JP2003310263A - Minichromosome holding variety originated from arabidopsis thaliana - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a nucleic acid useful for the construction of an artificial chromosome suitable for Arabidopsis thaliana and a minichromosome-holding variety originated from Arabidopsis thaliana, capable of stably holding the minichromosome acting as an independent chromosome, useful for the supply of the minichromosome and having excellent transforming property. <P>SOLUTION: The nucleic acid contains a tandem repeat sequence composed of a cluster of 40-60 kb holding an element composed of a specific sequence or its homolog sequence as a unit and has a centromere function. The minichromosome-holding variety holds the minichromosome originated from Columbia which is an ecotype of Arabidopsis thaliana, containing the nucleic acid, a transposable genetic element composed of other specific sequence or its homolog sequence and a telomere structure, sitting on the short arm of the 4th chtomosome of Arabidopsis thaliana, and independently acting in meiotic division without pairing with the 4th chromosome. <P>COPYRIGHT: (C)2004,JPO

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a nucleic acid having a centromere function of Arabidopsis thaliana and a minichromosome-holding strain derived from Arabidopsis thaliana.

[0002]

2. Description of the Related Art In elucidating the function of plants and breeding,
Techniques such as gene disruption and gene transfer are considered to be important techniques.

Arabidopsis is one of the plants under study as a model for plant research. The size of the chromosome of Arabidopsis thaliana is 17.5 to 29.1.
At present, it is Mb and is too large as a vector used for gene disruption and gene transfer.

[0004]

DISCLOSURE OF THE INVENTION An object of the present invention is to provide a nucleic acid useful for constructing an artificial chromosome suitable for Arabidopsis. Further, the present invention, it is possible to stably hold a minichromosome that can act as an independent chromosome,
It is an object of the present invention to provide an Arabidopsis thaliana-derived minichromosome-carrying line which is useful for supplying the minichromosome and is excellent in transformability.

[0005]

The gist of the present invention is [1]
40 to 60 kb in which the element consisting of the nucleotide sequence shown in SEQ ID NO: 1 or a homologue thereof is 1 unit
Contains a tandem repeat sequence consisting of
And a nucleic acid having a centromere function, [2] wherein the centromere function is a function of partitioning a minichromosome containing the nucleic acid according to [1] above into two daughter cells during meiosis. ] The nucleic acid of description, and [3]
It is derived from Colombia, which is an ecotype of Arabidopsis thaliana, and has the following (a) to (c): (a) the nucleic acid described in [1] or [2] above, (b) the nucleotide sequence shown in SEQ ID NO: 2 or A minichromosome containing a transposable genetic element consisting of a homolog sequence, and (c) a telomere structure, which loci on the short arm of chromosome 4 of Arabidopsis thaliana, and which is present at the time of meiosis 4
The present invention relates to a minichromosome 4S-retaining line, which holds a minichromosome that acts independently without pairing with a chromosome.

[0006]

BEST MODE FOR CARRYING OUT THE INVENTION The nucleic acid of the present invention contains a tandem repeat sequence consisting of a cluster of 40 to 60 kb in which the element consisting of the nucleotide sequence shown in SEQ ID NO: 1 or a homologue thereof is 1 unit, and the centromere It has a function. The nucleic acid of the present invention expresses the excellent property of exhibiting the centromere function although it is shortened as compared with the centromere on chromosome 4 of Arabidopsis thaliana.

[0007] In the present specification, the centromere function means a function of evenly distributing the minichromosome containing the nucleic acid of the present invention to two daughter cells during meiosis. Such centromere function can be evaluated, for example, by observing the dynamics of minichromosomes during meiosis by a conventional method, for example, a light microscope (a DAPI-stained sample is a fluorescence microscope in particular). For example, germinated seeds and anthers of Arabidopsis thaliana are fixed, and the resulting product is treated with an enzyme capable of destroying the cell wall, such as cellulase and pectinase, to obtain a cell slide preparation by a suitable method, and By subjecting the slide preparation to a conventional Giemsa staining method, DAPI staining method, etc., the dynamics of the minichromosome can be observed. At this time, the case where the minichromosomes are evenly distributed to the two daughter cells may be used as an index for having the centromere function.

The element consisting of the nucleotide sequence shown in SEQ ID NO: 1 is a sequence found in the centromere of the Arabidopsis thaliana chromosome. The cluster in which the element consisting of the nucleotide sequence represented by SEQ ID NO: 1 is one unit is a tandem repeat sequence called 180-bp or pAL1 family. The family is known to play an important role in forming large clusters of approximately 100-1200 kb and functioning as centromeres. However, in the present invention, even a very short cluster of 40 to 60 kb surprisingly exhibits the excellent effect of exhibiting the centromere function. Therefore, when constructing an artificial chromosome or the like, it is possible to further reduce the size.

[0009] Arabidopsis has five types of chromosomes (n = 5), and its centromere region has 18 chromosomes.
A cluster is formed with 0 bp element as one unit, and the size of the cluster is from several hundred kb to 1.
It is estimated to be 2 Mb, but surprisingly, the minichromosome has a characteristic that its centromere size is extremely short.

The base sequence shown in SEQ ID NO: 1 is at least one, specifically, 1 within the range in which the nucleic acid of the cluster having the element consisting of the base sequence as one unit can express the centromere function. Alternatively, it may be a homologous sequence that differs depending on a plurality of nucleotides. That is, such a sequence may have a mutation that may occur in nature or an artificial mutation, as long as it can exert the centromere function. The homologous sequence is at least 90%, preferably 95% or more, more preferably 98% or more, even more preferably, with SEQ ID NO: 1 when analyzed for homology based on the BLAST algorithm. Sequences having a homology of 99% or more are included. Examples of the consensus sequence of the homolog sequence include the base sequence shown in SEQ ID NO: 8.

The present invention also provides a minichromosome-carrying strain of Arabidopsis thaliana capable of supplying a minichromosome carrying the nucleic acid of the present invention and capable of acting as an independent chromosome. .

The minichromosome-holding line of the present invention is a minichromosome containing the nucleic acid of the present invention, is useful for supplying minichromosomes that can act as independent chromosomes, and has an excellent property of high transformability. Express. Specifically, the minichromosome-retaining line of the present invention is derived from Colombia, which is an ecotype of Arabidopsis thaliana, and has the following (a)-
(C): a minichromosome containing (a) the nucleic acid of the present invention, (b) a transposable genetic element comprising the nucleotide sequence shown in SEQ ID NO: 2 or a homologue thereof, and (c) a telomere structure. , And a strain having a mini-chromosome that sits on the short arm of chromosome 4 of Arabidopsis thaliana and acts independently during meiosis without pairing with the fourth chromosome.

The nucleotide sequence shown in SEQ ID NO: 2 of (b) above was identified by the present inventors as being a retrotransposon-like sequence 106 which was found to be localized on the minichromosome.
It is the sequence of B. The base sequence shown in SEQ ID NO: 2 may be a homolog sequence that differs by at least one, specifically, one or more nucleotides, within the range of exhibiting biologically equivalent properties. The homologue sequence is at least 90%, preferably 95% or more, and more preferably, with SEQ ID NO: 2 when analyzed for homology based on the BLAST algorithm.
Sequences having a homology of 98% or more, and even more preferably 99% or more can be mentioned.

The telomere structure is a structure characterized by being newly added to the cleaved site in the centromere sequence.

In addition to (a) to (c) above, the mini-chromosome has a cluster of the 18S-5.8S-25S ribosomal RNA gene and the 5S ribosomal RNA gene, and is located on the chromosome 4. It has the structural feature that it retains the sequence of cosmid clone g6844, which has been shown to sit on the short arm.

The minichromosomes have the following transfection rates of about 57% in the minichromosome-holding line of the present invention, transmitted mainly from the female side, and not so much from pollen, It exhibits the property that, even if a chromosome is present, it does not show a remarkable morphological abnormality.

In the minichromosome-holding line of the present invention,
The transmissibility of the mini-chromosomes is about 57%, which is an excellent property that the mini-chromosomes pair with each other. Therefore, it exhibits an excellent effect that the mini-chromosome can be stably retained.

The minichromosome-holding line of the present invention is, for example,
Ecotype Landberg erecta (abbreviated as Le) -derived Tr4S, ecotype Colombia (C
It can be obtained by backcrossing by applying pollen. That is, Tr4S was crossed with pollen of the ecotype Colombia, and the individual from the obtained seed was self-fertilized, and then the individual from the obtained seed was re-polished with Colombian pollen, and then 5 generations later. A minichromosome-retaining line can be obtained by applying pollen over Colombia.

The minichromosome-retaining line of the present invention has an excellent property that a flower bud is formed under a long-day condition and a high transforming ability, which is not present in Tr4S derived from ecotype Landberg erecta (abbreviated as Le). Therefore,
Under short-day conditions, flowering does not occur and many rosette leaves are formed. From these leaves, high molecular weight DNA can be prepared easily and in large amounts, and the excellent effect that the molecular structure of the minichromosome can be easily analyzed is demonstrated. In addition, if the transforming ability is high, specific genes and DNA can be easily transferred to the plant chromosome DN.
Can be introduced in A. As a result, the minichromosome can be tagged (for example, by introducing an antibiotic resistance gene as a marker), and it is possible to change the structure (shortening, etc.), which is an excellent effect. In the minichromosome-retaining line of the present invention, the minichromosome is meiotic in pollen mother cells, flower somatic cell division, and ecotype Landber.
It exhibits an excellent property that it is more stable than Tr4S derived from g erecta (abbreviated as Le).

The transforming ability of the minichromosome-carrying strain can be evaluated, for example, by infecting Agrobacterium (LBA4404, C58Ci) carrying a binary vector (PGA482.PBI121 etc.). Specifically, the plant is immersed in a cell suspension of Agrobacterium, then the plant is grown, seeds are collected, and the obtained seeds are germinated in a medium containing an antibiotic, The transformability can be evaluated by selecting a transformant.

[0021]

EXAMPLES The present invention will be described in detail below with reference to examples, but the present invention is not limited to these examples.

Example 1 Search for Minichromosome Cells of somatic cell division in Arabidopsis thaliana were analyzed by Giemsa staining or DAPI staining as follows.

Germinated seeds and anthers of Arabidopsis were fixed with ethanol-acetic acid (ethanol: acetic acid = 3: 1) and rinsed well with distilled water.
(Weight / Volume) Cellulase Onozuka R10 (manufactured by Kinki Yakult) and an enzyme solution containing 20% (volume / volume) pectinase were incubated at 30 ° C. for 1.5 hours. The product obtained was suspended with a micropipette, then filtered through a 50 μm nylon mesh and subjected to centrifugation at 10,000 rpm for 2 minutes,
A cell pellet was obtained. The obtained cell pellet was rinsed with distilled water and fixed with alcohol acetate. The solution containing fixed cells was dropped on a slide glass and dried to obtain a slide preparation.

4% (volume / volume) of the slide preparation diluted with 1/15 M phosphate buffer (pH 6.8)
Hold in a Giemsa (Merck) solution for 20-30 minutes,
Giemsa staining was performed. The results are shown in Fig. 1.

Further, the slide preparation is prepared in an amount of 1 μg / ml.
4,6-diamidino-2-phenylindole (DAP
The sample was subjected to an anti-fading solution containing I) and stained with DAPI. The results are shown in Fig. 1.

As a result, as shown in the left panel of FIG. 1 (DAPI staining), it can be seen that the minichromosomes have almost no stretched genuine chromatin and most of them are heterochromatin. In addition, as shown in the right panel (Giemsa stain) of FIG. 1, it is suggested that the minichromosome is telocentric.

Example 2 Characterization of Minichromosomes (1) Origin of Minichromosome In order to investigate the origin of the minichromosome found in Example 1 above, a gene 18 encoding two ribosomal RNAs 18
Using S-5.8S-25S rDNA and 5S rDNA as probes, fluorescence in
In situ hybridization (FISH) was performed.

Murata et al., Chromosoma, 104, 39-4 was used to prepare a mini chromosome slide preparation of Arabidopsis thaliana.
3 (1995).

Probe (18S-5.8S-25S r
For DNA), Nick Translation Kit [GIBCO BRL]
Manufactured by the company] was used for labeling with biotin-14-dATP. The probe (5S rDNA) was labeled with digoxigenin-11-dUTP using a nick translation kit (manufactured by Roche Diagnostics).

A hybridization solution [composition: 50% by volume deionized formamide, 10% by weight dextran sulfate, 2 × SSC] was added to the minichromosome slide preparation.
(Composition: 300 mM NaCl, 30 mM sodium citrate, pH 7.0), 30 ng / μl salmon sperm DNA, 30 ng / μl yeast tRNA, 4 ng / μl
Probe] 15 μl was placed, covered with a coverslip, and sealed with rubber cement. Then, the slide preparation was heated at 78 ° C. for 2 minutes for denaturation, and incubated at 37 ° C. overnight for hybridization. Then slide the slides at 37 ° C for 1
2 minutes containing 50% (vol / vol)% formamide for 2 minutes
It was washed twice with × SSC and then 3 times with 2 × SSC for 10 minutes at room temperature. Biotin label 1
8S-5.8S-25S rDNA was detected with streptavidin-Cy3 (red) and labeled with digoxigenin 5.
SrDNA was detected with anti-digoxigenin-fluorocein (green).

As counterstaining, DAPI solution [DAP at a concentration of 0.1 to 1.0 μg / ml was prepared.
Solution obtained by adding I] to each slide.
DAPI staining was performed by placing 0-100 μl and covering with a cover glass.

As a result, as shown in FIG. 2, the minichromosomes had 18S-5.8S-25S rDNA and 5S r
It can be seen that it has both DNA.

As a probe, 5S rDNA alone or 5S rDNA and 18S-5.8S-25S
The entire chromosome of Arabidopsis was identified by FISH using the combination with rDNA. The probe labeling and FISH conditions are the same as above. Murata et al., Chrom, slide samples of all chromosomes of Arabidopsis
It was prepared according to the method described in Osoma, 104, 39-43 (1995). FIG. 3 shows the result of FISH.

As a result, it can be seen that the mini-chromosome shows a FISH pattern similar to that of the short arm of chromosome 4. Therefore, it is suggested that the mini-chromosome may be derived from the short arm of chromosome 4.

Further, in order to confirm the origin of the mini-chromosome, FISH was carried out using cosmid clone g2616, which is located on the short arm of chromosome 4, as a probe.

Regarding the labeling of the probe, it was labeled with digoxigenin-11-dUTP using a nick translation kit (manufactured by Roche Diagnostics).

Hybridization solution [Composition: 50
Volume% deionized formamide, 10% by weight dextran sulfate, 2 × SSC (composition: 300 mM NaC
1, 30 mM sodium citrate, pH 7.0), 3
0 ng / μl salmon sperm DNA, 30 ng / μl yeast tRNA, 4 ng / μl probe] In 15 μl, the whole chromosome slide preparation was heated at 78 ° C. for 2 minutes to denature it and then incubated at 37 ° C. overnight to obtain high Hybridization was performed. The slide preparation was then washed twice with 2 × SSC containing 50% (vol / vol)% formamide for 10 minutes at 37 ° C., then 3 minutes with 2 × SSC at room temperature for 10 minutes. Washed twice. The digoxigenin labeled probe was detected with anti-digoxigenin-fluorescein. The results are shown in Fig. 4.

As shown in FIG. 4, the mini-chromosome showed a FISH pattern similar to that of the short arm of chromosome 4,
It can be seen that it is derived from the short arm of chromosome 4. Hereinafter, the mini-chromosome was designated as "mini-chromosome 4S", and the plant strain retaining 4S was designated as "Tr4S".

(2) Estimation of minichromosome size To estimate the size of the minichromosome, pulse field gel electrophoresis was performed.

From the leaves of a 5-week-old plant, an enzyme solution [composition:
2% (weight / volume) Cellulase Onozuka R10,1
% (Weight / volume) Macerozyme R10 (Kinki Yakult), 0.5M mannitol, 20mM 2-
(N-morpholino) ethanesulfonic acid (MES), p
H5.6] to prepare mesophyll protoplasts. Ganal, MW, et al., Plant Mol. B
iol. Rep. , 7, 17-27 (1989), a modified agarose plug-embedded protoplast was prepared and used as a sample for pulse field gel electrophoresis.

Running buffer (27 mM Tris, 2
7 mM boric acid, 0.75 mM EDTA pH8.
5), using 0.8% DNA grade agarose,
An agarose plug was placed in the sample groove, and the gap was filled with 0.8% agarose dissolved in a running buffer.

The electrophoresis was performed for 90 seconds for the first 15 hours, 120 seconds for the following 9 hours, and the voltage was adjusted to 200V. The result is shown in FIG.

In the figure, lane 1 indicates S. cerevisi
ae chromosome, lanes 2 and 3 are disomic 2n = 10, lanes 4 and 5 are trisomic 2
n = 10 + m (minichromosome), and lane 6 shows S.
It is the pombe chromosome.

From the electrophoresis pattern shown in FIG. 5, it is estimated that the size of mini-chromosome 4S is about 6 Mb or 5-6 Mb.

Example 3 Transmission of Minichromosome 4S in Arabidopsis Proportion of minichromosome transmission in selfed seeds and 2n =
The rate of minichromosome 4S transmission in a cross with 10 was investigated.

The self-fertilized seeds were germinated and the chromosome of each plant was examined to distinguish between a plant having 10 chromosomes and a plant having 11 chromosomes. If it was confirmed that a minichromosome was excessively present in a plant having 11 chromosomes, it was determined that the minichromosome was transmitted. On the other hand, the crossing of Tr4S with ecotype Colombia pollen and 2n = 10 was also judged in the same manner as in the case of the self-fertilized seeds. In this case, only transmission from the female side can be considered. The results are shown in Table 1.

[0047]

[Table 1]

As shown in Table 1, transmission of minichromosome 4S from the female side was 34.2% in seeds obtained by selfing of minichromosome-carrying strain Tr4S, and 2n = 1.
In seeds obtained by outcrossing with 0 plant as the pollen parent, it was 28.6%. Therefore, the minichromosome
It can be seen that transmission is mainly from the female side, and transmission from pollen is small.

Example 4 Effect of Minichromosome on Fertility The effect of extra 4S chromosome on fertility was investigated. Cut out anthers of mature flowers and place on slides. Pollen was collected from the anthers with tweezers or the like. 0.8% by weight in the obtained pollen
A few drops of an acetocarmine solution [a solution obtained by dissolving acetocarmine in 45% acetic acid] was dropped and a cover glass was placed. After about 5 minutes, the number of well-stained and unstained pollens was counted. Well stained was normal and unstained pollen was not fertile.

As a result, it was shown that the fertility of the pollen of trisomics (2n = 11 individuals) was about 60%, which was lower than that of disomics (2n = 10 individuals).

Example 5 Minichromosome 4 in meiosis
From the result of (2) of Example 2, the minichromosome 4S was
It was shown to have a region homologous to the short arm of the chromosome, suggesting that the minichromosome 4S may pair with chromosome 4.

Then, in meiosis (pachytene phase, metaphase), whether or not the minichromosome 4S and the 4th chromosome are paired was prepared by preparing a slide sample in the same manner as in Example 1 and performing Giemsa staining and DAPI staining. confirmed. Results are shown in FIG.

As shown in FIG. 6, it can be seen that the mini chromosome (arrow in the figure) does not pair with chromosome 4.

Example 6 Analysis of minichromosomal centromere FISH was performed using the tandem repeat family (called 180-bp or pAL family) existing in all five Arabidopsis thaliana chromosomes as a probe and 5S rDNA as a coprobe.

Regarding the probe (180-bp), Nick Translation Kit [manufactured by Roche Diagnostics]
With Fluoro Red [Amersham Pharmacia Biotech (AmershamPhar
manufactured by Macia Biotech)]. Also,
The coprobe (5S rDNA) was labeled with digoxigenin-11-dUTP using a nick translation kit (manufactured by Roche Diagnostics).

Hybridization solution [Composition: 50
Volume% deionized formamide, 10% by weight dextran sulfate, 2 × SSC (composition: 300 mM NaC
1, 30 mM sodium citrate, pH 7.0), 3
0 ng / μl salmon sperm DNA, 30 ng / μl yeast tRNA, 4 ng / μl probe] In 15 μl, the whole chromosome slide preparation was heated at 78 ° C. for 2 minutes to denature it and then incubated at 37 ° C. overnight to obtain high Hybridization was performed. The slide preparation was then washed twice with 2 × SSC containing 50% (vol / vol)% formamide for 10 minutes at 37 ° C., then 3 minutes with 2 × SSC at room temperature for 10 minutes. Washed twice. Since 180-bp was labeled with Fluoro Red, it was directly detected as red fluorescence, and digoxigenin-labeled co-probe (5S rDNA) was detected with anti-digoxigenin-fluorescein (green). The results are shown in Fig. 7.

In FIG. 7, minichromosome 4S is indicated by an arrow. Further, in FIG. 7, the left panel shows one metaphase cell and the right panel shows the second metaphase cell. As shown in FIG.
It can be seen that the red signal detected on the minichromosome is much weaker than the red signal detected on chromosome 4.
Therefore, mini-chromosome 4S is
It is suggested to have shorter 180-bp clusters.

Example 7 Analysis of Centromere Repeat Clusters on Minichromosome 4S (1) Size of Centromere Repeat Clusters To investigate the size of centromere repeat clusters on minichromosome 4S, pulse field gel electrophoresis was performed as follows. And Southern blot hybridization using 180-bp as a probe.

In the same manner as the preparation of the sample for pulse field gel electrophoresis in (2) of Example 2, a sample was prepared from a disomic plant and a trisomic plant.

Running buffer (27 mM Tris, 2
7 mM boric acid, 0.75 mM EDTA pH8.
5) Using 0.8% low melting point DNA grade agarose, an agarose plug was placed in the sample groove, and the gap was filled with 0.8% low melting point agarose dissolved in running buffer.

The electrophoresis was carried out for 90 seconds for the first 15 hours, 120 seconds for the following 9 hours, and the voltage was adjusted to 200V.

Then, the gel after electrophoresis was transferred onto a nylon membrane (trade name: Hybond (registered trademark) -N, manufactured by Amersham), and a gel (180-bp) labeled with digoxigenin by the random prime method was used. Hybridization was performed.

Hybridization was performed as follows. That is, the membrane (8x10cm)
Put in a hybridization bottle (KURABO), and put 20 ml of hybridization solution [composition: 50% deionized formamide, 5 × SS in the bottle.
C, 50 mM sodium phosphate (pH 7.0), 0.
1% N-lauroyl sarcosine sodium, 2%
A blocking solution (Roche Diagnostics, 7% SDS) was added, and prehybridization was performed at 37 ° C. for 1 hour. Heat-quenched digoxigenin-labeled probe (final concentration of about 10 ng / ml) was added to 10 ml of new hybridization solution, and the resulting solution was replaced with a bottle of prehybridization solution and incubated overnight at 37 ° C. did.
Washing was carried out with 2 × SSC / 0.1% SDS at room temperature for 5 minutes twice, and with 0.1 × SSC / 0.1% SDS at 68 ° C.
It was done twice for 15 minutes. The hybridized probe was detected with a DIG chemiluminescence detection kit (manufactured by Roche Diagnostics). The results are shown in Fig. 8.

As a result, as shown in FIG. 8, the size of the centromere repeat cluster in the minichromosome is estimated to be 40 to 60 kb (about 50 kb or less). That is, the centromere of the minichromosome is 1
80-bp (element shown in SEQ ID NO: 1) is 1
It was found that the unit is a cluster having a length of about 40 to 60 kb.

Example 8 Structural analysis of minichromosome Primer for telomeres: ctaaaccctaaaccctaaaccc
Primer CENF: ttcgactccaaaacac designed from taaac (SEQ ID NO: 3) and the centromere repeat sequence
tcacc (SEQ ID NO: 4), primer CENR: aaagct
ttgagaagcaagaagaa (SEQ ID NO: 5), primer 10
Using one primer selected from the group consisting of 6BF: gagagcgttttggctttgac (SEQ ID NO: 6) and primer 106BR: cccgaggatgaggtaattga (SEQ ID NO: 7), PCR was performed using disomic DNA or trisomic DNA as a template. After PCR, the obtained product was subjected to 1% agarose electrophoresis. The results are shown in Fig. 9.

As shown in D and T of lane 4 of FIG. 9, an amplified fragment of about 1.4 kb, which is specific to telotrisomic (T), was detected within 106B repeat sequence when 106BR and telomere primers were used. It was suspected that it had been severed and then telomere was added.

Therefore, from the above results, it is estimated that the mini-chromosome has the structure shown in FIG.

Example 9 Construction of Minichromosome 4S Retaining Line Tr4S derived from ecotype Landberg erecta (abbreviated as Le) was added to ecotype Colombia (C
(Olumbia) pollen, and by backcrossing, the minichromosome 4S-retaining line Tr4SCo5
Was produced. That is, ecotype Columbia (Co
Lumbia) pollen was crossed and the individual from the resulting seed was selfed. The individuals from the seeds obtained are then again pollinated with Colombia and then for five generations with Colombia, whereby Tr
4SCo5 was obtained.

The properties of the individual obtained from the seed were examined. As a result, the morphology was similar to ecotype Colombia. Further, it was found that the obtained minichromosome 4S-retaining line Tr4SCo5 has a surprisingly excellent property that flowers bloom under long-day conditions and high transforming ability.

Then, the transmissibility of minichromosomes in selfed seeds was examined. That is, self-fertilized seeds were germinated, the chromosome of each plant was examined, and a plant with 10 chromosomes and a plant with 11 chromosomes were distinguished. For a plant with 11 chromosomes,
If it was confirmed that the minichromosome was present in excess, it was determined that the minichromosome was transmitted. The results are shown in Table 2.

[0071]

[Table 2]

As shown in Table 2, the transmissibility of mini-chromosomes was about 57.3%, and it was found that the transmissibility of mini-chromosomes was higher than that of Tr4S.

As shown in Table 2, 5 (about 5%) individuals having two minichromosomes were found in the self-pollinated seeds examined.

Further, with respect to Tr4SCo and Tr4s, fluorescence in situ hybridization (FISH) was carried out using 18S-25S rDNA and 5S rDNA as probes in order to examine the pairing of minichromosomes in meiosis.

Regarding the chromosome preparation, Murata et al., Chrom
It was prepared according to the method described in Osoma, 104, 39-43 (1995). In addition, regarding the probe,
S-25S rDNA was added to Nick Translation Kit [Roche Diagnostics (Roche
Diagnostics)] and digoxigenin-
Labeled with digoxigenin using 11-dUTP and 5
S rDNA was labeled with biotin using a nick translation kit [manufactured by Gibco BRL] and biotin-14-dATP.

On the chromosome preparation, a hybridization solution [composition: 50% by volume deionized formamide, 10% by weight dextran sulfate, 2 × SSC (composition: 300
mM NaCl, 30 mM sodium citrate, pH
7.0), 30 ng / μl salmon sperm DNA, 30 ng /
μl yeast tRNA, 4 ng / μl probe] 15 μ
1 was placed, covered with a coverslip and sealed with rubber cement. Then, the slide preparation was heated at 78 ° C. for 2 minutes for denaturation, and incubated at 37 ° C. overnight for hybridization. The slide preparation was then placed in 2 × SSC containing 50% (vol / vol)% formamide for 10 minutes at 37 ° C. for 2 min.
It was washed twice, then 3 times with 2 × SSC for 10 minutes at room temperature.

Biotin-labeled 5S rDNA was detected with streptavidin-Cy3 (red), and digoxigenin-labeled 18S-25S rDNA was detected with anti-digoxigenin-.
Fluorescein (green) was detected. The result is shown in FIG.
Shown in. In the figure, the arrow indicates a mini chromosome.

As shown in FIG. 11, in Tr4S,
Although almost no pairing was observed, in Tr4SCo5, pairing between minichromosomes was found in about 90% of the examined individuals.

Therefore, Tr4SCo5 is equal to Tr4S
From this, it was found that the minichromosome is more stably retained.

Sequence Listing Free Text SEQ ID NO: 3 is the sequence of a primer for telomeres.

SEQ ID NO: 4 is the sequence of a primer designed based on the repeat sequence of centromere region.

SEQ ID NO: 5 is the sequence of a primer designed based on the repetitive sequence of centromere region.

SEQ ID NO: 6 is the sequence of the primer for 106B.

SEQ ID NO: 7 is the sequence of the primer for 106B.

[0085]

INDUSTRIAL APPLICABILITY The nucleic acid of the present invention is the fourth Arabidopsis
Although it is shorter than the centromere in the chromosome, it exhibits the excellent property of exhibiting the centromere function in Arabidopsis plants. Therefore, the nucleic acid containing the nucleic acid of the present invention exhibits an excellent effect of expressing a centromere function in an Arabidopsis plant body. Further, the minichromosome 4S-carrying strain of the present invention is useful for supplying minichromosomes that can act as independent chromosomes, and has an excellent effect of excellent transformability.

[0086]

[Sequence list]                                SEQUENCE LISTING <110> Japan Science and Technology Corporation <120> Plant line carrying minichromosome derived from Arabidopsis thalia na <130> KJ-14-008 <150> JP 2002-43779 <151> 2002-02-20 <160> 8 <170> PatentIn Ver. 2.1 <210> 1 <211> 180 <212> DNA <213> Arabidopsis thaliana <400> 1 gatcaagtca tattcgactc caaaacataa cctaccttct tcttgcttct caaagctttc 60 atggtgtagc caaagtccat atgagtcttg gctttgtgtc ttctaacaag gaaatactac 120 ttaggctttt aagatgcggt tgcgttttaa gttcttatac tcaatcatac acatgagatc 180 <210> 2 <211> 398 <212> DNA <213> Arabidopsis thaliana <400> 2 tcattatgct aggtggttga gtttgattga tagatccctt ctggattagt tgttcttaat 60 gcctattgct tccaatcaac ttgaatttga gcccagacat ttccgcgccc aaaaggtgtt 120 cgatgaaatg tctgaaccac taattccaga gatttgttgg cctgtaccaa ggtattggtt 180 gcagagagcg ttttggcttt gacttattga ttcgtaatgc ctgttaggtt agctctcttc 240 aatggtcatt gagtctggga ctaggttaac ttgagggctc tgtaacggtg gcacttatat 300 ttggttaatg aacttgttgt ctagggataa tttattgagc atatcaatca cctataaact 360 gaggaaacga aactactcaa ttacctcatc ctcgggat 398 <210> 3 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: a primer sequence for teromere <400> 3 ctaaacccta aaccctaaac cctaaac 27 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: a primer sequence designed on the basis of repetitive sequence on centromeric region <400> 4 ttcgactcca aaacactcac c 21 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: a primer sequence designed on the basis of repetitive sequence on centromeric region <400> 5 aaagctttga gaagcaagaa gaa 23 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: a primer sequence for 106B <400> 6 gagagcgttt tggctttgac 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: a primer sequence for 106B <400> 7 cccgaggatg aggtaattga 20 <210> 8 <211> 178 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: a consensus sequence for 180-b p sequence <400> 8 aaccttcttc ttgcttctca aagctttcat ggtgtagcca aagtccatat gagtctttgg 60 ctttgtgtct tctaacaagg aaacactact taggctttta agatgcggtt gcggtttaag 120 ttcttatact caatcataca catgagatca agtcatattc gactccaaaa cactcacc 178

[Brief description of drawings]

FIG. 1 is a micrograph showing the result of analysis of chromosomes of cells of somatic cell division in Arabidopsis thaliana. In the figure, the left panel shows the results of DAPI staining, and the right panel shows the results of Giemsa staining. Also, the scale bar is
5 μM is shown. Arrows indicate minichromosomes.

FIG. 2 is a micrograph showing the results of FISH analysis of minichromosomes regarding the origin of minichromosomes. In the figure, the left panel shows the results of DAPI staining as the counter stain, and the right panel shows the results of FISH. Scale bar indicates 5 μM. Arrows indicate minichromosomes.

FIG. 3 shows that all chromosomes of Arabidopsis are FISH
It is a figure of the microscope picture of the result analyzed by. Scale bar indicates 5 μM.

FIG. 4 is a diagram for confirming the origin of minichromosomes.
Cosmid clone g2 sitting on the short arm of chromosome 4
It is a figure of the microscope picture of the result of FISH which used 616 as a probe. The left panel shows the result of Giemsa staining as a counterstain, and the right panel shows the result of FISH. Scale bar indicates 5 μM.

FIG. 5 is an electrophoretic photograph showing the results of pulse field gel electrophoresis. Lane 1 is S. ce
revisiae chromosome, lanes 2 and 3
Diisomic 2n = 10, lanes 4 and 5 are trisomic 2n = 10 + m (minichromosomes), lane 6 is S. It is the pombe chromosome.

FIG. 6 is a micrograph showing the results of examining the dynamics of minichromosomes in meiosis (pachytene phase, metaphase). In the figure, the left panel shows the results of the dynamics of minichromosomes in the pachytene phase, and the right panel shows the results of the dynamics of minichromosomes in the metaphase. Scale bar indicates 5 μM.

FIG. 7 is a diagram showing the results of analysis of the structure of the minichromosome. In the figure, the left panel shows the result of FISH using the tandem repeat family existing in all five Arabidopsis thaliana chromosomes as a probe, and the right panel shows the result of FISH using the probe and the co-probe. Scale bar indicates 5 μM.

FIG. 8 is a diagram showing the results of examining the size of a centromere repetitive cluster of minichromosomes. The left panel shows an electropherogram of minichromosomes digested with various restriction enzymes, and the right panel shows the result of hybridization using a probe (180-bp).

FIG. 9 is a diagram showing the results of structural analysis of minichromosomes. Lane 1 is an amplification product using a telomere primer and primer CENF, lane 2 is an amplification product using a telomere primer and primer CENR, and lane 3 is a telomere primer and primer 1
The amplification product using 06BF and lane 3 are the amplification products using the telomere primer and the primer 106BR. In addition, M indicates a marker, D indicates disomic, and T indicates trisomic.

FIG. 10 is a schematic diagram of the structure of the minichromosome.

FIG. 11 is a diagram showing the results of examining the pairing of minichromosomes in Tr4sCo5 and Tr4s during meiosis. Panel A shows the results for Tr4SCo5,
Panel B shows the results for Tr4s. The arrow indicates the mini chromosome. The view range of each panel is about 2.4 × 10 ⁻² mm × about 2.9 × 10 ⁻² mm for each panel.

Claims (3)

[Claims] 1. A unit comprising an element consisting of the nucleotide sequence shown in SEQ ID NO: 1 or a homologue thereof 4
A nucleic acid containing a tandem repeat sequence consisting of a cluster of 0 to 60 kb and having a centromere function. 2. The nucleic acid according to claim 1, wherein the centromere function is a function of partitioning the minichromosome containing the nucleic acid according to claim 1 into two daughter cells at the time of meiosis. 3. A nucleic acid derived from Colombia, which is an ecotype of Arabidopsis thaliana, and (a) to (c) below: (a) the nucleic acid according to claim 1 or 2, (b) SEQ ID NO:
A minichromosome containing a transposable genetic element consisting of the nucleotide sequence shown in 2 or a homologue thereof, and (c) a telomere structure, which is loci on the short arm of chromosome 4 of Arabidopsis thaliana, A minichromosome-maintaining strain, which holds a minichromosome that acts independently without pairing with the fourth chromosome.