JP2003261600A - INTERFERON-gamma AND METHOD FOR PURIFYING THE SAME - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for purifying interferon-γ, by which in a desalting process for desalting a purified highly pure salt-containing interferon-γ to give a medicine, the production of an interferon-γ oxide during waiting for a quality test can be inhibited to give the highly pure medicine. <P>SOLUTION: This method for purifying the interferon-γ is characterized by using a solvent containing at least one selected from citric acid, glycine and boric acid in the desalting process or in a final purification process, after a solution containing the interferon-γ and its oxide is fractionated and purified with a salt-containing buffer solution. <P>COPYRIGHT: (C)2003,JPO

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a desalting method in which interferon-γ is fractionated and purified with a buffer containing a salt and is replaced with a component which constitutes a part of a pharmaceutical composition in order to remove the salt and enhance the stability of the pharmaceutical. In the process, interferon-γ
The invention relates to a method for purifying interferon-γ, which is capable of suppressing the production of the oxide, maintaining the purity of a pharmaceutical raw material in good condition, and efficiently producing the raw material for the next step.

[0002]

BACKGROUND ART Many techniques have been reported for producing interferon-γ, but human interferon-γ has been reported.
Purification of γ (JP-A-60-64999), a method for stabilizing canine interferon-γ using a genetically modified silkworm nuclear polyhedrosis virus (JP-A-11-246597), or dog A method for producing interferon-γ (JP 2001-192343 A, JP 2001-192396 A) and the like are disclosed.

In addition, it has been confirmed that interferon also produces an oxide, and the interferon-α2b preparation shows that
An oxide in which methionine at the 111th amino acid residue was oxidized to methionine sulfoxide was isolated, and the biological activity of this oxide was reported to be almost equivalent to that of interferon-α2b (Gitlin G, Tsarbopoulos. , A, P
atel ST, Sydor W, Pramanik BN, Jacobs, Westreich
L, Mittelman S, Bausch JN., Isolation and characte
rization of a monomethioninesulfoxide variant of i
nterferon alpha-2b. Pharm. Res., 13 (5). 762-769 (19
96)). In addition, recombinant human interferon-γ and recombinant tissue-type plasminogen activator were oxidized with tert-butyl hydroperoxide to give methionine sulfoxide, and no decrease in activity was observed with this oxide. (Keck RG., Theuse of t-butyl hydrop
eroxide as a probe for methionine oxidation in pro
teins. Anal. Biochem., 236 (1), 56-62 (1996)). On the other hand, in granulocyto colony-stimulating factor, it has been reported that biological activity is lost by oxidation of methionine residue to sulfoxide (Lu HS, Fausse
t PR, Narhi LO, Horan T., Shinagawa K., Shim
amoto G., and Boone TC, Chemical modification a
nd site-directed mutagenesis of methionine residue
s in recombinant human granulocyto colony-stimulat
ing factor: effect on stability andbiological act
ivity, Arch. Biochem. Biophys., 362 (2) .1-11 (199
9)).

The oxide in which the methionine residue of this protein is changed to sulfoxide is very difficult to separate in purification by column chromatography, and
Even if it is possible to produce high-purity interferon-γ in the purification step (JP 2001-192396 A), gel filtration column chromatography or dialysis is used to avoid instability due to the inclusion of salts. It requires a desalting step. The solvent used in this desalting step is required to be a single or plural composition that does not pose any problem even if it is contained as a pharmaceutical composition, and is oxidized as a pharmaceutical raw material during the storage period such as a quality test. It is desired that the solvent is prepared with a component that does not easily generate a substance or the like.

[0005]

Interferon-γ
Oxidation of a methionine residue in a pharmaceutical preparation may affect its activity retention, and in terms of purity retention,
Inhibiting the oxidation of methionine residues to sulfoxide during the desalting step of interferon-γ used as a drug raw material and the subsequent storage period is an important issue in producing a high-purity protein drug.

[0006]

Means for Solving the Problems In view of such a situation, the present inventor has made diligent efforts, and as a result, interferon-
Regarding a fraction containing a salt obtained by purifying γ with high purity, it is a single or multiple composition that does not cause a problem even if it constitutes a part of a pharmaceutical composition as a pharmaceutical raw material. As a result, by substituting a component that does not form an oxide during the storage period such as a quality test, for suppressing the oxidation of methionine residue to sulfoxide, and obtaining high-purity interferon-γ, the present invention is completed. Came to.

That is, the present invention has the following configuration. That is, "at least one selected from citric acid, glycine and boric acid is contained in the desalting step or the final purification step when fractionating and purifying a solution containing interferon-γ and its oxide. A method for purifying interferon-γ, which comprises using a solvent. "

Alternatively, "containing at least one selected from citric acid, glycine and boric acid, and having a pH of 7
Interferon-γ, characterized in that it is mixed in a solution of more than 1%. It is.

[0009]

BEST MODE FOR CARRYING OUT THE INVENTION The present invention will be described in detail below.

The interferon-γ of the present invention is not particularly limited. For example, human interferon-γ
γ, interferon-γs such as dog interferon-γ, and the like. Interferon-γ is a physiologically active substance whose main component is a protein that exhibits an antiviral action, and is abbreviated as IFN. In the following description of the present invention, this abbreviation is appropriately used. In the following description, dog interferon-γ (canine IFN
-Γ) will be described in detail by way of example, but the invention is not limited thereto.

Canine IFN-γ is a polypeptide encoded by the DNA shown in SEQ ID NO: 1,
Other than that, it is only required to have canine IFN-γ activity and is not limited to the structure such as sugar chain and amino acid sequence. In other words, a dog-derived cell, for example, a dog MDCK cell (ATCC) (ATCC) having a part of its amino acid sequence replaced, a part thereof lacking, or a part having some amino acid residues added The present invention includes any polypeptide having IFN-γ intrinsic physiological activity that induces antiviral activity against CCL-34). Specifically, for example, dog I lacking a sugar chain binding site such as the mature protein portion shown in SEQ ID NO: 2
FN-γ can be mentioned. Further, canine IFN-γ lacking the C-terminal such as the mature protein portions shown in SEQ ID NOS: 3 to 10 can be mentioned.

IFN-γ can be produced, for example, by using a recombinant baculovirus. Among the genetically modified baculoviruses, for example, silkworm nuclear polyhedrosis virus can be preferably used.

[0013] That is, the production of canine IFN-γ can be achieved by injecting a culture solution containing the above recombinant virus into silkworms and feeding them with an artificial feed.

After breeding, body fluid is collected and canine IFN-γ is recovered from the supernatant. For the recovery of dog IFN-γ, for example, the silkworm body fluid can be extracted with a buffer solution containing benzalkonium chloride or a metal chelating agent. The recombinant virus can be inactivated by benzalkonium chloride contained in the extraction buffer. It is known that ethylenediaminetetraacetic acid (EDTA) or the like can be used as the metal chelating agent, and specific dog IFN-γ can be preferentially obtained (JP 2001-192396 A).

Specific dog IFN-obtained in this way
The crude stock solution containing γ can be purified by a combination of ultrafiltration and column chromatography. In this purification, canine IFN-γ having a high purity can be sequentially obtained by using chromatography carriers having different functions.

For example, canine IFN-γ shown in SEQ ID NO: 6
Etc., the crude stock solution can be purified by column chromatography packed with a copper chelate carrier or the like. Subsequently, the purity of the major peak (SEQ ID NO: 6 etc.) can be increased to 87% by column chromatography purification in which a strong anion exchange carrier such as Q sepharose carrier is filled. The minor peak of the fraction obtained by this two-step column chromatography purification is, for example, the dog IF described in SEQ ID NO: 24.
It is an oxide of N-γ.

The IFN-γ oxide is an oxide in which the methionine residue of the polypeptide chain of IFN-γ is oxidized to methionine sulfoxide. For example, the amino acid sequence of any one of SEQ ID NOS: 2 to 10 In the above, it has a structure in which the third methionine from the N-terminal is oxidized to methionine sulfoxide. It is known that this oxide also has activity (Japanese Patent Laid-Open No. 2001-192396). However, when both are used as pharmaceutical ingredients,
It is necessary to individually purify and separate each component, and perform detailed analysis such as toxicity test and drug efficacy test for each component, and it is necessary to control each component at a constant amount during formulation. Therefore, when IFN-γ is used as a gene recombinant drug, it is economical and efficient to obtain a single component with high purity. Therefore, it is necessary to further remove the oxide of dog IFN-γ as an impurity so that the impurity does not increase during the quality test period as a raw material for pharmaceuticals. The weight ratio of the above-mentioned oxide to the total amount of dog IFN-γ and its oxides after the desalting step or the final purification step in the purification of dog IFN-γ is preferably 10% by weight.
Or less (more preferably 7% by weight or less, further preferably 5% by weight)
% Or less).

First, as a method for reducing impurities, it is necessary to carry out fractional purification by blue sepharose chromatography or the like, which is an affinity carrier (Japanese Patent Laid-Open No. 2001-192396). The above operation is a preferred example of the method of separating and purifying with a buffer solution containing a salt in the present invention, and in this operation, preferably 0.1 to 0.5 M (more preferably 0.15 to 5 M).
0.3M), including salts such as NaCl, preferably 5-10
By elution as a mixture of dog IFN-γ and its oxide, the concentration of NaCl and the like was increased stepwise with a buffer solution (preferably pH 6 to 8) such as 0 mM (more preferably 10 to 50 mM) phosphate. Get minutes Even in the purification with blue sepharose or the like, it is difficult to efficiently separate the oxide of dog IFN-γ, and the purity of dog IFN-γ 9
The fraction yield of 0% or more is about 60%, and the fraction yield obtained at a purity of 95% or more is 30%, which is half. The impurity contained in this fraction is canine IFN-γ oxide (SEQ ID NO: 24). Further, the fractionation operation can be further subdivided to collect the eluate to obtain a fraction suitable for the target purity of the drug.

However, this elution fraction was 0.15M.
~ 0.3M NaCl, etc., and when using the ingredients as they are as a raw material for medicines, deterioration of antiviral activity is observed during the storage period as a medicine, and in order to prevent it, it is necessary to remove NaCl, etc. is there. Examples of the method for removing NaCl and the like include a desalting operation by column chromatography using a gel filtration carrier and a desalting method by dialysis. The desalting operation by column chromatography known in the production method of human IFN and cat IFN is used. It is preferable.

In the present invention, among the fractional purification steps such as ultrafiltration and column chromatography as described above, at least one of the desalting step and the final purification step is carried out from citric acid, glycine and boric acid. A solvent containing at least one selected is used. Desalting step is from purified IFN-γ to salt NaC
1 (preferably 30 mM or less, more preferably 1
0 mM or less), and substituting a single component or a plurality of components constituting the pharmaceutical raw material, and the final purification step is
Purified IFN-γ, although not a necessary step
For the purpose of preparing a medicinal raw material for producing a medicinal product or a test solution body for use in a medicinal test, it refers to a step of column chromatography or gel filtration for exchanging buffers, Usually, it is performed after the desalting step.

In the present invention, citric acid, glycine, or boric acid is preferable in the form of a salt because a buffering action is exhibited, and citric acid and boric acid are polyvalent acids. Therefore, a salt may be formed with any valence. The normality ratio of citric acid to counterions (acid normality: counterion normality) is preferably 1.0.
It is 3: 1 to 1: 1.03 (ideally 1: 1). This is because if it is less than the lower limit, the pH is less than 7, which is not preferable, and if it exceeds the upper limit, the pH is more than 10 and it is basic, which is not preferable. Further, the boric acid is preferably tetraboric acid (H ₂ B ₄ O ₇ ),
The ratio of the normalities of tetraboric acid and the counter ion (acid normality: counter ion normality) is preferably 1.
8: 1 to 1: 1.1 (ideally 1: 1), but in addition, orthoboric acid (H ₃ BO ₃ ) and metaboric acid (HBO)
₂ ) may be. The salt is a metal salt, preferably an alkali metal salt, and more preferably a salt with sodium or potassium. This is because it is a substance that is contained as a large amount of ions in the living body. Of course, the metal species may be a single species or a mixture of a plurality of species. Moreover, citric acid, glycine, or boric acid (or their metal salts) may be used alone or in combination of two or more.

In the present invention, as the solvent component constituting the solvent containing at least one selected from citric acid, glycine and boric acid, the above acids are water-soluble and IFN is used.
Water is preferable because it has little influence on the deterioration of γ and the like, but within 10% by weight, polyols such as polyethylene glycol, surfactants such as polyoxyethylene hydrogenated castor oil, and sorbitol. Such saccharides and the like may be contained. Further, when applying a solvent by column chromatography or the like, different solvents having different components or concentrations may be switched stepwise or continuously. A buffer consisting of an acid other than citric acid, glycine or boric acid may be used in combination, in which case it may be mixed with citric acid, glycine or boric acid, or temporarily when switching the solvent to be applied. Citric acid,
You may use the solvent which does not contain glycine or boric acid. At least when IFN-γ is eluted, it may be adjusted so that the solvent contains citric acid, glycine or boric acid. By containing at least one selected from citric acid, glycine and boric acid in the solvent, the production of oxides of canine IFN-γ is suppressed. It is essential that the acid is contained in the solution-type dog IFN-γ.

In the solvent containing at least one selected from citric acid, glycine and boric acid, the concentration of the acid (in the case of mixing plural kinds, the total thereof) is preferably 5 to 5.
150 mM (considering the final drug form and its composition, etc., more preferably 10 to 50 mM, still more preferably 1
5 to 30 mM). This is because if the lower limit value is exceeded or if the upper limit value is exceeded, antiviral activity may be reduced due to alteration of the protein structure of canine IFN-γ, which is not preferable.

The pH of the solvent is preferably 5 to 1
1 (more preferably 6 to 10, still more preferably 7 to 9)
Is. Below the lower limit, the decrease in canine IFN-γ antiviral activity and increase in oxide are remarkably unfavorable. On the other hand, above the upper limit, unfavorable decrease in antiviral activity due to alteration of the protein structure of canine IFN-γ is not preferable. Because.

In the refining step, temperature conditions are preferably -1 to 35 ° C. (more preferably 0 to 35 ° C.).
C., more preferably 2-5.degree. C.). Below the lower limit, in a water-solvent system, there is a risk of protein structural alteration due to freezing and there is a possibility that antiviral activity may be reduced, which is not preferable, while above the upper limit, it is considered to promote the oxidation reaction. This is because it is not preferable.

The dog IFN-γ obtained by the purification method as described above contains at least one selected from citric acid, glycine and boric acid, and is mixed with a solution having a pH of more than 7. Is preferred. The acid is preferably 5 to 150 mM (more preferably 10 to 50 m).
M, more preferably 15 to 30 mM), and the pH is more preferably 6 to 10 (more preferably 7 to 9). This is because the protein structure is stable, antiviral activity can be maintained, and oxide formation can be suppressed. When used as an actual preparation, for example, in the case of a freeze-dried preparation, the pH is preferably adjusted to 5 to 8 for the purpose of maintaining antiviral activity in the freeze-drying process.

When IFN is used as a medicine, in addition to the protein having IFN activity, other components can be optionally added. The ingredients added to the drug are determined depending on the mode of administration of the drug. When used as an injectable drug, it is generally known that a freeze-dried preparation with stable quality and long-term storage is available. Even in the case of dog IFN-γ, a freeze-dried preparation can be used. It can be stabilized for a long time. The freeze-dried preparation can be prepared by adding ingredients according to the concentration of canine IFN-γ in the desalted solution, adjusting a predetermined concentration to a vial, and freeze-drying the preparation. it can. Therefore, it is required that the quality is stable after the desalting step and that the desalting solvent is a part of the pharmaceutical composition. Stabilization during the period is the most important issue. The quality test period is, for example, dog IFN.
-A negative test for substances contained in raw materials containing γ,
For example, tests for the absence of impurities such as insect proteins, benzalkonium chloride, endotoxin, and dog IFN-γ.
In addition to many test items such as purity test, protein concentration test, etc.
Examples include anti-virus activity tests that require weeks.

The present invention is used in the desalting step in order to obtain a high-purity canine IFN-γ preparation as a drug raw material during the quality test period after the desalting step in order to suppress the production of canine IFN-γ oxide. The solvent IF species to be used and its conditions were studied carefully, and dog IF
It became possible to use for the freeze-drying step without decreasing the N-γ purity.

Hereinafter, the present invention will be described in more detail with reference to examples, but the scope of the present invention is not limited thereto.

[0030]

[Examples] Comparative Example 1 (Oxide production in a desalted solution with sodium acetate buffer while waiting (pH 5.5)) (1) Preparation of dog cDNA Lymphocytes were isolated from dog peripheral blood and phytohemagglutinin was isolated. (PHA) was stimulated for 48 hours at a final concentration of 50 μg / ml. After stimulation, the separation device ISOGEN (Nipponji-
RNA) was used to prepare total RNA. The obtained RNA was dissolved in 10 mM Tris-HCl buffer (pH 7.5) containing 1 mM EDTA (hereinafter abbreviated as TE), and 70
After treatment at 5 ° C for 5 minutes, 1M LiCl was added to the solution.
The same amount of 10 mM TE containing was added. 0.5M LiCl
The RNA solution was applied to an oligo dT cellulose column equilibrated with TE containing and washed with the same buffer. After washing with TE containing 0.3 M LiCl, 0.01
% EDTA with 2% SDS (pH)
The poly (A) RNA adsorbed at 7.0) was eluted. Single-stranded cDNA is obtained using the poly (A) RNA thus obtained.
Was synthesized. That is, 5 μg of poly (A) RNA and 0.5 μg of oligo dT primer (12-18 mer) were put in a sterilized 0.5 ml microcentrifuge tube, and diethylpyrocarbonate-treated sterile water was added. Make 12 μl, incubate at 70 ° C. for 10 minutes, and then incubate on ice.
I put it on for a minute. 200 mM Tris-HCl (pH 8.
4), 2 μl of 500 mM KCl solution, 25 mM M
₂ μl of gCl ₂ and 1 μm of 10 mM dNTP (dATP (deoxyadenosine triphosphate), dTTP (deoxythymidine triphosphate), dGTP (deoxyguanosine triphosphate), dCTP (deoxycytidine triphosphate))
1 and 0.1 M DTT, 2 μl each,
After incubating at ℃ for 5 minutes, 200 units of Superscript II manufactured by GibcoBRL.
1 μl of RT was added and incubated at 42 ° C. for 50 minutes to carry out a cDNA synthesis reaction. 1 at 70 ℃
The reaction was stopped by incubating for 5 minutes and placed on ice for 5 minutes. 1 μl of E. coli RNas
eH (2 units / ml) was added, and the mixture was incubated at 37 ° C for 20 minutes.

(2) Preparation of Gene Encoding Protein Having Canine IFN-γ Activity Based on the nucleotide sequence of canine IFN-γ, 5'GCAGATCTATGAATTATACAAGGC
TATATCTTAGCT3 '(SEQ ID NO: 11) and 5'GCGAATTCTTTATTTCGATGCTCT
Two types of primers of GCGGCCCTCGAAA3 '(SEQ ID NO: 12) were synthesized. CD obtained in the previous section
2 μl of NA was placed in a 0.5 ml microcentrifuge tube and each primer was adjusted to 20 pmol.
mM Tris-HCl buffer (pH 8.0), 1.5 mM M
gCl ₂ , 25 mM KCl, 100 μg / ml gelatin, 50 μM dNTP of each base species, 4 units ExT
Reagents were added so that aqDNA polymerase (manufactured by Takara Shuzo Co., Ltd.) was added to make 100 μl in total. DNA denaturing conditions are 94 ° C. for 1 minute, primer annealing conditions are 55 ° C. for 2 minutes, primer extension conditions are 72 ° C. for 3 minutes, and Perkin-Elmer Cetus DNA thermal cycler is used. The reaction was performed for 30 cycles using-. This was electrophoresed on a 1% agarose gel,
A 7 bp DNA fragment (SEQ ID NO: 13) was prepared. This DNA fragment was used as a T-Vect from Invitrogen.
connected to or. Escherichia coli was transformed with this, and plasmid DNA was prepared from the resulting transformant. Next, a fluorescent DNA sequencer (Perkin Elmer DN
A sequencer 373S) and a DN obtained using the Perkin Elmer Dye Terminator Cycle Sequencing Kit according to the attached protocol.
It was confirmed that the A fragment was the nucleotide sequence of DNA encoding canine IFN-γ.

(3) Preparation of Bombyx mori Expression Plasmid Next, using this DNA fragment as a template and combining 6 kinds of primers (SEQ ID NOs: 14 to 19), PCR was carried out under the same conditions as above, and 3 kinds of PCR amplification were carried out. Fragments (SEQ ID NOs: 20-22) were obtained. These are collected according to the usual method,
The fragment shown in SEQ ID NO: 20 is digested with restriction enzymes BamHI and EcoRV, the fragment shown in SEQ ID NO: 21 is digested with restriction enzymes HincII and SnabI, and the fragment shown in SEQ ID NO: 23 is digested with restriction enzymes EcoRV and EcoRI. The enzyme-treated fragment shown in SEQ ID NO: 20 and the restriction enzyme-treated fragment shown in SEQ ID NO: 22 were mixed and inserted into the EcoRI and BamHI sites of pUC19 by a conventional method to obtain a recombinant vector. Further, this vector was cleaved with the restriction enzyme EcoR V to give
The fragment shown in (1) was inserted by a conventional method to obtain a recombinant vector, and the nucleotide sequence of the inserted DNA (SEQ ID NO: 23) was confirmed in the same manner as above. Thereafter, the DNA inserted with the restriction enzymes BamHI and EcoRI was recovered and pBM0 digested with the restriction enzymes BglII and EcoRI was recovered.
30 into the recombinant vector pBMγ for silkworm expression
S2 (-) was produced.

(4) DNA encoding canine IFN-γ
Preparation of Recombinant Silkworm Nuclear Polyhedrosis Virus Recombined in 1. A recombinant virus was prepared by the following method. That is, 5
0 mM HEPES buffer (pH 7.1), 0.2
8M NaCl, 0.7 mM Na ₂ HPO ₄ , 0.7 mM
2.5 ml of a 2.5 ml solution consisting of NaH ₂ PO ₄
DNA mixture (containing 0.25 M CaCl ₂ , 10 μg of BmNPV T ₃ strain of silkworm nuclear polyhedrosis virus BmNPV T ₃ and 65 μg of DNA of recombinant plasmid pBMγ) was added dropwise, and 0.5 ml of the resulting suspension was added to 5 ml of 10 ml. 25c in TC-10 medium supplemented with 15% fetal bovine serum (FBS)
DNA was introduced into the silkworm cells in addition to the culture medium of about 3 × 10 ⁵ silkworm BM-N cells which had been subjected to flat culture in a flask of m ² . After 20 hours, the medium was replaced with a fresh medium, and after further culturing for 7 days, the culture solution was collected. The culture broth was centrifuged and the clarified supernatant was diluted and added to the culture medium of BM-N cells cultivated on a flat surface, and after culturing for 8 days, virus infection was observed by microscopic observation and polyhedra were formed. No culture medium was selected (limit dilution method).

The limiting dilution method was repeated 7 times to clone the recombinant virus. Dog IFN- prepared here
Recombinant virus containing DNA encoding γ was designated as rBNV
It was set to γ.

(5) Preparation of rBNVγ virus solution At the bottom of a 75 cm ² flask, 15 ml of 10% FBS was added.
Approximately 3 × 10 ⁶ BM-N cells cultured in a plane in TC-10 medium containing the above were added with 50 μl of a culture solution of the BM-N cells containing the recombinant virus cloned in (4) above.
After adding to MN cells and culturing at 27 ° C for 5 days, the culture solution was centrifuged at 3,000 rpm for 5 minutes to obtain a centrifugation supernatant as a recombinant virus solution. 10 to 7 virus solution
After doubling the dilution and adding 1 ml to the culture medium of BM-N cells and continuing the culture at 27 ° C. for 7 days, virus infection was observed in the BM-N cells of the culture medium by microscopic observation.

(6) Biosynthesis and Purification After inoculating 100 silkworms with the rBNVγ virus solution and raising the silkworms, the silkworm body fluid was diluted with 1 L of a 20 mM sodium phosphate buffer containing 0.01% benzalkonium chloride and 2.5 mM EDTA. The pH of the extraction solution was adjusted to 6 by filtering off the solid content by filtration.

After standing for 14 hours in a refrigerator at 3 to 5 ° C. to inactivate the recombinant virus, it was centrifuged to separate into a centrifugal supernatant and a precipitate. The supernatant was subjected to aseptic filtration to obtain a stock solution for chromatographic purification.

This chromatographically purified stock solution was subjected to ultrafiltration to obtain a pH value.
The solution was exchanged with 5.5 mM of 20 mM sodium acetate buffer, passed through 330 ml of the copper chelate affinity carrier, and further passed through 20 mM sodium acetate buffer to collect the passing liquid (first stage fraction). The operation was performed at a liquid passing rate of 330 ml / hr and a column temperature of 5 ° C. First-stage fraction 1 purified here
The HPLC purity of L was 30%.

The first-stage fraction was exchanged with 20 mM glycine / sodium hydroxide buffer (pH 9) by ultrafiltration,
Purification was performed by column chromatography (40 ml / hr of liquid flow rate, column temperature 5 ° C.) with 40 ml of Q Sepharose (Pharmacia), which is a strong anion exchange carrier.
In this column chromatography, the target substance was adsorbed on the carrier and the target substance and its oxide were eluted by increasing the NaCl concentration of NaCl / 20 mM glycine / sodium hydroxide buffer (pH 9) stepwise to 20 mM to 50 mM. . The fraction (second-stage fraction) obtained here contained 30 mM NaCl and 225 ml was collected. The HPLC purity was 89% at the major peak (SEQ ID NO: 6) and the recovery rate was 5
It was 0%. The minor peak was SEQ ID NO: 24 only.

The second-stage fraction was exchanged with a 20 mM sodium acetate buffer (pH 5.5) by ultrafiltration, and column chromatography was performed with 10 ml of an affinity carrier, Blue Sepharose (Pharmacia) (liquid flow rate: 50 ml / hr). , Column temperature 5 ° C.) purification was performed. For elution, the target substance and its oxide were eluted by stepwise increasing the NaCl concentrations of NaCl and 20 mM sodium phosphate buffer to 0.15-0.5 M (third-stage fraction). This blue sepharose chromatography has a purity of 9
The fractions of 5% or more were 100 ml in total in the third-stage fractions 4 and 5 having 0.2M NaCl concentration (subdivided by elution time at the same salt concentration), and the dog IFN-γ yield was 30%. . In addition, as a fraction with a purity of 90% or more, 0.15M NaCl
Concentration third-stage fraction 3 (25 ml; the third-stage fractions 1 and 2 before this were excluded because they had many impurities), 0.
It was a third-stage fraction 6 (50 ml) with a concentration of 25 M NaCl, and fractions 3 and 6 were combined to give a purity of 93% (75 m
l), collecting this fraction 3 + 6 (fraction 3 + 4 + 5 +
6) The total yield reached 65%.

(7) Desalting and formulation column High-purity purified liquid (third-stage fraction 4 + 5), which has been purified by chromatography, is a column packed with Sephadex G-25 (Pharmacia), which is a gel filtration carrier. Chromatography (packing volume 100 ml).

Purified solution, equilibration solvent, canine IFN-
The solvent used for elution of γ was cooled to 5 ° C. The gel filtration carrier was also cooled to 5 ° C. Sterilization of the carrier and the column is performed by immersing 0.1N-NaOH, and after washing with sterilized water, a 20 mM sodium acetate buffer solution is passed through at a flow rate of 100 ml / hr (SV = 1), and the volume is 3 times the volume of the carrier (BV). = 3) was passed through 300 ml. Then 20 mM
Prepare 0.5% porcine hydrolyzed gelatin solution with sodium acetate buffer (pH 5.5), aseptically filter with 0.22 μm sterile filter, then pass BV = 0.3 (30 ml) and coat the carrier with 20 mM. Sodium acetate buffer (pH 5.
5) Equilibrated with BV = 3. Confirm the equilibration by p of the effluent
H was measured. Then, the third-stage fraction 4 + 5 (Blue Sepharose chromatography purified solution 0.2M NaCl
/ 20 mM phosphate buffer HPLC purity 97.4%, oxide 2.6% fraction) (25 ml) was passed through (SV = 0.
5) The solution was passed at 50 ml / hr. Continuously, the liquid passing speed is 50
20 mM sodium acetate buffer (pH 5.
5) The solution was passed through the column, and 37 ml of the eluate (fourth-stage fraction) having absorption at 280 nm was collected while monitoring the absorbance of the column eluate at 280 nm. It was operated at a column temperature of 5 ° C.
The pH of the recovered desalted solution was 5.5, and the yield of canine IFN-γ was 87%.

This desalted solution was filtered through a commercially available 0.22 μm sterilizing filter, and the change with time during the storage period spent for the quality test as a pharmaceutical raw material was followed up by HPLC analysis.
Samples were placed in Corning centrifuge tubes and stored at 5 ° C and 15 ° C. The HPLC analysis was performed by the method described in the item (8) below. The injection sample was 100 μl and was analyzed twice. As shown in Table 1, the canine IFN-γ oxide increased to 4.4% in 7 days and 6.0% in 14 days at the storage temperature of 5 ° C., and the purity of canine IFN-γ decreased. Also, at a temperature of 15 ° C, the increase in canine IFN-γ oxide was remarkable, and 6.4% in 7 days,
It increased to 9.5% in 14 days.

(8) Purity analysis by HPLC The LC-10AD series (manufactured by Shimadzu Corporation) is used as the HPLC system, and the column is Cosmo Seal 5C18-A.
R-300 (manufactured by Nacalai Teesque) was used. Also,
The eluent is 0.1% trifluoroacetic acid aqueous solution as solution A,
As solution B, acetonitrile containing 0.1% trifluoroacetic acid was used. The flow rate was 1 ml / min, and the peak detection wavelength was 210 nm. The elution was analyzed by a linear gradient (solution B concentration 0 minutes: 40%, 30 minutes: 46%). 100 μl of the anion exchange carrier fraction was analyzed. In addition, 50 μl of the purified fraction with the Blue Sepharose carrier and the desalted solution were analyzed. Two peaks detected at this time were detected at 25.5 minutes and 27.2 minutes. Each of these peaks was collected and subjected to structural analysis. The molecular weight was measured by TOF-MAS, the C-terminal amino acid sequence was decomposed with cyanogen bromide and then subjected to peptide mapping, and the obtained C-terminal peptide was determined by the Edman decomposition method. As a result, the minor peak detected at 25.5 minutes was that the third methionine from the N-terminal side of SEQ ID NO: 6 was oxidized to methionine sulfoxide (SEQ ID NO: 24).
It was done.

Comparative Example 2 (Oxidation of desalted solution with sodium acetate buffer during standby (pH 5.5)) Third stage fraction 3 + 6 (0.15M, 0) obtained by the purification described in Comparative Example 1 HPLC purity (dog IFN-γ) 93% containing .25M NaCl, dog IFN
-Comparative Example 1 except that a portion of 25 ml of the blue affinity chromatography fraction of -γ oxide 6.3%) was used.
Desalting was performed by the same operation method as described. 38 ml of the eluate having an absorption at 280 nm was collected. It was operated at a column temperature of 5 ° C. The pH of the recovered desalted solution was 5.5, and dog IFN-
The yield of γ was 89%. This desalted solution was aseptically filtered in the same manner as described in Comparative Example 1 and placed in a Corning centrifuge tube.
Stored at ° C. HPLC analysis was conducted to examine the change with time at 15 ° C. The HPLC analysis was performed by the same method as shown in Comparative Example 1. The injection sample was 100 μl and was analyzed twice. As shown in Table 1, the canine IFN-γ oxide increased to 9.5% in 7 days and 13.5% in 14 days, and the purity of canine IFN-γ decreased accordingly.

Example 1 (Oxidation inhibition of desalted solution by sodium citrate buffer during standby (pH 7.6)) Third-stage fraction 4 + 5 (0.2 M NaCl obtained by the purification described in Comparative Example 1) And a fraction of 20 mM phosphate buffer HPLC purity 97.4%, oxide 2.6% fraction) was used 25 ml. Desalting was carried out in the same manner as in Comparative Example 1 except that the gel filtration carrier was equilibrated and 20 mM sodium citrate buffer (pH 8) was used as an elution solvent for desalting. 38 ml of the eluate having an absorbance of 280 nm was collected. It was operated at a column temperature of 5 ° C. The pH of the recovered desalted solution was 7.6, and the yield of canine IFN-γ was 93%. The desalted solution was subjected to aseptic filtration in the same manner as described in Comparative Example 1 and placed in a Corning centrifuge tube at 5 ° C and 15 ° C.
The change with time was investigated by HPLC analysis. The HPLC analysis was performed by the same method as shown in Comparative Example 1. The injection sample was 100 μl and was analyzed twice. As shown in Table 1, the dog IFN-γ oxide was hardly produced at the storage temperature of 5 ° C., and the dog IFN-γ oxide was hardly produced even at the temperature of 15 ° C. for 14 days, and the purity was not lowered. .

Example 2 (Inhibition of oxide by waiting for desalting solution by glycine / sodium hydroxide buffer (PH 8.8)) Third-stage fraction 4 + 5 (0. 2M NaCl and 2
A 25 ml portion of 0 mM phosphate buffer HPLC purity 97.4%, oxide 2.6% fraction) was used. Comparative Example 1 except that the gel filtration carrier was equilibrated and glycine / sodium hydroxide buffer (pH 9.8) was used as an elution solvent for desalting
Desalting was performed by the same operation method as described. 37 ml of the eluate having an absorbance at 280 nm was collected. Column temperature 5 ℃
I operated it with. The pH of the recovered desalted solution was 8.8,
The yield of FN-γ was 85%. This desalted solution was used in Comparative Example 1
Aseptic filtration was performed by the same method as described, and the mixture was placed in a Corning centrifuge tube and subjected to HPLC analysis for changes with time at 5 ° C and 15 ° C. The HPLC analysis was performed by the same method as shown in Comparative Example 1. The injection sample was 100 μl and was analyzed twice. As shown in the results in Table 1, the dog IFN-γ oxide was hardly formed at the storage temperature of 5 ° C, and the oxide was slightly increased to 3.0% at the temperature of 15 ° C for 14 days.

Example 3 (Inhibition of oxide by waiting for desalting solution with dipotassium tetraborate solution (pH 9.3)) Third stage fraction 3 + 6 (0.15M) obtained by the purification described in Comparative Example 1 , HPLC purity containing 0.25 M NaCl (dog IFN-γ) 93%, dog IF
A portion of 4 ml of a blue affinity chromatography fraction (7% N-γ oxide) was used and the gel filtration carrier was
It was desalted in the same manner as in Comparative Example 1, except that the carrier was equilibrated and dipotassium tetraborate (pH 9.4) was used as an elution solvent for desalting. The eluate (7.4 ml) having an absorbance of 280 nm was collected. It was operated at a column temperature of 5 ° C. The pH of the recovered desalted solution was 9.3, and the dog IF
The yield of N-γ was 90%. The desalted solution was subjected to aseptic filtration by the same method as described in Comparative Example 1, put in a Corning centrifuge tube, and subjected to HPLC analysis for change with time at 15 ° C. HP
LC analysis was performed by the same method as shown in Comparative Example 1. The injection sample was 100 μl and was analyzed twice. As shown in Table 1, the canine IFN-γ oxide slightly increased to 6.7% at the storage temperature of 15 ° C.

Example 4 (Inhibition of oxides during stand-by of desalted solution by a solution of disodium tetraborate added to sodium acetate buffer (pH 7.
5)) 20 mM sodium acetate buffer (pH 5.5) 9
To 3 ml, 20 mM disodium tetraborate solution (pH
9.3) 7 ml was added to prepare a desalting buffer solution. At this time, the pH was 8.3.

Third-stage fraction 3 + 6 (HPL containing 0.15M, 0.25M NaCl) obtained by the purification described in Comparative Example 1
Blue affinity chromatography fraction of C purity (dog IFN-γ) 93%, dog IFN-γ oxide 7%)
Using a part of 4ml, the gel filtration carrier is 15ml,
Desalting was performed in the same manner as in Comparative Example 1 except that the carrier was equilibrated and the preparation buffer (pH 8.3) described above was used as the elution solvent for desalting. 7.5 ml of the eluate having an absorbance of 280 nm was collected. It was operated at a column temperature of 5 ° C. The pH of the recovered desalted solution was 7.5, and dog IFN-γ
The yield was 87%. The desalted solution was subjected to aseptic filtration in the same manner as described in Comparative Example 1 and placed in a Corning centrifuge tube at 15 ° C.
The change with time was investigated by HPLC analysis. The HPLC analysis was performed by the same method as shown in Comparative Example 1. The injection sample was 100 μl and was analyzed twice. As shown in Table 1, at a storage temperature of 15 ° C., there was almost no production of canine IFN-γ oxide and almost no decrease in purity.

Example 5 (Inhibition of oxides in standby by adding glycine / sodium hydroxide buffer to desalting solution (pH 7.8)) The fourth-stage fraction (20 mM sodium acetate desalting) obtained in Comparative Example 1 Liquid (pH
5.5) Purity 96.8%) 5 ml of 30 mM glycine / sodium hydroxide buffer (pH 9) was added to 5 ml to prepare (pH 7.8). The prepared solution was aseptically filtered in the same manner as in Comparative Example 1 and placed in a Corning centrifuge tube.
The change over time in ° C was investigated by HPLC analysis. HPLC
The analysis was performed by the same method as shown in Comparative Example 1. The injection sample was 100 μl and was analyzed twice. As shown in the results in Table 1, at a storage temperature of 5 ° C, dog IFN-γ oxide was scarcely produced and the purity did not decrease.

[0052]

[Table 1]

[0053]

INDUSTRIAL APPLICABILITY According to the present invention, in the purification step for producing a drug containing IFN-γ, the fraction purified by fractionation with a buffer containing a salt is removed to remove the salt in order to enhance the stability of the drug. In the desalting process of substituting with a solvent consisting of a part of the above, it becomes possible to suppress the production of IFN-γ oxide, maintain the drug raw material in high purity, and use it in the formulation process. Became stable and possible.

[0054]

[Sequence list]         SEQUENCE LISTING <110> Toray Industries, Inc. <120> Method for purifying interferon-γ <130> 51E16350 <160> 22 <210> 1 <211> 501 <212> DNA PRT <213> dog <220>  <221> CDS  <222> (1) ... (498) <220>  <221> mat # peptide  <222> (73) ... (498) <400> 1 atg aat tat aca agc tat atc tta gct ttt cag ctt tgc gtg att ttg 48 Met Asn Tyr Thr Ser Tyr Ile Leu Ala Phe Gln Leu Cys Val Ile Leu tgt tct tct ggc tgt aac tgt cag gcc atg ttt ttt aaa gaa ata gaa 96 Cys Ser Ser Gly Cys Asn Cys Gln Ala Met Phe Phe Lys Glu Ile Glu aac cta aag gaa tat ttt cag gca agt aat cca gat gta tcg gac ggt 144 Asn Leu Lys Glu Tyr Phe Gln Ala Ser Asn Pro Asp Val Ser Asp Gly ggg tct ctt ttc gta gat att ttg aag aaa tgg aga gag gag agt gac 192 Gly Ser Leu Phe Val Asp Ile Leu Lys Lys trp Arg Glu Glu Ser Asp aaa aca atc att cag agc caa att gtc tct ttc tac ttg aaa ctg ttt 240 Lys Thr Ile Ile Gln Ser Gln Ile Val Ser Phe Tyr Leu Lys Leu Phe gac aac ttt aaa gat aac cag atc att caa agg agc atg gat acc atc 288 Asp Asn Phe Lys Asp Asn Gln Ile Ile Gle Arg Ser Met Asp Thr Ile aag gaa gac atg ctt ggc aag ttc tta cag tca tcc acc agt aag agg 336 Lys Glu Asp Met Leu Gly Lys Phe Leu Gln Ser Ser Thr Ser Lys Arg gag gac ttc ctt aag ctg att caa att cct gtg aac gat ctg cag gtc 384 Glu Asp Phe Leu Lys Leu Ile Gln Ile Pro Val Asn Asp Leu Gln Val cag cgc aag gcg ata aat gaa ctc atc aaa gtg atg aat gat ctc tca 432 Gln Arg Lys Ala Ile Asn Glu Leu Ile Lys Val Met Asn Asp Leu Ser cca aga tcc aac cta agg aag cgg aaa agg agt cag aat ctg ttt cga 480 Pro Arg Ser Asn Leu Arg Lys Arg Lys Arg Ser Gln Asn Leu Phe Arg ggc cgc aga gca tcg aaa taa 501 Gly Arg Arg Ala Ser Lys *** <210> 2 <211> 143 <212> PRT <213> dog <220>  <221> mat # peptide  <222> (1) ... (143) <400> 2 Met Asn Tyr Thr Ser Tyr Ile Leu Ala Phe Gln Leu Cys Val Ile Leu             -20 -15 -10 Cys Ser Ser Gly Cys Asn Cys Gln Ala Met Phe Phe Lys Glu Ile Glu         -5 -1 1 5 Asn Leu Lys Glu Tyr Phe Gln Ala Ser Asn Pro Asp Val Ser Asp Gly  10 15 20 25 Gly Ser Leu Phe Val Asp Ile Leu Lys Lys trp Arg Glu Glu Ser Asp                  30 35 40 Lys Thr Ile Ile Gln Ser Gln Ile Val Ser Phe Tyr Leu Lys Leu Phe              45 50 55 Asp Asn Phe Lys Asp Asn Gln Ile Ile Gle Arg Ser Met Asp Thr Ile          60 65 70 Lys Glu Asp Met Leu Gly Lys Phe Leu Gln Ser Ser Thr Ser Lys Arg      75 80 85 Glu Asp Phe Leu Lys Leu Ile Gln Ile Pro Val Asn Asp Leu Gln Val  90 95 100 105 Gln Arg Lys Ala Ile Asn Glu Leu Ile Lys Val Met Asn Asp Leu Ser                 110 115 120 Pro Arg Ser Asn Leu Arg Lys Arg Lys Arg Ser Gln Asn Leu Phe Arg             125 130 135 Gly Arg Arg Ala Ser Lys ***         140 <210> 3 <211> 130 <212> PRT <213> dog <220>  <221> mat # peptide  <222> (1) ... (130) <400> 3 Met Asn Tyr Thr Ser Tyr Ile Leu Ala Phe Gln Leu Cys Val Ile Leu             -20 -15 -10 Cys Ser Ser Gly Cys Asn Cys Gln Ala Met Phe Phe Lys Glu Ile Glu         -5 -1 1 5 Asn Leu Lys Glu Tyr Phe Gln Ala Ser Asn Pro Asp Val Ser Asp Gly 10 15 20 25 Gly Ser Leu Phe Val Asp Ile Leu Lys Lys Trp Arg Glu Glu Ser Asp                  30 35 40 Lys Thr Ile Ile Gln Ser Gln Ile Val Ser Phe Tyr Leu Lys Leu Phe              45 50 55 Asp Asn Phe Lys Asp Asn Gln Ile Ile Gle Arg Ser Met Asp Thr Ile          60 65 70 Lys Glu Asp Met Leu Gly Lys Phe Leu Gln Ser Ser Thr Ser Lys Arg      75 80 85 Glu Asp Phe Leu Lys Leu Ile Gln Ile Pro Val Asn Asp Leu Gln Val  90 95 100 105 Gln Arg Lys Ala Ile Asn Glu Leu Ile Lys Val Met Asn Asp Leu Ser                 110 115 120 Pro Arg Ser Asn Leu Arg Lys Arg Lys *** 125 130 <210> 4 <211> 129 <212> PRT <213> dog <220>  <221> mat # peptide  <222> (1) ... (129) <400> 4 Met Asn Tyr Thr Ser Tyr Ile Leu Ala Phe Gln Leu Cys Val Ile Leu             -20 -15 -10 Cys Ser Ser Gly Cys Asn Cys Gln Ala Met Phe Phe Lys Glu Ile Glu         -5 -1 1 5 Asn Leu Lys Glu Tyr Phe Gln Ala Ser Asn Pro Asp Val Ser Asp Gly 10 15 20 25 Gly Ser Leu Phe Val Asp Ile Leu Lys Lys Trp Arg Glu Glu Ser Asp                  30 35 40 Lys Thr Ile Ile Gln Ser Gln Ile Val Ser Phe Tyr Leu Lys Leu Phe              45 50 55 Asp Asn Phe Lys Asp Asn Gln Ile Ile Gle Arg Ser Met Asp Thr Ile          60 65 70 Lys Glu Asp Met Leu Gly Lys Phe Leu Gln Ser Ser Thr Ser Lys Arg      75 80 85 Glu Asp Phe Leu Lys Leu Ile Gln Ile Pro Val Asn Asp Leu Gln Val  90 95 100 105 Gln Arg Lys Ala Ile Asn Glu Leu Ile Lys Val Met Asn Asp Leu Ser                 110 115 120 Pro Arg Ser Asn Leu Arg Lys Arg ***             125 <210> 5 <211> 128 <212> PRT <213> dog <220>  <221> mat # peptide  <222> (1) ... (128) <400> 5 Met Asn Tyr Thr Ser Tyr Ile Leu Ala Phe Gln Leu Cys Val Ile Leu             -20 -15 -10 Cys Ser Ser Gly Cys Asn Cys Gln Ala Met Phe Phe Lys Glu Ile Glu         -5 -1 1 5 Asn Leu Lys Glu Tyr Phe Gln Ala Ser Asn Pro Asp Val Ser Asp Gly 10 15 20 25 Gly Ser Leu Phe Val Asp Ile Leu Lys Lys Trp Arg Glu Glu Ser Asp                  30 35 40 Lys Thr Ile Ile Gln Ser Gln Ile Val Ser Phe Tyr Leu Lys Leu Phe              45 50 55 Asp Asn Phe Lys Asp Asn Gln Ile Ile Gle Arg Ser Met Asp Thr Ile          60 65 70 Lys Glu Asp Met Leu Gly Lys Phe Leu Gln Ser Ser Thr Ser Lys Arg      75 80 85 Glu Asp Phe Leu Lys Leu Ile Gln Ile Pro Val Asn Asp Leu Gln Val  90 95 100 105 Gln Arg Lys Ala Ile Asn Glu Leu Ile Lys Val Met Asn Asp Leu Ser                 110 115 120 Pro Arg Ser Asn Leu Arg Lys ***             125 <210> 6 <211> 127 <212> PRT <213> dog <220>  <221> mat # peptide  <222> (1) ... (127) <400> 6 Met Asn Tyr Thr Ser Tyr Ile Leu Ala Phe Gln Leu Cys Val Ile Leu             -20 -15 -10 Cys Ser Ser Gly Cys Asn Cys Gln Ala Met Phe Phe Lys Glu Ile Glu         -5 -1 1 5 Asn Leu Lys Glu Tyr Phe Gln Ala Ser Asn Pro Asp Val Ser Asp Gly 10 15 20 25 Gly Ser Leu Phe Val Asp Ile Leu Lys Lys Trp Arg Glu Glu Ser Asp                  30 35 40 Lys Thr Ile Ile Gln Ser Gln Ile Val Ser Phe Tyr Leu Lys Leu Phe              45 50 55 Asp Asn Phe Lys Asp Asn Gln Ile Ile Gle Arg Ser Met Asp Thr Ile          60 65 70 Lys Glu Asp Met Leu Gly Lys Phe Leu Gln Ser Ser Thr Ser Lys Arg      75 80 85 Glu Asp Phe Leu Lys Leu Ile Gln Ile Pro Val Asn Asp Leu Gln Val  90 95 100 105 Gln Arg Lys Ala Ile Asn Glu Leu Ile Lys Val Met Asn Asp Leu Ser                 110 115 120 Pro Arg Ser Asn Leu Arg ***             125 <210> 7 <211> 126 <212> PRT <213> dog <220>  <221> mat # peptide  <222> (1) ... (126) <400> 7 Met Asn Tyr Thr Ser Tyr Ile Leu Ala Phe Gln Leu Cys Val Ile Leu             -20 -15 -10 Cys Ser Ser Gly Cys Asn Cys Gln Ala Met Phe Phe Lys Glu Ile Glu         -5 -1 1 5 Asn Leu Lys Glu Tyr Phe Gln Ala Ser Asn Pro Asp Val Ser Asp Gly 10 15 20 25 Gly Ser Leu Phe Val Asp Ile Leu Lys Lys Trp Arg Glu Glu Ser Asp                  30 35 40 Lys Thr Ile Ile Gln Ser Gln Ile Val Ser Phe Tyr Leu Lys Leu Phe              45 50 55 Asp Asn Phe Lys Asp Asn Gln Ile Ile Gle Arg Ser Met Asp Thr Ile          60 65 70 Lys Glu Asp Met Leu Gly Lys Phe Leu Gln Ser Ser Thr Ser Lys Arg      75 80 85 Glu Asp Phe Leu Lys Leu Ile Gln Ile Pro Val Asn Asp Leu Gln Val  90 95 100 105 Gln Arg Lys Ala Ile Asn Glu Leu Ile Lys Val Met Asn Asp Leu Ser                 110 115 120 Pro Arg Ser Asn Leu ***             125 <210> 8 <211> 125 <212> DNA PRT <213> dog <220>  <221> mat # peptide  <222> (1) ... (125) <400> 8 Met Asn Tyr Thr Ser Tyr Ile Leu Ala Phe Gln Leu Cys Val Ile Leu             -20 -15 -10 Cys Ser Ser Gly Cys Asn Cys Gln Ala Met Phe Phe Lys Glu Ile Glu         -5 -1 1 5 Asn Leu Lys Glu Tyr Phe Gln Ala Ser Asn Pro Asp Val Ser Asp Gly 10 15 20 25 Gly Ser Leu Phe Val Asp Ile Leu Lys Lys Trp Arg Glu Glu Ser Asp                  30 35 40 Lys Thr Ile Ile Gln Ser Gln Ile Val Ser Phe Tyr Leu Lys Leu Phe              45 50 55 Asp Asn Phe Lys Asp Asn Gln Ile Ile Gle Arg Ser Met Asp Thr Ile          60 65 70 Lys Glu Asp Met Leu Gly Lys Phe Leu Gln Ser Ser Thr Ser Lys Arg      75 80 85 Glu Asp Phe Leu Lys Leu Ile Gln Ile Pro Val Asn Asp Leu Gln Val  90 95 100 105 Gln Arg Lys Ala Ile Asn Glu Leu Ile Lys Val Met Asn Asp Leu Ser                 110 115 120 Pro Arg Ser Asn ***             125 <210> 9 <211> 124 <212> PRT <213> dog <220>  <221> mat # peptide  <222> (1) ... (124) <400> 9 Met Asn Tyr Thr Ser Tyr Ile Leu Ala Phe Gln Leu Cys Val Ile Leu             -20 -15 -10 Cys Ser Ser Gly Cys Asn Cys Gln Ala Met Phe Phe Lys Glu Ile Glu         -5 -1 1 5 Asn Leu Lys Glu Tyr Phe Gln Ala Ser Asn Pro Asp Val Ser Asp Gly 10 15 20 25 Gly Ser Leu Phe Val Asp Ile Leu Lys Lys Trp Arg Glu Glu Ser Asp                  30 35 40 Lys Thr Ile Ile Gln Ser Gln Ile Val Ser Phe Tyr Leu Lys Leu Phe              45 50 55 Asp Asn Phe Lys Asp Asn Gln Ile Ile Gle Arg Ser Met Asp Thr Ile          60 65 70 Lys Glu Asp Met Leu Gly Lys Phe Leu Gln Ser Ser Thr Ser Lys Arg      75 80 85 Glu Asp Phe Leu Lys Leu Ile Gln Ile Pro Val Asn Asp Leu Gln Val  90 95 100 105 Gln Arg Lys Ala Ile Asn Glu Leu Ile Lys Val Met Asn Asp Leu Ser                 110 115 120 Pro Arg Ser *** <210> 10 <211> 123 <212> DNA PRT <213> dog <220>  <221> mat # peptide  <222> (1) ... (123) <400> 10 Met Asn Tyr Thr Ser Tyr Ile Leu Ala Phe Gln Leu Cys Val Ile Leu             -20 -15 -10 Cys Ser Ser Gly Cys Asn Cys Gln Ala Met Phe Phe Lys Glu Ile Glu         -5 -1 1 5 Asn Leu Lys Glu Tyr Phe Gln Ala Ser Asn Pro Asp Val Ser Asp Gly 10 15 20 25 Gly Ser Leu Phe Val Asp Ile Leu Lys Lys Trp Arg Glu Glu Ser Asp                  30 35 40 Lys Thr Ile Ile Gln Ser Gln Ile Val Ser Phe Tyr Leu Lys Leu Phe              45 50 55 Asp Asn Phe Lys Asp Asn Gln Ile Ile Gle Arg Ser Met Asp Thr Ile          60 65 70 Lys Glu Asp Met Leu Gly Lys Phe Leu Gln Ser Ser Thr Ser Lys Arg      75 80 85 Glu Asp Phe Leu Lys Leu Ile Gln Ile Pro Val Asn Asp Leu Gln Val  90 95 100 105 Gln Arg Lys Ala Ile Asn Glu Leu Ile Lys Val Met Asn Asp Leu Ser                 110 115 120 Pro Arg *** <210> 11 <211> 35 <212> DNA <213> Artificial Sequence <400> 11 gcagatctat gaattataca agctatatct tagct 35 <210> 12 <211> 35 <212> DNA <213> Artificial Sequence <400> 12 gcgaattctt atttcgatgc tctgcggcct cgaaa 35 <210> 13 <211> 517 <212> DNA <213> dog <400> 13 gcagatctat gaattataca agctatatct tagcttttca gctttgcgtg attttgtgtt 60 cttctggctg taactgtcag gccatgtttt ttaaagaaat agaaaaccta aaggaatatt 120 ttcaggcaag taatccagat gtatcggacg gtgggtctct tttcgtagat attttgaaga 180 aatggagaga ggagagtgac aaaacaatca ttcagagcca aattgtctct ttctacttga 240 aactgtttga caactttaaa gataaccaga tcattcaaag gagcatggat accatcaagg 300 aagacatgct tggcaagttc ttacagtcat ccaccagtaa gagggaggac ttccttaagc 360 tgattcaaat tcctgtgaac gatctgcagg tccagcgcaa ggcgataaat gaactcatca 420 aagtgatgaa tgatctctca ccaagatcca acctaaggaa gcggaaaagg agtcagaatc 480 tgtttcgagg ccgcagagca tcgaaataag aattcgc 517 <210> 14 <211> 30 <212> DNA <213> Artificial Sequence <400> 14 ataggatcca tgaattatac aagctatatc 30 <210> 15 <211> 33 <212> DNA <213> Artificial Sequence <400> 15 ctggatatct ggattacttg cctgaaaata ttc 33 <210> 16 <211> 27 <212> DNA <213> Artificial Sequence <400> 16 ccatacgtat cggacggtgg gtctctt 27 <210> 17 <211> 36 <212> DNA <213> Artificial Sequence <400> 17 ggtggtcgac tgtaagaact tgccaagcat gtcttc 36 <210> 18 <211> 36 <212> DNA <213> Artificial Sequence <400> 18 ccgatatcca ccagtaagag ggaggacttc cttaag 36 <210> 19 <211> 33 <212> DNA <213> Artificial Sequence <400> 19 ctcgaattct tatttcgatg ctctgcggcc tcg 33 <210> 20 <211> 147 <212> DNA <213> dog <400> 20 ataggatcca tgaattatac aagctatatc ttagcttttc agctttgcgt gattttgtgt 60 tcttctggct gtaactgtca ggccatgttt tttaaagaaa tagaaaacct aaaggaatat 120 tttcaggcaa gtaatccaga tatccag 147 <210> 21 <211> 201 <212> DNA <213> dog <400> 21 ccatacgtat cggacggtgg gtctcttttc gtagatattt tgaagaaatg gagagaggag 60 agtgacaaaa caatcattca gagccaaatt gtctctttct acttgaaact gtttgacaac 120 tttaaagata accagatcat tcaaaggagc atggatacca tcaaggaaga catgcttggc 180 aagttcttac agtcgaccac c 201 <210> 22 <211> 195 <212> DNA <213> dog <400> 22 ccgatatcca ccagtaagag ggaggacttc cttaagctga ttcaaattcc tgtgaacgat 60 ctgcaggtcc agcgcaaggc gataaatgaa ctcatcaaag tgatgaatga tctctcacca 120 agatccaacc taaggaagcg gaaaaggagt cagaatctgt ttcgaggccg cagagcatcg 180 aaataagaat tcgag 195 <210> 23 <211> 517 <212> DNA <213> dog <400> 23 gcagatctat gaattataca agctatatct tagcttttca gctttgcgtg attttgtgtt 60 cttctggctg taactgtcag gccatgtttt ttaaagaaat agaaaaccta aaggaatatt 120 ttaatgcaag taatccagat gtatcggacg gtgggtctct tttcgtagat attttgaaga 180 aatggagaga ggagagtgac aaaacaatca ttcagagcca aattgtctct ttctacttga 240 aactgtttga caactttaaa gataaccaga tcattcaaag gagcatggat accatcaagg 300 aagacatgct tggcaagttc ttaaatagca gcaccagtaa gagggaggac ttccttaagc 360 tgattcaaat tcctgtgaac gatctgcagg tccagcgcaa ggcgataaat gaactcatca 420 aagtgatgaa tgatctctca ccaagatcca acctaaggaa gcggaaaagg agtcagaatc 480 tgtttcgagg ccgcagagca tcgaaataag aattcgc 517 <210> 24 <211> 127 <212> PRT <213> dog <220>  <221> mat # peptide  <222> (1) ... (127) <220> Xaa  <221> Xaa is a oxidized form of methionine  <222> (3) <400> 24 Met Asn Tyr Thr Ser Tyr Ile Leu Ala Phe Gln Leu Cys Val Ile Leu             -20 -15 -10 Cys Ser Ser Gly Cys Asn Cys Gln Ala Xaa Phe Phe Lys Glu Ile Glu         -5 -1 1 5 Asn Leu Lys Glu Tyr Phe Gln Ala Ser Asn Pro Asp Val Ser Asp Gly 10 15 20 25 Gly Ser Leu Phe Val Asp Ile Leu Lys Lys Trp Arg Glu Glu Ser Asp                  30 35 40 Lys Thr Ile Ile Gln Ser Gln Ile Val Ser Phe Tyr Leu Lys Leu Phe              45 50 55 Asp Asn Phe Lys Asp Asn Gln Ile Ile Gle Arg Ser Met Asp Thr Ile          60 65 70 Lys Glu Asp Met Leu Gly Lys Phe Leu Gln Ser Ser Thr Ser Lys Arg      75 80 85 Glu Asp Phe Leu Lys Leu Ile Gln Ile Pro Val Asn Asp Leu Gln Val  90 95 100 105 Gln Arg Lys Ala Ile Asn Glu Leu Ile Lys Val Met Asn Asp Leu Ser                 110 115 120 Pro Arg Ser Asn Leu Arg ***             125

   ─────────────────────────────────────────────────── ─── Continued front page    F-term (reference) 4C084 AA06 BA44 DA24 ZB02                 4H045 AA20 BA10 CA40 DA18 EA22                       EA28 EA29 GA22

Claims (9)

[Claims] 1. A solution containing interferon-γ and its oxide is fractionated and purified with a buffer solution containing a salt, and then at least one selected from citric acid, glycine and boric acid in a desalting step or a final purification step. A method for purifying interferon-γ, which comprises using a solvent containing one kind. 2. The method for purifying interferon-γ according to claim 1, wherein the interferon-γ is canine interferon-γ. 3. The method for purifying interferon-γ according to claim 1 or 2, wherein the method of fractionating and purifying with a buffer containing a salt is a method of using a blue sepharose carrier. 4. Canine interferon-γ is SEQ ID NO: 2
The interferon-γ according to claim 2 or 3, which has the amino acid sequence according to any one of claims 10 to 10.
Purification method. 5. The interferon-γ according to any one of claims 1 to 4, wherein the pH of the solvent containing at least one selected from citric acid, glycine and boric acid is 7 to 10. Purification method. 6. The method according to claim 1, wherein the weight ratio of the oxide to the total of interferon-γ and its oxide after the desalting step or the final purification step is 10% by weight or less. Or the interferon-γ according to item 1.
Purification method. 7. The oxide according to claim 1, wherein the methionine residue of the interferon-γ polypeptide chain is oxidized to methionine sulfoxide.
7. The method for purifying interferon-γ according to any one of 1 to 6. 8. The oxide has a structure in which the methionine at the third position from the N-terminal in the amino acid sequence of any of SEQ ID NOs: 2 to 10 is oxidized to methionine sulfoxide. Item 8. A method for purifying interferon-γ according to any one of Items 1 to 7. 9. Interferon-γ, which is mixed with a solution containing at least one selected from citric acid, glycine and boric acid and having a pH of more than 7.