JP2003259868A - RECOMBINANT NUCLEIC ACID HAVING alpha-AMYLASE TRANSCRIPTIONAL ENHANCER OF RICE AND STABLY TRANSFORMED PLANT CELL AND TRANSFORMED PLANT INCLUDING THE SAME - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide an enhancer derived from α-amylase gene of rice usable to increase a promoter activity in a transformed plant cell or a transformed plant, and transformed plant cell and a transformed plant including the enhancer. <P>SOLUTION: Disclosed are a transcriptional enhancer derived from αAmy8 gene of rice, a promoter operatively connected with the enhancer and a recombinant nucleic acid operatively connected with the promoter and having a coding sequence encoding a transcript. Disclosed are also a stably transformed plant cell and transformed plant including the recombinant nucleic acid or a similar recombinant nucleic acid having a transcriptional enhancer derived from a plurality of αAmy3 genes of rice. <P>COPYRIGHT: (C)2003,JPO

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a transcriptional enhancer derived from the rice α-amylase gene, which can be used to increase promoter activity in transformed plant cells or in transformed plants,
It also relates to transformed plant cells and transformed plants containing this enhancer.

[0002]

BACKGROUND OF THE INVENTION Various strategies have been used to improve promoter activity in transformed plants. One of these strategies is to use an enhancer that is homologous or heterologous to the enhancer and that enhances the transcriptional activity of the promoter. This strategy is useful for producing transformed plants that overexpress endogenous or exogenous genes that control agronomically important characteristics or for overproduction of biomolecules.

[0003]

Accordingly, it is an object of the present invention to provide an enhancer from the rice α-amylase gene which can be used to increase promoter activity in transformed plant cells or in transformed plants, as well as this enhancer. It is intended to provide a transformed plant cell containing the same and a transformed plant.

[0004]

[Means for Solving the Problems] The above-mentioned object is as follows (1)
~ (23).

(1) A transcription enhancer derived from the rice αAmy8 gene; a promoter that is heterologous to the enhancer and is operably linked to the enhancer; and operably linked to the promoter,
A recombinant nucleic acid consisting of a coding sequence that encodes a transcript.

(2) The nucleic acid according to (1) above, wherein the transcript encodes a polypeptide.

(3) The nucleic acid according to (1) or (2) above, wherein the transcription enhancer consists of the nucleotide sequence of SEQ ID NO: 1 or its equivalent sequence having transcription enhancer activity.

(4) A transcription enhancer derived from a plurality of rice αAmy8 genes; a promoter operably linked to the enhancer; and a coding sequence operably linked to the promoter and encoding a transcript. Which is a recombinant nucleic acid.

(5) The nucleic acid according to (4) above, which has 2, 3 or 4 copies of the enhancer.

(6) The nucleic acid according to (4) or (5) above, wherein the transcript encodes a polypeptide.

(7) The transcription enhancer is SEQ ID NO: 1
The nucleic acid according to any one of (4) to (6) above, which comprises the nucleotide sequence of (4) or its equivalent sequence having transcription enhancer activity.

(8) A transcription enhancer derived from the rice αAmy8 gene; heterologous to the above enhancer,
A stably transformed plant cell or transformed plant comprising a promoter operably linked to the enhancer; and a recombinant nucleic acid operably linked to the promoter and comprising a coding sequence encoding a transcript.

(9) The stably transformed plant cell or transformed plant according to (8) above, wherein the transcript encodes a polypeptide.

(10) The stably transformed plant cell or trait according to (8) or (9) above, wherein the transcription enhancer consists of the nucleotide sequence of SEQ ID NO: 1 or its equivalent sequence having transcription enhancer activity. Convertible plant.

(11) The stably transformed plant cell or transformed plant according to any of (8) to (10) above, wherein the plant is a monocot.

(12) The stably transformed plant cell or transformed plant according to any of (8) to (11) above, wherein the plant is a cereal plant.

(13) The stably transformed plant cell or transformed plant according to (12) above, wherein the plant is a rice plant.

(14) αAmy3 or α of plural rice
A transcription enhancer from the Amy8 gene; a promoter operably linked to the enhancer; and a stably transformed recombinant nucleic acid comprising a coding sequence operably linked to the promoter and encoding a transcript. Plant cells or transformed plants.

(15) The transcription enhancer is αAmy
The stably transformed plant cell or transformed plant according to (14) above, which is derived from 3 genes.

(16) The stably transformed plant cell or transformation according to the above (15), wherein the transcription enhancer comprises the nucleotide sequence of SEQ ID NO: 2, 3 or 4 or its equivalent sequence having transcription enhancer activity. plant.

(17) The transcription enhancer is αAmy
The stably transformed plant cell or transformed plant according to (14), which is derived from 8 genes.

(18) The stably transformed plant cell or transformed plant according to (17) above, wherein the transcription enhancer consists of the nucleotide sequence of SEQ ID NO: 1 or its equivalent sequence having transcription enhancer activity.

(19) The stably transformed plant cell or transformed plant according to any of (14) to (19) above, wherein the nucleic acid has 2, 3 or 4 copies of the enhancer.

(20) The stably transformed plant cell or transformed plant according to any one of (14) to (19) above, wherein the transcript encodes a polypeptide.

(21) The stably transformed plant cell or transformed plant according to any of (14) to (20) above, wherein the plant is a monocot.

(22) The stably transformed plant cell or transformed plant according to any of (14) to (21) above, wherein the plant is a cereal plant.

(23) The stably transformed plant cell or transformed plant according to (22) above, wherein the plant is a rice plant.

[0028]

BEST MODE FOR CARRYING OUT THE INVENTION The embodiments of the present invention will be described in detail below. Other aspects, objects, and advantages of the present invention are as follows.
It will be apparent from the detailed description and claims.

The first aspect of the present invention is a transcription enhancer derived from the rice αAmy8 gene; a promoter that is heterologous to the enhancer and is operably linked to the enhancer; and a transcript operably linked to the promoter. There is provided a recombinant nucleic acid comprising a coding sequence encoding The transcription enhancer according to the present invention significantly improves the promoter activity, so that in a plant cell or transformed plant stably transformed with such a recombinant nucleic acid, the endogenous or exogenous gene is highly active. It can be expressed in certain situations and in tightly regulated systems. Further, the enhancer derived from the αAmy8 gene according to the present invention has sensitivity to sugar,
Encode genes or commercially useful polypeptides that are disease-, insect-, or stress-resistant to enhance promoter activity with hormone responsiveness, tissue-specifically, and developmentally-dependently It is useful for developing a plant system that overexpresses a gene that becomes a gene.

Α-Amylase is the major amylolytic enzyme that hydrolyzes the starch stored in the endosperm during germination of the grain, which provides the nutrients necessary for embryo growth. The expression of α-amylase gene in cereals is
Induced by both A) and sugar starvation. The rice α-amylase isozyme is encoded by at least 9 genes (Thomas, BR,
and Rodriguez, RL (1994) Plant Physiol 106: 123
5-1239). Of these, αAmy3 and αAmy8
Is significantly induced by sugar deficiency. 105 bp sugar response sequence of SEQ ID NO: 2
(SRS) has already been identified in αAmy3 (Lu
et al. (1998) J Biol Chem 273: 10120-10131).

In the present invention, it was found that the 230 bp sequence of SEQ ID NO: 1 in the rice αAmy8 gene promotes promoter activity in plant cells. This enhancer is located at −318 to −89 bp of αAmy8, has a 31 bp GC box at positions −266 to −236 bp, and is located −131 to − upstream of the transcription initiation site.
It has a TATCCA element at 126 bp.
Both of these are conserved in the αAmy3 SRS (ie SEQ ID NO: 2). In addition, αAmy8 of SEQ ID NO: 1
The gene-derived enhancer is a sequence having homology with the c-Myb binding site (Nakagoshi et al. (1990) J Biol Ch.
em 265: 3479-3483) and the GA response sequence (GA response s
sequence) (GARS) (Gubler et al. (1999) Plant J
17: 1-9), both of which are αAmy3 SR
Not present in S (ie, SEQ ID NO: 2). As used herein, the 230 bp αAmy8 gene-derived enhancer and mutants thereof are referred to as αAmy8 SRS / G.
Called ASR.

As described above, the present invention can be used to obtain transformed cells and transformed plants, and αAmy8 of rice is used.
Gene-derived transcription enhancer (ie, αAmy8 S
RS / GARS) -containing recombinant nucleic acid, but the recombinant nucleic acid of the present invention is a transcription enhancer derived from the αAmy8 gene of rice, is heterologous to the enhancer, and can be manipulated by the enhancer. It may be a nucleic acid fragment containing a promoter to be linked and a coding sequence operably linked to the promoter and encoding a transcript. Further, the recombinant nucleic acid of the present invention may be in the form of a plasmid or virus vector containing such a nucleic acid fragment.

The transcription enhancer used in the first aspect of the present invention is derived from the rice αAmy8 gene and is not particularly limited as long as it has a desired enhancer activity, but is preferably -318 to -8 of the αAmy8 gene.
It consists of the nucleotide sequence of SEQ ID NO: 1 corresponding to 9 bases or its equivalent sequence having transcription enhancer activity. On this occasion,
The base sequence of SEQ ID NO: 1 is as follows.

CGTCATGCGTGATCGGTGATCGATCACCGAGAGAGACC
GGACGACGAGTCGAGAGAGCTCGCGCCGCCTCGATCGGCGCGGCGGTGAC
TCGAGCAGGGCCTGAAGTAGCTGCACGGCTCAAGGCGGCACTCCATCACC
GGACACCGGGGTCCAGACTACTCGTTTCCGTTGGAGAAATAACCACCTTT
ATCCATGTTGCTTATCCGTGAATTGCAACAGCATTGATTGTT (SEQ ID NO: 1) In the present invention, the transcription enhancer may have a sequence longer or shorter than SEQ ID NO: 1 as long as it exerts an enhancer activity, that is, the base shown in SEQ ID NO: 1. It also includes equivalent sequences of sequences.
In this specification, the term "the equivalent sequence" means
It means that the base sequence shown in SEQ ID NO: 1 has some bases inserted, substituted or deleted, or added to both ends, and still exerts (holds) its enhancer activity. To do. In addition, the expression (retention) of enhancer activity in the equivalent sequence is
In an actual usage mode utilizing the activity, it means that the activity is maintained to the extent that the nucleotide sequence having all the sequences shown in SEQ ID NO: 1 can be used in substantially the same manner under the same conditions. It is obvious that those skilled in the art can select and produce such an “equivalent sequence” by referring to the sequence shown in SEQ ID NO: 1 without any particular difficulty.
Furthermore, enhancer activity can be determined by the methods described in the Examples below or by similar methods. Examples of such an equivalent sequence include, for example, -200 to-of αAmy8.
89 bp and the like. Mutant nucleic acid sequences obtained by polymorphism or as a result of recombinant genetic engineering are also
It can be used in the transcription enhancer according to the invention. For example,
A modified αAmy8 enhancer with duplication of TATCCA elements increases enhancer activity 6-fold in rice embryos. Recombinant nucleic acids having mutations of such sequences that retain enhancer activity, as well as stably transformed plant cells and transformed plants having such recombinant nucleic acids are also included in the invention.

The coding sequence, which constitutes the recombinant nucleic acid of the present invention, is operably linked to a promoter and encodes a transcript. At this time, the transcript is
It is not particularly limited and may be any transfer material, and can be appropriately selected depending on the desired application. Transcripts preferably used in the present invention include, for example, those encoding polypeptides and RNA. Among these, as RNA, as functions of other RNA in plant cells such as monocotyledonous plants (preferably cereal plants),
For example, preventing post-transcriptional gene silencing (sil) that prevents RNA from being translated into a polypeptide.
triggering the degradation of specific RNAs to facilitate encing (Mol et al. (1990) FEBS Lett 268 (2): 427-3.
0 and Fireet al. (1998) Nature 391: 806-811), RN
It may be A. The form of RNA is not particularly limited and may be any form, for example, mRNA, transfer RNA (tRNA), ribosomal RNA.
(RRNA), and small nuclear RNA (snRNA). Also, in the case of transcripts encoding a polypeptide, examples of transcripts are those required for amelioration of certain characteristics of the transformed plant or overproduction of the polypeptide in transformed plant cells or plants. There are some that encode polypeptides. In the latter case, in order to facilitate the recovery of the overproduced polypeptide, a sequence encoding a signal peptide is placed at a suitable position, for example between the promoter and the coding sequence of the polypeptide, as described above. It may be incorporated inside. As a result, the polypeptide is secreted into the cell culture medium or into the endosperm of germinated seeds, facilitating its recovery.
Of these, the transcript preferably encodes a polypeptide.

The promoter used in the recombinant nucleic acid of the present invention is not particularly limited and may be one that is widely spread and has activity, and known promoters can be used. Examples thereof include those derived from the actin gene, cauliflower mosaic virus 35S (CaMV35S) RNA, or ubiquitin gene. Alternatively, the promoter used in the present invention may be inducible (inducible).
ible), in this case, for example, those derived from α-amylase gene, invertase gene, sucrose synthase gene, patatin (patatin) gene, β-amylase gene, sporamin gene, and photosynthetic gene. Is mentioned. The above α-amylase genes include rice αAmy3 and αAmy3.
Genes responsive to sugars can be used, such as the 6, αAmy7, αAmy8 and αAmy10 genes (see US Pat. No. 5,460,952). In addition, in the present invention, a transcriptional control element such as another enhancer may be further included in the recombinant nucleic acid of the present invention for the purpose of considerably activating and very controlling the promoter activity.

In the first aspect of the invention, the promoter is heterologous to the enhancer.

ΑAmy8 SRS / GA, a transcription enhancer derived from the rice αAmy8 gene according to the present invention
The RS enhancer increases promoter activity in a dose-dependent manner. Thus, multiple (eg 2, 3, or 4 copies) rice αAmy8 gene-derived transcriptional enhancer; a promoter homologous or heterologous to said enhancer and operably linked to said enhancer; and said promoter. Recombinant nucleic acids operably linked to and having a coding sequence that encodes a transcript are also a preferred embodiment of the invention.

Therefore, the second aspect of the present invention is a transcription enhancer derived from a plurality of (for example, 2, 3 or 4 copies) rice αAmy8 gene; homologous or heterologous to the enhancer and operable by the enhancer. And a recombinant nucleic acid comprising a coding sequence operably linked to the promoter and encoding a transcript. Unless otherwise specified, the transcription enhancer in the second aspect of the present invention,
The definitions of the promoter and the coding sequence are the same as the definitions in the first aspect of the present invention.

In the second aspect of the invention, multiple copies of the enhancer are used. In this case, these enhancers do not have to be oriented in the same orientation as each other, and
Each enhancer may be the same or different. In addition, an intervening sequence (for example, a length of 50 to 100 bp or more) may be present between two copies of the enhancer as long as it does not interfere with the enhancer function.

In the present invention, the copy number of the enhancer is not particularly limited, but it is preferably 2, 3 or 4. Here, if too many enhancers are used (eg, more than 4 copies), they may be spliced out of the vector by recombination as it replicates in bacteria. In addition, too many copies of the enhancer may cause gene silencing in transformed plants. Thus, although promoter activity generally increases in proportion to enhancer copy number, the actual maximum copy number of an enhancer can be determined by the methods described in the Examples below or by similar methods.

The promoter used in the second recombinant nucleic acid of the present invention may be homologous or heterologous to the enhancer. This promoter is defined in the same manner as in the first aspect of the present invention except the above.

The recombinant nucleic acid containing the transcription enhancer derived from the first rice αAmy8 gene of the present invention can be introduced into plant cells to obtain stably transformed cells. Further, the transformed plant cells thus obtained can be further cultured to obtain transformed plants. Both such stably transformed plant cells and transformed plants are included in the invention.

Therefore, a third aspect of the present invention is a stably transformed plant cell or transformed plant containing the first recombinant nucleic acid of the present invention, more specifically, a transcription enhancer derived from the rice αAmy8 gene; A promoter that is heterologous to the enhancer and is operably linked to the enhancer; and that is stably transformed with a recombinant nucleic acid that is operably linked to the promoter and that comprises a coding sequence that encodes a transcript. Plant cells or transformed plants. Unless otherwise specified, the transcription enhancer in the third aspect of the present invention,
The definitions of the promoter and the coding sequence are the same as the definitions in the first aspect of the present invention.

Similarly, a stable transformed cell can be obtained by introducing the second recombinant nucleic acid of the present invention into a plant cell, and by culturing this cell, a transformed plant can be obtained. can get. Both such stably transformed cells and transformed plants are included in the concept of the present invention.

The present invention also provides a plurality of (eg, 2,
(3 or 4 copies) a transcriptional enhancer derived from the rice αAmy3 gene; a promoter homologous or heterologous to the enhancer and operably linked to the enhancer; and a transcript operably linked to the promoter, It also includes stably transformed plant cells or transformed plants containing a recombinant nucleic acid having an encoding coding sequence.

Accordingly, a fourth aspect of the present invention is to encode a transcript which is a transcription enhancer derived from a plurality of rice αAmy3 or αAmy8 genes; a promoter which is operably linked to the enhancer; and which is operably linked to the promoter. The present invention provides a stably transformed plant cell or a transformed plant containing a recombinant nucleic acid comprising a coding sequence that changes. Unless otherwise specified, the definitions of the transcription enhancer, promoter, coding sequence and the like in the fourth aspect of the present invention are the same as the definitions in the first aspect of the present invention.

In the third and fourth aspects of the present invention, a method of transforming a plant cell as a host with a recombinant nucleic acid to obtain a stably transformed plant cell; and such a transformed plant As a method for culturing cells to highly express a desired gene, various methods already reported and established in the art can be used.

In the third and fourth aspects of the present invention, the plant cell as a host to be transformed is not particularly limited, and known plant cells can be used, but preferred examples include protoplasts and callus. Can be mentioned.

Further, in the third and fourth aspects of the present invention,
The type of transformed plant obtained by culturing the transformed plant cell of the present invention is not particularly limited, and can be appropriately selected depending on the desired use and the like. For example, monocotyledonous plants and cereal plants are preferred, and rice plants are particularly preferably used.

The transcription enhancer used in the fourth aspect of the present invention is not particularly limited as long as it is derived from the rice αAmy3 or αAmy8 gene and has a desired enhancer activity. Preferably, rice αAmy8
The transcription enhancer derived from consists of the base sequence of SEQ ID NO: 1 corresponding to -318 to -89 bases of the αAmy8 gene or its equivalent sequence having transcription enhancer activity, as described in the first aspect of the present invention. In addition, αAm of rice
The transcription enhancer derived from y3 is -of the αAmy3 gene.
A base sequence of SEQ ID NO: 2 corresponding to 186 to -82 bases;
The nucleotide sequence of SEQ ID NO: 3 corresponding to -133 to -82 bases of αAmy3 gene, and -186 of αAmy3 gene
It is preferably composed of at least one kind selected from the group consisting of the base sequences of SEQ ID NO: 4 corresponding to -122 bases or an equivalent sequence thereof having transcription enhancer activity. At this time, the base sequences of SEQ ID NOs: 2, 3 and 4 are as follows.

ATCCCGTCGCCTTGGAGACCGGGCCCCGACGCGGCCGA
CGCGGCGCCTACGTGGCCATGCTTTAT TGCCTTATCCATATCCACGCCA
TTTATTGTGGTCGTCTCT (SEQ ID NO: 2) GCCATGCTTTATTGCCTTATCCATATCCACGCCATTTATTGTGGTCGTCT
CT (SEQ ID NO: 3) ATCCCGTCGCCTTGGAGACCGGGCCCCGACGCGGCCGACGCGGCGCCTAC
GTGGCCATGCTTTAT (SEQ ID NO: 4) In the present invention, the transcription enhancer may have a sequence longer or shorter than SEQ ID NO: 2, 3 or 4 as long as it exerts an enhancer activity, that is,
It also includes an equivalent sequence of the base sequence shown in SEQ ID NO: 2, 3 or 4. As described in the first aspect of the present invention, in the present specification, the term “the equivalent sequence” means the insertion or substitution of several bases in the base sequence shown in SEQ ID NO: 2, 3 or 4. Or, it means that it is deleted or added to both ends and that it still exerts (holds) its enhancer activity. In addition, the expression (holding) of the enhancer activity in the equivalent sequence is almost the same as the base sequence having all of the sequences shown in SEQ ID NO: 2, 3 or 4 in the actual use mode utilizing the activity. It means that the activity is maintained to the extent that it can be similarly used. It is obvious that those skilled in the art can select and produce such an “equivalent sequence” by referring to the sequence shown in SEQ ID NO: 1 without any particular difficulty. further,
Enhancer activity can be determined by the methods described in the Examples below or by analogy. Recombinant nucleic acids having mutations of such sequences that retain enhancer activity, as well as stably transformed plant cells and transformed plants having such recombinant nucleic acids are also included in the invention.

In the fourth aspect of the present invention, rice αAmy
Multiple copies are used as the transcription enhancer from the 3 or αAmy8 gene. At this time, these enhancers do not need to be placed in the same orientation as each other,
Further, each enhancer may be the same or different. In addition, an intervening sequence (for example, a length of 50 to 100 bp or more) may be present between two copies of the enhancer as long as it does not interfere with the enhancer function.

The copy number of the enhancer is not particularly limited, but it is preferably 2, 3 or 4.
Here, if too many enhancers are used (eg, more than 4 copies), they may be spliced out of the vector by recombination as it replicates in bacteria. In addition, too many copies of the enhancer may cause gene silencing in transformed plants. Thus, although promoter activity generally increases in proportion to enhancer copy number, the actual maximum copy number of an enhancer can be determined by the methods described in the Examples below or by similar methods.

Α having the nucleotide sequences of SEQ ID NOs: 2 to 4 above
Amy3 SRS promotes promoter activity in protoplasts of sugar-starved rice (Lu et al. (1998) J Bi
ol Chem 273: 10120-10131). Surprisingly, in stably transformed rice suspension culture cells, αAmy3
SRS can significantly increase promoter activity regardless of whether cells are cultured with or without sugar. This promoter activity is also associated with the protoplast transient expression system.
cation system), it is much higher in stably transformed plant cells.

In the present invention, both αAmy3 SRS and αAmy8 SRS / GARS promote promoter activity in transformed rice. At this time, αA
Whereas my3 SRS promotes promoter activity in a tissue-independent manner, αAmy8SRS / GARS mainly promotes promoter activity in endosperm and embryo of germinated rice seeds. In addition, αAmy8 SRS / GARS
Enhancer activity of Saccharomyces cerevisiae
, But the inhibition of sugar abolishes the induction of GA. Therefore, αAmy3 SRS and αAmy8
SRS / GARS are useful for the regulated expression of endogenous or exogenous genes in stably transformed plant cells or transformed plants.

The promoter used in the recombinant nucleic acid according to the fourth aspect of the present invention may be homologous or heterologous to the enhancer. This promoter is
Other than the above, it is defined as in the first aspect of the present invention.

Therefore, according to the present invention, a highly active and tightly regulated expression system of an endogenous or exogenous gene in a stably transformed plant cell or in a transformed plant can be provided. . The enhancers derived from the αAmy3 and αAmy8 genes according to the present invention have sensitivity to sugars, responsiveness to hormones, specific to tissues, and further improved promoter activity depending on the developmental stage. Alternatively, it is useful for developing a plant system that overexpresses a gene resistant to stress or a gene encoding a commercially useful polypeptide.

[0059]

The present invention will be described more specifically below with reference to the examples of the present invention, but the following examples do not limit the present invention. Without further elaboration, those skilled in the art
Based on the description herein, it is believed that the present invention can be fully utilized. Further, all publications and documents cited in the present specification are each completely incorporated herein by reference.

Reference Example 1 (1) Plant Material Oryza sativa L. Sea buoy. Tainung 67 (Oryza sativa L.cv. Tainung 67) was used as the rice variety in this example. Immature seed husks were removed, sterilized with 3% NaOCl for 30 minutes, washed well with sterile water, and N6D agar medium (Toki,
S. (1997) Plant Mol Biol Rep 5: 16-21). 1
Months later, new N6D for transformation of callus derived from scutellum
The medium was subcultured.

(2) Construction of plasmid For the purpose of constructing a plasmid containing the Act1-Luc chimeric gene, pBluescript SKII + (S
Eco in the multiple cloning site of tratagene)
The RI site was first removed by digestion with EcoRI, then made blunt ended and religated. 5'region of Act1 of rice (1.4 kb 5'-flanking sequence, 79
5'-noncoding exon of bp, 447 bp
5'-intron and 25 bp of the first coding exon) were added to pDM302 (Cao et al. (1992).
(Plant Cell Rep 11: 586-591) was excised with HindIII, and pBluescript without EcoRI site was excised.
By subcloning into the same site of pt,
pAct was obtained. Rice αAmy3 SRS (αAmy
3 to the transcription start site of -186 to -82),
Oligonucleotide: 5'-CCC GAATTC ATC
CCGTCGCCCTTGGAGA-3 ′ (SEQ ID NO: 5,
The underlined) into the EcoRI site as 5 'primer, and oligonucleotides: 5'-CCC G
AATTC AGAGACGACAATAAAT-3 ′ (SEQ ID NO: 6, the EcoRI site is underlined) as the 3 ′ primer and 1.7 kb of αAmy3.
P3G-132II (Lu et al. (199
8) PCR amplified using J Biol Chem 273: 10120-10131) as a DNA template. Ec of DNA fragment containing SRS
pACT-3SRS was obtained by digestion with oRI and insertion in the EcoRI site of the Act1 promoter (at position -459 with respect to the transcription start site) in three tandem repeats in the same orientation as the promoter. S containing the Luc coding sequence-Nos terminator fusion sequence
The alI-BglII fragment was added to pJD312 (Luehrsen et a
l. (1992) Methods Enzymol 216: 397-414) to give blunt ends, and then pACT and pACT-3S.
By inserting into the SmaI site of RS, pB-Act-LN and pB-Act-3SRS-, respectively.
LN was obtained. Next, pB-Act-LN and pB-Ac
Each of the t-3SRS-LNs was linearized with PstI to form a 35S promoter-Hph coding region-tumor morphology large gene.
(Tml) Terminator fusion gene containing binary vector pSMY1H (Ho et al. (2000) Plant Ph
ysiol 122: 57-66) to insert pAct-LN and pAct-3SRS, respectively.
-LN was obtained.

(3) Transformation of rice The plasmids pAct-LN and p obtained in (2) above.
Each of the Act-3SRS-LN was prepared according to the manufacturer's instructions by using an electroporator (BTX,
San Diego) and Agrobacterium tumefaciens EHA101 strain (Hood et al.
(1986) J Bacteriol 168: 1291-1301). Callus derived from immature rice seeds was cultivated with Agrobacterium tumefaciens (A. tumefaciens).
t al. (Plant J 6: 271-282, 1994) and Toki (Plant Mo
l Calli Rep 5: 16-21 1997).

(4) Suspension cell culture The transformed callus obtained in (3) above was subjected to Yu et al. (J
Biol Chem 266: 21131-21137, 1991) and propagated as described. Lu established cell suspension
Subcultures were performed as described by et al. (J Biol Chem 273: 10120-10131, 1998).

(5) Luciferase activity assay All proteins were analyzed in CCLR buffer (100 mM KH ₂
(PO ₄ ), pH 7.8, 1 mM EDTA, 10%
Glycerol, 1% Triton X-100, 7m
M β-mercaptoethanol) and extracted from cultured suspension cells or plant tissues and protein concentration was determined using Coomassie protein assay reagent (Pierce). Luciferase activity assay was performed by Lu et al. (1998).
Performed as described in J Biol Chem273: 10120-10131.

Example 1: αAmy8 SRS / GARS
Is an αAmy8SRS / GARS enhancer containing positions -318 to -89 of the αAmy8 promoter that promoted Act1 promoter activity in transformed rice,
Inserted at the −459th position of the Act1 promoter in three tandem repeats in the same orientation as the promoter,
This was tested for effects on Act1 promoter activity in transformed rice.

Act1-Luc and Act1-8SRS
The transformed callus having the / GARS-Luc chimeric gene was regenerated and self-fertilized for 3 generations to obtain T3 homozygous seeds. The homozygosity of transformed seeds is 7
2 in water containing 50 μg / ml hygromycin daily
Five transformed seeds were germinated and measured by calculating the ratio of the number of grown seedlings to the number of ungrown seedlings. Theoretically, all seeds of transformed lines that are homozygous for the transgene must germinate and grow under these conditions.

Transformation systems Act 6-9-1 and Act
(8SRS / GARS) 5 T3 homozygous seeds,
Germinated and grown for days. Various tissues of seedlings were collected and assayed for luciferase activity. Surprisingly, α
The Amy8 SRS / GARS enhancer improved Act1 promoter activity mainly in the endosperm and embryo of germinated seeds and seedlings.

Further, the αAmy8 SRS / GARS enhancer was added to the CaMV 35S minimal promoter-Lu.
After fusing upstream of the c-fusion gene, it was introduced into the rice genome. Several transformed rice lines were obtained.
One of these series is randomly selected (this series is referred to as "T4-12"), and T2 of this T4-12 series is selected.
Seeds were germinated for 6 days. Various tissues of germinated seeds were collected and assayed for luciferase activity. Luciferase activities in endosperm and embryo were 74 and 20 times, respectively, as compared to root. At this time, the luciferase activity in shoots was similar to that in roots. From these findings, αAmy8 SRS / GARS enhancer
It is shown that the minimal promoter confers endosperm- and embryo-specific activity in germinated transformed rice seeds.

In a second experiment, a similar batch of T2 seed from the transformation system T4-12 described above was prepared in 2,4
-D (2,4-dichlorophenoxyacetic acid) for 8 days,
Pre-treated. The embryos were collected and divided into 4 groups. Each group of embryos,
Luciferase activity was assayed after incubation for 2 days with or without sucrose and with or without GA. In the presence of sucrose, luciferase activity in embryos was relatively low, with or without GA. In the absence of both sucrose and GA, luciferase activity in embryos was significantly increased 5.5-fold. Addition of GA in the absence of sucrose promoted luciferase activity by a factor of 8.2.

In the third experiment, the transformation system T4 described above was used.
T1 seed embryos from −12 were removed to break the GA source. Next, the internal milk was divided into 4 groups. Each group of endosperm for 2 days with or without sucrose and GA
After incubation with or without GA,
Luciferase activity was assayed. In the absence of GA, luciferase activity in endosperm was low with or without sucrose. In the presence of both GA and sucrose, luciferase activity in endosperm was increased 4-fold. Removal of sucrose in the presence of GA did not change luciferase activity. From these results, the αAmy8 SRS / GARS enhancer is the GA promoter in the rice embryo and endosperm.
It is shown to give responsiveness.

Example 2: αAmy3 SRS is a firefly luciferase gene (Luc) which promotes Act1 promoter activity in stably transformed rice suspension cells, and is expressed in three tandems of the Act1 promoter and αAmy3 SRS, respectively. Fused downstream of the Act1 promoter containing repeats, Act1-Luc and A, respectively.
ct1-3SRS-Luc was obtained. The chimeric gene thus obtained was used as an Agrobacterium (Agrobacteri
(um) and introduced into the rice genome.
Several transformed cell lines were obtained, 4 for each construct
Lines were randomly selected and used for further studies.

The transformed callus was cultured as a suspension cell. These cells were then incubated for 2 days in medium with or without sucrose before assaying for luciferase activity. The luciferase activity conferred by the wild-type Act1 promoter was very low in cells lacking sucrose. This is 6-8 compared to the luciferase activity in cells fed sucrose.
It was twice as low. In contrast, Act1-3SR
The luciferase activity conferred by the S promoter was dramatically increased in cells lacking sucrose, approximately 2-5.5 times the value in cells fed with sucrose. Surprisingly, the Act1-3SRS promoter conferred significantly higher luciferase activity regardless of whether cells were cultured with or without sucrose. That is, αAmy3 SRS promoted Act1 promoter activity by an average of 3-fold in cells fed sucrose and at least 20-fold in cells lacking sucrose. From these results, the expression of luciferase was found to be αAmy3 in stably transformed rice suspension cells.
Incorporation of SRS into the Act1 promoter is shown to significantly enhance. In addition, αAm
The y3 SRS has also been shown to convert the sugar-inducible Act1 promoter into a sugar-deficiency-inducible promoter.

Example 3: αAmy3 SRS is a 4-transformation system having Act1-Luc which promoted Act1 promoter activity in transformed rice and Act1-.
Eight transgenic T3 homozygous seeds containing 3SRS-Luc were germinated and grown for 8 days. Leaves were collected from seedlings and assayed for luciferase activity. Luciferase activity was not significantly different in leaves of all transformed lines with similar constructs. The average luciferase activity conferred by the Act1-3SRS promoter in the different transformants was comparable and 2.5-3 times higher than that conferred by the Act1 promoter. From these results, αAmy3 SRS
Are generally shown to promote Act1 promoter activity in transformed rice.

Surprisingly, the promotion of Act1 promoter activity by αAmy3 SRS was developmentally regulated. Transformation systems Act 6-9-1 and Act (3
SRS) 5-15-1 T3 homozygous seeds were germinated and grown for a specified period of time. The Act1-3SRS promoter conferred higher luciferase activity after 2 weeks in various tissues of germinated seeds and seedlings compared to the Act1 promoter. The difference in promotion of luciferase activity is
The roots were most dramatic (5-56 fold), followed by shoots (4-11 fold) and embryos (3-18 fold). Act
Luciferase activity in various organs conferred by the 1 and Act1-3SRS promoters peaked within 7-8 days of germination and decreased thereafter. Within 8 weeks of growth, the difference in promotion of luciferase activity was highest in roots (7 to 38 times), then higher in leaves (5 to 20 times), and lowest in pods (4 to 7 times).
Times).

Total luciferase activities in transformed seedlings and plant leaves, pods, and roots were calculated and compared. A
Luciferase activity conferred by the ct1 or Act1-3SRS promoters in transformed rice varied depending on the developmental stage. The luciferase activity in various tissues was first determined within 1 week after germination.
Peaked, reached the lowest level at 2 or 3 weeks, and rose again at 4 weeks.

In addition, the luciferase activity conferred by the Act1-3SRS promoter causes the seedlings to grow in the dark or light / dark cycle.
It was significantly higher than the luciferase activity conferred by the Act1 promoter regardless of whether it was grown in e). In addition, the light / dark cycle (light / darkcyc
luciferase expression in seedlings grown in (le) was higher than in leaves grown in the dark within 1 week after germination, whether or not the Act1 promoter contained the αAmy3 SRS. It was

While many embodiments of the invention have been described, it will be appreciated that various modifications may be made without departing from the spirit and spirit of the invention. Therefore, other embodiments are within the concept of the invention.

[0078]

EFFECTS OF THE INVENTION As described above, the present invention provides (1) a transcription enhancer derived from the rice αAmy8 gene; a promoter that is heterologous to the enhancer and is operably linked to the enhancer; A recombinant nucleic acid operably linked and consisting of a coding sequence encoding a transcript; (2) a plurality of rice αAmy
(3) A recombinant nucleic acid comprising a transcription enhancer derived from 8 genes; a promoter operably linked to the enhancer; and a coding sequence operably linked to the promoter and encoding a transcript; (3) rice αAm
A transcription enhancer derived from the y8 gene; a promoter heterologous to the enhancer and operably linked to the enhancer; and a recombinant nucleic acid comprising a coding sequence operably linked to the promoter and encoding a transcript. Stably transformed plant cells or transformed plants comprising: (4) a transcription enhancer derived from a plurality of rice αAmy3 or αAmy8 genes; a promoter operably linked to the enhancer; and operable to the promoter And a stably transformed plant cell or transformed plant comprising a recombinant nucleic acid consisting of a coding sequence coding for a transcript, which is ligated to. By using the recombinant nucleic acid of the present invention, it is possible to increase the promoter activity in the plant cell or plant transformed with this nucleic acid, and thus such recombinant nucleic acid was stably transformed. Highly active and tightly regulated expression systems of endogenous or exogenous genes are obtained in plant cells or transformed plants.

Further, αAmy3 and αA according to the present invention
The enhancer derived from the my8 gene enhances the promoter activity depending on the sensitivity to sugar, the responsiveness to hormones, the tissue-specificity, and the developmental stage. Transformed plant cells or transformed plants are used to develop plant systems that overexpress genes that are resistant to disease, insects, or stress or genes that encode commercially beneficial polypeptides. It is useful.

[0080]

[Sequence list]                                 SEQUENCE LISTING <110> Academia Sinica <120> RICE ALPHA-AMYLASE TRANSCRIPTIONAL ENHANCERS <130> 2002P0069 <160> 6 <170> FastSEQ for Windows (registered trademark) Version 4.0 <210> 1 <211> 230 <212> DNA <213> Oryza sativa <400> 1 cgtcatgcgt gatcggtgat cgatcaccga gagagaccgg acgacgagtc gagagagctc 60 gcgccgcctc gatcggcgcg gcggtgactc gagcagggcc tgaagtagct gcacggctca 120 aggcggcact ccatcaccgg acaccggggt ccagactact cgtttccgtt ggagaaataa 180 ccacctttat ccatgttgct tatccgtgaa ttgcaacagc attgattgtt 230 <210> 2 <211> 105 <212> DNA <213> Oryza sativa <400> 2 atcccgtcgc cttggagacc gggccccgac gcggccgacg cggcgcctac gtggccatgc 60 tttattgcct tatccatatc cacgccattt attgtggtcg tctct 105 <210> 3 <211> 52 <212> DNA <213> Oryza sativa <400> 3 gccatgcttt attgccttat ccatatccac gccatttatt gtggtcgtct ct 52 <210> 4 <211> 65 <212> DNA <213> Oryza sativa <400> 4 atcccgtcgc cttggagacc gggccccgac gcggccgacg cggcgcctac gtggccatgc 60 tttat 65 <210> 5 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Synthetically generated primer <400> 5 cccgaattca tcccgtcgcc ttggaga 27 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Synthetically generated primer <400> 6 cccgaattca gagacgacaa taat 24

   ─────────────────────────────────────────────────── ─── Continued front page    F term (reference) 2B030 AA02 AB03 AD08 AD20 CA06                       CA17 CA19 CB02 CD03 CD07                       CD09 CD13 CD17                 4B024 AA08 CA01 DA01 FA06 GA11                       GA17 HA20                 4B065 AA88X AA88Y AB01 AC20                       BA01 BD50 CA53

Claims (23)

[Claims] 1. A transcription enhancer derived from the rice αAmy8 gene; a promoter that is heterologous to the enhancer and is operably linked to the enhancer; and a coding that is operably linked to the promoter and encodes a transcript. A recombinant nucleic acid consisting of a sequence. 2. The nucleic acid according to claim 1, wherein the transcript encodes a polypeptide. 3. The nucleic acid according to claim 1 or 2, wherein the transcription enhancer comprises the nucleotide sequence of SEQ ID NO: 1 or its equivalent sequence having transcription enhancer activity. 4. A recombination comprising a transcription enhancer derived from a plurality of rice αAmy8 genes; a promoter operably linked to the enhancer; and a coding sequence operably linked to the promoter and encoding a transcript. Nucleic acid. 5. The nucleic acid of claim 4, wherein the nucleic acid has 2, 3, or 4 copies of enhancer. 6. The nucleic acid according to claim 4 or 5, wherein the transcript encodes a polypeptide. 7. The nucleic acid according to claim 4, wherein the transcription enhancer consists of the nucleotide sequence of SEQ ID NO: 1 or its equivalent sequence having transcription enhancer activity. 8. A transcription enhancer derived from the rice αAmy8 gene; a promoter that is heterologous to the enhancer and is operably linked to the enhancer; and is operably linked to the promoter and encodes a transcript. A stably transformed plant cell or transformed plant comprising a recombinant nucleic acid comprising a coding sequence. 9. The stably transformed plant cell or transformed plant of claim 8, wherein the transcript encodes a polypeptide. 10. The stably transformed plant cell or transformed plant according to claim 8 or 9, wherein the transcription enhancer consists of the nucleotide sequence of SEQ ID NO: 1 or its equivalent sequence having a transcription enhancer activity. 11. The plant according to claim 8, which is a monocotyledonous plant.
10. The stably transformed plant cell or transformed plant according to any one of 10 to 10. 12. The plant according to claim 8, wherein the plant is a cereal plant.
12. The stably transformed plant cell or transformed plant according to any one of 11 above. 13. The plant according to claim 12, which is a rice plant.
The stably transformed plant cell or transformed plant according to 1. 14. A plurality of rice αAmy3 or αAm
A stable transformation comprising a transcription enhancer from the y8 gene; a promoter operably linked to the enhancer; and a recombinant nucleic acid comprising a coding sequence operably linked to the promoter and encoding a transcript. Plant cells or transformed plants. 15. The stably transformed plant cell or transformed plant according to claim 14, wherein the transcription enhancer is derived from the αAmy3 gene. 16. The transcription enhancer is SEQ ID NO: 2, 3.
The stably transformed plant cell or transformed plant according to claim 15, which comprises the nucleotide sequence of 4 or an equivalent sequence thereof having a transcription enhancer activity. 17. The stably transformed plant cell or transformed plant according to claim 14, wherein the transcription enhancer is derived from the αAmy8 gene. 18. The stably transformed plant cell or transformed plant according to claim 17, wherein the transcription enhancer consists of the nucleotide sequence of SEQ ID NO: 1 or its equivalent sequence having transcription enhancer activity. 19. The stably transformed plant cell or transformed plant according to any one of claims 14 to 18, wherein the nucleic acid has 2, 3, or 4 copies of the enhancer. 20. The stably transformed plant cell or transformed plant according to any one of claims 14 to 19, wherein the transcript encodes a polypeptide. 21. The plant is a monocotyledonous plant.
21. The stably transformed plant cell or transformed plant according to any one of 4 to 20. 22. The plant is a cereal plant.
22. A stably transformed plant cell or transformed plant according to any one of claims 21 to 21. 23. The plant according to claim 22, which is a rice plant.
The stably transformed plant cell or transformed plant according to 1.