in tumorigenesis or proliferation)
Delay or prevent.

Antagonists / agonists may also be utilized to inhibit hypervascular disease,
It also prevents the proliferation of epithelial lens cells after extracapsular cataract surgery. Prevention of the mitogenic activity of the polypeptides of the invention may also be required in cases such as restenosis after balloon angioplasty.

Antagonists / agonists may also be utilized to prevent the growth of scar tissue during wound healing.

Antagonists / agonists may also be utilized to treat the diseases described herein.

Accordingly, the present invention includes diseases, disorders and / or conditions (including those diseases, disorders and / or conditions listed throughout this application which are associated with overexpression of a polynucleotide of the invention), (Not limited to these), by administering to the patient (a) an antisense molecule directed to the polynucleotide of the invention and / or (b) a ribozyme directed to the polynucleotide of the invention. I will provide a.

Other Activities The polypeptides, polynucleotides, agonists or antagonists of the invention result in a variety of disease states (eg, as a result of their ability to stimulate vascular endothelial cell proliferation).
It can be utilized in a procedure to stimulate revascularization of ischemic tissue due to thrombosis, arteriosclerosis, and other cardiovascular conditions). The polypeptides, polynucleotides, agonists or antagonists of the invention can also be utilized to stimulate angiogenesis and limb remodeling as discussed above.

The polypeptides, polynucleotides, agonists or antagonists of the invention may also be utilized in the treatment of wounds due to injury, burns, post-operative tissue repair, and scarring. Because they are mitogenic for a variety of cells of different origin, such as fibroblasts and skeletal muscle cells, and therefore facilitate repair or replacement of damaged or diseased tissue.

The polypeptides, polynucleotides, agonists or antagonists of the present invention may also be used to stimulate neuronal growth and impair the neuronal degeneration or neurodegenerative conditions of particular neurons (eg Alzheimer's disease, Parkinson's disease, and AID).
The neuronal damage that occurs in the S-related complex) can be treated and prevented.
The polypeptides, polynucleotides, agonists or antagonists of the present invention may have the ability to stimulate chondrocyte proliferation and thus enhance bone and periodontal remodeling and in tissue or bone grafts. It can be used for assistance.

The polypeptides, polynucleotides, agonists or antagonists of the invention may also be utilized to prevent aging of the skin due to sunburn by stimulating keratinocyte proliferation.

The polypeptides, polynucleotides, agonists or antagonists of the present invention may also be utilized to prevent hair loss. This is because members of the FGF family activate hair-forming cells and promote melanocyte proliferation. Along the same line, the polypeptides, polynucleotides, agonists or antagonists of the invention can be utilized to stimulate hematopoietic and bone marrow cell proliferation and differentiation when used in combination with other cytokines.

The polypeptides, polynucleotides, agonists or antagonists of the present invention may also be utilized to maintain pre-transplant organs or may be used to support cell culture of primordial tissue. The polypeptides, polynucleotides, agonists or antagonists of the invention can also be utilized to induce tissues of mesodermal origin for differentiation in early embryos.

The polypeptides, polynucleotides, agonists or antagonists of the invention may also increase or decrease differentiation or proliferation of embryonic stem cells in addition to hematopoietic lineages, as discussed above.

Polypeptides, polynucleotides, agonists or antagonists of the invention may also have mammalian characteristics (eg height, weight, hair color, eye color, skin, percentage of adipose tissue, pigmentation, size, And shape (eg, cosmetic surgery). Similarly, the polypeptides, polynucleotides, agonists or antagonists of the invention can be used to regulate mammalian metabolism that affects catabolism, anabolic activity, processing, utilization, and energy storage.

The polypeptides, polynucleotides, agonists or antagonists of the invention may be used in biorhythms, caricadic rhythms, depression (including depressive disorders), violence tendencies, pain tolerance, fertility (preferably fertility). , Activin or inhibin-like activity), hormone or endocrine levels, appetite, libido, memory, stress, or other quality of cognition to alter a mammal's mental or physical condition Can be done.

The polypeptides, polynucleotides, agonists or antagonists of the invention also increase or decrease, eg, storage capacity, fat content, lipids, proteins, carbohydrates, vitamins, minerals, cofactors, or other nutritional components. It can be used as such a food additive or preservative.

The applications listed above are used in a wide variety of hosts. Such hosts include, but are not limited to, humans, mice, rabbits, goats, guinea pigs, camels, horses, mice, rats, hamsters, pigs, micro pigs, chickens, goats, cows. , Sheep, dogs, cats,
Non-human primates, and humans. In a particular embodiment, the host is a mouse, rabbit, goat, guinea pig, chicken, rat, hamster, pig, sheep, dog or cat. In a preferred embodiment, the host is a mammal. In the most preferred embodiment, the host is human.

Other Preferred Embodiments Another preferred embodiment of the present invention is a nucleotide sequence of SEQ ID NO: X or a complementary strand thereto, and / or a sequence of at least about 50 consecutive nucleotides in cDNA plasmid Z, Included is an isolated nucleic acid molecule that comprises a nucleotide sequence that is at least 95% identical.

Also preferred is a nucleic acid molecule comprised in the nucleotide sequence of SEQ ID NO: X, within the range of positions where the above contiguous nucleotide sequence is identified for SEQ ID NO: X in Table 1.

[0579] Isolated comprising a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: X or its complement, and / or the sequence of at least about 150 consecutive nucleotides in the nucleotide sequence of cDNA plasmid Z. Also preferred are nucleic acid molecules.

[0580] Isolated comprising a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: X or its complementary strand and / or the sequence of at least about 500 consecutive nucleotides in the nucleotide sequence of cDNA plasmid Z Nucleic acid molecules are even more preferred.

A further preferred embodiment is a nucleic acid molecule comprising a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: X in the range of positions identified for SEQ ID NO: X in Table 1.

A further preferred embodiment is an isolated nucleic acid molecule comprising the complete nucleotide sequence of SEQ ID NO: X or its complement, and / or a nucleotide sequence that is at least 95% identical to the nucleotide sequence of cDNA plasmid Z.

[0583] The nucleotide sequence of SEQ ID NO: X or its complementary strand, and / or cDNA
Also preferred is an isolated nucleic acid molecule that hybridizes to a nucleic acid molecule comprising the nucleotide sequence of plasmid Z under stringent hybridization conditions, wherein the hybridizing nucleic acid molecule described above is under stringent hybridization conditions. And does not hybridize to a nucleic acid molecule having a nucleotide sequence consisting of only A residues or T residues.

[0584]   Compositions containing a DNA molecule comprising the cDNA plasmid Z are also preferred.

Also preferred is an isolated nucleic acid molecule comprising a nucleotide sequence that is at least 95% identical to a sequence of at least 50 contiguous nucleotides in the nucleotide sequence of cDNA plasmid Z.

Also preferred is an isolated nucleic acid molecule in which the above sequence of at least 50 contiguous nucleotides is contained in the nucleotide sequence of the open reading frame sequence encoded by cDNA plasmid Z.

Also preferred is an isolated nucleic acid molecule comprising a nucleotide sequence that is at least 95% identical to a sequence of at least 150 contiguous nucleotides in the nucleotide sequence encoded by cDNA plasmid Z.

A further preferred embodiment is at least 95 for a sequence of at least 500 contiguous nucleotides in the nucleotide sequence encoded by cDNA plasmid Z.
An isolated nucleic acid molecule comprising nucleotide sequences that are% identical.

A further preferred embodiment is an isolated nucleic acid molecule comprising a nucleotide sequence that is at least 95% identical to the complete nucleotide sequence encoded by cDNA plasmid Z.

A further preferred embodiment is for detecting in a biological sample a nucleic acid molecule comprising a nucleotide sequence that is at least 95% identical to a sequence of at least 50 contiguous nucleotides in a sequence selected from the group consisting of: The method is: the nucleotide sequence of SEQ ID NO: X or its complementary strand, and the nucleotide sequence encoded by cDNA plasmid Z. The method comprises the steps of comparing a sequence selected from the group to a nucleotide sequence of at least one nucleic acid molecule in the sample, and the sequence of the nucleic acid molecule in the sample is at least 95% identical to the selected sequence. Or not.

Also preferred is the method wherein said step of comparing sequences comprises determining the extent of nucleic acid hybridization between the nucleic acid molecule in said sample and a nucleic acid molecule comprising said sequence selected from said group. Also preferred is the above method, wherein the above step of comparing sequences is also performed by comparing said sequence selected from said group with a nucleotide sequence determined from a nucleic acid molecule in said sample. The nucleic acid molecule can include a DNA molecule or an RNA molecule.

A further preferred embodiment detects a nucleic acid molecule (if any) in said sample which comprises a nucleotide sequence which is at least 95% identical to a sequence of at least 50 contiguous nucleotides in a sequence selected from the group consisting of: A method for identifying the species, tissue or cell type of a biological sample, comprising the steps of:
Nucleotide sequence of SEQ ID NO: X or its complementary strand, and cDNA plasmid Z
A nucleotide sequence encoded by.

The method for identifying the species, tissue, or cell type of a biological sample can include detecting a nucleic acid molecule comprising a nucleotide sequence in a panel of at least two nucleotide sequences, wherein At least one sequence in the panel is at least 95% identical to a sequence of at least 50 contiguous nucleotides in the sequence selected from the group above.

Also provided are methods for diagnosing in a subject a pathological condition associated with aberrant structure or expression of the nucleotide sequence of SEQ ID NO: X or its complementary strand, or the nucleotide sequence of cDNA plasmid Z encoding a protein. Preferably, the method comprises a nucleic acid molecule comprising a nucleotide sequence that is at least 95% identical to a sequence of at least 50 consecutive nucleotides in a sequence selected from the group consisting of (
Detecting in a biological sample (if any) obtained from the subject, including: the nucleotide sequence of SEQ ID NO: X or its complement, and the nucleotide sequence of cDNA plasmid Z.

The method for diagnosing a pathological condition can include detecting a nucleic acid molecule comprising a nucleotide sequence in a panel of at least two nucleotide sequences, wherein at least one sequence in the panel is , At least 95% identical to a sequence of at least 50 contiguous nucleotides in a sequence selected from the above group.

Compositions comprising isolated nucleic acid molecules are also preferred, wherein the nucleotide sequence of said nucleic acid molecule comprises a panel of at least two nucleotide sequences, wherein at least one sequence in said panel is , At least 95% identical to a sequence of at least 50 contiguous nucleotides in a sequence selected from the group consisting of: the nucleotide sequence of SEQ ID NO: X or the complement thereof and the nucleotide sequence encoded by cDNA plasmid Z. . The nucleic acid molecule can include a DNA molecule or an RNA molecule.

An isolated polypeptide comprising an amino acid sequence that is at least 90% identical to a sequence of at least about 10 contiguous amino acids in the polypeptide sequence of SEQ ID NO: Y; encoded by SEQ ID NO: X or its complement. Polypeptide and / or c
Also preferred is the polypeptide encoded by DNA plasmid Z.

An isolated polypeptide comprising an amino acid sequence that is at least 95% identical to a sequence of at least about 30 contiguous amino acids in the amino acid sequence of SEQ ID NO: Y; encoded by SEQ ID NO: X or a complement thereto. Polypeptides and / or polypeptides encoded by cDNA plasmid Z are also preferred.

An isolated polypeptide comprising an amino acid sequence that is at least 95% identical to a sequence of at least about 100 contiguous amino acids in the amino acid sequence of SEQ ID NO: Y; encoded by SEQ ID NO: X or a complement thereto. Further preferred are polypeptides and / or polypeptides encoded by cDNA plasmid Z.

An isolated polypeptide comprising an amino acid sequence that is at least 95% identical to the complete amino acid sequence of SEQ ID NO: Y; encoded by SEQ ID NO: X or a polypeptide encoded by the complement thereto and / or cDNA plasmid Z. Further preferred are the polypeptides that are described.

Further preferred is an isolated polypeptide comprising an amino acid sequence that is at least 90% identical to a sequence of at least about 10 contiguous amino acids in the complete amino acid sequence of the polypeptide encoded by cDNA plasmid Z.

A polypeptide wherein the sequence of contiguous amino acids is contained in the amino acid sequence of the portion of the polypeptide encoded by cDNA plasmid Z; the polypeptide and / or sequence encoded by SEQ ID NO: X or its complement. The polypeptide sequence number Y is also preferred.

Also preferred is an isolated polypeptide comprising an amino acid sequence that is at least 95% identical to a sequence of at least about 30 consecutive amino acids in the amino acid sequence of the polypeptide encoded by cDNA plasmid Z.

Also preferred is an isolated polypeptide comprising an amino acid sequence that is at least 95% identical to a sequence of at least about 100 consecutive amino acids in the amino acid sequence of the polypeptide encoded by cDNA plasmid Z.

The amino acid sequence of the polypeptide encoded by cDNA plasmid Z contains
Also preferred is an isolated polypeptide that comprises an amino acid sequence that is at least 95% identical.

An isolated antibody that specifically binds to a polypeptide comprising an amino acid sequence that is at least 90% identical to a sequence of at least 10 consecutive amino acids in a sequence selected from the group consisting of: Preferred: the polypeptide sequence of SEQ ID NO: Y; the polypeptide encoded by SEQ ID NO: X or its complement and the polypeptide encoded by cDNA plasmid Z.

Further preferred is a method of detecting in a biological sample a polypeptide comprising an amino acid sequence that is at least 90% identical to a sequence of at least 10 consecutive amino acids in a sequence selected from the group consisting of: The polypeptide sequence of SEQ ID NO: Y; the polypeptide encoded by SEQ ID NO: X or its complement and the polypeptide encoded by cDNA plasmid Z; the method comprises the amino acid sequence of at least one polypeptide molecule in this sample. With a sequence selected from this group, and determining whether the sequence of this polypeptide molecule in this sample is at least 90% identical to this sequence of at least 10 consecutive amino acids. Include.

The above step of comparing the amino acid sequence of at least one polypeptide molecule in this sample with a sequence selected from this group comprises the sequence of polypeptides in this sample selected from the group consisting of: The above method also includes the step of determining the degree of specific binding to an antibody that specifically binds to a polypeptide comprising an amino acid sequence that is at least 90% identical to a sequence of at least 10 consecutive amino acids in Preferred: the polypeptide sequence of SEQ ID NO: Y; the polypeptide encoded by SEQ ID NO: X or its complement and the polypeptide encoded by cDNA plasmid Z.

Also preferred is the above method, wherein the above step of comparing sequences is carried out by comparing the amino acid sequences determined from the polypeptide molecules in this sample with sequences selected from this group.

Also preferred is a method of identifying the species, tissue or cell type of a biological sample, which method is at least 90% identical to a sequence of at least 10 contiguous amino acids in a sequence selected from the group consisting of: Comprising detecting in this sample a polypeptide molecule comprising an amino acid sequence (if present): the polypeptide sequence of SEQ ID NO: Y; the polypeptide and cDNA encoded by SEQ ID NO: X or its complement. A polypeptide encoded by plasmid Z.

Also preferred is the above method of identifying a species, tissue or cell type of a biological sample, the method comprising detecting a polypeptide molecule comprising an amino acid sequence in a panel of at least two amino acid sequences, Here, at least one sequence in this panel is at least 90% identical to a sequence of at least 10 consecutive amino acids in a sequence selected from the group above.

Also preferred is a method of diagnosing a pathological condition associated with abnormal structure or expression of a nucleic acid sequence encoding a polypeptide, identified in Table 1, in a subject. The method comprises detecting a polypeptide molecule comprising an amino acid sequence in a panel of at least two amino acid sequences in a biological sample obtained from this subject, wherein at least one sequence in this panel is , At least 90% identical to a sequence of at least 10 contiguous amino acids in a sequence selected from the group consisting of: the polypeptide sequence of SEQ ID NO: Y; the polypeptide encoded by SEQ ID NO: X or its complement. A polypeptide encoded by cDNA plasmid Z.

In any of these methods, the step of detecting the polypeptide molecule comprises the steps of:
Using an antibody is included.

Also preferred is an isolated nucleic acid molecule comprising a nucleotide sequence that is at least 95% identical to a nucleotide sequence encoding a polypeptide, wherein the polypeptide is the polypeptide sequence of SEQ ID NO: Y; SEQ ID NO: X or It comprises an amino acid sequence that is at least 90% identical to a sequence of at least 10 contiguous amino acids within a sequence selected from the group consisting of the polypeptide encoded by its complement and the polypeptide encoded by cDNA plasmid Z.

Also preferred is an isolated nucleic acid molecule, which nucleic acid sequence encoding the polypeptide is optimized for expression of the polypeptide in a prokaryotic host.

Also preferred is an isolated nucleic acid molecule, wherein the polypeptide comprises the polypeptide sequence of SEQ ID NO: Y; the polypeptide encoded by SEQ ID NO: X or the complement thereof and cDNA plasmid Z. An amino acid sequence selected from the group consisting of

Further preferred is a method of making a recombinant vector, which method comprises the step of inserting any of the isolated nucleic acid molecules described above into a vector. Also preferred is a recombinant vector produced by this method. Also preferred is a method of making a recombinant host cell, which method comprises the step of introducing the vector into a host cell. Also, recombinant host cells produced by this method are also preferred.

Also preferred is a method of making an isolated polypeptide, which method comprises:
Under the conditions in which the polypeptide is expressed and the polypeptide is harvested,
The step of culturing this recombinant host cell is included. Also preferred is this method of making an isolated polypeptide, wherein the recombinant host cell is a eukaryotic cell, and the polypeptide is the polypeptide sequence of SEQ ID NO: Y; SEQ ID NO: X.
Alternatively, it is a human protein containing an amino acid sequence selected from the group consisting of a polypeptide encoded by a complementary chain thereto and a polypeptide encoded by cDNA plasmid Z. Also preferred are isolated polypeptides produced by this method.

Also preferred is a method of treating an individual in need of elevated levels of protein activity, which method provides such an individual with a therapeutic agent (increase the level of this protein activity in said individual). An isolated polypeptide of the invention effective for
A polynucleotide, an immunogenic fragment or analog thereof, a binding agent, an antibody, or an antigen-binding fragment).

Also preferred is a method of treating an individual in need of a reduced level of protein activity, the method comprising treating such an individual with a therapeutic agent, which reduces the level of activity of this protein in that individual. Effective amount of the isolated polypeptide, polynucleotide, immunogenic fragment or analog thereof, binding agent, antibody, or antigen-binding fragment of the present invention.

In a particular embodiment of the invention, each “contig ID” is listed in the fourth column of Table 2, preferably in the nucleotide sequence referenced in the fifth column of Table 2, and in ab One or more comprising or consisting of a nucleotide sequence described by the general formula (where a and b are uniquely determined for the corresponding SEQ ID NO: X, referenced in column 3 of Table 2). The polynucleotide is eliminated. More specific embodiments relate to polynucleotide sequences except one, two, three, four or more specific polynucleotide sequences referenced in column 5 of Table 2.
This enumeration is not meant to include all sequences that may be excluded by the general formula, only representative examples. Throughout these registries, all references available are hereby incorporated by reference in their entireties.

[0622]

[Table 2]

[0623]

[Table 3]

[0624]

[Table 4]

[0625]

[Table 5]

[0626]

[Table 6] Although the present invention has been generally described, it will be readily understood by reference to the following example, which is provided for purposes of illustration and is not intended to be limiting.

Examples Example 1: Isolation of Selected cDNA Clones from Deposited Samples Each cDNA clone in the referenced ATCC deposit is contained in a plasmid vector. Table 1 shows the vectors used to construct the cDNA library from which each clone was isolated. In many cases, the vector used to construct the library is a plasmid excised phage vector. The table immediately below correlates the relevant plasmids for each phage vector used in constructing the cDNA library. For example, if a particular clone is shown in Table 1 to be isolated in the vector "Lambda Zap",
The corresponding deposited clone is "pBluescript".

[0628]

[Table 7] Vector Lambda Zap (US Pat. Nos. 5,128,256 and 5,286,636), Uni-Zap XR (US Pat. No. 5,128,25).
6 and 5,286,636), Zap Express (US Pat. Nos. 5,128,256 and 5,286,636), pBluescri.
pt (pBS) (Short et al., Nucleic Acids Res., 16).
: 7583-7600 (1988); Alting-Mees et al., Nuclei.
c Acids Res. , 17: 9494 (1989)) and pBK (A
lting-Mees et al., Strategies, 5: 58-61 (1992).
), Stratagene Cloning Systems, Inc. 1
1011 N.I. Torrey Pines Road, La Jolla, CA
, 92037. pBS contains the ampicillin resistance gene,
And pBK contains the neomycin resistance gene. Both are E. coli strain XL
-1 Blue, which is also available from Stratagene, can be transformed. pBS arrives in four forms: SK +, SK-, KS + and KS. S and K are in the polylinker region ("S" is SacI and "K" is KpnI, which are the first sites at each end of the respective linkers). Refers to the orientation of the polylinker relative to the flanking T7 and T3 primer sequences. "+" Or "-" means f1 ori in a certain direction
Refers to the orientation of the f1 origin of replication (“ori”) such that a single-stranded rescue initiated from produces a sense-strand DNA and, on the other hand, an antisense-strand DNA.

Vectors pSport1, pCMVSport2.0 and pCMVSpor
t3.0 according to Life Technologies, Inc. , P .; O. Box6
009, Gaithersburg, MD 20897. All S
The port vector contains the ampicillin resistance gene, and E. E. coli strain DH
10B, which is also available from Life Technologies, can be transformed. (For example, Gruber, CE et al., Focus 1
5:59 (1993)). Vector lafmid BA (Bent
o Soares, Columbia University, NY) contains the ampicillin resistance gene, and E. E. coli strain XL-1 Blue. Vector pCR® 2.1 (this is Invitrogen
1600 Faraway Avenue, Carlsbad, CA 920
08), which contains the ampicillin resistance gene, and E. co
Li strain DH10B (available from Life Technologies)
(For example, Clark, Nuc. Acids Res., 1
6: 9677-9686 (1988) and Mead et al., Bio / Techno.
logy, 9: (1991)). Preferably, the polynucleotides of the invention do not include the phage vector sequences identified for the particular clones in Table 1, as well as the corresponding plasmid vector sequences shown above.

The deposited material in the sample given the ATCC accession number for any given cDNA clone, referred to in Table 1, also contains one or more additional plasmids, each of which is Including different cDNA clones)
Can be included. Thus, the deposit sharing the same ATCC Deposit Number contains at least the plasmid for each cDNA clone shown in Table 1. Typically, Table 1
The sample of each ATCC deposit referred to in US Pat. No. 5,037,049 contains a mixture of approximately equal amounts (by weight) of about 50 plasmid DNAs, each containing a different cDNA clone; , More or less than 50 cds
Plasmids for NA clones (up to about 500 cDNA clones) can be included.

Two approaches can be used to isolate a clone from the deposited sample of plasmid DNA cited for that particular clone in Table 1. First, the plasmid is isolated directly by screening the clones with the polynucleotide probe corresponding to SEQ ID NO: X.

In particular, particular polynucleotides having 30-40 nucleotides are synthesized using the Applied Biosystems DNA synthesizer according to the reported sequence. The oligonucleotide is labeled with, for example, ³² P-γ-ATP, T
Labeled with 4 polynucleotide kinase and purified according to conventional methods. (For example, Maniatis et al., Molecular Cloning: A
Laboratory Manual, Cold Spring Harbo
r Press, Cold Spring, NY (1982)). The plasmid mixture is prepared using techniques known to those of skill in the art, such as those provided by vector suppliers or the relevant publications or patents cited above, in a suitable host as described above. (For example, XL-1 Blue (Strata
gene)). Transformants are plated on 1.5% agar plates (containing an appropriate selection agent such as ampicillin) at a density of about 150 transformants (colony) per plate. These plates were subjected to conventional methods for bacterial colony screening (eg Sambrook et al., Molcu.
la Cloning: A Laboratory Manual, 2nd Edition,
(1989), Cold Spring Harbor Laboratory.
Press, 1.93-1.104) or other techniques known to those of skill in the art to screen using nylon membranes.

Alternatively, both ends of SEQ ID NO: X (ie, the 5'N of the clone defined in Table 1)
17-2 from within the region of SEQ ID NO: X surrounded by T and 3′NT)
Two 0 nucleotide primers are synthesized and used to amplify the desired cDNA using the deposited cDNA plasmid as a template. The polymerase chain reaction is carried out under conventional conditions, for example in 25 μl of a reaction mixture with 0.5 μg of the above cDNA template. A simple reaction mixture is 1.5-5 mM
MgCl ₂ , 0.01% (w / v) gelatin, 20 μM dATP each,
dCTP, dGTP, dTTP, 25 pmol of each primer and 0.25 unit of Taq polymerase. 35 cycles of PCR (denaturation at 94 ° C. for 1 min; annealing at 55 ° C. for 1 min; extension at 72 ° C. for 1 min)
Performed using an in-Elmer Cetus automated thermal cycler. Amplification products were analyzed by agarose gel electrophoresis and DN of expected molecular weight
The A band is cut out and purified. The PCR product is confirmed to be the selected sequence by subcloning and sequencing the DNA product.

Several methods are available for identification of the 5'non-coding or 3'non-coding portions of genes that may not be present in the deposited clones. These methods are
Including, but not limited to: filter probe searching, clonal enrichment using specific probes, and 5'and 3 '"RAC" well known in the art.
A protocol similar or identical to the "E" protocol. For example, a method similar to 5'RACE is available to generate deletions at the 5'end of the desired full length transcript (Frommont-Racine et al., Nucleic Acids Re.
s. , 21 (7): 1683-1684 (1993)).

Briefly, specific RNA oligonucleotides are ligated to the 5'end of a population of RNAs that probably contains full-length gene RNA transcripts. PCR of the 5'portion of the desired full-length gene is performed using a primer set containing a primer specific to the linked RNA oligonucleotide and a primer specific to the known sequence of the gene of interest.
Amplify. The amplified product can then be sequenced and used to generate the full length gene.

This above method starts with total RNA isolated from the desired source, but may also use poly A + RNA. The RNA preparation is then treated with phosphatase, if necessary, to degrade or damage the RN, which may interfere with subsequent RNA ligase steps.
The 5'phosphate group of A can be eliminated. The phosphatase should then be inactivated, and the RNA should be treated with tobacco acid pyrophosphatase to remove the cap structure present at the 5'end of the messenger RNA. This reaction leaves a 5'phosphate group at the 5'end of the cap cleaved RNA that can then be ligated to the RNA oligonucleotide using T4 RNA ligase.

This modified RNA preparation is used as a template for first-strand cDNA synthesis using gene-specific oligonucleotides. Use the first strand synthesis reaction as a template for PCR amplification of the desired 5'end using primers specific for the ligated RNA oligonucleotide and primers known for the known sequence of the gene of interest. . The resulting product is then sequenced and analyzed to confirm that the 5'end sequence belongs to the desired gene.

Example 2 Isolation of Genomic Clones Corresponding to Polynucleotides Human Genome P1 Library (Genomic Systems, Inc.)
Are screened by PCR using primers selected for the cDNA sequence corresponding to SEQ ID NO: X according to the method described in Example 1 (Sa
See also mbrook).

[0639]   (Example 3: Tissue distribution of polypeptide)   The tissue distribution of mRNA expression of the polynucleotides of the invention can be determined, inter alia, by Samb
Use the protocol for Northern blot analysis described by look et al.
Decide. For example, the cDNA produced by the method described in Example 1.
Probe the rediprime^TM  DNA labeling system
(Amersham Life Science) and follow the manufacturer's instructions.
That's P³²Label with. After labeling, the probe was attached to CHROMA SPIN-100. ^TM Using a column (Clontech Laboratories, Inc.)
And purify according to manufacturer's protocol number PT1200-1. Then this
Test various human tissues for mRNA expression using purified labeled probes
To do.

Multiple Tissue Northern (MTN) Blots (Clontech) containing various human tissues (H) or human immune system tissues (IM) were prepared using ExpressHyb ^™ Hybridization Solution (Clontech), manufacturer's protocol number P.
Test with labeled probe according to T1190-1. After hybridization and washing, blots are mounted and exposed to film overnight at -70 ° C, and film is developed according to standard procedures.

Example 4 Polynucleotide Chromosome Mapping A set of oligonucleotide primers is designed according to the sequence at the 5 ′ end of SEQ ID NO: X. This primer preferably spans about 100 nucleotides.
This primer set is then used for polymerase chain reaction under the following set of conditions: 95 ° C for 30 seconds; 56 ° C for 1 minute; 70 ° C for 1 minute. This cycle is repeated 32 times and then once at 70 ° C. for 5 minutes. Somatic cell hybrid panel containing individual chromosomes or chromosome fragments (Bios, Inc)
In addition, human, mouse, and hamster DNA are used as templates. Reactions are analyzed on either an 8% polyacrylamide gel or a 3.5% agarose gel. Chromosome mapping is performed for about 100 in specific somatic cell hybrids.
Determined by the presence of the bp PCR fragment.

Example 5: Bacterial Expression of Polypeptides Polynucleotides encoding the polypeptides of the invention are PCR oligonucleotides corresponding to the 5 ′ and 3 ′ ends of the DNA sequences, as outlined in Example 1. Amplify using primers and synthesize insert. The primers used to amplify the cDNA insert should include restriction sites, preferably BamHI and XbaI, and, if necessary, start / stop codons for cloning the amplification product into an expression vector. . For example, BamHI and XbaI are bacterial expression vectors pQE-9 (Qiagen, Inc., Chat.
(Sworth, CA). This plasmid vector
Antibiotic resistance (Amp ^r ), bacterial origin of replication (ori), IPTG-regulatable promoter / operator (P / O), ribosome binding site (RBS), 6-
It encodes a histidine tag (6-His), and a restriction enzyme cloning site.

The pQE-9 vector is digested with BamHI and XbaI and the amplified fragment is ligated into the pQE-9 vector which maintains the reading frame initiated in bacterial RBS. The ligation mixture was then treated with the plasmid pREP, which expresses the lacI repressor and also confers kanamycin resistance (Kan ^r ).
4 containing multiple copies of E. coli strain M15 / rep4 (Qiagen, In
c. ). Transformants are identified by their ability to grow on LB plates and ampicillin / kanamycin resistant colonies are selected. Plasmid DNA is isolated and confirmed by restriction analysis.

Clones containing the desired construct were cloned into Amp (100 μg / ml) and Kan (100 μg / ml).
Liquid culture in LB medium supplemented with both (25 μg / ml) overnight (O / N)
Proliferate. The O / N culture is used to inoculate a large culture at a ratio of 1: 100 to 1: 250. Cells absorbance 600 between 0.4 to 0.6 (O.D.. ⁶⁰⁰
). Then IPTG (isopropyl-BD-thiogalactopyranoside) is added to a final concentration of 1 mM. IPTG induces P / O clearing by inactivating the lacI repressor, leading to increased gene expression.

Cells are grown for an additional 3-4 hours. The cells are then centrifuged (6000 x
g for 20 minutes). The cell pellet is solubilized in the chaotropic reagent 6M guanidine HCl by stirring at 4 ° C. for 3-4 hours. Cell debris is removed by centrifugation, and the supernatant containing the polypeptide is
Load onto a nickel-nitrilo-triacetic acid (“Ni-NTA”) affinity resin column (available from QIAGEN, Inc., supra). Proteins with a 6xHis tag bind Ni-NTA resin with high affinity and can be purified in a simple one-step procedure (for details, see The QIAexpressi.
onist (1995) QIAGEN, Inc. (See above)).

Briefly, the supernatant was loaded onto a column of 6M guanidine-HCl, pH 8, the column was first washed with 10 volumes of 6M guanidine-HCl, pH 8, then 10 volumes of 6M guanidine-HCl. , Wash with pH 6, and finally elute the polypeptide with 6M guanidine-HCl, pH 5.

The purified protein was then loaded with phosphate buffered saline (PBS) or 5
Regenerate by dialysis against 0 mM sodium acetate, pH 6 buffer and 200 mM NaCl. Alternatively, the protein can be successfully refolded while immobilized on the Ni-NTA column. Recommended conditions are as follows: Regeneration using a linear gradient of 6M to 1M urea in 500 mM NaCl, 20% glycerol, 20 mM Tris / HCl pH 7.4 with protease inhibitors. Regeneration should take a minimum of 1.5 hours. After playing
The protein is eluted by the addition of 250 mM imidazole. Add imidazole to PBS or 50 mM sodium acetate pH 6 buffer and 200 mM Na
Removed by final dialysis step against Cl. The purified protein is stored at 4 ° C or frozen at -80 ° C.

In addition to the expression vectors described above, the invention further includes an expression vector called pHE4a that contains a phage operator and a promoter element operably linked to the polynucleotide of the invention (ATCC Accession No. 209645).
Deposited on February 25, 1998. ). This vector contains: 1) the neomycin phosphotransferase gene as a selectable marker, 2) E. coli
Origin of replication, 3) T5 phage promoter sequence, 4) two lac operator sequences, 5) Shine-Dalgarno sequence, and 6) lactose operon repressor gene (lacIq). The origin of replication (oriC) is pUC19 (LTI, G
aisersburg, MD). Promoter and operator sequences are made synthetically.

The vector was restricted with NdeI and XbaI, BamHI, XhoI, or Asp718, the restriction products were run on a gel, and the larger fragment (the stuffer fragment should be approximately 310 base pairs). DNA can be inserted into pHEa by isolating. DNA
The insert was labeled with NdeI (5 ′ primer) and XbaI, BamHI, XhoI.
, Or using PCR primers with restriction sites for Asp718 (3 ′ primer) and generated according to the PCR protocol described in Example 1. P
The CR insert is gel purified and restricted with compatible enzymes. The insert and vector are ligated according to standard protocols.

The engineered vector can be readily replaced in the above protocol to express the protein in bacterial systems.

Example 6: Purification of Polypeptides from Inclusion Bodies The following alternative method was performed using E. coli when the polypeptide was present in the form of inclusion bodies.
E. coli can be used to purify the expressed polypeptide. Unless otherwise specified, all the following steps are performed at 4-10 ° C.

E. After completion of the production phase of E. coli fermentation, the cell culture is cooled to 4-10 ° C. and the cells are harvested by continuous centrifugation at 15,000 rpm (Heraeus Sepatech). Based on the expected yield of protein per unit weight of cell paste and the amount of purified protein required, an appropriate amount of cell paste (by weight) was added to 100 mM Tris, 50 mM EDTA, pH 7.
Resuspend in a buffer solution containing 4. The cells are dispersed in a homogenous suspension using a high shear mixer.

The cells were then transferred to a microfluidizer (
Microfuidics, Corp. Or APV Gaulin, Inc.
) By passing the solution twice at 4000-6000 psi. The homogenate is then mixed with NaCl solution to a final concentration of 0.5 M NaCl, followed by centrifugation at 7000 xg for 15 minutes. The obtained pellet is
． Wash again using 5M NaCl, 100 mM Tris, 50 mM EDTA, pH 7.4.

The obtained inclusion bodies were washed with 1.5 M guanidine hydrochloride (GuHCl) for 2-4.
Solubilize for a period of time. After centrifugation at 7,000 xg for 15 minutes, discard the pellet,
Then, the supernatant containing the polypeptide was incubated overnight at 4 ° C. for further GuH
Allows Cl extraction.

Following high speed centrifugation (30,000 × g) to remove insoluble particles, Gu
HCl solubilized protein was combined with GuHCl extract, 50 mM sodium, pH 4
． 5, 150 mM NaCl, 20 mM buffer containing 2 mM EDTA,
Refold by rapid mixing with vigorous stirring. The refolded diluted protein solution is kept at 4 ° C. without mixing for 12 hours before further purification steps.

Preliminarily prepared 40 mM to clarify the refolded polypeptide solution.
0.16μ with proper surface area, equilibrated with sodium acetate, pH 6.0
contact filtration unit (tangential f with m membrane filter)
An illumination unit (eg, Filtron) is used. The filtered sample is treated with a cation exchange resin (eg, Poros HS-50, Per).
load on septeive Biosystems). The column was washed with 40 mM sodium acetate, pH 6.0, and 250 mM, 500 in the same buffer.
Elute in stepwise fashion with mM, 1000 mM, and 1500 mM NaCl. The absorbance of the eluate at 280 nm is continuously monitored. Fractions are collected and further analyzed by SDS-PAGE.

Fractions containing the polypeptide are then pooled and mixed with 4 volumes of water. The diluted sample was then treated with a pre-prepared strong anion (Poros HQ-50).
, Perseptive Biosystems) and weak anions (Poro
s CM-20, Perseptive Biosystems) loaded onto a set of in-line columns of exchange resin. The column was 40 mM sodium acetate, pH 6.0.
Equilibrate with. Both columns were loaded with 40 mM sodium acetate, pH 6.0, 200
Wash with mM NaCl. The CM-20 column was then loaded onto a 10 column volume linear gradient (0.2 M NaCl, 50 mM sodium acetate, pH 6.0 to 1.0).
Elute with M NaCl, 50 mM sodium acetate, pH 6.5 range). Fractions are collected under constant A ₂₈₀ monitoring of the eluate. Then (for example,
Fractions containing the polypeptide (as determined by 16% SDS-PAGE) are pooled.

The resulting polypeptide should exhibit greater than 95% purity after the above refolding and purification steps. When 5 μg of purified protein is loaded, no major contaminating band should be observed from Coomassie blue stained 16% SDS-PAGE gels. Purified protein can also be tested for endotoxin / LPS contaminants, and typically the LPS content is less than 0.1 ng / ml according to the LAL assay.

Example 7: Cloning and Expression of Polypeptides in Baculovirus Expression System In this example, the plasmid shuttle vector pA2 is used to insert a polynucleotide into a baculovirus to express the polypeptide. This expression vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhedrosis virus (AcMNPV), followed by BamHI, X.
Contains convenient restriction sites such as baI and Asp718. The simian virus 40 (“SV40”) polyadenylation site is used for efficient polyadenylation. For easy selection of recombinant virus, the plasmid was engineered into E. coli under the control of the weak Drosophila promoter in the same orientation. It contains the β-galactosidase gene from E. coli, followed by the polyadenylation signal of the polyhedrin gene. The inserted gene is flanked on both sides by viral sequences for cell-mediated homologous recombination with wild-type viral DNA, which produces a viable virus expressing the cloned polynucleotide.

Many other baculovirus vectors (eg pAc373, pVL941)
, And pAcIM1) are signals that the construct is properly positioned for transcription, translation, secretion, etc. (including signal peptide and in-frame AUG, if required), as will be readily appreciated by those of skill in the art. Can be used in place of the above vector as long as Such a vector is, for example, Lucco.
W et al., Virology 170: 31-39 (1989).

Specifically, the cDNA sequence contained in the deposited clone was cloned into the PC described in Example 1 using primers containing appropriate restriction sites and start / stop codons.
Amplify using the R protocol. The pA2 vector does not require a second signal peptide if a naturally occurring signal sequence is used to produce the secreted protein. Alternatively, the vector is described in Summers et al., "A Manual o
f Methods for Baculovirus Vectors an
d Insect Cell Culture Procedures ", Te
xas Agricultural Experimental Status
n Bulletin No. It can be modified to include a baculovirus leader sequence using standard methods described in 1555 (1987) (pA2).
GP).

The amplified fragment was transferred to a commercial kit (“Geneclean” BIO).
101 Inc. , La Jolla, Ca), and is isolated from a 1% agarose gel. The fragment is then digested with the appropriate restriction enzymes and again 1%
Purify on agarose gel.

The plasmids may be digested with the corresponding restriction enzymes and, if desired, dephosphorylated with calf intestinal phosphatase using conventional procedures known in the art.
The DNA is then added to a commercially available kit (“Geneclean” BIO 101 In).
c. , La Jolla, Ca), and is isolated from a 1% agarose gel.

The fragment and the dephosphorylated plasmid are ligated together using T4 DNA ligase. E. coli HB101 or XL-1 Blue (St
ratagene Cloning Systems, La Jolla, CA
) Other suitable E. The E. coli host is transformed with the ligation mixture and spread on culture plates. Bacteria containing plasmids were isolated from individual colonies using D
The NA is digested and the digestion products are identified by analysis by gel electrophoresis. The sequence of the cloned fragment is confirmed by DNA sequencing.

5 μg of plasmid containing this polynucleotide was prepared as described in Felgner et al., Pr.
oc. Natl. Acad. Sci. USA 84: 7413-7417 (19).
87), using 1.0 μg of commercially available linearized baculovirus DNA ("BaculoGold ^™ baculovi").
rus DNA ", Pharmingen, San Diego, CA). 1 μg of BaculoGold ^™ viral DNA
And 5 μg of plasmid were added to 50 μl of serum-free Grace's medium (Life Te
chnologies Inc. , Gaithersburg, MD),
Mix in sterile wells of a microtiter plate. Thereafter, 10 μl Lipofectin and 90 μl Grace's medium were added, mixed and allowed to stand at room temperature for 15
Incubate for minutes. Then, the transfection mixture was seeded on a 35 mm tissue culture plate containing 1 ml of Grace's medium without serum (Sf9 insect cells (
Add dropwise to ATCC CRL 1711). Then plate at 5 ° C for 5
Incubate for hours. The transfection solution is then removed from the plate and 1 ml Grace's insect medium supplemented with 10% fetal bovine serum is added. The culture is then continued for 4 days at 27 ° C.

After 4 days, the supernatants are collected and plaque assayed as described by Summers and Smith (supra). "Blue Gal" (Lif
e Technologies Inc. , Gaithersburg) is used to allow easy identification and isolation of gal expressing clones (resulting in blue colored plaques). (A detailed description of this type of "plaque assay" is also provided by Life Technologies Inc.,
(Can be found in the User Guide for Insect Cell Culture and Baculovirology, pages 9-10, distributed by Gaithersburg). After appropriate incubation, blue colored plaques are picked up with a micropipettor (eg Eppendorf) tip. The agar containing the recombinant virus was then resuspended in a microcentrifuge tube containing 200 μl Grace's medium and the suspension containing the recombinant baculovirus was seeded on a 35 mm dish of Sf.
Used to infect 9 cells. After 4 days, the supernatants of these culture dishes are collected and then stored at 4 ° C.

To confirm expression of the polypeptide, Sf9 cells are grown in Grace's medium supplemented with 10% heat-inactivated FBS. Infect cells with a multiplicity of infection (“MOI”) of about 2.
) To a recombinant baculovirus containing the polynucleotide. If radiolabeled protein is desired, the medium is removed after 6 hours and SF900 II medium without methionine and cysteine (Life Techno).
logs Inc. , Rockville, MD). After 42 hours, 5 μCi of ³⁵ S-methionine and 5 μCi ³⁵ S-cysteine (available from Amersham) are added. The cells are incubated for a further 16 hours and then harvested by centrifugation. Proteins in the supernatant and intracellular proteins are analyzed by SDS-PAGE followed by (when radiolabeled) autoradiography.

[0668] Micro-sequencing of the amino-terminal amino acid sequence of purified proteins can be used to determine the amino-terminal sequence of the produced protein.

Example 8 Expression of Polypeptides in Mammalian Cells The polypeptides of the invention can be expressed in mammalian cells. A typical mammalian expression vector contains promoter elements that mediate the initiation of transcription of mRNA, protein coding sequences, and signals necessary for termination of transcription and polyadenylation of the transcript. Additional elements include enhancers, Kozak sequences, and intervening sequences flanking the donor and acceptor sites of RNA splicing. Very efficient transcription is achieved by SV40-derived early and late promoters,
Long terminal repeats from retroviruses (eg RSV, HTLVI, HIVI) (
LTR), and the cytomegalovirus (CMV) early promoter. However, cellular elements such as the human actin promoter can also be used.

Expression vectors suitable for use in practicing the present invention are, for example, pSVL and pMSG (Pharmacia, Uppsala, Sweden), pRSVc.
at (ATCC 37152), pSV2dhfr (ATCC 37146),
Includes vectors such as pBC12MI (ATCC 67109), pCMVSport2.0, as well as pCMVSport3.0. Mammalian host cells that can be used include human Hela cells, 293 cells, H9 cells and Jurkat.
Cells, mouse NIH3T3 cells and C127 cells, Cos 1 cells, Cos
7 cells and CV1 cells, quail QC1-3 cells, mouse L cells, and Chinese hamster ovary (CHO) cells.

Alternatively, the polypeptide comprises a polynucleotide integrated into a chromosome,
It can be expressed in stable cell lines. Co-transfection with selectable markers such as dhfr, gpt, neomycin, hygromycin allows the identification and isolation of transfected cells.

The transfected gene can also be amplified to express large amounts of the encoded protein. The DHFR (dihydrofolate reductase) marker is useful for developing cell lines that carry hundreds or even thousands of copies of the gene of interest.
(For example, Alt et al., J. Biol. Chem. 253: 1357-1370 (
1978); Hamlin, Biochem. et Biophys. Acta
1097: 107-143 (1990): Page et al., Biotechnol.
Ogy 9: 64-68 (1991)). Another useful selectable marker is the enzyme glutamine synthase (GS) (Murphy et al., Bioche.
m J. 227: 277-279 (1991); Bebbington et al., Bi.
o / Technology 10: 169-175 (1992)). These markers are used to grow mammalian cells in selective medium and select the cells with the highest resistance. These cell lines contain the amplified gene integrated into the chromosome. Chinese hamster ovary (CHO) and NSO cells are often used for protein production.

Expression vectors pC4 (ATCC Accession No. 209646) and pC6 (AT), which are derivatives of plasmid pSV2-dhfr (ATCC Accession No. 37146).
CC Accession No. 209647) is for Rous sarcoma virus (Cullen et al., Mol.
electrical and Cellular Biology, 438-447 (
March 1985)), a strong promoter (LTR), and a fragment of the CMV enhancer (Boshart et al., Cell 41: 521-530 (1985)). For example, multiple cloning sites with BamHI, XbaI, and Asp718 restriction enzyme cleavage sites facilitate cloning of the gene of interest. The vector also contains a 3'intron, a polyadenylation and termination signal for the rat preproinsulin gene, and the mouse DHFR gene under the control of the SV40 early promoter.

Specifically, for example, plasmid pC6 is digested with appropriate restriction enzymes and then calf intestinal phosphatase (phosp) is followed according to procedures known in the art.
hate) and dephosphorylated. The vector is then isolated from a 1% agarose gel.

The polynucleotides of the invention are amplified according to the protocol outlined in Example 1, using primers with appropriate restriction sites and start / stop codons if necessary. If required for secretion, the vector may be modified to include a heterologous signal sequence (see, eg, WO96 / 34891).

The amplified fragment was transferred to a commercially available kit ("Geneclean", BIO 10).
1 Inc. , La Jolla, Ca. ) Is used to isolate from a 1% agarose gel. The fragment is then digested with the appropriate restriction enzymes and again 1%
Purify on agarose gel.

The amplified fragment is then digested with the same restriction enzymes and purified on a 1% agarose gel. The isolated fragment and the dephosphorylated vector are then ligated with T4 DNA ligase. Then E. E. coli HB101 or XL-1 Blue cells are transformed and bacteria containing the fragment inserted into plasmid pC6 are identified using, for example, restriction enzyme analysis.

Chinese hamster ovary cells lacking the active DHFR gene are used for transfection. 5 μg of expression plasmid pC6 is co-transfected with 0.5 μg of plasmid pSVneo using lipofectin (Felgner et al., Supra). Plasmid pSV2-neo contains the neo gene from Tn5 which encodes an enzyme that confers resistance to a group of antibiotics including G418, which is a dominant selectable marker. Cells with 1 mg / ml G4
Seed in α minus MEM supplemented with 18. After 2 days, cells were trypsinized and treated with 10, 25, or 50 ng / ml methotrexate and 1 mg / ml.
Seed in hybridoma cloning plates (Greiner, Germany) in α-MEM supplemented with ml G418. After about 10-14 days,
Single clones were trypsinized and then treated with different concentrations of methotrexate (5
0 nM, 100 nM, 200 nM, 400 nM, 800 nM) are used to seed 6-well petri dishes or 10 ml flasks. Clones growing at the highest concentrations of methotrexate were then selected for higher concentrations (1 μM, 2 μM, 5 μM).
(10 mM, 20 mM) to a new 6-well plate containing methotrexate. The same procedure is repeated until clones are obtained that grow at a concentration of 100-200 μM. Expression of the desired gene product is analyzed, for example, by SDS-PAGE and Western blot, or by reverse phase HPLC analysis.

Example 9: Protein Fusions The polypeptides of the invention are preferably fused to other proteins. These fusion proteins can be used for various applications. For example, fusion of a polypeptide of the invention to a His tag, HA tag, protein A, IgG domain, and maltose binding protein facilitates purification (see Example 5; EP A 394,827). Traunecker et al., Nature 331;
: 84-86 (1988)). These polypeptides also
It may be fused to a heterologous polypeptide sequence to facilitate secretion or intracellular trafficking (eg, KDEL). Furthermore, IgG-1, Ig
Fusion to G-3 and albumin increases half-life in vivo. The nuclear localization signal fused to the polypeptide of the present invention allows the protein to bind to specific subcellular (
Subcellular localization can be targeted. On the other hand, covalent heterodimers or homodimers may increase or decrease the activity of the fusion protein. Fusion proteins can also create chimeric molecules that have more than one function. Finally, fusion proteins may increase the solubility and / or stability of fusion proteins as compared to non-fusion proteins. All forms of the above fusion proteins can be made by modifying the protocol below, which outlines the fusion of polypeptides to IgG molecules, or the protocol described in Example 5.

Briefly, the human Fc portion of an IgG molecule is the 5'and 3'of the sequence set forth below.
It can be PCR amplified using primers spanning the ends. These primers should also have convenient restriction enzyme sites and, if necessary, start / stop codons to facilitate cloning into an expression vector, preferably a mammalian expression vector.

For example, if pC4 (Accession No. 209646) is used, the human Fc portion can be ligated into the BamHI cloning site. Note that the 3'BamHI site should be destroyed. The vector containing the human Fc portion was then restricted again with BamHI to linearize the vector and Example 1
A polynucleotide of the invention isolated by the PCR protocol described in
It is ligated to this BamHI site. Note that the polynucleotide is cloned without a stop codon, otherwise no fusion protein will be produced.

PC4 does not require a second signal peptide when a naturally occurring signal sequence is used to produce the secreted protein. Alternatively, if a naturally occurring signal sequence is not used, the vector can be modified to include a heterologous signal sequence (see, eg, WO 96/34891).

Human IgG Fc region: GGGATCCGGAGCCCAAATCTTCTGACAAAACTCACA
CATGCCCACCGTGCCCAGCACCTGAATTCGAGGGGTG
CACCGTCAGTCTTCCCCTTCCCCCCCAAAAACCCAAGG
ACACCCTCATGATCTCCCGGACTCCTGAGGTCACAT
GCGTGGGTGGGGACGTAAGCCACGAAGACCCTGAGG
TCAAGTTCAACTGGTACCGTGGACGGCGTGGAGGGTGC
ATAATGCCAAGACAAAGCCGCGGGAGGAGGCAGTACA
ACAGCACGTACCCGTGTGGTCAGCGTCTCACCACCGTCC
TGCACCAGGACTGGCTGAATGGCAAGGAGTACAAGT
GCAAGGTCTCCAACAAAGCCCTCCCAACCCCCCATCG
AGAAAACCCATCTCCAAAGCCAAAGGGCAGCCCCCGAG
AACCACAGGTGTACACCCTGCCCCCCATCCCGGGATG
AGCTGACCAAGAACCAGGTCAGCCTGACCTGCCTGG
TCAAAGGCTTCTATCCAAAGCGACCATCGCCGTGGAGGT
GGGAGAGCAATGGGGCAGCCGGAGAACAACTACAAGA
CCACGCCTCCCGTGCTGGACTCCGACGCGCTCCTTCT
TCCTCTACAGCAAGCTCACCGTGGACAAGAGCAGGT
GGCAGCAGGGGAACGTCTTCTCATGCTCCGTGATGC
ATGAGGCTCTGCACACACCACTACACCGCAGAAGAGCC
TCTCCCTGTCTCCGGGTAAATGAGTGCGACGGCCGC
GACTCTAGAGGAT (SEQ ID NO: 1).

Example 10 Polypeptide Formulations Polypeptide compositions are known to those of ordinary skill in the art including the clinical condition of an individual patient (particularly the side effects of treatment with a secreted polypeptide alone), delivery site, mode of administration, dosing regimen. Good medical practice, taking into account other factors
Prescription and dosing in a manner that complies with. Therefore, in the present specification, the target “
An "effective amount" is determined by such considerations.

As a general proposition, the total pharmaceutically effective amount of the polypeptide administered parenterally per dose is in the range of about 1 μg / kg / day to 10 mg / kg / day of patient body weight, This is at therapeutic discretion, as described above. More preferably, for the hormone, the dose is at least 0.01 mg / kg / day, and most preferably between about 0.01 mg / kg / day and about 1 mg / kg / day for humans. When administered continuously, the polypeptide is typically injected one to four times daily or continuously subcutaneously (eg, using a minipump) at a dosage rate of about 1 μg / kg / hour to about 50 μg / kg / hour. It is administered by either. Intravenous bag solutions may also be used. The duration of treatment required to observe changes and the post-treatment interval at which a response occurs appears to vary depending on the desired effect.

A pharmaceutical composition comprising the polypeptide of the invention may be administered orally, rectally, parenterally, intracistally, intravaginally, intraperitoneally, topically (powder, ointment,
Given as a gel, drops, or transdermal patch), buccal or oral or nasal spray. "Pharmaceutically acceptable carrier" means a non-toxic solid,
Semi-solid or liquid filler, diluent, encapsulant or formulation auxiliary of any type. The term "parenteral" as used herein means intravenous, intramuscular, intraperitoneal, intrasternal,
Refers to modes of administration which include subcutaneous and intraarticular injection and infusion.

The polypeptide is also suitably administered by a sustained release system. Suitable examples of sustained release compositions include semipermeable polymer matrices in the form of shaped articles, eg films or microcapsules. Sustained release matrices include polylactide (US Pat. No. 3,773,919, EP 58,481), a copolymer of L-glutamic acid and γ-ethyl-L-glutamate (Sidman et al., Bio.
polymers 22: 547-556 (1983)), poly (2-hydroxyethylmethacrylate) (Langer et al., J. Biomed. Mater. R).
es. 15: 167-277 (1981), and Langer, Chem. T
ech. 12: 98-105 (1982)), ethylene vinyl acetate (R.
Langer et al.) Or poly-D-(−)-3-hydroxybutyric acid (EP133,
988). Sustained-release compositions also include liposome-encapsulated polypeptides. Liposomes containing secreted polypeptides are prepared by methods known per se: DE 3,218,121; Epstein et al., Pr.
oc. Natl. Acad. Sci. USA 82: 3688-3692 (19).
85); Hwang et al., Proc. Natl. Acad. Sci. USA 77
: 4030-4034 (1980); EP52,322; EP36,676; E
P88,046; EP143,949; EP142,641; Japanese Patent Application No. 83-118008; US Patent Nos. 4,485,045 and 4,544.
, 545; and EP 102,324. Usually, liposomes are small (
(About 200-800 angstroms) monolayer, with a lipid content of greater than about 30 mole% cholesterol and a selected proportion adjusted for optimal secreted polypeptide therapy.

For parenteral administration, in one embodiment the secreted polypeptide is generally provided in a desired degree of purity in a pharmaceutically acceptable carrier, ie, at the dosage and concentration used by the recipient. It is formulated by mixing in a unit dosage injectable form (solution, suspension or emulsion) with a non-toxic agent that is compatible with the other ingredients of the formulation. For example, the formulation is preferably an oxidant,
And free of other compounds known to be deleterious to polypeptides.

In general, the formulations are prepared by uniformly and intimately contacting the polypeptide with a liquid carrier or a finely divided solid carrier or both. Then, if necessary,
Mold the product into the desired formulation. Preferably the carrier is a parenteral carrier, more preferably a solution that is isotonic with the blood of the recipient. Examples of such carrier vehicles include water, saline, Ringer's solution and dextrose solution. Non-aqueous vehicles such as fixed oils and ethyl oleate are also useful herein, as are liposomes.

The carrier suitably contains minor amounts of additives such as substances that enhance isotonicity and chemical stability. Such substances are not toxic to the recipient at the dosages and concentrations used, and include such substances as phosphate, citrate,
Buffering agents such as succinate, acetic acid and other organic acids or salts thereof; antioxidants such as ascorbic acid; low molecular weight (less than about 10 residues) polypeptides (eg polyarginine or tripeptides); serum Proteins such as albumin, gelatin or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamic acid, aspartic acid or arginine; cellulose or its derivatives, glucose, mannose or dextrin,
Monosaccharides, disaccharides, and other carbohydrates; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; counterions such as sodium;
And / or non-ionic surfactants such as polysorbates, poloxamers or PEG.

Polypeptides will typically be formulated in such vehicles at a concentration of about 0.1 mg / ml to 100 mg / ml, preferably 1-10 mg / ml, at a pH of about 3-8. . It is understood that the use of the particular excipients, carriers or stabilizers described above will result in the formation of polypeptide salts.

Any polypeptide used for therapeutic administration can be sterile. Sterility is easily achieved by filtration through a sterile filtration membrane (eg 0.2 micron membrane). Generally, the therapeutic polypeptide compositions are placed in a container having a sterile access port, for example, an intravenous solution bag or vial with a stopper pierceable by a hypodermic injection needle.

Polypeptides are typically stored in unit-dose or multi-dose containers, such as sealed ampoules or vials, as an aqueous solution or as a lyophilized formulation for reconstitution. As an example of a lyophilized formulation, sterile filtered 1% (
w / v) Charge 5 ml of aqueous polypeptide solution and lyophilize the resulting mixture. The lyophilized polypeptide is reconstituted with bacteriostatic water for injection to prepare an infusion solution.

The invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention. A notice in the form of a government agency that regulates the manufacture, use, or sale of pharmaceuticals or biological products may accompany such containers, which notice may include government notices regarding manufacture, use, or sale for human administration. Indicates approval by the institution. Furthermore, the polypeptides of the present invention may be used in combination with other therapeutic compounds.

Example 11 Methods of Treating Decreased Levels of Polypeptides Conditions caused by a reduction in normal or normal expression levels of a polypeptide in an individual are those in which the polypeptide of the invention is preferably secreted. It is understood that treatment may be by administration and / or in soluble form. Accordingly, the invention also provides a method of treating an individual in need of increased levels of this polypeptide. The method comprises the step of administering to such an individual a pharmaceutical composition comprising an amount of the polypeptide that increases the activity level of the polypeptide in such individual.

For example, a patient with reduced levels of a polypeptide receives the polypeptide at a daily dose of 0.1-100 μg / kg for 6 consecutive days. Preferably the polypeptide is in secreted form. The exact details of the dosing and formulation-based regimen are:
Provided in Example 10.

Example 12 Methods of Treating Elevated Levels of Polypeptides Antisense technology is used to inhibit production of the polypeptides of the invention. This technique uses polypeptides (preferably secretory forms) that result from various etiologies such as cancer.
Is one example of a method of reducing the level of.

For example, in patients diagnosed with abnormally elevated levels of polypeptide, antisense polynucleotides are administered at 0.5, 1.0, 1.5, 2.0 and 3.0 mg.
/ Kg / day for 21 days. If well tolerated, the procedure is repeated after a 7 day washout period. The formulation of this antisense polynucleotide is provided in Example 10.

Example 13 Treatment Methods Using Gene Therapy—Ex Vivo One method of gene therapy involves transplanting fibroblasts capable of expressing a polypeptide into a patient. Fibroblasts are generally obtained from a subject by skin biopsy. The resulting tissue is placed in tissue culture medium and divided into small pieces. A blob of tissue is placed on the wet surface of the tissue culture flask and approximately 10 pieces are placed in each flask. The flask is inverted and tightly closed, then left overnight at room temperature. After 24 hours at room temperature, the flask is inverted, the tissue mass remains fixed at the bottom of the flask, and fresh medium (eg,
Ham's F12 containing 10% FBS, penicillin and streptomycin
Medium) is added. The flask is then incubated at 37 ° C for approximately 1 week.

At this point, fresh medium is added and then replaced every few days. After culturing for another two weeks, a monolayer of fibroblasts appears. Trypsinizing this monolayer,
Scale up to a larger flask.

The Moloney murine sarcoma virus long terminal repeat is flanked by pMV-7 (Kirsc
hmeier, P.M. T. Et al., DNA, 7: 219-25 (1988)).
After digestion with RI and HindIII, it is treated with calf intestinal phosphatase.
The linear vector is fractionated on an agarose gel and purified using glass beads.

The cDNAs encoding the polypeptides of the present invention were prepared as described in Example 1 using primers and with appropriate restriction sites and start / stop codons, respectively, the 5'and 3'terminal sequences, respectively. Can be amplified using PCR primers corresponding to Preferably, the 5'primer contains an EcoRI site and the 3'primer contains a HindIII site. Equal amounts of the Moloney murine sarcoma virus linear backbone and the amplified EcoRI and HindIII fragments are added together in the presence of T4 DNA ligase. The resulting mixture is maintained under suitable conditions for ligating the two fragments. The ligation mixture is then used to transform bacterial HB101. It is then plated on agar containing kanamycin to confirm that the vector has the gene of interest inserted correctly.

Amphotropic pA317 or GP + am12 packaging cells were
Grow to confluent density in tissue culture in Dulbecco's Modified Eagle Medium (DMEM) with 0% Calf Serum (CS), Penicillin and Streptomycin. The MSV vector containing the gene of interest is then added to the medium and the packaging cells are transduced with this vector. At this time, the packaging cells produce infectious viral particles containing the gene (herein, the packaging cells are referred to as producer cells).

Fresh medium is added to the transduced producer cells and this medium is then harvested from 10 cm plates of confluent producer cells. The spent medium containing infectious viral particles is filtered through a Millipore filter to remove detached producer cells and then used to infect fibroblasts. Media is removed from the subconfluent plates of fibroblasts and quickly replaced with media from producer cells. This medium is removed and replaced with fresh medium. If the virus titer is high, virtually all fibroblasts will be infected and no selection is required. If the titer is very low, it is necessary to use a retroviral vector with a selectable marker such as neo or his. Once the fibroblasts are efficiently infected, the fibroblasts are analyzed to determine if the protein is being produced.

The engineered fibroblasts are then transplanted into the host either alone or after being grown to confluence on Cytodex 3 microcarrier beads.

Example 14 Gene Therapy Using the Endogenous TGF-β Receptor Gene Another method of gene therapy according to the present invention is the use of an endogenous TGF-β receptor gene sequence, eg, US Pat. No. 5,641. , 670 (issued June 24, 1997)
International Publication Number WO 96/29411 (published September 26, 1996); International Publication Number WO 94/12650 (published August 4, 1994); Koller et al.
Proc. Natl. Acad. Sci. USA, 86: 8932-8935 (
1989); and Zijlstra et al., Nature, 342: 435-43.
8 (1989), operably linked to the promoter via homologous recombination. The method involves activation of a gene that is present in the target cell but is not expressed in the cell or is expressed at a lower level than desired.

A polynucleotide construct containing a promoter and targeting sequence is made. This target sequence is homologous to the 5'non-coding sequence of the endogenous TGF-β receptor gene, flanked by promoters. The targeting sequence is sufficiently close to the 5'end of the TGF-β receptor gene so that the promoter is operably linked to the endogenous sequence upon homologous recombination. The promoter and targeting sequence can be amplified using PCR. Preferably, the amplified promoter is 5
It contains different restriction enzyme sites on the 'and 3'ends. Preferably, the 3'end of the first targeting sequence contains the same restriction enzyme sites as the 5'end of the amplified promoter, and the 5'end of the second targeting sequence is the 3'end of the amplified promoter. Contains the same restriction sites as.

The amplified promoter and amplified targeting sequence are digested with the appropriate restriction enzymes followed by treatment with calf intestinal phosphatase. The digested promoter and digested targeting sequence are added together in the presence of T4 DNA ligase. The resulting mixture is maintained under conditions suitable for ligation of these two fragments. The construct is size fractionated on an agarose gel, then purified by phenol extraction and ethanol precipitation.

In this example, the polynucleotide construct is administered as a naked polynucleotide via electroporation. However, the polynucleotide construct may also be administered with a transfection facilitating agent such as liposomes, viral sequences, viral particles, precipitating agents and the like. Such methods of delivery are known in the art.

Once the cells are transfected, homologous recombination will occur and the promoter will be operably linked to the endogenous TGF-β receptor gene sequence. This results in expression of the TGF-β receptor in this cell. Expression can be detected by immunological staining or any other method known in the art.

Fibroblasts are obtained from a subject by skin biopsy. The obtained tissue is DMEM +
Place in 10% fetal bovine serum. Exponentially growing or early stationary phase fibroblasts are trypsinized and rinsed from the surface of the plastic with nutrient medium. An aliquot of cell suspension is removed for counting and the remaining cells are subjected to centrifugation. The supernatant is aspirated and the pellet is mixed with 5 ml of electroporation buffer (20 mM HEPES pH 7.3, 137 mM NaCl, 5 mM K).
Cl, 0.7 mM Na ₂ HPO ₄ , 6 mM dextrose). The cells are recentrifuged, the supernatant aspirated, and the cells resuspended in electroporation buffer containing 1 mg / ml acetylated bovine serum albumin. This final cell suspension contains approximately 3 × 10 ⁶ cells / ml. Electroporation should be performed immediately after resuspension.

Plasmid DNA is prepared according to standard techniques. For example, to construct a plasmid for targeting the TGF-β receptor locus, plasmid p
UC18 (MBI Fermentas, Amherst, NY) to HindI
Digest with II. The CMV promoter is amplified by PCR with an XbaI site at the 5'end and a BamHI site at the 3'end. Two TGF-β receptor non-coding gene sequences are amplified via PCR: one TGF-β receptor non-coding sequence (TGF-β receptor fragment 1) is Hind at the 5'end.
Amplify with a III site and an Xba site at the 3'end; the other TGF-β receptor non-coding sequence (TGF-β receptor fragment 2) with a BamHI site at the 5'end and a HindIII site at the 3'end. Amplify. This C
The MV promoter and TGF-β receptor fragment are linked to the appropriate enzyme (C
MV promoter-XbaI and BamHI; TGF-β receptor fragment 1-XbaI; TGF-β receptor fragment 2-BamHI) and ligated together. The resulting ligation product is digested with HindIII and ligated with the HindIII digested pUC18 plasmid.

Plasmid DNA was added to a sterile cuvette (B
io-Rad). Final DNA concentration is generally at least 120μ
g / ml. Then 0.5 ml of the cell suspension (containing approximately 1.5 × 10 ⁶ cells) is added to the cuvette and the cell suspension and DNA solution are gently mixed. Electroporation is performed using a Gene-Pulser instrument (Bio-Rad). The capacitance and voltage are set to 960 μF and 250-300 V, respectively. Increasing the voltage reduces cell survival, but dramatically increases the proportion of viable cells that stably integrate the introduced DNA into their genome. Given these parameters, the pulse time is about 14-2
0 mSec should be observed.

The electroporated cells are maintained at room temperature for approximately 5 minutes, then the contents of the cuvette are gently removed using a sterile transfer pipette. The cells were placed in a 10 cm dish containing pre-warmed nutrient medium (D containing 15% bovine serum).
MEM) 10 ml directly and incubate at 37 ° C. The next day, the medium was aspirated and replaced with 10 ml of fresh medium and an additional 16-24
Incubate for hours.

The engineered fibroblasts are then injected into the host, either alone or after being grown to confluence on cytodex 3 microcarrier beads. To do. here,
The fibroblasts produce the protein product. The fibroblasts can then be introduced into a patient as described above.

Example 15 Treatment Methods Using Gene Therapy-In Vivo Another aspect of the invention is the use of in vivo gene therapy methods to treat disorders, diseases and conditions. This gene therapy method is used to increase or decrease the expression of TGF-β receptor polypeptide in the naked nucleic acid (DNA) of an animal.
, RNA, and antisense DNA or RNA) TGF-β receptor sequences. The TGF-β receptor polynucleotide may be operably linked to a promoter, or any other genetic element required for expression of the TGF-β receptor polypeptide by the target tissue. Techniques and methods for such gene therapy and delivery are known in the art, eg, WO 90/1109.
2, WO98 / 11779; US Pat. Nos. 5,693,622 and 5,705,151.
No. 5,580,859; Tabata et al., Cardiovasc. Res.
35 (3): 470-479 (1997); Chao et al., Pharmacol.
Res. 35 (6): 517-522 (1997); Wolff, Neurom.
uscul. Disord. 7 (5): 314-318 (1997), Schw.
artz et al., Gene Ther. 3 (5): 405-411 (1996);
Tsurumi Y et al., Circulation 94 (12): 3281-3.
290 (1996), incorporated herein by reference.

TGF-β receptor polynucleotide constructs are injected into the interstitial space of any method that delivers injectable substances to cells of an animal, such as tissue (heart, muscle, skin, lung, liver, intestine, etc.). ). The TGF-β receptor polynucleotide construct can be delivered in a pharmaceutically acceptable liquid or aqueous carrier.

The term “naked” polynucleotide, DNA or RNA refers to any delivery vehicle (viral sequence, viral particle, liposome formulation, lipofectin, or (Including a precipitating agent) is not included. However, TGF-β receptor polynucleotides can also be prepared in liposomal formulations (eg, Fe) by methods well known to those of skill in the art.
lgner et al. (1995) Ann. NY Acad. Sci. 772: 126-
139 (1995) and Abdallah et al. Biol. Cell 85 (1)
: 1-7 (1995)).

The TGF-β receptor polynucleotide vector construct used in this gene therapy method is preferably one that does not integrate into the host genome and does not contain sequences that allow replication. Any strong promoter known to those of skill in the art
It can be used to drive the expression of DNA. Unlike other gene therapy technologies,
One major advantage of introducing a naked nucleic acid sequence into a target cell is the transient nature of polynucleotide synthesis in that cell. Studies have shown that non-replicating DNA sequences can be introduced into cells to provide for the production of desired polypeptides for periods of up to 6 months.

This polynucleotide construct is used to determine the tissue (muscle, skin, brain, lung, liver,
(Including spleen, bone marrow, thymus, heart, lymph, blood, bone, cartilage, pancreas, kidney, gallbladder, stomach, intestine, testis, ovary, uterus, rectum, nervous system, eye, gland, and connective tissue) It can be delivered to the space. The interstitial spaces of this tissue are intercellular fluids, mucopolysaccharide substrates (between reticulum fibers of organ tissue, elastic fibers in the walls of blood vessels or chambers, collagen fibers of fibrous tissue), or connective tissue sheaths. Includes the same matrix within natural muscle cells or in the hiatus of bone. This is likewise the space occupied by circulating plasma and lymphatic fluid of the lymphatic channels. Delivery of muscle tissue to the interstitial space is preferred for the reasons discussed below. They can be conveniently delivered by injection into the tissue containing these cells. They are preferably delivered to and expressed in differentiated, persistent, non-dividing cells, which delivery and expression can be effected on undifferentiated cells or cells that are not fully differentiated (eg, blood stem cells). Or skin fibroblasts). In vivo, muscle cells are particularly competent for their ability to take up and express polynucleotides.

For injection of naked TGF-β receptor polynucleotides, DNA or RN
Effective dosages of A range from about 0.05 g / kg body weight to about 50 mg / kg body weight. Preferably, this dosage is from about 0.005 mg / kg to about 20 mg / k.
g, and more preferably about 0.05 mg / kg to about 5 mg / kg. Of course, as the skilled artisan will appreciate, this dosage will vary according to the tissue site of injection. Suitable and effective dosages of nucleic acid sequences can be readily determined by those of ordinary skill in the art and may depend on the condition being treated and the route of administration. The preferred route of administration is by the parenteral route of injection into the interstitial space of tissues. However, other parenteral routes may also be used, including, for example, inhalation of aerosol formulations, especially for delivery to the lungs or bronchial tissues, throat, or mucous membranes of the nose. In addition, the naked TGF-β receptor polynucleotide construct can be delivered to the artery during angioplasty by the catheter used in this procedure.

The dose response effect of infused TGF-β receptor polynucleotide in muscle in vivo is determined as follows. Appropriate TGF-β receptor template DNA for the production of mRNA encoding TGF-β receptor polypeptide,
Prepared according to standard recombinant DNA methodology. TGF-β receptor template DN
Either A, which can be either circular or linear, is used as naked DNA or is complexed with liposomes. The mouse quadriceps is then injected with varying amounts of template DNA.

To 5-6 week old female and male Balb / C mice, 0.3 ml of 2.5%
Anesthetize by intraperitoneal injection of Avertin. A 1.5 cm incision is made in the anterior thigh and the quadriceps are visualized directly. TGF-β receptor template DNA
In a 0.1 ml carrier and with a 1 cc syringe through a 27 gauge needle for 1 minute, at the knee about 0.5 cm from the distal insertion site of the muscle, about 0.2.
Inject at a depth of cm. Suture is performed over the injection site for future localization,
Then close the skin with a stainless steel clip.

After a suitable incubation time (eg 7 days), muscle extracts are prepared by cutting out whole quads. A 15 μm section of every five quadriceps muscles was
Histochemical staining for GF-β receptor protein expression. TGF-β
The time course for receptor protein expression can be done in a similar fashion, except that four animals from different mice are harvested at different times. The persistence of TGF-β receptor DNA in muscle after injection can be determined by Southern blot analysis after preparing total cellular DNA and HIRT supernatants from injected and control mice. The results of the above experiments in mice can be used to extrapolate appropriate dosages and other treatment parameters in humans and other animals using naked TGF-β receptor DNA.

Example 16: Production of Antibodies ((a) Hybridoma Technology) The antibodies of the invention can be prepared by a variety of methods. (Current Pr
otocols, Chapter 2). As an example of such a method, T
Cells expressing the GF-β receptor polypeptide are administered to the animal to induce the production of serum containing polyclonal antibodies. In a preferred method, TGF
A -β receptor polypeptide preparation is prepared and purified to be substantially free of natural contaminants. Such preparations are then introduced into animals to produce greater specific activity of polyclonal antisera.

Monoclonal antibodies specific for TGF-β receptor polypeptides are prepared using hybridoma technology (Kohler et al., Nature 256:
495 (1975); Kohler et al., Eur. J. Immunol. 6:51
1 (1976); Kohler et al., Eur. J. Immunol. 6: 292 (
1976); Hammerling et al .: Monoclonal Antibod.
ies and T-Cell Hybridomas, Elsevier, N
． Y. , Pp. 563-681 (1981)). Generally, animals (preferably mice)
Is a TGF-β receptor polypeptide, or more preferably secreted TGF-.
Immunize with β-receptor polypeptide expressing cells. Such polypeptide expressing cells are cultivated in any suitable tissue culture medium; preferably supplemented with 10% fetal bovine serum (inactivated at about 56 ° C.) and containing about 10 g / l of non-essential amino acids. , Earle modified Eagle medium supplemented with about 1,000 U / ml penicillin, and about 100 μg / ml streptomycin.

The splenocytes of such mice are extracted and fused with a suitable myeloma cell line. Any suitable myeloma cell line may be used in accordance with the present invention; however, AT
It is preferred to use the parental myeloma cell line (SP2O) available from CC. After fusion, the resulting hybridoma cells were selectively maintained in HAT medium and then Wands et al. (Gastroenterology 80: 225-232 (
Cloning by limiting dilution as described by 1981)). The hybridoma cells obtained through such selection are then assayed to identify clones secreting antibodies capable of binding the TGF-β receptor polypeptide.

Alternatively, an additional antibody capable of binding to the TGF-β receptor polypeptide is
Anti-idiotype antibodies may be used to generate in a two step process procedure. Such a method takes advantage of the fact that the antibody itself is the antigen and therefore it is possible to obtain an antibody that binds to the second antibody. According to this method, protein-specific antibodies are used to immunize animals, preferably mice. The splenocytes of such animals are then used to produce hybridoma cells. The hybridoma cells are then screened to identify clones that produce antibodies whose ability to bind to a TGF-β receptor protein-specific antibody can be blocked by the TGF-β receptor polypeptide. Such an antibody is TG
It contains anti-idiotypic antibodies against antibodies specific for the F-β receptor protein and is used to immunize animals to induce the formation of additional TGF-β receptor protein-specific antibodies.

For in vivo use of antibodies in humans, the antibody is "humanized." Such antibodies can be produced by using genetic constructs derived from hybridoma cells which produce the monoclonal antibodies described above. Methods for producing chimeric and humanized antibodies are known in the art and discussed herein. (For review, see Morrison, Science 229: 1.
202 (1985); Oi et al., BioTechniques 4: 214 (19).
86); Cabilly et al., U.S. Pat. No. 4,816,567; Taniguc.
hi et al., EP 171496; Morrison et al., EP 173494; Ne.
Uberger et al., WO 8601533; Robinson et al., WO 870.
2671; Boulianne et al., Nature 312: 643 (1984).
See Neuberger et al., Nature 314: 268 (1985)).

(B) Isolation of Antibody Fragments Directed against TGF-β Receptor Polypeptides from a Library of scFvs The naturally occurring V gene isolated from human PBL can be exposed to donors. To a library of antibody fragments containing reactivity to TGF-β receptor polypeptides that were or were not exposed (eg, US Pat. No. 5,885,5).
No. 793 (incorporated herein by reference in its entirety).

Library Rescue ScFvs libraries are constructed from human PBL RNA as described in PCT Publication WO 92/01047. To rescue the phage displaying the antibody fragment, about 10 ⁹ E. coli carrying the phagemid were rescued. 50 ml of 2xTY (containing 1% glucose and 100 μg / ml ampicillin) (2xTY-AMP-GLU) with E. coli and 0 with shaking.
． 8 of O. D. Grow to. Using 5 ml of this culture, 50 ml of 2xT
Y-AMP-GLU was inoculated and 2 × 10 8 TU of Δ gene 3 helper (M13Δ
Gene III, see PCT Publication WO92 / 01047) and the cultures are incubated at 37 ° C. for 45 minutes without shaking and then at 37 ° C. for 45 minutes with shaking. This culture was incubated for 10 minutes at 4000 rpm. p.
m. Centrifuge at 2 ° C. and pellet 2 liters of 2 × TY (100 μg / ml
Reconstitute in ampicillin and 50 μg / ml kanamycin) and grow overnight. Phages are prepared as described in PCT Publication WO 92/01047.

M13Δ gene III is prepared as follows: M13Δ gene III helper phage does not encode gene III protein. Therefore, phage displaying the antibody fragment (phagemid) have greater binding avidity for the antigen. During phage morphogenesis, infectious M13Δ gene III particles are made by growing helper phage in cells carrying the pUC19 derivative that supplies the wild-type gene III protein. The culture was incubated at 37 ° C. for 1 hour without shaking, then 3 with shaking.
Incubate at 7 ° C for an additional hour. Centrifuge the cells (IEC-Center)
a 8,400 r. p. m. 10 min / min) and 2 x TY broth (2 x TY) containing 100 μg / ml ampicillin and 25 μg / ml kanamycin.
-AMP-KAN) in 300 ml and grown overnight at 37 ° C with shaking. The phage particles were subjected to two PEG precipitations (Sambrook et al., 199).
0) purified and concentrated from the culture medium, resuspended in 2 ml PBS and 0.45 μm filter (Minisart NML; Sartorius).
And a final concentration of approximately 1013 transducing units / ml (ampicillin resistant clones) is obtained.

(Paning of Library) Immunotubes (Nunc) were treated with 100 μg of the polypeptide of the present invention.
Coat overnight in PBS with 4 ml of either 10 μg / ml or 10 μg / ml. Tubes were blocked with 2% Marvel-PBS for 2 hours at 37 ° C,
Then wash 3 times in PBS. Approximately 1013 TU of phage are applied to the tubes and incubated for 30 minutes at room temperature with tumbling up and down on a turntable, then allowed to stand for another 1.5 hours. Tube with PBS 0.1% Twe
Wash 10 times with en-20 and 10 times with PBS. The phage were eluted by adding 1 ml of 100 mM triethylamine and spinning up and down for 15 minutes on a rotating disc, then adding 0.5 ml of 1.0 M Tris-HCl to the solution.
, Neutralize immediately with pH 7.4. The eluted phage was then incubated with the bacteria 37
Phage was used to incubate 10 ml of mid-log phase E. E. coli TG1. Then E. 1% of coli
Plate on TYE plates containing glucose and 100 μg / ml ampicillin. The resulting bacterial library is then loaded with Δ gene 3 as described above.
Rescue with helper phage and prepare the phage for the next round of selection.
This process was then repeated for all four rounds of affinity purification, the third and fourth round of tube washing with PBS, 0.1% Tween-20, 20x,
And it increases 20 times with PBS.

Characterization of Binders Phage eluted from the third and fourth rounds of selection were used to transform E. coli. coli
Infect HB2151 and generate soluble scFv from a single colony for assay (Marks et al., 1991). 50 mM bicarbonate, pH 9.
The ELISA is performed with microtiter plates coated with either 10 pg / ml of the polypeptide of the invention in 6. Positive clones in the ELISA are further characterized by PCR fingerprinting (see, eg, PCT Publication WO92 / 01047) followed by sequencing. These ELI
SA positive clones can also be cloned using techniques known in the art (eg, epitope mapping, binding affinity, receptor signal transduction, ability to block or competitively inhibit antibody / antigen binding, and competitive agonist activity or competition). Further antagonistic activity).

Example 17: Production of Chimeric TGF-β Receptor Protein Receptor A chimeric receptor was prepared according to the protocol of Luo et al. For nucleotides encoding the transmembrane and intracellular domains of the TGF-β receptor protein of the invention. Produced by fusing nucleotides encoding the extracellular domain of the receptor of interest (Luo, K., et al., EMBO Journal.
, 15: 4485-96 (1996), which is incorporated herein by reference in its entirety). Alternatively, the chimeric receptor may be produced using the extracellular domain of the TGF-β receptor protein of the invention fused to the transmembrane and intracellular domains of the receptor of interest so that TGF-to the chimeric receptor is produced. β
Binding can be detected. Obviously, many combinations of domains from heterologous transmembrane receptor proteins can be fused using methods known in the art to produce chimeric receptor proteins.

The resulting DNA encoding the chimeric receptor can be expressed in a suitable mammalian, baculovirus, viral or bacterial expression vector (eg, pC4 discussed above).
, PCDNA3, or pA2). Mammalian host cells that can be used to express the chimeric receptor include the pre-B cell line BaF3.

Example 18: Chimeric EpoR / TGF at the plasma membrane by measuring Epo binding
-Detection of Expression of β-Receptor Proteins) Detection of expression of TGF-β chimeric receptors is described by Beutler et al., US Pat. No. 5,925,548, herein incorporated by reference in its entirety. Can be achieved using the detection assay described. Briefly, a radiolabeled ( ¹²⁵ I) ligand is obtained that binds to the extracellular domain of the chimeric receptor of interest. 2 × 10 ⁶ COS cells are seeded on a 10 cm plate and quiagen
Using 20 μg of total DNA purified by technique, CaP
Transfect according to the O ₄ method (Chen and Okayama, 1987). Transfections are done in duplicate plates from which cells are pooled for 12 hours. The cells are then distributed in triplicate wells of a 6-well plate at a density of 1 × 10 ⁶ per well. After attachment to the plastic for 5 hours, the cells are 2%
Serum and 2% antibiotic mixture (pen / strep / GIBCO), 25 mM
HEPES buffer and 0.525 pM iodide Epo (415 nCi / ml
Incubate on ice in 1 ml of medium containing Incubation is continued for 2 hours (on ice) with occasional gentle agitation by hand. 3 ml ice-cold PBS (containing 1 mM EDTA) is then added to each well. Cells are harvested, pelleted by grinding, transferred to Eppendorf tubes and washed once more with PBS / EDTA solution (all procedures are done on ice). The cell pellet is then counted for bound radioactivity.

Example 19: In Vitro Kinase Assay The following assay was performed according to Luo, K et al., EMBO Journal, 15: 448.
5-96 (1996) based on the in vitro kinase assay, which is incorporated herein by reference in its entirety, designed to detect the signaling activity of the TGF-β receptor polypeptides of the invention. . More specifically, TGF-
Approximately 3 × 10 ⁸ Ba / F3 cells expressing β-chimeric receptor, or other suitable cell line (where the chimeric vector comprises the intracellular domain of the TGF-β receptor of the invention) are washed and Fresh medium (RPMI medium supplemented with 10% fetal bovine serum (FBS), with or without different amounts of ligand or activating antibody,
And 10% WEHI-3 cell conditioned medium) for 10 minutes at room temperature and NP-40 lysis buffer (1% NP-40, 50 mM Tris, pH 7.5, 1).
Dissolve in 50 mM NaCl, 2 mM EDTA, 50 mM NaF, 10 μg / ml aprotinin and 2 mM phenylmethylsulfonyl fluoride (PMSF)). The TGF-β chimeric receptor is isolated by immunoprecipitation using an antibody against the cytoplasmic domain of the TGF-β receptor. In vitro phosphorylation using chimeric receptor immunoprecipitates was performed with 10 μCi [γ- ³² P] ATP.
(3000 Ci / nmol) in the presence of (3000 Ci / nmol) at 30 ° C. for 10 minutes in 20 μl of kinase buffer (50 mM Tris, pH 7.5, 10 mM MgCl ₂ ).
The reaction is terminated by the addition of 5 mM EDTA and the immune complex is eluted from the beads by boiling. The labeled chimeric receptor is then re-immunoprecipitated with an antibody against the extracellular domain of the TGF-β chimeric receptor. Phosphorylation is observed by SDS-PAGE and autoradiography. The extracellular portion of the TFG-β chimeric receptor can be derived from any suitable receptor known in the art.

Example 20: Identification of TGF-β Receptor Protein-Interacting Proteins TGF-β polypeptides of the present invention interact with Smad proteins or TGF-β receptor proteins (eg, TβR-I, other proteins). Signal transduction pathway protein) is a research tool for identification, characterization and purification. Briefly, labeled TGF-β receptor protein is useful as a reagent for purification of interacting molecules. In one embodiment of affinity purification, membrane bound TG
The F-β receptor protein is covalently attached to the chromatography column. Cell-free extracts from putative target cells (eg, colon cancer cells) pass through the column, and molecules with the appropriate affinity bind to the TGF-β receptor protein. Collecting the TGF-β receptor protein complex from the column, separating and
And the molecule to be subjected to N-terminal protein sequencing is recovered. The amino acid sequence is then used to identify captured molecules or to design the construction of oligonucleotide probes for cloning relevant genes from the appropriate cDNA library.

Example 21: Kinase Assays for Receptor Protein-Interacting Proteins To determine which candidate TGF-β receptor protein-interacting proteins could be directly involved in signal transduction, described by Hirai et al. A modified kinase assay as described above may be performed (Hirai, S. et al., J. Biol. C.
hem, 272: 15167-73 (1997), incorporated herein by reference in its entirety). Briefly, the isolated TGF-β receptor protein of the invention was immobilized on 2 μl of protein G-Sepharose and 20 μl
Assay mixture (20 mM HEPES, pH 7.5, 15 mM MgCl2
, 15 mM glycerophosphate, 0.1 mM Na3VO4, 2 mM dithiothreitol, 25 μM ATP, 5 μCi [−32P] ATP, and 1 μg of each candidate TGF-β receptor protein-interacting protein) and appropriate controls. Suspended. Kinase reaction is performed at 30 ° C. for 20 minutes,
Then stop by the addition of 25 μl of SDS sample buffer. Phosphorylation of each candidate receptor protein-interacting protein is detected by SDS-PAGAE and autoradiography, and ³² P uptake by the candidate receptor protein-interacting protein is indicated by phosphorylation of the TGF-β receptor protein.

The TGF-β receptors of the present invention are described in US provisional application Nos. 60 / 133,239; 60 / 135,163; 60 / 147,005; 60/152,
935; and 60 / 162,979, which are incorporated herein by reference in their entirety. It will be apparent that the present invention may be practiced other than as described in detail in the foregoing description and examples. Many modifications and variations of the present invention are possible in light of the above teachings, and are therefore within the scope of the appended claims. Full disclosure of each document cited in the background of the invention, detailed description and examples, including patents, patent applications, academic literature, abstracts, laboratory manuals, books or other disclosures.
Are incorporated herein by reference. Further, both the hard copy of the sequence listing and the corresponding computer readable form, submitted herewith, are hereby incorporated by reference in their entireties.

[0742]

[Table 8] ATCC Deposit No. PTA-539 Page 2 (Canada) The applicant is the Commissioner of the Patent Office until a Canadian patent is issued under the application, or the application is refused or abandoned and cannot be recovered or withdrawn. (Commissioner of Patents) requested that only the independent expert nominated by the Commissioner grant the donated sample of the deposited biological material referred to in the application, the applicant Before the regulatory preparations for publication of an application are completed, the International Bureau must be notified in writing.

(Norway) Applicants hereby agree that the application of samples shall be made by the Norwegian Patent Office until the application has been published (by the Norwegian Patent Office) or has been decided by the Norwegian Patent Office without publication. Claim that it will only be done to the house. A request to this effect shall be made by the applicant to the Norwegian Patent Office before the time when the application is made publicly available under section 22 and section 33 (3) of the Norwegian Patent Act. If such a claim is made by the applicant, any claim for the provision of the sample by a third party shall indicate the expert used. The expert is a list of certified experts prepared by the Norwegian Patent Office (list of
any of those listed in "recognized experts", or
It can be any person approved by the applicant in the individual case.

(Australia) Applicant hereby states that donation of a sample of microorganisms prior to the grant of a patent
Alternatively, before the abandonment, rejection or withdrawal of the application, a person who is a person skilled in the art who has no interest in the invention (skilled addre)
It is to be announced that it will only be performed for Ssee) (Australian Patent Law No. 3.25 (3)).

(Finland) The applicant hereby states that the application is (Patent and Control Committee (National
That samples will only be provided to experts in the art until published (by Board of Patents and Regulations) or until a decision by the National Patent and Legal Commission is made without publication. ,Claim.

(UK) Applicant hereby claims that the provision of a sample of microorganisms is made available only to professionals. A request to this effect must be made by the applicant to the International Bureau before the regulatory preparations for the international publication of the application are complete.

ATCC Deposit No. PTA-72 page 3 (Denmark) The applicant hereby states that until the application has been published (by the Danish Patent Office) or has not been published and has been decided by the Danish Patent Office. We claim that the samples will only be provided to experts in the art. A request to this effect shall be filed by the applicant with the Danish Patent Office before the time when the application is made publicly available under Articles 22 and 33 (3) of the Danish Patent Act. If such a claim is made by the applicant, any claim for the provision of the sample by a third party shall indicate the expert used. The expert is a list of certified experts prepared by the Danish Patent Office (list of).
any of those listed in "recognized experts", or
It can be any person approved by the applicant in the individual case.

(Sweden) Applicants hereby advise that the application of a sample shall be prioritized in the art until the application has been published (by the Swedish Patent Office) or has been decided by the Swedish Patent Office without publication. Claim that it will only be done to the house. A request to this effect shall be filed by the applicant with the International Bureau not later than 16 months from the priority date (preferably PCT Applicant's Gui).
Form PCT / RO / 13 described in Annex Z of Volume I of de
4). If such a claim is made by the applicant, any claim for the provision of the sample by a third party shall indicate the expert used. The expert is a list of certified experts (lis) prepared by the Swedish Patent Office.
any of the persons listed in to of recognized experts),
Alternatively, it may be any person approved by the applicant in the individual case.

(Netherlands) Applicants hereby agree that until the issue date of the Dutch patent, or until the date when the application is rejected, withdrawn or lapped, microorganisms are specialized under the provisions of Patent Act 31F (1). Claim that it will only be done in the form of sample delivery to the house. A request for this shall be made by the applicant before the Dutch industrial property right before the date on which the application is made publicly available under Article 22C or Article 25 of the Dutch Patent Act, whichever is earlier. It shall be submitted to the Bureau.

[Sequence list]

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁷ Identification code FI theme code (reference) A61P 13/12 A61P 21/00 4C084 15/00 25/00 4C085 21/00 35/00 4C087 25/00 37 / 00 4H045 35/00 C07K 14/71 37/00 16/28 C07K 14/71 C12N 1/15 16/28 1/19 C12N 1/15 1/21 1/19 C12P 21/02 C 1/21 C12Q 1 / 68 A 5/10 G01N 33/15 Z C12P 21/02 33/50 Z C12Q 1/68 33/53 D G01N 33/15 33/566 33/50 A61K 35/76 33/53 39/395 N 33 / 566 C12N 15/00 ZNAA // A61K 35/76 5/00 A 39/395 A61K 37/02 (81) Designated countries EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), OA ( F, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, MZ, SD, SL, SZ, TZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AE, AG, AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, BZ, CA, CH, CN, CR, CU, CZ, DE, DK, DM, DZ, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL , IN, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MA, MD, MG, MK, MN, MW, MX, MZ, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM TR, TT, TZ, UA, UG, US, UZ, VN, YU, ZA, ZW (72) inventor Ruben, Stephen M.. United States Maryland 20832, Ornay, Heritage Hills Drive 18528 (72) Inventor Ni, Gian United States Maryland 20853, Rockville, Manor Field Road 5502 F Term (reference) 2G045 AA34 AA35 BB10 BB14 BB20 BB29 BB46 BB51 CB01 DA13 DA36 FB02 FB03 FB08 4B024 AA01 AA11 BA61 BA63 CA01 CA11 GA11 HA12 4B063 QA19 QQ02 QQ42 QQ79 QQ96 QR32 QR48 QR55 QS33 QS34 QX01 4B064 AG20 AG27 CA19 CC24 DA01 DA13 4B065 AA93Y AB01 AC14 BA02 CA24 CA25 CA44 CA46 4C084 AA01 AA02 AA03 AA06 AA07 AA13 BA01 BA02 CA53 NA14 ZA022 ZA362 ZA592 ZA662 ZA812 ZA942 ZB072 ZB082 ZB092 ZB262 4C085 AA13 AA14 4C087 AA01 AA02 AA03 BC83 CA12 NA14 ZA02 ZA36 ZA59 ZA66 ZA81 CA50 DA76 A50 FA40 A40 A40A40 A10

Claims (21)

[Claims] 1. An isolated nucleic acid molecule comprising: (a) a polynucleotide set forth in SEQ ID NO: X, or a polynucleotide encoded by the cDNA contained in ATCC Deposit No. Z; (b) SEQ ID NO: Biologically active polypeptide fragment of Y, or AT
A polynucleotide encoding a biologically active polypeptide fragment encoded by the cDNA sequence contained in CC Accession No. Z; (c) the polypeptide epitope of SEQ ID NO: Y, or the cDNA sequence contained in ATCC Accession No. Z A polynucleotide encoding a polypeptide epitope encoded by: (d) a polynucleotide capable of hybridizing to any one of the polynucleotides specified in (a) to (c) under stringent conditions. Wherein the polynucleotide comprises a polynucleotide selected from the group consisting of: a polynucleotide that does not hybridize under stringent conditions to a nucleic acid molecule having a nucleotide sequence with only A residues or only T residues. , An isolated nucleic acid molecule. 2. The isolated nucleic acid molecule of claim 1, wherein the polynucleotide comprises a nucleotide sequence that encodes a soluble polypeptide. 3. The polynucleotide, wherein the polynucleotide encodes a sequence identified as SEQ ID NO: Y, or a cDNA contained in ATCC Accession No.Z.
A nucleotide sequence encoding a polypeptide encoded by the sequence,
An isolated nucleic acid molecule according to claim 1. 4. The isolated nucleic acid molecule of claim 1, wherein the polynucleotide comprises the entire nucleotide sequence of SEQ ID NO: X, or the cDNA contained in ATCC Deposit No.Z. 5. The isolated nucleic acid molecule of claim 2, wherein the polynucleotide is DNA. 6. The isolated nucleic acid molecule of claim 3, wherein the polynucleotide is RNA. 7. A vector comprising the isolated nucleic acid molecule of claim 1. 8. A host cell containing the vector of claim 7. 9. A recombinant host cell comprising the nucleic acid molecule of claim 1 operably linked to a heterologous regulatory element that controls gene expression. 10. A method for producing a polypeptide, which comprises a step of expressing the encoded polypeptide from the host cell according to claim 9 and a step of recovering the polypeptide. 11. An isolated polypeptide, which is: (a) a polypeptide represented by SEQ ID NO: Y, or a polypeptide encoded by a cDNA; (b) a polypeptide fragment of SEQ ID NO :, or at least 95 in the sequence selected from the group consisting of: (c) a polypeptide epitope of SEQ ID NO: or a polypeptide encoded by cDNA; and (d) a variant of SEQ ID NO: % Containing amino acid sequences,
Isolated polypeptide. 12. The isolated polypeptide of claim 11, which comprises a polypeptide having SEQ ID NO: Y. 13. An isolated antibody that specifically binds to the isolated polypeptide of claim 11. 14. Expressing the isolated polypeptide of claim 11.
Recombinant host cell. 15. A method for producing an isolated polypeptide, comprising: (a) culturing the recombinant host cell of claim 14 under conditions such that the polypeptide is expressed. A step; and (b) recovering the polypeptide. 16. A polypeptide produced by the method of claim 15. 17. A method of preventing, treating or alleviating a medical condition, comprising:
13. A method comprising administering to a mammalian subject a therapeutically effective amount of the polypeptide of claim 11 or the polynucleotide of claim 1. 18. A method for diagnosing a pathological condition or susceptibility to a pathological condition in a subject, comprising: (a) determining the presence or absence of a mutation in the polynucleotide of claim 1. And (b) diagnosing a pathological condition, or susceptibility to a pathological condition, based on the presence or absence of the mutation. 19. A method of diagnosing a pathological condition or susceptibility to a pathological condition in a subject, comprising: (a) the presence of expression of the polypeptide of claim 11 in a biological sample. Or a step of determining the amount; and (b) diagnosing a pathological condition or susceptibility to the pathological condition based on the presence or amount of expression of the polypeptide. 20. A method of identifying a binding partner for the polypeptide of claim 11, comprising: (a) contacting the polypeptide of claim 11 with a binding partner;
And (b) determining whether the binding partner results in the activity of the polypeptide. 21. A method of screening for a molecule that modifies the activity of the polypeptide of claim 11, comprising: (a) contacting the polypeptide with a compound suspected of having agonistic or antagonistic activity. And (a) assaying the activity of the polypeptide.