JP2003177126A - Screening method of ccn family protein activity control agent - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a screening method of a CTGF (connective tissue growth factor) activity control agent and/or a Notch (Lin 12) activity control agent. <P>SOLUTION: This screening method of a CCN family protein activity control agent and/or the Notch activity control agent is characterized by measuring whether a specimen controls the activity of Notch competitively with a CCN family protein or not. Otherwise, the screening method of the CCN family protein activity control agent and/or the Notch activity control agent is characterized by measuring whether the specimen is bonded with the Notch competitively with the CCN family protein or not. <P>COPYRIGHT: (C)2003,JPO

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a method for screening a CCN family protein activity control agent based on the finding of a receptor protein for a CCN family protein.

[0002]

2. Description of the Related Art CCN family proteins include connective tissue growth factor (CTGF) and cysteine-rich protein (Cysteine-Rich protei).
n: Cyr61), nephroblastoma overexpression gene (nephroblastom
a overexpressed gene: Nov), Elm-1 / WIAP-1, Cop-1 / WI
It is a group of proteins consisting of SP-2, WISP3, etc. A major feature of CCN family proteins is that they are insulin-like growth factor binding proteins.
n), von Willebrand factor type C repeat, thr
ombospondin type1 repeat, growth factor cystei
It has four conserved modular domain structures of ne knots. CCN family proteins other than WISP-2 have all of the above four conserved domains. C
CN family proteins have about 60% or more homology in amino acid sequence with each other, and it is known that all of them have activity as growth factors.

Connective tissue growth factor
wth factor (CTGF) exists as a monomer and has a molecular weight of 36-3.
It is an 8 kDa protein and belongs to the CCN family (CTGF, Cyr61, Nov) that is rich in cysteine (Oemar, BS and Lusch
er, TF (1997) Arteriosclerosis, Trombosis and Va
scular Biology 17 (8): 1483-1489). CTGF consists of four domains (IGF binding domain, von Willebrand factor type C repeat, thrombospondin type 1 repeat, C-terminal domain), but recent reports show that a specific fragment of CTGF has similar activity to CTGF whole. Has been suggested
(Brigstock et al. (1997) J. Biol. Chem. 272 (32): 20.
275-20282). Human, mouse, and rat CTGF have a high homology of 90% or more in the amino acid sequence (Bork (1993) FEBS Le.
tt. 327: 125-130), both have a molecular weight of about 38 kDa (Br
adham et al. (1991) J. Cell. Biol. 114: 1285-1294).
In addition, it has been clarified that the promoter region of CTGF gene contains a TGFβ responsive element (Gro
tendorst et al. (1996) Cell Growth & Differentiatio
n 7: 469-480), CTGF is induced to be expressed by stimulation with TGFβ, and is considered to play a part in the physiological function of TGFβ.

It is known that CTGF acts on cells of connective tissue system such as fibroblasts, and acts as production of collagen and extracellular matrix, proliferation induction and chemotactic factor. Therefore,
It is considered that CTGF is an aggravating factor for diseases associated with abnormal proliferation such as fibrosis, cancer, angiogenesis associated with cancer, and atherosclerosis and accumulation of excessive extracellular matrix.
For example, overexpression of CTGF may lead to fibroblasts in scleroderma or keloid (Igarashi et al. (1996) J. Invest. Dermato).
l. 106: 729-733), glomerular stromal cells in renal fibrosis (Riser et al.
al. (2000) J. Am. Soc. Nephrol. 11: 25-38), pancreatitis (d.
i Mola et al. (1999) Ann. Surg. 230: 63-71), bleomycin-induced pulmonary fibrosis (Lasky et al. (1998) Am. J.
Physiol. 275: L365-371), breast cancer (Frazier and Groten
dorst (1997) Int. J. Biochem. Cell. Biol. 29: 153-16
1), arteriosclerosis (Oemar et al. (1997) Circulation 9
5: 831-839), infarct region of myocardial infarction (Ohnishi et al. (1
998) J. Mol. Cell. Cardiol. 30: 2411-2422), inflammatory bowel disease (Dammeier et al. (1998) Int. J. Biochem. Ce
ll. Biol. 30: 909-922), connective tissue malignant melanoma.
(Kubo et al. (1998) Br. J. Dermatol. 139: 192-197)
It is found in the pathological tissue of. In addition, CTGF has been shown to be a causative factor for scleroderma and arteriosclerosis
(Igarashi et al. (1995) J. Invest. Dermatol. 105:
280- 284; Igarashi et al. (1996) J. Invest. Dermat
ol. 106: 729-733; and Oemar et al. (1997) Circulati
on 95: 831-839), and the expression level of CTGF is known to show a high positive correlation with the severity of renal or pulmonary fibrosis (Ito et al. (1998) Kidney Int. 53: 853-8
61; Paradis et al. (1999) Hepatology 30: 968-976).
On the other hand, CTGF is also known to promote the growth of bone and cartilage and induce tissue regeneration such as healing of damaged parts (Nakanishi).
T. et al. (1997) Biochemical & Biophysical Researc
h Communications. 234 (1): 206-10; Nakanishi T. et
al. (2000) Endocrinology. 141 (1): 264-73; Igarashi.
A. et al. (1993) Molecular Biology of the Cell. 4
(6): 637-45).

From the above, agents that control the expression or activity of CTGF suppress hyperplasia of connective tissue and extracellular matrix in diseases associated with tissue fibrosis and proliferative diseases, and in bone and cartilage. It is considered to be effective in regenerating tissue. Actually, a peptide compound or an anti-CTGF antibody is known as a CTGF inhibitor, and it is reported that it is effective for an animal model of organ fibrosis.

The nephroblastoma overexpressing gene (Nov) is a protein belonging to the CCN family and has an amino acid composition rich in cysteine like CTGF. Nov was found to be overexpressed in nephroblastomas induced by myeloblastosis-associated virus type 1, and it is known that its expression is normally suppressed in adult kidney cells. Furthermore, it has been reported that transformation is induced by forced expression of Nov whose amino terminus has been cleaved in chicken embryo fibroblasts (Joliot, V. et al., Mol. Cell. Biol.,
12: 10-21 (1992)). In addition, the Balb / c 3T3 cell culture system was
Addition of protein has been shown to enhance the intracellular tyrosine phosphorylation level and promote the concentration-dependent proliferative response (Changlu Liu et al., Gene, 238: 471-478 (199
9)). Based on these findings, Nov is considered to be deeply involved in early development and cell growth control (Joliot, V. et al, M
ol. Cell. Biol., 12: 10-21 (1992); Chevalier et al., Am.
J. Pathol., 152: 1563-1575 (1998)). However No
There are many unclear points about the action of v in vivo. Cysteine-rich protein 61 (Cyr61) is a protein belonging to the CCN family, and as its name implies, is a protein rich in cysteine. It is known to have an angiogenesis-promoting effect and exist in a form attached to the extracellular matrix (Lau, L.
F. and Lam, SC Exp. Cell Res. 248: 44-57 (1999); Br
igstock, DR Endocr. Rev. 20: 189-206 (1999)). It is known to have an action of inducing cell adhesion, promoting cell migration, and promoting DNA synthesis induction by growth factors for fibroblasts and endothelial cells (Kireeva, ML et al. Mol. Ce.
ll. Biol. 16, 1326-1334 (1996); Kireeva, ML et al.
Exp. Cell Res. 233, 63-77 (1997)). Cyr61 induces / promotes chondrocyte differentiation in mouse limb bud mesenchymal cells (Wong, M. et al. Dev Biol. 192, 492-508 (199
7)). In addition, it has been shown that Cyr61 promotes angiogenesis in vivo, and is known to increase tumorigenicity by increasing the size and angiogenesis of human tumor cells transplanted in immunodeficient mice. (Bab
ic, AM et al. (Proc. Natl. Acad. Sci. USA 95,
6355-6360 (1998)). Furthermore, Cyr61 is also known to enhance the expression of matrix metalloproteinase-1, -3, an enzyme that promotes remodeling of extracellular matrix during angiogenesis and wound healing (Chen, C.-C. . et al. J. Bio
l. Chem. 276, 10443-10452 (2001)). These findings regarding Cyr61 activity are in good agreement with the expression of Cyr61 in chondrogenic sites, cells involved in angiogenesis during development, and granulation tissue during subcutaneous wound healing.

On the other hand, Notch (also known as Lin12) is a transmembrane receptor and is thought to play a central role in ontogeny by controlling cell differentiation (S
impson, P. 1994. Austin, TX: RGLandes Compan
y.). Currently, Notch1 to Notch4 in mammals
Four Notch homologues have been identified. Notch gene is expressed in various tissues in both fetuses and mature individuals,
It has been suggested to be involved in various signal transduction pathways other than ontogeny (Swiatek, PJ et al. (1994)
Genes and Dev. 8: 707-719; Weinmaster, G. et al.
(1992) Development 116: 931-941; Kopan, R. and Wein
traub, H. (1993) J. Cell. Biol. 121: 631-641; and U
yttendaele, H. et al. (1996) Development 122: 2251-
2259). In addition, it has been known that Notch protein is overexpressed in human T cell tumors, suggesting that Notch is involved in tumor formation (Girard, L. et.
al. (1996) Genes and Dev. 10: 1930-1944). Notch
Notch ligand is activated by binding, etc.
ch IC region (Eric H. Schroeter. Et al. Nature 393: 3
82-386 (1998)) is known to be cleaved.
The otch IC region translocates into the cell nucleus and controls various transcription factors.

The Notch ligands include Jagged, J
agged2 and Delta are known (Lindsell, CE
et al. (1995) Cell 80: 909-917; Valsecchi, C. et a
l. (1997) Mech. Dev. 69: 203-207; and Laborda, J. et
al. (1993) J. Biol. Chem. 268: 3817-3820). However, the relationship between Notch and CTGF and Nov was unknown. In addition, Notch and CCN such as tissue fibrosis, proliferation of vascular cells, differentiation of fibroblasts (Fibloblast)
The relationship with diseases involving family proteins was unknown. On the other hand, the relationship between the CCN family proteins and the abnormal cell proliferative function of T cell carcinoma, which was suggested to involve Notch, was not known.

[0009]

Problem to be Solved by the Invention
It is intended to identify a receptor protein of a family protein and provide a method for screening a CCN family protein or a therapeutic agent for a disease associated with the receptor protein.

[0010]

[Means for Solving the Problems] As a result of extensive studies to identify receptors for CCN family proteins, the present inventors have found that Nov and CTGF specifically bind to Notch1. That is, the interaction between CTGF and mouse Notch1 (hereinafter referred to as mNotch1) was measured using the Mammalian2-hybrid method. The Mammalian2-hybrid method is a system for examining the interaction after expressing the protein in the cell nucleus.
Since it is a method that utilizes transcriptional events that occur in the cell nucleus, it is considered unsuitable for membrane proteins and secretory proteins. Therefore, the combination of the secretory factor CTGF and the membrane protein Notch could not be assayed. So CT
The mature protein portion lacking the signal peptide of GF and mNotch1, and the portion of mNotch1 only in the extracellular region was cloned into a 2-hybrid vector to examine the interaction. As a result, mNotch1 was added to pM vector (Clontech) and pVP16 vector (Clontech).
The presence of the interaction was found when the vector in which CTGF was cloned into was used. On the other hand, Nov was also examined by an immunoprecipitation method, and as a result, it was found that a complex in which Notch1 and Nov were bound was precipitated. Further investigation using a reporter gene assay revealed that
It was confirmed that ch1-derived signal transduction occurs. That is, in the presence or absence of Notch1, Nov, and a luciferase expression vector (HES5) in which the transcription factor HES5 activated by Nov was integrated as a transcription factor.
-luciferase) was co-transfected into C2 / 4 cells, and it was examined whether luciferase activity fluctuates depending on the presence or absence of Notch1 and the expression level of Nov. As a result, the expression of Nov was observed only when Notch1 was co-expressed. The luciferase activity increased depending on the level. From the above, CCN family proteins and Notch
By searching for compounds that regulate the interaction of
CCN family protein activity regulator and / or Not
It is possible to screen for ch activity control agents.
The present invention has been completed based on the above findings.

That is, the present invention [1] An agent for controlling CCN family protein activity, which comprises determining whether or not a test substance competitively regulates Notch activity with CCN family protein, and /
Or a screening method for a Notch activity controlling agent; [2] a screening method according to [1], which comprises the following steps (1) to (3): (1) Notch, CCN family protein, and test Contacting a substance, (2) detecting Notch activity,
(3) A step of comparing the Notch activity in the absence of the test substance with the Notch activity in the above (2); [3] The test substance competes with CCN family protein for N.
CC, characterized by measuring whether it binds to otch
Screening method for N-family protein activity regulator and / or Notch activity regulator; [4] The screening method according to any one of claims 1 to 3, wherein the CCN family protein is Nov or CTGF. [5] CCN family protein activity regulator obtained by the screening method according to any one of [1] to [4], and / or Notch activity regulator; [6] CCN family protein activity regulator according to [5] A therapeutic or prophylactic agent for a disease associated with tissue fibrosis, which comprises as an active ingredient; [7] A treatment for a disease involving a CCN family protein, which contains the CCN family protein activity control agent according to [5] as an active ingredient, or Prophylactic agent; [8] A therapeutic or prophylactic agent for a disease associated with Notch, containing the Notch activity control agent according to [5] as an active ingredient. Than it is.

[0012]

BEST MODE FOR CARRYING OUT THE INVENTION "Notch" in the present invention includes its subtype and homologues. That is, it is a concept including all of Notch 1 to 4. Regarding the amino acid sequence of Notch and the nucleotide sequence of the gene,
Listed in Gene Bank. Gene Bank below,
An accession number is illustrated. Human Notch1:
AF308602, human Notch2: XM_034671, human Notch3: XM_00
9303, Human Notch4: XM_042469, Mouse Notch1: NM_0087
14. The “CCN family protein” in the present invention is
(1) Insulin-like growth factor binding protein (insulin-like
growth factor binding protein), (2) von Willebra
nd factor type C repeat, (3) thrombospondin type
1 repeat, (4) a protein containing four conserved modular domain structures of growyh factor cysteine knots,
Specific examples include CTGF, Nov, Cyr61 and the like. "CTG
“F” also includes the homologue thereof, and regarding the amino acid sequence and the nucleotide sequence of the gene, for example, human CTGF is gene bank (accession number: NM_
001901). "Nov" also includes its homologue, and its amino acid sequence and the nucleotide sequence of its gene are described in, for example, human Nov in Gene Bank (accession number: NM002514). "Cyr61" also includes its homologue, and its amino acid sequence and the nucleotide sequence of the gene are:
For example, human Cyr61 is described in Gene Bank (accession number: AF307860).

The "activity of the CCN family protein" in the present invention is not particularly limited as long as it is a physiological activity possessed by the CCN family protein, but preferably fibroblast proliferation induction, extracellular matrix production, angiogenesis induction. , Cartilage formation induction and the like. Among them, the CTGF activity includes fibroblast proliferation induction, extracellular matrix production and the like. Nov activity includes cell growth induction,
Induction of tyrosine phosphorylation and the like can be mentioned. The "activity of Notch" in the present invention includes Notch-induced Suppressor of Hairless, which is produced by binding to CCN family proteins, activation of transcription factors such as Suppressor of Hairless, NF-κB2, and E47, and transcription repressors. To be Also, Notch is C
Activation of Notch by binding to CN family proteins is also included in the category of "Notch activity". The Not
Activation of ch refers to a phenomenon in which the IC region of Notch is cleaved and translocates into the cell nucleus. The IC region of Notch represents the C-terminal portion after the 1744th valine (V).

The “CCN family protein activity controlling agent” in the present invention means a “CCN family protein activity promoting agent” which enhances the activity of CCN family protein, and a “CCN family protein activity inhibitor which inhibits the activity of CCN family protein. And a substance that regulates the activity of the CCN family protein by inhibiting the binding between the CCN family protein and its receptor, Notch, and the like.

The "substance that inhibits the bond between Notch and CCN family protein" is a substance that interacts with Notch or CCN family protein via hydrophobic bond, hydrogen bond, ionic bond, electrostatic interaction, etc., The substance is not particularly limited as long as it is a substance that inhibits the binding between Notch and a CCN family protein, and examples thereof include proteins, peptides, natural products, and synthetic organic compounds.

In the present invention, the term “Notch activity control agent” refers to a concept including both “Notch activity promoter” which enhances Notch activity and “Notch activity inhibitor” which inhibits Notch activity. And substances that regulate Notch activity by inhibiting the binding to its ligand, CCN family protein. The substance is particularly a substance that interacts with CCN family protein or Notch via hydrophobic bond, hydrogen bond, ionic bond, electrostatic interaction, or the like, and inhibits the bond between Notch and CCN family protein. It is not limited, and examples thereof include proteins, peptides, natural products, and synthetic organic compounds.

The “screening method for a CCN family protein activity controlling agent” in the present invention includes (1) a method for examining whether or not a test substance inhibits the binding between a labeled CCN family protein and Notch, or ( 2) Notch
Examples include a method of screening a substance that inhibits the binding between Notch and the CCN family protein, such as a method of measuring and evaluating the activity of the CCN family protein or Notch due to the binding of the protein with the CCN family protein. Examples of the “screening method for Notch activity regulator” in the present invention include the above-mentioned methods. That is, the test substance is labeled CCN family protein and Not
How to check whether it inhibits ch binding, or Notch
And the method of measuring and evaluating the activity of CCN family protein or Notch resulting from the binding of the CCN family protein to and. As the “test substance” in the screening method of the present invention, an organic compound (preferably,
Examples thereof include organic compounds having a molecular weight of 2000 or less, and more preferably 1000 or less. ), Proteins, nucleic acids, peptides,
Examples include natural products.

The embodiments of the present invention will be specifically described below. The first aspect of the present invention relates to the “CCN family protein activity regulator” and / or “Notch of the present invention.
The method for screening "activity control agent". As the screening, (1) whether or not the test substance to be screened enhances or inhibits the interaction between Notch and CCN family protein in the presence of Notch and CCN family protein by any detection method. (2) The test substance to be screened is allowed to coexist with a CCN family protein in a cell culture system containing a gene having an expression regulatory region of a transcription factor whose expression is regulated by Notch. By a detection method, a method of searching for a substance that inhibits or enhances Notch expression by examining the change in the expression level of a reporter gene such as luciferase bound downstream of the expression control region of the transcription factor (reporter gene assay), etc. Is mentioned.

The following method can be used as a method for screening a substance that inhibits the binding between the CCN family protein and Notch by interacting with Notch.
As used herein, Notch may be a natural product or a recombinant product. A mouse type is preferable, but a human type (Gene Bank, accession number: AF30860
Receptors from other species such as 2) can also be used. That is, an appropriate DNA portion based on the above DNA sequence can be used as a probe for hybridization or a primer for PCR, and can be cloned from, for example, a cDNA library derived from human or animal. These clonings include, for example, Molecular Cloning 2nd Edt., Cold
Those skilled in the art can easily carry out the method according to the basic documents such as Spring Harbor Laboratory Press (1989). Also,
Even if a part of the amino acid sequence is substituted, deleted, and / or added, it can be used in the screening method of the present invention as long as the ability to bind to the CCN family protein is maintained. Modifications such as the substitution can be easily made based on the above-mentioned Molecular Cloning and the like. Examples of the method for expressing a protein from the Notch DNA obtained as described above include the following methods. That is, first, Notch's cDNA prepared in advance
A to pCAGGS (Gene 108, 193-199 (199
1)), pcDNA1.1, pcDNA3.1 derivative (Invitrogen) and other known expression vectors. Then, by introducing into an appropriate host and culturing, the introduced Notc
Transformed cells expressing a protein corresponding to the h DNA can be prepared. As a host, CHO cells, C127 cells, BHK21, which are generally widely used,
Cells, COS cells and the like can be used, but not limited thereto, yeast, bacteria, insect cells and the like can also be used. The method of introducing the Notch expression vector into the host cell may be any method as long as it is a method of introducing a known expression vector into the host cell, for example, the calcium phosphate method (J. Virol., 52, 456-467. (197
3)), a method using LT-1 (manufactured by Panvera), a method using a gene transfer lipid (Lipofectamine, Lipofectin; manufactured by Gibco-BRL), and the like.

The Notch-expressing transformed cells obtained as described above can be used for screening as they are. When the cell membrane is used for screening, the cell membrane fraction can be obtained, for example, as follows. That is, first, the cells were hypotonic buffered (10 mM Tris-
Hydrochloric acid buffer, 1 mM EDTA, 0.5 mM PMSF
Alternatively, 1 mM AEBSF, 5 μg / ml aprotinin, 5 μg / ml leupeptin; pH 7.4) was added, and the mixture was allowed to stand at 4 ° C. for about 30 minutes for hypotonic disruption, and then homogenized by pipetting. 5000 at ℃
A precipitate of the cell membrane fraction is obtained by centrifugation at 0xg for 30 minutes. Then, by suspending this precipitate in Tris-hydrochloric acid buffered saline (Tris-hydrochloric acid buffer solution, 154 mM sodium chloride; pH 7.4), a membrane fraction containing Notch can be obtained. Further, since the portion used for the binding assay is the extracellular region, it is possible to secrete it into the culture medium of cell culture by preparing a vector expressing only the extracellular region of Notch and preparing a transformed cell. The obtained Notch can also be purified by a method well known to those skilled in the art using a column or the like to which an antibody is bound. For the preparation of Notch, for example, the method described in Protein Experiment Note (1996, Yodosha) can also be used. The CCN family protein, which is a protein secreted extracellularly, can be prepared in the same manner as above.

The system for measuring the binding inhibitory activity between the CCN family protein and the above Notch is appropriately selected within the range of common knowledge of those skilled in the art. As an example, (i) the case of contacting the Notch with the CCN family protein , (Ii) a screening method including a comparative evaluation of the case where Notch is contacted with a CCN family protein and a test substance. The following methods (1) to (3) can be given as specific examples. (1) Method Using Receptor-Expressing Cells Notch-expressing cells can be used for the screening of the present invention. Here, the cell may be a natural cell or the transformed cell described above. Specifically, first, the CCN family protein that is a ligand is labeled by some method. For example, a method of labeling with RI such as ³⁵ S, alkaline phosphatase, Horserad
Rhodamine, a method of labeling with enzymes such as ish peroxidase
Labeling with a fluorescent reagent such as Fluorescein, or
Examples include the method of expressing by fusing with tags such as GST and polyhistidine (Current Protocols in molec
ular Biology (Cuurent Protocols, 1998). On the other hand, cells expressing Notch are prepared. Next, the binding properties of the labeled CCN family protein to the cells were compared to the cells when (i) the labeled CCN family protein was added and (ii) the labeled CCN family protein and the test substance were added. To detect. In the case of (ii) having a lower or no binding activity as compared with the case of (i), it is shown that the test substance is a candidate for a substance that inhibits the binding of Notch and CCN family protein. Be done.

(2) Using the cell membrane expressing Notch In place of cells in the method (1), a cell membrane fraction prepared from the cells is used, and the screening of the present invention is carried out in the same manner as in (1). be able to. (3) Method using isolated and purified Notch The screen of the present invention can be carried out using isolated and purified Notch. Since the region that binds to CCN family proteins is the extracellular region, in this case Notch
It is preferable to use only the extracellular region of. In the screening of (1) to (3) above, Notch
As long as it binds to, both promoters and inhibitors of CCN family protein activity are selected, and therefore it is desirable to carry out another screening to distinguish them.

[0023] In addition, the binding of CCN family protein to Notch is carried out by a method for examining the presence or absence of nuclear translocation of Notch IC region caused by binding of CCN family protein to Notch, or a method for measuring physiological activity. As a method for screening a substance that inhibits the activity of Notch, a method of detecting the activity of a transcription factor controlled by Notch activation using a reporter gene assay or the like, an expression level of a gene whose expression is induced by the transcription factor, etc. A method of investigating is included. As the method, a method of investigating the transcriptional activation regulation of CBF-1 / Su (H), which is a transcription factor downstream of the Notch signal, or E47 by a reporter gene assay, mRNA expression fluctuation of Notch target gene expression such as NFκB2, etc. Can be examined by a conventional method such as RT-PCR or Northern hybridization, and a method of examining the protein expression fluctuation of the target gene expression of Notch such as NFκB2 by Western blot. Specifically, as described in Examples of the present specification,
A reporter gene assay in which a transcription factor controlled by Notch such as HES5 is incorporated into an expression vector as a promoter for a protein such as luciferase, CAT, or NFκB2, CBF-1 / Su (H) (Suppressor of Hairless),
Alternatively, a method of examining the activity of a transcription factor such as E47 by gel shift assay and the like can be mentioned.

Further, as a method for examining the presence or absence of translocation of NotchIC region into the nucleus, increase or decrease in translocation of Su (H) (Suppressor of Hairless) binding to Notch intracellular region or Notch intracellular region to cell nucleus is carried out by Western blot. Examples include a method of detecting with a blot.

By subjecting the test substance selected by the above screening method to another screening system or an in vivo evaluation system as necessary, CC
Drugs that control N-family protein activity or Notch activity can be found.

The third aspect of the present invention relates to a CCN family protein activity regulator and a Notch activity regulator obtained by the screening method. The CCN family protein activity controlling agent and / or Notch activity controlling agent, as the CCN family protein or Notch, interacts with Notch through hydrophobic bond, hydrogen bond, ionic bond, electrostatic interaction, or the like. It is not particularly limited as long as it is a substance that inhibits binding with CCN family protein,
Examples include proteins, peptides, natural products, and synthetic organic compounds. A peptide having a molecular weight of 2000 or less, more preferably 1000 or less, a natural product, or a synthetic organic compound is preferable. The “CCN family protein activity regulator” obtained by the screening method of the present invention is C
It is useful as a therapeutic or preventive agent for diseases involving CN family proteins. Examples of diseases involving the CCN family proteins include diseases associated with tissue fibrosis, diseases associated with cell proliferation, and diseases associated with angiogenesis. Preferably, a disease associated with tissue fibrosis or a disease associated with cell proliferation is included. “Tissue fibrosis-associated disease” refers to a disease in which parenchymal cells are not regenerated due to hyperplasia of connective tissue due to excessive proliferation of fibroblasts during tissue repair / regeneration, resulting in tissue dysfunction. Examples include pulmonary fibrosis, renal fibrosis, scleroderma, arteriosclerosis, and inflammatory diseases. Examples of the inflammatory diseases include rheumatoid arthritis, osteoarthritis, ulcerative colitis, and multiple sclerosis. Preferably, the inflammatory disease includes rheumatoid arthritis. Diseases associated with cell proliferation include organ adhesions during surgery, cancer, endometriosis, granuloma and the like. As a therapeutic or preventive agent for the above diseases, CCN
Family protein activity inhibitors are preferred. In addition, "CCN
The "family protein activity promoter" is useful as a wound healing promoter and the like. The “Notch activity control agent” obtained by the screening method of the present invention is useful as a therapeutic or prophylactic agent for diseases involving Notch. Examples of the disease in which Notch is involved include diseases accompanied by abnormal cell proliferation. Examples of the diseases accompanied by abnormal proliferation of cells include cancer, immune system diseases such as rheumatoid arthritis, and the like. In addition, as diseases related to Notch, CADASIL, Al
Nervous system diseases such as agille syndrome and autosomal dominant inherited cerebral arteropathy are mentioned. As a therapeutic or preventive agent for the above-mentioned diseases, Notch activity inhibitor is preferable.

The dose and dosage form of the CCN family protein activity controlling agent and / or Notch activity controlling agent of the present invention will be described below. The CCN family protein activity controlling agent and / or Notch activity controlling agent of the present invention can be orally or parenterally administered, preferably orally, and various dosage forms suitable for oral or parenteral administration as a drug, respectively. Used in humans and non-human animals. For example, when it is orally administered, it can be administered in a commonly used administration form such as tablets, capsules, syrups and suspensions. In the case of parenteral administration, solutions such as solutions, emulsions and suspensions can be administered as injections, and can be rectally administered in the form of suppositories. Such a dosage form can be produced according to a general method by mixing an active ingredient with a usual carrier, excipient, binder, stabilizer and the like. When used in injection form, buffer,
It is also possible to add solubilizing agents, isotonic agents and the like. The dose and frequency of administration are the target disease, patient symptoms, age,
When administered orally, the active ingredient is usually in the range of about 1 to 1000 mg per day for an adult, preferably about 10 to 500, though it depends on the body weight and the like and the administration form.
The mg range can be administered once or in several divided doses. When administered as an injection, the active ingredient is approximately 0.1
To about 500 mg, preferably about 3 to about 100 mg
The above range can be administered once or divided into several times.

[0028]

EXAMPLES The present invention will be described below with reference to examples, but the present invention is not limited thereto. Unless otherwise stated, the following examples are based on Sambrook, J. et al., Mole.
cular Cloning: A Laboratory Manual, 2nd Edition, Cold S
It can be carried out by the method described in pring Harbor Laboratory Press, New York, 1989, etc.

Example 1 Construction of Expression Vector (Production of Synthetic DNA Sequence) CTGF protein is GenBank NM_00190
1. For mNotch1, oligo DNA was synthesized according to GenBank NM_008714. The primers used are as follows. CTGF1M: 5'-CGAATTC ATG ACCGCCGCCAGTATGGGCCC-3 '(SEQ ID NO: 1) (Underlined part: Corresponding to the start codon at the 146-148th nucleic acid sequence) CTGFMat: 5'-CGAATTC CAG AACTGCAGCGGGCCGTGCCG-3' (SEQ ID NO: 2) (Underlined) Part: Corresponding to glutamine, which is the starting amino acid of the mature peptide at nucleic acid sequence 224-226) CTGFR: 5'-CGAAT TCA TGCCATGTCTCCGTACATCTTC-3 '(SEQ ID NO: 3) (underlined: at the stop codon at 1193-1195th nucleic acid sequence) Correspondence) CTGFnEND: 5'-CGAATTCTGCCATGTCTCCGTACATCTTCC-3 '
(SEQ ID NO: 4) (oligo in which the stop codon of CTGFR is destroyed) hCTGFEcoKozak: 5'-CGGAATTCCACC ATG ACCGCCGCCAGTATGG
GCCC-3 '(SEQ ID NO: 5) (Underlined part: Corresponding to the start codon at the 146-148th nucleic acid sequence) CTGF1: 5'-CAAGGACCAAACCGTGGTTG-3' (SEQ ID NO: 6) (652-671 sense sequence) CTGF2: 5 '-CAACCACGGTTTGGTCCTTG-3' (SEQ ID NO: 7) (652-671 antisense sequence) mNotch1: 5'-GCACGTTCCAGCATTCTTAC-3 '(SEQ ID NO: 8) (281-300 antisense sequence) NotchSPK: 5'- CGGA ATTCCACC ATG CCACGGCTC CTGACGCCC
C TTCTCTGCCT-3 '(SEQ ID NO: 9) (Underlined part: Corresponding to the start codon at nucleotide positions 79-81) NotchSP: 5'- CGGAATTC ATG CCACGGCTC CTGACGCCCC TTC
TCTGCCT-3 '(SEQ ID NO: 10) (Underlined part: Corresponding to the start codon at the 79-81st nucleic acid sequence) mNotchEcoMTHF: 5'-CGGAATTC TGC TCCCAGCCAAGTGGGACCTG
CCTGAAT-3 '(SEQ ID NO: 11) (Underlined part: Corresponding to cysteine at nucleotide position 148-150) mNotchEcoMTHR: 5'- CGGAATTC CTG CGAGGGCAGCGGAGGCTCC
ACCGGCTCA-3 '(SEQ ID NO: 12) (Underlined part: Corresponding to glutamine at the 5245-5247th nucleic acid sequence) VP16S: 5'-GATATGGCCGACTTCGAGTTTGAG-3' (SEQ ID NO: 13) (upstream sequence of multiple cloning site of pVP16 vector) pMF: 5'-GAATAAGTGCGACATCATCATCGG-3 '(SEQ ID NO: 1
4) (Multicloning site upstream sequence of pM vector)

Human CTGF protein coding region full-length cDNA (GeneBank Accession No NM 00190
1) Inserted Vector DNA (pRC / CMV / CTGF) (0.1 mg / ml)
1 μl, 10X PCR buffer 5 μl, 2.5 mM dNTP Mix 4 μl
l, 10 μM Forward Primer (CTGF1M) 2 μl, 10 μM Rev
erse Primer (CTGFR) 2 μl, DW 35.75 μl, Enzyme0.25
The reaction was performed in a total volume of 50 μl. After 98 ° C. for 10 seconds, 98 ° C. for 10 seconds and 65 ° C. for 75 seconds were reacted for 15 cycles, and then 72 ° C. for 5 minutes to complete the reaction. Purify the amplified fragment with a PCR purification kit (Qiagen), then EcoRI
Restriction enzyme treatment was carried out with and the purified fragment was separated by agarose gel electrophoresis. The purified fragment was cut out from the agarose gel, and the amplified fragment was purified with a gel purification kit (Qiagen). The expression vector pcDNA3.1 / HisC (manufactured by Invitrogen) was subjected to restriction enzyme treatment with EcoRI, and purified fragments were separated by agarose gel electrophoresis. The purified fragment was cut out from the agarose gel, and the amplified fragment was purified with a gel purification kit (Qiagen). The purified fragment was treated with alkaline phosphatase (manufactured by Toyobo Co., Ltd.), and then the amplified fragment was purified by a PCR purification kit (manufactured by Qiagen). Purified CT
The GFcDNA fragment and pcDNA3.1 / HisC were ligated with ligation high (Toyobo Co., Ltd.) and transformed with DH5α (Toyobo Co., Ltd.). The selection of colonies in which the insert was correctly inserted was performed using T7 primer and CTGF2 as PCR primers. The direction and sequence of insertion was confirmed by sequencing.

(PM / matCTGF, pM / ecNotch1, pVP / ecNotc
h1, pVP / construction of matCTGF) matCTGF (CTGF cDNA of the full length protein coding region lacking signal peptide; GeneBank Accession No NM 001
901), the fragment amplified in the same manner as above was used for Mammalia.
Subcloning was performed on pM and pVP16 (manufactured by Clontech), which are vectors for n 2 hybrid. For ecNotch1 (mouse Notch1 cDNA of the entire extracellular region in the protein coding region lacking the signal peptide), pTag was used as a template.
HA / mNotch1 (Mouse Notch1 full-length cDNA (GenBank NM_008
714) PC using mNotchEcoMTHF and mNotchEcoMTHR as an expression vector prepared by a known method)
The region of about 5.5 kb amplified by R was subcloned into pM and pVP16. Although the base sequence of matCTGF was confirmed by sequencing, the base sequence of ecNotch1 was about 5.5 kb, and the base sequence was not confirmed. Three independent clones were obtained and used in the experiment. (However, in each case, the expression was confirmed by Western blot as shown below.)

Example 2: Protein-protein interaction (Mammalian 2 hybrid assay) The response element of the yeast transcription factor GAL4 and the rabbit β-globin promoter were set in pGL3Basic.
The vector pGAL4Luc 0.2 μg and pM / ecNotch1, pV inserted in the multi-cloning site (manufactured by Promega)
P / mat CTGF 0.2 μg each, and pCH110 0.15 μg total 0.75 μg mixture for gene transfer efficiency correction 1.5 ml
It was made into an Eppendorf tube. (As above, matCTG
For F, one clone whose nucleotide sequence was confirmed, ecNotch1
3 independent clones (NotchA, NotchB, Notc
hC) was used in the experiment).
Gene6 (Boehringer) was used to introduce into COS1 cells. After 48 hours, aspirate and wash the medium, then use cell lysate LC
The cells were lysed with 180 μl of β (manufactured by Nippon Gene) to prepare a cell extract. 17.5 μl of the luciferase assay reagent (manufactured by Promega) was used to measure luciferase activity with Microlumat 96 (manufactured by Wallac Beltold). The gene transfer efficiency was measured by measuring β-galactosidase expressed from pCH110 using 35 μl of cell extract. The strength of interaction was calculated as a relative value by dividing the luciferase activity by the β-galactosidase activity. The results are shown in Table 1. From Table 1, matCTGF
The relative fold of luciferase activity greatly exceeded 1 due to co-expression of NotchA, NotchB, or NotchC with matCTGF and NotchA, NotchB, or NotchC.
Were found to interact with each other.

[Table 1]

Example 3: Confirmation that protein was expressed from pM / ecNotch1, pVP / matCTGF and translocated to the cell nucleus (1) Introduction of gene: For COS1 cells seeded in 10 cm culture dish, Example Vector used in 2, ie pM /
4 μg of ecNotch1, pVP / matCTGF alone or a total of 8 μg of 4 μg each was introduced using FuGene6 (Boehringer) gene transfer reagent. (2) Preparation of cell nuclei: 48 hours later, buffer A (10 mM Tris (pH.7.9), 10 mM washed with 12 ml of PBS (-) and ice-cooled)
KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, 1 mM MPMS
F, 0.1 mM Na3VO4, 1 mM NaF, 5 μg / ml leupeptin) 1
Collected in an Eppendorf tube in ml. 5000 in a cooling centrifuge
The mixture was rotated and centrifuged at 4 ° C for 3 minutes, and the supernatant was removed. 0.5 ml of ice-cooled buffer A was added, the cell mass was sequentially loosened with a chip of P1000 and P200, and the mixture was left standing on ice for 15 minutes. 13 μl of 10% N
After P-40 was added and vortexed vigorously for 15 seconds, it was centrifuged at 7,000 rpm and 4 ° C. for 2 minutes in a cooling centrifuge, and the supernatant was removed.
Add 25 μl of buffer C (20 mM Tris (pH.7.9), 400
mM KCl, 1 mM EDTA, 1 mM EGTA, 20% Glycerol, 1 mM
DTT, 1 mM PMSF, 0.1 mM Na3VO4, 1 mM NaF, 5 μg / ml
leupeptin) was added and the mixture was stored at −80 ° C. overnight. After thawing on ice, centrifuge at 14,000 rpm in a cooling centrifuge at 4 ° C for 10 minutes,
The supernatant was used as the nuclear fraction. (3) Western blot: Nuclear fraction 25 prepared in (2)
Add an equal volume of 2X SDS-PAGE buffer to μl and
After boiling for 10 minutes, 10% gel (Asahi Techno Glass Co., Ltd.)
Was used for SDS-PAGE at 140V for 90 minutes. After completion of the electrophoresis, the PVDF membrane was transferred at 100 V for 1 hour. Transferred film is 1% BSA-TBST (BSA: Albumin, Bov for 30 minutes at room temperature)
Made by ine SIGMA, CatNo.A-7030LotNo.109H1072, TBST: Tr
is 2.42 g / l, NaCl 8 g / l, Tween 20 1 ml / l), and then washed with TBST for 10 minutes 3 times at room temperature. As a primary antibody, CTGF is Rabbit anti mCTGF (Torrey Pines Bio
labs, Cat No.TP243 Lot No.112919, 1 μg / μl) in PBS
(-) (PBS: Phosphat Buffered Saline 7.2 (Gibco, C
At No.20012-027, Lot No.1094151)) at a dilution ratio of 1: 1000, Notch is Anti Notch 1 extracellular domain.
rabbit polyclonal IgG (up state, Cat No.07-218 Lot
No.20442, 1ug / ul) with PBS (-) at a dilution ratio of 1: 250,
The reaction was carried out at room temperature for 1 hour. After washing with TBST for 10 minutes 3 times at room temperature, anti-rabbit IgG horse radis was used as the secondary antibody.
h peroxidase Linked whole antibode (from donky) (Ame
rsham, Cat No.NA934 Lot No.123450) with PBS (-) 1:
The reaction was performed at a dilution ratio of 2000 for 1 hour at room temperature. After washing with TBST for 10 minutes 3 times at room temperature, a reaction was carried out with a super signal luminescence reagent (PIERCE) for 5 minutes. The film was exposed to an X-ray film (Amersham Pharmacia Biotech) and then developed. The results are shown in Fig. 1. pM / ecNotch, pV
It was revealed that both signals were expressed in cells in which P / mat CTGF was co-expressed and that the expressed protein was expressed in cells in which either one was expressed. Therefore, Mamm
The vector introduced in the alian 2 hybrid assay expresses the target protein. It was confirmed that the interaction observed in this assay is likely to be the interaction between the proteins of interest.

Example 4 Examination of Whether Notch Is a CTGF Receptor Whether Notch and CTGF are overexpressed in COS cells and whether the Notch signal is activated is determined by the presence or absence of nuclear translocation of Notch IC region. Can be considered at. (1) Construction of vector: (construction of pcDNA3.1 / HisC / 1MCTGF) Vector DNA (pRC / CMV / CTGF) ((0.1 mg / ml) 1 μl, 10X P
CR buffer 5 μl, 2.5 mM dNTP Mix 4 μl, 10 mM Forward
Primer (CTGF1M) 2 μl, 10 μM Reverse Primer (CTGFR)
The reaction was carried out in a total of 50 μl of 2 μl, DW 35.75 μl, and Enzyme 0.25 μl. After 98 ℃ 10 sec, 98 ℃ 10 sec, 65 ℃
After reacting for 75 seconds for 15 cycles, the reaction was terminated at 72 ° C. for 5 minutes. The purified fragment was purified with a PCR purification kit (Qiagen), treated with a restriction enzyme with EcoRI, and the purified fragment was separated by agarose gel electrophoresis. The purified fragment was cut out from the agarose gel, and the amplified fragment was purified with a gel purification kit (Qiagen). Expression vector pcDNA
3.1 / HisC was digested with EcoRI and the purified fragments were separated by agarose gel electrophoresis. The purified fragment was cut out from the agarose gel, and the amplified fragment was purified with a gel purification kit (Qiagen). CTGF obtained by treating the purified fragment with alkaline phosphatase (manufactured by Toyobo Co., Ltd.) and purifying the amplified fragment by PCR purification kit (manufactured by Qiagen).
Ligation of the cDNA fragment and pcDNA3.1 / HisC with ligation high (Toyobo), DH5α (Toyobo)
I was transformed. Selection of colonies in which the insert was correctly inserted was performed using T7 primer and CTGF2 as PCR primers. The direction and sequence of insertion was confirmed by sequencing. Mouse Notch full-length expression vector pTagHA / mNotch1 or pCMV / mNotch1 (pTagHA
Both / mNotch1 excluding the tag HA from the expression vector) and pcDNA3.1 / HisC / 1MCTGF were prepared in large quantities according to a conventional method. (2) Gene transfer: The same procedure as in Example 3 above (mNotch1 expression vector (pTagHA / mNotch1 or pCM
V / mNotch1) and pcDNA3.1 / HisC / 1MCTGF, or both of them are introduced at the same time. ). Alternatively, a cell culture supernatant in which CTGF was introduced in advance, a cell culture supernatant in which pcDNA3.1 / HisC had been introduced was prepared, and these cells were introduced into cells into which the mNotch1 expression vector (pTagHA / mNotch1 or pCMV / mNotch1) had been introduced. Allow the supernatant to act and incubate. (3) Preparation of cell nuclei: The same procedure as in Example 3 above is performed. (4) Western blot: Performed in the same manner as in Example 3 above. However, a Notch antibody that recognizes the intracellular region is used. When pcDNA3.1 / HisC / 1MCTGF is simultaneously overexpressed in cells into which the mNotch1 expression vector has been introduced, or when the culture supernatant containing CTGF is allowed to act on cells into which the mNotch1 expression vector has been introduced. It can be detected whether nuclear translocation is observed.

Example 5: Examination of whether CTGF activates Notch signal (1) Examination on transcriptional repression via E-box: Notch signal is a transcription factor having so-called E-box as a recognition sequence. It is known to suppress transcriptional activation by bHLH type transcription factors such as E47 (Mol.Cell.Biol.18: 2230-
2239, 1998). If CTGF activates the Notch signal, it may suppress E-box-mediated transcription. Therefore, we examined the repression of transcription via E-box. Eb
ox consensus sequence (CAGGTG) (Cell 56: 777-783,19
89) was synthesized with four tandem sequences of KpnI and BglII restriction enzyme sites at the 5'and 3'ends,
PGL3-Promote, a luciferase reporter vector
It was inserted into the KpnI and BglII sites of the r vector (Promega) to construct pGL3 / 4xEbox / SV40p. Transiently to COS1 cells
Notch1 expression vector (pTagHA / mNotch1 and pCMV / mNo
Each was carried out at tch1. ), Forcibly expressing pGL3 / 4xEbox / SV40p, and at the same time coexpressing pcDNA3.1 / HisC / 1MCTGF were compared. Also, pcDNA3.1 / His
Prepared in advance instead of co-expressing C / 1MCTGF
The experiment was performed using the culture supernatant containing CTGF. (2) Study on CBF-1 / Su (H) -mediated transcriptional activation: N
It is known that when the otch receptor is activated, the intracellular region translocates to the nucleus to activate the transcription factor CBF-1 / Su (H) (Mol.Cell.Biol.20: 6913-6922, 2000). ). CTGF is Notch
If it activates a signal, it may increase the transcriptional activity of CBF-1 / Su (H). So the transcription factor CBF-1 /
The effect of Su (H) on the transcriptional activity was examined. CBF-1 / Su (H) binding sequence consensus sequence (CGTGGGAA) (Mol.Cell.Bio
l.17: 2679-87, 1997) into four tandem linked sequences.
KpnI and BglI of pGL3-Promoter vector (Promega), which is a luciferase reporter vector, were synthesized by synthesizing DNA in which the restriction enzyme sites of pnI and BglII were linked to the 5'and 3'ends.
It was inserted into the I site to construct pGL3 / 4xCBF / SV40p. COS1
Expression vector of mNotch1 transiently in cells (pTagHA / mNotch
1 or pCMV / mNotch1 respectively. ), PGL3 /
Forced expression of 4xCBF / SV40p, and at the same time pcDNA3.1 / HisC / 1MC
A comparison was made between the case where TGF was co-expressed and the case where TGF was not expressed. Or instead of co-expressing pcDNA3.1 / HisC / 1MCTGF,
The experiment was conducted using a culture supernatant containing CTGF prepared in advance. As a result of these (1) and (2) experiments, CTGF
Was found to regulate the transcriptional activity of transcription factors downstream of the Notch signal.

Example 7: Nov and Notch, and CTGF and Notch
(Creation of HAGF-tagged CTGF (CTGF-HA)) Mouse CT cloned by cDNA library screening
The Xba1 site was added to the GF clone by PCR and amplified by PCR.
(Primer sequence: CATGAGGGGCAACCCACTGA (SEQ ID NO: 1
5), CCTCTAGAGAAGGCACTGTTCCATG (SEQ ID NO: 16)),
It was put in pTagHA. This pTagHA is pCMVTag4 (Sta
ratagene) was obtained by PCR amplification of the HA epitope (the stop codon was added before the Flag.
Flag is not expressed. PCR primer sequence: GGCCCAAGCTTTC
TAGATATCCGTATGATGTTCCTGAT (SEQ ID NO: 17), GTGCGGT
CGACCTAGAGGCTAGCATAATCAGGAACATC (SEQ ID NO: 18)).

(Preparation of Nov (Nov-HA) with HA tag) BP
The Nov donated from erbal is cut out with EcoR1-Stu1, pTag
I put it in HA's R1-RV site. (Preparation of Notch with Flag Tag (Notch-Flag)) Notch donated by J. Nye was cut out with R1-HindIII and pCMVTag4
(Stratagene) R1-HindIII site.

Serrate (Serrate-Fla with a Flag tag
g) Preparation of Serrate was cloned by cDNA library screening (Sakamoto et al., Biochem.
iophys. Res. Com. 1998). Then, PCR was performed at the 3'end of the ORF to add a HindIII site (primer sequence: GTACAAAGGCGACCAGTTAAG (SEQ ID NO: 19), CAAGCTTC).
TCTACAATGTACTCCATTC (SEQ ID NO: 20)). This fragment was replaced with the wild type part and placed in pCMVTag4. (Preparation of Delta with FLAG tag (Delta-FLAG)) D. Henri
Delta donated by que lacked ORF3 ', so
PC with ORF 3'part only in the primer with Flag epitope
R (primer sequence: TGGGTTATTCTGGGTTCAACTGTG
(SEQ ID NO: 21), CCATTCTTGTCGTCATCGTCTTTGTAGTCCACC
TCAGTTGCTATGATGCAC (SEQ ID NO: 22)), which was replaced with the 3'portion of the donated clone and placed in pBK-CMV-EX2. This expression vector contains the Nhe1-Spe1 part of pBK-CMV (blue
-Lacp part for white selection) is removed.

All of the above PCRs are Clontech Advantage
50 pmol each of polymerase and primer were used. 94 ° C 30
25 cycles of sec, 55 ℃ 30 sec, 72 ℃ 90 sec. The insert was confirmed by restriction enzyme digestion and actual transfection. The gene transfer method is lipofectamine 2000 (i
In vitrogen) 2 ul was used in a 12-well plate. The cells used were HEK293 and COS, and the transfer efficiency was approximately 2
It was confirmed to be 0% to 40% by transfection with β-galactosidase. TNTC buffer was used for protein extraction. Immunoprecipitation was carried out according to a conventional method using anti-Flag M2 affinity gel (Sigma). After SDS-PAGE and Western blotting, detection was performed with anti-HA high affinity, peroxidase conjugation.
The chemiluminescence method using luminol was performed using ted (Roche). The results are shown in FIGS. 2 and 3. From these results, CTGF-HA and Notch-Flag or Nov-HA and Notch-F
Large amount of CTGF or Nov is Notch when co-introduced lag
The result of co-precipitation was obtained. Ie CTGF, Nov and Not
It was confirmed that ch was connected.

Example 8: Activation of Notch-derived signal by Nov Notch, Nov, HES5 promoter (Notch-1 in C2 / 4 cells)
: GenBank NM_008714, Nov: GenBank NM 002514, HES
5: Takebayashi, K., Akazawa, C., Nakanishi, S. And K
ageyama, RJ Biol. Chem. 270 (3), 1342-1349 (199
5)) Use the DC-Chol method (G
ao, X., and Huang, L. (1991) Biochem. Biophys. Res.
Commun. 179, 280-285). Approximately 48 hours later, cells were collected and subjected to Dual luciferase reporter assay s.
The luciferase activity in the cell lysate was measured using ystem (Promega). The results are shown in Fig. 4. The luciferase activity shows a relative value when the luciferase activity when the Renilla luciferase gene was introduced into C2 / 4 was set as 1 as a control group showing the gene transfer efficiency. Notch
It can be seen that the luciferase activity increases in a Nov-concentration-dependent manner only in the presence of. From this result, it was confirmed that the signal mediated by Notch was transduced into cells by Nov.

Example 9: Screening method (1) After contacting CTGF with Notch in the presence or absence of a test substance and incubating for a certain period of time, CTGF-Not
Ch complex, free CTGF and free Notch were separated by electrophoresis and labeled with CTG using labeled anti-CTGF antibody and labeled anti-Notch antibody.
The band intensity corresponding to the F-Notch complex is measured. For example, an expression vector containing DNA encoding CTGF and Notc
h Culture supernatant in which both the expression vector containing the DNA encoding the extracellular region was introduced, or culture supernatant in which the expression vector containing the DNA encoding CTGF was introduced and Notc
After incubation with or without addition of a test substance to a mixture of membrane fractions of host cells into which an expression vector containing DNA encoding h was introduced, each reaction solution was subjected to non-denaturing gel electrophoresis and RI Alternatively, Western blotting is performed with each non-RI (enzyme, fluorescence, etc.) labeled antibody, and the intensities of the bands that cross-react with both antibodies are compared. When CTGF and / or Notch are synthesized using a cell-free translation system such as rabbit reticulocyte system, CTGF or Noch
If one of the tch is labeled with ³⁵ S-Met, etc., instead of performing Western blotting using the labeled antibody as a probe, autoradiography of the electrophoretic gel is performed, and the band on the higher molecular weight side is Compare the intensities of. (2) Alternatively, in the above (1), the reaction solution contains anti-CTGF.
After immunoprecipitation by adding antibody or anti-Notch antibody, the precipitate is electrophoresed and RI or non-RI (enzyme, fluorescence, etc.)
Western blotting can be performed using a labeled anti-Notch antibody or anti-CTGF antibody to compare the intensities of the detected bands. Immunoprecipitation can be preferably performed using an antibody immobilized on an insoluble carrier such as plastic beads or Sephadex. Also, CTGF and /
Alternatively, when Notch is synthesized using a cell-free translation system as described above, either CTGF or Notch is labeled with ³⁵ S-Met or the like, and an antibody against the other is added to the reaction solution for immunoprecipitation. After that, the precipitate is subjected to electrophoresis and autoradiography of the electrophoretic gel is performed to compare the intensities of the detected bands. (3) The CTGF-Notch complex can also be measured by using a conventional immunoassay system. For example, anti-CT in the reaction solution
After immunoprecipitation by adding GF antibody or anti-Notch antibody and removing the liquid phase, RIA, EIA, FIA, etc. are performed using anti-Notch antibody or anti-CTGF antibody labeled with RI or non-RI (enzyme, fluorescence, etc.) The detected signal intensities may be compared. When CTGF and / or Notch are synthesized using a cell-free translation system as described above, if either CTGF or Notch is labeled with ³⁵ S-Met or the like, an antibody against the other reacts. After immunoprecipitation in the liquid and removing the liquid phase,
The CTGF-Notch complex can also be measured by performing RIA. (4) Alternatively, CTGF-Notch complex can be directly measured from the reaction solution by using homogeneous immunoassay such as surface plasmon resonance, fluorescence polarization immunoassay, fluorescence quenching immunoassay, and fluorescence energy transfer immunoassay that does not require B / F separation. can do.

[0042]

INDUSTRIAL APPLICABILITY According to the present invention, it is useful for searching for a therapeutic or prophylactic agent for diseases such as pulmonary fibrosis, renal fibrosis, scleroderma, rheumatoid arthritis, and cancer, which are associated with tissue fibrosis or cell proliferation. It has become possible to provide various screening methods.

[0043]

[Sequence list]                                SEQUENCE LISTING      <110> Sumitomo Pharmaceuticals Co., Ltd. <120> The method for screening the agents which regulate the activity of  CCN family protein <130> 132888 <160> 22 <170> PatentIn Ver. 2.1    <210> 1 <211> 30 <212> DNA <213> Artificial Sequence <223> Description of Artificial Sequence: PCR Primer    <400> 1 cgaattcatg accgccgcca gtatgggccc 30    <210> 2 <211> 30 <212> DNA <213> Artificial Sequence    <223> Description of Artificial Sequence: PCR Primer    <400> 2 cgaattccag aactgcagcg ggccgtgccg 30       <210> 3 <211> 30 <212> DNA <213> Artificial Sequence    <223> Description of Artificial Sequence: PCR Primer    <400> 3 cgaattcatg ccatgtctcc gtacatcttc 30       <210> 4 <211> 30 <212> DNA <213> Artificial Sequence    <223> Description of Artificial Sequence: PCR Primer    <400> 4 cgaattctgc catgtctccg tacatcttcc 30       <210> 5 <211> 35 <212> DNA <213> Artificial Sequence    <223> Description of Artificial Sequence: PCR Primer    <400> 5 cggaattcca ccatgaccgc cgccagtatg ggccc 35       <210> 6 <211> 20 <212> DNA <213> Artificial Sequence    <223> Description of Artificial Sequence: PCR Primer    <400> 6 caaggaccaa accgtggttg 20       <210> 7 <211> 20 <212> DNA <213> Artificial Sequence    <223> Description of Artificial Sequence: PCR Primer    <400> 7 caaccacggt ttggtccttg 20       <210> 8 <211> 20 <212> DNA <213> Artificial Sequence    <223> Description of Artificial Sequence: PCR Primer    <400> 8 gcacgttcca gcattcttac 20       <210> 9 <211> 44 <212> DNA <213> Artificial Sequence    <223> Description of Artificial Sequence: PCR Primer    <400> 9 cggaattcca ccatgccacg gctcctgacg ccccttctct gcct 44       <210> 10 <211> 40 <212> DNA <213> Artificial Sequence    <223> Description of Artificial Sequence: PCR Primer    <400> 10 cggaattcat gccacggctc ctgacgcccc ttctctgcct 40       <210> 11 <211> 38 <212> DNA <213> Artificial Sequence    <223> Description of Artificial Sequence: PCR Primer    <400> 11 cggaattctg ctcccagcca agtgggacct gcctgaat 38       <210> 12 <211> 39 <212> DNA <213> Artificial Sequence    <223> Description of Artificial Sequence: PCR Primer    <400> 12 cggaattcct gcgagggcag cggaggctcc accggctca 39       <210> 13 <211> 24 <212> DNA <213> Artificial Sequence    <223> Description of Artificial Sequence: PCR Primer    <400> 13 gatatggccg acttcgagtt tgag 24       <210> 14 <211> 24 <212> DNA <213> Artificial Sequence    <223> Description of Artificial Sequence: PCR Primer    <400> 14 gaataagtgc gacatcatca tcgg 24    <210> 15 <211> 20 <212> DNA <213> Artificial Sequence    <223> Description of Artificial Sequence: PCR Primer    <400> 15 catgaggggc aacccactga 20    <210> 16 <211> 25 <212> DNA <213> Artificial Sequence    <223> Description of Artificial Sequence: PCR Primer    <400> 16 cctctagaga aggcactgtt ccatg 25      <210> 17 <211> 38 <212> DNA <213> Artificial Sequence   <223> Description of Artificial Sequence: PCR Primer    <400> 17 ggcccaagct ttctagatat ccgtatgatg ttcctgat 38    <210> 18 <211> 38 <212> DNA <213> Artificial Sequence   <223> Description of Artificial Sequence: PCR Primer    <400> 18 gtgcggtcga cctagaggct agcataatca ggaacatc 38    <210> 19 <211> 21 <212> DNA <213> Artificial Sequence   <223> Description of Artificial Sequence: PCR Primer    <400> 19 gtacaaaggc gaccagttaa g 21    <210> 20 <211> 27 <212> DNA <213> Artificial Sequence   <223> Description of Artificial Sequence: PCR Primer    <400> 20 caagcttctc tacaatgtac tccattc 2 7 <210> 21 <211> 24 <212> DNA <213> Artificial Sequence   <223> Description of Artificial Sequence: PCR Primer    <400> 21 tgggttattc tgggttcaac tgtg 24    <210> 22 <211> 51 <212> DNA <213> Artificial Sequence   <223> Description of Artificial Sequence: PCR Primer    <400> 22 ccattcttgt cgtcatcgtc tttgtagtcc acctcagttg ctatgatgca c 5 1

[0044]

[Brief description of drawings]

FIG. 1 is a diagram showing that a protein was expressed from pM / ecNotch1, pVP / matCTGF and translocated to the cell nucleus. Lane 1: pM / NotchA, pVP / matCTGF, Lane 2: pM / NotchB, p
VP / matCTGF, Lane 3: pM / NotchC, pVP / matCTGF, Lane
4: No gene transfer, lane 5: pM / NotchA, lane 6: pM /
NotchB, Lane 7: pM / NotchC, Lane 8: pVP / matCTGF
.

[Fig. 2] cDNAs encoding CTGF (CTGF-HA) with HA tag and Notch (Notch-Flag) with Flag tag were introduced into COS cells, and immunoprecipitation was performed using a cell lysate of the COS cells. It is a figure which shows the result of having performed.

[Fig. 3] Nov (Nov-HA) with HA tag and Delta, Serrate, Notch (Delta-Flag, Serrate-Fla with Flag tag)
g, Notch-Flag) encoding cDNA into COS cells,
It is a figure which shows the result of having performed immunoprecipitation using the cell lysate of this COS cell. The upper photo shows immunoprecipitation using an anti-Flag antibody, and shows the result of performing western blotting of the precipitate with an anti-HA antibody, and a large amount of the complex was observed only when Nov-HA and Notch-Flag were co-introduced. It can be seen that it has settled.

[Figure 4] Notch (+) or (-) / Nov / HES5-luc in C2 / 4
It is a figure which shows the result of having co-introduced into and measuring the luciferase activity. The luciferase activity was determined by comparing Renilla-derived luciferase with C2 / 4 as a control group showing the gene transfer efficiency.
2 shows the relative value when the luciferase activity in the case of transfection was set to 1. Only in the presence of Notch, N
It can be seen that the luciferase activity increases depending on the concentration of ov. From this result, it was confirmed that the signal mediated by Notch was transduced into cells by Nov.

   ─────────────────────────────────────────────────── ─── Continued front page    (72) Inventor Kenichi Katsube             1-5-45 Yushima, Bunkyo-ku, Tokyo Tokyo Medical Teeth             Inside the university (72) Inventor Kei Sakamoto             1-5-45 Yushima, Bunkyo-ku, Tokyo Tokyo Medical Teeth             Inside the university (72) Inventor Toru Nakanishi             238-105-1-501 Nishikomatsu, Okayama City, Okayama Prefecture (72) Inventor Fumio Nishikaku             3-1,98-1 Kasugade, Konohana-ku, Osaka             Tomo Pharmaceutical Co., Ltd. F term (reference) 2G045 AA35 BB10 BB14 BB20 BB46                       CB01 DA13 FB01 FB02 FB03                       FB05 FB09                 4B024 AA01 AA11 BA21 BA63 CA04                       CA07 CA20 DA02 EA04 GA13                       HA11

Claims (5)

[Claims] 1. A CCN family protein activity regulator and / or a Notch activity regulator characterized by measuring whether or not a test substance competitively regulates Notch activity with a CCN family protein. Screening method. 2. The screening method according to claim 1, which comprises the following steps (1) to (3): (1) a step of contacting Notch, a CCN family protein, and a test substance; 2) a step of detecting Notch activity,
(3) A step of comparing the activity of Notch in the absence of a test substance with the activity of Notch in (2) above. 3. A method for screening a CCN family protein activity controlling agent and / or a Notch activity controlling agent, which comprises determining whether or not a test substance competitively binds to Notch with a CCN family protein. . 4. The CCN family protein is Nov or CTGF.
The screening method according to any one of claims 1 to 3, wherein 5. A CCN family protein activity regulator and / or a Notch activity regulator obtained by the screening method according to claim 1.