JP2003505035A - Diagnosis method - Google Patents

Abstract

  (57) [Summary] The present invention provides a method of detecting cancer in a subject by detecting altered genomic imprinting, and the long-term prognosis of a subject diagnosed with cancer using a difference in methylation status of a specific nucleotide sequence for estimating long-term prognosis. And a method for measuring.

Description

Detailed Description of the Invention

The present invention relates to a diagnostic method, a nucleotide sequence containing a Wilms tumor suppressor gene (WT1) antisense control region, and a method for disease detection and prognosis based on the methylation status of the control region.

Wilms tumor (WT) is a childhood embryonal kidney tumor that results from malignant transformation of renal stem cells. WT occurs in about 1 in 10,000 children, making it one of the most common pediatric solid tumors.

The human WT1 gene is located on chromosome 11p13 (Call et al., Cell 60, 5
09-520 (1990); Gessler et al., Nature 343,
774-778 (1990); Call et al., U.S. Pat. No. 5,350,8.
No. 40 (1994)) and is organized in the genome as 10 exons that span a 60 kilobase chromosomal region. Intragenic deletions and mutations of the tumor suppressor gene WT1 were detected in approximately 10% of Wilms tumors.

During nephrogenesis, or kidney development, WT1 gene expression is regulated in a very specific manner, increasing as metanephric mesenchymal cells progress to immature epithelial cells, and cells become more It decreases phenotypically as it matures. The inverse proportion between WT1 expression and differentiation status of human leukemia cells, along with evidence of expression in ovary and testis, and notochord and brain, indicates that WT1 gene product function is crucial for proliferation and / or differentiation in diverse cell types. It strongly suggests that The WT1 protein, which contains four zinc fingers, is expressed as four isoforms resulting from two alternative splicing sites (I and II) in the gene.
Splicing II occurs within the zinc finger domain, thereby inserting or deleting the three amino acids (KTS) between zinc fingers 3 and 4.
The WT1 protein without the KTS amino acid (WT1-KTS) specifically binds to the EGR site consensus sequence (5′-GCGGGGGGCG-3 ′), whereas
The WT1 protein with S (WT1 + KTS) does not bind. Insulin-like growth factor type II (IGF-II), platelet-derived growth factor A (PDGF-A), colony stimulating factor-1 (CSF-1), and epidermal growth factor receptor (EGF-
R) -like genes in the promoter region of early growth response genes (EGR)
By binding to the mold site, WT1 acts as a transcriptional repressor (Hastie, Ann. Rev. Genet 28, 523-558 (19).
1994), and Menke et al., Int. Rev. Cytol. 181, 15
1-212 (1998)).

The human WT1 promoter region has been characterized and has been shown to belong to a family of GC-rich promoters lacking TATA sequences with multiple responsive sites for the transcription factor Sp1, lacking CCAAT sequences. The EGR / WT1 consensus sequence was also identified upstream and downstream of the major transcription start site (Hofmann.
Et al., Oncogene 8, 3123-3132 (1993)), suggesting that these sites may cause WT1 autorepression was confirmed using a transient transfection assay with a human promoter ( Malik et al., FEBS
Letters 349, 75-78 (1994)).

Diseases characterized by renal and genital abnormalities along with a predisposition to Wilms tumor (Copes et al., FASEB J. 7, 886-895 (
1993)), WT1 function is normal to the urogenital system as demonstrated by WAGR (Wilm's tumor, aniridia, genitourinary disorders and mental retardation) syndrome and Dennis-Drash syndrome (DDS). Important for development.

There is accumulating evidence for the involvement of WT1 in the differentiation of non-renal tissues. A role in hematopoiesis has been demonstrated by HL60 cells (Sekiya et al., Blood 83).
Vol. 1876-1882 (1994)) and K562 cells (Phelan).
Et al., Cell Growth Differ. Volume 5, pp. 677-686 (199
4 years)) is suggested by down-regulation of WT1 expression during chemically induced differentiation. Normal hematopoietic progenitor cells (Inoue et al., Blood 89:
1405-1412 (1997)), increased WT1 expression in leukemia cells, and WT1 mutations detected in leukemia (King-Underwood).
d et al., Blood 87, 2171-2179 (1996); King-
Underwood and Pritchard-Jones, Blood 91.
Vol. 2961-2968 (1998)), leukocyte formation is associated with WT1.
Strongly indicate that the gene is involved. Altered WT1 expression was also shown in breast cancer (Silberstein et al., Proc. Natl. Acad. Sci. US).
A 94, 8132-8137 (1997)).

Furthermore, an antisense WT that does not have an apparent open reading frame
1 mRNA transcripts were detected in fetal kidney and WT, suggesting a regulatory role for these mRNAs (Campbell et al., Oncog.
ene 9, 583-595 (1994); Eccler et al., Oncog.
ene 9, 2059-2063 (1994)). One such function of these mRNAs is the formation of RNA heteroduplexes with the sense WT1 mRNA, which may regulate a limited level of cellular WT1 protein. Previously, we found that antisense W located in intron 1 activated by WT1.
The identification of the T1 promoter was reported. This effect of WT1 is inversely proportional to that observed with the WT1 promoter, suggesting that antisense promoter activity is involved in WT1 gene regulation (Malik et al., Oncoge.
ne Vol. 11, pp. 1589-1595 (1995)). In addition, expression of ectopic exon 1 RNA was associated with intracellular levels of WT1 in vitro (Malik).
Et al., Oncogene 11: 1589-1595 (1995); Moo.
rwood et al. Pathol 185, 352-359 (1998)
), Thereby supporting a regulatory role for antisense WT1 RNA.

WT1 antisense transcripts can upregulate levels of WT1 protein (Moorwood et al., J. Pathol 185, 352-359.
(1998)), abnormal regulation of antisense RNA transcription may lead to inappropriate transient and spatial expression of the WT1 protein and contribute to tumorigenesis. In this regard, it is interesting to note that WT1 can increase the tumor growth rate of adenovirus-transformed rat kidney cells (Menke et al., Oncogen.
e 12: 537-546 (1996)). The relationship between epigenetic modification of the WT1 antisense regulatory region, WT1 overexpression, and renal tumorigenesis remains unclear, but preliminary studies have shown that hypermethylation of the WT1 antisense regulatory region and low WT1 protein It was shown that there was a correlation between and that there was an inverse relationship in hypomethylation. Interestingly, the WT1 antisense promoter locus was identified as a hypermethylated sequence in human breast cancer (Huang et al., Cancer Res. 57:
1030-1034 (1996)), breast cancer was shown to reduce WT1 expression (Silberstein et al., Proc. Natl. Acad.
Sci USA 94, 8132-8137 (1997)).

The inventors have found that the antisense regulatory region of the WT1 antisense promoter (AR
R) was identified and indicated that the ARR is part of the differentially methylated region. The WT1 ARR, which was characterized and utilized as the basis of the invention, has the WT1 gene sequence described above (eg, Call et al., US Pat. No. 5,350,84).
0 (1994)) is structurally and functionally different. Furthermore, the inventors found a correlation between the level of ARR methylation and the pathological state of human cells. In particular, various cancer cells are shown to differ from their normal counterparts based on epigenetic changes.

Therefore, the first aspect of the present invention includes a part of the sequence shown in SEQ ID NO: 1, consists of the sequence shown in SEQ ID NO: 1, or has a sequence by base substitution, deletion and / or addition. Provided is a nucleotide sequence encoding a WT1 antisense regulatory region, comprising at least a portion of the variant number 1.

A second aspect of the present invention comprises the sequence shown in SEQ ID NO: 2, consists of the sequence shown in SEQ ID NO: 2, or is a mutant form of SEQ ID NO: 2 by base substitution, deletion and / or addition. A nucleotide sequence encoding a WT1 antisense regulatory region is provided that comprises at least a portion of The WT1 antisense regulatory region may be limited to the sequence shown in bold in SEQ ID NO: 2 or part of a variant of such a sequence due to base substitutions, deletions and / or additions.

The third aspect of the present invention comprises at least a part of the sequence shown in SEQ ID NO: 1 or at least a part of a variant of SEQ ID NO: 1 due to base substitution, deletion and / or addition, A nucleotide sequence encoding the negative regulatory element (NRE) of the WT1 antisense regulatory region is provided. The nucleotide sequence shown in SEQ ID NO: 1 may include the negative regulatory elements of several WT1 antisense regulatory regions.

Preferably, the nucleotide sequence according to the first, second or third aspect of the invention is a DNA or RNA sequence. A portion of any sequence is preferably functional. That is, they have the biological function of the corresponding native sequence.

A fourth aspect of the invention is the detection, diagnosis or prognosis of a disease in a subject with cancer using the differentially methylated status of a particular nucleotide sequence, such as the nucleotide sequence in the WT1 ARR region. To provide a method. Epigenetic alterations of the genome are local, for example affecting thereby various loci on chromosome 11p15 (Feinberg, Cancer Research (Appendix) 59, 1743-1746 (1999)). Therefore, in our identification of the chromosome 11p13 region as a target for epigenetic changes due to methylation, we identified 11
11 including those derived from p13 gene reticulocarbin and PAX6
It is suggested that other DNA probes / DNA sequences obtained from the p13 region may also be used for detection purposes in the method according to the invention.

The particular nucleotide sequence may be one or more regulatory elements, preferably one or more negative regulatory elements (NREs), eg one or more NREs in the ARR. One or more NRE sequences are part of the WT1 gene,
Alternatively, it may be part of the chromosome 11p13 region and the method of disease diagnosis and prognosis in a subject diagnosed with cancer is the WT1 gene or chromosome 11p1 in the subject.
Measuring the NRE or ARR methylation status of the tri-region DNA sequence and correlating the NRE methylation status with the subject's diagnosis and predicted long-term recovery prognosis. For example, in the case of acute myelogenous leukemia (AML), NRE
Hypermethylation indicates that the subject has a positive long-term recovery prognosis, and NRE
Hypomethylation indicates that the subject is susceptible to relapse after treatment. In the case of Wilms tumor, hypermethylation of NRE indicates that the subject exhibits a positive long-term recovery prognosis, and hypomethylation of NRE indicates that the subject is susceptible to relapse after treatment. In Wilms tumor, hypomethylation is specifically detected in tumors, and in colorectal cancer cell lines, hypomethylation correlates with the potential for tumorigenesis. However, in other cancers, hypermethylation of specific one or more nucleotide sequences may indicate the presence of cancer cells and / or a predisposition of the subject to recurrence after treatment, whereas specific one or more nucleotides Sequence hypomethylation may indicate the absence of cancer cells and / or the subject exhibits a positive long-term recovery prognosis. For example, FIG. 1 (e)
reference. Diagnostic applications are contradictory to the hypermethylation of other renal tumors such as undifferentiated neuroectodermal tumors (PNET) and clear cell sarcoma of the kidney (CCSK) (see FIG. 1D)
Underlined by hypomethylation at T.

Methylation status can be determined by restriction digestion of the WT1 antisense regulatory region using a combination of enzymes such as Bsh1236I, SpeI and Kpn1. Bsh126I is an isoschizomer of BstUI. Bsh1
236I cuts with the restriction sequence CGCG only in the absence of CpG methylation. The methylation sequence is not restricted by Bsh1236I. Therefore, Bsh12
The restriction pattern obtained for a 36I restricted nucleotide sequence depends on whether the Bsh1236I site in the nucleotide sequence is methylated or not.
The different band patterns are shown. Other commercially available enzymes can also be used, and one or more can distinguish between methylated and unmethylated DNA.

Methylation status can be measured using a PCR-based assay system. Such PCR-based assay systems can involve the use of sodium metabisulfite. This shows the effect of converting all unmethylated cytosine residues to uracil residues. Preferably, the PCR reaction uses the following primers that use at least a portion of the WT1 antisense regulatory region:

[0019] Tf: 5'-GGGTGGAGAAGAAGGATATATTTAT-3 ' Tr: 5'-TAAATATCAAATTAATTTCTCATCC-3 ' TfN: 5'-GATATATTTATTTATTAGTTTTGGT-3 '(nested primer) TrN: 5'-AAACCCCTATAATTTACCCTCTTC-3 '(nested primer)

The conditions used in the PCR reaction are the same as those described later in this specification. The PCR product resulting from the PCR reaction can then be cloned and sequenced, as described below. The PCR product was pGEM-T (Promega (Pro
mega)). Alternatively, the PCR product may be sequenced directly. Once sequenced, any methylated cytosine residue remains readable as a "C" in the nucleotide sequence, whereas unmethylated cytosine appears as a T residue in that sequence.

[0021]   The nested PCR reaction involves the following primers Tf: 5'-GGGTGGAGAAGAAGGATATATTTAT-3 ' Tr: 5'-TAAATATCAAATTAATTTCTCATCC-3 ' TfN: 5'-GATATATTTATTTATTAGTTTTGGT-3 '(nested primer) TrN: 5'-AAACCCCTATAATTTACCCTCTTC-3 '(nested primer)

A fifth aspect of the invention provides a method of detecting cancer in cells from a subject, which comprises detecting tumor-specific changes in genomic imprinting. If normal tissue expresses the gene in a single allele, expression of any two alleles of the tumor-specific gene may indicate the presence of tumorigenic cell proliferation. Alternatively, in some cancers, normal tissue may be biallelic and cancer may be monoallelic. Furthermore, methylation changes can be associated with changes in gene expression through silent or enhanced gene expression, independent of allelic contribution to gene administration (Jones, Can).
cer Research 56, 2463-2467 (1996)).

Tumor-specific alterations in genomic imprinting are characterized by reverse transcription PCR (RT-PC
R). This allows relatively early detection of altered genomic imprinting by visual analysis of RT-PCR products on electrophoretic gels.

The method described above can be used to detect WT in a subject and can detect alterations in genomic imprinting of WT-specific genes such as the WT-1 gene. The altered genomic imprinting detected can be mitigation of genomic imprinting, loss of imprinting, or increased imprinting.

RT-PCR may use two primers designed to anneal to tumor-specific gene sequences on either side of the allelic polymorphism introducing a restriction site into only one allele. For example, in the case of WT, RT-PCR can use the following primers:

Primer 1: WT18 [CTTAGCACTTTCTTCTTGGC] Primer 2: WITBBF2 [TTGCTCAGTGATTGACCAGG] The sixth aspect of the invention comprises the step of altering the genomic imprinting of a tumor-specific gene in a subject suffering from a particular cancer. Provide a treatment method. This may involve mitigation of genomic imprinting or reversal of mitigated genomic imprinting.

A seventh aspect of the invention provides a diagnostic kit, assay or monitoring method using the method according to the fifth aspect of the invention. An eighth aspect of the invention is the step of detecting a tumor-specific alteration in genomic imprinting using the method according to the previous aspect of the invention, wherein the alteration in the genomic imprinting is detected in the WT1 antisense regulatory region. A method of detecting the methylation status of the WT1 antisense regulatory region, which comprises the step of correlating with differential methylation. For example, mitigation of genomic imprinting can be correlated with hypomethylation of the WT1 antisense regulatory region.

A nucleotide sequence according to the present invention and a method of disease diagnosis, detection and prognosis,
As an example, the description will be given with reference to the attached FIGS. 1A to 3B and SEQ ID NOS: 1 to 3.

SEQ ID NO: 1 shows the nucleotide sequence of the WT1 ARR. SEQ ID NO: 2 shows the nucleotide sequence of the negative regulatory element of the gene encoding WT-1. SEQ ID NO: 3 is the nucleotide sequence of the WT1 antisense region (Gessler
, M & Bruns, Genomics 17: 499-501 (199
3 years)). RT-PCR primers are shown as arrows and exon sequences are shown in bold.

[0030] 1. Cloning and characterization of the WT1 genomic sequence   The WT1 cDNA and the WT1 promoter region were respectively replaced by human fetal kidney c
DNA library (Clontech) and human B cells
Genome library (λSha2001, Cambridge Metical Research)
・ Council (Medical Research Council, Camb
ridge) T.W. H. Claws from the kidneys) supplied by Rabbitts)
I learned. For each library, plaque screen filter (Dupo
(Du Pont) 1 x 10⁶Phage (Benton, WD and
And Davis, R.A. W. , Science, 196, 180-182 (19
1977)) created in situ. Filter at 65 ° C with 6 x SSC
(1 × SSC = 0.15M NaCl, 0.015M sodium citrate), 5
X Denhardts solution, 0.5% SDS and 100 μg / ml salmon sperm D
Hybridized with NA. (0.1 x SSC, 0.5% SDS, 65 ° C)
Washes were performed at high stringency. For the cDNA library, see P
The partial WT1 cDNA obtained by CR amplification was used as a probe.
The DNA sequence of the full-length cDNA isolated from the cDNA library was converted to the dideoxy chain.
Terminator method (Sanger, F et al., Proc. Natl. Sci. USA
74, 5463-5467 (1977)).
The 700 bp fragment obtained from the 5'end was used to probe a genomic library.
I used it for. The probe was a random primer method (Feinberg, A .;
P. And Vogelstein, B .; , Biochem. Biophys. R
es. Commun. , 111, 47-54 (1983)) [α- ³² Radiolabeled with P] dCTP (Amersham).

A genomic clone corresponding to the 5'end of the WT1 gene was subcloned,
And restriction analysis by standard methodologies (Sambrook et al., Molecular cloning (M
Olecular Cloning), 1st and 2nd Edition, Cold Spring
Characterized by Harbor Laboratory Press, Cold Spring Harbor, New York (1989)). The DNA sequence was analyzed by the dideoxy chain terminator method (Sanger, F et al., Proc. Natl. Acad. Sci. U.
SA, 74, 5463-5467 (1977)) and by the manufacturer (USB-Amersham).
It was measured by q-cycle sequencing. Functional evaluation of the DNA obtained from intron 1 of the WT1 gene was performed by transient transfection of a reporter gene construct with various TW1 intron sequences that detect gene expression (Malik, K. et al.
Oncogene, Vol. 11, pp. 1589-1595 (1995)).

2. Differential methylation assay Human genomic DNA was assayed using standard phenol-chloroform extraction method (Sambrook
K. et al., Molecular Cloning, 1st and 2nd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (198).
9 years)). Based on the DNA sequence of the intron region (see FIG. 2), the restriction enzyme Bsh1236I (MBI Fermentus (MBI Fer) is used.
mentas)) was chosen to test the methylation of the intron region. This enzyme cleaves the restriction sequence CGCG only in the absence of CpG methylation; the methylation sequence is not restricted. Our study shows that differential methylation contains 850 bp of KpnI-SpeI (new phenotype) containing four strong Bsh1236I sites.
It has been established that it is favorably detected within the New England Biolabs fragment (see Figure 1). Band patterns characterized by whether these sites were methylated or unmethylated showed that KpnI, SpeI, and Bsh1 after digestion of genomic DNA.
Observed with 236I combination. Hybridization using Samsan blotting and radiolabeled DNA probes (Sambrook et al., Molecular Cloning, 1 and 2 editions, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989)) Defined by KpnI and SpeI sites in the intron sequence (FIGS. 1 and 2)
.

FIG. 1 (D) shows a sasan blot of matched normal kidney and Wilms tumor samples. All WT samples were confirmed to show no loss of heterozygotes. In addition, matched normal kidney and PNET or CCSK DNA are also shown.

As shown in FIG. 1 (D), the pattern of differential methylation was
And Wilms tumor DNA (panel A), white blood cells from patients with variable prognosis and normal lymphocytes (panel B), and highly tumorigenic and non-tumorigenic colon cell lines (panel C). Make a successful distinction between the two. The results presented in Panel C suggest that this change may be associated with the oncogenic process and thus with cancers other than Wilms tumor.

In filmoma, hypomethylation of specific nucleotide sequences correlates with tumor status. However, in other cancers this correlation can be reversed such that hypermethylation of specific nucleotide sequences corresponds to the methylation status of tumor cells and hypomethylation is indicative of normal cells. This example is shown in Figure 1 (E), along with Southern blot analysis of normal breast tissue DNA and breast tumor DNA for changes in ARR methylation status. Normal breast tumor DNA in all four wet ductal carcinomas with varying aggressiveness
It was shown that the methylation of WT1 ARR was increased compared to. Therefore, relative differential methylation comparing normal and tumor tissue can be diagnostically utilized.

3. PCR-based assay system Tumor cells and normal cells can be distinguished by their post-molding as outlined above. Knowledge of the DNA sequence of the WT1 antisense regulatory region has made it possible to develop a PCR-based assay system that allows the measurement of the methylation status of a sample, requiring little biological material. This method introduces a CpG dinucleotide that is not part of the restriction enzyme recognition sequence by treatment of a genomic DNA sample with sodium metasulfite (Merck), thereby converting all unmethylated cytosine residues to uracil. (Paulin, R. et al., Nuclei
c Acids Research 8: 4777-4790 (1998)). The specific region of interest in the WT1 intron sequence can then be amplified using primers specific for both strands of DNA. The PCR band obtained was pG
It can be directly sequenced or cloned using commercially available vectors such as EM-T (Promega) and analyzed by DNA sequencing. Any methylated cytosine residue remains readable as "C" in the DNA sequence, whereas unmethylated cytosine appears as "T".

Alternatively, after the first round of PCR with DNA treated with sodium sulfite, a sequence specific for the methylated Bsh1236I site (boxed in FIG. 2) was shown to be generally differentially methylated. , Or a nested primer containing a sequence specific for the unmethylated Bsh1236I site (ie, specific for the C → T conversion) is used, which allows visualization of the PCR product between methylated and unmethylated sequences. The distinction becomes possible. That is, if a primer specific for the methylated Bsh1236I site is used, a PCR product will only be observed if the Bsh1236I site in the sample is methylated, otherwise no PCR amplification will occur.

Representative primers that can be used for methylation-specific PCR are shown below, and the position of their hybridization to the WT1 sequence is indicated by the arrow in FIG. 2 for amplification of the top strand. To enable C → T conversion:

[0039] Tf: 5'-GGGTGGAGAGAAGGATATATTTAT-3 ' Tr: 5'-TAAATATCAAATTAATTTCTCATCC-3 ' TfN: 5'-GATATATTTATTTATTAGTTTTGGT-3 '(nested primer) TrN: 5'-AAACCCCTATAATTTACCCTCTTC-3 '(nested primer)

There is A representative primary amplification is performed using Amplitaq (Perkin-Elmer) with 100 ng of sodium sulfite treated DNA in buffer supplemented with 3 mM MgCl ₂ . The amplification conditions are
Denaturation at 94 ° C for 3 minutes, followed by denaturation at 94 ° C for 30 seconds, 50 ° C for 30 seconds
35 cycles of annealing at 90 ° C. and extension at 72 ° C. for 90 seconds. 7
The reaction is completed by a final extension at 2 ° C. for 5 minutes. Secondary PCR with nested primers uses the same conditions except using the 1 / 100th primary PCR reaction and 24 cycles.

4. Correlation of long-term disease prognosis with (NRE) methylation status. We have detected a correlation between the methylation status of ARR and the diagnostic and long-term disease prognosis in subjects with cancer. Diagnostic capacity is demonstrated by hypomethylation in WT as opposed to hypermethylation in other renal tumors such as undifferentiated neuroectodermal tumors (PNET) and clear cell sarcoma of the kidney (CCSK) (Fig. 1
See D). AML subjects with hypermethylated ARR responded well to treatment and had full recovery. However, recurrent subjects with unmethylated NRE
Resistant to treatment.

Therefore, the methylation status of NREs can be used as a powerful early indicator of the prognosis of long-term disease. Subjects with unmethylated NRE can be maintained under myopic observation for early detection of recurrence. This maximizes their potential for recovery. However, the cost of such myopia observations after treatment is unmethylated because these patients are expected to respond well to treatment once any recurrence is detected by normal routine examination. Not required for subjects with NRE.

In a pilot study with AML, hypermethylation of specific nucleotide sequences was found to be
Responding to an estimated positive long-term prognosis for subjects exhibiting L, and hypomethylation corresponds to a predisposition for subjects to relapse after treatment. But in other cancers, this correlation
It can be reversed so that hypermethylation of specific nucleotide sequences may correspond to a predisposition to relapse after treatment and hypomethylation may indicate a positive long-term prognosis for recovery.

Accordingly, decisions regarding the best methods of treatment suitable for a subject can be made in the light of knowledge-based predictions of how the subject is expected to respond to treatment in the event of a relapse of their cancer symptoms.

Therefore, differential methylation is a determinant in developing a long-term prognosis for subjects diagnosed with cancer. 5. Genomic Imprinting of the WT1 Gene The WT1 allele-specific methylation pattern observed in normal kidney cells is W
It is strongly indicated that there is genomic imprinting of T1 ARR / NRE (antisense regulatory region / negative regulatory region) and tumor-specific relaxation of genomic imprinting in Wilms tumor.

Genome imprinting is the phenomenon whereby maternal or paternal copies of a gene are selectively expressed, and DNA methylation serves as a regulatory signal. Such loss of signal can lead to altered administration of gene expression that can be detrimental to normal cell growth. For example, the IGF2 gene exhibits loss of genomic imprinting control of IGF2 and is overexpressed in WT (Feinberg, AP, Cancer Res. (Supplement), 59: 1743s-1746s (1999)). ). When IGF2 is a growth factor, it can easily contribute to the uncontrolled growth associated with tumorigenesis.

Differentiation methylation of WT1 ARR / NRE results in WT1 antisense RNA (WT
Reverse transcription-PCR (RT-PCR) analysis was performed on fetal and normal kidney cells, and WT cells to determine whether they were associated with allele-specific expression of 1-AS). Primers on either side of antisense WT1 RNA splicing (see Sequence 3 and Figure 3A) (Gessler, M. and Bruns).
, Genomics, 17: 499-501 (1993)), RT-P.
Used for CR.

Primer 1: WT18 [CTTAGCACTTTCTTCTTGGC] Primer 2: WITKBF2 [TTGCTCAGTGATTGACCAGG] Typical reaction conditions used for RT-PCR were heating at 60 ° C. for 5 minutes to 1 μm.
Reverse primer was annealed to g total RNA, followed by quenching on ice, followed by 6
Super RT (HT Biotechnology (HT
Biotechnologies, Cambridge, United Kingdom
UK)) was to perform reverse transcription performed using reverse transcriptase. This was followed by the following PCR cycling;

95 ° C. for 3 minutes (1 cycle); 94 ° C. for 15 seconds, 60 ° C. for 30 seconds, 72 ° C. for 60 seconds (2 cycles); 94 ° C. for 15 seconds, 58 ° C. for 30 seconds, 72 ° C. 60 seconds (2 cycles); 94 ° C for 15 seconds, 56 ° C for 30 seconds, 72 ° C for 60 seconds (10 cycles, 20 cycles for antisense product); and 94 ° C for 15 seconds, 56 ° C for 30 seconds, 1 72 ° C with 20 seconds extension per cycle
60 seconds (20 cycles)

PCR cycle of The obtained PCR product was added with the restriction enzyme MnII directly to the PCR mixture, and 3
Digested by incubation for 60 minutes at 7 ° C. The PCR products were then separated on a 2% agarose gel and then alkaline blotted onto hybrid N ⁺ membranes and hybridized with ³² P-labeled antisense cDNA probe. The sequence of the probe is shown in bold between WT18 and WTTKBP2 in Sequence 3. The following primers were used as DNA controls:

[0051] Primer 1: WITKBF2 [TTGCTCAGTGATTGACCAGG] Primer 2: WITKBR2 [TTGGCTGGAAAGCTTGCAGC]

The MnII polymorphism utilized (Grubb, GR et al., Oncogene, 1
0: 1677-1681 (1995)), marked with an asterisk in FIG. 3A, RT-PCR products of 285 and 222 bp for two allele expression, or alternatively 286 bp or 222 bp for single allele expression. We obtained selectively allele bands of major.

As shown in FIG. 2B, the expression of WT1-AS in normal kidney samples with one methylated and one unmethylated allele only originates from one allele, Genome imprinting is confirmed. But,
WT exhibits biallelic expression of WT1-AS, thus indicating relaxation of imprinting control in WT. Therefore, the net increase resulting from the expression of both WT1-AS alleles may serve as an additional marker of the differential methylation pattern detected in Wilms tumor.

This modified imprinting may be present in cancers other than WT. Thus, altered imprinting control of specific genes may provide markers for the detection or diagnosis of various cancer types in patients. Furthermore, if the epigenetic modification of DNA is reversible, the detection of altered imprinting control and / or diagnosis of methylation changes is based on enzymes such as DNA methyltransferases and demethylases or by compounds (Jones P. A. and Lai
rd P. W. , Nature Genetics, 21: 163-167 (1999)), should also promote therapeutic strategies. This allows regulation of gene expression and allows treatments which depend on proper gene regulation.

[0055]

[Brief description of drawings]

FIG. 1 (A) shows the probe used for the detection of methylation for Southern blotting, and FIG. 1 (B) shows three acute myelogenous leukemias (AM).
L) shows a Southern blot of DNA and normal peripheral blood lymphocyte DNA.
C) is a D obtained from a non-tumorigenic and highly tumorigenic colorectal cell line
Southern blots of NA are shown, Figure 1 (D) shows Southern blots of matched normal kidney and WT samples, matched normal kidney and PNET or CCSK DNA and fetal kidney controls, Figure 1 (E). 4 shows Southern blot analysis of breast tumor DNA for changes in ARR methylation status.

FIG. 2 shows the nucleotide sequence of WT1 ARR. Primer hybridization sites are indicated by arrows.

FIG. 3 (A) Antisense WT used for RT-PCR.
FIG. 3B is a schematic showing primers on either side of 1 RNA splicing, and FIG. 3 (B) shows a Southern blot of antisense WT1 RNA RT-PCR products.

[0056]

[Sequence list 1]

[0057]

[Sequence listing 2]

[0058]

[Sequence list 3]

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁷ Identification code FI theme code (reference) G01N 33/53 G01N 33/566 33/566 33/574 D 33/574 C12N 15/00 ZNAA (81) designation Country EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), OA (BF, BJ, CF, CG) , CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, MZ, SD, SL, SZ, TZ, UG, ZW) ), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AE, AG, AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, BZ, CA, CH, CN, CR, CU, CZ, DE, DK, DM, DZ, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS , JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MA, MD, MG, MK, MN, MW, MX, MZ, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, TZ, UA, UG, US, UZ, VN, YU, ZA, ZW (72) Inventor Brown , Keith BS8 1TD Bristol University Walk School of Medical Sciences Department of Pathology Click Unit F Term (Reference) 4B024 AA01 AA12 AA20 CA01 CA09 CA11 CA20 HA09 HA11 HA12 HA17 HA20 4B063 QA01 QA13 QA17 QA19 QQ42 QQ52 QR08 QR14 QR32 QR35 QR40 QR42 QR56 QR62 QS16 QS25 QS34 QX02 4C084 AA13 AA17 NA14 ZB26

Claims (38)

[Claims] 1. A WT1 antisense comprising at least a part of the sequence shown in SEQ ID NO: 1 or including at least a part of a variant of the sequence shown in SEQ ID NO: 1 by base substitution, deletion and / or addition. A nucleotide sequence that encodes a regulatory region. 2. The nucleotide sequence according to claim 1, which encodes a negative regulatory element (NRE) of the WT1 antisense regulatory region. 3. A WT1 anti-comprising at least a part of the sequence shown in SEQ ID NO: 2 or at least a part of a variant of the nucleotide sequence shown in SEQ ID NO: 2 by base substitution, deletion and / or addition. Negative regulatory element (N
RE). 4. The WT1 antisense according to claim 3, wherein the NRE comprises the sequence shown in bold in SEQ ID NO: 2 or a variant of such sequence by base substitution, deletion and / or addition. Regulatory region NRE. 5. The nucleotide sequence or NRE according to any one of claims 1 to 3, wherein the nucleotide sequence is a DNA sequence. 6. An RNA sequence encoded by the nucleotide sequence according to any one of claims 1 to 5. 7. A method of disease diagnosis and prognosis in a subject diagnosed with Wilms tumor cancer, comprising determining the differential methylation status of a specific nucleotide sequence or nucleotides in the subject or in a sample derived from the subject. A method comprising the steps of measuring. 8. The method of claim 7, wherein the particular one or more nucleotide sequences form part of a WT1 antisense regulatory region (ARR). 9. A step of measuring the methylation status of the negative regulatory element (NRE) or ARR of the WT1 gene in a sample isolated from a subject, and NRE or AR.
9. Correlating the methylation status of R with the subject's diagnosis and expected long-term recovery prognosis. 10. Hypermethylation of NRE or ARR indicates that a subject exhibits a positive long-term recovery prognosis, and hypomethylation of NRE or ARR indicates that the subject is predisposed to relapse after treatment. The method according to claim 9, wherein: 11. A hypomethylation of a specific nucleotide or nucleotides indicates that the subject has a positive long-term recovery prognosis, and a hypermethylation of a specific nucleotide or nucleotides indicates that the subject is post-treatment. 9. The method according to claim 7 or 8, which indicates that the patient is predisposed to recurrence. [12] The method according to any one of [7] to [11], wherein the NRE is the nucleotide sequence according to any one of [1] to [6]. 13. The methylation status is detected by restriction digest analysis.
13. The method according to any one of items 1 to 12. 14. The method of claim 13, wherein at least the enzyme Bsh1236I is used to limit NRE. 15. The method of any of claims 7-12, wherein the methylation status is detected using a PCR-based assay system. 16. A PCR assay system for amplifying a region of a nucleotide sequence, comprising the following primers: Tf: 5′-GGGTGGAGAAGAAGGATATATTTAT-3 ′ Tr: 5′-TAAATATCAAATTAATTTCTCATCC-3 ′ TfN: 5′-GATATATTTATTTATTAGTTTTGGT-3 ′ (nested. 16. The method according to claim 15, wherein at least one of TrN: 5′-AAACCCCTATAATTTACCCTCTTC-3 ′ (nested primer) is used. 17. The method of claim 16, wherein the amplified nucleotide sequence is cloned and sequenced. 18. A probe comprising the nucleotide sequence according to any one of claims 1 to 6. 19. A nucleotide sequence according to any one of claims 1 to 6,
Alternatively, a diagnostic kit, assay or monitoring method using the probe according to claim 18. 20. A diagnostic kit, assay or monitoring method using the method according to any one of claims 7 to 17. 21. A method of cancer detection in a subject or in a sample isolated from the subject, comprising the step of detecting the methylation status of a particular nucleotide or nucleotide sequences. 22. The methylation status of a specific one or more nucleotide sequences,
22. Correlating with the presence or absence of cancer cells in a subject.
The method described in. 23. The method of claim 22, wherein hypomethylation of a specific nucleotide or nucleotide sequences is indicative of the presence of cancer cells in the subject. 24. A method for detecting cancer in cells derived from a subject, which comprises the step of detecting a tumor-specific alteration in genomic imprinting. 25. The method of claim 24, comprising detecting tumor-specific alleviation of genomic imprinting by measuring the methylation status of specific nucleotide sequences. 26. The tumor-specific alteration of genomic imprinting is reverse transcription-P.
The method according to claim 24 or 25, which is detected by CR (RT-PCR). 27. The method according to any one of claims 24 to 26, wherein the cancer is Wilms tumor (WT). 28. The method of claim 27, comprising detecting the relaxation of genomic imprinting of the antisense WT-1 RNA sequence. 29. RT-PCR uses two primers designed to anneal to a tumor-specific gene sequence on both sides of the allelic polymorphism introducing a restriction site into only one allele. Item 29. The method according to Item 28. 30. RT-PCR is carried out by the following primer pair: Primer 1: WT18 CTTAGCACTTTCTTCTTGGC Primer 2: WITBBF2 TTGCTCAGTGATTGACCAGG 30. The method of claim 29, wherein 31. A method of treating a subject having a particular cancer, comprising altering the genomic imprinting of a tumor-specific gene. 32. The method of claim 31, wherein the genomic imprinting of a tumor-specific gene is altered by altering the methylation status of specific nucleotide sequences. 33. The method of claim 31 or claim 32, wherein the genomic imprinting is modified to mitigate genomic imprinting of tumor-specific genes. 34. The method of claim 31 or claim 32, wherein the genomic imprinting is modified to reverse the relaxation of genomic imprinting of tumor-specific genes. 35. A diagnostic kit, assay or monitoring method using the method according to any one of claims 24 to 30. 36. Using the method according to any one of claims 21 to 30,
Methylation of the WT1 antisense regulatory region, comprising detecting a tumor-specific alteration of genomic imprinting and correlating the alteration detected in relaxed genomic imprinting with differential methylation of the WT1 antisense regulatory region Detection method. 37. The method of claim 36, wherein the alteration in genomic imprinting is a relaxation in genomic imprinting. 38. A method of treatment comprising selecting a particular course of treatment based on the results of the method according to any one of claims 7-17, 21-34, 36, 37.