JP2003230387A - Method for establishing hiv infectious clone - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a cell for assaying an infection capable of assaying the HIV-1 infection in real time without immobilizing the cell, an HIV-1-cloning vector capable of stably cloning an HIV genomic gene and an HIV-1-infected clone. <P>SOLUTION: (1) The cell for assaying the infection is obtained by constructing an expression vector for assaying the HIV-1 infection comprising an nEGFP reporter gene integrated therein and transfecting the resultant vector into an MAGIC-5 cell. (2) The HIV-1-cloning vector is constructed by modifying a plasmid pBR322 as a base. (3) The HIV-infected clone comprising the nEGFP reporter gene integrated therein is obtained by efficiently and stably cloning a gene of about 9.0 kbp corresponding to a nearly full genome of the HIV-1 genomic gene by using the cell (1) for assaying the infection and the HIV-1- cloning vector (2). <P>COPYRIGHT: (C)2003,JPO

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to cells for measuring HIV-1 infection, vectors for cloning the same, and HIV-1.
Infectious clone and its construction, establishment method, especially HIV-
1. Infection measurement cells capable of measuring infection 1 in real time without fixing cells, and HIV-1 cloning vector capable of stably cloning HIV genome gene in each HIV-1 subtype, stable HIV genome gene Specifically cloned HIV-1 infectious clone, and its construction and establishment method.

[0002]

2. Description of the Related Art 1996 E.I. H by Berger et al.
In addition to the CD4 molecule, which is the major viral receptor on the cell side, IV cell T-1 tropic HIV-1 induces CXCR4 and macrophage tropic HI during the process of IV-1 entry into target cells.
V-1 was revealed to use CCR5 as a Coreceptors, and it is a new memory that it opened a breakthrough in the elucidation of HIV-1 tropism and viral entry process. On the other hand, as a measurement system for HIV-1 infection, a system based on the measurement of gag protein p24, which is a structural protein of HIV-1, by ELISA and the measurement of reverse transcriptase activity has been widely used. It was hard to say that the reflected quantitative system.

As a currently used infectious titer measuring system, Emerman et al. Have already reported that CD4-expressing HeLa cells are infected with HIV-.
HIV-1 infected with a cell line incorporating an expression unit containing β-galactosidase added to the nuclear translocation signal of SV40 large T downstream of the LTR of 1.
Established a measurement system MAGI assay that can count in situ the expression of β-galactosidase enzyme activity driven by 1 tat activated LTR, and revealed that the infectious titer of T cell-tropic HIV-1 can be measured .
However, since HeLa cells express CXCR4 but not CCR5, it has been revealed that they cannot be applied to many clinical isolates including macrophage-directed HIV-1. Therefore, the elongation factor (Elongation Factor) 1 was added to the MAGI cells.
CCR5 was integrated downstream of the α promoter, and an expression vector selectable by blasticidin was transfected, and CCR5 expressing MAGI cells (MAGIC-
5: MAGI-CCR5) was established (Antimicrob.Age
nts Chemother. 2001,45, 495-501). This established cell line contains the essential viral receptor molecules CD4 and Coreceptor in the process of HIV-1 entry into the target cell.
H expressing and infecting CXCR4 and CCR5
Β-galactosidase is expressed by the expression of tat of IV-1.

It has been found that this cell line can count the infectious titer of not only T cell-tropic HIV-1 but also macrophage-tropic HIV-1. Using this MAGIC-5 cell line, HIV-1 infectivity titer measurement, virus cloning, virus isolation from clinical specimens, and establishment of infectious molecular clones have already been reported at academic conferences and the like. In addition, this cell line is resistant to drug resistance in Japan and abroad.
It has been applied to type Assay and anti-HIV drug screening. However, HI with this cell line
Since the V infectious titer had to be counted under a microscope after cell fixation, X-gal blue-stained cell nuclei had to be counted. Therefore, the virus culture from the infection-positive culture medium to the subsequent passage of time is carried out in the same culture medium. It was impossible. Therefore, depending on this cell line, it is difficult to measure HIV-1 infection in real time over time without fixing the cells, and such HIV-1 infection is therefore difficult.
As an infection measurement cell capable of measuring infection, MAGIC
Modification of -5 cells has been desired.

On the other hand, HIV-1 is known to be a lentivirus with a complicated genetic constitution having various regulatory and modifying genes in addition to the constitutive proteins such as gag, pol and env. The genetic region responsible for the pathogenicity has been searched for using the subtype B molecular clones that are prevalent in Japan. However, it is known that HIV-1 subtype B is mainly infested with homo group and risk group of narcotics, although heterosexual infection is also observed. On the other hand, the center of recent HIV-1 infection has been shifting from Europe and the United States to Southeast and South Asia and sub-Saharan Africa, and H that is prevalent mainly in heterosexual intercourse.
IV-1 is dominated by subtype A, subtype E and subtype C. In Japan as well, signs of an increase in the number of people infected with subtype E due to heterosexual intercourse have been recognized in recent years. Although infectious clones of subtypes E and C have not been obtained despite the difference in infection efficiency due to the difference in infection route between subtypes, the difference between HIV-1 subtypes derived from the difference was found. This is a bottleneck in the progress of analysis of pathogenicity based on the difference in gene composition, and there is an urgent need to establish infectious clones.

[0006] The establishment of infectious clones and the gene analysis of the HIV-1 genome, which is prevalent in various parts of the world, provides essential basic knowledge for future vaccine development by tracing the epidemic pattern molecularly. ing. However, it is known that the lentivirus genome is difficult to clone. This is Toxi in the gp41 region
Presence of c sequence or L at both ends of homology
It is presumed that the frequent causes such as loss and loss in the E. coli culture process in the TR region are the causes, but it is not always clear. HIV-1 near amplified
It is desired to construct a plasmid vector capable of more efficiently integrating ly full-genome and stably cloning the HIV genomic gene. By constructing such a plasmid vector, H
Near full-genome of various subtypes of IV-1 (Near
If full-genome) clones can be obtained, it is expected that not only analysis of pathogenic differences between subtypes but also the molecular basis of various anti-HIV strategies such as vaccine development can be established and new research fields can be opened. It

As described above, in recent years, the existence of various subtypes of HIV-1 has been revealed, and although the difference in infection efficiency due to the difference in the infection route between the subtypes has been recognized, those subtypes have been confirmed. Has not been obtained, it is a bottleneck in the progress of analysis of pathogenicity based on the difference in gene constitution between HIV-1 subtypes derived from the difference. Therefore, there is an urgent need to establish infectious clones with the aim of obtaining infectious clones of those subtypes. In particular, HIV-1
Infectious clones of subtype E and C are:
It is expected to open a new field not only for analysis of pathogenic differences between subtypes but also for various anti-HIV strategies such as vaccine development. The establishment of an efficient method for establishing infectious clones will improve the molecular basis of the anti-HIV strategy that directly links the virological and molecular genetic characteristics of clinical isolates, and is expected to be applied in various fields. It is expected to be a technology that can

[0008]

The object of the present invention is to provide a novel HIV-1 infection measuring cell, a cloning vector thereof, an HIV-1 infectious clone and its construction, and a method for establishing the same, particularly HIV- 1. Infection measurement cells capable of measuring infection 1 in real time without fixing cells, and HIV-1 cloning vector capable of stably cloning HIV genome gene in each HIV-1 subtype, stable HIV genome gene To provide a cloned HIV-1 infectious clone, and a method for constructing and establishing the clone.

[0009]

As a result of earnest research to solve the above problems, the present inventor has found that (1) HIV-1 LTR
An HIV-1 infection-measuring expression vector incorporating an nEGFP reporter gene having a HIV-1 Rev protein nuclear transfer signal added downstream was constructed, and this was transfected into MAGIC-5 cells. -(1) It is possible to obtain infection-measuring cells capable of measuring the infection of -1 in real time without fixing the cells. (2) Based on pBR322, the tetracycline resistance gene and K at four sites are derived from the plasmid.
HIV-1 cloning vector from which the asI site has been removed, and pBluescript II SK of the plasmid
At the EcoRV site of the Multiple Cloning site derived from (+), X is added so that T overhang occurs.
By constructing a vector for HIV-1 cloning incorporating a restriction enzyme cassette of cmI-NcoI-BglII-XcmI-BstEII, an HIV-gene capable of efficiently and stably cloning an HIV genomic gene using the vector. 1-infectious clones can be obtained, and (3) HIV-1 infection measuring cells incorporating the nEGFP reporter gene described in (1) above and (2) HIV-1 cloning vectors are used to collect HIV- 1. A nEGFP reporter gene-integrated HI obtained by efficiently and stably cloning a gene of about 9.0 Kbp, which corresponds to almost the full-genome of the genomic gene of 1.
The inventors have found that a V-1 infectious clone can be obtained, and completed the present invention.

That is, the present invention comprises an expression vector for measuring HIV-1 infection, characterized in that an nEGFP reporter gene having a HIV-1 Rev protein nuclear transfer signal added downstream is incorporated downstream of HIV-1 LTR ( An expression vector for HIV-1 infection measurement (claim 2), characterized in that a puromycin resistance gene is incorporated into the expression vector according to claim 1) or claim 1, or the expression according to claim 1 or 2. The vector contains the viral receptor molecules CD4 and Coreceptor CXCR4 and CC, which are essential in the process of HIV-1 entry into target cells.
MAGIC- which expresses R5 and β-galactosidase by the expression of tat of infected HIV-1
HIV-1 infection measurement cells (claim 3), characterized by transfecting 5 cells, and HIV-1
An nEGFP reporter gene in which a HIV-1 Rev protein nuclear transfer signal was added to the downstream of the LTR was incorporated, and a puromycin resistance gene was further incorporated to construct an expression vector, and the expression vector was infected with HIV. A method for establishing cells for HIV-1 infection measurement (claim 4), which comprises transfecting MAGIC-5 cells expressing β-galactosidase by expressing tat of -1 (claim 4), or the HIV-of claim 4. 1 After establishing established cells for infection measurement by drug resistance,
A method for measuring HIV-1 infection, which comprises measuring FP-expressing cells in real time without fixing (claim 5).

Further, the present invention is based on pBR322 and is characterized in that the tetracycline resistance gene and
HIV characterized by removing the KasI site
-1 Cloning vector (claim 6) and claim 6
PBluescript II SK of the described plasmid
At the EcoRV site of the Multiple Cloning site derived from (+), X is added so that T overhang occurs.
HIV characterized by incorporating a restriction enzyme cassette of cmI-NcoI-BglII-XcmI-BstEII.
-1 cloning vector (claim 7) and claim 6
Or the vector described in 7 is pMT1, a vector for HIV-1 cloning (claim 8)
Or pBR322 as a base, the tetracycline resistance gene and four KasI sites were removed from the plasmid, and pBluescriptIIS of the plasmid was further removed.
XcmI-NcoI-BglII-XcmI-BstEII so that a T overhang occurs at the EcoRV site of the Multiple Cloning site derived from K (+).
HI characterized by incorporating the restriction enzyme cassette of
Method for constructing V-1 cloning vector (claim 9)
Consists of.

Furthermore, the present invention provides HIV-1 virus
Viral receptor molecule CD4 and Coreceptor CX essential for the process of IV-1 entry into target cells
HIV-expressing and infected with CR4 and CCR5
MAGIC-5 cells expressing β-galactosidase by the expression of tat of 1 were infected, cloned,
A further amplified Amplicon is incorporated into the HIV-1 cloning vector according to any one of claims 6 to 8, and the vector is transfected into another MAGIC-5 cell. Establishment method (claim 10) and amplified Ampli
After cloning the virus of HIV-infected MAGIC-5 cells, con infected CD4 and CCR5-expressing HeLa cells (HeLa4.5), using the infected cell genome as a template, from HIV-15 'LTR U5. Forw to the Primer Binding Site
ard Primer, also HIV-1 3'LTR P
Forward Pri downstream of ol A Signal
Reverse Prime in the area that does not overlap with the mer
rK is 9.0 Kbp Amplicon amplified by the Long PCR method after being produced, scanned, and established with the HIV-1 infectious clone according to claim 10 (claim 11), or Forward P
A noter of U5 region of HIV-1 5'LTR, which is conserved in many HIV-1 genomes.
U5-NotI (+): GC with I site added
GCGGCCGCAAATCTCTAGCAGTGGC
GCCCGAACAG (SEQ ID NO: 1) and Rev
rse primer is a NotI s in a region downstream of PolyA signal in the HIV-1 3′LTR region.
R-NotI (-) with addition of ite: GGCGCGG
CCGCGCACTCAAGGCAAGCTTTATT
The method for establishing an HIV-1 infectious clone according to claim 11, which is GAGGCT (SEQ ID NO: 2), or the amplified Amp according to claim 10.
Another MAGIC-5 cell transfecting an HIV-1 cloning vector incorporating licon is the HIV-1 infection measuring cell MAG according to claim 3.
It is IC-5 / nEGFP, It is characterized by the above-mentioned.
A method for establishing an HIV-1 infectious clone according to any one of 0 to 12 (claim 13), and an HIV-1 infectious clone established by the method according to any one of claims 10 to 13 (claim 14). Consists of.

[0013]

BEST MODE FOR CARRYING OUT THE INVENTION In the present invention, as a result of earnest research to solve the above problems, (1) an nEGFP reporter gene in which a HIV-1 Rev protein nuclear import signal was added downstream of HIV-1 LTR H incorporating
An expression vector for measuring IV-1 infection was constructed and used as a MA.
By infecting GIC-5 cells, HIV-1 infection can be measured in real time without fixing the cells.
Obtaining nEGFP, (2) a vector for HIV-1 cloning based on pBR322, in which the tetracycline resistance gene and four KasI sites have been removed from the plasmid, and pBluescri of the plasmid.
Multiple Cloni from ptII SK (+)
XcmI-NcoI-BglII-XcmI-B so that a T overhang occurs at the EcoRV site of the ng site.
constructing an HIV-1 cloning vector capable of efficiently and stably cloning an HIV genomic gene by constructing an HIV-1 cloning vector such as pMT1 incorporating a stEII restriction enzyme cassette; And (3) nEG of (1) above
Using the HIV-1 infection-measuring cell into which the FP reporter gene was incorporated and the HIV-1 cloning vector of (2), a gene of about 9.0 Kbp corresponding to almost the full-genome of the HIV-1 genomic gene was obtained. Efficiently and stably cloned HIV-1 infectious clone with integrated nEGFP reporter gene is obtained.

HeLa / developed by Emmerman et al.
CD4-LTR-β-Galactosidase, commonly referred to as MAGI cells, was used for the National Institute of Allergy an
AIDS Reagents from d Infectious Diseases, NIH, USA
Obtained from Program, this MAGI cell was transfected with the CCR5 expression vector pEFBOSbsrHuCCR5, cloned by the limiting dilution method after drug selection. The CCR5 expression vector is a human CCR5 cD
The NA gene was incorporated into the downstream of Elongation Factor 1 alpha Promotor, and the resistance gene of blasticidin, a selective drug for expressing cells, was added to SV4.
It was constructed to be driven by the 0 Early Promoter. After drug selection, the remaining cell colonies were treated with M-tr
Recombinant Vacc expressing opicHIV-1 env
syncytium-positive by infection with inia virus, and X-G by infection with M-tropic HIV-1.
Staining strain MAGIC-5 was selected after selecting the one in which the nucleus of the infected cell was blue stained by al staining and cloning by limiting dilution method.
C1.14 was established. A decrease in the expression of the CD4 molecule was detected in parallel with the decrease in the sensitivity to clinical strains at passage 25 and above. Therefore, the CD4 expression vector pEFBOS having a puromycin resistance gene was newly detected.
After transfection of pacCD4 and selective culture, a clone with high CD4 expression and stabilization was selected by the limiting dilution method, and finally used as the MAGIC-5A cell line.

(Cells for measuring HIV-1 infection of the present invention,
The cloning vector, construction of HIV-1 infectious clone, and establishment method) The present invention will be described in more detail with reference to specific examples, but the scope of the present invention is not limited to these examples. . Specific Example 1 (Cells for infection measurement MAGIC-5 / n capable of measuring HIV-1 infection in real time without fixing cells)
Acquisition of EGFP) When HIV-1 is infected, HIV-1 is activated by Tat protein that is expressed early.
It was incorporated into the LTR downstream. At that time, EGFP added with a nuclear nucleolar translocation signal (ArgAsnArgArgArgArgArgTrpArg; SEQ ID NO: 3) of the Rev protein of HIV-1 NL432 strain so that the expressed EGFP translocates to the nucleus of infected cells so that observation under a microscope becomes easier. Was produced. Specifically, EG
FP expression plasmid pEGFP-Cl (Clontech) was added to B
It is cleaved at the spEI site, and there is a nuclear import signal for the Rev protein (ArgAsnArgArgArgArgTrpArg; SEQ ID NO: 3).
(Rev NLS (+) oligo: 5'-CCGGACG
CAACCGCCGCCGCCGCCGCTGGCGCT-3 '(SEQ ID NO: 4), Rev N
LS (-) oligo: 5'-TGCGTTGGCGGCGGCGGCGACCGCGAGGCC-3 '
(SEQ ID NO: 5)) and then Rev-NLS added E
PHIV-LTRpa in which GFP is excised and the puromycin resistance gene is driven by the SV40 promoter
The vector pHIV-LTRpac / nEGF integrated into c
P was constructed (Figure 1). This expression vector is MAGIC
Of the colonies that survived after selective culturing with puromycin after transfection of the −5A cell line, EGFP expression was negative in non-infected colonies and infected with HIV.
Those expressing GFP were selected. More Stabili
In order to obtain a clone excellent in ty, MAGIC-5 / n was subjected to twice by the limiting dilution method in the absence of a selective drug.
EGFP was established.

[0016]

[Results] A clone MAGIC-5 / nEGFP clone 2 showing stable HIV sensitivity was established from a cell group that specifically expresses EGFP by HIV infection by the limiting dilution method twice. This cell line showed a high correlation with MAGIC-5A in HIV-1 sensitivity. This assay system uses the expression of the HIV-1 Tat protein to induce EGFP in nuclear kernels.
The formation of syncytia can be confirmed by the expression of Env protein and the expression of Env protein, and X-
Gal staining has the advantage that the morphology of infected cells can be preserved. In addition, this target cell line is HIV-1
In addition, since the HIV-2 and SIV infection process can be detected under a fluorescent inverted culture microscope in real time without cell fixation, a cell line useful for constructing a wide range of measurement systems involved in the HIV infection process. Is. MAGIC-5
An outline of HIV infectivity titer measurement by / nEGFP is shown in FIG. 2 (see reference photograph 1).

Example 2 (Construction of HIV-1 cloning vector (pMT1) capable of efficiently and stably cloning HIV genomic gene) In order to amplify almost full-genome (about 9 kbp) Amplicon, HIV- 1 5 '
LTR U5 to Primer Binding Sit
Forward Primer in the region up to e, and R in the region that does not overlap with the Forward Primer downstream of PolyASignal of HIV-1 3'LTR
EverPrimer is selected by scanning, and NotI S which is a Rare Cutter restriction enzyme is selected.
Plasmid by adding ite to the upstream of Primer
A strategy was made to make cloning into Vector more efficient.

That is, Not in the U5 region of HIV-1 5'LTR, which is conserved in many HIV-1 genomes.
Forward Primer with I site
U5-NotI (+): GCGCGGCCGCAAAT
CTCTAGCAGTGGGCGCCCGAACAG (SEQ ID NO: 1) and Pol of HIV-1 3'LTR region
Reverse Primer R-NotI added with NotI site in the downstream region of yA signal.
(-): GCGCGGGCCGCGCACTCAAGGC
A Long PCR method was performed using Primer Set with AAGCTTTATTGAGGCT (SEQ ID NO: 2) using the genome of most HIV-1-infected cells as a template to obtain about 9.0.
A nearly full-genome Amplicon of Kbp was amplified and the construction of a vector for cloning this approximately 9.0 Kbp genome was planned.

From the viewpoint of ease of handling and versatility, a cloning vector is considered to be a plasmid, rather than a Phase Cosmid or a Charomid, which allows a large size gene fragment to be cloned more efficiently.
Since a plasmid vector with a copy number is liable to drop out, pBL322, which is a general-purpose vector, is used to enhance Cloning Efficiency based on pBR322, which has a moderate Copy number, and is convenient for subsequent recombination.
Multiple Clo of scriptII SK (+)
After modifying the Ning Site, an integrated pMT1 was constructed (FIG. 3).

PMT1 is later full-length HIV-1
It incorporates various ideas to efficiently construct genomic clones. Many HIV-1s have Primer Bindi downstream of the 5'-LTR in the process of reverse transcription.
The reaction is initiated by the binding of Lys-tRNA to ng Site, and a unique NarI / KasI site in the HIV-1 genome is present in this PBS region. To enable the recombination using this site, the tetracyc of pBR322 that became Base
Vector si by removing the lin resistance gene
Reduction of ze and removal of KasI sites at four locations.
In addition, Mu derived from pBluescript II SK (+)
Eco RV of the Little Cloning Site
XcmI- so that T overhang occurs on the site
NcoI-BglII-XcmI-BstEII restriction enzyme cassette was incorporated to achieve more efficient Restructi.
enabled Enzyme Mapping.

To obtain HIV-1 clones using pMT1, for example, clinical isolate HIV-1 was prepared by
AGIC-5A (CD4, CCR5, CXCR4 expression H incorporating a β-Gal expression unit driven by tat
eLa cell line) HeL expressing CD4 and CCR5 after infecting a cell line and carrying out virus cloning
a cell line HeLa4.5 is infected, Long PCR is performed using the infected cell genome as a template to amplify almost full-genome Amplicon, which is purified by electrophoresis and purified.
NotI-treated pMT1 treated with otI and dephosphorylated
Integrated into a nearly full-length genome (approximately 9.0K
A clone in which the insert of bp) is integrated can be obtained. The clone thus obtained is
After the restriction enzyme Mapping was confirmed, the base sequence of the whole genome was determined. A cloning flowchart of the near full-length HIV genome using pMT1 is shown in FIG.

[0022]

[Results] In this example, HIV-1 of about 9.0 Kbp, which is almost full-length of the HIV-1 genomic gene, was obtained.
It was possible to construct a vector capable of efficiently and stably cloning the genomic gene. Conventionally, Amplicon, which has reached 9 Kbp, has been converted into the existing High copy number P.
Incorporation into the Lasmid Vector was extremely inefficient, and it was necessary to devise measures such as lowering the culture temperature for its amplification. Furthermore, it has been known that the once integrated genome is often deleted or lost during the amplification process. HI this time
By using pMT1 constructed for V genome cloning, many HIV-1 viruses are not
A stable almost full-length clone was obtained even under the culture condition of 7 ° C. Thus, the plasmid vector pMT
1 is High Efficien of HIV-1 genome
It is a useful vector that enables cy cloning, and various subtypes that are prevalent in various parts of the world.
e and their Recombinant HIV-1
It is expected to be a basic tool that can contribute to the molecular epidemiologic analysis of genome and eventually establishment of infectious clones of each HIV-1.

Specific Example 3 (MAGIC-incorporating nEGFP reporter gene)
HI using 5 / nEGFP cells and plasmid pMT1
Establishment of V-1 infectious clone) A clinical specimen or the obtained HIV-1 virus was used as a clone for HIV-
, A viral receptor molecule CD4 essential for the process of entry into the target cell and Coreceptor CXCR
Of infected HIV-1 expressing 4 and CCR5
In expressing β-galactosidase by expression of at
Dicatorcell MAGIC-5 cells were infected and the virus was cloned by the Agarose baking soda method.
ng, CD4 and CCR5 expressing Hela cells (HeLa4.5) were infected. Using this infected cell genome as a template, Los Alamos HIV Data Ba
se from the HIV-1 consensus sequence PBS (P
Rimmer binding site) and 3'-L
Create a candidate for the TR region Primer, scan it, and
Ampklon of 9.0 Kbp by ongPCR method
Primer Pair for efficient and specific amplification
Was selected.

As a plasmid vector for stably incorporating Amplicon over almost the entire length, the above-mentioned specific example 2 is used.
As described above, pBR1 having pBR322 as a basic skeleton
Was built. Using the NarI / KasI site of the PBS region, which is conserved in many HIV-1, into a vector into which a small fragment from 5'-LTR to PBS was inserted,
After restriction enzyme treatment with NotI site on the 3'-LTR side, incorporation was carried out and Prototype clone
Was built. This plasmid was constructed using M constructed in Example 1.
AGIC-5 / nEGFP (EG-downstream of HIV-LTR
The FP gene tail was transfected into a MAGIC-5 cell line in which an expression unit in which a nuclear transfer signal of rev was added was incorporated), and its infectivity was examined. Two days after transfection, EGFP was added to the nucleus by Tat expression.
The culture supernatant of a clone that was found to be positive and positive for Syncytium formation was newly cultured.
X-Ga was added to IC-5 cells and fixed after 2 days of culture.
The infectivity was examined by 1 staining.

When no infectivity is observed, MAGIC-
Since Tat expression and syncytium formation were positive in the 5 / nEGFP cell line, at least the candidate clone was HI.
Since it can be inferred that the region from the tat region of the V-1 genome to the 3'-LTR is functional, a Reverse Primer was constructed in the Vpr region conserved in HIV-1, and the Left Arm (5 'of HIV-1 genome was prepared.
-LTR ~ vpr) and again pMT1 vect
incorporated in or. This Left Arm clone and the previous full-length clone were treated with various 6-base recognition restriction enzymes, the restriction enzyme that produces the same Size Fragment was selected, recombination was performed, and the infectivity of the clone was analyzed again as described above. did. Thus, using MAGIC-5 / nEGFP cells in which the nEGFP reporter gene was integrated and the plasmid pMT1, HI covering 9.0 Kbp was obtained.
An HIV-1 infectious clone in which the V-1 genomic gene was efficiently and stably infected was established.

[0026]

The present invention will be described in more detail below with reference to examples, but the scope of the present invention is not limited to these examples. (Establishment of HIV-1 Infectious Clone) In this example, USA NIH AIDS R was used as HIV-1 subtype C.
An Indian isolate R5 93IN101 was obtained from the eagent & Reference Program, and an experiment was conducted. I got H
IV-1 subtypeC 93IN101 with MGI
Cells and MAGIC-5 cells by infecting Co
When I examined the receptor usage, I found that the CCR
R5 HIV-1 using 5 was used. M reported earlier
The virus was cloned by the Blue Plaque method using AGIC-5 cells, and 93IN. 101.1 ~
5 strains of 5 were obtained (FIG. 5).

The cloned virus was transformed into LTR-β-G
CD4 / CCR5 not incorporating an al expression unit
Infection of expressing HeLa cells (HeLa4.5), Sy
When the formation of ncytium was observed, cells Geno
Me was separated and purified and used as a template in the subsequent PCR. PCR Re is a strategy for constructing infectious clones.
From the 5'LTR to the Primer Binding to reduce the possibility of combination as much as possible.
A virus-specific Fragment was amplified by Short PCR up to Site (PBS) and Long PCR up to 3'LTR from PBS, and a strategy for later combination was set up (Fig. 6). Los Alamos HIV Data
Conse of HIV-1 subtype C from Base
Primer binding sit from nsus array
e (PBS) area and 3'-LTR area candidate Prime
r and make it Long with various Primer Pair
Tried PCR, scanned and reached 9.0 Kbp A
Prim that efficiently and specifically amplifies mplicon
er Pair was selected (Fig. 7).

As a Plasmid Vector that stably incorporates Amplicon over almost the entire length, initially, considering the yield, a high copy number of pUC system Pl is used.
Stable Construct is tried using asmid
It was difficult to build t. So a moderate co
pMT1 was prepared using py number of pBR322 as a basic skeleton. NarI / KasI site in the PBS region, which is conserved in many HIV-1, was used in a vector in which a small fragment from 5'-LTR to PBS was inserted into this MCS, and a restriction enzyme was added together with NotI site on the 3'-LTR side. After processing, install and use Prototype c
lone p93IN101 was constructed. This plasmid was transfected into a cell line (MAGIC-5 / nEGFP) that incorporates LTR-nEGFP in MAGIC-5 and fluoresces EGFP when infected with HIV-1, and its infectivity was examined. However, the formation of Syncytium was not observed (Fig. 8). So the Primer in the PBS area
Was redesigned and the plasmid p93IN101. d
When ef was constructed and transfected into MAGIC-5 / nEGFP and its infectivity was examined, fluorescence was emitted and formation of syncytium was observed.

The supernatant was positive for p24gag and did not lead to the production of infectious virus although the formation of virus particles was observed by electron microscopy (FIG. 8). This p93IN101. Since it expresses fluorescence by transfecting def, it means that at least tat is expressed. Furthermore, since it was positive for syncytium formation, the rev and env genes were considered to be functional. H from these results
Since the coding region of the 3'half of the IV-1 genome is at least functional, the 5'LTR, gag and po
It was speculated that infectivity could not be acquired because the left half (see FIG. 6) including the l region was defective. Therefore, the left half of the HIV-1 genome was amplified from the same template from the 5'LTR to vpr, and p93IN101. def
In addition, when a fragment having the same size after cleavage was screened and reconstructed with the selected NcoI fragment and transfected, an infectious virus was observed in the supernatant (FIG. 8). This infectious clone was named pIndie-C1 because it was the first infectious clone of the Indian isolate HIV-1 subtypeC.

(Evaluation of established clones) After transfection of the established clones, the virus C in the supernatant was
oreceptor usage with MGI and M
When examined for infectivity to the AGIC-5 cell line, R5 Phenotyping using CCR5 as in the parent virus was performed.
e was shown (FIG. 9). HIV-1 subtype
As a result of the property analysis of the C infectious clone pIndie-C1, the following items were clarified. Infectious clone pI
ndie-C1 is composed of 9680 bp, and HIV-1 subty isolated in India in 1993 by phylogenetic tree analysis by NJ method over the entire base sequence.
It was confirmed that it is a typical subtype C virus that forms a cluster with the peC virus group. From the nucleotide sequence analysis, this clone shows that all the constitutive genes, Acc
The essay and regulatory gene were open, and the virus production after transfection was shown to be as high as that of the frequently used laboratory strain pNL432. In addition, as a feature on the nucleotide sequence, the motif sequence of the transcription factor NF-κB reported as a feature of subtype C in the LTR region exists in 3 places as compared with subtype B in which there are only 2 places.
Defective regions that have not been reported up to now have been found in the genes, and each of these indicates the possibility of obtaining new findings by future biological characterization.

(Discussion) Using the method of the present invention, the first infectious clone of HIV-1 subtype C in the world could be established. According to WHO statistics and future trends in the number of infected people, epicenter of recent HIV-1 infection
HIV-1 has been shifting from Europe and America to Africa, Southeast and South Asia, and is mainly prevalent in heterosexual sex.
It is pointed out that subtype E and subtype C dominate. Especially subtypeC
Has accumulated infections in India and African countries and is expected to increase dramatically in the future. Due to the high cost, measures such as triple-drug combination therapies in Europe and the United States in these areas are not considered realistic. Therefore H
The development of the IV-1 vaccine has been urgently required and is being actively researched. The virological research on HIV-1 is a region where specific progress is made among the viruses that infect humans, which have been extensively studied due to their social impacts and have been isolated to date. Therefore, it is well known that the molecular biological analysis of the virus was extremely detailed.

However, since the infection center has been in Europe and America until now, many of the infectious clones belonged to subtype B which was prevalent in Europe and America. The lack of infectious clones to serve as a reference for basic research such as vaccine development and virological research between subtypes is a major bottleneck, and efforts are being made to establish infectious clones in each country. It's about to come. Under such circumstances, it is expected that the subtype C infectious clone established this time can serve as a Reference Reagent in various HIV-1 research areas. This time, despite the fact that the construction of infectious clones by the Long PCR method was considered to be low in the establishment so far, it was successful in several Key Poi.
It seems that there is nt. First, HIV-1 virus was cloned by the BLue Plaque method using MAGIC-5 cells, and replication was performed.
It can be mentioned that a uniform population of viruses is concentrated by Competent.

At present, in many attempts, Long PCR is carried out by using peripheral blood lymphocytes (PBMC) stimulated with PHA or the like as target cells and using cDNA from its genome or mRNA as a template. However, it is known that, of the viral particles in the genome or culture supernatant that became infected with PBMC to become Provirus, there are some that are defective in their gene composition. Moreover, by using the virus particles themselves in the PBMC genome infected with the quasitypes, which is a characteristic of HIV-1, or in the culture supernatant as a template for PCR,
The probability of occurrence of Recombination is high. In many cases, using PBMC itself as a target cell requires selection of donors with good growth of the isolated virus. This can also be one of the biases of isolated viruses. In addition, PBMC contains HIV-8 such as CD8 T cells.
It should also be taken into account that there are cell populations that inhibit 1 proliferation. In this regard, the isolation and cloning of viruses by the MAGIC-5 cell line is a kind of Filt that is targeted only at viruses that can infect cell lines with the isolated virus.
However, this problem is conceivable in any culture system.

In the experience of the present inventor to date, the viruses isolated by PBMC are propagated by MAGIC-5 without exception, so that the spectrum may be wider than that by PBMC isolation. Secondly, CD4 / incorporating EGFP with a nuclear translocation signal of rev added downstream of HIV-1 LTR
CCR5-expressing HeLa cell line (MAGIC-5 / nEG
FP) to monitor the construction process of the construct
It is a point that can be ng. The constructed construct is fun
Whether or not the partial tat, rev and env genes are expressed can be analyzed in situ in a culture system. E as shown in the reconstruction of subtype C this time
When the production of infectious particles was not observed despite the fact that GFP expression and syncytium formation were observed, it was suspected that there was a defect at either site from the 5'LTR to pol of the construct, and its recombination was performed. It has been shown that thinking can be an effective strategy.

Since this strategy is also a cloned virus for the PCR template, it is considered that there is no risk of unintentional production of mosaic clones. At present, it is arguable that the authentic production of an HIV-1 infectious clone is to pick up a phage clone containing the full length from a phage library from an infectious cell, but this method itself is very troublesome. This is a method with a low probability of being involved, and above all, in order to construct a high-quality library, it is essential in the first step to obtain infected cells in which a high copy number of Provirus is integrated, but many HIV-1 Isolates do not meet this requirement. Furthermore, clones obtained by hybridization and the like are selected based on the homology of their nucleotide sequences, and their infectivity is not guaranteed functionally. It has been reported many times that the hard-caught clones are ultimately defective because either ORF is not open. In addition, it is necessary to search for restriction enzymes that do not cleave the target viral genome as the information required when constructing the library.

The methodology used in combination with the virus cloning by MAGIC-5 cells and the Long PCR method used in this time (FIG. 10) can more rapidly obtain an infectious clone as long as the nucleotide sequence of the LTR region of the target virus is obtained. It was thought that the probability was high. Regarding the possibility of base relaxation due to misincorporation inherent in the PCR method, fidelity has been improved by recent improvements in thermostable polymerases, and it is expected that the quality will further improve in the near future. Expected to be even more effective. The present inventor has previously reported that the virus can be directly isolated from patient serum with MAGIC-5 cells. After the experience of isolation from clinical donations, the initially established MAGIC-5 cells were repeatedly subcultured to NL432 and Ba.
Although the sensitivity was stable for laboratory strains such as L,
It was found that the efficiency of separation from clinical donors decreased.

By searching by flow cytometry,
It was confirmed that the expression of the CD4 molecule was decreased in the MAGIC-5 cells that had been repeatedly passaged. Since it was speculated that the clinical isolates were more dependent on the CD4 molecule density for their infection than the laboratory strains, the cell line MAGIC-5A in which CD4 was incorporated into pEF-BOSpac and CD4 expression was enhanced again. Was established. From this patient's serum of 10 ⁴ copy / ml or more,
It was shown that the virus can be isolated by culturing for 2 to 8 days, and the nucleotide sequence of the isolated virus V3 region is MAGIC.
Since it was homologous to that of the virus isolated by -5A, it is considered unlikely that there is at least a particular bias in virus isolation by MAGIC-5A. This cell line is also a drug-resistant virus strain Phe
Since it was shown to be applicable to nottyping, it was considered that this cell line could be applied to various areas of HIV-1 research.

[0038]

INDUSTRIAL APPLICABILITY According to the present invention, infection measuring cells which can be measured in real time without fixing the cells, and HIV
It became possible to construct and establish an HIV-1 cloning vector capable of stably cloning the HIV genomic gene in each subtype of -1, and an HIV-1 infectious clone in which the HIV genomic gene was stably cloned. . According to the present invention, a subtype clone of the HIV-1 genome, which has been difficult to obtain in the past, can be obtained, and the gene analysis thereof has become possible. Based on this, it became possible to analyze pathogenicity. Furthermore, by genetic analysis of the HIV-1 genome, genetic information for each subtype of HIV-1 can be obtained, and it can be expected to open a new area for various anti-HIV strategies such as vaccine development.

[0039]

[Sequence list]                                SEQUENCE LISTING <110> JAPAN SCIENCE AND TECHNOLOGY CORPORATION       National Institute of Infectious Diseases Presiden <120> Methods of establishing HIV-1 infected clones <130> 12-414 <140> <141> <160> 5 <170> PatentIn Ver. 2.1 <210> 1 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Forward Primer <400> 1 gcgcggccgc aaatctctag cagtggcgcc cgaacag 37 <210> 2 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Reverse Primer <400> 2 gcgcggccgc gcactcaagg caagctttat tgaggct 37 <210> 3 <211> 8 <212> PRT <213> Human immunodeficiency virus type 1 <400> 3 Arg Asn Arg Arg Arg Arg Trp Arg   1 5 <210> 4 <211> 33 <212> DNA <213> Human immunodeficiency virus type 1 <400> 4 ccggacgcaa ccgccgccgc cgccgctggc gct 33 <210> 5 <211> 30 <212> DNA <213> Human immunodeficiency virus type 1 <400> 5 tgcgttggcg gcggcggcga ccgcgaggcc 30

[Brief description of drawings]

FIG. 1 Clone MAGIC-5 / nEGFP of the present invention
FIG. 3 is a diagram showing the structure of an expression vector, which was constructed for the establishment of n.

FIG. 2 Clone MAGIC-5 / nEGFP of the present invention
It is a figure which shows the outline of HIV-1 infectious titer measurement by.

FIG. 3 is a diagram showing the structure of the cloning vector pMT1 of the present invention.

FIG. 4 is a diagram showing a cloning chart of almost full-length HIV genome using the cloning vector pMT1 of the present invention.

FIG. 5: Blue plaque cloning of HIV (Blue P
It is a figure which shows the laqe Cloning) method.

FIG. 6 is a short and long P used in an embodiment of the present invention.
It is a figure which shows the position of the primer used by CR.

FIG. 7 is a diagram showing agarose electrophoresis images of short PCR and long PCR products in a specific example of the present invention.

FIG. 8 is a diagram showing a restructuring process in the process of establishing an infectious clone of HIV-1 subtype C931N101 in the example of the present invention.

FIG. 9 shows the infectious clone pI in the example of the present invention.
FIG. 8 shows Coreceptor Usage of virus in the supernatant after transfection with ndie-Cl.

FIG. 10 is a view showing a flowchart of the process of establishing an HIV-1 infectious clone in the present invention.

   ─────────────────────────────────────────────────── ─── Continued front page    (72) Inventor Koji Sakai             4-12-5 Hamano Building, Musashimurayama City Gakuen, Tokyo             No. 202 F-term (reference) 4B024 AA01 AA14 BA32 CA02 DA03                       EA04 HA11                 4B063 QA06 QA19 QQ08 QQ10 QQ35                       QR15 QR77 QR79 QX02 QX10                 4B065 AA93X AA97Y AB01 CA24                       CA46

Claims (14)

[Claims] 1. A HIV-1 LTR is provided downstream of HIV-
1 Rev protein nE in which a nuclear transfer signal was added downstream
An expression vector for HIV-1 infection measurement, which comprises a GFP reporter gene. 2. The expression vector according to claim 1, wherein a puromycin resistance gene is incorporated.
Expression vector for measuring IV-1 infection. 3. The expression vector according to claim 1 or 2,
Essential viral receptor molecules CD4 and Coreceptor C in the process of HIV-1 entry into target cells
HIV expressing and infected with XCR4 and CCR5
A cell for measuring HIV-1 infection, which is obtained by transfecting MAGIC-5 cell expressing β-galactosidase by the expression of tat of -1. 4. HIV-LTR is provided downstream of HIV-
1 Rev protein nE in which a nuclear transfer signal was added downstream
The expression vector was constructed by incorporating the GFP reporter gene and further incorporating the puromycin resistance gene, and the expression vector was expressed by MAGIC expressing β-galactosidase by expression of tat of infected HIV-1.
A method for establishing cells for measuring HIV-1 infection, which comprises transfecting 5 cells. 5. The HIV-1 infection measuring method according to claim 4, wherein the established cells for HIV-1 infection measurement according to claim 4 are selected in real time without being fixed with EGFP-expressing cells after selection by drug resistance. Method. 6. Based on pBR322, the tetracycline resistance gene and KasI at four sites are derived from the plasmid.
An HIV-1 cloning vector, which is characterized in that the site has been removed. 7. The pBlue of the plasmid according to claim 6.
Multiple C derived from scriptII SK (+)
XcmI-NcoI-BglII-Xc so that a T overhang may occur at the EcoRV site of the cloning site.
An HIV-1 cloning vector characterized by incorporating a restriction enzyme cassette of mI-BstEII. 8. The vector according to claim 6 or 7 is pM
An HIV-1 cloning vector, which is T1. 9. Based on pBR322, the tetracycline resistance gene and KasI at four sites are derived from the plasmid.
The site was removed and the pBluescri
Multiple Cloni from ptII SK (+)
XcmI-NcoI-BglII-XcmI-B so that a T overhang occurs at the EcoRV site of the ng site.
A method for constructing an HIV-1 cloning vector, which comprises incorporating a restriction enzyme cassette of stEII. 10. HIV-1 tat of HIV-1 which expresses viral receptor molecule CD4 and Coreceptor CXCR4 and CCR5 which are essential in the process of HIV-1 entry into target cells, and which is infected with HIV-1 virus.
Expressing β-galactosidase by the expression of
Amplicon, which has been obtained by infecting C-5 cells, cloning and further amplifying, is incorporated into the HIV-1 cloning vector according to any one of claims 6 to 8, and the vector is transfected into another MAGIC-5 cell. A method for establishing an HIV-1 infectious clone, which comprises: 11. The amplified Amplicon is HIV
After cloning the virus of MAGIC-5 cells infected with E. coli, HeLa cells expressing CD4 and CCR5 (HeLa4.5) were infected, and using the genome of the infected cells as a template, from U5 to Primer of HIV-1 5'LTR.
Forward Pri up to Binding Site
mer, also Poly AS of HIV-1 3'LTR
The Reverse Primer is prepared in a region that does not overlap with the Forward Primer in the downstream of the signal,
The method for establishing an HIV-1 infectious clone according to claim 10, which is 9.0 Kbp of Amplicon that has been scanned and amplified by the Long PCR method. 12. The Forward Primer is an HIV that is preserved in many HIV-1 genomes.
U5 NotI (+): GCGCGGCGCGCA to which NotI site of U5 region of -1 5'LTR was added
AATCTCTAGCAGTGGCGCCCCGAACA
G (SEQ ID NO: 1), and Reverse prime
r is PolyA s of the HIV-1 3′LTR region
R-NotI (−): GCGCCGGCCGCGCA to which the NotI site in the downstream region of the signal is added.
CTCAAGGCAAGCTTTATTGAGGCT
The method for establishing an HIV-1 infectious clone according to claim 11, which is (SEQ ID NO: 2). 13. Amplified Ampl according to claim 10.
Another MAGIC-5 cell transfecting an HIV-1 cloning vector, which has been incorporated with icon, is the HIV-1 infection measuring cell MAGI according to claim 3.
11. The composition according to claim 10, which is C-5 / nEGFP.
13. The method for establishing an HIV-1 infectious clone according to any one of 1 to 12. 14. An HIV-1 infectious clone established by the method according to claim 10.