JP2003310273A - Adenovirus vector containing triple gene expression system - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To obtain a new adenovirus vector which can efficiently and simply control the expression of a foreign gene with a medicine and to provide a method for controlling the expression of a foreign gene in a non-human mammal or in a mammalian cell using the vector. <P>SOLUTION: An adenovirus-mediated triple gene expression system that includes a foreign gene respectively in the E1 deletion region, the E3 deletion region and a region between E4 and 3'ITR is developed. In this invention, a cassette that can express three genes is introduced into one vector and the expression of the foreign genes can be more efficiently and simply controlled in comparison with the conventional case where three genes are expressed with individually different vectors. Further, the use of the vector according to the invention can achieve efficient control of the expression of a foreign gene in a non-human mammal or in a mammalian cell. <P>COPYRIGHT: (C)2004,JPO

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to an adenovirus vector capable of regulating the expression of a foreign gene.

[0002]

BACKGROUND OF THE INVENTION Modulation of foreign gene expression systems in mammalian cells is favorable for studying the efficacy and safety of gene therapy and gene function in cell biology. Important features of a suitable regulatory system include 1) low basal expression, 2) high inducible expression, 3) rapid reaction time, 4) regulation of expression (important for functional analysis).

So far, mammalian expression systems capable of regulating the expression of several types of foreign genes have been developed.
(1) Tetracycline inducible expression system (Gossen, M. and B
ujard, H. (1992) Tight control of gene expression
in mammalian cells by tetracycline-responsive prom
oters. Proc. Natl. Acad. Sci. USA., 89, 5547-5551;
Gossen, M., Freundlieb, S., Bender, G., Muller,
G., Hillen, W. and Bujard, H. (1995) Transcription
al activation by tetracyclines in mammalian cells.
Science, 268, 1766-1769), (2) ecdysone inducible expression system (No, D., Yao, TP and Evans, RM (1996) E
cdysone-inducible gene expression inmammalian cell
s and transgenic mice. Proc. Natl. Acad. Sci. US
A., 93, 3346-3351), (3) Mifepristone inducible expression system (Tsai, SY, O'Malley, BW, DeMayo, FJ,
Wang, Y. and Chua, SS (1998) A novel RU486 ind
ucible system for the activation and repression of
genes. Adv. Drug Deliv. Rev., 30, 23-31; Wang,
Y., O'Malley, BWJ, Tsai, SY and O'Malley,
BW (1994) A regulatory system for use in gene t
ransfer. Proc. Natl. Acad. Sci. USA., 91, 8180-818
4), (4) Rapamycin inducible expression system (Amara, JF, Cl
ackson, T., Rivera, VM, Guo, T., Keenan, T., Na
tesan, S., Pollock, R., Yang, W., Courage, NL,
Holt, DA and Gilman, M. (1997) A versatile synt
hetic dimerizer for the regulation of protein-prot
ein interactions. Proc. Natl. Acad. Sci. USA., 94,
10618-10623; Ho, SN, Biggar, SR, Spencer, D.
M., Schreiber, SL and Crabtree, GR (1996) D
imeric ligands define a role for transcriptional a
ctivation domains in reinitiation. Nature, 382, 82
2-826; Magari, SR, Rivera, VM, Iuliucci, J.
D., Gilman, M. and Cerasoli, FJ (1997) Pharmaco
logic control of ahumanized gene therapy system im
planted into nude mice. J. Clin. Invest., 100, 286
5-2872; Rivera, VM, Clackson, T., Natesan, S.,
Pollock, R., Amara, JF, Keenan, T., Magari, S.
R., Phillips, T., Courage, NL, Cerasoli, FJ,
Holt, DA and Gilman, M. (1996) A humanized syst
em for pharmacologic control of gene expression. N
at Med., 2, 1028-1032). Of these, the tetracycline-inducible expression system is the most widely used. Two types of systems, tet-off and tet-on, have been used to regulate foreign gene expression (Gossen, M. and Buj.
ard, H. (1992) Tight control of gene expression in
mammalian cells by tetracycline-responsive promot
ers. Proc. Natl. Acad. Sci. USA., 89, 5547-5551; Go
ssen, M., Freundlieb, S., Bender, G., Muller, G., H
illen, W. and Bujard, H. (1995) Transcriptional ac
tivationby tetracyclines in mammalian cells. Scien
ce, 268, 1766-1769). In the tet-off system, which uses the tetracycline-responsive transcriptional activator (tTA), transcription is switched off in the presence of tetracycline (Gossen, M.
and Bujard, H. (1992) Tight control of gene expres
sion in mammalian cells by tetracycline-responsive
promoters. Proc. Natl. Acad. Sci. USA., 89, 5547-
5551). In contrast, the tet-on system, which uses the reverse tetracycline-responsive transcriptional activator (rtTA), switches on transcription in the presence of tetracycline (Gossen, M., Freu
ndlieb, S., Bender, G., Muller, G., Hillen, W. and
Bujard, H. (1995) Transcriptional activation by te
tracyclines in mammalian cells. Science, 268, 1766
-1769). Thus, the tet-off and tet-on systems provide negative and positive control of foreign gene expression, respectively.

The method of delivering a regulated mammalian expression system to cells is an important determinant for its application. The combination of recombinant adenovirus vector and tetracycline-controlled expression factor is an attractive strategy for this purpose. Adenovirus vectors can be easily propagated to high titers and can efficiently transfer foreign genes to a wide range of cell types both in vitro and in vivo (Benihoud, K., Yeh, P. and Perr
icaudet, M. (1999) Adenovirus vectors forgene deli
very. Curr. Opin. Biotechnol., 10, 440-447; Kovesd
i, I., Brough, D., Bruder, J. and Wickham, T. (199
7) Adenoviral vectors for gene transfer. Curr. Opi
n. Biotechnol., 8, 583-589). So far, the present inventors have performed a comparison of the functions of the adenovirus-mediated tet-off and tet-on systems, and the regulation of adenovirus vectors containing the tet-on system has been shown to include adenovirus vectors containing the tet-off system. Significantly lower (often less than 20 times) (Mizu
guchi, H. and Hayakawa, T. (2002) The tet-off syst
em is more effective than the tet-on systemfor reg
ulating transgene expression in single adenoviral
vector. J. GeneMed. in press). Adenovirus vector
The highest level of foreign gene expression by the tet-on system is more than 10-fold lower than that of the adenovirus-mediated tet-off system. tet
The -on system is preferred because it positively regulates gene expression, and it is important to develop methods to overcome these limitations.

[0005]

The present invention has been made in view of such circumstances, and an object thereof is to develop a novel adenovirus vector capable of efficiently and conveniently controlling the expression of a foreign gene by a drug. To do. Furthermore, the present invention aims to provide a method for controlling the expression of a foreign gene in a non-human mammal or mammalian cells using the vector.

[0006]

[Means for Solving the Problems] In order to solve the above-mentioned problems, the inventors of the present invention have conducted extensive studies as described below, and have shown that the tetracycline-regulated gene expression system (tet-on system) has a higher regulated activity. The adenovirus vector system was developed.

First, the present inventors have developed an adenovirus-mediated triple gene expression system containing a foreign gene in the E1 deletion region, the E3 deletion region, and the region between E4 and 3'ITR. rtTA
And tetracycline-controlled transcription silencer (tTS)
Expression cassette (Freundlieb, S., Schirra-Muller, C. a
nd Bujard, H. (1999) A tetracycline controlled act
ivation / repression system with increased potential
for gene transfer into mammalian cells. J. Gene M
ed., 1, 4-12), E3 deletion region, and E4 and 3 ', respectively.
Introduced into the region between the ITRs, the luciferase gene driven by the tet-responsive promoter was introduced into the E1 deleted region. With this modification, a single adenovirus vector containing the improved tet-on system will result in highly regulated expression of foreign genes (60-2,500 depending on cell type).
More than twice).

[0008] As described above, the present inventors have completed the present invention by developing a novel adenovirus vector capable of efficiently controlling the expression of a foreign gene with a drug.

The present invention is one in which a cassette for expressing three genes is introduced into one vector, and the expression control of a foreign gene is more efficient than the conventional case where three genes are expressed in separate vectors. It can be performed easily and easily. Moreover, by using the vector of the present invention, it is possible to efficiently control the expression of a foreign gene in a non-human mammal or mammalian cells.

That is, the present invention relates to a novel adenovirus vector capable of efficiently and conveniently controlling the expression of a foreign gene by a drug, and controlling the expression of the foreign gene in a non-human mammal or a mammalian cell using the vector. Regarding the method, more specifically, [1] E1 region, E3 region, and E4 region and 3'of the adenovirus genome
In the region between the ends, (a) a foreign gene expression cassette having a structure in which a foreign gene is functionally linked downstream of the drug-responsive promoter, and (b) a drug-responsive transcription activation gene downstream of the promoter. Expression cassette of a drug-responsive transcriptional activation gene having a functionally linked structure, and (c) expression of a drug-controlled transcriptional silencer gene having a structure in which a drug-controlled transcriptional silencer gene is functionally linked downstream of a promoter Recombinant adenovirus vector DNA, characterized in that the cassettes have inserted structures, and the expression of the foreign gene is controlled by the drug, [2] the foreign gene expression cassette is E1 deficient in the adenovirus genome. An adenovirus vector DNA according to [1], which is inserted into the loss region.
[3] The adenovirus vector D according to [1], wherein the expression cassette of the drug-responsive transcription activation gene is inserted into the E3 deletion region of the adenovirus genome.
NA, [4] does not express E1 gene product, [1]-
Adenovirus vector DN according to any one of [3]
A, [5] The adenovirus vector DNA according to any one of [1] to [4], wherein the promoter described in (b) is a cytomegalovirus-derived promoter,
[6] The adenovirus vector DNA according to any one of [1] to [4], wherein the promoter described in (c) is an EF-1α promoter, [7] the agent is tetracycline or a tetracycline derivative, [1] ]
[8] The recombinant adenovirus vector DNA according to any one of [6] to [8], wherein the drug-reactive transcription-activating gene is a reverse tetracycline-reactive transcription-activating factor gene,
The recombinant adenovirus vector DNA according to [7], wherein the drug-controlled transcription silencer gene is a tetracycline-controlled transcription silencer gene,

[9] [1]-
Adenovirus vector DN according to any of [8]
A recombinant adenovirus vector containing A, [10]
The recombinant adenovirus vector DNA according to any one of [1] to [8] is introduced,

A packaging cell for producing the recombinant viral vector according to [9],
[11] The packaging cell according to [10], which is derived from 293 cells, [12] [10] or [11].
Culturing the cells according to, and collecting the resulting viral particles,

[9] A method for producing a recombinant adenovirus vector, [13] A method for controlling the expression of a foreign gene in a non-human mammal or mammalian cells, which comprises the following steps (a) and (b): a) a step of providing a non-human mammal or a mammalian cell into which the adenovirus vector DNA according to any one of [1] to [8] is introduced, (b) a drug for the mammal or the mammalian cell of step (a) [14] A composition for gene therapy, which comprises the adenovirus vector DNA according to any one of [1] to [8].

In the present invention, the "vector" means
A DNA for expressing a foreign gene in a host is defined as a packaged “virus particle”, and the DNA contained in the virus particle is defined as a “vector DNA”.

[0012]

BEST MODE FOR CARRYING OUT THE INVENTION The present inventors have described recombinant adenovirus vector DNA (in the present specification, simply referred to as “vector DN”) capable of efficiently controlling the expression of a foreign gene by a drug.
"A" may be described). In a preferred embodiment of the present invention, the expression of the foreign gene is turned on in response to the addition of the drug, and the expression level of the foreign gene increases as the drug concentration increases.

The vector DNA of the present invention has the following genes (a), (b), and (c) in the E1 region, E3 region, and E4 region of the adenovirus genome and the region between the 3'ends, respectively. It has a structure in which an expression cassette is inserted. The vector DNA of the present invention can control the expression of foreign genes by drugs. (A) An expression cassette of a foreign gene having a structure in which the foreign gene is functionally linked to the downstream of the drug-responsive promoter. (B) An expression cassette of a drug-responsive transcriptional activation gene having a structure in which a drug-responsive transcriptional activation gene is functionally linked downstream of a promoter. (C) A drug-regulated transcription silencer gene expression cassette having a structure in which a drug-regulated transcription silencer gene is functionally linked to the downstream of a promoter.

In the present invention, the "foreign gene" refers to a desired gene whose expression is desired to be regulated in cells. For example, for the purpose of gene therapy or the like, a gene for treating the target disease can be used as the foreign gene.

The vector DNA of the present invention has a structure in which a foreign gene, a drug-responsive transcription activation gene, and a drug-regulated transcription silencer gene are inserted into one adenovirus vector DNA in a state in which each gene can be expressed. It is characterized by having. This is more convenient than expressing the three genes using separate vectors, and has a particular effect of efficiently controlling the expression of the foreign gene.

Adenovirus has a linear double-stranded DNA as a genome, and the reverse end sequence (Inve
rted terminal repeat (ITR) is present and contains the origin of replication. The adenovirus vector mainly has the following characteristics (Mizuchi, Hayakawa, Quality and safety evaluation of biopharmaceuticals (LIC publication), p.383-393, 2001). (1) Genes can be introduced into many types of cells regardless of species, and it is one of the most efficient genes introduced among the vectors known so far. (2) Gene transfer can be efficiently performed even in cells in the growth arrest phase. (3) It is also suitable for direct gene transfer to tissues in vivo. (4) High titer (10 ¹¹ PFU / ml or more) virus can be obtained relatively easily. (5) It is physicochemically stable and can be concentrated by centrifugation. (6) A relatively large foreign gene (up to about 8.1 kb) can be inserted. (7) Since the viral genome exists as extrachromosomal DNA in the nucleus and is rarely integrated into the host chromosome, it may cause genotoxicity (eg, canceration of cells due to integration of foreign gene into host chromosome). Is extremely low.

Genes contained in the adenovirus genome are roughly classified into early genes E1, E2, E3 and E4 and late genes L1, L2, L3, L4 and L5. The E1 gene functions to induce the synthesis of viral proteins, and a vector lacking this gene cannot theoretically grow in cells that do not express the E1 gene product.

Usually, an adenovirus vector used for gene therapy has a structure in which a foreign gene is inserted into the E1 region, which is an early gene that induces the synthesis of viral proteins, and as a result, the E1 gene product is not produced. . Therefore, in normal cells which cannot theoretically supply the E1 gene product in trans, they cannot grow,
It is considered highly safe. Therefore, the vector DNA of the present invention is preferably constructed so as not to express the E1 gene product.

The E3 region is not essential for virus growth and is usually excluded for the purpose of increasing the insertion size of foreign genes.

Therefore, the above E1 region of the present invention is preferably one in which a part or all of the DNA on the E1 gene is deleted, and more preferably an E1 region having a deletion such that the E1 gene product is not produced. Is. The E3 region of the present invention is a part or all of the D3 gene on the E3 gene.
It is preferable that NA is deleted.

In the present invention, the E1 region in which a part or all of the DNA on the E1 gene is deleted is particularly described as "E1 deleted region". Similarly, the E3 region in which some or all of the DNA on the E3 gene is deleted is particularly referred to as "E3 deleted region". In addition, the vector DNA of the present invention has a foreign gene, a drug-responsive transcriptional activation gene, and a drug-controlled transcriptional silencer gene into one adenovirus vector DNA, and each of the genes can be expressed in the above-described region in an expressible state. As long as it has an inserted structure, it may have deletions, substitutions, insertions, etc. in the DNA of the adenovirus genome.

DNA deleted in the E1 deletion region
The region is not precisely defined, but one skilled in the art would appreciate that the 342-3523 bp of the E1 region of the adenovirus genome.
Deletion, or deletion of 354-3824 bp, or 45
Vector DNA lacking 9-3510 bp can be preferably used. Also, in the E3 deletion region, the DN that is deleted
Although it is difficult to precisely define the A region, vector DNA lacking 27865-30995 bp or 28133-30818 bp of the E3 region of the adenovirus genome is usually used. In this specification, the numbers indicating the positions on the adenovirus genome are the National Cente
r for Biotechnology Information Based on GeneBank accession number: M73260 / M29978.

In the present invention, the “region between the E4 region and the 3 ′ end” is more specifically a promoter sequence encoding the E4 gene (the E4 gene is encoded from the left side to the right side of the adenovirus genome). Therefore, the promoter sequence is at the 3'-most end) and the first DNA of the ITR present at the 3'-end
It refers to the area between. The region is usually 35610-35832bp
However, this number is not precisely specified.

In the present invention, the above-mentioned foreign gene expression cassette (a) is constructed so that the foreign gene can be expressed in response to transcription of a drug. Usually, it has a structure in which a foreign gene is functionally linked downstream of the promoter. In the present invention, “operably linked” means that the promoter and the downstream gene are linked so that the expression of the downstream gene is induced with the activation of transcription of the promoter. The gene expression cassette of the above (a) of the present invention preferably has a response element to which a “drug-reactive transcription factor” can bind, and usually, by binding the drug-reactive transcription factor to the response element, , Transcription of foreign genes is regulated.

In the present invention, the "drug-responsive transcriptional activator" is defined as a substance that specifically binds to a response element that controls the expression of a foreign gene in the presence of a drug and activates the expression of the foreign gene. (The gene encoding the factor is described as "drug-responsive transcription activator gene" or "drug-responsive transcription activator gene"). When the “drug” in the present invention is tetracycline or a tetracycline derivative, the “drug-reactive transcription factor” of the present invention
As, for example, reverse tetracycline-controlled trans activator (rtTA;
activator) can be preferably used. The response element may be TRE, for example. TRE is a DNA sequence having a structure in which a 42 bp sequence containing tetO (tet operon) is repeated 7 times.

Further, an improved rtTA in which the basal transcriptional activity is changed in the absence of tetracycline is known (International Publication No. WO 00/75347; International Publication No.
WO 00/75362; Urlinger S. et al., Proc. Natl. Acad.
Sci. USA., 97, 7963-7968). In the present invention, such a known improved rtTA can also be preferably used as the drug-reactive transcription activator. Further, the drug-reactive transcription activator of the present invention is not limited to wild-type rtTA or the above-mentioned known improved rtTA, and it is also possible for those skilled in the art to use rtTA in which the rtTA is further appropriately modified. .

In the present invention, the "drug-regulated transcription silencer gene" is defined as one that specifically binds to a response element that controls the expression of a foreign gene in the absence of a drug and suppresses the expression of the foreign gene. Expression of foreign gene in the absence of drug (background)
It is used for the purpose of lowering. When the “drug” in the present invention is tetracycline or a tetracycline derivative, examples of the “drug-controlled transcription silencer gene” in the present invention include, for example, tetracycline-controlled transcription silencer (Tetracycline-controlled transcriptional s).
ilencer; tTS) can be preferably used.

Specific examples of the above-mentioned tetracycline derivative in the present invention include doxoxycycline (doxycycli).
ne), anhydrotetracycline
ine), minocycline and the like. Further, as the drug other than tetracycline or a tetracycline derivative, for example, ecdysone,
Mifepriston, rapamycin and the like can be indicated.

When the “drug” in the present invention is ecdysone, the drug-responsive transcription factor of the present invention may be, for example, a fusion protein of RXR and VgEcR (RXR: Ret
inoidX receptor, VgEcR: VP16 / ecdysone receptor fu
sion gene). When the “drug” is mifepristone, as the drug-responsive transcription factor of the present invention, for example, GAL4-DBD / hPR-LBD / p65-AD fusion protein (GAL4 DBD: YeastGAL4 DNA binding domain, hPR-
LBD: Truncated human progesterone receptor ligand
binding domain, p65-AD: Human p65 activation dom
ain from NF-kB). When the “drug” is rapamycin, as the drug-reactive transcription factor of the present invention, for example, ZFHD1 / 3xFKBP fusion protein (3xFKBP: Three tandemly repeated copies of human)
FKBP12 protein, ZFHD1: HumanDNA binding domain c
omposed of two zinc finger domains from the human
transcription factor Zif268, joined to a homeodoma
in derived from the human transcription factor Oct
-1) can be mentioned.

The promoter in the present invention can be appropriately selected and used from promoters known to those skilled in the art in consideration of the type of foreign gene to be expressed, the type of cell into which the foreign gene is introduced, and the like. . Specifically, cytomegalovirus (CMV) -derived promoter, EF-1α promoter, β-actin promoter, Rous sarcoma virus-derived (RSV) promoter, SV4
0 promoter, TK promoter, PGK promoter, SRα promoter and the like can be exemplified.
It is not particularly limited to these.

The adenovirus vector DNA of the present invention is
It usually contains DNA that encodes a protein called fiber that the adenovirus genome has. Adenovirus has an icosahedral structure composed of 252 capsomeres, and 12 of them at the apex are called pentons, which have a protruding structure composed of a penton base and fibers.
When the adenovirus enters the cell, the fiber is CAR.
It is known to occur by binding to an adenovirus receptor called (coxsackievirus-adenovirus receptor). Therefore, adenovirus can be used for cells that do not express CAR (eg, respiratory epithelial cells, smooth muscle cells, T cells, macrophages, hematopoietic stem cells, dendritic cells, glioma cells) or cells that lack CAR expression. Normal,
It cannot be infected. The present inventors have developed an adenovirus vector capable of infecting cells that do not express CAR or cells with poor expression by modifying the adenovirus fiber (Mizuguchi, H.,
et. al., Gene Therapy 8: 730-735, 2001). The modified fiber of the adenovirus vector has a feature that a foreign peptide is inserted into the HI loop of the fiber knob.

In a preferred embodiment of the present invention, in order to enhance the infectivity of the adenovirus vector into cells, the vector DNA of the present invention is a fiber modified as described in (1) and / or (2) above. DNA encoding
May be included. The foreign peptide is not particularly limited as long as it is a peptide that specifically binds to or has an affinity for a protein existing on the surface of the cell (tissue) to be infected, and is usually on the surface of the cell to be infected. A peptide capable of binding (having affinity) to heparin sulfate or αv integrin.

Specific examples of the foreign peptide include Arg-
Gly-Asp (RGD), Asn-Gly-Arg (NGR), or Lys-Lys-Lys-
Mention may be made of polypeptides containing the Lys-Lys-Lys-Lys (K7) motif. For example, a vector in which an RGD sequence having an affinity for integrin is incorporated into a fiber is C
It is known that cells that do not express AR can be efficiently infected via RGD-integrin.

The adenovirus vector DNA of the present invention is
A vector plasmid having a known adenovirus genome (herein, simply referred to as "vector plasmid").
In some cases, those skilled in the art
It can be prepared using general genetic engineering technology. For example, it can be produced by a method based on plasmid construction by in vitro ligation, but is not limited to this method. The method utilizes a restriction enzyme that recognizes 9 to 11 bp or more, I-Ceu I and PI-Sce I, and inserts a foreign gene into the E1 deletion region by in vitro ligation to obtain a modified viral vector. This is a method of producing DNA. The above vector plasmid, which serves as the basis of the vector DNA of the present invention, usually has all adenovirus genomes except the E1 (or E1 / E3 or E1 / E3 / E4) region, and the E1 deletion region contains three adenovirus genomes. Unique site I
-Has Ceu I, Swa I, PI-Sce I sites. The shuttle plasmid usually has a kanamycin or ampicillin resistance gene, and those skilled in the art can use various known shuttle plasmids in which a promoter cassette is inserted in advance (Miguchi et al., Cell Engineering, Vol. 1).
8, p.1824-1827, 1999). In the present invention, as a shuttle plasmid, I-Ceu I and P are added at both ends of the gene expression unit.
Those having an I-Sce I site can be preferably used.

The foreign gene is cloned downstream of the promoter on the shuttle plasmid, and then cloned, for example, in I-Ceu.
E1 on the vector plasmid utilizing the I and PI-Sce I sites
It can be easily inserted into the (deletion) region.

Similarly, the drug-reactive transcriptional activation gene and the drug-controlled transcriptional silencer gene of the present invention are cloned into the downstream of the promoter on the shuttle plasmid, respectively, and then between the E3 region, the E4 region and the 3'end. Insertion into the region of ClaI or Csp45I or Xb
It is excised from the shuttle plasmid using the aI, AvrII, NheI or SpeI sites and inserted into the E3 region or the region between the E4 region and the 3'end on the adenovirus vector plasmid, respectively. In the present invention, a foreign gene, a drug-responsive transcriptional activation gene, and a drug-controlled transcriptional silencer gene are each operably linked downstream of a promoter, and a DNA fragment containing these genes in a state in which expression is possible is performed. Called "expression cassette".

In the adenovirus vector plasmid for producing the vector DNA of the present invention, a cloning site can be designed at the insertion site so that the expression cassette of the present invention can be easily inserted. . The cloning site can be, for example, a restriction enzyme recognition sequence. Thereby, the above-mentioned "expression cassette" of the present invention can be inserted into the restriction enzyme site in the vector DNA encoding the adenovirus genome. The cloning site may be a so-called multi-cloning site having a plurality of restriction enzyme recognition sequences. The design and construction of these cloning sites is
A person skilled in the art can perform this using general genetic engineering technology. The vector DNA of the present invention may have a gene or a DNA fragment other than the gene encoded by the adenovirus genome, in addition to containing the expression cassette.

More specifically, the production of the adenovirus vector DNA of the present invention can be carried out by the method described in Examples below, but is not limited to this method.

The modification of the fiber in the vector of the present invention can be carried out by a person skilled in the art by general genetic engineering techniques. For example, optimal sites for insertion of foreign peptides into fiber molecules (eg, HI
A unique restriction enzyme site is inserted into the genomic DNA encoding (loop), and a synthetic oligo DNA corresponding to the desired peptide sequence to be inserted by one-step in vitro ligation is introduced into the fiber gene region to facilitate fiber formation. A modified vector DNA can be prepared. More specifically, it can be produced by the method described in Examples below, but is not particularly limited to this method.

Further, the adenovirus vector DN of the present invention
Recombinant adenoviruses containing A are also included in the invention.
In the present invention, the adenovirus is referred to as "adenovirus vector" or simply "virus vector".

The packaging cell of the present invention (host cell for producing the viral vector of the present invention) can be any cell capable of producing the viral vector of the present invention,
There is no particular limitation. When the vector DNA of the present invention is constructed so that the E1 gene product is not expressed, the host cell from which the packaging cell of the present invention is derived normally encodes the viral genome required for adenovirus replication. It is a cell that contains a known E1 gene and can supply the gene product in trans. Specific examples of such cells include 293 cells and PER cells.

As the method for introducing the vector DNA of the present invention into cells, gene transfer methods well known to those skilled in the art, for example, calcium phosphate method, electroporation method,
Or lipofectamine, GIBCO BR
L), fusin (Fugene, Bohringer Mannheim), superfect (SuperFect, Qiagen) and the like can be used. The vector DNA of the present invention can optionally contain an ampicillin or nakamycin resistance gene for enabling drug selection in Escherichia coli.

The packaging cells into which the viral vector of the present invention has been introduced are cultured under appropriate conditions, and the viral particles released in the culture supernatant or in the cells (nuclei) are collected to obtain the target adenovirus. Viral vectors can be prepared.

The adenovirus vector of the present invention can be prepared by a method well known to those skilled in the art. Alternatively, a commercially available kit can be used. The preparation of an adenovirus vector usually comprises the steps of (1) virus growth and virus solution preparation, and (2) virus purification / concentration. Specifically, the above step (1) can be carried out as follows (Kanegae et al., Experimental Medicine separate volume, new edition, new genetic engineering handbook, revised third edition, p.202-209), but the following method is used. It is not particularly limited to. First, infect 293 cells with the virus solution, and
Incubate for 3-5 days, freeze-thaw or sonicate. Then, the supernatant is separated by low-speed centrifugation (3 krpm, 10 minutes), dispensed, rapidly frozen and stored at -80 ° C. In addition, (2) above
The step of can be performed as follows, for example. First, infect 293 cells with the virus solution, and
Incubate for 5 days and sonicate. Then high-speed centrifugation (10 krpm,
Collect the supernatant at 10 minutes. Perform step gradient centrifugation (25 krpm, 2 hours) to collect the virus band. Then, a second step gradient centrifugation (35 krpm, 3 hours) is performed, and the virus band is collected, dialyzed, and then dispensed and rapidly frozen. The titer of the prepared viral vector can be appropriately measured by a well-known method.

The recovered adenovirus can be purified to be substantially pure. The purification method can be carried out by known purification / separation methods including filtration, centrifugation, column purification and the like, or a combination thereof. "Substantially pure" means that the virus is the major component of the sample in which it is present. Typically, a substantially pure viral vector has a ratio of viral vector-derived proteins of 50% or more, preferably 70% or more, more preferably 80% or more, and It can be confirmed by preferably occupying 90% or more.

The adenovirus vector produced by the packaging cell of the present invention is useful in a wide range of research and medical fields. For example, in gene therapy or in the production of model animals, the gene of interest is ex vivo or in vitro.
Used as a vector for expression in vo. It is also useful as a vaccine for expressing an antigen protein or a protein that enhances immune function. It is also useful as an in vitro gene transfer vector for analyzing gene function. The vector can also be used to produce the desired protein. Further, it is also useful as a vector for preparing a library that expresses an unspecified cDNA molecular species, such as a cDNA expression library.

When a viral vector is prepared by using a disease-treating gene as a foreign gene, it becomes possible to administer this vector for gene therapy. As an application of the viral vector of the present invention to gene therapy, either the gene expression by direct administration or the gene expression by indirect (exvivo) administration causes a shortage of foreign genes that can be expected to have therapeutic effects or insufficient supply in the patient's body. It is possible to express the existing endogenous gene and the like. The foreign gene is not particularly limited, and may be a nucleic acid that does not encode a protein such as antisense or ribozyme, in addition to a nucleic acid that encodes a protein.

The viral vector of the present invention can be made into a composition with a desired pharmaceutically acceptable medium.
A "pharmaceutically acceptable carrier" is a material that can be administered with a vector and does not inhibit gene transfer by the vector. For example, the viral vector of the present invention can be appropriately diluted with physiological saline, phosphate buffered saline (PBS) or the like to form a composition. The composition containing the viral vector of the present invention may contain a medium such as deionized water or a 5% dextrose aqueous solution. further,
In addition, stabilizers, biocides and the like may be contained.

By introducing the viral vector obtained as described above or a composition containing the vector into a non-human mammal or mammalian cell, a foreign gene possessed by the viral vector is expressed in the animal or animal cell. be able to.

The protein that can be expressed by the viral vector of the present invention may be a desired protein regardless of whether it is a natural protein or an artificial protein. Examples of natural proteins include secretory proteins, membrane proteins, cytoplasmic proteins, nuclear proteins, hormones, cytokines, growth factors, receptors,
Examples include enzymes and peptides. Examples of artificial proteins include fusion proteins such as chimeric toxins, dominant negative proteins (including soluble molecule of receptor or membrane-bound dominant negative receptor), deletion type cell adhesion molecule and cell surface molecule, etc. . Further, it may be a protein to which a secretory signal, a membrane localization signal, a nuclear localization signal and the like are added. In addition, by expressing an antisense RNA molecule, an RNA-cleaving ribozyme, or the like, it is possible to suppress the expression of a gene whose expression in cells is not desired, or suppress the function of the gene product.

The viral vector of the present invention can be used as a gene therapy vector by using a disease therapeutic gene as the foreign gene. It is also possible to induce immunity in an animal by using a gene encoding a bacterial or viral antigen relating to an infectious disease as a foreign gene and administering the gene to the animal. That is, the vector of the present invention can be used as a DNA vaccine.

The viral vector of the present invention is administered in an amount (effective amount) sufficient for introduction into a non-human mammal or animal cell. "Sufficient amount" refers to the amount in the present invention in which a gene is introduced into an animal or cell so as to at least partially bring about a desired therapeutic or prophylactic effect.

The expression level of a foreign gene introduced into cells by administration of the vector of the present invention can be assayed by a method known to those skilled in the art. Transcripts of genes include, for example, Northern hybridization, RT-PC
It can be detected by R, RNA protection assay or the like. Detection by Northern hybridization or RT-PCR can be performed in situ. To detect the translation product, Western blotting using an antibody, immunoprecipitation, RIA, ELISA, pull-down assay and the like can be performed. Furthermore, in order to facilitate detection of gene introduction, it is possible to add a tag to the protein to be expressed or incorporate a reporter gene so as to express it. Reporter genes include β-galactosidase, chloramphenicol acetyltransferase (CAT), alkaline phosphatase, or GFP (G
Examples include genes encoding reen Fluorescent Protein), but are not particularly limited thereto.

The dose of the vector depends on the disease, the weight of the patient,
Although it depends on age, sex, symptoms, administration purpose, transgene, etc., it can be appropriately determined by those skilled in the art.
Preferably, the amount of vector administered is from about 10 ⁵ pfu to about 10 ^5.
It should be in the range of ¹² pfu. More preferably, the amount of vector administered is in the range of about 10 ⁷ pfu to about 10 ¹⁰ pfu. Most preferably, about 10 ⁸ pfu to about 10 ⁹ pfu
It is preferred to administer an amount in the range of in a pharmaceutically acceptable carrier.

The present invention also includes cells produced as described above, which contain the vector DNA of the present invention, or non-human mammals containing the vector DNA of the present invention.

The present invention further provides methods for regulating the expression of foreign genes in non-human mammals or mammalian cells. The method comprises the adenovirus vector of the invention.
The method includes the step of providing a non-human mammal or a mammalian cell into which DNA has been introduced (step (a)), and the step of administering an agent to the mammal or the mammalian cell provided in step (a).

In this method, a desired animal or cell in which the expression of a foreign gene is desired to be regulated can be used as the non-human mammal or mammalian cell. For example, non-human mammals in which expression regulation of foreign genes may be useful according to this method include mice, rats, rabbits, monkeys, dogs, hamsters, pigs, cats, cows, goats and the like. Further, as the mammalian cells, human-derived cells are particularly useful, but the mammalian cells of the present invention are not particularly limited, and for example, mouse, rat, rabbit, monkey, dog, hamster, pig, cat,
Bovine or goat-derived cells can be used.

[0058]

EXAMPLES The present invention will be specifically described below with reference to examples, but the present invention is not limited to these examples.

[Example 1] Construction of vector (1) Construction of vector plasmid pAdHM48 The present inventors cloned a unique restriction site, XbaI site, into E4 of adenovirus genome cloned in the plasmid.
And introduced in the area between 3'ITR. The newer vector plasmid pAdHM48 contains E1 deletion region (Δbp342 to 3523), E3
The deletion region (Δbp27865 to 30995) and the region between E4 and 3′ITR (bp35811 of the adenovirus genome) contain I-CeuI / SwaI / PI-SceI, Csp45I, and XbaI sites, respectively (FIG. 1). 2).

The vector plasmid pAdHM48 was constructed as follows. Right end of adenovirus genome (35464
~ Right end) EcoRI / XbaI fragment of pGEM-ITR (Mizuguchi,
H. and Kay, MA (1999) A simple method for cons
tructing E1 and E1 / E4 deleted recombinant adenovir
us vector.Hum. Gene Ther., 10, 2013-2017), pGE
EcoRI after changing ClaI or EciI site of M-ITR to XbaI site
Ligation with the / XbaI fragment resulted in pGEM-ITR1. Next, BamHI site of pGEM-ITR1 and EciI of pGEM-ITR
After changing the sites to ClaI and XbaI sites respectively, pG
PGEM-ITR2 was constructed by ligation of the ClaI / XbaI fragment of EM-ITR1 and ClaI / XbaI of pGEM-ITR. pGEM-IT
The AvrII / ClaI fragment of R2 was ligated to the AvrII / ClaI fragment of pEco-ITR15 to change the PacI site of pAdHM19 into a ClaI site, and then pGEM7Zf (+) (Promega Corp., Madison, USA) was used for EcoRI / of pAdHM19. The PacI fragment was cloned into pEco-ITR16.

Then, the EcoRI / BamHI fragment of pHM15 and pEco-I
Ligation of TR16 with EcoRI / BamHI fragment resulted in pHM15
-Build ITR16. Finally, pAdHM48 was constructed by ligation of the Csp45I / XbaI fragment of pAdHM19 and the Csp45I / SpeI fragment of pHM15-ITR16. The ClaI site at the right end of the adenovirus genome is the oligonucleotide (5'-CGTTAATTAA-
The PacI site was changed by using 3 '/ SEQ ID NO: 1). pAdHM48 has an IC in the E1 deletion region (Δbp342-3523).
It has euI, SwaI, and PI-SceI sites and has an E3 deletion region (△
bp27865-30995) and a complete E1 / E3 deleted adenovirus genome with an XbaI site in the region between E4 and 3'ITR (bp 35811 of the adenovirus genome) (Figs. 1, 2).

(2) Construction of shuttle plasmid pHM15 As an aid for introducing the gene of interest into the region between E4 and 3'ITR, XbaI / AvrII / NheI / Sp at both ends of the multiple cloning site.
A shuttle plasmid pHM15 containing an eI site was also constructed. Xba
I, AvrII, NheI, and SpeI form a cohesive cohesive end, so XbaI along with AvrII, NheI, and SpeI sites.
The site can be used for cloning into the XbaI site of pAdHM48. Therefore, a simple plasmid construction based on in vitro ligation can insert a foreign gene into the E1 and E3 deletion regions and the region between E4 and 3′ITR.

Shuttle plasmid pHM15 was constructed as follows. XbaI site of pHM5 (Mizuguchi, H. and Kay,
MA (1999) A simple method for constructing E1
and E1 / E4 deleted recombinant adenovirus vector. H
um. Gene Ther., 10, 2013-2017) and then I-Ceu
The I / SphI digested plasmid was labeled with oligonucleotide 1 (5'-TCTA
GACCTAGGGCTAGCACTAGTGCGGCCGCCATG-3 '/ SEQ ID NO:
2) and 2 (5'-GCGGCCGCACTAGTGCTAGCCCTAGGTCTAGATT
Ligation with AG-3 '/ SEQ ID NO: 3), pHM
Got 14. EcoRI / PI-SceI digested pHM14 with oligonucleotide 3 (5'-AATTCCAGCTGGGGCCCACTAGTGCTAGCCCTAGGTCTAGAG
TGC-3 '/ SEQ ID NO: 4) and 4 (5'-TCTAGACCTAGGGCTA
Ligation with GCACTAGTGGGCCCCAGCTGG-3 '/ SEQ ID NO: 5) gave pHM15. pHM15 contains XbaI / AvrII / NheI / SpeI sites at both ends of the multiple cloning site (FIGS. 1 and 2).

(3) Construction of Recombinant Adenovirus Vector Using pAdHM48, the present inventors have succeeded in luciferase (tet).
-Expressed by a responsive promoter), rtTA (expressed by CMV promoter), and tTS (expressed by EF-1α promoter) expression cassettes for E1 deletion region, E3 deletion region, and E4 and 3'ITR A luciferase-expressing adenovirus vector, Ad-rtTA-tTS-L, cloned in the region between the two was prepared (FIGS. 1 and 2).

The inventors have used different types of P (A) in Ad-rtTA-tTS-L to avoid recombination of the adenovirus genome. BG for luciferase expression
HP (A), SV40 P (A) for rtTA expression and mRBG P (A) for tTS expression were used. AdOn-L4 is a control vector containing luciferase (expressed by Tet-responsive promoter) and rtTA (expressed by CMV promoter) expression cassettes in the E1 and E3 deletion regions, respectively (Mizuguchi, H. and Hayakawa, T. (2002) T
he tet-off system is more effective than the tet-o
n system forregulating transgene expression in sin
gle adenoviral vector. J. Gene Med. in press). Ad
-rtTA-IRES-tTS-L contains the rtTA and tTS expression cassettes as a bicistronic construct with IRES in the E3 deletion region. When two or more genes are linked by the IRES sequence,
Efficient expression from a single promoter (Mountford, PS and Smith, AG (1995) Inter
nal ribosome entry site and dicistronic RNAs in ma
mmalian transgenesis. Trends Genet., 11, 179-18
Four). As another type of vector, we use AdB
I-rtTA-L and Ad-tTS-BI-rtTA-L were prepared, and both were rt
It utilizes a bidirectional promoter based on the tet-responsive element to express TA and luciferase. Co-regulation of two types of gene products can be obtained by one central TRE element, which lies between the two minimal CMV promoters (Baro
n, U., Freundlieb, S., Gossen, M. and Bujard, H.
(1995) Co-regulation of two geneactivities by tetr
acycline via a bidirectional promoter.Nucleic Aci
dsRes., 23, 3605-3606). Ad-tTS-BI-rtTA-L and E4
The region between the 3'ITRs contains the tTS expression cassette.

The adenovirus vector was constructed as follows by the modified in vitro ligation method described previously (Mizuguchi, H. and Kay, MA (1998) Ef.
ficient construction of a recombinant adenovirus v
ector by an improved in vitro ligation method. Hu
m. Gene Ther., 9, 2577-2583; Mizuguchi, H. and Ka
y, MA (1999) A simple method for constructing E
1 and E1 / E4 deleted recombinant adenovirus vector.
Hum. Gene Ther., 10, 2013-2017). pAdHM48-rtTA-tT
Regarding the construction of SL, human elongation factor-1α (EF-1α) promoter / tTS gene / minimal rabbit β globin (mRB
G) An expression cassette containing P (A) was inserted into pHM15, and the AvrII fragment of the obtained plasmid pHM15-tTS was inserted into the XbaI site of pAdHM48 to obtain pAdHM48-tTS. Next, pHM13-rtTA obtained by cloning CMV promoter / intron A / rtTA gene / SV40P (A) into pHM13 (Mizuguchi, H., Kay, M.
A. and Hayakawa, T. (2001) In vitro ligation-based
cloning of foreign DNAs into the E3 as well as E1
deletion region for generation of recombinant ade
novirus vector.BioTechniques, 30, 1112-1116) Cl
Digested with aI and ligated with Csp45I digested pAdHM48-tTS to give pAdHM48-rtTA-tTS. Finally, tet-
Reactive promoter (TRE / CMV) / luciferase gene / bovine growth hormone (BGH) P (A) cloned into pHM5 pHM5-TREL2 was digested with I-CeuI and PI-SceI to give I-CeuI / PI-SceI Ligation with digested pAdHM48-rtTA-tTS resulted in pAdHM48-rtTA-tTS-L (FIGS. 1 and 2).

PAdHM4-BI-rtTA-L is a BGHP (A) / luciferase gene / bidirectional tet-responsive promoter (pBI
(From Clontech, Palo Alto, Calif.) / RtTA gene / SV40 P (A) cassette, pAdHM4
E1 deletion region (I-CeuI-PI-SceI site) of (Mizuguchi, H.
and Kay, MA (1998) Efficient construction of ar
ecombinant adenovirus vector by an improved in vit
ro ligation method. Hum. Gene Ther., 9, 2577-258
Constructed by inserting into 3). pAdBI-rtTA-L
Luciferase and tet-reactive element (TRE)
Is capable of expressing rtTA from a single bidirectional tet-responsive promoter that is located between two minimal CMV promoters (Baron, U., Freundlieb, S., Gossen, M.
and Bujard, H. (1995) Co-regulation of two gene ac
tivities by tetracycline via a bidirectional promo
ter. Nucleic Acids Res., 23, 3605-3606). As a result, the bidirectional tet-responsive promoter is
-Since there is no binding of rtTA to the operator sequence, it is silent.

AdHM19-rtTA-IRES-tTS-L is a CMV promoter / intron A / rtTA gene / encephalomyocarditis virus
Internal ribosome entry site derived from 5'untranslated region (IRE
S) / tTS gene / SV40P (A) and TRE / CMV / luciferase gene / BGH P (A) in E3 of pAdHM19 (Csp45I site)
And the E1 deletion region (I-CeuI / PI-SceI site).

PAdHM48-tTS-BI-rtTA-L is a BGH P (A) / luciferase gene / bifunctional tet-reactive promoter /
It was constructed by inserting the rtTA gene / SV40 P (A) cassette into the E1 deletion region (I-CeuI / PI-SceI site) of pAdHM48-tTS.

Table 1 shows a comparison of the structures of the adenovirus vectors used in this example.

[0071]

[Table 1]

[Example 2] Controlled expression of luciferase in human cells First, the dose-dependence of doxocyclin on luciferase production was examined using AdOn-L4, AdBI-rtTA-L, Ad-rtTA-IRES.
Comparison with SK HEP-1 cells transduced with -tTS-L, Ad-tTS-BI-rtTA-L, or Ad-rtTA-tTS-L (Fig. 3). To date, AdOn-L4 is known to mediate a relatively low regulated production of luciferase (Mizuguchi, H. an.
d Hayakawa, T. (2002) The tet-off system is more e
ffective than the tet-on system for regulating tra
nsgene expression in single adenoviral vector. J.
Gene Med. In press). The regulation coefficient by AdOn-L4 (ratio of maximum production value and minimum production value (basal activity value)) is 6.6 (M
OI = 5), and 15.5 (MOI = 50). Adenovirus vector containing a bidirectional promoter (AdBI-rtTA-L
And Ad-tTS-BI-rtTA-L) failed to regulate luciferase production. Ad-rtTA-IRES-tTS-L-mediated regulation of luciferase production was less than AdOn-L4. In contrast, Ad-rtTA-tTS-L mediated tightly regulated luciferase production. The adjustment factors by Ad-rtTA-tTS-L were 310 (MOI = 5) and 2515 (MOI = 50). The background level of luciferase production by Ad-rtTA-tTS-L is 2-6 compared to AdOn-L4.
The level of induction by Ad-rtTA-tTS-L decreased by a factor of 2.
It was more than 30 times higher than that of.

To examine whether the above results are applicable to other cell types, HeLa and ECV304 cells were transduced with the respective vectors (MOI = 5, 50), background (minimum) and induced. The luciferase production was measured (FIG. 4). The regulatable luciferase production pattern in HeLa and ECV304 cells was similar to that of SK HEP-1 cells. All cells transduced with AdOn-L4 showed lower levels of luciferase production regulation, whereas cells transduced with Ad-rtTA-tTS-L produced high levels of luciferase production in a tightly regulated manner. Indicated. AdBI-rtTA-L and Ad-tTS-BI-rtTA-L also failed to regulate expression, but Ad-tTS-BI-
ECV304 cells transduced with rtTA-L (MOI = 50) showed low levels of regulation. Ad-rtTA-IRES-tTS-L is AdOn-L
It did not improve regulation in HeLa cells compared to 4, but slightly improved regulation in ECV304 cells. Ad-r
The background level of luciferase in ECV304 cells transduced with tTA-IRES-tTS-L was 9-15 fold lower than that in cells transduced with AdOn-L4, but Ad-rtTA
The luciferase-inducing activity of cells transduced with -IRES-tTS-L was lower than that of cells transduced with AdOn-L4.

Next, the present inventors have confirmed that AdOn-L4 or Ad-rt
Induced luciferase production in cells transduced with TA-tTS-L was compared to cells transduced with an adenovirus vector containing a CMV promoter / enhancer driven luciferase expression cassette (Ad-L2) (Figure 5). CMV
Promoters / enhancers are the most widely used for foreign gene expression and are known to induce high levels of foreign gene expression. Ad-rtTA-tTS-L is SK
It mediated similar or higher levels of luciferase production in HEP-1, HeLa, and ECV304 cells. In contrast, AdOn-L4 is 10 in all cell types more than Ad-L2.
It mediated more than a twofold lower luciferase production. From these results, the adenovirus vector containing the gene of interest, rtTA, and tTS gene in the E1 deletion region, the E3 deletion region, and the 3'ITR-neighboring region is better than the adenovirus vector containing the tet-off system. It was suggested to show a high level of activation (regulation) of foreign gene expression.

[Example 3] Code modified fiber
Construction of adenovirus vector DNA containing DNA Vector plasmids pAdHM15, -16, -17 and -18 were constructed as follows. PEco-ITR1 (Mizuguchi, including the right end of type 5 adenovirus genome (from adenovirus genome 27331 bp to right end of the genome (△ 27865-30995)))
H. and Kay, MA (1999) Efficient construction of a
recombinant adenovirus vector by an improved in v
itro ligation method. Hum. Gene Ther. 9, 2013-201
7) is cut with ApaI and MunI, and AatII and Bsa
It has AgeI and MunI sites between I sites, PvuII and Bst1107I
PBR322-derived plasmid with a deletion between the site and
It was ligated with the ApaI / MunI fragment of pBR-AM2. The resulting plasmid, pBR-AM3, contains the adenovirus genome (31905
~ 32825) are included. Next, the pBR-AM3 ApaI / AseI fragment, the pBR-AM3 ApaI / BsmAI fragment, the pBR-AM3 BsaAI fragment,
And oligonucleotide 5 (5'-AACAGGAGACACAACTTCGA
ACATCGATCCAAGTGCATACTCTATGTCATTTTCATGGGACTGGTCTGGC
CACAACTACAT-3 '/ SEQ ID NO: 6) and 6 (5'-TAATGTAG
TTGTGGCCAGACCAGTCCCATGAAAATGACATAGAGTATGCACTTGGATC
4 using GATGTTCGAAGTTGTGTCTCC-3 '/ SEQ ID NO: 7)
One piece was ligated to obtain pBR-AM4. pEco-AM4
Was constructed by ligating the HpaI / MunI fragment of pBR-AM4 and the HpaI / MunI fragment of pEco-ITR5, the latter containing the right end of the type 5 adenovirus genome (2733 of the genome).
1bp to the right end (△ 28133 to 30818)). Finally, it is a derivative of pAdHM2 (Mizuguchi, H. and Kay, MA (1998) Hum.
Gene Ther. 9, 2577-2583) pAdHM15-1 was constructed by ligating the SrfI / ClaI fragment of pAdHM2-1 and the Srf / ClaI fragment of pEco-AM4, and then oligonucleotide A (5'-CGTTAATTAA-3 '/ SEQ ID NO: 1) was used to change the ClaI site at the right end of the adenovirus genome into a PacI site (final plasmid pAdHM15). pAdHM16,
-17 and -18 were constructed in the same way. pAdHM1
5, -16, -17, and -18 have I-CeuI, Swa in the E1 deletion region.
I, and PI-SceI sites, and Csp45I and / or between positions 32679-32680 (threonine residue 456-proline 547 of the fiber protein) of the adenovirus genome.
Or complete E1 / E3 with ClaI (dammethylation) site
It has a deleted adenovirus genome.

To construct a vector plasmid with an exogenous oligonucleotide corresponding to the RGD-4C peptide CDCGRDCFC (SEQ ID NO: 8), which binds with high affinity to integrins (αvβ3 and αvβ5) on the cell surface (Arap, W., et. Al., (1997) Cancer treatment by
targeted drug delivery to tumor vasculature ina m
ouse model. Science 279, 377-380; Pasqualini, R.,
et. al., (1997) Alpha v integrins as receptors for
tumor targeting by circulating ligands.Nat.Biote
chnol. 15, 542-546; Koivunen, E., et al., (1995) P
hage libraries displaying cyclic peptides with dif
ferent ring sizes: ligand specificities of the RGD
-directed integrins. Biotechnology 13, 265-270), p
AdHM15 was cleaved with Csp45I / ClaI to give oligonucleotides 7 (5'-GGAAGTGTGACTGCCGCGGAGACTGTTTCTG-3 '/ SEQ ID NO: 9) and 8 (5'-CGCAGAAACAGTCTCCGCGGCAGTCACA).
It was ligated to CTT-3 '/ SEQ ID NO: 10). Then, transforming the ligated DNA into DH5α,
pAdHM15-RGD was obtained.

Furthermore, an adenovirus vector having the NGR peptide CNGRCVSGCAGRC (SEQ ID NO: 11) on the fiber knob was used as an oligonucleotide 9 (5'-CGGCTGCAACGG
CCGCTGCGTGAGCGGCTGCGCCGGCCGCTG-3 '/ SEQ ID NO: 1
2) and 10 (5'-CGCAGCGGCCGGCGCAGCCGCTCACGCAGCGGC
CGTTGCAGC-3 '/ SEQ ID NO: 13) is the ClaI of pAdHM15 above.
It was prepared by inserting into the site.

[0078]

INDUSTRIAL APPLICABILITY The present invention provides an adenovirus vector capable of controlling the expression of foreign genes. The vector DNA of the present invention is characterized by having a structure in which a cassette for expressing three genes is inserted into one vector, and compared to the case where conventional three genes are expressed in separate vectors, Gene expression can be controlled efficiently and easily. By using the vector of the present invention, it is possible to efficiently control the expression of a foreign gene in non-human mammals or mammalian cells, and it is very useful in gene therapy and the like.

Further, the vector of the present invention is also useful as a research tool for directly expressing a target gene in the tissue of an animal individual and analyzing its function.

[0080]

[Sequence list]                                SEQUENCE LISTING        <110> National Institute of Health Sciences       Mizuguchi, Hiroyuki       Hayakawa, Takao <120> Novel adenovirus vectors containing trinal gene expression system <130> C1-A0202 <140> <141> <160> 13 <170> PatentIn Ver. 2.0 <210> 1 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Artificially       Synthesized Sequence <400> 1 cgttaattaa 10 <210> 2 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Artificially       Synthesized Sequence <400> 2 tctagaccta gggctagcac tagtgcggcc gccatg 36 <210> 3 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Artificially       Synthesized Sequence <400> 3 gcggccgcac tagtgctagc cctaggtcta gattag 36 <210> 4 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Artificially       Synthesized Sequence <400> 4 aattccagct ggggcccact agtgctagcc ctaggtctag agtgc 45 <210> 5 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Artificially       Synthesized Sequence <400> 5 tctagaccta gggctagcac tagtgggccc cagctgg 37 <210> 6 <211> 81 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Artificially       Synthesized Sequence <400> 6 aacaggagac acaacttcga acatcgatcc aagtgcatac tctatgtcat tttcatggga 60 ctggtctggc cacaactaca t 81 <210> 7 <211> 79 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Artificially       Synthesized Sequence <400> 7 taatgtagtt gtggccagac cagtcccatg aaaatgacat agagtatgca cttggatcga 60 tgttcgaagt tgtgtctcc 79 <210> 8 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Artificially       Synthesized Peptide <400> 8 Cys Asp Cys Gly Arg Asp Cys Phe Cys   1 5 <210> 9 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Artificially       Synthesized Sequence <400> 9 ggaagtgtga ctgccgcgga gactgtttct g 31 <210> 10 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Artificially       Synthesized Sequence <400> 10 cgcagaaaca gtctccgcgg cagtcacact t 31 <210> 11 <211> 13 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Artificially       Synthesized Peptide <400> 11 Cys Asn Gly Arg Cys Val Ser Gly Cys Ala Gly Arg Cys   1 5 10 <210> 12 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Artificially       Synthesized Sequence <400> 12 cggctgcaac ggccgctgcg tgagcggctg cgccggccgc tg 42 <210> 13 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Artificially       Synthesized Sequence <400> 13 cgcagcggcc ggcgcagccg ctcacgcagc ggccgttgca gc 42

[Brief description of drawings]

FIG. 1 shows a strategy for constructing an adenovirus vector containing a triple gene expression system. XbaI-Av digested pAdHM48
Ligated with rII-digested pHM15-tTS. The resulting plasmid pAdHM48-tTS was digested with Csp45I to generate ClaI
Ligated with digested pHM13-rtTA. Next, the obtained plasmid pAdHM48-tTS-rtTA was digested with I-CeuI and PI-SceI to obtain I-CeuI and PI-SceI digested pHM5-TREL2.
Was ligated. The resulting plasmid pAdHM48-tT
S-rtTA-L is digested with PacI and transfected into 293 cells, resulting in a recombinant adenovirus vector with an improved tet-on system.

FIG. 2 is a continuation of FIG.

FIG. 3 shows luciferase production in various adenovirus-mediated tet-on systems in SK HEP-1 cells. AdOn-L4, AdBI-rtTA-L, Ad-rtTA-IR on SK HEP-1 cells
ES-tTS-L, Ad-tTS-BI-rtTA-L, or Ad-rtTA-tTS-L was transduced (A: MOI = 5, B: MOI = 50) and the medium alone was used.
Alternatively, it was cultured with a medium containing various concentrations of doxocycline. After 48 hours of culture, luciferase production in cells was determined. Luciferase production in non-transduced cells was 0.5 ± 0.2 pg / 10 ⁵ . Each value represents the mean value ± SD of 3-4 experiments.

FIG. 4 shows luciferase production in various adenovirus-mediated tet-on systems in HeLa and ECV304 cells. HeLa (A-1, A-2) and ECV304 (B-1, B-
2) AdOn-L4, AdBI-rtTA-L, Ad-rtTA-IRES-tTS- in cells
L, Ad-tTS-BI-rtTA-L, or Ad-rtTA-tTS-L (A-1, B-
1: MOI = 5; A-2, B-2: MOI = 50). Cells were incubated for 48 hours with no doxocyclin (white column) and with doxocycline (10 ⁴ ng / ml) (shaded column). After 48 hours of culture, luciferase production in cells was determined. Non-transduced HeLa and ECV304
Luciferase production in cells was 4.6 ± 2.2 each
And 0.7 ± 0.1 pg / 10 ⁵ pieces. Each value is
The mean value of 5 experiments ± SD is shown.

[Figure 5] Shapes AdOn-L4, Ad-rtTA-tTS-L, or Ad-L2
Comparison of induced luciferase production in transfected cells
FIG. SK HEP-1 (A), HeLa (B) and ECV304
(C) Form AdOn-L4, Ad-rtTA-tTS-L, or Ad-L2 in cells
Quality (MOI = 5 or 50), including doxocycline
First, or Doxocycline (10 ^Four ng / ml)
Cultured. Production of luciferase in cells after 48 hours
The amount was determined. For AdOn-L4 and Ad-rtTA-tTS-L,
It showed large induced luciferase production. To non-transduced cells
Luciferase production in is shown in Figures 3 and 4.
It Each value represents the average of 5 experiments ± SD.

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁷ Identification code FI theme code (reference) C12N 5/10 C12N 5/00 B (72) Inventor Hiroyuki Mizuguchi 1-18-1 Kamigaga, Setagaya-ku, Tokyo National Institute of Medical Science and Hygiene, Department of Gene and Cell Medicine (72) Inventor Takao Hayakawa 1-1-18 Kamigaga, Setagaya-ku, Tokyo F-Term (Reference) 4B024 AA01 CA03 DA02 EA02 FA02 GA18 HA17 4B065 AA90 AB01 BA02 CA44 4C084 AA01 AA13 AA18 4C087 AA01 BC83

Claims (14)

[Claims] 1. The E1 region of the adenovirus genome, E3
To the region and between the E4 region and the 3'end (a)
A foreign gene expression cassette having a structure in which a foreign gene is functionally linked downstream of a drug-responsive promoter,
(B) a drug-responsive transcription activation gene expression cassette having a structure in which a drug-responsive transcription activation gene is functionally linked downstream of the promoter; and (c) a drug-regulated transcription silencer gene functions downstream of the promoter. Recombinant adenovirus vector DNA characterized in that expression cassettes of drug-regulated transcription silencer genes each having a structurally linked structure are inserted and the expression of a foreign gene is controlled by the drug. 2. A foreign gene expression cassette is inserted into the E1 deletion region of the adenovirus genome.
The adenovirus vector DNA according to claim 1. 3. The adenovirus vector DNA according to claim 1, wherein the expression cassette of the drug responsive transcription activation gene is inserted into the E3 deletion region of the adenovirus genome. 4. The E1 gene product is not expressed.
Adenovirus vector DN according to any one of
A. 5. The adenovirus vector DNA according to claim 1, wherein the promoter described in (b) is a promoter derived from cytomegalovirus. 6. The promoter according to (c) is EF-1.
The adenovirus vector DNA according to any one of claims 1 to 4, which is an α promoter. 7. The recombinant adenovirus vector DNA according to claim 1, wherein the drug is tetracycline or a tetracycline derivative. 8. The recombinant adenovirus vector according to claim 7, wherein the drug-responsive transcription activator gene is a reverse tetracycline-responsive transcription activator gene and the drug-controlled transcription silencer gene is a tetracycline-controlled transcription silencer gene. DNA. 9. A recombinant adenovirus vector containing the adenovirus vector DNA according to claim 1. 10. The recombinant adenovirus vector DNA according to claim 1, which has been introduced.
A packaging cell for producing the recombinant viral vector according to 1. 11. The packaging cell according to claim 10, which is derived from 293 cells. 12. A method for producing a recombinant adenovirus vector according to claim 9, comprising the step of culturing the cell according to claim 10 or 11 and collecting the produced virus particles. 13. A method for regulating the expression of a foreign gene in a non-human mammal or mammalian cells, which comprises the following steps (a) and (b). (A) a step of providing a non-human mammal or a mammalian cell into which the adenovirus vector DNA according to any one of claims 1 to 8 has been introduced (b) an agent to the mammal or the mammalian cell of the step (a), Administering process 14. A gene therapy composition comprising the adenovirus vector DNA according to any one of claims 1 to 8.